Note: Descriptions are shown in the official language in which they were submitted.
CA 02223038 1997-12-01
W O 96~9511 - PCT~US96/08~96
A C5a-LlKE SEVEN TRANSMEMBRANE RECEPTOR
TECHNICAL FIELD
The present invention is in the field of molecular biology; more particularly, the
5present invention describes the nucleic acid and amino acid sequences of a C5a-like seven
Il ansme" Ibrane receptor.
.
BACK iROUND ART
Co,llp!e llent, which is produced in the liver and circulates in the blood and extracellular
fluid, stimulates cells and antihodies to fight i-~te~;tions. Complement 5 (C5) is proteolytically
cleaved to produce C5a and C5b whenever the corll, !e llenl system is activated. C5a is one of 13
plasma protei.ls responsible for clearing foreign particles and oryanisllls from the blood. In
addition, human C5a, a 74 amino acid peptide, functions as a chemoattractant for immune
system cells.
The C5a receptor is a G-protein coupled seven transll'eu'brdl1e receptor (T7G) which is
present on neutrophils, macrophages, and mast cells and is believed to couple with a Gq-/G11-
protein to activate the phosphoinositol signaling pathway. The leceplor contains 350 amino
acids and is glycosylated at Asn5 to produce a protein of 52-55 kDa. A disulfide bond links
Cys109 in the first external loop with Cys188 in the second external loop. The C5a receptor has
2 o been cloned (Boulay et al (1991 ) Biochem 30:2993-99; Gerard (1991 ) Nature 349:614-
17; and Gerard et al (1992) J Immunol 149:2600-06). Six Asp residues in the N-terminus
of the C5a receptor are thought to bind to the Arg and Lys reeidues in the C5a ligand. With its
affinity for peptide ligands and its short third intr~ce'!u~r loop, the C5a receptor most closely
resembles the neurokinin T7G receptors.
The T7Gs chara.:teli~lically contain seven hydrophobic donlaills which span the plasma
Illenlbrdne and form a bundle of antiparallel a helices. These Iranslllelllbldne segments are
designated by roman numerals l-VII and account for structural and functional features of the
receptor. In most cases, the bundle forms a binding pocket; how~,~/cr, when the binding site
must accomlllodate more bulky molecules, the extr~cs" ll~r N-terminal segment or one or more
of the three extrAr:ell~ r loops participate in binding (Watson S and Arkinstall S (1994) The
G P,u~.,i., Linked Receptor Facts Book, Acadell ~, Press, San Diego CA) and in sllhsequent
induction of conforlllalional change in intracellular portions of the receptor. The activated
receptor in turn, interacts with an intr~cell~ r G-protein complex which mediates further
intrae--'lu'-r signaling activities, generally the production of second messengers such as cyclic
AMP (cAMP), phospholipase C, inositol triphosphale, or ion channel prutei~ls.
CA 02223038 1997-12-01
W 096~9511 PCT/U',G.'~J~596
Neurokinin-type receptors include tachykinin (TK), formyl peptide (fMLP), GnRH, and
prostaglandin E recepl~,r:,. They are large ligands, mostly pe~lides, which do not fit the binding
pocket of 17G. The N-termini and first extr~ r loops have a cG"~"~on tachykinin motif
recognition site while the second and third extr~cs" ll~r loops bind to hormone-specific
sequences which differ among the rece~lor~. The C-terminus which is co"""on to all isofor,.... s
binds to transmer-L r~ne helices and activates the receptors. The third intr~cellu~ r loop is
quite short in this group; and in fMLP, it is only 15 amino acids in length. Many of these
receptors have short C-termini, and GnRH completely lacks the C-terminal domain (Bolander
FF (1994) Mol~c~ Cndo~;,i"ology, Academic Press, San Diego CA).
The idenliricdIion of novel C5a-like receptor provides the opportunity to diagnose or
intervene in those pathologic or phys;Dlogic condilions in which such receptors are expressed
or otherwise actively involved.
DISCLOSURE OF THE INVENTION
The subject invention provides a unique nucleotide sequence which encodes a novel
human C5a-like lecepIor homolog, herein designated CALR. The cDNA, herein desi~.,aI~d calr,
was identified and cloned using Incyte Clone No. 8118 from a human mast cell cDNA library.
The invention also relates to the use of the nu ~ ~e~ lide sequence or amino acid sequence of
CALR or its variants in the diagnosis or Il~dl~.-.ll. of conditions or ~ice~ses ~soci-ted with CALR
e~,rt,ssion or signal transduction activity. Aspects of the invention include the antisense DNA of
calr; cloning or ex~,ression vectors containing calr; host cells or organisms transformed with
ex~ lession vectors containing calr; and a method for the production and recovery of purified
CALR protein from host cells. Purified CALR can be used to produce anliL,od;ec" antagonists or
inhibitors for diagnostic or therapeutic use.
BRIEF DESCRIPTION OF DRAWINGS
Figures 1A, 1 B and 1C show the alignment between the nucleotide (SEQ ID NO:1) and
amino acid (SEQ ID NO :2) sequences for CALR. The ,~ "el:j used to extend the partial
n~ ~U~ sequence to full length were XLR = GAAAGACAGCCACCACCACCACG and XLF=
3 0 ~1~
Figure 2 displays the alignment of human CALR with CFOMC5AM, C5A anaphylatoxin
receptor from dog; boxed residues are identical.
MODES FOR CARRYING OUT THE INVENTION
As used herein, CALR refers to a C5a-like ~eceplor homolog in naturally occurring or
CA 02223038 1997-12-01
W O 96~9Sll ~ PCT/U~6/~-596
synthetic form and active fragments thereof, which have the sequence shown in SEQ ID NO:2. In
one embodiment, the polypeptide (des;yl .dl~d by the upper case, CALR) is encoded by mRNAs
lldnscriLed from the cDNA (desiyll~led by the lower case, calr) of SEQ ID NO:1.
"Activen refers to those forms of CALR which retain the biologic and/or immunologic
activities of any naturally occurring CALR.
"Naturally occurring CALR" refers to CALRs produced by human cells that have not been
genetically engineered and specifically co"lt:r"pldles various CALRs arising from
post-t,dnsldlional modiricdlions of the polypeptide including but not limited to acetylation,
carboxylation, glycosylation, phosphorylation, lipidation and acylation.
"Derivative" refers to CALRs chemically modified by such techniques as ubiquitination,
labeling (eg, with radionuclides, various enzymes, etc.), pegylation (derivatization with
polyethylene glycol), and insertion or sl~hstit~tion by chemical synthesis of amino acids such as
ornithine which do not normally occur in human prolei.,s.
"Recombinant variant" refers to any polypeptide having the activity of the CALR protein
and differing from naturally occurring CALRs by amino acid insertions, deletions, and
5llhstitlltions created using It:coll ' ndlll DNA techn ~_es Guidance in determining which amino
acid residues may be replaced, added or deleted without ~ho'~ 9 activities of interest, such as
normal signal trancduction~ may be found by comparing the sequence of the par~icular CALR
with that of homologo~s peptides and " ,i",i~i"g the number of amino acid sequence changes
made in highly conserved regions.
Preferably, amino acid "sl~hstih~tions'~ are the result of replacing one amino acid with
another amino acid having similar structural and/or chemical properties, such as the
replacement of a leucine with an i~ o'eucine or valine, an aspa,lale with a glutamate, or a
threonine with a serine, ie, conservative replacemenl~. "Insertions" or "deletions" are
typically in the range of about 1 to 5 amino acids. The ~,aridlion allowed may be experimentally
determined by producing the peptide synthetically or by systematically making insertions,
deletions, or 5~hstihltions of nucleotides in a calr molecule using recGI, ' ,ant DNA techniques
and assaying the e,~.ressed, lecon'-inant variants for activity.
Where desired, a "signal or leader sequence" can direct the po!ypeptide through the
mel"L,dne of a cell. Such a sequence may be naturally present on the polypeptides of the
present invention or provided from heterologous sources by recor"'- ,anl DNA techniques.
A polypeptide "fragment," "portion," or "segment" is a stretch of amino acid residues of
at least about 5 amino acids, often at least about 7 amino acids, typically at least about 9 to 13
amino acids, and, in various el"bo ' ~enls, at least about 17 or more amino acids. To be active,
any CALR peptide must have sufficient length to display biologic and/or immunologic activity.
CA 02223038 1997-12-01
W O 96~9511 PCT/U~,5/q~96
An "oligonu~ieotide" or polynucleotide "fragment", "portion", "probe" or "segment" is a
stretch of nu 'o.lide residues which is long enough to use in polymerase chain reaction (PCR)
or various hyL,Iidi~dlion procedures. Oligonucleotides are pr~pa,ed based on the cDNA sequence
which encodes CALR provided by the present invention and are used to amplify, or simply reveal
the pl~sence of, related RNA or DNA ,-,Dle ~'os Oligonu~ lides cG",p,ise portions of the DNA
sequence having at least about 10 n-: ~'sotides and as many as about 35 nucle~ lides, preferably
about 25 nucleotides. Nucleic acid probes co""~ ,e po, lions of calr sequence having fewer
nu~'~olides than about 6 kb, pl~r~r~bly fewer than about 1 kb.
After apprupriate testing to eli".;.,ale false positives, both oligonucleotides and nucleic
acid probes may be used to determine v,~ ll,er mRNAs encod ,g CALR are present in a cell or
tissue or to isolate similar natural nucleic acid sequences from chl~",oso",al DNA as described
by Walsh PS et al (1992, PCR Methods Appl 1:241-50).
Probes may be derived from naturally occurring or ~ecomiJ..~a~ll single- or
double-~ nded nucleic acids or be cl,e" --lly synthesized. They may be labeled by nick
I~ansldlion, Klenow fill-in reaction, PCR or other methods well known in the art. Probes of the
present invention, their preparation and/or labeling are elaborated in Sambrook J et al
(1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor NY; or Ausubel FM et al (1989) Current Protocols in i\A2lE!clll~r Biology, John Wiley &
Sons, New York NY, both incorporated herein by ,~rerence.
RecG" ' ,a"l variants enc_ ' ,g T7Gs may be sy"ll,esi~ed or ~ele~,led by making use of the
"redundancy" in the genetic code. Various codon sl'hstit''tions, such as the silent changes which
produce specific ,~ ;lion sites, may be introduced to opli",i~e cloning into a plasmid or viral
vector or to increase e~ essi0n in a particular prokaryotic or eukaryotic system. Codon
usage-specific mutations may also be introduced or chl "erds co"l~i" ,g the do",a;"s of related
peptides added to test or modify the properties of any part of the poiypeptide, particularly to
change ligand-binding affinities, interchain affinities, or degradation/turnover rate.
The present invention provides a unique nucleotide sequence identifying a novel C5a-like
receptor which was first identified in human mast cells. The sequence for calr is shown in SEQ
ID NO:1 and is ho"~ LS to the GenBank sequence, CFCOMC5AM for canine C5a anaphylatoxin
receptor. Incyte 8118 has 45% amino acid identity with the C5a receptor and differs from it
in having only three carboxylate residues in the N-terminus, two of which are Glu rather than
Asp. In addition, the N-terminus of Incyte 8118 is shorter than that of the published C5a
,ecepl~r and would be expected to have dirr~r,.,l binding specificity.
Because CALR is e,~ ssed in cells active in immunity, the nucleic acid (calr),
polypeptide (CALR) and antibodies to CALR are useful in inve~lig~lions of and interventions in
CA 02223038 1997-12-01
W O 96~9511 . - - PCT~US96/08596
the normal and abnormal ph~ , - and pall-D~og'- processes ~q-csoc~ with the mast cell's
role in immunity. Therefore, an assay for upregulated ex~,ression of CALR can accelerdle
diagnosis and proper lledllllellt of condilions caused by abno,-..al signal transduction events due
to anaphylactic or hyper~ensiti~e rtw~onses~ systemic and local i-.re~;lions, traumatic and other
tissue damage, hereditary or env;,on.. e.. lal ~ise~qces ~q-csociqt~od with hy~ e.lt:nsion, carcinomas,
and other phy~ 9 o or pathologic pr~ ~~s.
The nuc'eDtide sequence encoding CALR (or its cor., '-melll) has numerous other
a7-Flic 'i~ns in tecl-ri,_es known to those skilled in the art of l-.ole- ~'qr biology. These
techn:, les include use as h~L ridi~dlion probes for Southern or northern analysis, use as
lol-g- ~-ers for PCR, use for chromosomal and gene ~- eF, ' -g, use in the recor.. t:.. anl production
of CALR, use in generdlion of arli:,ense DNA or RNA, their che--,' I analogs and the like, and use
in production of chl "eric molecules for selecting agonists, inl !b'- ~ni or antagonists for design
of domain-specific ll,e.dpeutic mole~ ~'es. Uses of the nucleolides encod .g CALR ~icclosed
herein are exemplary of known tech~ les and are not intended to limit their use in any
tech. :,_e known to a person of ordinary skill in the art. Furthermore, the nucleotide sequences
.J;~closed herein may be used in .. ole.,L'qr biology tech-~ es that have not yet been developed,
provided the new tel;l.ni, les rely on plope,lies of nucleotide sequences that are currently
known, eg, the triplet genetic code, specific base pair interactions, etc.
It will be appreciated by those skilled in the art that as a result of the degeneracy of the
genetic code, a multitude of CALR-enco-' .g nucleotide sequences, some bearing minimal
ho".o!a;"r to the nuc'e~tide sequence of any known and naturally occurring gene may be produced.
The invention has specifically conl~l..plated each and every pcs~ ' Ie variation of nucleotide
sequence that could be made by sele_ti~ .9 cGr b: IdliOl)s based on pOc ~- !e codon cl, ~i ~ s These
co",'-' ,alions are made in accordance with the sldn(ldrd triplet genetic code as applied to the
nucleotide sequence of naturally occurring CALR, and all such variations are to be considered as
being specifically ~iisclosed
Although nucleotide sequences which encode CALR and its variants are pl~erdbly c~rqhlE
of h~blidiGi--g to the nucleotide sequence of the naturally occurring CALR gene under sl~i"gel,
condiliol-s, it may be advantageous to produce nucleotide sequences encGI )g CALR or its
derivatives possessi"g a suL.:,Id.. lially ~irrele-.t codon usage. Codons can be selected to increase
the rate at which expression of the peptide occurs in a particular prokaryotic or eukaryotic
ex~,ression host in accordance with the frequency with which particular codons are utilized by
the host. Other reasons for subsldr~ lly altering the nucleotide sequence encoding CALR and its
derivatives without altering the encoded amino acid sequence include the production of RNA
l-a--s.~ ; having more desirable properties, such as a greater half-life, than l.dnscli~
_
CA 02223038 1997-12-Ol
WO 96~9511 - PCT~US96/08596
produced from the naturally occurring sequence.
The n-!c's: -'e sequence en~- ' ,9 CALR may be joined to a variety of other nuclectide
sequences by means of well e_: ~' hed lecc,u ': ldlll DNA lechn:, les (Sambrook J et al, supra).
Useful nuc~Qotide sequences for joining to calr include an asso,l-"~"l of cloning vectors such as
plas,n- c, cc,s., idC, lambda phage derivatives, phage"l ~, and the like that are well known in the
art and may be chosen for such characlt:ri:ilics as the size insert they can accol"",oddle, their
utility, their fidelity, etc. Other vectors of interest include e~ression vectors, ~eplicalion
vectors, probe gen~dlion vectors, sequencing vectors, YAC and BAC r"a,~: ,g vectors, and the
like. In general, these vectors may contain an origin of re~ icn functional in at least one
organism, convenient le:,l,i.,-lion endonu~ ce sensitive sites, and select~hlc markers for
recovering transformed host cells.
Another aspect of the subject invention is to provide for calr-specific nucleic acid
h~,l,,iJi~dlion probes c~p~le of h~,LIidi~i,l9 with naturally occurring nucleotide sequences
e~ cc ' ,g CALR. Such probes may also be used for the d~le.,1ion of CALR-enc- ' ,g sequences and
should preferably contain at least 50% of the nucleotides from any particular domain of
interest from this calr encod ,9 sequence. The hyl,ridi~lioll probes of the subject invention
may be derived from the nu~ le~,lide sequence of the SEQ ID NO:1 or from gencJ" ~ sequence
including pror"c,ler, enhancer elements and introns of the respective naturally occurring calrs.
Hybridization probes may be labeled by a variety of reporter groups, including radionuclides
2 0 such as 32p or 35S, or enzymatic labels such as alkaline phosphdldse coupled to the probe via
avidin/biotin coupling systems, and the like.
PCR, as described in US Patent Nos. 4,683,195 and 4,965,188, provides additionaluses for oligonucleQIicles based upon the n~-~lecli.le sequences which encode CALR. Such probes
used in PCR may be of l~co"': .anl origin, may be che" ~'ly synthesized, or may be a mixture
of both and comprise a discrete nu 'e3lide sequence for diagnostic use or a degenerate pool of
possil~lQ sequences for identification of closely related r7G sequences.
Full length genes may be cloned from known sequence using a new method, disclosed in
Patent Application Serial No 08/487,112, filed June 7, 1995 and hereby incorporated by
reference, which employs XL-PCR (Perkin-Elmer, Foster City, CA) to amplify long pieces of
DNA. This method was developed to allow a single resedlcl)er to process multiple genes (up to
20 or more) at a time and to obtain an extended (possibly full-length) sequence within 6-10
days. It ,eplaces current methods which use labeled probes to screen 1' dlies and allow one
researcher to process only about 3-5 genes in 14-40 days.
In the first step, which can be performed in about two days, primers are designed and
synthesized based on a known partial sequence. In step 2, which takes about six to eight hours,
CA 02223038 1997-12-01
W O 96~9511 ~ PCT~US96/08596
the sequence is e,~lended by PCR amplification of a selected library. Steps 3 and 4, which take
about one day, are pu,iric~lion of the ar,, '''ied cDNA and its ligation into an apprupli~le vector.
Step 5, which takes about one day, involves lldll~Urll ,g and y,u~;"g up host bacteria. In step
6, which takes appruxi",alely five hours, PCR is used to screen ba~;t~rial clones for extended
sequence. The final steps, which take about one day, involve the prepa,~lion and sequencing of
selevled clones. If the full length cDNA has not been obtained, the entire procedure is repeated
using either the original library or some other pr~er~ed library. The preferred library may
be one that has been size-selected to include only larger cDNAs or may consist of single or
combined commercially available libraries, eg. Iung, liver, heart and brain from Gibco/BRL
(Gaithersburg MD). The cDNA library may have been prepared with oligo d(T) or random
primers. The advantage of using random primed libraries is that they will have more sequences
which contain 5' ends of genes. A randomly primed library may be particularly useful if an
oligo d(T) library does not yield a con, '_le gene. Obviously, the larger the protein, the less
likely it is that the complete gene will be found in a single plas",id.
Other means for producing hyl,ridi~lion probes for T7G DNAs include the cloning of
nucleic acid sequences encGd' ,g CALR or its derivatives into vectors for the production of mRNA
probes. Such vectors are well known in the art, are commercially available, and may be used to
synthesize RNA probes in vitro by means of the addition of the appropli~le RNA polymerase as
T7 or SP6 RNA polymerase and the appropri~l.3 labeled nucleotides.
2 o It is now possible to produce a DNA sequence, or portions thereof, encoding CALR and/or
its derivatives entirely by synthetic chemistry. Such molecules can be inserted into any of the
many available vectors using reagents and methods that are known in the art at the time of the
filing of this ~pplic~lion. Moreover, synthetic chemistry may be used to introduce mutations
into the calr sequences or any portion thereof.
2 5 The nucleotide sequence can be used to develop an assay to detect activation,
i"rlar"",alion, or disease ~sor!i~t~d with abnormal levels of CALR ex~.rt:ssion. The nucleotide
sequence can be labeled by methods known in the art and added to a fluid or tissue sample from a
patient. After an incubation period sufficient to effect h~L"idi~lion, the sample is washed with
a compatible fluid which contains a visible marker, a dye or other appropriate molecule(s), if
the nucleotide has been labeled with an enzyme. After the cG",r ' Ie fluid is rinsed off, the dye
is quar,lilaled and compared with a standard. If the amount of dye is siylli~icantly elevated (or
lowered, as the case may be), the nuclectide sequence has hyL,li- i~ed with the sample, and the
assay i"dicdles an abnor",al condition such as i"~lan""alion or disease.
The nucleotide sequence for calr can be used to construct hyLridi~lion probes for
~l~ap~i ~g the gene. The nucleotide sequence provided herein may be mapped to a vhlor"osome or
CA 02223038 1997-12-01
W O 96~9511 PCT/U~~~96
specific regions of a cl,r~moso",e using well known genetic and/or chru,noso,,~al ..~appi .g
le~;h.,i les. These lechl, les include in situ hyLridi,dlion, linkage analysis against known
cl,rcn.oso,..al markers hyl,.idi2aliol1 screening with libraries or flow-sorted chromosomal
prepar~lions specific to known cl.lo.r)oso",es and the like. The tech, i le of fluorescent in situ
hyL"i~ Iion of chromosome spreads has been des.-liL,ed among other places, in Verma et al
(1988) Human Gh,u,,,oso,,,es: A Manual of Basic Techl- les Perya",on Press New York City.
Fluorescent in situ hyl,ridi~lion of chrol"oso",al preparations and other physical
vhru~OSG.ne ll~-FPi .9 Iechh-,_es may be correlated with addilional genetic map data. EXdl~, 1~5
of genetic map data can be found in the 1994 Genome Issue of SclOnce (265:1981f).
0 corl~ldlion between the location of calr on a physical cl,r~""osol"al map and a specific disease
(or pledi. position to a specific disease) can help delimit the region of DNA ~-ssoci~ted with that
genetic disease. The n~ o~ t;~P sequence of the subject invention may be used to detect
differences in the genetic sequence between normal and carrier or ~rr~.iIed individuals.
The nucleotide sequence enc~ ,g CALR may be used to produce purified CALR using well
1 5 known methods of ~ecfJ~h[ ~ant DNA technology. Among the many pu !;- 'icns that teach
methods for the ex~ress;on of genes after they have been isolated is Goeddel (1990) Gene
Ex,ur~ssion Te.;hn~!aJy M: -ocls and Enzymology, Vol 185, Acade--, c Press San Diego CA. CALR
may be ex~JIessed in a variety of host cells either prokaryotic or eukaryotic. Host cells may be
from the same species in which calr nucleotide sequences are endogenous or from a dirre,el~t
species. Advantages of producing CAL.R by reco~ ,alll DNA te~:hl,o!c~y include obtaining
adequate amounts of the protein for pu.irication and the availability of simplified purification
procedures.
Cells l~a":jror---ed with DNA encoding CALR may be cultured under con.lilions suitable for
the expression of CALR and recovery of the protein from the cell culture. CALR produced by a
rec-." ~ ,anI cell may be secreted or rnay be contained intr~-- 'u'~rly depenui.,g on the
particular genetic construction used. In general it is more convenient to prepare recombinant
proteins in secreted form. Pu,iricalion steps vary with the production process and the
particular protein produced.
Various methods for the isoldlion of CALR polypeptide may be acc-..",.,li hed byprocedures well known in the art. For example such a polypeptide may be purified by
immunoaffinity chro,nalography by employing the antibodies provided by the present invention.
Various other methods of protein purification well known in the art include those described in
Deutscher M (1990) Methods in Enzymology, Vol 182 Acader"ic Press San Diego CA; and in
Scopes R (1982) Protein P~"iricalion: Principles and Practice Springer-Verlag New York
City, both incorporated herein by reference.
CA 02223038 1997-12-01
W O 96~9511 PCT~US96/08596
In addition to leco., '-: .anl production, fragments of CALR may be produced by direct
peptide synthesis using solid-phase techniques (cf Stewart et al (1969) Solid-Phase Peptide
Synthesis, WH r,ee,-,an Co, San Frdnc;sco CA; M~r-i~ield J (1963) J Am Chem Soc
85:2149-2154). In vitro protein synthesis may be performed using manual techniques or by
aulol.. dlion. Aul."-,dl~d synthesis may be achieved, for exd--., le, using Applied Biosystems 431A
Peptide Synthesizer (ABI, Foster City, California) in accordance with the instructions provided
by the manufacturer. Various fragments of CALR may be cha...i~ 'Iy sy..ll.esi~ed separdl_ly and
combined using cl-er..i ~l ~-~etl-ods to produce the full length poly~,aplide.
CALR for ar,libocl~ induction does not require biological activity; howe~er, the protein
1 0 must be a.. ligel i~ Pe~.lides used to induce specific antibodies may have an amino acid sequence
consi;,li--g of at least five amino acids, pr~t r~bly at least 10 amino acids. They should mimic
an e~ osed structural portion of the amino acid sequence (an epitope) of the protein and may
contain the entire amino acid sequence of a small domain of CALR. Short stretches of CALR
amino acids may be fused with those of another protein such as keyhole limpet hemocyanin, and
1 5 antibody produced against the fusion protein.
A.lliL_ 'ics specific for CALR may be produced by inocl~'~tion of an applupriala animal
with the polypeptide or an ar,ligenic fragment. An antibody is specific for CALR if it is specific
for an immunogenic epitope of the polypeptide and binds to at least part of the natural or
reco",t:.,ar,l protein. Antibody production includes not only the stimulation of an immune
response by injection into animals, but also analogous steps in the production of synthetic
ar,libodies or other specific-binding molecules such as the screening of reco---'-:..anl
immunoglobulin libraries (Orlandi R et al (1989) PNAS 86:3833-37, or Huse WD et al
(1989) Science 256:1275-81) or the in vitro stimulation of Iymphocyte populations.
Current technology (Winter G and Milstein C (1991) Nature 349:293-99) provides for a
number of highly specific binding reagents based on the pri.,, Ies of antibody formation. These
lechr,i,_es may be adapted to produce molecules specifically binding particular domains of
CALR.
An additional embodiment of the subject invention is the use of CALR specific antibodies
or the like as bioactive agents to treat abnormal signal tranccluction events ~-ssoci~l~d with
anaphylactic or hypersensitive responses systemic and local infections, traumatic and other
tissue damage, hereditary or environmental ~ise~-ees associaled with hype~lension, carcinomas,
and other physiologicipdll,GI3gic plotle."s.
Bioactive compositions CGIIl~ ill9 agonists, antagonists, or inhibitors of CALR may be
ad-- .islarad in a Sll~hlE! therapeutic dose determined by any of several m~ll,od~ -s
including clinical studies on r.,a------alian species to determine maximum tolerable dose and on
CA 02223038 1997-12-01
W O 96~9511 PCT~US96/08596
normal human s-~b;~ to del~ .e safe dosage. Ad.lilionally, the bioactive agent may be
Coll~ d with a variety of well est~ hed compounds or cc,...,.~osilions which enhance
stability or pharm~ol~ l properties such as half-life. It is corlen,plated that a therapeutic,
bioactive cGIllposiliol- may be delivered by intravenous infusion into the t'codsl-l:am or any
other effective means which could be used for l-edl---~nl.
The e,~dr. ~'es below are provided to des~;.il,e the subject invention. These examples are
provided by way of illu~l~dlion and are not included for the purpose of limiting the invention.
INDUSTRIAL APPLICABILITY
1 0
Isolation of mRNA and Construction of the cDNA Library
The CALR sequence of this ar~ n was first idenliried in Incyte Clone 8118 (SEQ ID
NO:1) among the sequences cG-..prisi..g the human mast cell library. The cells used to prepare
the human mast cell library were obtained from a Mayo Clinic cancer patient. The mast cell
cDNA library was prepart:d by purifying poly-A+ mRNA and synthesizing double stranded
co,., !er..enlary DNA enzymatically. Synthetic adapters were ligated to the blunt-ended cDNAs
which were then ligated to the phage lambda-derived Uni-ZAPTM vector (Stratagene, La Jolla
CA). This allowed high efficiency un d ~;lional (sense orienldlion) lambda library
construction and the convenience of a plasmid system with blue/white color selection to detect
2 o clones with cDNA i. .se. lions.
The quality of the cDNA library was screened using DNA probes, and then, the
pBluescript(~) phagemid (Sl-dldgene) was ex~ised This phagemid allows the use of a plasmid
system for easy insert chara.;leri~dlion, sequencing, site-dire-;Led mutagenesis, the creation of
unidirectional deletions and e~ sSion of fusion polypeptides S~hsequently, the custom-
constructed library phage particles were infected into E. coli host strain XL1-Blue~'
(Stratagene). The high l.dnsrur-.,dlion efficiency of this bacterial strain increases the
probability that the cDNA library will contain rare, under-represented clones. Alternative
unidirectional vectors might include, but are not limited to, pcDNAI (Invitrogen, San Diego CA)
and pSHlox-1 (Novagen, Madison Wl).
3 o ll Isolation of cDNA Clones
The phagemid forms of individual cDNA clones were obtained by the in yivo exc;;,ion
process, in which XL1-BLUE was ~i ,fe~iLed with an f1 helper phage. Proteins derived from
both lambda phage and f1 helper phage initiate new DNA synthesis from defined sequences on the
lambda target DNA and create a smaller, single--~;l.dnded circular phagemid DNA molecule that
includes all DNA sequences of the p'"uescript plasmid and the cDNA insert. The phagemid DNA
1 o
CA 02223038 1997-12-01
W O 96~9511 PCT/U',~'08Ç96
was ~eleascd from the cells and purified, then used to reinfect fresh bacterial host cells
(SOLRTM Sl"lL~gene), where the do~ nded phager,l'd DNA was produce~l RecRuce thephagemid carries the gene for B-lactamase the newly l"l,-s~c.r",ed bacteria were selected on
medium containing ampicillin.
Phagemid DNA was purified using the QIAWELL-8 Plasmid Pu,iri~dlion System~ from
QIAGEN Inc. (C;h~lsNo,ll, CA). This lechr,i _e provides a rapid and reliable high-throughput
method for Iysing the bacterial cells and isoldli"g highly purified phagemid DNA. The DNA
eluted from the puliricalion resin was s~'~' Ie for DNA sequencing and other analytical
manipulations.
111 Sequencing of cDNA Clones
The cDNA inserts from random isolates of the mast cell library were sequenced in part.
Methods for DNA sequencing are well known in the art. Conventional enzymatic methods
e." '~yed DNA polymerase Klenow fragment, SEQUENASEg' (US Bioche",ical Corp, Cleveland OH)
or Taq poly",erdse to extend DNA chains from an oligonuc~ectide primer annealed to the DNA
ler"~ldle of interest. Methods have been dcveloped for the use of both single- and
double-stranded te."pldles. The chain termination reaction products were electrophoresced on
urea-acrylamide gels and detected either by autoradiog,~phy ffor radionuclide-labeled
precursors~ or by fluorescence (for fluorescent-labeled precursors). Recent improvements
in mechanized reaction preparation, sequencing and analysis using the fluorescenl detection
method have per",itled ek~ansion in the number of sequences that can be dele"" ,ed per day
using machines such as the Catalyst 800 and the Applied Biosystems 377 or 373 DNA
sequencers.
IV Homology Searching of cDNA Clones and neduce~l r,otei.,s
Each sequence so obtained was colllpa,~d to sequences in GenBank using a search
algorill"" dcv~ loped by Applied Biosystems and incorporated into the INHERITTM 670 Sequence
Analysis System. In this algorill"n Pattern Specific-llion Language (developed by TRW Inc. Los
Angeles CA) was used to dt:l~r",i"e regions of homology. The three pa~",elel~ that determine
how the sequence comparisons run were window size window offset and error tolerance. Using
a co" ' i ,~lion of these three parameters the DNA ~ h~e was searched for sequences
cor,l~i"! ,9 regions of homology to the query sequence and the appropriale sequences were
scored with an initial value. .S~hsequently, these homologous regions were examined using dot
matrix homology plots to distinguish regions of homology from chance matches.
-
Smith-Waterman alignments were used to display the results of the homology search.
Peptide and protein sequence homologies were ascertained using the INHERITTM 670Sequence Analysis System in a way similar to that used in DNA sequence l1O"L~IC~ gs Pattern
CA 02223038 1997-12-01
W O 96~9511 PCTAJS96/08~96
Speciricalion Language and parameter wi. Idu~ ~ were used to search protein ~ ces for
sequences conldi, ! 19 regions of ho,-.o~oyy which were scored with an initial value. Dot-matrix
ho., o!agy plots were eAdr. ~ed to distinguish regions of siylliricanl hon Dlcgy from chance
~at~:l,es.
Altematively, BLAST, which stands for Basic Local All_ ""~nl Search Tool, is used to
search for local sequence alignments (Altschul SF (1993) J Mol Evol 36:290-300; Altschul,
SF et al (1990) J Mol Biol 215:403-10). BLAST produces alignments of both nucleotide and
amino acid sequences to d~lell- ~ ~e sequence si~ ily. Because of the local nature of the
alignments, BLAST is especially useful in deter...- .9 exact matches or in identifying homologs.
Whereas it is ideal for matches which do not contain gaps, it is i"appropriale for pelrur-, ,9
motif-style searching. The fundamental unit of BLAST algorill"" output is the High-scoring
Segment Pair (HSP).
An HSP con:,i;,t-~i of two sequence fragments of arbitrary but equal lengths whose
~I_ ""e"t is locally maximal and for which the ~ )r"enl score meets or exceeds a threshold or
cutoff score set by the user. The BLAST appr~,a~,h is to look for HSPs between a query sequence
and a ~ se sequence, to evaluate the ~ l siyl~ cance of any ~"~lches found, and to
report only those matches which satisfy the user-selected threshold of siylli~icance. The
parameter E est~ es the s~ lically siy"iricanl threshold for reporting r~t~h~se sequence
matches. E is i"l~r,u,eled as the upper bound of the expected frequency of chance occurrence of
an HSP (or set of HSPs) within the context of the entire ~t~h~ce search. Any ~ h~ce sequence
whose match satisfies E is reported in the pr~Jyldlll output.
V Identification, Full Length Cloning, Sequencing and Translation
Analysis of INHERITTM results from ~dndo")ly picked and sequenced pollions of clones
from mast cell library ide"liried Incyte 8118 as a homolog of the canineC5a receptor,
CFOMC5AM (Perret et al, supra). The cDNA insert CGm~uri~ g Incyte 8118 was fullysequenced and used as the basis for cloning the full length cDNA.
The cDNA of Incyte 8118 was extended to full length using a modified XL-PCR (Perkin
Elmer) procedure ~licclosed in Patent Application Serial No 08/487,112, by Guegler et al. and
filed June 7, 1995 and hereby incorporated by reference. Two primers were designed--one to
3 o initiate exl~nsiun in the a"li~ense ~ ,tiun (XLR=GAMGACAGCCACCACCACCACG) and the other
to extend sequence in the sense direction (XLF=AGAMGCMGGCAGTCCATTCAGG). The primers
allowed the sequence to be extended "outward" from the known sequence. This generated
alr, '.-c~ns containing new, unknown nucleotide sequence for the gene of interest. The primers
were designed using Oligo 4.0 (National Biosciences Inc, Plymouth MN) to be 22-30
nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence
CA 02223038 1997-12-01
W O 96~9511 PCTAUS96/08596
at te.l.pe-dlures of about 68~-72O C. Any xl,el~l-es of nucleotide sequence which would result
in hairpin structures and primer-primer dimerizations were avoided.
The mast cell cDNA library was used as a ter -pldle, and XLR and XLS primers were used
to extend and amplify the 8118 sequence. By foll~ ;..g the instructions for the XL-PCR kit and
thoroughly mixing the enzyme, reaction mix, etc., high fidelity a.. ~"'icdlion is obtained.
R,~ n! ~9 with 25 pMol of each primer and the leco-.. ended conce.,l,dlions of all other
cor..~onents of the kit, PCR was performed using the MJ PTC200 (MJ Resea,~;h, Wdle,lo..~,
MA) and the f~l'2w;ng pa,d".eler:,:
Step 1 94~ C for 60 sec (initial denaturation)
1 0 Step 2 94~ C for 15 sec
Step 3 65~ C for 1 min
Step 4 68~ C for 7 min
Step 5 Repeat step 2-4 for 15 additional times
Step 6 94~ C for 15 sec
1 5 Step 7 65~ C for 1 min
Step 8 68~ C for 7 min + 15 sec/cycle
Step 9 Repeat step 6-8 for 11 additional times
Step 10 72~ C for 8 min
Step 11 4~ C (and holding)
At the end of 28 cycles, 50 ~11 of the reaction mix was removed; and the remaining
reaction mix was run for an addilional 10 cycles as outlined below:
Step 1 94~ C for 15 sec
Step 2 65~ C for 1 min
Step 3 68~ C for (10 min + 15 sec)/cycle
Step 4 Repeat step 1-3 for 9 additional times
Step 5 72~ C for 10 min
A 5-10 ~LI aliquot of the reaction mixture was analyzed by electrophoresis on a low
concentration, about 0.6-0.8%, agarose mini-gel to determine which reactions were successful
in exten.l;.,g the sequence. Although all exlens;ons potelllidlly contained a full length gene, some
of the largest products or bands were selected and cut out of the gel. Further pu,i~icdlion
involved using a commercial gel extraction method such as QlAQuickTM (QIAGEN). F~o" ~,;.,9
recovery of the DNA, Klenow enzyme was used to trim S;ll_~Q cl,dncled, nu~'eclti~e overl,angs
creating blunt ends which facil;tdled r~'~ n and cloning.
After ethanol prel-i, tion, the products were red;~solved in 13 ~ul of ligation buffer.
Then, 1,u1 T4 DNA ligase (15 units) and 1~11 T4 polynuc'eotide kinase were added, and the
CA 02223038 1997-12-01
WO 96~9511 ~ PCT/U~6/~YÇ96
mixture was inc-lhRtPd at room temperature for 2-3 hours or overnight at 16~ C. Competent E.
coli cells (in 40 ,ul of appropriate media) were lldn~for.,-ed with 3 ~LI of ligation mixture and
cultured in 80 ~LI of SOC medium (Sa".l~.uol; J et al, supra). After inCllhRtion for one hour at
37~ C, the whole l.dr:,ror---alion mixture was plated on Luria Bertani (LB)-agar (Sambrook J
et al, supra) containing carbenicillin at 25 mg/L. The l~lls~ g day, 12 colonies were
randomly picked from each plate and cultured in 150 ~l of liquid LB/carbenicillin medium
placed in an individual well of an approp,idle, commercially-available, sterile 96-well
.,,i~;,uliler plate. The f~ ;,.g day, 5 ~11 of each overnight culture was l-~n:,re.-ed into a non-
sterile 96-well plate and after dilution 1:10 with water, 5 1ll of each sample was transferred
1 o into a PCR array.
For PCR all F''icdlion, 15 111 of conce~ dled PCR mix (1.33X) containing 0.75 units of
Taq polymerase, a vector primer and one or both of the gene specific primers used for the
extension reaction were added to each well. A".~,liricdlion was performed using the following
conditions:
1 5 Step 1 94~ C for 60 sec
Step 2 94~ C for 20 sec
Step 3 55~ C for 30 sec
Step 4 72~ C for 90 sec
Step 5 Repeat steps 2-4 for an additional 29 times
2 o Step 6 72~ C for 180 sec
Step 7 4~ C (and holding)
Aliquots of the PCR reactions were run on agarose gels together with molecular weight
markers. The sizes of the PCR produclts were compared to the original partial cDNAs, and
appluplidle clones were scleclt:d, ligated into plasmid and sequenced.
2 5 The cDNA (SEQ ID NO:1) and amino acid (SEQ ID NO:2) sequences for human CALR are
shown in Figures 1A-C. Incyte's calr produced a BLAST score of 412 when compared with the
C5a receptor sequence and has a prct-~ " y of 1.8-50 that the sequence 5j"~ ity occurred by
chance. This calr homolog also resembles various N-formylpeptide receptors generating BLAST
scores ranging from 381 to 363 with probR~ ' lis~ of 7.4-46 to 3.2-43. When the translation of
CALR was searched against protein ~IRt~hRces such as SwissProt and PIR, no exact matches were
found. Fig 2 shows the cG",parison of the human calr sequence with that of the dog C5a receptor,
CFOMC5AM.
V I Antisense analysis
Knc,~ledge of the correct, CGII, let~ cDNA sequence of CALR enables its use as a tool for
a"~i:,ense techl,cl-gy in the inve~lig~ orl of gene function. Oligonucleotides, cDNA or genomic
CA 02223038 l997-l2-Ol
W O 96~9511 ' = ' ~ PCTAJS96/08596
fragments co-,-plising the a~lisense strand of calr are used either in Yitro or in vivo to inhibit
eA~ ssion of the mRNA. Such le~;hnDlogy is now well known in the art, and anlisense mcle ~les
are designed at various loclllions along the nu~e~: :'o sequences. By treatment of cells or whole
test animals with such anli~ense sequences, the gene of interest can be effectively turned oK.
Frequently, the function of the gene is ascertained by observing behavior at the intracellular,
cellular, tissue or ory~ni .--al level (eg, lethality, loss of dirrer~nli~led function, changes in
~-.or~,holQ~,y, ~tc.).
In addition to using sequences constructed to interrupt ll~nsc,i,ulion of a particular open
reading frame, modiricalions of gene eA,~ression are obtained by designing ar,li~ense sequences to
intron regions, pro"-~,ler/enhancer elements, or even to trans-acting regulatory genes.
Similarly, i..h ~i~ -n is achieved using Hogeboom base-pairing methodology, also known as
"triple helix" base pairing.
V 11 E,~,ression of CALR
Ex~.ression of calr is accor..plisl-ed by subcloning the cDNAs into appropriate expression
vectors and transfecting the vectors into analogous e~,~.ression hosts. In this particular case,
the cloning vector previously used for the generation of the cDNA library, pBluescript, also
provides for direct ex~ ssion of calr sequences in ELÇQli. U~ l-ea-.- of the cloning site, this
vector contains a promoter for B-g~l~.;lo~idAce, followed by sequence conl~i, Iy the
amino-terminal Met and the sllhsequent 7 residues of 13-g~l~clo~id~-ce. Immediately following
these eight residues is an engineered bacteriophage promoter useful for artificial priming and
transcri~lion and a number of unique re~l,iclion sites, including Eco Rl, for cloning.
Induction of the isolated, transfected bacterial strain with IPTG using standard methods
produces a fusion protein corresponding to the first seven residues of B-galactos;dR~e, about 15
residues of "linker", and the peptide encoded within the cDNA. Since cDNA clone inserts are
generaled by an essenlially random process, there is one chance in three that the included cDNA
lies in the correct frame for proper translation. If the cDNA is not in the proper reading
frame, it is obtained by deletion or insertion of the appropri~le number of bases by well known
methods including in vitro mutagenesis, ~I;gestion with exonuclQ~ee lll or mung bean nu~'o~ce
or the inclusion of an oligonucleotide linker of appropriale length.
Alternativelyl the calr cDNA is shuttled into other vectors known to be useful for
ex~ression of protein in specific hosts. Oligonucleotide primers conl~i,.i.,y cloning sites as well
as a segment of DNA (about 25 bases) sufficient to hybridize to :,I.elcl\es at both ends of the
target cDNA is synthesized chemically by standard methods. These primers are then used to
amplify the desired gene seylllenl by PCR. The resulting gene sey~,et)t is ~'ise~: d with
appropri~le lesl~i~lion enzymes under standard condilions and isolated by gel electrophoresis.
CA 02223038 1997-12-01
W O 96~9511 PCTAUS96/08596
Alternately, similar gene segments are produced by dige -n of the cDNA with appru~,iale
re:il,i~tion enzymes. Using app,upri~te primers, se~,l,enls of coding sequence from more than
one gene are ligated together and cloned in apprupri~le vectors. It is poscil~lE to opli",i~e
ex~.r~ss;on by construction of such ch "eric sequences.
S~ ~le ~ "ession hosts for such chimeric molec~ s include, but are not limited to,
,,,c.,,,r,,alian cells such as Chinese I Id",:.ler Ovary (CHO) and human 293 cells, insect cells such
as Sf9 cells, yeast cells such as Saccharomyces cerevisiae. and ba~,ia such as E. coli. For
each of these cell systems, a useful ex~,less;on vector includes an origin of leF'- e~n to allow
prop~g~tion in bacteria and a selert~i-'e marker such as the 13-la-;ld",ase antibiotic les;~l~nce
gene to allow plasmid c cl~tion in ba~teria. In addition, the vector includes a second selectable
marker such as the neomycin phospholl~"sl~rase gene to allow selection in transfected
eukaryotic host cells. Vectors for use in eukaryotic e,~,ression hosts often require RNA
prucess;"g ele~llenlx such as 3' polyadenylation sequences if such are not part of the cDNA of
interest.
Additionally, the vector contains promoters or enhancers which increase gene
ex~ ression. Such pr.,l"oLer~ are host specific and include MMTV, SV40, and metallothionine
promoters for CHO cells; trp, lac, tac and T7 pn,mul~rs for bacterial hosts; and alpha factor,
alcohol oxidase and PGH p,ur"ole,~ for yeast. Transc,iplion enhancel-~i, such as the rous
sarcoma virus enhancer, are used in ",ar"l"alian host cells. Once homogeneous cultures of
recombinant cells are obtained through standard culture methods, large quantities of
recGn qi ldlllly produced CALR are recovered from the condilioned medium and analyzed using
chro",alographic methods known in the art.
V 111 Isolation of Recombinant CALR
CALR is e~,uressed as a chimeric protein with one or more additional polypeptidedomains added to facilitate protein pu,iric~lion. Such purification facililali"g domains include,
but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow
purification on i",r"obili~ed metals, protein A domains that allow pu,iricalion on immobilized
immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system
(Immunex Corp, Seattle WA). The inclusion of a cleavable linker sequence such as Factor XA or
e"ler~ ase (Invitrogen, San Diego CA) between the purification domain and the calr sequence
is useful to f~ t~ e~.r~ssion of CALR.
I X Testing of Chimeric T7Gs
Functional cl,i",eric T7Gs are constructed by co,~ ~i ,i"g the extracellular receptive
sequences of a new isoform with the l,llns",e",bl~ne and intr~e~ r segments of a known
isoform. Such chimeric ",Dlec~es are useful for testing purposes. This concepl was
1 6
,
=~ :
CA 02223038 1997-12-01
W O 96~9511 - . PCT/U~ 96
de,l,on:jlldted by Kobilka et al (1988, .S~-nce 240:1310-1316) who created a series of
chimeric a2-B2 adrenergic receptors (AR) by illsellillg progressively greater amounts of a2-
AR l-dns,-lelllL -dne sequence into B2-AR. The binding activity of known agon: ~ts changed as the
mDle~ e shifted from having more a2 than B2 colll~rlllalion, and intermediate constructs
d~lllon~lldted mixed specificity. The specificity for binding anldgoll;.,ts, however, correlated
with the source of the domain Vll. The illlpolldnce of T7G domain Vll for ligand recogll -n was
also found in chimeras utilizing two yeast a-factor receptors and is s;ylliricant because the
yeast leceplul:j are cl~ccified as ,lli_ce"-neous receptors. Thus, the functional role of specific
dulllains appears to be preserved throughout the T7G family regardless of calegory~
1 0 In parallel fashion, internal seylllenl~ or cytoplasllli ~ domains from a particular
isoform are ex.;hanged with the analogous doll - ~s of a known T7G and used to identify the
structural determinants responsible for coupling the receptors to trimeric G-prvleills
(Dohlman et al (1991) Annu Rev Biochem 60:653-88). A chillleric receptor in which
domains V, Vl, and the intracellular connecting loop from B2-AR are sl-hstitllted into a2-AR
1 5 are shown to bind ligands with a2-AR specificity, but to stimulate adenylate cyclase in the
manner of B2-AR. This demon:,lldles that for adrenergic-type receptors, G-protein
l~cGyl -n is present in dGIllai.ls V and Vl and their connecting loop. The opposite situation was
prel' ~ d and observed for a chimera in which the V->Vl loop from a1-AR replaced the
corresponding domain on B2-AR and the resulting receptor bound ligands with B2-AR
specificity and activated G-protein-mediated phosphdlidylinositol turnover in the a1-AR
manner. Finally, chimeras constructed from muscarillic receptors also demonslldled that V-
>Vl loop is the major determinant for specificity of G-protein activity (Bolander FF, supra).
Chimeric or modified T7Gs cGIlldi~ g substitutions in the extr~cell~ r and
trans.ll~l-.brdne regions have shown that both po,lions of the It7ceptur determine ligand binding
specificity. For example, two Ser residlles are conserved in domain V of all adl~neryic and D
catecholamine receptors and are necessary for potent agonist activity. These serines are
believed to be in the T7G binding site and to form hydrogen bonds with the catechol moiety of the
agonists. Similarly, an Asp residue present in domain lll of all T7Gs which binds bi~genic
amines is believed to be in the T7G binding site and to form an ion pair with the ligand amine
3 o group.
Functional, cloned T7Gs are eA~I 3ssed in h~lerMagous eA~,r~ssion systems and their
biological activity assessed (Marullo et al (1988) Proc Natl Acad Sci 85:7551-55; King et al
(1990) Science 250:121-23). One heter,-lagous system introduces genes for a mammalian
T7G and a Illarllmalian G-protein into yeast cells. The T7G was shown to have apprupri-ale ligand
specificity and affinity and trigger appropridle biological activation--growth arrest and
CA 02223038 1997-12-01
WO 96~9511 PCT/U',''/~Y~96
~-~G~,uh~l-gical changes--of the yeast cells. Incyte sequences for 17G domains are tested in a
similar manner.
X Pro~ction of CALR Specific Antibodies
Two approaches are utilized to raise anliL,c ' -s to CALR, and each approach is useful for
generdli"g either polyclonal or monoclonal antiho~ s In one approach, denatured protein from
reverse phase HPLC sep;s-~lion is obtained in quantities up to 75 mg. This denatured protein is
used to immunize mice or rabbits using standard prol~cols; about 100 ",;.;.uy.a...s are adequate
for immu--i~lion of a mouse, while up to 1 mg might be used to immunize a rabbit. For
identifying mouse hyl,lido,-.as, the denatured protein is r 'ici~-" .aled and used to screen
polenlial murine B-cell h~,l,ridG",as for those which produce anlibo.ly. This procedure requires
only small quantities of protein, such that 20 mg would be sufficient for labeling and screening
of several thousand clones.
In a second approach, the amino acid sequence of an appl~priale CALR domain, as cleduced
from translation of the cDNA, is analyzed to del~r" ~e regions of high immunogenicity.
Oligopeptides comprising appropriale hydrophilic regions, as illustrated in Figure 3, are
sy..ll.esi~ed and used in sllit~hl~ immu.,i~lion plolucols to raise anliL,odies Analysis to select
apprupriale ~eF pes is desc--ibed by Ausubel FM et al (supra). The optimal amino acid
sequences for immunization are usually at the C-terminus, the N-terminus and those
intervening, hyd.uph''- regions of the polypeptide which are likely to be exposed to the
external environment when the protein is in its natural conrur~ation.
Typically, selected peptides, about 15 residues in length, are synthesized using an
Applied Biosystems Peptide Synthesizer Model 431A using fmoc-chen.;~l.y and coupled to
keyhole limpet hemocyanin (KLH; Sigma, St Louis MO) by reaction with M-
maleimidobenzoyl-N- hydroxysucc;., ,.ide ester (MBS; cf. Ausubel FM et al, supra). If
necessary, a cysteine is introduced at the N-terminus of the peptide to permit coupling to KLH.
Rabbits are immunized with the peptide-KLH cGnlplEx in complete Freund's adjuvant. The
resulting a..liser~ are tested for antipeptide activity by binding the peptide to plastic, blocking
with 1% bovine serum albumin, reacting with antisera, washing and reacting with labeled
(radioactive or fluorescent), affinity purified, specific goat anti-rabbit IgG.
HyL.ridG.-.as are prepared and screened using :~tandard techni~ 'es Hybridomas of
interest are dePct~d by screening with labeled CALR to identify those fusions producing the
monoclonal antibody with the desired specificity. In a typical protocol, wells of plates (FAST;
Becton-Dicki..son, Palo Alto CA) are coated during incubation with affinity purified, specific
rabbit-anti-mouse (or sl~it~hlQ anti-species lg) antibodies at 10 mg/ml. The coated wells are
blocked with 1% BSA, washed and inc~h~ted with super.. al~nl-~; from hybridomas. After washing
CA 02223038 l997-l2-Ol
W O 96~9511 . ' PCT~US96/08596
the wells are incuh~ted with labeled CALR at 1 mg/ml. Super,lalanls with specific antih- 'ie6
bind more labeled CALR than is cl~l~ 'e in the background. Then clones producing specific
anl;L- ' ~s are ex~,anded and s~bjP ~ to two cycles of cloning at limiting dilution. Cloned
h~,Lrido",as are injected into pristane-treated mice to produce ascites, and monoclonal aulil,od~
is purified from mouse ascitic fluid by affinity chlorl,dlc,gl~phy on Protein A. Monoclonal
allliL.od;Es with arlillilies of at least 10e8 Me-1, preferably 10e9 to 10e10 or stronger, are
typically produced by standard procedures as described in Harlow and Lane (1988) Antibodies:
A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; and in Goding
(1986) Monocl~nal Antibodies: Principles and Practice, Academic Press, New York NY, both
incorporated herein by reference.
X l Dis ~,-oslic Test Using CALR Specific Antibodies
Particular CALR anlil~o~l;es are useful for invesliydlillg signal transduGtion events and
the diagnosis of infectious or hereditary conditions which are characterized by differences in
the amount or distribution of CALR or do/L,I~lrl3am products of an active signaling cascade. Since
CALR was found in a human mast cell library, it appears to be upregulated in cell types mainly
involved in immune protection or delense.
Diagnostic tests for CALR include Ill~lhocls utilizing antibody and a label to detect CALR in
human body fluids, membranes, cells, tissues or extracts of such. The polypeptides and
antibodies of the present invention are used with or without Illocliricdlion. Frequently, the
polypeptides and ~ iL,o.lies are labeled by joining them, either covalently or noncovalently,
with a substance which provides for a detectable signal. A wide variety of labels and conjugation
techni,Jes are known and have been reported e,~lensively in both the s- .llilic and patent
literature. Suitable labels include radionu-'-des, enzymes, substrates, cofactors, inhibitors,
fluorescenl agents, chemiluminescent agents, magnetic particles and the like. Patents teaching
the use of such labels include US Patent Nos. 3,817,837; 3,850,752; 3,939,350;
3,996,345; 4,277,437; 4,275,149; and 4,366,241. Also, recombinant immunoglobulins
are produced as shown in US Patent No. 4,816,567, illcor~.or~led herein by reference.
A variety of p~olocols for measuring soluble or Ille,llbl~ne-bound CALR, using either
polyclonal or monoclonal antiho~lies specific for the protein, are known in the art. ExdrllFles
include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and
fluorescent activated cell sorting (FACS). A two-site monoclonal-based immunoassay utilizing
monoclonal anlil,odies reactive to two non-interfering epitopes on CALR is pleferl.3d, but a
conlpelili~e binding assay may be el~ ~laycd. These assays are described, among other places, in
Maddox, DE et al (1983, J Exp Med 158:1211f).
X l l Purification of Native CALR Using Specific Antibodies
19
CA 02223038 1997-12-01
W O 96~9511 PCT~US96/08596
Native or .eco" bi:lant CALR is purified by immu..o~rrir-iLy cl,ru,..alug.~phy using
antibodies specific for CALR. In general, an immunoaffinity column is constructed by
covalently coupling the anti-CALR antibody to an activated chl~rlldloyldphic resin.
Polyclonal immunoglobulins are prepared from immune sera either by preCirit-9tion
with a.. ,.on:um sulfate or by purification on immobilized Protein A (Pharmacia LKB
Biotechno!c~,y, Piscataway, NJ). Likewise, monoclonal a--lib~ 'i~s are prepared from mouse
ascites fluid by a..,r.oriurrl sulfate precipitation or ch,un.al~,g-~phy on immobilized Protein A.
Partially purified immunoglobulin is covalently attached to a ~:I.ruln~Lographic resin such as
CnBr-activated Sepharose (Pharmacia, Piscataway NJ). The antibody is coupled to the resin,
the resin is blocked, and the derivative resin is washed accon~i.. g to the manufacturer's
instructions .
Such immunoaffinity columns are utilized in the puliricalion of CALR by preparing a
fraction from cells containing CALR in a soluble form. This preparation is derived by
solubilization of whole cells or of a subcellular fraction obtained via differential centrifugation
(with or without addition of detergent) or by other methods well known in the art.
Alternatively, soluble CALR conl~ g a signal sequence is sec.~led in useful quantity into the
medium in which the cells are grown.
A soluble CALR-containing preparation is passed over the immunoaffinity column, and
the column is washed under conditions that allow the prtl-3renlial absorbance of CALR (eg, high
ionic ::ilrenylll buffers in the p~esence of detergent). Then, the column is eluted under
conditions that disrupt antibody/CALPL binding (eg, a buffer of pH 2-3 or a high concenl,dlion
of a chaotrope such as urea or thiocyanate ion), and CALR is collected.
X l l l Drug Screening
This invention is particularly useful for screening therapeutic compounds by using
CALR or binding fragments thereof in any of a variety of drug screening tech~ es The
polypeptide or fragment employed in such a test is either free in solution, affixed to a solid
support, borne on a cell surface or located intr~c-'lu'~rly. One method of drug screening
utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant
nucleic acids expressing the polypeptide, fragment or chimera as described above. Drugs are
screened against such transformed cells in competitive binding assays. Such cells, either in
viable or fixed form, are used for standard binding assays. The formation of con, '~xes between
CALR and the agent being tested are measured. Alternatively, one examines the diminution in
cor"plex lur~ation between CALR and a receptor caused by the agent being tested.Thus, the present invention provides methods of screening for drugs or any other agents
which affect signal transduction events. These methods, well known in the art, co",pri-~e
CA 02223038 1997-12-01
W O 96/39511 PCT~U~96/~~~96
contacting such an agent with CALR polypeptide or a fragment thereof and assaying (i) for the
presence of a CO~ X between the agent and the CALR polypeptide or fragment, or (ii) for the
presence of a co",, Is-~ between the CALR polypeptide or fragment and the cell. In such
competitive binding assays, the CALR polypeptide or fragment is typically labeled. After
sll -'-le incuh~tion, free CALR polypeptide or fragment is separdled from that present in bound
form, and the amount of free or UIICGlll, 'ex~sd label is a measure of the ability of the particular
agent to bind to CALR or to illtelrere with the formation of the CALR and agent co,l ~'ex
Another technique for drug screening provides high throughput screening for compounds
having suitable binding affinity to the CALR polypeptides and is described in detail in European
Patent Applicdlion 84/03564, published on September 13, 1984, incorporated herein by
reference. Briefly stated, large numbers of dir~erent small peptide test compounds are
synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test
compounds are reacted with CALR polypeptide and washed. Bound CALR polypeptide is then
detected by methods well known in the art. Alternatively, purified CALR is coated directly onto
plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing
antibodies are used to capture the peptide and immobilize it on the solid support.
This invention also contelllpldles the use of competitive drug screerl lg assays in which
neutralizin~ anlib~ 'ics capable of binding CALR specifically compete with a test compound for
binding to CALR polypeptides or fragments thereof. In this manner, the antibodies can be used
to detect the presence of any peptide which shares one or more anligenic d~Lt:nllinants with
CALR.
XIV Rational Drug Design
The goal of rational drug design is to produce structural analogs of biolo~ lly active
polypeptides of interest or of small molecules with which they interact, eg, agonists,
antagonists, or inhibitors. Any of these examples can be used to fashion drugs which are more
active or stable forms of the polypeptide or which enhance or interfere with the function of a
polypeptide in vivo (Hodgson J (1991) Bio/Technology 9:19-21, incorporated herein by
reference).
In one approach, the three-dimensional structure of a protein of interest, or of a
protein-inhibitor complex, is determined by x-ray crystallography, by computer modeling or,
most typically, by a COUI' .lalion of the two approaches. Both the shape and charges of the
polypeptide must be ascertained to elucid~t~ the structure and to determine active site(s) of the
molecule. Less often, useful information regarding the structure of a polypeptide is gained by
modeling based on the structure of homologous prute;~ls~ In both cases, relevant structural
information is used to design erric;enl inhibitors. Useful examples of rational drug design
-
CA 02223038 1997-12-01
WO 96~9511 . PCT/U',Gi~-Ç96
include molecules which have improved activity or stability as shown by Braxton S and Wells
JA (1992, Biochemistry 31:7796- 7801) or which act as inhibitors, agonists, or antagonists
of native peptides as shown by Athauda SB et al (1993 J Biochem 113:742-46), incorporated
herein by r~:f~rence.
It is also poc-! Ie to isolate a target-specific anlil,ody, selected by functional assay, as
desc,iL.ed above, and then to solve its crystal structure. This appruach, in p,i. ', le, yields a
phar",acore upon which s~hsequf3nt drug design is based. It is p~s~' l~ to bypass protein
crystallography altogether by generating anti-idiotypic antibodies (anti-ids) to a functional,
pharmacolot'~ lly active antibody. As a mirror image of a mirror image, the binding site of the
1 o anti-ids is expected to be an analog of the original receptor. The anti-id is then used to identify
and isolate peptides from banks of chemically or biolcy;cally produced peptides. The isolated
peptides then act as the pharmacore.
By virtue of the present invention, sufficient amount of polypeptide are made available
to perform such analytical studies as X-ray crystalloy~aphy~ In addition, knowledge of the CALR
1 5 amino acid sequence provided herein provide 9U- '-nce to those employing computer modeling
techniques in place of or in addition to x-ray crystallography.
XV Iclm.liric~lion of Other Members of the Signal Transduction Complex
Purified CALR is a research tool for idenlific~lion, characterization and purification of
interacting G-proteins, phospholipase C, adenylate cyclase, or other signal trar-sduction
pathway proteins. f2~ ~tive labels are incorporated into a selected CALR domain by various
methods known in the art and used in vitro to capture interacting mole~ s. A preferred
method involves labeling the primary amino groups in CALR with 1251 Bolton-Hunter reagent
(Bolton, AE and Hunter, WM (1973) f3iochem J 133: 529). This reagent has been used to label
various molecules without concomitant loss of biological activity (Hebert CA et al (1991) J
Biol Chem 266: 18989; McColl S et al (1993) J Immunol 150:4550-4555).
Labeled CALR is useful as a reagent for the pL"ifi~lion of molecules with which it
interacts. In one embodiment of affinity purification, membrane-bound CALR is covalently
coupled to a cl,ro",alography column. Cell-free extract derived from mast cells or putative
target cells is passed over the column, and mclec~ 'es with apprup,iale affinity bind to CALR.
The CALR-cor", !ex is recovered from the column, ~ ssoci~ted and the recovered ,I Dlecl~'e is
sll' je-' d to N-terminal protein sequencing. This amino acid sequence is then used to identify
the captured molecule or to design degenerate oligonucleotide probes for cloning the relevant
gene from an apprup~i~le DNA library.
In an -'~ 3r"ale method, artih--lies are raised against CALR, specifically monoclonal
antibodies, as described above. The monoclonal a"liL,od;Es are screened to identify those which
CA 02223038 1997-12-01
W O 96/39511 PCTAU~S~'~5~,~
inhibit the binding between ligands and CALR. These .,.onoclonal anlibc li~s are then used
therapeutically.
XVI Use and Administration of Antibodies, Inhibitors, or Antagonists
Antihc~i~s, inhibitors, or antagonists of CALR (or other l.~al"le"ls to limit signal
trar-cduGtion, LST), provide different effects when ad" ~ )i~ler~d therapeutically. LSTs are
formulated in a nontoxic, inert, pharmaceutically ~ccept~hle aqueous carrier medium
preferably at a pH of about 5 to 8, more preferably 6 to 8, although pH varies according to the
characteristics of the antibody, inhibitor, or antagonist being formulated and the condition to be
treated. Chara~;leri~tics of LSTs include solubility of the molecule, half-life and antigenicity/
immunogenicity; these and other characteristics aid in defining an effective carrier. Native
human proteins are preferred as LSTs, but organic or synthetic molecules resulting from drug
screens are equally effective in particular situations.
LSTs are delivered by known routes of a-J~ini3lldlion including but not limited to topical
creams and gels; transmucosal spray and aerosol; I-dnsder"-al patch and bandage; injectable,
intravenous and lavage formulations; and orally administered liquids and pills particularly
formulated to resist stomach acid and enzymes. The particular formulation, exact dosage, and
route of adl" ,i~l,dlion is determined by the attending physician and varies according to each
specific situation.
Such d~:ler" ,alions are made by considering multiple variables such as the condition to
be treated, the LST to be ae~"~- ~;stered, and the pharmacokinetic profile of the particular LST.
Additional factors which are taken into account include disease state (eg, severity) of the
patient, age, weight, gender, diet, time and frequency of ad".i";~l~dlion, drug combination,
reaction sensitivities, and tolerance/response to therapy. Long acting LST formulations are
administered every 3 to 4 days, every week, or once every two weeks depending on half-life and
clearance rate of the particular LST.
Normal dosage amounts vary from 0.1 to 100,000 Ill;ClOyldllls, up to a total dose of
about 1 9, depending upon the route of adl"i~ ,l,dlion. ~ ce as to particular dosages and
methods of delivery is provided in the literature. See US Patent Nos. 4,657,760; 5,206,344;
or 5,225,212. Those skilled in the art employ different formulations for different LSTs.
Administration to cells such as nerve cells necessi'~Ps delivery in a manner different from that
to other cells such as vascular endothelial cells.
It is conle,npldled that abnormal signal transduction in those con.Jilions or diseases
which trigger mast cell activity cause damage that is treatable with LSTs. Such conditions,
particularly anaphylactic or hypersensilive It:a~oonses~ are treated as discussed above. The LST
is also used to treat other systemic and local infections, traumatic tissue damage, hereditary or
CA 02223038 1997-12-01
W O 96~9511 ~ PCT/U'_51'~35~6
env;,un",~"ldl ~l-se~ses Acsoci~l~d with allergies, hypellensioll, car~i;"o~"a, and other
phy_ioic~ -/pdlllolc_ problems ~csoci~ted with abnormal signal transduction events.
All p~ ns and patents l"enliolled in the above speciricdlion are herein incorporated
by reference. Various mo-l 'ic~lions and variations of the desc,iLed method and system of the
invention will be apparent to those skilled in the art without depa,li"y from the scope and "
spirit of the invention. Although the invention has been described in connection with specific
pler~r,ed e",bod ~,enl:" it should be l,nder:jlood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various mol - ns of the above-
described modes for carrying out the invention which are obvious to those skilled in the field of
molecular biology or related fields are intended to be within the scope of the following claims.
CA 02223038 l997-l2-0l
W O 96~9511 PCT/U',~ 96
~yU~NC~ LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: INCYTE PHARMACEUTICALS, INC.
(ii) TITLE OF lNV~N-l'lUN: C5a-Like Seven Tr~n~ e Receptor
(iii) NUMBER OF ~yu~N~S: 2
(iv) CORT~T~ P~N~N~ ~nnRT.~.qs
(A) AnnR~qSR~: INCYTE PHARMACEUTICALS, INC.
(B) STREET: 3330 Hillview Avenue
(C) CITY: Palo Alto
(D) STATE: CA
(E) COUN-1'KY: USA
(F) ZIP: 94304
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) ~u~RhNl APPLICATION DATA:
(A) APPLICATION NUMBER: To Be Assigned
(B) FILING DATE: Filed Herewith
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION SERIAL NO: 08/462,355
(B) FI~ING DATE: 5-JUN-1995
(viii) ANlOKN~Y/AGENT INFORMATION:
(A) NAME: Luther, Barbara J.
(B) REGISTRATION N~MBER: 33954
(C) REFERENCE/DOCKET NUMBER: PF-0040 PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 415-855-0555
(B) TELEFAX: 415-852-0195
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CE~RACTERISTICS:
(A) LENGTH: 1446 base pairs
(B) TYPE: nucleic acid
- (C) sTR~nRnN~.~,q single
(D) TOPOLOGY: linear
(ii) MoT~FcuT~T~ TYPE: cDNA
(vii) IMMEDIATE SOURCE:
CA 02223038 l997-l2-0l
WO 96~9511 PCTAUS~3;,6
(A) T-TRR~RY: Mast Cell
(B) CLONE: 8118
(xi) S~yu~ DESCRIPTION: SEQ ID NO:1:
ATGGCGTCTT l~l ~ l G~-L~A GACCAATTCA ACTGACCTAC TCTCACAGCC ATGGAATGAG 60
CCCCCAGTAA lL~l~lC~AT GGTCATTCTC AGCCTTACTT TTTTACTGGG ATTGC QGGC 120
AATGGGCTGG TG~l~lGG~l GGCTGGCCTG AAGATGCAGC GGACAGTGAA CACAATTTGG 180
~llC~lCCACC TCACCTTGGC GGAC~lC~lC TGCTGCCTCT CCTTGGCCTT CTCGCTGGCT 240
CA~Ll~G~lC TCCAGGGACA GTGGCCCTAC GGCAGGTTCC TATGCAAGCT CAlCCC'~lCC 300
ATCATTGTCC TCAACATGTT TGGCAGTGTC TTCCTGCTTA CTGCCATTAG CCTGGATCGC 360
l~l~ll~lGG TATTCAAGCC AATCTGGTGT CAGAATCATC GCAATGTAGG GATGGCCTGC 420
TCTATCTGTG GATGTATCTG G~-lG~-lGGCT ~ GCAllC'~l~ C~l~l~C 480
CGGGAAATCT TCACTACAGA CAACCATAAT AGATGTGGCT ACAAATTTGG l~l~lC~AGC 540
TCATTAGATT ATCCAGACTT TTATGGGGAT CCACTAGA~A ACAG~l~l~l TGAAAACATT 600
GTTCAGCCGC CTGGAGA~AT GAATGATACG TTAGATCCTT C~1~11"1C~A AACAAATGAT 660
CATCCTTGGA CAGTCCCCAC ~l~'l~llC~AA CCTCAAACAT TTCAAAGACC TTCTGCAGAT 720
TCA~lCC~l~A GGG~ll~lGC TAGGTTAACA AGTCAAAATC TGTATTCTAA TGTATTTAAA 780
CCTGCTGATG lG~l~l~ACC TA~AATCCCC A~lGG~lllC CTATTGAAGA TCACGAAACC 840
AGCCCACTGG ATAACTCTGA TG~llll~lC TCTACTCATT TAAAGCTGTT CCCTAGCGCT 900
TCTAGCAATT C~ll~lACGA GTCTGAGCTA CCACAAGGTT TCCAGGATTA TTACAATTTA 960
GGCCAATTCA CAGATGACGA TCAAGTGCCA ACACCCCTCG TGGCAATAAC GATCACTAGG 1020
CTAGTGGTGG ~ll~lC~lGCT GCC~l~l~ll ATCATGATAG C~l~llACAG CTTCATTGTC 1080
TTCCGAATGC A~AGGGGCCG CTTCGCCAAG TCTCAGAGCA AAAC~lllCG AGTGGCCGTG 1140
GTGGTGGTGG ~'l~-l~'lL-l'~l TGTCTGCTGG ACTCCATACC ACATTTGGGG A~-1~C~ A 1200
TTGCTTACTG ACCCAGAAAC ~lCC~ll~GGG A~AACTCTGA ~l~lC~lGG~A TCATGTATGC 1260
ATTGCTCTAG CATCTGCCAA TAGTTGCTTT AATCCCTTCC TTTATGCCCT CTTGGGGA~A 1320
GATTTTAGGA AGA~AGCAAG GCAGTCCATT QGGGAATTC TGGAGGCAGC CTTCAGTGAG 1380
GAGCTCACAC GTTCCACCCA ~ ~lCC~l~A AACAATGTCA TTTCAGA~AG AAATAGTACA 1440
26
CA 02223038 1997-12-01
W O 96~9511 PCT/U~ ;g6
ACTGTG 1446
(2) INFORMATION FOR SEQ ID NO: 2:
yu~ ; CE~R~CTERISTICS:
(A) LENGTH: 482 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi ) ~ Uu~ ; DESCRIPTION: SEQ ID NO: 2:
~et Ala Ser Phe Ser Ala Glu Thr Asn Ser Thr Asp Leu Leu Ser Gln
~ro Trp Asn Glu Pro Pro Val Ile Leu Ser Met Val Ile Leu Ser Leu
~hr Phe Leu Leu Gly Leu Pro Gly Asn Gly Leu Val Leu Trp Val Ala
Gly Leu Lys Met Gln Arg Thr Val Asn Thr Ile Trp Phe Leu His Leu
Thr Leu Ala Asp Leu Leu Cys Cys Leu Ser Leu Ala Phe Ser Leu Ala
~is Leu Ala Leu Gln Gly Gln Trp Pro Tyr Gly Arg Phe Leu Cys Lys
~eu Ile Pro Ser Ile Ile Val Leu Asn Met Phe Gly Ser Val Phe Leu
100 105 110
Leu Thr Ala Ile Ser Leu Asp Arg Cys Leu Val Val Phe Lys Pro Ile
115 120 125
Trp Cys Gln Asn His Arg Asn Val Gly Met Ala Cys Ser Ile Cys Gly
130 135 140
Cys Ile Trp Val Val Ala Phe Val Leu Cys Ile Pro Val Phe Val Tyr
145 150 155 160
~rg Glu Ile Phe Thr Thr Asp Asn His Asn Arg Cys Gly Tyr Lys Phe
165 170 175
~ly Leu Ser Ser Ser Leu Asp Tyr Pro Asp Phe Tyr Gly Asp Pro Leu
180 185 190
~lu Asn Arg Ser Leu Glu Asn Ile Val Gln Pro Pro Gly Glu Met Asn
195 200 205
CA 02223038 l997-l2-Ol
W O 96~9511 - . PCT~US96/08596
Asp Arg Leu Asp Pro Ser Ser Phe Gln Thr Asn Asp His Pro Trp Thr
210 215 220
Val Pro Thr Val Phe Gln Pro Gln Thr Phe Gln Arg Pro Ser Ala Asp
225 230 235 240
~er Leu Pro Arg Gly Ser Ala Arg Leu Thr Ser Gln Asn Leu Tyr Ser
245 250 255
~sn Val Phe Lys Pro Ala Asp Val Val Ser Pro Lys Ile Pro Ser Gly
260 265 270
Phe Pro Ile Glu Asp His Glu Thr Ser Pro Leu Asp Asn Ser Asp Ala
275 280 285
Phe Leu Ser Thr His Leu Lys Leu Phe Pro Ser Ala Ser Ser Asn Ser
290 295 300
Phe Tyr Glu Ser Glu Leu Pro Gln Gly Phe Gln Asp Tyr Tyr Asn Leu
305 310 315 320
~ly Gln Phe Thr Asp Asp Asp Gln Val Pro Thr Pro Leu Val Ala Ile
325 330 335
~hr Ile Thr Arg Leu Val Val Gly Phe Leu Leu Pro Ser Val Ile Met
340 345 350
Ile Ala Cys Tyr Ser Phe Ile Val Phe Arg Met Gln Arg Gly Arg Phe
355 360 365
Ala Lys Ser Gln Ser Lys Thr Phe Arg Val Ala Val Val Val Val Ala
370 375 380
Val Phe Leu.Val Cys Trp Thr Pro Tyr His Ile Trp Gly Val Leu Ser
385 390 395 400
~eu Leu Thr Asp Pro Glu Thr Pro Leu Gly Lys Thr Leu Met Ser Trp
405 410 415
~sp His Val Cys Ile Ala Leu Ala Ser Ala Asn Ser Cys Phe Asn Pro
420 425 430
Phe Leu Tyr Ala Leu Leu Gly Lys Asp Phe Arg Lys Lys Ala Arg Gln
435 440 445
Ser Ile Gln Gly Ile Leu Glu Ala Ala Phe Ser Glu Glu Leu Thr Arg
450 455 460
Ser Thr His Cys Pro Ser Asn Asn Val Ile Ser Glu Arg Asn Ser Thr
465 470 475 480
Thr Val
