Note: Descriptions are shown in the official language in which they were submitted.
CA 02222280 1997-11-2
W 0~16/39522 PCTnUS9C~
~uman Chemokine Beta-11 and ~uman Chemokine Alpha-1
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptides of the present invention are human chemokine
polypeptides, sometimes hereinafter referred to as human
chemokine beta-11 (Ck~-11) and human chemokine alpha-1 (Ck~-
1). The invention also relates to inhibiting the action of
such polypeptides.
Chemokines, also referred to as intercrine cytokines,
are a subfamily of structurally and functionally related
cytokines. These molecules are 8-10 kd in size. In general,
chPmnkines exhibit 20% to 75~ homology at the amino acid
level and are characterized by four conserved cysteine
residues that form two disulfide bonds. Based on the
arrangement of the first t,wo cysteine residues, chemokines
have been classified into two subfamilies, alpha and beta.
In the alpha subfamily, the first two cysteines are separated
by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in
an ad~acent position and are, therefore, referred to as the
CA 02222280 1997-11-2~
W O 915/39522 PCT~US~6~'~5~/>
IIC-CII sub~amily. Thus far, at least eight dif~erent members
of this family have been identified in hl~m~nR.
The intercrine cytokines exhibit a wide variety of
functions. A hallmark feature is their ability to elicit
chemotactic migration of distinct cell types, includiny
monocytes, neutrophils, T lymphocytes, basophils and
fibroblasts. Many ch~mnkines have proinflammatory activity
and are involved in multiple steps during an inflammatory
reaction. These activities include stimulation of histamine
release, lysosomal enzyme and leukotriene release, increased
adherence of target immune cells to endothelial cells,
enhanced binding of complement proteins, induced expression
of granulocyte adhesion molecules and complement receptors,
and respiratory burst. In addition to their involvement in
inflammation, certain chemokines have been shown to exhibit
other activities. For example, macrophage inflammatory
protein 1 (MIP-1) is able to suppress hematopoietic stem cell
proliferation, platelet factor-4 (PF-4) is a potent inhibitor
of endothelial cell growth, Interleukin-3 (IL-8) promotes
proli~eration of keratinocytes, and GRO is an autocrine
growth factor for melanoma cells.
In light of the diverse biological activities, it is not
surprising that ch~mokines have been implicated in a number
of physiological and disease conditions, including lymphocyte
trafficking, wound healing, hematopoietic regulation and
immunological disorders such as allergy, asthma and
arthritis.
Members of the "C-C" branch exert their effects on the
following cells: eosinophils which destroy parasites to
lessen parasitic infection and cause chronic inflammation in
the airways of the respiratory system; macrophages which
suppress tumor formation in vertebrates; and basophils which
release histamine which plays a role in allergic
inflammation. However, members of one branch may exert an
effect on cells which are- normally responsive to the other
CA 02222280 1997-11-2
W 01~6~9522 PCT~US~
branch of rhPmokines and, therefore, no precise role can be
attached to the members of the branches.
While members of the C-C branch act pre~om;n~ntly on
mononllclear cells and members o$ the C-x-c branch act
pre~o~in~ntly on neutrophils a distinct chemoattractant
property cannot be assigned to a ~h~m~kine based on this
guideline. Some chemokines from one family show
characteristics of the other.
The polypeptides of the present invention have the
conserved cysteine residues, namely Ck~-11 has "C-CII and Ck~-
1 has "C-X-C" regions, and they have high amino acid sequence
homology to known chemokines and have, therefore, been
putatively characterized as human ch~mokines.
In accordance with one aspect of the present invention,
there are provided novel polypeptides which are human Ck~-11
and Ck~-1 as well as biologically active and diagnostically
or therapeutically useful fragments, analogs and derivatives
thereof.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
encoding such polypeptides, including mRNAs, DNAs, cDNAs,
genomic DNA as well as biologically active and diagnostically
or therapeutically useful fragments, analogs and derivatives
thereof.
In accordance with another aspect of the present
invention there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to Ck~-11 and Ck~-1 sequences.
In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptides by recombinant techniques which comprises
culturing recombinant prokaryotic and/or eukaryotic host
cells, containing a Ck~-11 or Ck~-1 nucleic acid sequence,
under conditions promoting expression of said protein and
subsequent recovery of said protein.
CA 02222280 1997-11-2
W 0~6~9522 PCTrUS9~ 3/~
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing ~uch
polypeptides, or polynucleotides encoding such polypeptides
for therapeutic purposes, for example, to treat solid tumors,
chronic infections, leukemia, T-cell mediated auto-immune
di.seases, parasitic infections, psoriasis, asthma, allergy,
to regulate hematopoiesis, to stimulate growth factor
ac:tivity, to inhibit angiogenesis and to promote wound
healing.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
In accordance with yet another aspect of the present
invention, there are provided antagonists to such
polypeptides, which may be used to inhibit the action of such
polypeptides, for example, in the treatment of certain auto-
immune diseases, atherosclerosis, chronic inflammatory and
infectious diseases, histamine and IgE-mediated allergic
reactions, prostagl~n~;n-independent fever, bone marrow
failure, cancer~, silicosis, sarcoidosis, rheumatoid
arthritis, shock, hyper-eosinophilic syndrome and fibrosis in
the asthmatic lung.
In accordance with another aspect of the present
invention there is provided a method of diagnosing a disease
or a susceptibility to a disease related to a mutation in the
Ck~-ll or Ck~-1 nucleic acid secluences and the protein
encoded by such nucleic acid secluences.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides,
for in vitro purposes related to scientific research,
synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
CA 02222280 1997-11-2
W 0'96/39522 PCTJU~ J~
The following drawings are illustrative of embo~;m~nts
o~ the invention and are not meant to limit the ~cope o~ the
i.nvention as enromp~ssed by the claims.
Figure 1 displays the cDNA sequence and corresponding
deduced amino acid sequence of Ck~-11 The initial 17 amino
acids represent the leader sequence such that the putative
mature polypeptide comprises 81 amino acids. The st~n~d
a,ne-letter abbreviations for amino acids are used.
Sequencing was performed using a 373 Automated DNA sequencer
(Applied Biosystems, Inc.). Sequencing accuracy is predicted
to be greater than 97% accurate.
Figure 2 displays the cDNA sequence and corresponding
deduced amino acid sequence of Ck~-l. The initial 22 amino
acids represent the leader sequence such that the putative
mature polypeptide comprises 87 amino acids. The standard
one-letter abbreviations for amino acids are used.
In accordance with an aspect of the present invention,
there are provided isolated nucleic acids (polynucleotides)
which encode for the mature polypeptides having the deduced
almino acid sequences of Figures 1 (SEQ ID No. 2) and 2 (SEQ
ID No. 4) or for the mature polypeptides encoded by the cDNAs
of the clones deposited as ATCC Deposit No. 75948 (Ck~
and 75947 (Ck~-1) on November 11, 1994.
Polynucleotides encoding Ck~-11 may be isolated ~rom
mlmerous human adult and fetal cDNA libraries, for example,
a human fetal spleen cDNA library. Ck~-11 is a member of the
C-C branch of rhem~kines. It contains an open reading frame
encoding a protein of 98 amino acid residues of which
approximately the first 17 amino acids residues are the
putative leader sequence such that the mature protein
comprises 81 amino acids. The protein exhibits the highest
degree of homology to the Rat, RANTES polypeptide with 31
identity and 47% similarity over a stretch of 89 amino acids.
It is also important that the four spatially conserved
CA 02222280 1997-11-2~
W O 96~9522 PCT~US96/09572
cysteine residues in ~hPmnkines are founLd in the
E~ Ypeptides.
Polynucleotides encoding Ck~-l may be isolated from
numerous human adult and fetal cDNA libraries, for example,
hLuman tonsils cDNA library. Ck~-1 is a member o~ the C-x-C
branch of chPmokines. It contains an open reading frame
encoding a protein of 109 amino acid residues of which
approximately the first 22 amino acids residues are the
putative leader secruence such that the mature protein
comprises 87 amino acids. The protein exhibits the highest
degree of homology to interleukin-8 from Sheep (Ovis Aries)
with 31% identity and 80% similarity over a stretch of 97
amino acids. It is also important that the four spatially
conserved cysteine residues in rhPmokines are found in the
polypeptides.
The polynucleotides of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
c~DNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which encodes the mature polypeptides may be
identical to the coding sequences shown in Figures 1 (SEQ ID
No. 1) and 2 (SEQ ID No. 3) or that of the deposited clones
or may be a different coding sequence which coding sec~uence,
as a result of the rP~lln~ncy or degeneracy of the genetic
code, encodes the same mature polypeptides as the DNA of
Figures 1 (SEQ ID No. 1) and 2 (SEQ ID No. 3) or the
d~posited cDNAs.
The polynucleotides which encode for the mature
polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4)
OI' for the mLature polypeptides encoded by the deposited cDNAs
maLy include: only the coding sequence for the mature
polypeptide; the coding sec~uence for the mature polypeptide
and additional coding ~equence such as a leader or secretory
se!c~uence or a proprotein ~equence; the coding secluence for
--6--
CA 02222280 1997-11-2
W O 96/39522 . PcTsu~GJ~53l~
t]~e mature polypeptide (and optionally additional codiny
sequence) and non-coding sequence, such as introns or non-
coding sequence 5' and/or 3' of the coding sequence for the
~ture polypeptides.
Thus, the term l~polynucleotide encoding a polypeptide~
encompasses a polynucleotide which includes only coding
sequence ~or the polypeptide as well as a polynucleotide
w]~ich includes additional coding and/or non-coding ~equence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequences of Figures 1 (SEQ ID No. 2)
and 2 (SEQ ID No. 4) or the polypeptides encoded by the cDNAs
o~ the deposited clones. The variant of the polynucleotides
~ly be a naturally occurring allelic variant of the
polynucleotides or a non-naturally occurring variant of the
polynucleotides.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptides as shown in Figures 1
(',EQ ID No. 2) and 2 (SEQ ID No. 4) or the same mature
polypeptides encoded by the cDNA of the deposited clones as
well as variants of such polynucleotides which variants
encode for a fragment, derivative or analog of the
polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4)
or the polypeptides encoded by the cDNA of the deposited
clones. Such nucleotide variants include deletion variants,
substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotides may have
a coding sequence which is a naturally occurring allelic
variant of the coding sequences shown in Figures 1 (SEQ ID
Nc~. 1) and 2 (SEQ ID No. 3) or of the coding se~uence of the
deposited clones. As known in the art, an allelic variant is
an alternate form of a polynucleotide sequence which may have
a substitution, deletion or addition of one or more
-
CA 02222280 1997-11-2~
W 0~6~9522 PCT~US96/09572
nucleotides, which does not substantially alter the function
of the e~coded polypeptide.
The present invention also includes polynucleotides,
wherein the coding sequence for the mature polypeptides may
be fused in the same reading frame to a polynucleotide
sequence which aids in expression and secretion of a
p~lypeptide from a host cell, for example, a leader sequence
which functions as a secretory sequence for controlling
transport of a polypeptide from the cell. The polypeptide
having a leader sequence is a preprotein and may have the
leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode
for a proprotein which is the mature protein plus additional
5' amino acid residues. A mature protein having a
p~osequence is a proprotein and is an inactive form of the
p~otein. Once the prosequence is cleaved an active mature
protein r~mA; n~ .
Thus, for example, the polynucleotides of the present
invention may encode for a maLture protein, or for a protein
having a prosequence or for a protein having both a
prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for purification of the polypeptides of the
present invention. The marker sequence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide for
purification of the mature polypeptides fused to the marker
in the case of a bacterial host, or, for example, the marker
sequence may be a hemagglutinin (HA) tag when a mAmmAlian
hcst, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding
and following the coding r~gion (leader and trailer) as well
--8--
CA 02222280 1997-11-2~
wos6~ss22 PCT~S96J09572
as intervening seguences (introns) between individual coding
~;egments (exons).
Fragments of the full length gene of the present
invention may be used as a hybridization probe ~or a cDNA
library to isolate the full length cDNA and to isolate other
cDNAs which have a high sequence s;mi 1 ~rity to the gene or
~imilar biological activity. Probes of this type pre~erably
hlave at least 30 bases and may contain, for example, 50 or
ore bases. The probe may also be used to identify a cDNA
clone corresponding to a full length transcript and a genomic
clone or clones that contain the complete gene including
regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region of
the gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a
sequence complementary to that of the gene of the present
invention are used to screen a library of human cDNA, genomic
D~NA or mRNA to determine which members of the library the
probe hybridizes to.
The present invention further relates to
polynucleotides which hybridize to the hereinabove-described
sequences if there is at least 70~, preferably at least 90%,
and more preferably at least 95~ identity between the
sequences. The present invention particularly relates to
polynucleotides which hybridize under stringent conditions to
the hereinabove-described polynucleotides. As herein used,
the term "stringent conditions" means hybridization will
occur only if there is at least 95~ and preferably at least
9,7~ identity between the sequences. The polynucleotides
which hybridize to the her~;n~hove described polynucleotides
in a preferred embodiment encode polypeptides which either
retain substantially the same biological function or activity
as the mature polypeptide encoded by the cDNAs of Figure 1
(SEQ ID NO:1) or the deposited cDNA(s).
CA 02222280 1997-11-2
W 0~6~9522 . PCTAUS~G~'u5~/~
Alternatively, the polynucleotide may have at least 20
h,ases, preferably at least 30 bases, and more preferably at
least 50 bases which hybridize to a polynucleotide of the
present invention and which has an identity thereto, as
her~;n~hove described, and which may or may not retain
activity. For example, such polynucleotides may be employed
as probes for the polynucleotide of SEQ ID NO:1, for example,
for recovery of the polynucleotide or as a diagnostic probe
or as a PCR primer.
Thus, the present invention is directed to
polynucleotides having at least a 70% identity, preferably at
least 90~ and more preferably at least a 95~ identity to a
polynucleotide which encodes the polypeptide of SEQ ID NO:2
as well as fragments thereof, which fragments have at least
3D bases and preferably at least 50 bases and to polypeptides
encoded by such polynucleotides.The deposit(s) referred to
herein will be maint~ne~ under the terms of the Budapest
T:reaty on the International Recognition of the Deposit of
M:icro-organisms for purposes of Patent Procedure. These
deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is
required under 35 U.S.C. 112. The sequence of the
polynucleotides contA;n~ in the deposited materials, as well
as the amino acid sequence of the polypeptides encoded
thereby, are incorporated herein by reference and are
controlling in the event of any conflict with any description
ol sequences herein. A license may be required to make, use
or sell the deposited materials, and no such license is
hereby granted.
The present invention further relates to polypeptides
which have the deduced amino acid sequences of Figures 1 (SEQ
Ir) No. 2 ) and 2 (SEQ ID No. 4), or which have the amino acid
sequence encoded by the deposited cDNA, as well as fragment~,
a~lalogs and derivatives of such polypeptides.
--10--
-
CA 02222280 1997-11-2
W O 96~9522 . PCTJU'~ f~33s~
The terms ~$ragment," "derivative" and ~analog~ when
referring to the polypeptides of Figures 1 (SEQ ID No. 2) and
2 (S~Q ID No. 4) or that encoded by the deposited cDNA, means
polypeptides which retain essentially the same biological
function or activity as such polypeptides. Thus, an analog
includes a proprotein which can be activated by cleavage of
the proprotein portion to produce an active mature
plolypeptide .
The polypeptides of the present invention may be
recombinant polypeptides, natural polypepti~es or synthetic
polypeptides, preferably reComh;n~nt polypeptides.
The fragment, derivative or analog of the polypep~ides
of Figures 1 ( SBQ ID No. 2) and 2 (SEQ ID No. 4) or that
encoded by the deposited cDNAs may be (i) one in which one or
more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or
(ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the
mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for
example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptide,
such as a leader or secretory sequence or a sequence which is
elmployed for purification of the mature polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs
are deemed to be within the scope of those skilled in the art
from the teachings herein.
The polypeptides and polynucleotides of the present
illvention are preferably provided in an isolated form, and
preferably are purified to ho~ yelleity.
The term "isolated" means that the material is removed
from its original enviLol~..ellt (e.g., the natural environment
ii-- it is naturally occurring). For example, a naturally-
W 0 96~9522 CA 02222280 1997-11-2~ PCTrUSg~5~/~
occurring polynucleotide or polypeptide present in a living
an:imal is not isolated, but the same polynucleotide or
poLypeptide, separated from some or all of the coexisting
mat:erials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 ( in particular the mature
polypeptide) as well as polypeptides which have at least 70~
similarity (preferably at least 70~ identity) to the
polypeptide of SEQ ID NO:2 and more preferably at least 90
similarity (more preferably at least 90~ identity) to the
polypeptide of SEQ ID NO:2 and still more preferably at least
95~ similarity (still more preferably at least 95~ identity)
to the polypeptide of SEQ ID NO:2 and also include portions
of such polypeptides with such portion of the polypeptide
generally containing at least 30 amino acids and more
preierably at least 50 amino acids.
As known in the art "similarity" between two
polypeptides is determined by comparing the amino acid
se~lence and its conserved amino acid substitutes of one
polypeptide to the sequence of a second polypeptide.
Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to
synthesize full-length polynucleotides of the present
invention.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the
-12-
CA 02222280 1997-11-2~
WOS~6~9S22 PCT~S96/095~2
invention and the production o~ polypeptide~ of the invention
by recombinant techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the Ck~
or Ck~-1 genes. The culture conditions, such as temperature,
pH and the like, are those previously used with the host cell
selected for expression, and will be apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be
e~ployed for producing polypeptides by recombinant
tlechniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from
combinations of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is
replicable and viable in the host.
The appropriate DNA sequence may be inserted into the
v/_ctor by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
Pn~onllClease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
l:inked to an appropriate expression control sequence(s)
(promoter) to direct mR~A synthesis. As representative
-13-
~ CA 02222280 1997-11-2~
.~6~9522 PCT/U~G~ 72
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the E. coli. lac or,trp, the phage lambda PL
promoter and other promoters known to control expression of
genes in prokaryoti_ or eukaryotic cells or their viruses
The expression vector also contains a ribosome binding site
for translation initiation and a transcripticn terminator.
The vector may also include appropriate sequences for
al~plifying expression. t
In addition, the expression vectors preferably contain
one or more selectable marker genes to provide a phenotypic
t:rait for selection of transformed host cells such as
d:ihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate
host to permit the host to express the protein.
As representative examples of appropriate hosts, there
m~ly be mentioned: bacterial cells, such as E. coli,
st.rePtomyces~ S~lm~n~lla tYPhimUriUm; fungal cells, such as
yeast; insect cells such as Drosophila S2 and Spodoptera Sf9;
~mimAl cells such as CH0, COS or Bowes melanoma;
ad.enoviruses; plant cells, etc. The selection of an
appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
More particularly, the present invention also includes
recomhinAnt constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of this
embodiment, the construct further comprises regulatory
se,~uences, including, for example, a promoter, operably
lilnked to the sequence. Large numbers of suitable vectors
-14-
CA 02222280 1997-11-2
W 0 96/39522 PCT/U~3~a~5)~
and promoters are known to those of 5kill in the art, and are
,-ommercially available. The fo;lowing vectors are provided
by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen),
pBS, pD10, phagescript, psiX174, pBluescript SK, pBSKS,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-
3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBP~, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
t.
Promoter regions can be selected from any desired gene
using CAT (chlor~mrh~nicol transfera8e) vectors or other
vectors with selectable markers. Two appropriate vectors are
pKK232-8 and pCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, l~mh~l~ PR~ PL and trp.
Eukaryotic promoters include CMV imm~ te early, HSV
t:hymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriate
vector and promoter is well within the level of ordinary
skill in the art.
In a further embo~i m~nt, the present invention relates
to host cells containing the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
m~ ian cell, or a lower eukaryotic cell, ~;uch as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEAE-
Dextran mediated transfection, or electroporation (Davis, L.,
Dibner, M., Battey, I., Basic Methods in Molecular Biology,
(1986)).
The constructs in host cells can be used in a
conventional m~nnP~ to produce the gene products encoded by
the recombinant sequences. Alternatively, the polypeptides
of the invention can be synthetically produced by
conventional peptide synthesizers.
CA 02222280 1997-11-2
W 0~6~9522 PCT~US9~/05~/~
Mature proteins can be expressed in m~mm~lian cells,
yeast, bacteria, or other cells under the control of
aLppropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
Appropriate cloning and expression vector8 for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory ~nllAl, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an enhancer sequence into the vector. ~nhAn~erS
are cis-acting elP~Ants of DNA, usually about from 10 to 300
b]D that act on a promoter to increase its transcription.
Examples include the SV40 Pnh~ncer on the late side of the
replication origin bp 100 to 270, a cytomegalovirus early
promoter ~nh~ncer~ the polyoma Pnh~ncer on the late side of
the replication origin, and adenovirus Pnh~ncers.
Generally, recomh;n~nt expression vectors will include
origins of replication and selectable markers permitting
tr.ansformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
promoters can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), ~-factor,
acid phosphatase, or heat shock proteins, among others. The
he!terologous structural secluence is assembled in appropriate
phase with translation initiation and termination sequences,
and preferably, a leader sequence capable of directing
secretion of translated protein,into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics,
CA 02222280 1997-11-2~
WO 96/39522 PC~JUS96109572
e.g., stabilization or simpli~ied puri~ication o~ expressed
recombinant product.
Useful expression vectors for bacterial use are
c:onstructed by inserting a structural DNA se~;{uence encoding
a desired protein together with ~uitable tran~lation
initiation and termination ~ignal~ in operable reading pha~e
with a ~unctional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to en~ure maintenance of the vector and to, if
de~irable, provide ampli~ication within the host. Suitable
prokaryotic ho~t~ for tran~formation include E. coli,
~acillus ~ubtilis, Salmonella tY~~;mllrium and various ~pecies
within the genera Psell~m~n~, Streptomyces, and
Staphylococcus, although others may also be employed a~ a
atter of choice.
AS a representative but nonlimiting example, usef~ul
expre~~ion vector~ for bacterial u~e can comprise a
s;electable marker and bacterial origin of replication derived
from commercially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such cs~Prcial vector~ include, for example,
p~KK223-3 (Pharmacia Fine Chemicals, Upp~ala, Sweden) and
pGEM1 (Promega Biotec, Madi~on, WI, USA). These pBR322
"backbone" section~ are combined with an a~ro~riate promoter
and the structural sequence to be expres~ed.
Following transformation of a ~uitable ho~t ~train and
growth of the host strain to an appropriate cell den~ity, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by phy~ical or chemical mean~, and the resulting
crude extract ret~;ne~ for further purification.
Microbial cell~ employed in expre~~ion of proteins can
be disrupted by any convenaent method, including freeze-thaw
-17-
CA 02222280 1997-11-2
WO '~6/39S22 PCr/lJS9~v3~1~
cycling, sonication, mechanical disruption, or use of cell
lysing agents, such methods are well know to those skilled in
the art.
Various ~ lian cell culture systems can also be
elnployed to express recombinant protein. Examples of
m:~mm~ n expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
(:L981), and other cell lines capable of expressing a
compatible vector, for example, the C127, 3T3, CH0, HeLa and
BlIK cell lines. ~mm~l ian expression vectors will comprise
an origin of replication, a suitable promoter and enhancer,
and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
The polypeptides can be recovered and purified from
recombinant cell cultures by methods including ~mmo~; um
sulfate or ethanol precipitation, acid extraction, anion or
cation exchange chromatography, phosphocellulose
chLromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and
lectin chromatography. Protein refolding steps can be used,
as necessary, in completing configuration of the mature
protein. Finally, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a
naturally purified product, or a product of chemical
synthetic procedures, or produced by recombinant techniques
from a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant" insect and m~ l ian cells in
culture). Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
-18-
CA 02222280 1997-11-2~
W O 96~9522 P ~ ~US96109572
Plolypeptides of the invention may also include an initial
methionine amino acid residue.
The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials
for discovery of treatments and diagnostics to human disease.
The human ch~mokine polypeptides may be employed to
; nh; h; t bone marrow stem cell colony fonmation as adjunct
protective treatment during cAnc~r chemotherapy and for
leukemia.
The human chem~k;ne polypeptides may al80 be employed to
~nh;h;t epidermal keratinocyte proliferation for treatment of
psoriasis, which is characterized by keratinocyte hyper-
proliferation.
The human ~h~mokine polypeptides may also be employed to
treat solid tumors by stimulating the invasion and activation
of host defense cells, e.g., cytotoxic T cells and
macrophages and by inhibiting the angiogenesis of tumors.
They may also be employed to ~nhAnce host defenses against
resistant chronic and acute infections, for example,
mycobacterial infections via the attraction and activation of
microbicidal leukocytes.
The human ch~mokine polypeptides may also be employed to
;nh;h;t T cell proliferation by the inhibition of IL-2
biosynthesis for the treatment of T-cell mediated auto-;mmllne
diseases and lymphocytic leuk~m; A~,
Ck~-11 and Ck~-1 may also be employed to stimulate wound
healing, both via the recruitment of debris clearing and
connective tissue promoting inflammatory cells and also via
its control of excessive TGF~-mediated fibrosis. In this
s,ame m~nner~ Ck~-ll and Ck~-1 may also be employed to treat
other fibrotic disorders, including liver cirrhosis,
o;steoarthritis and pnlm~nAry fibrosis.
The human ch~mokine polypeptides also increase the
presence of eosinophils which have the distinctive function
WO 96/39522 CA 0 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US96/09572
of killing the larvae of parasites that invade tissues, as in
~;chistosomiasis, trichinosis and ascariasis.
They may also be employed to regulate hematopoiesis, by
regulating the activation and differentiation of various
hematopoietic progenitor cells, for example, to release
mature leukocytes from the bone marrow following
chemotherapy.
The polynucleotides and polypeptides encoded by such
Elolynucleotides may also be utilized for in vitro purposes
related to scientific research, synthesis of DNA and
manufacture of DNA vectors and for designing therapeutics and
diagnostics for the treatment of human disease.
Fragments of the full length Ck~-11 or Ck~-1 genes may
be used as a hybridization probe for a cDNA library to
isolate the full length gene and to isolate other genes which
have a high sequence similarity to the gene or similar
biological activity. Probes of this type generally have at
l,east 20 base~. Preferably, however, the probes have at
least bases and generally do not exceed 50 bases, although
t]hey may have a greater number of bases. The probe may al80
be used to identify a cDNA clone corresponding to a full
length transcript and a genomic clone or clones that contain
t~le complete genes including regulatory and promotor regions,
e~cons, and introns. An example of a screen comprises
i~;olating the coding region of the genes by using the known
D~A sequence to synthesize an oligonucleotide probe. Labeled
o].igonucleotides having a sequence complementary to that of
the genes of the present invention are used to screen a
li.brary of human cDNA, genomic DNA or m~NA to determine which
members of the library the probe hybridizes to.
This invention is al~o related to the use of the Ck~
or Ck~-1 gene as part of a diagnostic assay for detecting
diseases or susceptibility to diseases related to the
presence of mutations in the Ck~-11 or Ck~-1 nucleic acid
sequences. Such diseases are related to under-expression of
-20-
CA 02222280 1997-11-2
W0'~6~9522 PC~S9GI~5~l)
the human ch~m~kine polypeptides, for example, tumors and
cancers.
Individuals carrying mutations in the Ck~-11 or Ck~-l
gene may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from
a patient's cells, such as from blood, urine, saliva, tissue
biopsy and autopsy material. The genomic DNA may be used
directly for detection or may be amplified enzymatically by
using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to
analysis. RNA or cDNA may also be used for the same purpose.
As an example, PCR primers complementary to the nucleic acid
encoding Ck~-11 or Ck~-l can be used to identify and analyze
Ck~-11 or Ck~-1 mutations. For example, deletions and
insertions can be detected by a change in size of the
al~plified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified
D]NA to radiolabeled Ck~-11 or Ck~-1 RNA or alternatively,
radiolabeled Ck~-ll or Ck~-1 antisense DNA sequences.
Perfectly matched sequences can be distinguished from
mismatched duplexes by RNase A digestion or by differences in
melting temperatures.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
v:isualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be distinguished on
denaturing formamide gradient gels in which the mobilities of
d:ifferent DNA fragments are retarded in the gel at different
positions according to their specific melting or partial
melting temperatures (see, e.g., Myers et al., Science,
2:30:1242 (1985)).
Sequence changes at specific locations may also be
revealed by nuclease protection assays, such as RNase and Sl
-21-
WO !~6/39S22 CA O 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/U5!)6/~5 / ?
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 (1985)~.
Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA secluencing or the use of
restriction enzymes, (e.g., Restriction Fragment Length
Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and
DNA sequencing, mutations can also be detected by in situ
analysis.
The present invention also relates to a diagnostic assay
for detecting altered levels of Ck~-ll or Cka-1 protein in
various tissues since an over-expression of the proteins
c~mpared to normal control tissue samples may detect the
presence of a disease or susceptibility to a disease, for
example, a tumor. Assays used to detect levels of Ck~-11 or
Cka-1 protein in a sample derived from a host are well-known
to those of skill in the art and include radioimml~noassays,
competitive-binding assays, Western Blot analysis, ELISA
assays and "sandwich" assay. An ELISA assay (Coligan, et
a:L., Current Protocols in Tmmllnology, 1(2), Chapter 6,
(:L991)) initially comprises preparing an antibody specific to
the Ck~-11 or Cka-l antigen, preferably a monoclonal
antibody. In addition a reporter antibody is prepared
against the monoclonal antibody. To the reporter antibody is
at:tached a detectable reagent such as radioactivity,
f].uorescence or, in this example, a horseradish peroxidase
enzyme. A sample is removed from a host and incubated on a
solid support, e.g. a polystyrene dish, that binds the
proteins in the sample. Any free protein ~;n~ing sites on
the dish are then covered by incubating with a non-specific
protein like BSA. Next, the monoclonal antibody is incubated
in the dish during which time the monoclonal antibodies
attach to any Ck~-ll or Ck~-1 proteins attached to the
polystyrene dish. All un~ound monoclonal antibody is washed
CA 02222280 1997-11-2
W09,6/39522 PCT~S~6/09~7~
out with buffer. The reporter antibody linked to horseradish
p~eroxidase is now placed in the dish resulting in binding of
the reporter antibody to any monoclonal antibody bound to
Ck~-11 or Ck~-1. Unattached reporter antibody is then washed
out. Peroxidase substrates are then added to the dish and
the amount o~ color developed in a given time period is a
measurement of the amount of Ck~-11 or Ck~-l protein present
v in a given volume of patient sample when comr~red against a
st~n~A~d curve.
A competition assay may be employed wherein antibodies
specific to Ck~-11 or Ck~-1 are attached to a solid support
and labeled Ck~-11 or Ck~-1 and a sample derived from the
host are passed over the solid support and the amount of
l,abel detected, for example by liquid scintillation
chromatography, can be correlated to a quantity of Ck~-ll or
Ck~-1 in the sample.
A "sandwich" assay is similar to an ELISA assay. In a
~;andwich~ assay Ck~-11 or Ck~-l is passed over a solid
sllpport and binds to antibody attached to a solid support.
A second antibody is then bound to the Ck~-11 or Ck~-1. A
third antibody which is labeled and specific to the second
antibody is then passed over the solid support and binds to
the second antibody and an amount can then be quantified.
This invention provides a method for identification of
the receptors for the human ~h~mnkine polypeptides. The gene
encoding the receptor can be identified by numerous methods
known to those of skill in the art, for example, ligand
p~nning and FACS sorting (Coligan, et al., Current Protocols
in Immun., 1(2), Chapter 5, (1991)). Preferably, expression
cloning i8 employed wherein polyadenylated RNA is prepared
from a cell responsive to the polypeptides, and a cDNA
library created from this RNA is divided into pools and used
to transfect COS cells or other cells that are not responsive
to the polypeptides. Transfected cells which are grown on
glass slides are exposed -to the labeled polypeptides. The
-23-
WO 1~6/39S22 CA O 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US9~ 53 /~
polypeptides can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-
specific protein kinase. Following fixation and incubation,
the slides are subjected to autoradiographic analysis.
Positive pools are identified and sub-pools are prepared and
retransfected using an iterative sub-pooling and rescreening
process, eventually yielding a single clones that encodes the
putative receptor.
As an alternative approach for receptor identification,
the labeled polypeptides can be photoaffinity linked with
cell membrane or extract preparations that express the
receptor molecule. Cross-linked material is resolved by PAGE
analysis and exposed to X-ray film. The labeled complex
cont~in;ng the receptors of the polypeptides can be excised,
resolved into peptide fragments, and subjected to protein
m:icrosequencing. The amino acid sequence obtained from
m:Lcrosec~uencing would be used to design a set of degenerate
o]Ligonucleotide probes to screen a cDNA library to identify
the genes encoding the putative receptors.
This invention provides a method of screening compounds
to identify agonists and antagonists to the human ch~m~kine
polypeptides of the present invention. An agonist is a
compound which has similar biological functions of the
polypeptides, while antagonists block such functions.
ChLemotaxis may be assayed by placing cells, which are
chemoattracted by either of the polypeptides of the present
invention, on top of a filter with pores of sufficient
diameter to admit the cells (about 5 ~Lm). Solutions of
potential agonists are placed in the bottom of the chamber
with an appropriate control medium in the upper compartment,
and thus a concentration gradient of the agonist is measured
by counting cells that migrate into or through the porous
membrane over time.
When assaying for antagonists, the human ~hemokine
polypeptides of the present invention are placed in the
-24-
CA 02222280 1997-11-2
W O ~6/39522 PCT/U~,GI'~53~
bottom chamber and the potential antagonist is added to
determine i~ chemotaxis o~ the cells is prevented.
Alternatively, a mAmmAlian cell or membrane preparation
expressing the receptors of the polypeptides would be
incubated with a labeled human ch~mokine polypeptide, eg.
radioactivity, in the presence of the compound. The ability
of the compound to block this interaction could then be
measured. When assaying ~or agonists in this fashion, the
human chpmnkines would be absent and the ability of the
agonist itself to interact with the receptor could be
measured.
~ xamples of potential Ck~-ll and Ck~-1 antagonists
include antibodies, or in some cases, oligonucleotides, which
bind to the polypeptides. Another example of a potential
antagonist is a negative ~omin~nt mutant of the polypeptides.
Negative ~mln~nt mutants are polypeptides which bind to the
receptor o~ the wild-type polypeptide, but fail to retain
biological activity.
Antisense constructs prepared using antisense technology
~re also potential antagonists. Antisense technology can be
used to control gene expression through triple-helix
iormation or antisense DNA or RNA, both of which methods are
based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide
sequence, which encodes for the mature polypeptides of the
present invention, is used to design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length.
A DNA oligonucleotide is designed to be complemPnt~y to a
region of the gene involved in transcription (triple- helix,
see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et
al, Science, 241:456 (1988); and Dervan et al., Science, 251:
1360 (1991)), thereby preventing transcription and the
p~roduction of the human che~k;ne polypeptides. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo
and blocks translation -of the mRNA molecule into the
W 0!~6/39522 CA 02222280 1997-11-2~ PCT/U~3GI~33/'
polypeptides (antisense - Okano, J. Neurochem , 56:560
(1991); OligodeoxynucleotideS as Antisense Inhibitors of Gene
]3xpression, CRC Press, Boca Raton, FL (1988)). The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed i~
~vivo to inhibit production of the human chPmokine
polypeptides~
Another potential human ch~mnkine antagonist is a
peptide derivative of the polypeptides which are naturally or
synthetically modified analogs of the polypeptides that have
lost biological function yet still recognize and bind to the
receptors of the polypeptides to thereby effectively block
t:he receptors. Examples of peptide derivatives include, but
are not limited to, small peptides or peptide-like molecules.
The antagonists may be employed to inhibit the
chemotaxis and activation of macrophages and their
precursors, and of neutrophils, basophils, B lymphocytes and
some T cell subsets, e.g., activated and CD8 cytotoxic T
cells and natural killer cells, in certain auto-~mmlln~ and
chronic inflammatory and infective diseases. Examples of
auto-immune diseases include multiple sclerosis, and insulin-
dependent diabetes.
The antagonists may also be employed to treat infectious
diseases including silicosis, sarcoidosis, idiopathic
pnlmnnAry fibrosis by preventing the recruitment and
aLctivation of ~nnonllclear phagocytes. They may also be
employed to treat idiopathic hyper-eosinophilic syndrome by
preventing eosinophil production and migration. Endotoxic
shock may also be treated by the antagonists by preventing
the migration of macrophages and their production of the
human c~h~m~kine polypeptides of the present invention.
The antagonists may al~o be employed for treating
atherosclerosis, by preventing monocyte infiltration in the
artery wall.
-26-
CA 02222280 1997-11-2
W 0516~9522 . PCTnJS5~5~r~
The antagonists may also be employed to treat hist~mine-
mediated allergic reactions and ;m~lln~logical disorders
including late phase allergic reaction~ chronic urticaria
and atopic dermatitis by inhibiting ~hA~okine-induced mast
cell and basophil degranulation and release of histamine.
Ig~-mediated allergic reactions such as allergic asthma
rhinitis and eczema may also be treated.
The antagonists may also be employed to treat chronic
and acute inflammation by ~L~v~,lting the attraction of
monocytes to a wound area. They may al~o be employed to
r-egulate normal pnlmonAry macrophage populations since
chronic and acute inflammatory plllmon~y disea~es are
associated with sequestration of mo~onllclear phagocytes in
the lung.
Antagonists may also be employed to treat rheumatoid
arthritis by preventing the attraction of monocytes into
synovial fluid in the joints of patients. Monocyte influx
and activation plays a significant role in the pathogenesis
of both degenerative and inflammatory arthropathies.
The antagonists may be employed to interfere with the
d~leterious cascades attributed primarily to IL-l and TNF
which prevents the biosynthesis of other inflammatory
cytokines. In this way the antagonists may be employed to
prevent inflammation. The antagonists may also be employed
to inhibit prostagl~n~; n -indepPn~nt fever induced by
cl~Pm~lkines .
The antagonists may also be employed to treat cases of
bone marrow failure for example aplastic ~n~mi~ and
myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and
a]Llergy by preventing eosinophil accumulation in the lung.
The antagonists may also be employed to treat subepithelial
basement .,.~..~ dne fibrosis which is a pro~n~nt feature of
the asthmatic lung.
CA 02222280 1997-11-2~
W O916~9~22 PCTAUS96/09572
The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
The human chemokine polypeptides and agonists and
antagonists may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
t:herapeutically effective amount of the polypeptide, and a
plharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
tihereof. The formulation should suit the mode of
~m; nistration.
The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of
the ingredients of the pharmaceutical compositions of the
invention. Associated with such cont~;nPr(s) can be a notice
in the form prescribed by a governm~nt~l agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects approval by the agency of
m~mufacture, use or sale for human A~ministration. In
addition, the polypeptides and agonists and antagonists may
be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be A~mi nistered in
a convenient mAnner such as by the topical, intravenous,
intraperitoneal, intramuscular, intratumor, subcutaneous,
intranasal or intradermal routes. The pharmaceutical
compositions are A~m;n;stered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In general, the polypeptides will be ~m;nistered in an
amount of at least about 10 ~g/kg body weight and in most
caLses they will be ?~m;nistered in an amount not in excess of
about 8 mg/Kg body weight per day. In most cases, the dosage
is from about 10 ~g/kg to about 1 mg/kg body weight daily,
ta.king into account the routes of ~ministration, symptoms,
etc.
-28-
CA 02222280 1997-11-2
W096~9522 PCT~S961~5~
The human ch~mnkine polypeptides, and agonists or
antagonists which are polypeptides, may be employed in
accordance with the present invention by expression of such
polypeptides in vivo, which is often referred to as "gene
therapy."
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) encoding a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells
may be engineered by procedures known in the art by use of a
retroviral particle contA;n;ng RNA encoding a polypeptide of
the present invention.
Similarly, cells may be engineered in vivo for
expression of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle cont~;n;ng RNA
encoding the polypeptide of the present invention may be
~m; ni stered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
nnethods for ;~Am; n;stering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the teachings of the present invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
be used to engineer cells in vivo after combination with a
suitable delivery vehicle.
Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not
l.imited to, Moloney Murine Leukemia Virus, spleen necrosis
~irus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia
virus, human ;mmllnoAeficiency virus, adenovirus,
~yeloproliferative Sarcoma Virus, and m~mm~ry tumor virus.
-29-
CA 02222280 1997-11-2~
W 0~6/39522 PCT/U',C~5~72
In one embodiment, the retroviral plasmid vector is ~erived
~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited
to, the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other
promoter (e.g., cellular promoters such as eukaryotic
clellular promoters including, but not limited to, the
histone, pol III, and ~-actin promoters). Other viral
p:romoters which may be employed include, but are not limited
to, adenovirus promoters, thymidine kinase (TK) promoters,
and B19 parvovirus promoters. The selection of a suitable
promoter will be apparent to those skilled in the art from
the teachings contained herein.
The nucleic acid seguence encoding the polypeptide of
the present invention is under the control of a suitable
promoter. Suitable promoters which may be employed include,
b~lt are not limited to, adenoviral promoters, such as the
aclenoviral major late promoter; or hetorologous promoters,
such as the cytomegalovirus (CMV) promoter; the respiratory
syncytial virus (RSV) promoter; inducible promoters, such as
the MMT promoter, the metallothionein promoter; heat shock
promoters; the albumin promoter; the ApoAI promoter; human
globin promoters; viral thymidine kinase promoters, such as
the Herpes Simplex thymidine kinase promoter; retroviral LTRs
(including the modified retroviral LTRs hereinabove
described); the ~-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter
which controls the gene encoding the polypeptide.
The retroviral plasmid vector is employed to transduce
packaging cell lines to form p~oducer cell lines. Examples
of packaging cells which may be transfected include, but are
not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X,
VT-19-17-H2, ~CRE, ~CRIP,~GP+E-86, GP+envAml2, and DAN cell
-30-
CA 02222280 1997-11-2~
Wo~6~9s22 PCT~S~6/09572
lines as described in Miller, Human Gene Therapv, Vol. 1,
pgs. 5-14 (1990), which is incorporated herein by reference
in its entirety. The vector may transduce the packaging
cells through any means known in the art. Such means
include, but are not limited to, electroporation, the use o~
liposomes, and CaP04 precipitation. In one alternative, the
retroviral plasmid vector may be encapsulated into a
liposome, or coupled to a lipid, and then ~m~n; ~tered to a
host.
The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles
then may be employed, to transduce eukaryotic cells, either
in vi tro or in vivo. The transduced eukaryotic cells will
express the nucleic acid sequence(s) encoding the
polypeptide. Fukaryotic cells which may be transduced
include, but are not limited to, embryonic stem cells,
embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronch~l epithelial cells.The
sequences of the present invention are also valuable for
chromosome identification. The sec~uence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there i8 a current
need for identifying particular sites on the chromosome. Few
chromosome marking reagents based on actual secruence data
~repeat polymorphisms) are presently available for marking
c:hromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with genes associated with
clisease.
Briefly, sequences can be mapped to chromosomes by
p~reparing PCR primers (preferably 15-25 bp) ~rom the cDNA.
Computer analysis of the 3' untranslated region is used to
- rapidly select primers tha~ do not span more than one exon in
-31-
W05~6/39522 CA 02222280 Iss7-ll-2~ PCT~S96/09572
the genomic DNA, thus complicating the amplification process.
1'hese primers are then used for PCR screening of somatic cell
~Lybrids cont~ning individual human chromosomes. Only those
hybrids cont~in~ng the human gene corresponding to the primer
will yield an amplified fragment.
PCR mapping o~ somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels of
fragments from specific chromosomes or pools of large genomic
clones in an analogous m~nn~r, Other mapping strategies that
can similarly be used to map to its chromosome include in
situ hybridization, prescreening with labeled flow-sorted
c.hromosomes and preselection by hybridization to construct
c~hromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
c:Lones to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., Human
Chromosomes: a MAnU~ l of Basic Techniques, Pelydmoll Press,
New York (1988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
da.ta are found, for example, in V. McKusick, Mendelian
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaf~ected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then
.
CA 02222280 1997-11-2
W096~9522 PCT~S~6~
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disea8e could be one
of between 50 and 500 potential causative genes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an lmmllnogen to produce antibodies thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
~The present invention also includes ch;m~ric, single chain,
,and hllm~n~zed antibodies, as well as Fab fragments, or the
product of an Fab expression library. Various procedures
~nown in the art may be u~ed for the production of such
antibodies and ~ragments.
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obtained by direct injection of the polypeptides into an
iln;m~l or by ~min;stering the polypeptides to an ~n;m~l,
preferably a nonhl-m~n. The antibody so obtained will then
bind the polypeptides itself. In this m~nn~r, even a
~;ecluence encoding only a fragment o~ the polypeptides can be
used to generate antibodies binding the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique
~hich provides antibodies produced by continuous cell line
cultures can be used. Examples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
~Kozbor et al., 1983, Tmmllnology Today 4:72), and the BBV-
hybridoma technique to produce human monoclonal antibodies
WO 96/39522 CA 0 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US9~ 3 /~
(Cole, et al., 1985, in Monoclonal Antibodies and ~ancer
Therapy~ Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to ;mmllnogeniC polypeptide products
of this invention. Also, transgenic mice may be used to
c~xpress hllm~n;zed antibodies to ;mml~nogeniC polypeptide
products of this invention.
The present invention will be further described with
reference to the following examples; however, it is to be
~mderstood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate underst~n~;ng of the following
e!xamples certain ~requently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
starting plasmids herein are either co~mercially available,
publicly available on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzy~me that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are cQ~m~rcially available and their reaction
conditions, cofactors and other requirements were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1
of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
D~rA are digested with 20 tlO 250 units of enzyme in a larger
CA 02222280 1997-11-2~
W O 96/39522 PCT~US96109572
volume. Appropriate buffers and substrate amounts for
paLrticular restriction enzymes are specified by the
maLnufacturer. Incubation times o~ about 1 hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier's instructions. After digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
tlle desired fragment.
Size separation of the cleaved fragments is performLed
u~3ing 8 percent polyacrylamide gel described by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded
polydeoxyDLucleotide or two complementary polydeoxynucleotide
st:rands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
li.gate to another oligonucleotide without adding a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
d~phosphorylated.
~ higation" refers to the process of forming
phLosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions with 10 units to T4 DNA ligase
("ligase") per O.5 ~g of approximately equimolar amounLts of
the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
Exam~le 1
Bacterial ~xpression and Purification of Ck~-11
The DNA sequence encoding,for Ck~-11, ATCC # 75948, is
initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed
Ck~-11 nucleic acid sequence (minus the putative signal
-35-
CA 02222280 1997-11-2~
W 0!16~9522 PCT~US96/09572
peptide sequence). Additional nucleotides corresponding to
the Ck~-11 gene are added to the 5~ and 3' end sequences
respectively. The 5' oligonucleotide primer has the sequence
5' CCCGCATGCCAA~-l~-l~AGTGGCACCA 3' contains a SphI restriction
enzyme site (bold) followed by 18 nucleotides of Ck~
coding sequence (underlined) starting from the second
nucleotide of the secluences coding for the mature protein.
The ATG codon is included in the SphI site. In the next
codon following the ATG, the first base is from the SphI site
and the rPm~i ni ng two bases correspond to the second and
third base of the first codon (residue 18) of the putative
mature protein. The 3' sequence 5~
CCCGGATCCCAATGCTTGACTCGGACT 3' contains complementary
sequences to a BamH1 site (bold) and is followed by 18
nucleotides of gene specific secluences preceding the
termination codon. The restriction enzyme sites correspond
to the restriction enzyme sites on the bacterial expression
vector pQE-9 (Qiagen, Inc. Chatsworth, CA). pQE-9 encodes
,~ntibiotic resistance (Ampr), a bacterial origin of
replication (ori), an IPTG-regulatable promoter operator
(P/O), a ribosome binding site (RBS), a 6-His tag and
:restriction enzyme sites. pQE-9 is then digested with SphI
and BamH1. The amplified secluences are ligated into pQE-9
~nd are inserted in frame with the secluence encoding for the
histidine tag and the RBS. The ligation mixture is then used
lo transform the E. coli strain M15/rep 4 (Qiagen, Inc.) by
t:he procedure described in Sambrook, J. et al., Molecular
tloning: A Laboratory M~n~ , Cold Spring Laboratory Press,
(1989). M15/rep4 contains multiple copies of the plasmid
pREP4, which expresses the lacI repressor and also confers
kanamycin resistance (Kanr). Transformants are identified by
t:heir ability to grow on LB plates and ampicillin/kanamycin
resistant colonies are selected. Plasmid DNA is isolated and
c:onfirmed by restriction analysis. Clones cont~;ning the
clesired constructs are grown overnight (O/N) in liquid
-36-
CA 02222280 1997-11-2~
W O 9'6/39522 PCTnU5,G~5/J
culture in LB media supplemented with both Amp (100 ug/ml)
aLnd Kan (25 ug/ml). The O/N culture is used to inoculate a
large culture at a ratio of l:100 to 1:250. The cells are
glrown to an optical density 600 (O.D.~) of between 0.4 and
0.6. IPTG ("Isopropyl-B-D-thiogalaCto pyrano~ide~) is then
added to a final concentration o~ 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading to
increased gene expression. Cells are grown an extra 3 to 4
hours. Cells are then harvested by centrifugation. The cell
pellet is solubilized in the chaotropic agent 6 Molar
Guanidine HCl pH 5Ø A~ter clarification, solubilized Ck~-
ll is purified ~rom this solution by chromatography on a
Nickel-Chelate column under conditions that allow for tight
binding by proteins cont~;n~ng the 6-His tag (Hochuli, E. et
al., J. Chromatography 411:177-184 (1984)). Ck~-11 ( ~98~
pure) is eluted from the column in 6M guanidine HCl. Protein
renaturation out o~ GnHCl can be accomplished by several
protocols (Jaenicke, R. and Rudolph, R., Protein Structure -
A Practical Approach, IRL Press, New York (1990)).
Initially, step dialysis is utilized to remove the GnHCL.
Alternatively, the purified protein isolated from the Ni-
chelate column can be bound to a second column over which a
decreasing linear GnHCL gradient is run. The protein is
allowed to renature while bound to the column and is
subsequently eluted with a buffer cont~;ning 250 mM
Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10~
Glycerol. Finally, soluble protein is dialyzed against a
s~torage buffer cont~;ning 5 mM ~mmonium Bicarbonate.
Example 2
Bacterial ExPression and Purification of Ck~-1
The DNA sequence encoding.for Ck~-1, ATCC # 75947, is
i]litially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed
Ck~-1 nucleic acid sequence (minus the putative signal
WO~K~9522 CA 02222280 Iss7-ll-2~ PCT~S96/ogs72
peptide sequence). Additional nucleotides corresponding to
1 are added to the 5' and 3' end sequences respectively.
~he 5' oligonucleotide primer has the sequence 5~
C'CCGCATGCCTTCTGGAGGTCTATTACACA 3' contains a SphI restriction
e!nzyme site (bold) followed by 21 nucleotides of Ck~-1 coding
~equence starting from the 8econd nucleotide of the sequences
coding for the mature protein. The ATG codon is included in
the SphI site. In the next codon following the ATG, the
first base is from the SphI site and the r~m~;n~ng two bases
correspond to the second and third base of the first codon
(residue 23) of the putative mature protein. ~s a
consequence, the first base in this codon is changed from G
to C co~rAring with the original sequences, resulting in a
Val to Leu substitution in the recombinant protein. The 3~
sequence 5' CCCGGATCCGGGAATCTTT~-l~-l-lA~AC 3~ contains
complementary sequences to a BamH1 site (bold) and is
followed by 19 nucleotides of gene specific sequences
preceding the termination codon. The restriction enzyme
si.tes correspond to the restriction enzyme sites on the
bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
C~,). pQE-9 encodes antibiotic resistance (Ampr), a bacterial
origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag
and restriction enzyme sites. pQE-9 is then digested with
SphI and BamHl. The amplified sequences are ligated into
pQE-9 and are inserted in frame with the sequence encoding
for the histidine tag and the RBS. The ligation mixture is
then used to trans~orm the E. coli M15/rep 4 (Qiagen, Inc.)
by the procedure described in Sambrook, J. et al., Molecular
Cloning: A Laboratory MAnllAl~ Cold Spring Laboratory Press,
(1989). M15/rep4 contains multiple copies of the plasmid
p~3P4, which expresses the lacI repressor and also confers
ka~amycin resistance (Kanr). Transformants are identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies are selected. Plasmid DNA is isolated and
-38-
-
CA 02222280 1997-11-2~
W 09~6/39522 PCTnUS~C,'~jJ7
~onfinmed ~y restriction analysis. Clones cont~ning the
desired constructs are grown overnight (0/N) in liquid
c:ulture in LB media supplemented with both Amp (100 ug/ml)
cmd Xan (25 ug/ml). The O/N culture is used to inoculate a
]arge culture at a ratio of 1:100 to 1:250. The cells are
grown to an optical density 600 (O.D.~) of between 0.4 and
0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then
added to a final concentration of 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/0 leading to
i.ncreased gene expression. Cells are grown an extra 3 to 4
hours. Cells are then harvested by centrifugation. The cell
pellet is solubilized in the chaotropic agent 6 Molar
Guanidine HCl pH 5Ø A~ter clari~ication, solubilized Ck~-1
i.s purified from this solution by chromatography on a Nickel-
C'helate column under conditions that allow for tight binding
by proteins cont~;n~ng the 6-His tag (Hochuli, E. et al., J.
Chromatography 411:177-184 (1984)). Ck~-l ( ~98% pure) is
eluted from the column in 6M guanidine HCl. Protein
renaturation out of GnHCl can be accomplished by several
plrotocols (Jaenicke, R. and Rudolph, R., Protein Structure -
A. Practical Approach, IRL Press, New York (1990)).
Initially, step dialysis is utilized to remove the GnHCL.
A.lternatively, the puri~ied protein isolated from the Ni-
chelate column can be bound to a second column over which a
decreasing linear GnHCL gradient is run. The protein is
allowed to renature while bound to the column and is
subsequently eluted with a buffer contA;n;ng 250 mM
Imidazole, 150 mM NaCl, 2S mM Tris-HCl pH 7.5 and 10~
Glycerol. Finally, soluble protein is dialyzed against a
storage buffer cont~;n;ng 5 mM ~m~n;um Bicarbonate.
Example 3
~x~ression of Recombinant Ck~-ll in COS cells
The expression of plasmid, Ck~-ll HA is derived from a
vector pcDNAI/Amp (Invitr~gen) contA;n;ng: 1) SV40 origin of
-39-
WO '~6/39522 CA 0 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US96/09S72
replication, 2) ampicillin resistance gene, 3) E coli
replication origin, 4) CMV promoter followed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-11 precursor and a HA tag
~used in frame to its 3' end is cloned into the polylinker
region of the vector, therefore, the recom~inant protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hem,agglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
1984, Cell 37, 767). The infusion of HA tag to the target
protein allows easy detection of the recombinant protein with
a;n antibody that recognizes the HA epitope.
The plasmid construction strategy is described as
f~llows:
The DNA sequence encoding for Ck~-11, ATCC # 75948, is
constructed by PCR using two primers: the 5' primer 5'
A~ AGCTTGCCATGGCCCTGCTACTG 3' contains a HindIII site
followed by 18 nucleotides of Ck~-ll coding sequence starting
from the minus 3 position relative to initiation codon; the
3' sequence 5'CGCTCTAGATTAAGCGTAGT~ ~AC~l~lATGGGTATAGGTTA
ACTGCTGCGAC 3' contains complementary sequences to an XbaI
site, translation stop codon, HA tag and the last 18
n~Lcleotides of the Ck~-11 coding sequence (not including the
stop codon). Therefore, the PCR product contains a HindIII
site, Ck~-ll coding sequence followed by HA tag fused in
~rame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA ~ragment and
the vector, pcDNAI/Amp, are digested with HindIII and XbaI
restriction enzyme and ligated. The ligation mixture is
transformed into E. coli strain SURE (Stratagene Cloning
Systems, La ~olla, CA) the transformed culture is plated on
ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and ex~m~ned by
restriction analysis for the presence of the correct
-40-
CA 02222280 1997-11-2~
W O 9~6/39522 PCT~US~ 5~L
fragment. For expression of the recombinant Ck~-11, COS
cells are transfected with the expression vector by DBAE-
DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory Press, (1989)). The expression of the Ck~-11 HA
protein is detected by radiolabelling and ~mmllnoprecipitation
method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, (1988)). Cells are
labelled for 8 hours with 35S-cysteine two days post
transfection. Culture media are then collected and cells are
l~rsed with detergent (RIPA buffer (150 mM NaCl, 1~ NP-40,
0.1~ SDS, 1~ NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I.
et: al., Id. 37:767 (1984)). Both cell lysate and culture
media are precipitated with a HA specific monoclonal
antibody. Proteins precipitated are analyzed by SDS-PAGE.
Exam~le 4
E~ression of Recombinant Ck~-l in COS cells
The expression of plasmid, Ck~-l HA is derived from a
vector pcDNAI/Amp (Invitrogen) cont~n;n~: 1) SV40 origin of
replication, 2) ampicillin resistance yene, 3) ~.coli
replication origin, 4) CMV promoter followed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-1 precursor and a HA tag
fused in frame to its 3' end is cloned into the polylinker
region of the vector, therefore, the recombinant protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
1984, Cell 37, 767). The infusion of HA tag to the target
protein allows easy detection of the recombinant protein with
an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as
follows:
-41-
WO 96/39522 CA O 2 2 2 2 2 8 0 19 9 7 - 1 1 - 2 ~ PCT/US~G/~5; ~2
The DNA sequence encoding for Ck~-1, ATCC # 75947, is
constructed by PCR using two primers: the 5' primer 5'
~AAAAGCTTAGAATGAAGTTCATCTCG 3' contains a HindIII site
followed by 18 nucleotides of Ck~-1 coding sequence starting
from the minus 3 position relative to the initiation codon;
the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGAC~l~lATGGGTAG
~GAA~ -l-l 3' contains complementary sequences to an XbaI
site, translation stop codon, HA tag and the last 18
nucleotides of the Ck~-1 coding sequence (not including the
stop codon). Therefore, the PCR product contains a HindIII
site, Ck~-1 coding sequence followed by HA tag fused in
frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA fragment and
t:he vector, pcDNAI/Amp, are digested with HindIII and an XbaI
restriction enzyme and ligated. The ligation mixture is
transformed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, CA) the transformed culture is plated on
ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and ~mi n~d by
restriction analysis for the presence of the correct
fragment. For expression of the recombinant Ck~-1, COS cells
are transfected with the expression vector by DEAE-DEXTRAN
method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular
Cloning: A Laboratory M~n~ , Cold Spring Laboratory Press,
(L989)). The expression of the Ck~-1 HA protein is detected
by radiolabelling and immunoprecipitation method (E. Harlow,
D. Lane, Antibodies: A Laboratory ~nll~ l, Cold Spring Harbor
Laboratory Press, (1988)). Cells are labelled for 8 hours
w:Lth 35S-cysteine two days pOst transfection. Culture media
are then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1~ NP-40, 0.1~ SDS, 1~ NP-40, 0.5~ DOC,
5CImM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media are precipitated with a HA
specific monoclonal antibody. Proteins precipitated are
analyzed by SDS-PAGE.
-42-
CA 02222280 1997-11-2
W o 96r39522 PCTrUS961~53
ExamDle 5
Clonin~ and ex~ression of Ck~-11 usinq the baculovirus
e~ression SYstem
The DNA sequence encoding the full length Ck~
protein, ATCC # 75948, is ampli~ied using PCR oligonucleotide
primers corresro~; ng to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' CGCGGGATCCGCCATCATG
GC'CCTGCTACTGGCCCT 3' and contA; nQ a BamHI restriction enzyme
si.te (in bold) followed by 6 nucleotides resPmhli ng an
efficient ~ignal for the initiation of translation in
eu~aryotic cells (Kozak, M., J. Mol. Biol., 196:947-950
(1987) which is ju8t behind the first 20 nucleotides of the
Ck:~-11 gene (the initiation codon for translation "ATG" is
underlined).
The 3' primer has the sequence 5'
CGGCGGTACCTGGCTGCACGGTCCATAGG 3' and contains the cleavage
site ~or the restriction en~onl~clease Asp781 and 19
nucleotides complementary to the 3' non-translated 8equence
of the Ck~-11 gene. The amplified sequences are isolated
from a 1~ agarose gel using a c- -rcially available kit
(nGeneclean," BI0 101 Inc., La Jolla, Ca ). The frag~ent is
then dige8ted with the ~n~nnll~leases BamHI and Asp781 and
then purified again on a 1~ agarose gel. This ~ragment is
designated F2.
The vector pRG1 (modification of pVL941 vector,
di~cussed below) is used for the expression of the Ck~-11
protein using the baculovirus expression system (for review
se~e: Summers, M.D. and Smith, G.E. 1987, A mAnllAl of methods
for baculovirus vectors and insect cell culture procedures,
Te:Kas Agricultural Experimental Station Bulletin No. 1555).
This expre88ion vector rnnt~inQ the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
vi~us (AcMNPV) followed by the recognition sites for the
restriction Pn~onllrleases BamHI and Asp781. The
polyadenylation site of the simian virus (SV)40 is used for
-43-
CA 02222280 1997-11-2
W O 96/39522 PCT~US9~ 53/~
efficient polyadenylation. For an easy selection of
recombinant viruses the beta-galactosidase gene from E.coli
i6 inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at
both sides by viral se~uences for the cell-mediated
homologous recombination of cotransfected wild-type viral
Dl~A. Many other baculovirus vectors could be used in place
o:E pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and
Sllmmers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymes
BamHI and Asp781 and then dephosphorylated using calf
intestinal phosphatase by procedures known in the art. The
D~A is then isolated from a 1~ agarose gel using the
commercially available kit ("Geneclean" BI0 101 Inc., La
~olla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are
ligated with T4 DNA ligase. E.coli B 101 cells are then
transformed and bacteria identified that contained the
p~.asmid (pBac-Ck~-ll) with the CK~-ll gene using the enzymes
Ba~mHI and Asp781. The sequence of the cloned fragment is
confirmed by DNA sequencing.
5 ~g of the plasmid pBac-CK~-ll is cotransfected with
1.O ~g of a commercially available linearized baculovirus
(~BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.)
using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid
pBac-CK~-ll are mixed in a sterile well of a microtiter plate
contA;ning 50 ~1 of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~1
Lipofectin plus 90 ~1 Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the
transfection mixture is added dropwise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
-44-
CA 02222280 1997-11-2
W0~6~9522 PCT~S9'~
with lml Grace's medium without serum. The plate is rocked
back and forth to mix the newly added solution. The plate i~
then incubated for 5 hours at 27OC. After 5 hours the
transfection solution is removed from the plate and 1 ml o~
Grace's insect medium supplemented with 10~ fetal cal~ serum
is added. The plate i8 put back into an incubator and
cultivation continued at 27~C for four days.
After four days the supernatant is collected and a
plaque assay perfonmed 8~mil~ as described by Summers and
Smith (supra). As a modification an agarose gel with "Blue
Gal" (Life Technologies Inc., Gaithersburg) is used which
allows an easy isolation of blue st~ne~ plaques. (A
detailed description of a "plaque assay" can also be found in
t]he user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
1~)) .
Four days after the serial dilution, the viruses areaclded to the cells and blue st~inPA plaques are picked with
the tip of an Eppendorf pipette. The agar cont~;n'ng the
recombinant viruses is then resuspended in an Eppendorf tube
containing 200 ~1 of Grace's medium. The agar is removed by
a brief centrifugation and the supernatant con~n;ng the
recombinant baculovirus is used to infect Sf9 cells seeded in
35 mm dishes. Four days later the supernatants of these
culture dishes are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with
10~ heat-inactivated FBS. The cells are infected with the
recombinant baculovirus V-CK~-ll at a multiplicity of
in~ection (MOI) of 2. Six hours later the medium is removed
and replaced with SF900 II medium minus methionine and
cysteine (Life Technologies Inc., Gaithersburg). 42 hours
lalter 5 ~Ci of 35S-methionine and 5 ~Ci 3~S cysteine (Amersham)
are added. The cells are further incubated for 16 hours
before they are harvested by centrifugation and the labelled
proteins visualized by SDS-PA OE and autoradiography.
-45-
CA 02222280 1997-11-2
W 0!~6~9522 PCT/U~ 5
~xample 6
Cloninq and expression of Ck~-1 usinq the baculovirus
expression system
The DNA sequence encoding the full length Ck~-1 protein,
ATCC # 75947, is ampli~ied using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' GCCGGATCCGCCATC
aTGAAGTTCATCTCGACATC 3' and contains a BamHI restriction
enzyme site (in bold) followed by 6 nucleotides resembling an
efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950
(1987) which is just behind the first 20 nucleotides of the
Ck~-1 gene (the initiation codon for translation "ATG" is
underlined).
The 3' primer has the sequence 5' CGCGGGTACCGG
TGTTCTTAGTGGAAA 3' and contains the cleavage site for the
restriction endonuclease A~p781 (in bold) and 17 nucleotides
complementary to the 3' non-translated sequence of the Ck~-1
gene. The amplified sequences are isolated from a 1~ agarose
gel using a commercially available kit ("Geneclean,~ BIO 101
Inc., La Jolla, Ca.). The fragment is then digested with the
endonucleases BamHI and Asp781 and then purified again on a
1% agarose gel. This fragment is designated F2.
The vector pRG1 (modification of pVL941 vector,
discussed below) is used for the expression of the Ck~-l
protein using the baculovirus expression system (for review
see: Summers, M.D. and Smith, G.E. 1987; A mAn~lAl of methods
for baculovirus vectors and insect cell culture procedures,
Texas Agricultural ~xperimental Station Bulletin No. 1555).
This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
virus (AcMNPV) followed by t~e recognition sites for the
restriction Pn~onllcleases BamHI and Asp781. The
polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of
-46-
CA 02222280 1997-11-2~
W 0 96~9522 PCT/U~/O~S72
recombinant viruses the beta-galactosidase gene from E.coli
i s inserted in the same orienta~ion a~ the polyhedrin
promoter followed by the polyadenylation ~ignal of the
polyhedrin gene. The polyhedrin sec~uences are flanked at
both sides by viral sequences ~or the cell-mediated
homologous recombination of cotransfected wild-type viral
DNA. Many other baculovirus vectors could be used in place
o,f pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and
Summers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymeE;
BamHI and Asp781 and then dephosphorylated usi~g calf
intestinal phosphatase by procedures known in the art. The
DNA is then isolated from a 1% agarose gel using the
commercially available kit ("Geneclean" BIO 101 Inc., La
Jolla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated pla~;mid V2 are
ligated with T4 DNA ligase. E.coli HB101 cells are then
transformed and bacteria identified that contained the
plasmid (pBac-CkcY-1) with the Ck~ gene using the enzymes
Bi~nHI and Asp781. The sec~uence of the cloned fragment is
confirmed by DNA secruencing.
5 ~g of the plasmid pBac-CkcY-1 is cotransfected with 1.0
~g of a commercially available linearized baculovirus
("BaculoGoldn' baculovirus DNA", Pharmingen, San Diego, CA.)
using the lipofection method (Felgner et al. Proc. Natl.
Acad. Sci USA, 84:7413-7417 (1987)).
l~g of BaculoGoldn' virus DNA and 5 ~g of the plasmid
p~ac-Ck~-1 are mixed in a sterile well of a microtiter plate
cont~;n;ng 50 ~l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l
Lipofectin plus 90 ~ul Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the
transfection mixture is added dropwise to the Sf9 insect
cells (ATCC CRI 1711) seeded in a 35 mm tissue culture plate
with lml Grace's medium without serum. The plate is rocked
-47-
CA 02222280 1997-11-2~
WO 516/39522 PCT/US~6~'~53 / ?
back and forth to mix the newly added solution. The plate is
t~en incubated for 5 hours at 27~C. After 5 hours the
t:ransfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum
is added. The plate is put back into an incubator and
cultivation continued at 27~C for four days.
After four days the supernatant is collect~d and a
p:Laque assay performed similar as described by Summers and
Srnith (supra). As a modification an agarose gel with "Blue
Gal" (Life TechnologieS Inc., Gaithersburg) is used which
a]Llows an easy isolation of blue stained plaques. (A
detailed description of a l'plaque assay" can also be found in
the user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
lt~).
Four days after the seri~l dilution, the viruses are
aclded to the cells and blue stained plaques are picked with
the tip of an Eppendorf pipette. The agar cont~;n;ng the
recombinant viruses is then resuspended in an Eppendorf tube
contA;n;ng 200 ~1 of Grace's medium. The agar is removed by
a brief centrifugation and the supernatant cont~in~ng the
recombinant baculovirus is used to infect Sf9 cells seeded in
35 mm dishes. Four days later the supernatants of these
cu.lture dishes are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with
10~ heat-inactivated FBS. The cells are infected with the
recombinant baculovirus V-Ck~-1 at a multiplicity of
infection (MOI) of 2. Six hours later the medium is removed
and replaced with SF900 II medium minus methionine and
cysteine (hife Technologies Inc., Gaithersburg, MD). 42
hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine
(Amersham) are added. The cells are further incubated for 16
hours before they are harvested by centrifugation and the
labelled proteins visualized by SDS-PAGE and autoradiography.
-48-
CA 02222280 1997-11-25
wo96~9s22 PCT~S9G~
Example 7
~x~ression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy.
The resulting tissue is placed in tissue-culture medium and
separated into small pieces. Small chunks of the tissue are
placed on a wet ~urface of a tissue culture flask,
approximately ten pieces are placed in each flask. The flask
is turned upside down, closed tight and le~t at room
temperature over night. After 24 hours at room temperature,
the flask is inverted and the chunks of tissue remain fixed
to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
At this time, fresh media is added and subsequently changed
ev~ry several days. After an additional two weeks in
cu_~ure, a monolayer of fibroblasts emerge. The monolayer is
trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988)
flanked by the long tenminal repeats of the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with cal~ intestinal phosphatase. The
linear vector is ~ractionated on agarose gel and purified,
using glass beads.
The cDNA encoding a polypeptide of the present invention
i5 amplified using PCR primers which correspond to the 5' and
3' end sequences respectively. The 5' primer contA; n; ng an
EcoRI site and the 3' primer $further includes a HindIII
site. ~qual quantities o~ the Moloney murine sarcoma virus
linear backbone and the amplified $EcoRI and HindIII ~ragment
are added together, in the presence of T4 DNA ligase. The
resulting mixture is maint~;n~ under conditions appropriate
for ligation of the two fragments. The ligation mixture is
used to transform bacteria HB101, which are then plated onto
agar-cont~;n;ng kanamycin for the purpose of confirming that
the vector had the gene o~ interest properly inserted.
-49-
CA 02222280 1997-11-2
W O 96~9S22 PCT~US96~3~/~
The amphotropic pA317 or GP+aml2 packaging cells are
qrown in tissue culture to confluent density in Dulbecco~s
~odified Eagles Medium (DMEM) with 10~ calf serum (CS),
penicillin and streptomycin. The MSV vector cont~nlng the
gene is then added to the media and the packaging cells are
t:ransduced with the vector. The packaging cells now produce
infectious viral particles containing the gene (the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells,
cmd subsequently, the media is harvested from a 10 cm plate
of confluent producer cells. The spent media, cont~;ning the
infectious viral particles, is filtered through a millipore
iilter to remove detached producer cells and this media is
t:hen used to infect fibroblast cells. Media is removed from
a sub-confluent plate of fibroblasts and quickly replaced
with the media from the producer cells. This media is
removed and replaced with fresh media. If the titer of virus
:Ls high, then virtually all fibroblasts will be infected and
IlO selection is required. If the titer is very low, then it
:is necessary to use a retroviral vector that has a selectable
marker, such as neo or his.
The engineered fibroblasts are then injected into the
host, either alone or after having been grown to confluence
on cytodex 3 microcarrier beads. The fibroblasts now produce
lhe protein product.
Numerous modifications and variations of the present
:invention are possible in light of the above teachings and,
l:herefore, within the scope of the appended claims, the
:invention may be practiced otherwise than as particularly
described.
-50-
-
CA 02222280 1997-11-25
W 0 96~95Z2 . PCTlUb,~J0~5~2
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANTS: H~ GENoME SCIENOES, I~C. AND HA~DCNG LI
(ii) TITLE O~ INVENTION: Human Chemokine Beta-1I and
Human Chemokine Alpha-1
(iii) NUMBER OF SEQUENCES: 16
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
~B) STREET: 1100 New York Avenue, N.W.
(C) CITY: ~.~h;n~bon
(D) STATE: D.C.
(E) COUNTRY: USA
(F) ZIP: 20005-3934
(v) CURRBNT APPLICATION DATA:
(A) APPLICATION NUMBER: TO BE ADVI~D
(B) FIhING DATE: 05 ~~ 1996
(C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER: 08/460,987 & 08/464,401
(B) FILING DATE: 05 June 1995 & 05 June 1995
(vii) ATTORNEY/AGENT INFORMATION:
(A) NAME:GOLDSTEIN, JORGE A.
(B) ~EGISTRATION NUMBER: 29,021
(C) RBFEREN OE /DOCKET NUMBER: 1488.038PC02
(viii; TBLECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 371-2600
(B) TELEFAX: (202) 371-2540
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS'
(A) LENGTH: 29~ BASE PAIRS
(B~ TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLO&Y: LINEAR
CA 02222280 1997-11-25
W 0'~6~9522 PCT~US96/09572
(ii) MOLECULE TYPE: CDNA
(xi) SE~u~NC~ DESCRIPTION: SEQ ID NO:1:
ATGGCCCTGC TACTGGCCCT CAGCCTGCTG Gll~ l~GA ~l-lLCCLAGC CCCAACTCTG 60
AGTGGCACCA ATGATGCTGA AGACTGCTGC ~-lrJl~-lr~lL;A CCCAGAAACC CA~CC~-lL;GG 120
TACATCGTGA GGAACTTCCA CTAC~-ll~-lC ATCAAGGATG GTTGCAGGGT GCCTGCTGTA 180
GTGTTCACCA CACTGAGGGG CCGCCAGCTC TGTGCACCCC CAGACCAGCC C-lr~G~lAGAA 240
CGCATCATCC AGAGACTGCA GAGGACCTCA GCCAAGATGA AGCGCCGCAG CAGTTAA 297
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQ~NC~ CHARACTERISTICS
(A) LENGTH: 98 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRAN~N~SS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
M:et Ala Leu Leu heu Ala Leu Ser Leu Leu Val Leu Trp Thr Ser
-15 -10 -5
P~ro Ala Pro Thr Leu Ser Gly Thr Asn Asp Ala Glu Asp Cys Cys
1 5 10
L,eu Ser Val Thr Gln Lys Pro Ile Pro Gly Tyr Ile Val Arg Asn
E~he His Tyr Leu Leu Ile Lys ASp Gly Cys Arg Val Pro Ala Val
~al Phe Thr Thr Leu Arg Gly Arg Gln Leu Cy~ Ala Pro Pro Asp
Gln Pro Trp Val Glu Arg Ile Ile Gln Arg Leu Gln Arg Thr Ser
60 65 70
Ala Lys Met Lys Arg Arg Ser Ser
75 80
~2) INFORMATION FOR SEQ ID NO:3:
(i) SEQu~N~ CHARACTERISTICS
(A) LENGTH: 330 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
ATGAAGTTCA TCTCGACATC TCTGCTTCTC ATG~TGCTGG TCAGCAGCCT ~ CL-AGTC 60
C'AA~l~l-lC TGGAGGTCTA TTACACAAGC TTGAGGTGTA GAl~l~lC~A AGAGAGCTCA 120
Gl~-l-l-lATcc CTAGACGCTT CATTGATCGA ATTCAAATCT TGCCCCLilLrG GAATGGTTGT 180
CCAAGAAAAG A~ATC'ATAGT CTGGAAGAAG AACAAGTCAA llrvl~l~l~l GGACCCTCAA 240
GCTGAATGGA TACAAAGAAT GATGGAAGTA TTGAGAAAAA GAALi~ lC AACTCTACCA 30O
GTTCCACTGT TTAAGAGAAA GATTCCCTG1A 330
CA 02222280 1997-11-25
W O 96~9522 . PCTnuS9~10
~2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 109 AMINO ACIDS
(B) TYPE: AMIN0 ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Met Lys Phe Ile Ser Thr Ser Leu Leu Leu Met Leu Leu Val Ser
-20 -15 -10
S~er Leu Ser Pro Val Gln Gly Val Leu Glu Val Tyr Tyr Thr Ser
-5 1 5
Leu Arg Cys Arg Cys Val Gln Glu Ser Ser Val Phe Ile Pro Arg
Arg Phe Ile Asp Arg Ile Gln Ile Leu Pro Arg Gly Asn Gly Cys
Pro Arg Lys Glu Ile Ile Val Trp Lys Lys Asn Lys Ser Ile Val
Cys Val Asp Pro Gln Ala Glu Trp Ile Gln Arg Met Met Glu Val
Leu Arg Lys Arg Ser Ser Ser Thr Leu Pro Val Pro Val Phe Lys
70 75 80
Arg Lys Ile Pro
(2) INFORMATION FOR SEQ ID NO:5:
(i) ~ SEQu~ CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: 01igonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:5:
CCCGCATGCC AA~ AGT GGCACCA 27
(2~ INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
-53-
CA 02222280 1997-11-2~
W O 96~9522 PCT~US96/09572
CCCGGATCCC AATGCTTGAC TCGGACT 27
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CCCGCATGCC TTCTGGAGGT CTATTACACA 30
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 28 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CCCGGATCCG GGAATCTTTC TCTTAAAC 28
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:9:
A~AAAGCTTG CCATGGCCCT GCTACTG 27
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQU~N~ CHARACTERISTICS
(A) LENGTH: 57 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
-54-
CA 02222280 1997-11-25
W O 96~9522 . PCTnUS96/09572
(xi~ SEQ~N~ DESCRIPTION: SEQ ID NO:10:
CGCTCTAGAT TAAGCGTAGT CTGGGACGTC GTATGGGTAT AGGTTAACTG CTGCGAC 57
(2) lN~O~IATION FOR SEQ ID NO:11:
(i) SEQ~N~ CHARAC~ERISTICS
(A) LENGTH: 27 BASB PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ _D NO:11:
F~AAGCTTA GAATGAAGTT CATCTCG 27
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQ~N~ CHARACTERISTICS
(A) LENGTH: 54 BASE PAIRS
(B) TYPE: N~CLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
CGCTCTAGAT TAAGCGTAGT CTGGGACGTC GTATGGGTAG GGAATCTTTC T~ l' 54
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 36 BASE PAIRS
(B) TYPE: N~CLEIC ACID
(C) STRAN~N~SS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
CGC'GGGATCC GCCATCATGG CCCTGCTACT GGCCCT 36
(2) INFORMATION FOR SEQ ID NO:14:
(i) SBQUBNCE CHARACTERISTICS
(A) LBNGTH: 29 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINBAR
-55-
CA 02222280 1997-11-25
W 0~6~9522 PCTAJ5~ 3
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
C~,GCGGTACC TGGCTGCACG GTCCATAGG 29
(:2) INFORMATION FOR SEQ ID NO:15:
(i) SE~N~ CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GCCGGATCCG CCATCATGAA GTTCATCTCG ACATC 35
(:2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUEN OE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
CGCGGGTACC GGTGTTCTTA GTGGAAA 27
-56-
CA 02222280 l997-ll-2;i
W O 96~9522 PCT~US9CI~5iL
INDICATIONS RE ~ ~ING TO A DErOSITED MICRO ORGANISM
(PCT Rule 13L~is)
A. ~he indications made belo v relate to the microorganism referred to in Ihe description
on page 5 , line 23
lB. IDENTI~ICATION OF DEPOSIT Further deposits are identified on an a~ innql sheet
Name of dcp~sit;lly institution
AMERIC~N TYPE C~LTU~ Ct T~T~ TIoN
Address of d~po:.ild- ~ institution (including postal code and counJry)
12301 Parklawn Drive
R~ckville, Maryland 20852
United States of America
Date of depositAccession Number
No~vember 11, 1994ATCC 75947
C. ADDITIONAL INDICATIONS (l~ave blank if not app&cablc) This information is r, nn-inued on an 3~ iti nnql sheet O
D~ Plasmid, 374~801
D. DESiC.NATED STATES FOR WHIC~ INDICATIONS ARE MADE (if tfie i ' - are~ notfot all dcsignated S~ates)
E. SEPARATEF~NISHINGOFINDICATIONS (leavcblankifnot nrr!; ",
Thein~tir~qti,nnclistedbelcwwillbesubmittedtotheInternationalBureaulater(speci~ egcn~ta/natureofthei~ n~i c.g.,"Acccssion
Numb~r of Dcposit~)
For receivinn Office use only For Intcrnational Bureau use only
O lllis sheet was received with the international application O l~is shcct was received by the International Bureau on:
Authori;~cd officcr/~ulhoriacd olIicer
form l'C~'/KO,~l 3 t (I uh, 199~) --56.1--
CA 02222280 1997-11-25
W 0516~9S22 PCT~US96/09572
INDICATIONS RELATING TO A DEI'OSITED MICROORGANISM
(PCI' Rule 13bts)
A. The indications made below relate to the microorganism referred to in lhe description
on page 5 , line 22
1~. IDENTIEICATION OF DEPOSIT Furlher deposits are identified on an aAA~ n~l sbeet O
Name of depositary hl .liluliu"
AMER~C~N TYPE CULTU~ Ct~T ,T F~CI IC~
Address of del~osild,~ ~ _lil..(;.... (includ;ng postal codcand country)
12301 Parklawn Drive
Rockville, Maryland 20852
United States of Arnerica
Date of àeposit Acoession Number
Nove~r~ber 11, 1994 ATCC 75948
C. ADDITIONAL INDICATIONS (/eave blank if not applicablc) This inforrnation is ~r ~; ~ed on an aA~A ~ n~l sheet
~NA l?lasmid, 374~797
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indicafions arenotforall lcsignafed Sfafes)
E. SEPARATEFURNISHINGOFINDICATIONS (/eaveblankifnot nrr~
TheindicationslistedbelowwillbesubmittedtotheInternalionalBureaulater (specifythegeneralnatureoftheindicationsGg., ~Accession
Number of Depositn)
For receivin~ OfGce use oniy For International Bureau use only
This shect was received with the internalional application C~ This sheet was received by the International Bureau on:
Aulhorizcd oh lcer ~.ulhorized of Gcer
Form PCI'/RO/13~ (July 1992) --56.2--
