Note: Descriptions are shown in the official language in which they were submitted.
CA 02222~62 1997-11-27
WO 96/41013 PCTAJ~9G~ 8
DESCRIPTION
Method For Screeninq For Receptor
Aqonists And Antaqonists
Related Applications
This application is a continuation-in-part of
McDonnell and Tzukerman, entitled "Method For Screening
For Receptor Agonists", filed April 6, 1994, U.S. Serial
No. 08/223,943, which is a continuation-in-part of
McDonnell and Tzukerman, entitled "Method For Screening
For Receptor Agonists", filed January 10, 1994, U.S.
Serial No. 08/179,750, which is a continuation-in-part
of McDonnell and Tzukerman, entitled "Method For
Screening For Receptor Agonists", filed April 4, 1993,
U.S. Serial No. 08/045,807, incorporated by reference
herein, including the drawings attached thereto.
Field of the Invention
This invention relates to methods and constructs
useful for identifying agonists and antagonists active
at intracellular receptors.
Backqround of the Invention
Steroid hormones, such as estrogen, progesterone,
androgens, glucocorticoids, and mineralocorticoids
travel via the blood stream to their target cells, enter
these cells, and then bind to steroid hormone receptors.
The steroid hormone receptors exist in inactive
apoprotein forms either in the cytoplasm or nucleus.
_ Upon binding their respective hormonal ligands, the
receptors become activated. The activated receptor can
bind effectively to a hormone response element (HRE) on
a chromosome and activate transcription of a cis-linked
gene.
The steroid hormone receptor superfamily includes
receptors ~or the steroids, e.g., estrogen,
CA 02222~62 1997-11-27
WO96/41013 PCT~S96/09638
progesterone, glucocorticoid, mineralocorticoid and
androgen. It also includes receptors for thyroid
hormone, vitamin D, retinoic acid and a 9- cis retinoid
acid and ecdysone. Furthermore, it includes a large
number of proteins having sequence homologous to the
steroid hormone receptors, but whose ligands are
unknown, e.g., peroxisome proliferator activated
receptor. These proteins have been termed ''orphan
receptors".
A typical steroid hormone receptor can be divided
into six domains, A, B, C, D, E and F as indicated in
Figure ll. The function of each domain is 1ndicated by
solid lines. The N-terminal A/B domain contains a
transactivation function. The C region is -esponsible
for DNA binding and receptor dimerization. The D region
is a hinge region which allows the protein l_o bend or
alter conformation. The E region is important for
dimerization, transactivation, intramolecular repression
and ligand binding. DNA sequences responsive to steroid
hormones have been termed hormone response elements
(HRES). I
Evans et al., U.S. Patent 5,071,773, incorporated by
reference herein, describes an assay by which hormone
receptors, ligands for such receptors, and proteins
having transcription activating properties of a hormone
receptor, can be detected. Generally, the assay
involves using a cell containing both a DNA encoding a
receptor protein, and a DNA encoding a hormone
responsive element (e.q., a promoter) linked to an
operative reporter gene. When a suitable hormone or
ligand is provided to the cell, a receptor-hormone is
formed and delivered to an appropriate DNA-binding
region to thereby activate the hormone responsive
element and cause expression of the reporter gene. The
expression product of the reporter gene is detected by
st~n~d procedures known to one skilled in the art.
CA 02222~62 1997-11-27
W O 96/41013 PCTAJS96/0~8
Web~ter et al., Cell 54:199 (1988), used chimeric
receptors to localize regions responsible for
transcription activation function. The authors propose
that a hormone is responsible for allowing a receptor to
recognize a DNA response element, and that the hormone
induces a transcription activation function in the
hormone-binding domain.
Summary of the Invention
The present invention features a method for
identifying agonists and antagonists of an intracellular
receptor. These agonists and antagonists modulate the
transcription activity of a promoter through a TAF
region of the receptor in a cell. The present invention
also features a method for using these agents to treat
diseases and pathological conditions affected by an
intracellular receptor, such as, but not limited to,
breast cancer, endometrial cancer, fibroids, and
endometriosis. This invention makes it possible to
screen large collections of natural, semisynthetic, or
synthetic compounds for therapeutic agents that affect
the transcription activation activity of an
intracellular receptor.
This invention provides an assay to screen for an
agonist or antagonist of an intracellular receptor which
interacts with one of the TAF regions of the receptor.
Not only can an agonist or antagonist be specifically
identified, but the type of agonist or antagonist can be
determined in such an assay. The agonists and
antagonists so identified may be used to selectively
modulate a promoter in a cell.
In order to detect agonists and antagonists which
act through a particular TAF region of a chosen
intracellular receptor, Applicant inactivates the
transcription activation function of other TAF regions
in the receptor. Considering that the activity of a TAF
region is dependent on having the functional context of
CA 02222~62 1997-11-27
W O96/41013 ~ PCTrUS96/09638
other TAF regions available, this invention describes
introducing mutations to receptor constructs to
inactivate the transcription activation act-vity of
these other TAF regions, while retaining the functional
context of these TAF regions. Such modifiec receptors
can be used to identify promoter and cell-type specific
requirements for the transcriptional activation activity
of a particular TAF region. This invention allows the
determination o~ such promoter-type and cell-type
specific differences in transcription activation
activity.
This invention also relates to selectinc a cellular
context in which the rem~;n'ng TAF region is able to
activated transcription from a promoter. Furthermore,
this invention relates to selecting a promoter context
which is responsive to the transactivation by the
r~m~;n;ng TAF region. Therefore, by properly preparing
a receptor construct and selecting a cellular context
and promoter context, the claimed assay alllws the
r~m~;n;ng TAF region to exhibit its transcription
activation activity on a promoter in a cell.~
Without being bound by any theory, Applicant
proposes that such promoter-type and cell-type speci~ic
transcription activity of a TAF region may be explained
by a model in which one TAF region acts as a dominant
transcriptional activator, and a second TAF region as a
transcriptional facilitator (see Fig. 7). The second
TAF region prepares the transcription apparatus for the
action of the first TAF region. Such preparation may be
recruitment of basic transcription ~actors, alteration
of chromatin structure, or causing removal of a
transcriptional repressor. Alternatively, the second
TAF region may prepare a transcription apparatus for
other transcriptional activators, and alone have little
inherent transcription activation activity. In such a
model, the ~irst TAF region is unable to access the
transcription apparatus until the second TAF~ region has
CA 02222~62 1997-11-27
W O 96/41013 PCT~US96/09638
acted appropriately to prepare it for the action of the
first TAF region.
Applicant proposes that cell specificity for a
particular TAF activity may reflect the presence or
absence of a function in a cell that mimics the presence
of a helper TAF region, respectively. Such a mimetic in
a cell will allow a receptor construct having a mutated
and inactive helper TAF region to be active because the
inactive portion of the receptor is complemented by the
active functionality present in the cell.
A similar model may exist for promoter specificity,
i.e., only selected promoters will be activated by a
particular TAF in a cell, depending on the
functionalities present in those promoters. In this
model, the difference in agonist activity of various
agents is dependent on the effect of that agonist on the
TAF1 region or TAF2 region, and interaction of the
resulting TAF1 or TAF2 region with a selected promoter
or general transcription apparatus.
Thus, in a first aspect, the invention features a
method for identifying an agonist or antagonist of an
intracellular receptor. The method includes providing a
cell containing a nucleic acid encoding an intracellular
receptor having a first TAF region and a second TAF
region. The first TAF regions is able to activate
transcription from a selected promoter, and the second
TAF region is mutated so that, while it provides the
functional context of that region, it is not able to
activate transcription from the promoter.
The cell also includes a reporter construct which
has a promoter region which is activated to cause
transcription of a reporter gene in the presence of a
receptor having an active TAF region corresponding to
that which is not mutated above. The promoter is not
activated by the presence of a receptor containing only
the TAF region corresponding to that mutated above. The
CA 02222~62 1997-11-27
WO 96/41013 PCT~US96/09638
receptor construct and reporter construct may be
inserted in two vectors or a single vector.
The cell is so chosen that no, or m; n; m~l,
transcription of the promoter occurs in the,presence of
a receptor having only an unmutated second TAF region
corresponding to that mutated above (and not the other
TAF region). The cell is also chosen such that
transcription o~ the promoter occurs in the~presence of
a receptor having the above nonmutated ~irs_ TAF region
alone.
For example, in a receptor construct having an
operative TAF1 region and a mutated, inoperative TAF2
region, transcription of the promoter will not occur
(i.e., no signi~icant level of transcription is
detectable, usually less than 5-10~ of normal levels) in
the presence o~ a receptor having an operative TAF2
region only, but will occur in the presenceiof a
receptor having an operative TAF1 region only.
The method further includes the step oflcontacting
the cell with a potential agent under conditions in
which contact of the cell with a normal agonist (e.q.,
estrogen for an estrogen receptor) or antagonist will
either increase or decrease the transcription of the
reporter gene from the promoter, respectively. The
method may involve transcribing the reporter construct
at a basal (low or minimal) level in the cell before the
agonist or antagonist is applied. Alternatively, the
method may involve applying the agonist or antagonist
first, and then transcribing the reporter construct.
Finally, the method involves the step o- measuring
the level o~ increase or decrease o~ the reporter gene
product, as an indication of the agonist or antagonist
activity of said agent, respectively.
By "intracellular receptor" is meant an
transcription polypeptide in the cytoplasm or nucleus of
a cell whose transcription regulation activity is
regulated by binding of small molecules such as steroid
CA 02222~62 1997-11-27
W O 96/41013 PCT~US96/09638
hormones, including, but not limited to, estrogen
receptor (ER), retinoid acid receptors (RAR), retinoid X
receptors (RXR), glucocorticoid receptors (GR),
progesterone receptors (PR), androgen receptors (AR),
mineralocorticoid receptor (MR), thyroid hormone
receptors (TR), peroxisome proliferator activated
receptor (PPAR), and vitamin D receptors. An
intracellular receptor may be mutated by site-directed
mutagenesis, deletion, substitution, and other genetic
methods known to those skilled in the art. The
intracellular receptor may either be endogenous to the
cell or transfected into the cell.
By "transcription polypeptide" is meant a
cytoplasmic or nuclear protein that, when activated,
binds a promoter, enhancer or silencer either directly,
or indirectly through a complex of proteins to modulate
the transcription activity of the promoter.
By "TAF" is meant a transactivation function domain
located in an intracellular receptor having the ability
to interact with a transcription target and activate the
transcription from a promoter. In the art, a TAF region
sometimes is referred to as an AF region. The A/B
domain and E domain of a typical steroid hormone
receptor contain TAF regions. Other TAF regions may be
identified by deletions, site-directed mutagenesis and
other methods known to those skilled in the art.
By "agonist" is meant a compound or composition
which when combined with an intracellular receptor
stimulates or increases a reaction typical for the
receptor, e.g., transcription activation activity.
By "antagonist" is meant a compound or composition
which when combined with an intracellular receptor
interferes or decreases a reaction typical for the
receptor, e.g., transcription activation activity.
By "promoter" is meant a DNA regulatory region
pro~;m~l to the RNA start site in the 5' or upstream
direction capable of binding directly or indirectly to
CA 02222~62 1997-11-27
W O 96/41013 PCTAUS96/09638
RNA polymerase and associated transcription ~actors in a
cell and initiating transcription of a downstream (3'
direction) coding sequence. A promoter o~ a DNA
construct, including an oligonucleotide sequence
according to the present invention, may be linked to a
heterologous gene where the presence of the~promoter
influences transcription from the heterologous gene,
including genes encoding reporter molecules such as
human growth hormone, luci~erase, chloramphenicol acetyl
trans~erase, ~-galactosidase, secreted placental
alkaline phosphatase and other secreted enzyme
reporters.
By "reporter gene" is meant a nucleotide sequence
encoding a polypeptide whose presence or activity is
readily detectable, including, but not limited to,
luci~erase, chloramphenicol acetyl transfer?se (CAT), ~-
galactosidase, secreted placental alkaline phosphatase,
human growth hormone, and other secreted enzyme
reporters. Generally reporter genes encode a
polypeptide not otherwise produced by the host cell
which is detectable by in si tu analysis o~ the cell
culture, e.g., by the direct ~luorometric, radioisotopic
or spectrophotometric analysis o~ the cell culture
without the need to remove the cells ~or signal analysis
from the culture chamber in which they are contained.
Preferably the gene encodes an enzyme which produces
colorimetric or ~luorometric changes in the host cell
which is detectable by in si tu analysis and which is a
quantitative or semi-quantitative ~unction o~
transcriptional activation. Exemplary enzy~es include
esterases, phosphatases, proteases (tissue plasminogen
activator or urokinase) and other enzymes wkose ~unction
can be detected by appropriate chromogenic or
~luorogenic substrates known to those skilled in the
art.
By "functional context" is meant only a ~ew amino
acids (i.e., up to 10), or pre~erably only I-3 amino
CA 02222~62 1997-11-27
W O96/41013 PCTAUS96/09638
acids are altered in one region so that the interaction
o~ a hormone or transcription ~actor with the region is
altered to a minimum extent (pre~erably, the interaction
is unaltered). Such interaction will allow ~ull
expression o~ the activity of the unaltered or non-
mutated region. Thus the functional context of one TAF
region contains the ~unctional activities o~ the other
TAF region with respect to agonist binding,
dimerization, and heat shock protein interaction, but
not with respect to the ability to activate
transcription.
In another word, ~unctional context is meant the
part of a TAF region that contains the functional
activities o~ another TAF region with respect to agonist
binding, dimerization, and heat shock protein
interaction, but not with respect to the ability to
activate transcription. The ~unctional context of a TAF
region can be preserved while the transcription
activation activity o~ the TAF region is destroyed. For
example, receptor dimerization or the interaction o~ a
hormone or transcription factor with the TAF region is
altered to a minimum extent, or pre~erably unaltered,
when certain mutations are made in the TAF region (e.g.,
a ~ew amino acids (i.e., up to 10), or pre~erably only
1-3 amino acids are mutated in the TAF region). Such
interaction allows the ~ull~illment of transcription
activation activity o~ another unaltered or non-mutated
TAF region.
In this invention, a cell is provided with a
speci~ic receptor construct having a selected TAF
activity, and having a suitable promoter, which responds
to the TAF activity, linked to an operative reporter
gene. The promoter is selected in conjunction with a
speci~ic cell so that activity o~ an agonist or
antagonist is observed only under selected conditions.
Thus, in one example, the receptor may have an active
~irst TAF region, and a mutated (inactive) second TAF
CA 02222~62 1997-11-27
W O 96/41013 I PCT~US96/09638
region which provides the functional conte7t for the
first TAF region, and the cell is chosen such that it
has a component which mimlcs or replaces tke second TAF
region function of the receptor at the chosen promoter.
The promoter in turn provides an appropriate binding
context to allow the component to manifest¦the desired
TAF functions. In this way, an agonist or antagonist
which acts at the first TAF region can be readily
identified by its ability to increase or dqcrease
expression of the reporter gene, despite the lack of an
active second TAF region on the receptor. I
In preferred embodiments, the agent isla human
hormone agonist or antagonist, and a nuclear receptor,
e.q., a human hormone receptor is encoded by the nucleic
acid within the cell.
In another preferred embodiment, the receptor has a
mutated TAF2 region, and the cell and promcter are
chosen to exhibit no, or minimal, response to the
presence of TAF2 alone.
In a further preferred embodiment, suck a cell is a
liver cell (specifically, a HepG2 cell) in which a
receptor with an operative TAF2 region has no activity.
That is, there is no inherent transcriptional activity
with a receptor having just TAF2 and no TAF1 region
present in the cell, but there is transcriptional
activity with a receptor only having an operative TAF1
region available. Most preferably, the promoter (e.g.,
a C3 promoter) is chosen such that it does not require a
receptor with a TAF2 function to be provided within the
chosen cell, so that any agonist (e.g., an!ER agonist)
which acts in conjunction with a functionai TAF1 in the
receptor construct is able to show its agorist activity.
In yet another preferred embodiment, tke candidate
agent is selected from the group consistinc of
glucocorticoids and other agonists and antagonists of
GR, nonsteroid glucocorticoids; estrogens and other
agonists and antagonists of ER, nonsteroid estrogens;
CA 02222~62 1997-11-27
WO 96/41013 PCTAJS96/09638
androgens and other agonists and antagonists of AR,
nonsteroid androgens; progestins and other agonists and
antagonists of PR; non-steroid progestins;
mineralocorticoids and other agonists and antagonists of
MR, nonsteroid mineralocorticoids.
Candidate compounds include but are not limited to
those disclosed and re~erred to in Table 2. Peptide or
small molecule combinatorial libraries can be used to
screen for agonists and antagonists (Bunin, B.A.N.
Ellman, J. A., J. An. Chem. Soc. 114:10997-10998 (1992)
and references contained therein).
By "comprising" is meant including, but not limited
to, whatever follows the word "comprising". Thus, use
of the term "comprising" indicates that the listed
elements are required or mandatory, but that other ele-
ments are optional and may or may not be present. By
"consisting of" is meant including, and limited to,
whatever follows the phrase "consisting of". Thus, the
phrase "consisting of" indicates that the listed
elements are required or mandatory, and that no other
elements may be present. By "consisting essentially of"
is meant including any elements listed after the phrase,
and limited to other elements that do not interfere with
or contribute to the activity or action specified in the
disclosure for the listed elements. Thus, the phrase
"consisting essentially of" indicates that the listed
elements are required or mandatory, but that other ele-
ments are optional and may or may not be present
depending upon whether or not they affect the activity
or action of the listed elements.
In another aspect, the invention features a method
for identifying a receptor agonist by providing a cell
containing both a nonmutated intracellular receptor
having functional TAFl and TAF2 regions and a reporter
construct having a promoter.
The cell is chosen to lack a mimicking TAFl or TAF2
activity (i.e., a receptor having either an active TAFl
CA 02222~62 1997-ll-27
W O 96/41013 PCTAJS96~5'~8
12
or TAF2 region alone does not cause activation of
transcription in the cell). The promoter is chosen so
that activation is achieved in this cell from this
promoter in the presence of an agonist for _he receptor
which acts only through one of the TAF regions but not
both.
In a preferred embodiment, a liver cell'(e.q.,
HepG2) and a complex C3 promoter together p~ovide a
useful assay for agonists (e.g., an ER agonist) active
at a TAF1 region only. The liver cell and C3 promoter
have a TAF2 activity, but the promoter is not activated
in the presence of a receptor having an active TAF2
region alone. However, the promoter is active in the
presence of an active TAF1 region. Thus, agonists
active at the receptor TAF1 region can be identified as
those which increase expression of the reporter gene.
In another preferred embodiment, the TAF2 region is
mutated.
This cell provides a useful screening test to
determine the type of agonist tested. The level of
transcription observed is related to the agonist type as
exemplified below. The above two methods (with mutated
and nonmutated receptor constructs) may be used in
combination to detect, grade or type agonis_s at a
selected receptor.
Unlike prior methods in which laborious procedures
were involved to detect useful agonists, the methods
described herein allow rapid screening of potential
agonists and antagonists of intracellular receptors,
including, but not limited to, estrogen, progesterone,
glucocorticoid, androgen and mineralocorticoid
receptors. The assay may be conducted not only in the
human derived cells, but also in other eucaryotic cell
lines, such as chicken and yeast cell lines.
The agonists and antagonists identi~ied-by this
invention have advantages in treating diseases. For
example, an estrogen agonist can be identified which is
CA 02222~62 1997-11-27
W O 96/41013 PCTAUS~'0~8
useful for treatment of osteoporosis. In osteoporosis,
it appears as though TAF1 activity alone is sufficient
for prevention of bone loss. Thus, agonists having
activity only at the TAF1 region and not at the TAF2
region of the receptor are useful for disease treatment
with no or fewer side effects.
In another aspect, the invention features a method
for treating or preventing an estrogen related disease
or condition. By "estrogen related disease or
condition" is meant a disease or condition that is
caused or associated with an elevated or depressed level
of the hormone estrogen, including, but not limited to,
osteoporosis, breast cancer, uterine cancer,
endometriosis, vasomotor abnormalities, hot flashes,
depression, other psychiatric abnormalities and uterine
fibroids. In some diseases the patient may be unable to
produce estrogen in an amount required by the body. In
other diseases, estrogen may be overproduced. By
"hormone~ is meant a naturally occurring biochemical
that will function as a receptor agonist. Synthetic
hormones are more properly referred to as agonists.
The method involves administering a chemical
compound other than keoxifene, but having a keoxifene-
like transcriptional profile to a patient (or causing 1n
vivo production of a compound other than keoxifene, but
having a keoxifene-like transcriptional profile).
The treatment may have the effect of preventing new
tumors from developing and/or of shrinking the size of
existing tumors. The method includes varieties o~
hormone replacement therapy. In this method, the
patient is preferably first identified as suffering from
such a disease or condition by standard techniques, and
then treated as described below.
By "keoxifene-like transcriptional profile" is meant
the activity of a compound in producing a normalized
response similar to that produced by keoxifene, i.e., a
relatively low TAF1 response at low concentrations of
CA 02222~62 1997-11-27
W O 96/41013 PCTAUS96/09638
14
the compound but relatively high response a~t higher
concentrations o~ the compound. In additioh, little or
no TAF2 response should be present at all
concentrations. Furthermore, it should have a greater
(about twice or more) TAFl response than with a wild
type receptor at higher concentrations (about 10-7 M),
see Fig. 8E compared to Figs. 8A-D). The ~m; n; stration
o~ compounds with keoxi~ene-like transcriptional
pro~iles is expected to exhibit bone protecting activity
and uterine/breast sparing activity.
By "bone protecting activity" is meant =he ability
to prevent bone resorption which can be measured by
standard techniques. Bone resorption is typically
associated with a loss o~ estrogen. Bone resorption is
typically associated with osteoporosis and is manifest
by bone dissolution due to a loss o~ calcium.
By "uterine/breast sparing activity" is meant the
prevention or reduction of the proli~eration o~ tumorous
cancer cells which can be measured by standard
techniques.
Dihydronaphthalenes, benzothiophenes and other
compounds described and suggested in Jones, U.S. Patent
No. 4,418,068, issued November 29, 1983 (incorporated
herein by re~erence), may be screened for keoxi~ene-like
transcriptional pro~ile. Other compounds that can be
screened include compounds with a similar chemical
structure to keoxi~ene or keoxifene-like an$10gs. Some
o~ these compounds could be produced by making
substitutions of 1-10 carbon long alkyl, alkenyl or
similar-type ~h~;n~ in the nitrogen-contain-ng ring o~
keoxi~ene. Other alterations could include altering the
length or saturation characteristic o~ the alkyl chain
(e.g., ~rom 0-10 carbon atoms) that links the nitrogen-
containing ring to the rest of the keoxi~ene compound.
Other compounds that can be screened ~or a keoxi~ene-
like pro~ile include compounds with a chemical structure
similar to tamoxi~ine or tamoxi~ine analogs. Those
CA 02222~62 1997-11-27
W O 96/41013 PCTAUS96/09638
skilled in the art will readily recognize other
modifications and substitutions that can be made to
compounds that can be screened for a keoxifene-like
profile.
While steroids and steroid analogues may exemplify
agents identified by the present invention, Applicant is
particularly interested in the identification of agents
of low molecular weight (less than 10,000 daltons,
preferably less than 5,000, and most preferably less
than 1,000) which can be readily formulated as useful
therapeutic agents.
Such agents can then be screened to ensure that they
are specific to tissues with pathological conditions
related to an intracellular receptor with little or no
effect on healthy tissues such that the agents can be
used in a therapeutic or prophylactic manner. If such
agents have some effect on healthy tissues they may
still be useful in therapeutic treatment, particularly
in those diseases which are life threatening.
Once isolated, a candidate agent can be put in
pharmaceutically acceptable formulations, such as those
described in Reminqton's Pharmaceutical Sciences, 18th
ed., Mack Publishing Co., Easton, PA (1990),
incorporated by reference herein, and used for specific
treatment of diseases and pathological conditions with
little or no effect on healthy tissues.
Other features and advantages of the invention will
be apparent from the following description of the
preferred embodiments thereof, and from the claims.
Brief Description of the Drawinas
Fig. 1 shows schematic diagrams of BR-wt, ER-TAF1,
ER-TAF2 (i.e., ER179C) and ER-Null mutants (Fig. lA) and
graphs indicating their transcription activation
activities (Fig. lB, C and D).
CV1, HepG2 and HS578T cells were transiently co-
transfected with increasing concentrations of the
CA 02222~62 1997-11-27
W O96/41013 PCTrUS96/09638
16
di~erent receptor expression vectors as in~icated,
together with 9.5 ~g/ml o~ ERE-tk-LUC repor_er plasmid,
and 5 ~g/ml o~ pRSV-~-gal expression vector as an
internal control for trans~ection e~iciency. Carrier
DNA (pGEM4) was added to adjust the total amount o~ DNA
to 20 ~g/ml (see below).
Cultures were treated with or-without 10-7M
17-,~-estradiol (E2) as indicated for 36 hours and assayed
~or ~-galactosidase and luci~erase activity. LUC
activity is normalized ~or ~-gal activity. 'The relative
luciferase activity is calculated by dividing the
normalized luci~erase value at a given point by that
obtained in the absence o~ a trans~ected receptor or
ligand. A single experiment representative o~ four
independent experiments is detailed above. Data shown
indicate the mean + SE(m) o~ triplicate estimations.
Fig. 2 shows schematic diagrams o~ ER-w~, ERN282G
and ER-TAF2 (i.e., ER179C) mutants (Fig. 2A? and graphs
indicating their transcription activation açtivities
(Fig. 2B, C and D).
CV1, HepG2 and HS578T cells were transiently co-
trans~ected with increasing concentrations o~ di~erent
receptor expression vectors as indicated, and assays
were conducted as described in Fig. 1.
Fig. 3 shows diagrams indicating transc~iption
activities o~ TAF1 and TAF2 on the human C3 gene
promoter in dif~erent cells.
In Fig. 3A, 3B and 3C, CV1, HepG2 and HS578T cells
were transiently co-trans~ected with 0.5 ~g o~ the
indicated receptor expression vector, 9.5 ~g o~ C3-LUC
reporter plasmid, 5 ~g pRSV-~-gal and carrier DNA to a
total amount of 20 ~g DNA. In addition, a minus
receptor control was included.
Cultures were treated with or without 1 0 -7 M
17-~-estradiol (E2) ~or 36 hours, and assayed for
luci~erase activity. The data shown are representative
curves o~ experiments that have been repeated 6 times
CA 02222~62 1997-11-27
W O 96/41013 PCTAUS961~5~8
with similar results. The curves represent averages of
quadruplicate data points averaged and normalized for
transfection efficiency by simultaneous estimation of
pRSV-~-gal transcriptional activity.
Fig. 4 shows graphs indicating transcription
activities of ER-TAF1 and ER-TAF2(i.e., ER179C) on
different promoter constructs.
In Fig. 4A and 4B, CV1 and HepG2 cells were
transiently co-transfected with 0.5 ~g of the indicated
receptor expression vector, 9.5 ~g of pA2-LUC reporter
plasmid, 5 ~g pRSV-~-gal and carrier DNA to a total
amount of 20 ~g. In Fig. 4C and D, CV1 and HepG2 cells
were co-transfected as described above, using the
pEREMLT-LUC reporter.
Cultures were treated with or without 10-7 M
~-estradiol (E2) for 36 hours and assayed for luciferase
activity. Data presentation is described in Fig. 1.
Fig. 5 shows graphs indicating activation of ER-TAF1
and ER-TAF2 (i.e., ER179C) by triphenylethylene-derived
estrogen partial agonists. ER represents ER-wt, ERm
represents ER-TAF1, TAF2 represents ER-TAF2 (i.e., ER-
179C,) and TAF2m represents ER-Null.
HepG2 cells were co-trans~ected with 0.5 ~g of the
indicated receptor expression vectors, 9.5 ~g of C3-LUC
reporter, S ~g of pRSV-~-gal and carrier DNA to a total
amount o~ 20 ~g.
Cultures were treated with 10-7M of 17-~-estradiol
(i.e., E2, Fig. 5A), Tamoxifen (Fig. 5B), 4-hydroxy-
Tamoxifen (Fig. 5C), Nafoxidine (Fig. 5D) or Clomiphene
(Fig. 5E) for 36 hours and assayed for luciferase
activity. Data presentation is described in Fig. 1.
Fig. 6 shows diagrams indicating displacement of
estradiol binding to ER-wt and ER-TAF1 proteins by
estrogen agonists.
Yeast cytosols prepared from cell expressing ER-wt
or ER-TAF1 were incubated overnight at 4~C with 5 nM of
3H-17-~-estradiol alone or in the presence of the
CA 02222~62 1997-11-27
WO 96/41013 PCT~US96/09638
18
indicated concentrations of the di~ferent e-strogen
agonists. Ligand binding was determined by
scintillation counting following separation;of bound and
free ligand using hydroxylapatite.
Fig. 7 is a schematic model showing TAFi and TAF2 as
~unctionally dependent activators of transcription.
This schematic outlines a hypothesis fo~ the
promoter and cell specificity of the individual
transactivators of the estrogen receptor. Interaction
of the receptor with ligand initiates a cascade of
events which exposes the receptor DNA binding region
(DBD) and promotes association of ER with D~A. Only
"estrogenic compounds" are capable of functionally
activating TAF2 region o~ the receptor. Upon activation
(B), the TAF2 region of the receptor interacts with a
transcriptional repressor (I), displacing it or altering
its structure (C) to permit the TAF1 activation sequence
access to the general transcription apparatus (GTA). In
certain cells and on certain promoters, TAF2 function of
the receptor can be supplied by other transcription
factors, allowing TAF1 region of the receptor to
function independently of TAF2. Therefore,'binding of
the receptor to DNA is synonymous with transactivation
and can be accomplished by both estrogen agonists, as
well as antagonists that permit delivery of the receptor
to DNA. In this model, the partial agonist activity of
the triphenylethylene-derived estrogen agon1sts depends
on the conformation induced by the ligand and the effect
that this conformation has on the presentat-on of TAF1
to the transcription apparatus.
Fig. 8 shows diagrams indicating that the partial
agonist activities of the triphenylethylene derived
antiestrogens depends on TAF1 function.
HepG2 cells were cotransfected with 0.5 ~g of the
indicated receptor expression vectors, 9.5 ~g of C3-LUC
reporter, 5 ~g of pRSV-~-gal and pGem4 as carrier DNA to
a total amount of 20 ~g.
CA 02222~62 1997-11-27
W O 96/41013 PCTrUS96/09f~8
19
Cultures were treated with various concentrations of
17-~-estradiol (Fig. 8A), Clomiphene (Fig. 8B),
Nafoxidine (Fig. 8C), 4-OH-Tamoxifen (Fig. 8D) and
keoxifene (Fig. 8E) for 36 hours and assayed for
luciferase activity. The data for panel E was obtained
relative to a different estradiol control than the other
panels. Thus, the peak in panel E appears approximately
five times higher than it would if the data had been
obtained relative to the same estradiol control that was
used in panel A. The relative luciferase activity was
calculated as described for Fig. 1. A single experiment
representative of 6 independent experiments is detailed.
The data shown indicate the mean + SE(m) of triplicate
estimations.
Fig. 9 is a diagram showing the effect of keoxifene
(keox) on MCF-7 cell proliferation. The activity of
estrogen in this assay is maximum at 10-l~ M, and induces
MCF-7 cell proliferation to 1500~ of the control.
Fig. 10 is a diagram showing the structure of pC3-
LUC plasmid.
Fig. 11 is a diagram showing functional domains ofintracellular receptors.
Fig. 12 shows diagrams indicating schematic
structure organization of PRB, PR-TAFl (i.e.,
PRB(Eg07A,E9llA)), PR-TAF2 (i.e., PRA) and PR-Null (i.e.,
PRAlE907A,E9llA) ) -
Fig. 13 shows diagrams indicating activity of PR-
TAF1 on MMTV promoter.
Plasmid phPRB or phPRB(Eg07A E9llA) was transfected into
MCF-10 cells (A) or CV-1 cells (B) together with an
MMTV-LUC reporter plasmid (10 ~g/ml) and pCH110 (5
~g/ml) as an internal control. The amount of expression
vector was chosen to permit maximal transcriptional
activation in each cell line e~mi ned. The transfected
cells were incubated for 40 h with increasing
concentrations of progesterone as indicated, and assayed
CA 02222~62 1997-11-27
WO 96/41013 PCT/U',G~56~8
for luciferase and ~-galactoside activities~ The data
are presented as normalized luciferase (LUC~ units.
Normalization was calculated by dividing the raw
luciferase activity (relative light units x~ 104) for each
point by the ~-galactosidase activity (A415 x 105)/time
in minutes) at that point. The data shown represent the
mean values +/- the standard errors of the means of 12
replicates.
Fig. 14 shows graphs indicating activity of PR-TAF2
on TAT promoter in HeLa cells.
HeLa cells were transiently co-transfected with
increasing concentrations of the hPR expression plasmid
phPRB or phPRA (A), or phPRA or phPRAtEg07A,EgllA) (i-e-, PR-
TAF1) (B) together with a TAT-LUC reporter plasmid (10
~g/ml) and pCH110 (5 ~g/ml) as an internal control. The
transfected cells were incubated with or without 10-7 M
progesterone as indicated for 40 h and assayed for
luciferase (LUC) units calculated as for Fig. 13.
Fig. 15 shows graphs indicating activity of PR-TAF2
on MMTV promoter in HepG2 cells.
HepG2 cells were transiently co-transfected with
increasing concentrations of the hPR expression plasmid
phPRB or phPRA (A), or phPRA or phPRA (E907A,E9llA) (i.e.,
PR-TAF1) (B) together with an MMTV-LUC reporter plasmid
(10 ~g/ml) and pCH110 (5 ~g/ml) as an internal control.
The transfected cells were incubated with or without 10-7
M progesterone as indicated for 40 h and as.sayed for
luciferase and ~-galactosidase activities. ~The data are
presented as normalized luciferase (LUC) units
calculated as for Fig. 13.
Fig. 16 (A-D) are diagrams showing saturation
analysis of the binding of [3H] progesterone to PRA and
PRB mutants.
Aliquots of in vi tro expressed receptor proteins
PRB-wt (A), PRB(Ego~A~Eg1lA) (B), PRA-wt (C) and PRA(Eg07A~Eg
(D) were incubated for 18 h at 4~C with increasing
concentrations of [3H] progesterone. Bound¦and free
CA 02222~62 1997-11-27
W O 96/41013 PCT/U5,G~'~3G38
ligand were separated using the dextran coated charcoal
method. Each point represents duplicate determinations.
Scatchard analysis o~ the saturation data are shown for
each receptor protein in the inserts.
Fig. 17 is a graph showing the agonist activity of
DHT on AR and the antagonist activity of 2-OH Fluramide
on AR.
Fig. 18 is a graph showing an AR-TAF1 specific assay
for screening AR-TAF1 agonists.
Figure 19 shows the structure organization of GR-wt,
GR-TAF1, GR-TAF2, GR-N-del and GR-Null.
Fig. 20 shows the organization structures of GR-Gal4
constructs.
Fig. 21 is a graph showing the effect of mutations
on TAF2 transactivation function.
Gal4 DNA binding domain fused to the ligand binding
domain of either wt GR (Gal-G) or mutant galG. The
number following Gal-G indicates the amino acid(s) that
was mutated to alanine. These constructs were
transfected into CV-1 cells. Dexamethasone was added to
the cell culture. Each mutation resulted in a drastic
reduction of the luciferase gene activation by
dexamethasone.
Fig. 22 is a graph showing activation profiles
obtained with different promoters.
Wild type and mutant GRs were co-transfected in CV1
cells with luciferase reporter genes driven by either
MMTV, C3 or TAT3 promoters. Gene activation is measured
after 24 hours of dexamethasone treatment.
Description of the Preferred Embodiments
The methods discussed briefly above are useful for
- identifying agonists or antagonists of various
intracellular receptors, including, but not limited to,
ER, GR, AR and PR.
ER, GR, AR and PR are members of the nuclear
receptor super-family, a class of transcription factors
CA 02222~62 1997-11-27
WO96/41013 , PCT/U',G/~638
22
whose ~unctions are regulated by steroids, vitamins or
thyroid hormone (Beato, Cell 56:335, 1989). This ~amily
of regulatory proteins share common mechani!stic ~eatures
in that they are transcriptionally inactive within the
cell until exposed to hormone. Occupancy by hormone
results in trans~ormation of=the receptor to an
activated state, thus allowing it to productively
interact with speci~ic DNA sequences in the regulatory
regions of target genes. The resultant positive or
negative effects o~ the bound receptor on specific gene
transcription are cell-type and promoter-context
dependent. Nonetheless, the relative ef~ect may be
measured in any particular cell/promoter construct.
Thus, the desired effect may be observed in a wide
variety of constructs.
The following are speci~ic examples of this
invention. These examples make use of the estrogen
receptor, androgen receptor, progesterone receptor and
glucocorticoid receptor, but are not limiting in the
invention. Those in the art will recognize that other
equivalent receptors, cells and promoters c m be readily
used in equivalent procedures within the scope of the
claims.
I. Estroqen RecePtor
The cDNA for ER has been cloned and used to
reconstitute estrogen responsive transcription units in
heterologous m~mm~l ian cells (Kumar et al., EMBO J.
5:2231, 1986, and Green et al., 231 Science,1150, 1986).
This has enabled a detailed ~m; n~tion 0~ the
functional domains within the protein (Kumar et al.,
Cell 51:941, 1987). A functional ~m;n~tion of the
domains of ER in several systems has revealed the likely
structural ~eatures within the receptor which may
interface with critical cellular componentslto generate
a variety of hormone responsive endpoints (Danielian et
al., EMso J. 11:1025, 1992).
CA 02222~62 1997-11-27
W O 96/41013 PCT~US9G/~96~8
Two distinct transactivation domains have been
defined, a sequence at the amino terminus of the
receptor, termed TAF1, and a sequence confined to the
carboxyl 60 amino acids, termed TAF2 (Danielian et al.,
supra; Berry et al., EMBO J. 9:2811, 1990; and Tasset et
al., Cell 62:1177, 1990), all hereby incorporated by
reference herein. Recently, investigators involved in
intracellular receptor research have favored referring
to the TAF domains, as AF domains (e.g. Cavailles et
al., J. of Cellular Bio., 341, 1994) to avoid confusion
with the discovery and cloning of TATA-binding protein
associated factors (Dynlacht et al., 66 Cell, 563,
1991) .
Pierre Chambon and his group (Kumar et al., Cell
51:941, 1987) have used truncated estrogen-receptor-
encoding genes to study properties of the estrogen
receptor and its alleged cell-type and promoter-context
dependent activity. These truncated genes express ERs
lacking all or a portion of two domains termed TAF1 and
TAF2. These domains are thought to be regulated by
estrogen and then cause promoter activation.
Tora et al., Cell 59:477 (1989), analyzed truncated
mutants of human estrogen receptor, and described TAFl
and TAF2 as two transcriptional activation functions in
the receptor. These activators are said to exhibit
cell-type specificity and promoter-context dependency.
The authors indicate that TAF2 acts synergistically with
upstream elements.
Meyer et al., Cell 57:433 (1989), describe
inhibition of transcription stimulation by the
progesterone receptor by co-expression of the estrogen
receptor. The authors propose that the observations
reflect competition by the receptors for a limiting
transcription factor.
Berry et al., EMBO Journal 9:2811 (1990), describe
promoter-specific and cell-specific effects of an
agonist on estrogen-responsive genes. Truncated and
CA 02222~62 1997-11-27
i
WO96/4l013 PCT~S96/09638
chimeric estrogen receptors were used which contained
TAFl and/or TAF2 regions from the same or different
sources.
Tassett et al., Cell 62:177 (1990), deslcribe
interaction of TAFl and TAF2 regions, and c~ompetition
(squelching) for limiting factors, by comparing relative
activities of TAF regions and competitor constructs.
Fawell et al., Cell 60:953 (1990), describe
estrogen-receptor dimerization and its alteration by
mutations in the molecule.
Metzger et al., Nucleic Acids Research 20:2813
(1992), describe alleged promoter- and cell-specificity
of TAFl and TAF2 regions in the yeast Saccharomyces
cerevisiae. Truncated receptors, or recept~rs having
regions deleted from them, were used in the analyses.
Danielian et al., EMBO Journal 11:1025 ~(1992),
describe conserved regions in the estrogen receptor and
state that:
Activities of TAFl and TAF2 vary
depending upon the responsive promoter
and cell type and, in some cases, both
are re~uired for full transcriptional
stimulation.
The authors identify amino acids near the C-terminus of
the mouse estrogen and glucocorticoid recep=ors which
are said to be essential for hormone dependent
stimulation of transcription. Point mutations were
introduced either into the full-length receptor, or into
an internal deletion mutant which lacked the TAFl
region, to allow the authors to determine the effects of
mutations upon TAF2 activity in the absence or presence
of TAFl.
It appears that alterations in charged residues of
the amino terminal portion of the hormone binding domain
can result in increases or decreases in ER
transcriptional activity with no change in receptor
affinity of cognate hormone. Therefore, the regions
around residue 530 (Danielian et al., supral) and the
CA 02222~62 1997-11-27
W 096/41013 PCT/U~,6/'~ 8
. .
region around cystelne 381 (Pakdel et al., Mol
Endocrinol, 7:1408, 1993) may in themselves constitute
AF su~domains within TAF-2. It follows then, that
changes in such domains, such as the region around
cysteine 381, could result in mutant receptors which
could discriminate between estrogen and antiestrogen
ligands, paralleling the results obtained as detailed
herein. Furthermore the analogous situation could exist
for discreet residues in the TAF-1 region of ER.
The following experiments characterize the
dependence of ER-TAF1 and ER-TAF2 activities on cell-
context and promoter-context in m~mm~l ian cells, and the
role of agonist or antagonist in the manifestation of
these differences. Some of these experiments are
described in Tzukerman et al., Mol. Endocrin 8:21, 1994,
hereby incorporated by reference herein.
Receptor constructs
cDNA sequences encoding the ER-wt and a TAFl -
deleted receptor derivative were excised from the
plasmids YEpwtER and YEpER179C, respectively, using BfrI
and SacI. The DNA encoding the TAFl receptor derivative
was excised from the plasmid YePERN282G using BfrI and
K~nI. Construction of the vectors YEpwtER, YEpER179C
and YEpERN282G, have been described previously (Pham et
25 al., Mol. Endo. 6:1043, 1992). The excised DNA was
treated with T4 DNA polymerase (Boehringer Mannheim Co.)
and ligated into the unique EcoRV site within the
m~mm~l ian expression vector pRST7 (Berger et al., J.
Steroid Biochem. Mol. Biol. 41:733, 1992).
The wild type estrogen receptor cDNA (ER-wt) was
cloned into pGEM-llZf(+) (Promega, Wisconsin). Specific
mutations were introduced into the hormone binding
domain of the receptor by substituting alanine for amino
acids located at positions 538, 542, and 545, using site
directed mutagenesis (Kunkel et al., 154 Methods in
Enzvmoloqy 367, 1987), creating the plasmid pGERm. The
CA 02222~62 1997-11-27
WO96/41013 PCT~S96~09~8
26
mutated hormone binding domains were introduced into ER-
wt and ER179C by exchanging the BglII-SacIIC-terminal
~ragment o~ this vector with the analogous'mutated
~ragment from pGERm.
Reporter plasmids
The reporter ERE-tk-LUC contains a sinqle copy o~
the vitellogenin ERE upstream o~ the herpes simplex
thymidine kinase promoter sequences linked to luci~erase
(LUC).
The C3-LUC reporter contains 1.8 kb of the human C3
gene promoter (-1807 to +58) (Vik et al., Biochemistrv
30:1080, 1991). Unique restriction sites Xhol and BamH1
were introduced into the C3 promoter, the DNA was then
cloned into the cognate sites o~ the vector pl-LUC
(Berger et al., J. Steroid Biochem. Mol Biol. 41:733,
1992), where a polyclonal site has been inserted into
the MMTV-LUC vector (see Fig. 10). Those in the art can
readily construct equivalent vectors.
pA2-LUC contains a 835 bp ~ragment (-821 to +14) of
the Xenopus vitellogenin A2 gene promoter (Vik et al.,
Biochemistrv 30:1080, 1991).
pEREMLT-LUC contains a single ERE upstream the
adenovirus major late promoter sequences (-44 to +11)
(Hu and Manly, Proc. Natl. Acad. Sci. USA 78:820, 1981).
Cell cultures
CV1 and HS578T cells were routinely maintained in
Dulbecco's modi~ied Eagle's medium - DMEM (Biowittaker,
Maryland) supplemented with 10~ ~etal bovire serum (FBS)
(Hyclone Laboratories, Utah). HepG2 cells were
maintained in M;n;m~l Essential Medium Eagle's - MEM
(Biowittaker, Maryland) containing 10~ FCS.
Transient trans:Eection assay
Cells were seeded 24 hours prior to trans~ection in
~lat-bottom 96-well tissue culture platesj(5xlo3
CA 02222~62 1997-11-27
W O 96/41013 PCT/U',~1'05~38
cells/well), in phenol red-free DMEM containing 10~ FBS.
DNA was introduced into cells using calcium phosphate
precipitation. Plasmid DNA was diluted in 1 ml of 1 mM
Tris, pH 7.4, 0.1 mM EDTA, 0.25 M CaCl2. DNA solution
was added dropwise with vortexing into an equal volume
of 2X HBS pH 6.9 (280 mM NaCl, 50 mM HEPES, 1.5 mM
Na2HPO4) and precipitates were allowed to form for 20
minutes. Transfections (11 ~l of DNA mix/well) were
performed on a Biomek 1000 Automated Laboratory
Workstation (Beckman, California). Cells were
transfected for 6 hours and then washed with phosphate-
buffered saline (PBS) to remove the precipitate. Cells
were incubated for an additional 36 hours in phenol red-
free medium containing 10~ charcoal-treated FBS, with or
without hormones as indicated in the text. Cell
extracts were prepared as described by Berger et al., J.
Steroid Biochem. Mol. Biol. 41:733, 1992, and assayed
for luciferase and ~-galactosidase activities. All
determinations were performed in triplicate in at least
two independent experiments, and were normalized for
transfection efficiency by using expression of ~-
galactosidase as an internal control.
Preparation of Yeast receptor proteins
Expression vectors producing ER-TAF1 were
constructed by replacing the B~rl-Mlul fragment of
YEpE10 (Pham et al., 88 Proc. Natl. Acad. Sci. USA 3125,
1991) with the corresponding fragment of pRST7ER-TAF1.
This vector and a vector producing wild type receptor
(YEPE10) were transformed into the yeast strain BJ2168
as described by McDonnell et al., J. Steroid Biochem.
Molec. Biol. 39:291, 1991. Individual transformants
were picked and grown to an OD600=1. Cultures were then
induced with 100 ~M CuS04, and 2 mM chloroquine for 16
hours at 30~C. Cells were then pelleted and washed with
cold water. Cells were resuspended in 2-5X pellet
volume o~ 10 mM Tris, 0.4 M KCl, 2 mM EDTA, 0.5 mM PMSF,
.
CA 02222~62 1997-11-27
W O96/41013 ' PCTAJS96/09638
28
1 ~g/ml aprotinin, 2 mM DTT, pH 7.6, and lysed by
vortexing with 0.45-0.5 mm glass beads, intermittently
with cooling on ice, until at least 90~ o~ the cells
were observed to be open. Extracts were cehtrifuged at
13,000xg and the supernatants were recovereld. Protein
concentrations were determined by Bio-Rad Plotein Assay
(Bio-Rad, Richmond, CA).
~-Estradiol bindinq competition assay
This assay was performed on a Biomek 1000 automated
workstation (Beckman Instrument, Fullerton, CA). Ten-
fold serial dilutions of the compounds to be tested were
made in 10 mM Tris, 0.3 M KCl, 5 mM DTT, pH 7.6, and
transferred to polystyrene tubes containing' 100 ~1 at
final concentrations of 10-4 M to 10-1l M dillted
compounds, 5 mM 3H-~-estradiol (Amersham, UK), and 22 ~g
total protein derived from strains producing ER or ER-
TAFl. Following an overnight incubation at'4 C, 100 ~1
of a 6~ hydroxylapatite slurry in 10 mM Tris, 5 mM DTT,
pH 7.6 was added. The tubes were incubated for an
additional 30 minutes at 4~C, mixing after the first 15
minutes. Hydroxylapatite pellets were washed 4X with
1 ml 1~ Triton X-100 in 10 mM Tris, 5 mM DTT, pH 7.6.
Finally, the hydroxylapatite pellets were resuspended in
800 ~1 of Ecoscint A scintillation fluid (National
Diagnostics, Manville, NJ). Activity in each sample was
measured u~ing a LS6000IC scintillation counter (Beckman
Instruments, Fullerton, CA).
Example 1: ER-TAFl Transcription Activation Requires
the Functional Context of TAF2
TAFl and TAF2 functions have been defined as
individual domains within the estrogen receptor that
were capable of supporting transcription of an ER
responsive promoter (Berry et al., 9 EMBO J. 2811, 1990,
and Tasset et al., 62 Cell 1177, 1990). However, we
were unable to show a distinct activity of _he TAFl
CA 02222~62 1997-11-27
W O 96/41013 PCT~US96/09638
29
sequence when analyzed in the context of the ERN282G
deletion in the mammalian cells tested here. Therefore,
we considered whether analysis of this transactivator
outside the context of the full-length receptor may not
reflect its true biological activity.
Danielian et al., su~ra, changed three amino acids
between residues 535 and 550 in the carboxyl terminus of
the mouse estrogen receptor which comprises
transcriptional activity of TAF2 without diminishing the
receptor's ability of binding both specific DNA and
cognate ligand with wild type affinity, indicating that
these changes did not lead to gross structural
abnormalities in the protein.
We created similar amino acid changes in the
carboxyl terminus of human ER at residues 538, 542 and
549 using site-directed mutagenesis (see the ER-TAFl
construct of Fig. 1). This triple mutation was also
introduced into ER179C creating a null estrogen receptor
(See the ER-Null construct of Figure 1). ER-Null and
ER-TAFl constructs allowed a specific determination of
the effect of these mutations on TAF2 function. The
transcriptional activities of these mutant ERs were
assessed by transient transfection into CV-l cells
together with the ERE-tk-LUC reporter.
Mutation of these three amino acids provides but one
example by which the context of a TAF region can be
maintained while inactivating that region. Those in the
art will recognize that equivalent mutations in the same
or other amino acids can be readily made by standard
techniques.
Introduction of the triple mutation into ER179C
totally abolished TAF2 activity (Fig. lB). Thus, we
believed that introduction of this mutation into the
wild-type ER would allow an ~mi n~tion of TAFl activity
in the full-length receptor context without interference
from TAF2 activity. The ability to specifically mutate
the TAF2 activator within the human estrogen receptor in
CA 02222~62 1997-11-27
W O 96/41013 j PCT~US96/09638
this manner is consistent with the results previously
reported for the mouse ER, and indicates that equivalent
mutations can be made in the other receptor TAF regions.
The full-length receptor containing the triple
mutation (ER-TAF1) was subsequently used for analysis of
TAF1 function in the context of the intact'receptor.
Constructs encoding wild type receptor, ER-TAF1, ER-TAF2
(i.e., ER179C) or ER-Null were transfected into CV-1,
HepG2 or HS578T cells, together with the EPE-tk-LUC
reporter. The results are shown in Fig. 1
In all cell lines, the ER179C was transcriptionally
active, as observed earlier (Figs. lB, C &'D), whereas
the null receptor was inactive. Interestingly, in CV-1
cells, in the absence of a functional TAF2 activation
sequence, the ER-TAF1 protein exhibited a significant
transcriptional activity (Figs. lB, C & D). Thus, the
activity of the TAF1 activator when analyzed in the
context of a full length receptor molecule, as observed
here, was different ~rom that when analyzed as a
deletion mutant (ERN282G, Fig. 2). This suggests that
TAF1 activity does not function independently, but
rather requires additional carboxyl-terminal sequences
for appropriate function.
Interestingly, increasing the concentration of
transfected ER-TAF1 DNA did not result in a receptor
dependent "squelching" of transcriptional activity.
This observation implies that both TAF1 and TAF2
activators and possibly the context of the full-length
receptor are required for this squelching function.
A comparison was made o~ the expression level of
each of these receptors by transfecting the expression
vectors into CV-1 cells and analyzing the hormone
binding activities in the resulting cytoso_ic extracts
(data not shown). The Kds of the ER-wt, ER-TAF1 and
ER179C were the same. The ER-wt and ER-TA-~1 were
synthesized in comparable levels as measured by hormone
binding activity, whereas the amino-terminally deleted
CA 02222~62 1997-11-27
WO 96/41013 PCTAUS96/096~8
ER179C and the null receptor were expressed at about 25~
of ER-wt level. Since all the transcriptional responses
detected with each receptor were maximal responses
achievable, it is unlikely that receptor expression
S levels are a significant factor in the outcome of our
experiments.
Example 2: Transcriptional Activation bY TAF1 and TAF2
Truncated Receptors
Referring to Fig. 2, truncated forms of the human
estrogen receptor were prepared which lacked either the
TAF1 (ER179C, see Fig. 2A) or the TAF2 (ERN282G, see
Fig. 2A) activation sequence. These constructs encode
proteins structurally similar to those used previously
in m~mm~lian (Berry et al., 9 EMBO J. 2811, 1990) and
yeast cells (Pham et al., 6 Mol. Endo. 1043, 1992).
The transcriptional activities of these ER
derivatives were assessed using a reporter plasmid
containing one copy of the vitellogenin estrogen
response element (ERE) (Klein-Hitpass et al., 76 Cell
1053, 1986) inserted upstream of the thymidine kinase
promoter (ERE-tk-LUC). The reporter plasmid and
increasing concentrations of ER or mutant ER expression
vectors were transiently transfected into the ER
negative cell lines CV-1 (monkey kidney fibroblasts),
HepG2 (human hepatocellular carcinoma) and HS578T (human
breast cancer cells), and activity assessed as
documented in Fig. 2B. All transfections were performed
in the absence or in the presence of 17-~-estradiol at
concentrations ranging from 10-5M to 10-11M. However, due
to the number of data points obtained in this way
(~2,500) only the activities obtained using 10-7M 17-~-
estradiol are presented since this is a concentration
that elicited m~l m~ l transcriptional response in all
cell lines ~m~ ned.
The ER-wt was active in all cell lines. Using this
protocol, we were unable to detect significant TAF1-
CA 02222~62 1997-11-27
W O 96/41013 PCTnJS96/09638
mediated transcriptional activity in either CV-l, HepG2,
HS578T (Figs. 2B, C, D) or HeLa or U20S cells (data not
shown) when assayed in the context o~ the ERN282G
deletion. In contrast, however, the TAF2 activation
~unction (ER179C) exhibited substantial activity in
these cells (Figs. 2B, C & D). The magnit4de o~ the
TAF2 transcriptional activity by ER179C was cell-type
dependent. This isolated activator exhibitled a lower
e~icacy relative to wild type receptor, even at DNA
concentrations that produced saturating receptor levels.
In HepG2 cells ER179C was about 35~ as active as ER-wt
(Fig. 2C), whereas in CV-l and HS578T, the ER179C
demonstrated 70~ and 65~ o~ ER-wt activity respectively
(Figs. 2B & D). Trans~ection e~iciency ard recombinant
expression levels were similar as estimatec by indirect
~luorescence microscopy and flow cytometric analysis
(data not shown).
The results obtained in this analysis are consistent
with the hypothesis that the TAFl and TAF2 sequences
represent ~unctionally distinct transcriptional
activators. A wild type receptor activity requires
either both activator regions or an intact receptor
context ~or an individual activator to exhibit m~; m~ 1
transcriptional activity. I
In addition to the partial activities observed by
the above ER-mutants, increasing concentrations o~
trans~ected ER-wt in CV-l and HS578T cells led to a
progressive decrease in hormone dependent
transcriptional activity (Figs. 2B & D). This
phenomenon has been observed by others and likely
results ~rom sequestration o~ limited transcription
~actors or targets by the over-expressed, hormone-
activated receptor, such that activated receptor
~unction is compromised (Tasset et al., 62 Cell 1177,
1990). This "squelching" or "transcriptional
inter~erence" supports the idea that ER requires
additional, limiting cellular transcription ~actors ~or
CA 02222~62 1997-11-27
WO 96/41013 PCTAUS96/09638
33
appropriate function. The failure of the ER-wt to
~squelch" in the HepG2 cell line (Fig. 2C) suggests
either an increased abundance of a required co-factor,
or the involvement of an additional cell specific
component in this process.
Example 3: ER-TAF1, HepG2 Cell and C3 Promoter
Constitute an Assav for an Aaonist or Antaqonist Actina
Throuqh TAF1
The above results using the ERE-tk-LUC reporter
indicated that the TAF1 activator of the estrogen
receptor functions, albeit weakly, in the absence o~ an
intact TAF2 function. In addition, TAF1 activity
appeared to be cell-type dependent.
We extended our studies to ~m; ne the efficacy of
the individual activator functions on other estrogen
responsive promoters. To this end, we chose the
estrogen responsive C3 promoter in which a s~rong ERE
has recently been identified (Zawaz, Gene Exp. 2:39,
1992; Vik et al. Biochemistrv 30:1080, 1991).
The activities of the of ER-wt, ER-TAF1 and ER-TAF2
(i.e., ER179C) activators were evaluated on C3 promoter-
directed transcription as depicted in Fig. 3. In HS578T
cells, the C3 promoter can be activated equally well by
either ER-wt, ER-TAF1 or ER179C (Fig. 3C). In HepG2
cells, however, the ER-TAF1 activator was as active in
transcription as wild type ER, but the ER179C activator
was silent (Fig. 3B).
These data suggest that, with respect to the C3
promoter, there is a strong cell-type bias in ER
transactivator functions. In CV-1 cells it appears that
the combination of the activation sequences is required
for m~; m~ 1 activity (Fig. 3A). Cumulatively, these
data suggest that the TAF1 and TAF2 activators within ER
demonstrate a dependence upon cell-type and promoter,
and furthermore, the dominant activator of ER-mediated
regulation of C3 expression is TA~1.
CA 02222~62 1997-11-27
W O96/41013 PCTAUS96/09638
34
The analysis of the relative contributilon of the
individual ER TAF domains in ER function was extended to
include two additional promoters, namely the adenovirus
major late promoter, containing an estrogen response
element, and the vitellogenin promoter (Fig. 4). Both
of these promoters were responsive to estrogen in the
presence of ER-wt. However, unlike the C3 promoter the
individual activation domains of ER were mihimally
active in both cell lines examined. This highlights
further the promoter specificity of the estrogen
receptor activation domains. Similar tests to those
described above can be used to quickly identify useful
promoter and cell combinations for use in assays for
agonists discussed above (see also, Example 4, below).
Example 4: Screeninq Aaents for Partial Aqonist
Activity
Certain triphenylethylene-derived estrogen receptor
antagonists (i.e., tamoxifen, nafoxidine) aire reported
to exhibit partial agonist activities. We ,tested
whether these compounds preferentially actilvate either
TAF1 or TAF2 transactivators.
A series of these compounds was evaluatled in HepG2
cells using the ER-TAF-specific receptor derivatives and
the C3 promoter. In this cellular and promoter context,
ER179C was not activated by either estradiol or the
partial estrogen agonists. On the C3 promo~ter,
tamoxifen, 4-hydroxy-t~mox~fen, nafoxidine and
clomiphene were all potent activators of ER-wt mediated
C3 gene transcription (Figs. 5B-E) Howevelr, none of
these compounds were as effective as estrogjen in this
regard (Fig. 5A). In addition, estrogen was an
efficient activator of the ER-TAF1, whereas the partial
estrogen agonists were not as effective.
These data imply that even though TAF1 ~activity is
necessary, it alone does not activate this promoter by
triphenylethylene-derived antihormones, suggesting that
CA 02222~62 1997-11-27
W O 96/41013 PCT~US~6~
their mode of action may be mechanistically different
from that of estrogen (Figs. 5A-F). The differences in
hormonal responsiveness of these receptor derivatives do
not relate to alterations in the affinity of the
proteins for ligands. As shown in Figs. 6A and B, the
affinity and specificity for ligands of the ER-wt and
ER-TAF1 were indistinguishable. It is notable that not
all the anti-hormones tested in this system have an
identical transcriptional profile (Figs. 5B-E). The
absolute efficacy for each of the anti-hormones is
different, as is their ability to differentially
activate TAF1, suggesting subtle mechanistic differences
in the agonistic properties of these ligands.
These examples demonstrate specific point mutations
in the human estrogen receptor affects ER-transcription
activation function. Mutation of TAF2 in this manner is
still compatible with wild-type binding affinities for
estrogen, tamoxifen and 4-hydroxy-tamoxifen.
Surprisingly, TAF1 retained considerable transcriptional
activity despite TAF2 mutation. When we deleted the
entire TAF2 sequence (ERN282G) we were unable to observe
residual transcriptional activity of TAF1 in any cell
line ~X~m; ned. This suggests that either TAF2 or the
context of the full length receptor is required for full
manifestation of TAF1 activity.
Berry et al. have observed that a construct
identical to ERN282G was constitutively active in avian
CEF cells (Berry et al., g EMBO J. 2811, 1990). This
may suggest a difference in estrogen receptor function
in m~mm~l ian and avian cells, and may not reflect basic
differences between the two sets of results.
Using the modified receptors we were able to
identify cell and promoter specific differences in the
activity of ER-TAFl and ER-TAF2 (i.e., ER179C). In
studies which were controlled for expression level and
transfection efficiency we saw that both activators
displayed promoter and cell type specific differences in
CA 02222~62 1997-11-27
WO 96/41013 PCT/U'9G~638
36
their activity. The most striking example of this is
the inability o~ ER179C to ~unction well on any promoter
in HepG2 cells. The ER-TAF1 activator, on the other
hand, ~unctions very well on the complex C3,promoter,
but less well on the other promoters ~m; ned The
activity pro~iles o~ ER-TAF1 and ER179C are clearly
distinct, suggesting dissimilar mechanisms Q~ action.
On the complex C3 promoter there is no apparent
synergism between TAF1 and TAF2, whereas it'clearly
exists on other promoters. This suggests that on this
promoter the ER activation domains may interact with
di~ering transcription ~actors. The data obtained
using the C3 promoter in HepG2 cells indicate that there
is a transcription ~actor in these cells that can
~unctionally replace TAF2, as TAF1 is as good a
transcriptional activator as ER-wt. However, since TAF2
alone does not activate transcription, it suggests that
no mimetic ~or TAF1 exists ~or transcription of this
promoter in this particular cell line.
The dissimilar mechanism o~ action and the promoter
and cell type speci~icity can be explained by a model in
which TAF1 is the dominant transcriptional a,ctivator and
TAF2 is a transcriptional facilitator (see model in Fig.
7). We suggest that the ~unction o~ TAF2 is to
"prepare" the transcription apparatus ~or TAF1 function.
This "preparation" ~unction could be the reçruitment o~
basic transcription ~actors, alteration o~ chromatin
structure or overcoming the e~ects of a transcriptional
repressor. On the other hand, TAF2 could ~prepare" the
transcription apparatus ~or another transcrlptional
activator, but on its own would have little inherent
transcriptional activity. In support o~ this
hypothesis, the TAF2 activator is poorly active on
m; n; m~ 1 promoters.
This dependence on promoter complexity -s also
observed for ER-TAF1 activity. Additional ~vidence in
support o~ the ~acilitator role o~ TAF2 is that in yeast
CA 02222~62 1997-11-27
W O 96/41013 PCT/W'6'~96~8
the TAF1 activator is inactive on a minimal promoter.
However, a mutation of the SSN6 locus (a cellular
repressor of transcription), Keleher et al., 68 Cell,
709, 1992, results in a 100-fold increase in ER-TAF1
activity (to a level comparable to ER-wt), whereas
ER179C activity is not effected (McDonnell et al., 89
Proc. Natl. Acad. Sci. USA 10563, 1992). We suggest
that this cellular mutation has the effect of mimicking
the function of TAF2, and that in mammalian cells TAF2
has a similar role. In this system TAF1 is unable to
access the transcription apparatus as a result of
stearic hindrance by an inhibitor Where TAF2 is
available, then the inhibitor is displaced and TAF1 is
able to interact with the transcriptional apparatus.
Example 5: Screeninq For and Use 0~ Compounds With
Keoxi~ene-Like Transcri~tional Profiles
In hnm~n.q the tri-phenylethylene derived anti-
estrogen keoxifene exhibits bone sparing activity while
having no significant effects on uterine proliferation.
In contrast, tamoxifen, a related anti-estrogen, is bone
sparing but functions as a partial estrogen agonist in
the uterus promoting an undesirable proliferative
effect.
In order to determine whether the differences in the
in vivo biological activity o~ tamoxifen and keoxifene
could be reconciled by their differential ability to
transcriptionally activate TAF1, these compounds were
studied in HepG2 cells using the ER-TAF specific
receptor derivatives on the C3 promoter. The results
are shown in Figure 8D and 8E.
Keoxifene had a unique transcription profile in this
promoter and cellular context. In particular, low
concentrations of keoxi~ene stimulated ER
transcriptional activity. At higher concentrations,
keoxifene inhibited the basal transcriptional activity
of ER and did not cause further transcriptional
CA 02222~62 1997-11-27
WO96/41013 PCTAUS96/09638
38
activation (See Fig. 8E). On the ER-TAFl construct,
keoxifene demonstrated significant partial;agonist
activity inducing C3 promoter transcription 5-fold over
background. The mechanism by which keoxifene manifests
a transcriptional profile distinct from the related
molecule tamoxifen is unclear. However, it is likely
that these compounds induce subtle alteratilons in
receptor structure which facilitate distinct
interactions of the ER-TAFs with the genera~l
transcription apparatus.
The unique profile exhibited by keoxifehe in this in
vitro assay suggested that additional compounds
displaying similar transcriptional profiles may also
exhibit favorable bone protective/uterine sparing
activities. To this end we have studied several
compounds derived from tamoxifen using this assay system
and have been able to split these compounds into three
distinct groups based on their ability to modulate TAFl
activity. The first category contains compounds that
resemble the activity of estrogen, the second group
resembles the activity of tamoxi~en and the third group
profile similar to keoxifene.
When the keoxifene-like compounds are alsayed in the
ovariectomized rat model they are expected to be bone
protective and to demonstrate no uterotrophic activity.
Rats are given a dorsal ovariectomy as follows:
The animals are anesthetized with Ketamlne:Xylazine
and surgery is performed. Shave the centrai back of the
anesthetized rat. Make a longitudinal incision in the
skin parallel to the spine about 1 inch long. Spread
the connective tissue away from the muscle layer with
the tips of scissors. About 1 inch from the spinal
column at the base of the rib cage, make a small cut
(1/4") of the muscle with scissors. With small forceps,
pull out ovarian fat. Ovary will be visible as a
cluster-like structure, attached to the end of the
uterine horn. Cut the connective tissue that holds them
CA 02222~62 1997-11-27
W O96/41013 PCTrUS~6~'~5-~8
together. Staunch any bleeding. Replace fat into body
cavity. Repeat on opposite side. Clip skin together
and use betadine on the incision to retard infection and
reduce clip removal. The next day injections are begun.
Injections are done subcutaneously in the hip daily
(usually in the morning). Vehicle is 10~ ethanol and
all injection volumes are 300 ~l. After 28 days of
injections, the ~n;m~ls are sacrificed under anesthetic
by cervical dislocation and the body and wet uterine
weights are determined. The hindlimbs are taken for
histology and histomorphometry.
The transcriptional profile exhibited by keoxifene
in vitro is predictive of agents demonstrating bone
selective estrogenic activity. Thus, the use of these
ER-TAF constructs ~x~m;ned on this promoter and
cellular context provides a useful screen for compounds
useful for the treatment of osteoporosis.
In in vivo studies, rats are subjected to sham or
authentic ovariectomy and allowed to recover for 5 days.
Rats (4-6 per group) are then injected subcutaneously
with vehicle or vehicle containing estrogen, keoxifene,
or a test compound daily for periods up to 28 days.
~n;m~ls are sacrificed, weighed, and evaluated for
uterine wet weight, total serum cholesterol, and bone
mineral density. Established methods are utilized with
the exception that bone mineral density of the distal
femural metaphysis is determined utilizing an Hologic
mineral densitometer. Bone marrow from test ~n;m~1s is
evaluated for osteoclastic potential in the coculture
assay with primary osteoblasts. Bone marrow is combined
with primary osteoblasts in the presence of 1,25-
dihydroxyvitamin D3 and parathyroid hormone for 8 days
and scored for the number of tartrate acid phosphatase
resistant multinucleated cells (TRAP + MNC). The number
of TRAP + MNC in the sham operated animals is set at
100~. Tartrate resistant acid phosphatase positive,
CA 02222~62 1997-11-27 ,
W O96/41013 PCT~US96/09638
multinucleated cells are scored by standard methods as
nascent osteoclasts.
The in vitro effects of compounds on MCF-7 breast
cell proliferation can also be studied. The partial
agonist activities of estrogen, keoxifene, and the test
compound on MCF-7 human breast carcinoma cells, is
assessed by treating the cells for 7 days in the absence
or presence of increasing concentrations of compound.
Cells are treated at day 0 and day 4 with compound.
Triplicate wells are evaluated for cell num~er at
termination of the experiment on day 7. The activity of
estrogen in this assay is expected to be ma~ imum at 10-
~M, and induce proliferation to 1500~ of control.
The in vitro profiles of keoxifene and the test
compounds could then be determined. The acthvities of
increasing concentrations of compound on ER,~ER-TAF1,
and ER-null receptor transactivation of the C3 promoter
in HepG2 cells is determined by standard methods as
described in this document. Thus, compounds that
exhibit both bone protecting and uterine/breast sparing
activity at a given concentration can be identified.
Higher potency compounds than keoxifene are preferred.
By "potency" is meant the amount of a compound required
to produce the desired effect. Thus, high potency
compounds will bind to the receptor with greater
affinity than keoxifene. High potency compounds produce
maximal effect at minimal dosages. As illus=rated in
Fig. 8, compounds with high potency have pea~s further
to the right than do compounds of lower potency.
ER agonists and their type can be quickly identified
in the above systems. Specifically, the experiment
described in Example 4l and illustrated in F-g. 5, is
useful for identifying an agonist and then defining its
type of activity. For example, the use o~ a wild type
receptor (ER-wt) in this assay will indicate whether a
test compound is an ER agonist. The use of a mutated
CA 02222~62 l997-ll-27
W O 96/41013 PCT~US96/09638
41
receptor with full functional context (ERm) in the assay
will indicate the type of agonist, i.e., what level of
activity is observed. Examples of the range of results
expected with various test compounds are shown in Fig.
5, and discussed in Example 4. Using such assays, one
can readily screen for desired agonist activity, e.q.,
agonists active only at TAF1 regions which mimic the
activity of estrogen and are useful for treatment of
osteoporosis.
II. Proaesterone Receptor
The steroid hormone progesterone is involved in the
regulation of growth and development of m~m~y gland
and uterus. Synthetic progestins and antiprogestins
have been used or are in human clinical trials in
treatment of endometrial and breast cancer, as
combination oral contraceptive agents, and as ad~uncts
to estrogen in hormonal replacement therapy.
The effects of progesterone are mediated by
progesterone receptors. Upon binding to their hormonal
ligands, the activated receptors bind with high affinity
to specific DNA binding sites and activate transcription
of the cis-linked genes.
Gronemeyer et al. (1987) EMBO J. 6:3985-3994, cloned
and sequenced chicken PR and described that both the N-
2 5 terminal A/B region and C-terminal hormone binding
domain are required for transactivation function on MMTV
promoter in HeLa cells.
Carson et al. (1987) Mo. Endo. 1: 791-801, cloned and
sequenced chicken PR, and conducted analysis to define
the functional domains of the receptor. The authors
state that a transcription activation function domain
resides outside the hormone binding domain and that the
C-terminal region may function as a "repressor".
Tora et al. (19 88) Nature 333:185-188, reported on
the functional difference between chicken PRA and PRB in
the transactivation of target genes.
CA 02222~62 1997-11-27
WO96/41013 ' PCTrUS96/09638
42
Meyer et al. (1990) EMBO J 9:3923-3932, described
the presence of two transcription activation ~unction
(TAFs) located in the N-terminal region A/B (TAF1) and
the hormone binding region (TAF2) of the human PR. The
authors described the agonistlc activities of RU486.
Meyer et al. (1992) J Biol Chem 267:10882-10887,
state that a region specific for PRB is required for
TAF1 function.
Two isoforms of human progesterone receptor, sized
94kD and 120 kD, have been observed in human breast
cancer T47D cells and primary human endometrial
carcinoma. In T47D cells, two promoters in'a gene give
rise to two distinct classes of human proge~terone
receptor mRNAs, one of which codes for hPRB while the
other one encodes hPRA. The two isoforms dilffer only in
their N-terminal sequences. Form A lacks the amino
terminal 164 amino acids present in form B.
The human progesterone receptor A and B lisoforms
(hPAR and hPRB) differentially activate tran~scription of
progesterone-responsive genes (Vegeto et al., Mol. Endo.
7:1244-1255, 1993; Wen et al., Mol. Cell. Biol. 14:8356-
8364, 1994, all incorporated by reference he;rein).
Using site-directed mutagenesis we were ablelto show
that hPRA has a functionally inactive TAF1. ITAF2 of
hPRA is the sole transcription activator of Ihis
receptor form. However, TAF2 is a weak transcription
activator and functions only in some promotell and
cellular contexts.
TAF1 of hPRB functions synergistically with TAF2 of
hPRB in certain promoter and cellular contex_s. TAF1 of
hPRB also functions independently in some promoter and
cellular contexts.
Reaqents
DNA restriction and modification enzymes were
obtained from Boehringer Mannheim (Indianapolis, Ind.),
New England Biolabs (Beverly,Mass.), or Stratagene (San
CA 02222~62 1997-11-27
W O 96/41013 PCT~US~'/056
43
Diego, Cali~.). PCR reagents were obtained ~rom Persin-
Elmer Cetus (Norwalk, Conn.). Progesterone,
dexamethasone, and 17-~-estradiol were purchased ~rom
igma (St. Louis, Mo.). [1,2-3H]progesterone was
purchased ~rom Amersham (Arlington Heights, Ill.).
Rece~tor and reporter constructs
Construction o~ the mammalian expression plasmids
phPRB, phPRA and pRShGR has been described elsewhere
(Vegeto et al. (1993) Mol. Endocrin. 7:1244-1255), as
has the construction o~ PRE2-TK-LUC,TAT-LUC, and ERE-TK-
LUC reporters (Berger et al., (1992) Cell 70:251-
265,Tzukerman et al., (1994) Mol. Endocrinol. 8:21-
30,Vegeto et al. (1993) Mol. Endocrin. 7:1244-1255).
Plasmid MMTV-ERE-LUC was constructed as ~ollows.
Plasmid ~MTV-LUC containing a deletion o~ the sequences
~rom +190 to -88 was obtained ~rom Ron Evans (Salk
Institute, San Diego, Calif.). This plasmid was
digested with HindIII to remove the glucocorticoid
response elements, and five copies o~ a 33-bp
oligonucleotide containing the consensus vitellogenin A2
estrogen response element were inserted. The sequence
o~ the oligonucleotide used was
5'AATTAAAGTCAGGTCACAGTGACCTGATCAAA3'.
Glutamic acid residues at positions 907 and 911 were
substituted with alanines by using PCR primers
containing two base changes (underlined) as indicated:
5'CCAGCAATGATGTCTGCAGTTATTGC3' and
5'GCAATAACTGCAGACATCATTGCTGG3' (National Biosciences
Inc., Plymouth, Minn.) to prepare the E907A and E9llA
mutations. The EcoNI-KpnI ~ragment o~ DNA containing
the mutated receptor sequences was subcloned into
plasmids phPR-B and phPR-A and sequenced to con~irm the
mutations.
CA 02222~62 1997-11-27
WO 96/41013 PCT/U'~GI'~3~38
44
Cell lines
The human m~mm~ry epithelial cell line MCF-10 was
obtained originally from Samuel Brooks (Mic~igan Cancer
Foundation). This cell line was routinely maintained in
a 1:1 mixture of Dulbecco's modified Eagle's medium
(Biofluids, Rockville, Md.) and Ham's F12 medium
(Biofluids) with 20 ng of epidermal growth factor
(Sigma) per ml, 100 ng of cholera toxin (Sigma) per ml,
0.01 ~g of insulin (Biofluids) per ml, 500 rg of
hydrocortisone (Sigma) per ml, and 5~ horse serum
(Biofluids). The human breast adenocarcinoma cell line
MCF-7 was obtained from Marc E. Lippman (Vincent T.
Lombardi Cancer Center, Georgetown Universit,y) and
maintained in Iscove's modified Eagle's medium
(Biofluids) with 10~ fetal bovine serum (HyClone
Laboratories, Inc., Logan, Utah). Monkey ki'dney CV-1
fibroblasts were routinely maintained in Dulbecco's
modified Eagle's medium supplemented with 10l~ fetal
bovine serum.
AssaYs
Cotransfection assays were conducted as follows.
Cells were plated in 12- or 96-well tissue culture
plates the day before transfection. DNA was introduced
into cells by the calcium phosphate coprecipitation
25 method (Berger et al., (1992) Mol. Biol. 41: 733-738).
For each transfection reaction, 20 ~g of DNA per ml of
transfection buffer was used. For the 96-well plate
experiments, transfections were performed wi_h a Biomek
1000 automated laboratory workstation (Beckman,
Fullerton, Calif.). Cells were incubated with the
precipitate for 6 h, then washed with phosphate-buffered
saline, and incubated for 40 h with or without hormones
as indicated in the text. Cell extracts were prepared
as previously described (Berger et al., (1992) Mol.
Biol. 41:733-738) and assayed for luciferase and ~-
galactosidase activities.
CA 02222~62 1997-11-27
W O 96/41013 PCTrUS96/09638
Hormone bindinq assay
Hormone binding assays were conducted as follows.
The wild-type PR and mutant receptor proteins were
produced by in vitro translation of mRNA synthesized by
using wild-type and mutant PR templates. The binding
assay buffer constituted of 10~ glycerol, lOmM Tris, 2
mM dithiothreitol, 2 mM 3-[3-cholamidopropyl)-dimethyl-
ammonio]-l-propanesulfonate, and 1.5 mM EDTA (pH 7.5).
The binding assays were performed in a 500-~1 volume
containing 10 ~1 of reticulocyte lysate (containing PR)
and various concentrations of [3H]progesterone in the
absence or presence of 10 ~M progesterone. Incubations
were carried out at 4~C for 16 h. At the end of the
incubation period, bound and unbound progesterone were
separated by using dextrancoated charcoal. The
supernatants containing bound progesterone were drawn
off, and the radioactivity retained was estimated by
liquid scintillation counting. Data were analyzed by
the method of Rosenthal, H.A. (1967) Anal. Biochem.
64:1393-1401. For competition binding assays, a similar
protocol was used except that a fixed concentration of
[3H]progesterone was added to extracts in the presence or
absence of competing ligands (lnM to lO~M). After
correcting for nonspecific binding, 50~ inhibitory
concentration values were determined graphically from a
log-logit plot of the data. Kis were determined from the
calculated 50~ inhibitory concentration values by using
the Cheng-Prusoff equation (Cheng et al., (1973)
Biochem. Pharmacol. 22:3099-3108).
A PR-TAFl construct, phPRB(Eg07A~EgllA)~ was trans~ected
into MCF-10 cells together with an MMTV-LUC reporter
plasmid (see Figs. 12 and 13). In MCF-10 cells,
PhPRB~Eg07AE9llA~ functioned as a hormone-dependent
activator o~ MMTV gene transcription in the presence of
progesterone (Fig. 13A). In contrast, this mutant
CA 02222~62 1997-11-27
WO 96/41013 i PCTAUS96/09638
46
receptor was unable to activate MMTV gene transcription
in CV-1 cells (Fig. 13B).
There~ore, MCF-10 cells, phPRB(Eg07AEg1~) and MMTV
promoter constitute an assay ~or an agonistlor
antagonist which acts through the TAF1 region of PR.
With this assay, we were able to demonstrate that the
partial agonist activity of some antiprogestins is
mediated by the TAF1 region o~ hPRB.
A PR-TAF2 selective assay was also constructed. A
PR-TAF1 construct, phPRA, was trans~ected into XeLa
cells together with a TAT-LUC reporter plasmid (see
Figs. 12 and 13). The construction o~ plasmids,
mutagenesis, cell culture, cotrans~ection assays and
hormone binding assays were conducted as deccribed in
Wen et al. supra.
In HeLa cells, phPRA ~unctioned as a hormone-
dependent activator of TAT gene transcriptiojn in the
presence o~ progesterone (Fig. 14). In contrast, this
mutant receptor was unable to activate MMTV gene
transcription in HepG2 cells (Fig. 15). There~ore, HeLa
cells, phPRA and TAT promoter constitute an assay for an
agonist or antagonist which acts through the TAF2 region
Of PR.
Depending on the e~pression ration of hPRA and hPRB
and the particular target tissues or cells, PR agonists
can activate the transcription o~ di~ferent isets o~
genes. PR antagonists can have di~erent e~fects o~
target gene transcription depending on cellular
environments. Partial agonists or antagonists of PR
screened by the above described assays may be used as
oral contraception, in hormone replacement therapy, to
treat endometriosis, fibroids, endometrial cancer and
breast cancer with little or no side e~ects.
III. Androaen Rece~tor
The steroid hormones testosterone and its active
metabolite dihydrotestosterone (DHT) have multiple
CA 02222~62 l997-ll-27
WO 96/41013 PCTAUS96/09638
47
effects in the body, including fusion of the
labioscrotal fold during embryogenesis, induction of
male differentiation of the wolffian ducts, growth of
the male urogenital tract, induction of spermatogenesis,
growth of beard and body hair, retention of nitrogen,
temporal regression of scalp hair, hyperplasia of the
sebaceous gland with increased sebum production,
development of prostatic hyperplasia in aging males,
secretion of ejaculate, and virilization of the
hypothalamus. These diverse effects are modulated
through the action of the androgen receptor AR.
The human AR cloned by Lubahn et al. Mol. Endo.
2:1265-1275, 1988, is a member of the superfamily of
ligand inducible nuclear receptors. AR has high
15 homology with PR, MR and GR (Evans R.M. Science 240:889-
895, 1988).
Chang et al. Proc. Natl. Acad. Sci. 85:7211-7215,
1988, described the cloning of AR and androgen binding
specificity.
Jenster et al. Mol. End. 5:1394-1404, 1991,
described a series of deletion mutants of AR that define
steroid binding domain, regions of the N terminal region
required for transactivation and regions required for
nuclear targeting.
Palvimo et al. Mol. Endo. 7:1399-1407, 1993,
described a region of the N terminal domain that is
required for transactivation.
When testosterone or DHT binds to hAR, hAR binds to
HREs in target genes and modulates transcription of
those genes. DHT causes a dose-dependent enhancement of
luciferase activity from cells cotransfected with a hAR
plasmid and a reporter plasmid containing an androgen
response element (Figure 17). The activity induced by
DHT can be reversed by the nonsteroidal AR antagonist,
2-hydroxy flutamide.
CA 02222~62 l997-ll-27
W O96/~1013 PCT~US96/09638
48
Rece~tor Constructs
Four receptor constructs were generatedito establish
an assay to screen for AR TAF region partial agonists
and antagonists. These constructs are analogous to the
mutant forms o~ the estrogen receptor descrlbed above.
cDNA sequence encoding the AR-wt was excised from
plasmid hARpGBM3 as a 3.6Kb BglII/BamH1 fracment and
ligated into unique BamH1 site o~ the m~m~l ian
expression base vector pRS (Berger et al., 41 J. Steroid
Biochem. Mol. Biol. 733,1992). The resulting plasmid
was named pRShAR. pRShAR-wt contains the coding
sequence of the full length human AR clonedlinto the
expression vector pRS (AR-wt plasmid). I
The AR-TAF1 plasmid was generated by cloning a
BamH1/Kpnl ~ragment of the hAR into the plas'mid pALTER
using an in vitro mutagenesis system by Promega.
Specific mutations were introduced into the hormone
binding domain o~ the receptor by substituting alanine
for amino acids located at positions 892, 896 and 899
using site directed mutagenesis according to'the
manu~acturers instructions. The hormone binding domain
o~ pRShAR-wt and pRShAR-TAF1 was then replaced with
1.5Kb Kpnl/BamHl mutated hormone binding domain DNA
fragment. The resulting plasmids were named pRShAR-TAF1
(derived ~rom pRShAR-wt) and pRShAR-null (derived from
pRShAR-TAF2). pRShAR-TAFl contains a mutated ~orm o~
the AR that carries a series o~ point mutations that
change the glutamic acid residues at positions 892, 896
and serine at position 899 to alanine (AR-TAFl).
The AR-TAF2 plasmid was constructed by e~cising the
l.Skb AR cDNA fragment generated by cutting with Apal
and BamH1. The single-stranded DNA overhang generated
by Apal was removed by treatment with T4 polymerase
prior to treatment with BamH1. Another aliquot o~
pRShAR was treated with Asp718, the ends of the DNA were
~illed by treatment with Klenow fragment. The DNA was
then cut with BamH1. The 4 kb ~ragment generated was
CA 02222~62 1997-11-27
WO 96/41013 PCTrUS9~'0~8
49
isolated and ligated with the 1.5 kb Apal/BamH1 hAR DNA.
pRShAR-TAF2 contains a mutated form of the AR that has
the N terminal region of the receptor truncated so that
amino acids residues 1-506 are missing, effectively
removing the TAF1 portion of the receptor.
pRShAR-null contains a mutated form of the AR that
carries both the point mutations in the TAF2 region and
the truncation of the N terminal region as described
above.
Cotransfection assaY
CV-1 cells (African green monkey kidney fibroblasts)
were cultured in the presence of Dulbecco's Modified
Eagle Medium (DMEM) supplemented with 10~ charcoal
resin-stripped fetal bovine serum and then transferred
to 96-well microtiter plates one day prior to
transfection.
Cells were transiently transfected by calcium
phosphate coprecipitation (Berger et al. J. Steroid
Biochem. Mol. Biol. 41:733, 1992) with pRShAR (1
ng/well), MTV-LUC reporter (100 ng/well), pRS-~-Gal (50
ng/well) and pRS-CAT (filler DNA, ~9 ng/well). The
receptor plasmid, pRShAR, contains the human AR under
constitutive control of the rous sarcoma virus promoter.
The reporter plasmid, MTV-LUC, contains the cDNA for LUC
under control of the mouse m~mm~y tumor virus (MMTV)
long terminal repeat, a conditional promoter containing
an androgen response element (Berger, et al. J. Steroid
Biochem. Mol. Biol. 41: 733, 1992). pRS-~B-Gal, coding
for constitutive expression of E. coli ~-galactosidase
(~-Gal), was included as an internal control for
evaluation of transfection efficiency and compound
toxicity. Transfections and subsequent procedures were
performed on a Biomek 1000 automated laboratory work
station.
Six hours after transfection, media was removed and
the cells were washed with phosphate-buffered saline
CA 02222~62 1997-11-27
W O96/41013 PCTAUS96/~56~8
(PBS). Media containing reference compounds (i.e., DHT
and 2-hydroxy flutamide) or test compounds in
concentrations ranging from 10~12 to 10-5 M were added to
the cells. Three to ~our replicates were used for each
sample. '
After 40 hours, the cells were washed with PBS,
lysed with Triton X-100-based buffer and assayed for LUC
and ~-Gal activities using a luminometer or
spectrophotometer, respectively.
Data evaluation was performed using thelOracle
relational database management system. Forleach
replicate, the normalized response (NR) was,calculated
as:
LUC response/~-Gal rate
where
~-Gal rate = ~-Gal activity xlO~5/~-Gal incubation time.
The mean and standard error of the mean (SEM) of the
NR were calculated. Data was plotted as the response of
the compound compared to the reference compounds over
the range of the dose-response curve. For agonist
experiments, the effective concentration that produced
50% of the maximum response (ECso) was quanti-fied.
Agonist e~ficacy was a function (%) of LUC
expression relative to the maximum LUC production by the
reference agonist, DHT. Antagonist activity'was
determined by testing the amount of LUC exprlession in
the presence of DHT at its EC50 concentratio$. The
concentration of test compound that inhibited 50% of LUC
expression induced by DHT was quantified (IC50). In
addition, the efficacy of antagonists was determined as
a function (~) of maximal inhibition.
Cotransfection studies with the human glucocorticoid
receptor (hGR, Giguere, et al. Cell 46:645-652,
1986), human progesterone receptor (hPR-B, Vegeto, et
al. Cell 69:703-713, 1992), human mineralocorticoid
receptor (hMR) with the MTV-LUC reporter and'human
estrogen receptor (hER) with the MTV-ERE5-LUC reporter
CA 02222~62 1997-11-27
W O 96/41013 PCT~US96/09638
51
were carried out as described above for evaluating the
cross-reactivity of test compounds.
The receptor constructs were used in transient co-
transfection studies (Fig. 18). HepG2 cells were
trans~ected with 10 ~g of the reporter plasmid C'9, 5 ~g
of pRSV-~-gal expression vector as an internal control
for transfection efficiency, carrier DNA (pGEM4) added
to adjust the total amount of DNA to 20 ~g and receptor
expression DNA (i.e., pRShAR-wt 200 ng; pRShAR-TAF1
200ng; pRShAR-TAF2 3~g; or pRShAR-null 3~g).
Increasing concentrations of testosterone were added
to the HepG2 cells. The procedures and calculations
used to determine normalized response ~ollows that
described above. The response element used in the
reporter plasmid is the C'9 promoter (Adler et al. Mol.
Endo. 5:1587-1596, 1991), a fragment o~ the promoter
region of the sex limited protein (SLP) cloned by the
polymerase chain reaction from mouse genomic DNA.
Figure 18 demonstrates that in the context of the
HEPG2 cell line and C'9 promoter a significant response
is obtained with the AR-TAF1 construct relative to wild
type AR whereas the AR-TAF2 construct exhibits a very
minor response. The AR-null does not exhibit a dose
dependent response to hormone. In this example agonist
activity can be detected through function of the TAF1 in
this context.
Therefore, HepG2 cells, pRShAR-TAF1 and C'9 promoter
constitute an assay for an agonist or antagonist which
acts through the TAFl region of AR. With this assay, we
can screen agents for partial agonist or antagonist
activity mediated by the TAF1 region of hAR.
The development of compounds with androgenic and
anti-androgen properties acting through a particular TAF
region on certain promoters in certain cellular
environments have clinical applications in the treatment
of prostate cancer, alopecia, hirsutism, acne, benign
prostate hyperplasia, male breast cancer, precocious
CA 02222~62 1997-11-27
WO 96/41013 ~ PCTAUS96/09638
52
puberty and laryngeal carcinoma with little or no side
effects. Currently known compounds have sice effects.
For example, cyprotene acetate (CPA) is a steroidal
antiandrogen with progestin activity. Side effects are
tests and adrenal suppression, feminization potential
teratogen, cardiovascular disorder, liver toxicity,
inhibition of libido and bone maturation. In addition,
futamide is a nonsteroidal antiandrogen currently used
in the treatment of prostate cancer. It is~also
effective ~or treating hirsutism. Side effects of
futamide include severe gastrointestinal disturbance,
hot flashes, gynecomastia, liver toxicity, elevation of
serum leutenizing hormone and testosterone levels.
Furthermore, casodex is a non-steroidal anti!androgen
currently being developed for use in the clinic to treat
prostate cancer, hirsutism (in women) and acne. Side
effects of casodex include liver toxicity, breast
tenderness, gynecomastia, hot flashes, mild back pain.
IV. Glucocorticoid Receptor
Glucocorticoids are potent agents available for the
treatment of inflammatory diseases, certain lymphoid
cancers and various immunological disorders.' However,
current therapy is limited by debilitating slde effects
associated with long term use of glucocorticoids. Side
effects include, but are not limited to, hyperglycemia
and the resultant diabetes mellitus, osteoporosis,
cataracts, fragile skin, weight gain and psychosis.
These effects result from the action of glucocorticoid
receptor on groups of promoters in specific tissues. In
many cases, such as osteoporosis, diabetes and
psychosis, the side effects are unrelated to!the anti-
inflammatory or anti-proliferative effects. ~Finding GR
agonists capable of distinguishing between tissues
and/or promoters could limit the effects of the GR
agonists to the beneficial anti-inflammatory and anti-
proliferative effects.
CA 02222~62 1997-11-27
W O 96/41013 PCTrUS96/Og~38
We have developed assays to detect and distinguish
GR agonists that operate through a speci~ic TAF region
in certain cellular environments. These assays use
cells including a reporter construct containing
multimerized glucocorticoid response elements (GRE)
upstream ~rom a minimal promoter driving the expression
o~ the reporter gene luciferase. This reporter responds
strongly to glucocorticoids in CV1 cells when these
cells are transfected with wild type GR.
Receptor ex~ression vectors
Figure 19 is a diagram showing the structural
organization o~ GR-wt, GR-TAF1, GR-TAF2, GR-N-del and
GR-null. These expression vectors produce modi~ied
~orms o~ GR that selectively inactivate one or more of
the transactivation domain of GR.
GR-TAF2 and GR-N-Del plasmids were derived ~rom GR-
wt. GR was modi~ied to add a NotI restriction site on
the 5' side o~ the DNA binding domain and an XhoI site
on the 3' side of the DNA binding domain. In GR-TAF2,
20 amino acids 77-262 were excised ~rom GR-wt using BglII.
In GR-N-del, amino acids 9-385 were excised ~rom GR-wt.
The procedures were described previously by Hollenberg
et al., Cell 49:39-46, 1987, incorporated by re~erence
hereln .
To prepare GR-TAF1 plasmid, the TAF2 domain was
mutated using a site-directed mutagenesis kit by
Clonetech. Amino acid residues 751, 755, 758, and
751+755, 751+758, 755+758 were changed to alanines using
the ~ollowing mutagenesis primers:
30 751: 5'GCT AAC ATC GCG GGG AAT TC3'
755: 5'GAT GAT TGC AGC AGC TAA CAT C3'
758: 5'CTG ATT GGC GAT GAT TTC AGC3'
751+755: 5'GAT GAT TGC AGC TAA CAT CGC GGG GAA TTC3'
751+758: 5'CTG ATT GGC GAT GAT TTC AGC TAA CAT CGC GGG
GAA TTC3'
755+758: 5'CTG ATT GGC GAT GAT TGC AGC TAA C3'
CA 02222~62 1997-11-27
WO 96/41013 I PCTrUS96/09638
54
The GR-Null plasmid serves as a negative
control that lacks both TAFl and TAF2 translactivation
activity. It is constructed ~rom GR-TAFl ~rom which the
TAFl domain was excised by BglII.
To prepare the GR-Gal4 plasmids, the Gal4 DNA
binding domain was excised ~rom pBSGalG with KpnI and
SalI. The Gal4 DNA binding domain ~ragment was then
inserted into each o~ the TAF mutants ~rom which the N-
terminus and the DNA binding domain of GR have been
removed with KpnI and XhoI (see Figure 20).
Reporter plasmids
The reporter plasmids contain either the Murine
M~m~y Tumor Virus (MMTV-luc) promoter, Complement 3
gene promoter (C3-luc) or TAT3 promoter (i.e., a
synthetic promoter consisting o~ 3 repeats o~ a
Glucocorticoid Response Element (GRE) derived ~rom the
Tyrosine Amino Transferase gene ~used to the alcohol
dehydrogenase TATA box).
Cell culture
CVl, Cos-l, CHO, 293, HepG2, HeLa and HIG82 cells
were maintained in Dulbecco's modi~ied Eagle's medium
(DMEM) supplemented with 10~ ~etal bovine scrum (FBS).
MCF7 were maintained in Iscove's modi~ied Eagle's medium
(IMEM) supplemented with 10~ FBS.
Transient transfection assay
Transient trans~ection assays were per~ormed
essentially as described ~or ER except that the cells
were incubated with or without hormone ~or 24 hours.
Dexamethasone bindinq competition assaY
GR proteins were expressed in reticulocyte lysates
using a transcription/translation kit ~rom Promega.
Aliquots o~ reticulocyte lysates in binding bu~er are
incubated with 4-7nM (3H)-dexamethasone andlvarying
CA 02222~62 1997-11-27
W O96/41013 PCTAJS96/09638
concentrations o~ unlabelled competing ligand at
concentrations ranging ~rom 0 to 10-5 M. Incubations
were carried out at 4 ~C ~or 16 hours. At the end o~ the
incubation period, GR-bound ligand was absorbed onto
hydroxylapatite, pelleted and counted in liquid
scintillation cocktail.
The e~fect o~ the TAF2 mutations on transactivation
was tested by co-trans~ection (see Figure 21). CV1,
Cos-1 (green monkey kidney cells), CHO (Chinese Hamster
cells), HeLa (human cervical carcinoma cells), HepG2
(human Hepatocarcinoma cells), MCF7 (human Breast
adenocarcinoma cells), HIG82 (rabbit synoviocytes) and
293 (human Embryonal kidney cells) were co-trans~ected
with the Gal4-TAF2 mutants and a reporter plasmid
containing Gal4 DNA binding sites ~used to luci~erase
gene. The ability o~ the TAF2 domain to activate the
luci~erase gene was detected by measuring
chemiluminescence. The data in Figure 21 shows that the
mutations in TAF2 inactivated the transactivation
activity o~ TAF2. Similar assays may be conducted to
analyze the e~ects o~ mutations to other
transactivation domains in the GR.
GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-Null were
cotrans~ected into CV1 cells with a reporter gene under
the regulation o~ a TAT3 promoter. Dexamethasone was
then added to the CV1 cells and the expression level o~
the reporter gene measured. GR mutants are expressed in
CV1 cells. The GR mutations selectively eliminate each
transactivation domain but do not signi~icantly change
hormone binding. GR-TAF1, GR-N-del and GR-TAF2 have
transactivation activity. However, the GR-null receptor
has no activation capability, indicating that together
the TAF1 and TAF2 mutations eliminate all the
transactivation potential ~rom GR.
Figure 22 shows that despite TAF2 transactivation
activity was inactivated in GR-TAF1 plasmid, GR-TAF1
CA 02222~62 1997-11-27
WO 96/41013 PCT~US96/09638
56
still exhibited transactivation activity in CV1 cells on
TAT3 promoter. Therefore, CV1 cells, GR-TAF1 plasmid
and TAT3 promoter constitute an assay for an'agonist or
antagonist which acts through the TAF1 region of GR.
Figure 22 also shows that despite TAF1
transactivation activity was inactivated in GR-TAF2 and
GR-N-del plasmids by deletion mutations, GR-TAF2 and GR-
N-del still exhibited transactivation activity in CV1
cells on TAT3 promoter. Therefore, GR-TAF2 or GR-N-del
plasmid, CV1 cells and TAT3 promoter constitute an assay
for an agonist or antagonist which acts through the TAF2
region of GR.
The assay we have established for the de_ection of
TAF selective GR agonists or antagonists can utilize any
cell line in which either TAF1 or TAF2 is active. The
approach described here makes use o~ the CVl'cell line
and mutants of hGR in which either TAF1 or TAF2 is
mutated. Each cotransfection assay contains a control
~-galactosidase expression vector for transfection
efficiency and the TAT3-luciferase reporter.
Individual compounds may be screened in Ithree
separate cotransfection assays, the first contains GR-
wt, the second contains the GR-TAF1, and the~third
contains the GR-TAF2 or GR-N-del. Compounds that are
active in the wild type assay will be compared in the
two mutant assays. All classes of agonists and
antagonists may be screened.
Compounds with uni~ue profiles relative to TAFl or
TAF2 identified by the above described assays will
generate differences in the tissue or promoter
selectivity of the receptor, allowing the determination
of which TAF region is associated with the side effects
and which is associated with the anti-proliferative or
anti-inflammatory activity. The compounds identified by
the above described assays may be put to therapeutical
uses. For example, if TAF2 is crucial for GR activity
in bone cells, then one may selectively eliminate side
CA 02222~62 1997-11-27
WO 96/41013 PCTAUS96/09638
57
effects of GR in osteoclasts and osteoblasts by
administering a TAF1 selective agonist screened by the
claimed assay to prevent TAF2 activity and reduce the
osteoporosis associated with glucocorticoid therapy.
V. Pharmaceutical Compositions
The present invention also encompasses pharmaceu-
tical compositions prepared for storage and subsequent
administration, which have a pharmaceutically effective
amount of the products disclosed above in a
pharmaceutically acceptable carrier or diluent.
Acceptable carriers or diluents for therapeutic use are
well known in the pharmaceutical art, and are described,
for example, in Reminqton's Pharmaceutical Sciences,
Mack Publishing Co. (A.R. Gennaro edit. 1985).
Preservatives, stabilizers, dyes and even flavoring
agents may be provided in the pharmaceutical
composition. For example, sodium benzoate, sorbic acid
and esters of p-hydroxybenzoic acid may be added as
preservatives. Id. at 1449. In addition, antioxidants
and suspending agents may be used. Id.
The compositions of the present invention may be
formulated and used as tablets, capsules or elixirs for
oral administration; suppositories for rectal
administration; sterile solutions, suspensions for
injectable administrationi and the like. Injectables
can be prepared in conventional forms, either as liquid
solutions or suspensions, solid forms suitable for
solution or suspension in liquid prior to injection, or
as emulsions. Suitable excipients are, for example,
water, saline, dextrose, mannitol, lactose, lecithin,
albumin, sodium glutamate, cysteine hydrochloride, and
the like. In addition, if desired, the injectable
pharmaceutical compositions may contain minor amounts of
nontoxic auxiliary substances, such as wetting agents,
pH buffering agents, and the like. If desired,
CA 02222~62 1997-11-27
WO 96/41013 PCTrUS96/09638
58
absorption enhancing preparations (e q., lip'osomes) may
be utilized.
The pharmaceutically e~ective amount o~ the
composition required as a dose will depend cn the route
o~ administration, the type o~ animal being treated, and
the physical characteristics o~ the speci~ia animal
under consideration. The dose can be tailored to
achieve optimal e~icacy but will depend on such ~actors
as weight, diet, concurrent medication and other ~actors
which those skilled in the medical arts will recognize.
In practicing the methods of the invention, the
products or compositions can be used alone or in
combination with one another, or in combination with
other therapeutic or diagnostic agents. These products
can be utilized ln vivo, ordinarily in a m~mm~l,
pre~erably in a human, or in vitro. In emp~oying them
ln vivo, the products or compositions can be
administered to the m~mm~ 1 in a variety o~ ways,
including parenterally, intravenously, ~ubcutaneously,
intramuscularly, colonically, rectally, nasally or
intraperitoneally, employing a variety o~ dosage ~orms.
As will be readily apparent to one skilled in the
art, the useful in vlvo dosage to be administered and
the particular mode o~ administration will vary
depending upon the age, weight and m~mm~l ian species
treated, the particular compounds employed,land the
speci~ic use ~or which these compounds are employed.
The determination o~ ef~ective dosage levels, that is
the dosage levels necessary to achieve the desired
result, will be within the ambit o~ one skilled in the
art. Typically, human clinical applications o~ products
are commenced at lower dosage levels, with'dosage level
being increased until the desired e~ect is achieved.
In non-human ~n;m~l studies, application~ G~ products
are commenced at higher dosage levels, witk dosage being
decreased until the desired e~ect is no longer achieved
or adverse side e~ects disappear.
CA 02222~62 1997-11-27
WO 96/41013 PCTAJS96/09638
59
The dosage for the products of the present invention
can range broadly depending upon the desired affects and
the therapeutic indication. Typically, dosages may be
7 between about 10 ~g/kg and 100 mg/kg body weight,
5 preferably between about 100 ~g/kg and 10 mg/kg body
weight. ~m; n; stration is preferably oral on a daily
basis.
The exact formulation, route of administration and
dosage can be chosen by the individual physician in view
10 of the patient's condition. (See e.q. Fingl et al., in
The Pharmacoloqical Basis of Thera~eutics, 1975, Ch. 1
p. 1). It should be noted that the attending physician
would know how to and when to terminate, interrupt, or
adjust administration due to toxicity, or to organ dys-
functions. Conversely, the attending physician would
also know to adjust treatment to higher levels if the
clinical response were not adequate (precluding toxi-
city). The magnitude of an administrated dose in the
management of the disorder of interest will vary with
the severity o~ the condition to be treated and to the
route of administration. The severity of the condition
may, for example, be evaluated, in part, by standard
prognostic evaluation methods. Further, the dose and
perhaps dose frequency, will also vary according to the
age, body weight, and response of the individual
patient. A program comparable to that discussed above
may be used in veterinary medicine.
Depending on the specific conditions being treated,
such agents may be formulated and administered
systemically or locally. Techniques ~or formulation and
administration may be found in Reminqton's Pharmaceu-
tical Sciences, 18th ed., Mack Publishing Co., Easton,
PA (1990). Suitable routes may include oral, rectal,
transdermal, vaginal, transmucosal, or intestinal admin-
istration; parenteral delivery, including intramuscular,subcutaneous, intramedullary injections, as well as
intrathecal, direct intraventricular, intravenous,
CA 02222~62 1997-11-27
WO 96/41013 , PCTrUS96/09~38
intraperitoneal, intranasal, or intraocular injections,
just to name a ~ew.
For injection, the agents o~ the invention may be
formulated in aqueous solutions, pre~erably in physio-
logically compatible bu~fers such as Hanks'r, solution,Ringer's solution, or physiological saline bu~fer. For
such transmucosal administration, penetrant~ appropriate
to the barrier to be permeated are used in the ~ormula-
tion. Such penetrants are generally known ln the art.
Use of pharmaceutically acceptable carriers to
~ormulate the compounds herein disclosed ~or the prac-
tice o~ the invention into dosages suitable for systemic
administration is within the scope of the i~vention.
With proper choice o~ carrier and suitable manu~acturing
practice, the compositions o~ the present invention, in
particular, those formulated as solutions, may be admin-
istered parenterally, such as by intravenous injection.
The compounds can be ~ormulated readily uslng pharmaceu-
tically acceptable carriers well known in the art into
dosages suitable for oral administration. Such carriers
enable the compounds o~ the invention to be ~ormulated
as tablets, pills, capsules, liquids, gels syrups,
slurries, suspensions and the like, for oral ingestion
by a patient to be treated.
Agents intended to be administered intracellularly
may be administered using techniques well known to those
o~ ordinary skill in the art. For example, such agents
may be encapsulated into liposomes, then ~m; n; stered as
described above. Liposomes are spherical lipid bilayers
with aqueous interiors. A11 molecules present in an
aqueous solution at the time of liposome ~ormation are
incorporated into the aqueous interior. The liposomal
contents are both protected ~rom the external microenvi-
ronment and, because liposomes fuse with cell membranes,
are e~ficiently delivered into the cell cytoplasm.
Additionally, due to their hydrophobicity, small organic
molecules may be directly administered in_racellularly.
CA 02222~62 1997-11-27
W O 96t41013 PCTAUS96/09638
61
Pharmaceutical compositions suitable ~or use in the
present invention include compositions wherein the
active ingredients are contained in an e~ective amount
to achieve its intended purpose. Determination o~ the
effective amounts is well within the capability of those
skilled in the art, especially in light of the detailed
disclosure provided herein. In addition to the active
ingredients, these pharmaceutical compositions may
contain suitable pharmaceutically acceptable carriers
comprising excipients and auxiliaries which ~acilitate
processing of the active compounds into preparations
which can be used pharmaceutically. The preparations
~ormulated for oral administration may be in the form o~
tablets, dragees, capsules, or solutions. The
pharmaceutical compositions of the present invention may
be manufactured in a manner that is itself known, e.g.,
by means of conventional mixing, dissolving,
granulating, dragee-making, levitating, emulsi~ying,
encapsulating, entrapping or lyophilizing processes.
Pharmaceutical formulations for parenteral
administration include aqueous solutions o~ the active
compounds in water-soluble ~orm. Additionally, suspen-
sions o~ the active compounds may be prepared as appro-
priate oily injection suspensions. Suitable lipophilic
solvents or vehicles include fatty oils such as sesame
oil, or synthetic ~atty acid esters, such as ethyl
oleate or triglycerides, or liposomes. Aqueous injec-
tion suspensions may contain substances which increase
the viscosity o~ the suspension, such as sodium carboxy-
methyl cellulose, sorbitol, or dextran. Optionally, the
suspension may also contain suitable stabilizers or
agents which increase the solubility o~ the compounds to
- allow ~or the preparation o~ highly concentrated
solutions.
Pharmaceutical preparations ~or oral use can be
obtained by combining the active compounds with solid
excipient, optionally grinding a resulting mixture, and
CA 02222~62 1997-11-27
WO 96/41013 PCT~US96/09638
62
processing the mixture of granules, a~ter adding suit-
able auxiliaries, if desired, to obtain tablets or
dragee cores. Suitable excipients are, in particular,
fillers such as sugars, including lactose,lsucrose,
mannitol, or sorbitoli cellulose preparatiohs such as,
for example, maize starch, wheat starch, rice starch,
potato starch, gelatin, gum tragacanth, methyl cellu-
lose, hydroxypropylmethyl-cellulose, sodium carboxy-
methylcellulose, and/or polyvinylpyrrolidone (PVP). If
desired, disintegrating agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic
acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings.
For this purpose, concentrated sugar solutions may be
used, which may optionally contain gum arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene
glycol, and/or titanium dioxide, lacquer solutions, and
suitable organic solvents or solvent mixtures. Dye-
stuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
Pharmaceutical preparations which can be used orally
include push-fit capsules made of gelatin, as well as
soft, sealed capsules made of gelatin and G plasticizer,
such as glycerol or=sorbitol. The push-fit capsules can
contain the active ingredients in admixture with ~iller
such as lactose, binders such as starches, and/or
lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In so~t capsules, the active
compounds may be dissolved or suspended in suitable
liquids, such as fatty oils, liquid paraff-n, or liquid
polyethylene glycols. In addition, stabil_zers may be
added.
All publications referenced are incorpprated by
reference herein, including the nucleic acid sequences
and amino acid sequences listed in each publication.
CA 02222~62 1997-11-27
W O 96/41013 PCT~US96/09638
All the compounds disclosed and re~erred to in the
publications mentioned above are incorporated by
re~erence herein, including those compounds disclosed
and re~erred to in articles cited by the publications
mentioned above.
Other embodiments o~ this invention are disclosed in
the ~ollowing claims.
CA 02222562 1997-11-27
PCTnJS96/09638
WO 96/41013
64
EX Vivo Formatlon of Osteoclasts
l RAP(t)MNC
(~,6 ~ontrol)
Sh~m C)YX OVX OVX
+~BE2 +Ke~xlfen
Exp~ 00 147.8~ 84,3c gg3c
EXpt.2 100 ~4.0b 11~ 4C 78~2a
~Sign~Kant~different from sham. pc0.02.
bSignifi~n~differentfirom~h~m,p<O.~.
C~osigni(i~n~d~ere~etr~m~m.
i
Table 1
Bone marrow from sham (control), OVX
(ovariectomized rats), OVX plus estrogen, and OVX plus
keoxifene treated rats were evaluated for osteoclastic
potential in the coculture assay. Bone marrow was
combined with primary osteoblasts in the presence o~
1,25-dihydroxyvitamin D3 and parathyroid hcrmone for 8
days and scored for the number of tartrate acid
phosphatase resistant multinucleated cells (TRAP + MNC).
The number of TRAP + MNC in the sham operatled animals was
set at 100~.
CA 02222~62 1997-11-27
W O96/41013 PCTrUS96/09638
TABLE 2
List of Candidate Com~ounds
~ CANDIDATE COMPOUNDS REFERENCES
1) Compounds Modulating *p.1213 ff, and
Glucocorticoids references therein
WO/92tl6546,
PCT/US92/02024
WO92/16658,
PCT/US92/02014
US 4,981,787
. US 5,071,773
R. Evans, Science
240:889-895 (1988)
2) Estrogens-agonists & antagonists *p. 1193 ff and
references therein
3) Androgens-agonists & antagonists *p. 1208 ff, and
references therein
US 4,144,270
US 3,847,988
US 3,995,060
4) Progestins-agonists & antagonists *p. 1200 ff, and
references therein
Non-steroid progestins PCT/US93/03909
PCT/US93/10086
WO 94/24080
5) Mineralocorticoids-agonists & *p. 1213 ff, and
antagonists references therein
6) Nonsteroidal anti-inflammatory **
drugs
*Intracellular receptor general reference Comprehensive
Medicinal Chemistry "The Rational Design, Mechanistic Study
and Therapeutic Applications of Chemical Compounds," C.
Hamsch, P.G. Sammes, John B. Taylor and John C. Emmett Vol. 3-
Membrane and Receptors, Pregammon Press, Oxford, Ch. 16.3
Steroid Hormone Receptors pp. 1176-1226.
**Negrel et al., Biochem. J 257:399-405 (1989)
