Note: Descriptions are shown in the official language in which they were submitted.
CA 02236161 1998-05-21
1JNIMOLECULAR SEGMENT,tMPLIFICATION AND DETECTION
The disclosed invention is generally in the field of assays for detection of
nucleic acids,
and specifically in the field of nucleic acid amplification and sequencing.
The invention is also in
the field of rolling circle amplification (see, for example, Lewin, "Genes II"
(J. Wiley and sons,
1985) page 525).
A number of methods have been developed which permit the implementation of
extremely
sensitive diagnostic assays based on nucleic acid detection. Most of these
methods employ
exponential amplification of targets or ;probes. These include the polymerase
chain reaction
(PCR), ligase chain reaction (LCR), self-sustained sequence replication (3SR),
nucleic acid
sequence based amplification (NASBA), strand displacement amplification (SDA),
and
amplification with Q(3 replicase (Birkeruneyer and Mushahwar, J. Virological
Methods, 35:117-
126 (1991); Landegren, Trends Genetics, 9:199-202 (1993)).
While all of these methods offer good sensitivity, with a practical limit of
detection of
about 100 target molecules, all of them suffer from relatively low precision
in quantitative
measurements. This lack of precision manifests itself most dramatically when
the diagnostic assay
is implemented in multiplex format, that is, in a format designed for the
simultaneous detection of
several different target sequences.
In practical diagnostic applicaticins it is desirable to assay for many
targets simultaneously.
Such multiplex assays are typically used to detect five or more targets. It is
also desirable to
obtain accurate quantitative data for the targets in these assays. For
example, it has been
demonstratecl that viremia can be correPated with disease status for viruses
such as HIV-1 and
hepatitis C (Lefrere et al., Br. J. Haematol., 82(2):467-471 (1992), Gunji et
al., Int. J. Cancer,
52(5):726-730 (1992), Hagiwara et al., Hepatology, 17(4):545-550 (1993), Lu et
al., J. Infect.
Dis., 168(5):1165-8116 (1993), Piatak et al., Science, 259(5102):1749-1754
(1993), Gupta et al.,
Ninth International Conference on AIDS/Fourth STD World Congress, June 7-11,
1993, Berlin,
Germany, Saksela et al., Proc. Natl. Acad. Sci. USA, 91(3):1104-1108 (1994)).
A method for
accurately quantitating viral load would be useful.
In a multiplex assay, it is especially desirable that quantitative
measurements of different
targets accurately reflect the true ratio of the target sequences. However,
the data obtained using
multiplexed, exponential nucleic acid atnplification methods is at best semi-
quantitative. A
number of factors are involved:
1. Wher,i a multiplex assay involves different priming events for different
target sequences,
the relative efficiency of these events may vary for different targets. This
is due to the stability
and structural differences between the various primers used.
2. If the rates of product strand reriaturation differ for different targets,
the extent of
competition with priming events will not be the same for all targets.
1
AM~NDED SHEET
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
3. For reactions involving multiple: ligation events, such as LCR, there may
be small but
significant differences in the relative efficiency of ligation events for each
target sequence. Since
the ligation events are repeated many times, this effect is magnified.
4. For reactions involving reverse transcription (3SR, NASBA) or klenow strand
displacement (SDA), the extent of polymerization processivity may differ among
different target
sequences.
5. For assays involving different replicatable RNA probes, the replication
efficiency of each
probe is usually not the same, and hence the probes compete unequally in
replication reactions
catalyzed by Qg replicase.
6. A relatively small difference in yield in one cycle of amplification
results in a large
difference in amplification yield after several cycles. For example, in a PCR
reaction with 25
amplification cycles and a 10% difference in yield per cycle, that is, 2-fold
versus 1.8-fold
amplification per cycle, the yield woulct be 2.01=33,554,000 versus
1.825=2,408,800. The
difference in overall yield after 25 cycles is 14-fold. After 30 cycles of
amplification, the yield
difference would be more than 20-fold.
Accoi-dingly, there is a need for amplification methods that are less likely
to produce
variable and possibly erroneous signal yields in multiplex assays.
It is therefore an object of the disclosed invention to provide a method of
amplifying
diagnostic nucleic acids with amplification yields proportional to the amount
of a target sequence
in a sample.
It is another object of the disclosed invention to provide a method of
detecting specific
target nucleic acid sequences present in a sample where detection efficiency
is not dependent on
the structure of the target sequences.
It is amother object of the disclosed invention to provide a method of
determining the
amount of specific target nucleic acid sequences present in a sample where the
signal level
measured is proportional to the amount of a target sequence in a satnple and
where the ratio of
signal levels measured for different target sequences substantially matches
the ratio of the
amount of the different target sequences present in the sample.
It is another object of the disclosed invention to provide a method of
detecting and
determining the amount of multiple specific target nucleic acid sequences in a
single sample
where the ratio of signal levels measur(xl for different target nucleic acid
sequences substantially
matches the ratio of the amount of the different target nucleic acid sequences
present in the
sample.
It is another object of the disclosed invention to provide a method of
detecting the
presence of single copies of target nucleic acid sequences in situ.
2
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
It is another object of the disclosed invention to provide a method of
detecting the
presence of target nucleic acid sequences representing individual alleles of a
target genetic
element.
It is another object of the disclosed invention to provide a method for
detecting, and
determining the relative amounts of, multiple molecules of interest in a
sample.
It is another object of the disclosed invention to provide a method for
determining the
sequence of a target nucleic acid sequence.
It is another object of the present invention to provide a method of
determining the range
of sequences present in a mixture of target nucleic acid sequences.
SUMMARY OF THE INVENTION
Disclosed are compositions and a method for amplifying nucleic acid sequences
based on
the presence of a specific target sequence or analyte. The method is useful
for detecting specific
nucleic acids or analytes in a sample with high specificity and sensitivity.
The method also has
an inherently low level of background signal. Preferred embodiments of the
method consist of a
DNA ligation operation, an amplification operation, and, optionally, a
detection operation. The
DNA ligation operation circularizes a specially designed nucleic acid probe
molecule. This step
is dependent on hybridization of the probe to a target sequence and forms
circular probe
molecules in proportion to the amount of target sequence present in a sample.
The amplification
operation is i-olling circle replication of the circularized probe. A single
round of amplification
using rolling circle replication results in a large amplification of the
circularized probe
sequences, oirders of magnitude greater than a single cycle of PCR replication
and other
amplification techniques in which each cycle is limited to a doubling of the
number of copies of
a target sequence. Rolling circle amplification can also be performed
independently of a ligation
operation. By coupling a nucleic acid tag to a specific binding molecule, such
as an antibody,
amplification of the nucleic acid tag can be used to detect analytes in a
sample. This is preferred
for detection of analytes where an amplification target circle serves as an
amplifiable tag on a
reporter binding molecule, or where an amplification target circle is
amplified using a rolling
circle replication primer that is part of a reporter binding molecule.
Optionally, an additional
amplification operation can be performed on the DNA produced by rolling circle
replication.
Following amplification, the amplified sequences can be detected and
quantified using
any of the conventional detection systems for nucleic acids such as detection
of fluorescent
labels, enzyn:ie-linked detection systems, antibody-mediated label detection,
and detection of
radioactive labels. Since the amplified product is directly proportional to
the amount of target
sequence present in a sample, quantitative measurements reliably represent the
amount of a
target sequer,tce in a sample. Major advantages of this method are that the
ligation operation can
3
CA 02236161 1998-05-21
WO 97/19193- PCT/US96/18812
be manipulated to obtain allelic discrimination, the amplification operation
is isothermal, and
signals are strictly quantitative because the amplification reaction is linear
and is catalyzed by a
highly processive enzyme. In multiplex assays, the primer oligonucleotide used
for DNA
replication can be the same for all probes.
Following amplification, the nucleotide sequence of the amplified sequences
can be
determined either by conventional means or by primer extension sequencing of
amplified target
sequence. Two preferred modes of primer extension sequencing are disclosed.
Unimolecular
Segment Amplification and Sequencing (USA-SEQ), a form of single nucleotide
primer
extension sequencing, involves interrogation of a single nucleotide in an
amplified target
sequence by incorporation of a specific and identifiable nucleotide based on
the identity of the
interrogated nucleotide. Unimolecular Segment Amplification and CAGE
Sequencing (USA-
CAGESEQ), a form of degenerate probe primer extension sequencing, involves
sequential
addition of degenerate probes to an interrogation primer hybridized to
ainplified target
sequences. Addition of multiple probes is prevented by the presence of a
removable cage at the
3' end. After addition of the degenerate probes, the cage is removed and
further degenerate
probes can be added or, as the final operation, the nucleotide next to the end
of the interrogation
primer or the last added degenerate probe is interrogated as in USA-SEQ to
determine its
identity. The disclosed primer extension sequencing methods are useful for
identifying the
presence of multiple distinct sequences in a mixture of target sequences.
The clisclosed method has two features that provide simple, quantitative, and
consistent
amplificatior.i and detection of a target nucleic acid sequence. First, target
sequences are
amplified via a small diagnostic probe with an arbitrary primer binding
sequence. This allows
consistency in the priming and replication reactions, even between probes
having very different
target sequerices. Second, amplification takes place not in cycles, but in a
continuous,
isothermal replication: rolling circle replication. This makes amplification
less complicated and
much more consistent in output.
Also disclosed are compositions and a method for of multiplex detection of
molecules of
interest involving rolling circle replication. The method is useful for
simultaneously detecting
multiple specific nucleic acids in a sample with high specificity and
sensitivity. The method also
has an inherently low level of background signal. A preferred form of the
method consists of an
association operation, an amplification operation, and a detection operation.
The association
operation involves association of one or more specially designed probe
molecules, either wholly
or partly nucleic acid, to target molecules of interest. This operation
associates the probe
molecules to a target molecules present in a sample. The amplification
operation is rolling circle
replication of circular nucleic acid molecules, termed amplification target
circles, that are either
4
CA 02236161 2006-10-04
75304-70
a part of, or hybridized to, the probe molecules. A single
round of amplification using rolling circle replication
results in a large amplification of the amplification target
circles, orders of magnitude greater than a single cycle of
PCR replication and other amplification techniques in which
each cycle is limited to a doubling of the number of copies
of a target sequence. By coupling a nucleic acid tag to a
specific binding molecule, such as an antibody,
amplification of the nucleic acid tag can be used to detect
analytes in a sample.
Following rolling circle replication, the
amplified sequences can be detected using combinatorial
multicolor coding probes that allow separate, simultaneous,
and quantitative detection of multiple different amplified
target sequences representing multiple different target
molecules. Since the amplified product is directly
proportional to the amount of target sequence present in a
sample, quantitative measurements reliably represent the
amount of a target sequence in a sample. Major advantages
of this method are that a large number of distinct target
molecules can be detected simultaneously, and that
differences in the amounts of the various target molecules
in a sample can be accurately quantified. It is also
advantageous that the DNA replication step is isothermal,
and that signals are strictly quantitative because the
amplification reaction is linear and is catalyzed by a
highly processive enzyme.
The disclosed method has two features that provide
simple, quantitative, and consistent detection of multiple
target molecules. First, amplification takes place not in
cycles, but in a continuous, isothermal replication:
rolling circle replication. This makes amplification less
complicated and much more consistent in output. Second,
5
CA 02236161 2006-10-04
75304-70
combinatorial multicolor coding allows sensitive
simultaneous detection of a large number different target
molecules.
Thus, in one aspect, the present invention
provides a method of amplifying nucleic acid sequences, the
method comprising, (a) mixing one or more rolling circle
replication primers with one or more amplification target
circles (ATCs), to produce a primer-ATC mixture, and
incubating the primer-ATC mixture under conditions that
promote hybridization between the amplification target
circles and the rolling circle replication primers in the
primer-ATC mixture, wherein the amplification target circles
each comprise a single-stranded, circular DNA molecule
comprising a primer complement portion, wherein the primer
complement portion is complementary to at least one of the
rolling circle replication primers; and (b) mixing DNA
polymerase with the primer-ATC mixture, to produce a
polymerase-ATC mixture, and incubating the polymerase-ATC
mixture under conditions that promote replication of the
amplification target circles, wherein replication of the
amplification target circles results in the formation of
tandem sequence DNA; wherein the method further comprises at
least one of the following: (1) an amplification operation;
(2) the use of at least one rolling circle replication
primer coupled to a specific binding molecule; (3) the use
of at least one amplification target circle tethered to a
specific binding molecule; (4) a nucleic acid collapse
operation; (5) a combinatorial multicolor coding detection
operation; (6) differential amplification of at least two of
the amplification target circles; and (7) primer-extension
sequencing; wherein the amplification operation (i) is
performed simultaneous with, or following step (b); (ii) is
selected from the group consisting of nested ligation
5a
CA 02236161 2006-10-04
75304-70
mediated rolling circle amplification, secondary DNA strand
displacement, and transcription; and (iii) results in the
formation of secondary tandem sequence DNA or tandem
sequence RNA.
In another aspect, the present invention provides
a method of amplifying nucleic acid sequences, the method
comprising, (a) mixing one or more different open circle
probes (OCPs) with a target sample comprising one or more
target sequences, to produce an OCP-target sample mixture,
and incubating the OCP-target sample mixture under
conditions that promote hybridization between the open
circle probes and the target sequences in the OCP-target
sample mixture; (b) mixing ligase with the OCP-target sample
mixture, to produce a ligation mixture, and incubating the
ligation mixture under conditions that promote ligation of
the open circle probes to form amplification target circles
(ATCs); (c) mixing a rolling circle replication primer with
the ligation mixture, to produce a primer-ATC mixture, and
incubating the primer-ATC mixture under conditions that
promote hybridization between the amplification target
circles and the rolling circle replication primer in the
primer-ATC mixture; and (d) mixing DNA polymerase with the
primer-ATC mixture, to produce a polymerase-ATC mixture, and
incubating the polymerase-ATC mixture under conditions that
promote replication of the amplification target circles;
wherein replication of the amplification target circle
results in the formation of tandem sequence DNA; wherein
the method further comprises at least one of the following:
(1) an amplification operation; (2) the use of at least one
rolling circle replication primer that is coupled to a
specific binding molecule; (3) the use of a reporter binding
agent as at least one of the target sequences; (4) a nucleic
acid collapse operation; (5) a combinatorial multicolor
5b
CA 02236161 2006-10-04
75304-70
coding detection operation; (6) differential amplification;
and (7) primer-extension sequencing; (8) the use of one or
more gap oligonucleotides; (9) the use of a primary
amplification target circle as at least one of the target
sequences; wherein the amplification operation (i) is
performed simultaneous with, or following step (d); (ii) is
selected from the group consisting of nested ligation
mediated rolling circle amplification, secondary DNA strand
displacement, and transcription; and (iii) results in the
formation of secondary tandem sequence DNA or tandem
sequence RNA; and wherein the primary amplification target
circle is formed by (i) mixing a primary open circle probe
with a primary target sample, to produce a primary OCP-
target sample mixture, and incubating the primary OCP-target
sample mixture under conditions that promote hybridization
between the primary open circle probe and a primary target
sequence in the primary OCP-target sample mixture; wherein
the primary target sequence comprises a 5' region and a 3'
region; and wherein the primary open circle probe comprises
a single-stranded, linear DNA molecule comprising, from 5'
end to 3' end, a 5' phosphate group, a right target probe
portion, a spacer portion, a left target probe portion, and
a 3' hydroxyl group, wherein the left target probe portion
is complementary to the 3' region of the primary target
sequence and the right target probe portion is complementary
to the 5' region of the primary target sequence, and (ii)
mixing ligase with the primary OCP-target sample mixture, to
produce a primary ligation mixture, and incubating the
primary ligation mixture under conditions that promote
ligation of the primary open circle probe resulting in the
formation of the primary amplification target circle.
In another aspect, the present invention provides
a kit for selectively detecting one or more target
5c
CA 02236161 2006-10-04
75304-70
molecules, the kit comprising, (a) one or more amplification
target circles, wherein the amplification target circles
each comprise a single-stranded, circular DNA molecule
comprising a primer complement portion; and (b) a rolling
circle replication primer comprising a single-stranded,
linear nucleic acid molecule comprising a complementary
portion that is complementary to the primer complement
portion of one or more of the amplification target circles;
wherein either (1) each amplification target circle is
tethered to a specific binding molecule, or (2) the rolling
circle replication primer is coupled to a specific binding
molecule, wherein the specific binding molecule interacts
with at least one of the target molecules.
In another aspect, the present invention provides
a kit for selectively amplifying nucleic acid sequences
related to one or more target sequences, each comprising
a 5' region and a 3' region, the kit comprising, (a) one or
more open circle probes each comprising a single-stranded,
linear DNA molecule comprising, from 5' end to 3' end, a 5'
phosphate group, a right target probe portion, a spacer
portion, a left target probe portion, and a 3' hydroxyl
group, wherein the spacer portion comprises a primer
complement portion, and wherein the left target probe
portion is complementary to the 3' region of at least one of
the target sequences and the right target probe portion is
complementary to the 5' region of the same target sequence;
(b) a rolling circle replication primer comprising a single-
stranded, linear nucleic acid molecule comprising a
complementary portion that is complementary to the primer
complement portion of one or more of the open circle probes;
and (c) one or both of (1) a secondary DNA strand
displacement primer comprising a single-stranded, linear
nucleic acid molecule comprising a matching portion that
5d
CA 02236161 2006-10-04
75304-70
matches a portion of one or more of the open circle probes,
and (2) one or more reporter binding agents each comprising
an affinity portion and an oligonucleotide portion, wherein
the oligonucleotide portion comprises one of the target
sequences.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a diagram of an example of an open
circle probe hybridized to a target sequence. The diagram
shows the relationship between the target sequence and the
right and left target probes.
Figure 2 is a diagram of an example of a gap
oligonucleotide and an open circle probe hybridized to a
target sequence. The diagram shows the relationship between
the target sequence, the gap oligonucleotide, and the right
and left target probes.
Figure 3 is a diagram of an open circle probe
hybridized and ligated to a target sequence. The diagram
shows how the open circle probe becomes topologically locked
to the target sequence.
Figure 4 is a diagram of rolling circle
amplification of an open circle probe topologically locked
to the nucleic acid containing the target sequence.
Figure 5 is a diagram of an example of an open
circle probe. Various portions of the open circle probe are
indicated by different fills.
5e
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
Figure 6 is a diagram of tandem sequence DNA (TS-DNA) and an address probe
designed to hybridize to the portion of the TS-DNA corresponding to part of
the right and left
target probes of the open circle probe and the gap oligonucleotide. The TS-DNA
is SEQ ID
NO:2 and the address probe is SEQ ID NO:3.
Figure 7 is a diagram of the capture and detection of TS-DNA. Capture is
effected by
hybridization of the TS-DNA to address probes attached to a solid-state
detector. Detection is
effected by h.ybridization of secondary detection probes to the captured TS-
DNA. Portions of
the TS-DNA corresponding to various portions of the open circle probe are
indicated by
different fills.
Figure 8 is a diagram of an example of ligation-mediated rolling circle
replication
followed by transcription (LM-RCT). Diagramed at the top is a gap
oligonucleotide and an open
circle probe, having a primer complement portion and a promoter portion next
to the right and
left target probe portions, respectively, hybridized to a target sequence.
Diagramed at the
bottom is the: rolling circle replication product hybridized to unligated
copies of the open circle
probe and gap oligonucleotide. This hybridization forms the double-stranded
substrate for
transcription.
Figure 9 is a diagram of an exainple of a multiplex antibody assay employing
open circle
probes and L.M-RCT for generation of an amplified signal. Diagramed are three
reporter
antibodies, each with a different oligonucleotide as a DNA tag. Diagramed at
the bottom is
amplification of only that DNA tag coupled to a reporter antibody that bound.
Figure 10 is a diagram of two schemes for multiplex detection of specific
amplified
nucleic acids. Diagramed at the top is hybridization of detection probes with
different labels to
amplified nucleic acids. Diagramed at the bottom is hybridization of amplified
nucleic acid to a
solid-state detector with address probes for the different possible
amplification products attached
in a pattern.
Figures 11A and 11B are diagrams of an example of secondary DNA strand
displacement. Diagramed at the top of Figure 11A is a gap oligonucleotide and
an open circle
probe hybridized to a target sequence. Diagramed at the bottom of Figure 11A
is the rolling
circle replication product hybridized to secondary DNA strand displacement
primers.
Diagramed in Figure 11B is secondary DNA strand displacement initiated from
multiple primers.
Figure 11B illustrates secondary DNA strand displacement carried out
simultaneously with
rolling circle replication.
Figure 12 is a diagram of an example of nested RCA using an unamplified first
open
circle probe as the target sequence. Diagramed at the top is a gap
oligonucleotide and a first
open circle probe hybridized to a target: sequence, and a secondary open
circle probe hybridized
6
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
to the first open circle probe. Diagramed at the bottom is the rolling circle
replication product
of the secondary open circle probe.
Figure 13 is a diagram of an example of strand displacement cascade
amplification.
Diagramed is the synthesis and template relationships of four generations of
TS-DNA. TS-
DNA-1 is generated by rolling circle replication primed by the rolling circle
replication primer.
TS-DNA-2 and TS-DNA-4 are generated by secondary DNA strand displacement
primed by a
secondary DNA strand displacement primer (P2). TS-DNA-3 is generated by strand-
displacing
secondary DNA strand displacement primed by a tertiary DNA strand displacement
primer (P1).
Figure 14 is a diagram of an example of opposite strand amplification.
Diagramed are
five differeni., stages of the reaction as I)NA synthesis proceeds. TS-DNA-2
is generated by
secondary DNA strand displacement of TS-DNA primed by the secondary DNA strand
displacement primer. As rolling circle replication creates new TS-DNA
sequence, the secondary
DNA strand displacement primer hybridizes to the newly synthesized DNA and
primes synthesis
of another copy of TS-DNA-2.
Figure 15 is a diagram of an open circle probe including a gap sequence. The
lower half
of the diagram illustrates a preferred relationship between sequences in the
open circle probe and
interrogation, primers.
Figures 16A, 16B, and 16C are diagrams showing the results of unimolecular
segment
amplificatior.t and sequencing (USA-SEQ) performed on three different nucleic
acid samples.
The large circles represent a target sam.ple dot on a solid-state support. The
small circles
represent individual TS-DNA molecules, amplified in situ at the location of
target nucleic acids
in the sample, which have been subjected to primer extension sequencing.
Figure 16A is
representative of a sample that is homozygous for the wild type sequence
(indicated by
incorporation of cystine). Figure 16B is representative of a sample that is
heterozygous for the
wild type and a mutant (indicated by ari equal number of TS-DNA molecules
resulting in
incorporatioii of cystine and adenine). Figure 16C is representative of a
sample that is
homozygous but includes a few cells with a somatic mutation.
Figures 17A and 17B are diagrams of an example of the relationship of an open
circle
probe to twa target sequences having a different amount of a repeating
sequence. The
hybridization of the left target probe anid the right target probe of the open
circle probe to the
two different target sequences is shown (with I indicating hydrogen bonding).
The fill
sequences are the nucleotides, complementary to the sequence in the target
sequence opposite the
gap space, which will fill the gap space between the left and right target
probes to join the open
circle probe into an amplification target circle. The sequences depicted in
the diagrams relate to
the assay described in Example 10. In Figure 17A, the target sequence is SEQ
ID NO:24, the
7
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
left target sequence is nucleotides 76 to 96 of SEQ ID NO:25, the right target
sequence is
nucleotides 1 to 24 of SEQ ID NO:25, and the fill sequence is nucleotides 97
to 128 of SEQ ID
NO:25. In Figure 17B, the target sequence is SEQ ID NO:23, the left target
sequence is
nucleotides 2 to 21 of SEQ ID NO: 18, the right target sequence is nucleotides
1 to 24 of SEQ
ID NO:25, and the fill sequence is nucleotides 22 to 51 of SEQ ID NO: 18.
Figures 18A, 18B, 18C, 18D, and 18E are diagrams showing a slide containing an
array
of nucleic acid samples and coverage of rows of samples with a mask during
unimolecular
segment amplification and cage sequeiicing (USA-CAGESEQ).
Figure 19 is a diagram showing the nucleotide incorporated in the first column
of
samples on a slide subjected to USA-CAGESEQ. The samples correspond to the
target sequence
shown in Figure 17A.
Figure 20 is a diagram showing the nucleotide incorporated in the first column
of
samples on a slide subjected to USA-CAGESEQ. The samples correspond to the
target sequence
shown in Figure 17B.
Figures 21A, 21B, 22A, 22B, 23A, 23B, 24A, and 24B depict interrogation
primers,
formed from interrogation probes and degenerate probes, hybridized to TS-DNA.
The figures
depict five slides and TS-DNA representing a single column of five sample dots
from each slide.
In each row, the top (shorter) sequence is the interrogation primer and the
bottom (longer)
sequence is a portion of the TS-DNA. The non-underlined portions of the
interrogation primers
represent the interrogation probe. The underlined portions of the
interrogation primers were
formed by sequential ligation of one or more degenerate probes to the end of
the interrogation
probe. The nucleotide in boldface is the nucleotide added to the interrogation
primer during
primer extension. The TS-DNA sequences shown in Figures 21A, 21B, 22A, and 22B
are
related to the target sequence shown in Figure 17A and correspond to
nucleotides 1 to 60 of
SEQ ID NO:19. The interrogation primer sequences in Figures 21A, 21B, 22A, and
22B
correspond to various portions of nucleotides 76 to 125 of SEQ ID NO:25. The
sequences
shown in Figures 23A, 23B, 24A, and. 24B are related to the target sequence
shown in Figure
17B and coi=respond to nucleotides 1 to 58 of SEQ ID NO:26. The interrogation
primer
sequences in Figures 23A, 23B, 24A, and 24B correspond to various portions of
nucleotides 1 to
50 of SEQ lD NO:18.
Figures 25A and 25B are diagrams of a reporter binding molecule made up of a
peptide
nucleic acid (as the affinity portion) and a rolling circle replication primer
(as the oligonucleotide
portion). The affinity portion is shown hybridized to a target DNA. In Figure
25B, an
amplification target circle is shown hybridized to the oligonucleotide portion
(that is, the rolling
circle replication primer).
8
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Figui-es 26A and 26B are diagrams of a reporter binding molecule hybridized to
a ligated
open circle probe that is topologically locked to target DNA. The reporter
binding molecule
made up of a peptide nucleic acid (as the affinity portion) and a rolling
circle replication primer
(as the oligonucleotide portion). In Figure 26B, an amplification target
circle is shown
hybridized to the oligonucleotide portion (that is, the rolling circle
replication primer).
Figures 27A and 27B are diagrams of a reporter binding molecule made up of a
chemically-Iiinked triple helix-forming oligonucleotide (as the affinity
portion) and a rolling circle
replication primer as the oligonucleotide portion. The affinity portion is
shown hybridized to a
target DNA. PS indicates a psoralen derivative creating a chemical link
between the affinity
portion and ithe target DNA. In Figure 27B, an amplification target circle is
shown hybridized
to the oligonucleotide portion (that is, the rolling circle replication
primer).
Figures 28A and 28B are diagrams of a reporter binding molecule hybridized to
a ligated
open circle probe that is topologically llocked to target DNA. The reporter
binding molecule
made up of a chemically-linked triple helix-forming oligonucleotide (as the
affinity portion) and
a rolling circle replication primer as the oligonucleotide portion. PS
indicates a psoralen
derivative creating a chemical link between the affmity portion and the target
DNA. In Figure
28B, an amplification target circle is sliown hybridized to the
oligonucleotide portion (that is, the
rolling circle: replication primer).
Figui=es 29A and 29B are diagrams of a reporter binding molecule made up of an
antibody (as the affinity portion) and a rolling circle replication primer (as
the oligonucleotide
portion). Ttie affinity portion is showri bound to a target antigen. In Figure
29B, an
amplificatiori target circle is shown hybridized to the oligonucleotide
portion (that is, the rolling
circle replication primer).
DETAILED DESCRIPTION OF THE INVENTION
The disclosed composition and :method make use of certain materials and
procedures
which allow consistent and quantitative amplification and detection of target
nucleic acid
sequences. 'These materials and procedures are described in detail below.
Some major features of the disclosed method are:
I. The ligation operation can be manipulated to obtain allelic discrimination,
especially with
the use of a gap-filling step.
2. The ainplification operation is isothermal.
3. Signals can be strictly quantitative because in certain embodiments of the
amplification
operation amplification is linear and is catalyzed by a highly processive
enzyme. In multiplex
assays, the primer used for DNA replication is the same for all probes.
9
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
4. Modified nucleotides or other moieties niay be incorporated during DNA
replication or
transcription.
5. The amplification product is a repetitive DNA molecule, and may contain
arbitrarily
chosen tag sequences that are useful for detection.
I. Materials
A. Open ('.ircle Probes
An open circle probe (OCP) is a linear single-stranded DNA molecule, generally
containing between 50 to 1000 nucleotides, preferably between about 60 to 150
nucleotides, and
most preferably between about 70 to 100 nucleotides. The OCP has a 5'
phosphate group and a
3' hydroxyl. group. This allows the ends to be ligated using a DNA ligase, or
extended in a
gap-filling operation. Portions of the OCP have specific functions making the
OCP useful for
RCA and LM-RCA. These portions are referred to as the target probe portions,
the primer
complemenit portion, the spacer region, the detection tag portions, the
secondary target sequence
portions, the address tag portions, and the promoter portion (Figure 5). The
target probe
portions and the primer complement portion are required elements of an open
circle probe. The
primer complement portion is part of the spacer region. Detection tag
portions, secondary target
sequence portions, and promoter portions are optional and, when present, are
part of the spacer
region. Address tag portions are optional and, when present, may be part of
the spacer region.
Generally, an open circle probe is a single-stranded, linear DNA molecule
comprising, from 5'
end to 3' end, a 5' phosphate group, a right target probe portion, a spacer
region, a left target
probe portion, and a 3' hydroxyl group, with a primer complement portion
present as part of the
spacer region. Those segments of the spacer region that do not correspond to a
specific portion
of the OCP can be arbitrarily chosen sequences. It is preferred that OCPs do
not have any
sequences that are self-complementary. It is considered that this condition is
met if there are no
complemenitary regions greater than six nucleotides long without a mismatch or
gap. It is also
preferred that OCPs containing a promoter portion do not have any sequences
that resemble a
transcription terminator, such as a run of eight or more thymidine
nucleotides.
The open circle probe, when ligated and replicated, gives rise to a long DNA
molecule
containing multiple repeats of sequences complementary to the open circle
probe. This long
DNA molecule is referred to herein as tandem sequences DNA (TS-DNA). TS-DNA
contains
sequences complementary to the target probe portions, the primer complement
portion, the
spacer region, and, if present on the open circle probe, the detection tag
portions, the secondary
target sequence portions, the address tag portions, and the promoter portion.
These sequences in
the TS-DNA are referred to as target sequences (which match the original
target sequence),
primer sequences (which match the sequence of the rolling circle replication
primer), spacer
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
sequences (complementary to the spacer region), detection tags, secondary
target sequences,
address tags, and promoter sequences.
A particularly preferred embodiment is an open circle probe of 70 to 100
nucleotides
including a left target probe of 20 nucleotides and a right target probe of 20
nucleotides. The
left target probe and right target probe hybridize to a target sequence
leaving a gap of five
nucleotides, which is filled by a single pentanucleotide gap oligonucleotide.
1. Target Probe Portions
There are two target probe portions on each OCP, one at each end of the OCP.
The
target probe portions can each be any length that supports specific and stable
hybridization
between the target probes and the target sequence. For this purpose, a length
of 10 to 35
nucleotides for each target probe portion is preferred, with target probe
portions 15 to 20
nucleotides long being most preferred. The target probe portion at the 3' end
of the OCP is
referred to as the left target probe, and. the target probe portion at the 5'
end of the OCP is
referred to as the right target probe. These target probe portions are also
referred to herein as
left and righ.t target probes or left and right probes. The target probe
portions are
complementary to a target nucleic acid sequence.
The target probe portions are complementary to the target sequence, such that
upon
hybridization the 5' end of the right target probe portion and the 3' end of
the left target probe
portion are base-paired to adjacent nucleotides in the target sequence, with
the objective that they
serve as a substrate for ligation (Figure 1). Optionally, the 5' end and the
3' end of the target
probe portions may hybridize in such a way that they are separated by a gap
space. In this case
the 5' end and the 3' end of the OCP rnay only be ligated if one or more
additional
oligonucleotides, referred to as gap oli,gonucleotides, are used, or if the
gap space is filled
during the ligation operation. The gap oligonucleotides hybridize to the
target sequence in the
gap space ta a form continuous probe/t:arget hybrid (Figure 2). The gap space
may be any
length desired but is generally ten nucleotides or less. It is preferred that
the gap space is
between about three to ten nucleotides in length, with a gap space of four to
eight nucleotides in
length being; most preferred. Alternatively, a gap space could be filled using
a DNA polymerase
during the ligation operation (see Example 3). When using such a gap-filling
operation, a gap
space of three to five nucleotides in length is most preferred. As another
alternative, the gap
space can be partially bridged by one or more gap oligonucleotides, with the
remainder of the
gap filled using DNA polymerase.
2. F'rimer Complement Portiori
The primer complement portion is part of the spacer region of an open circle
probe. The
primer complement portion is complementary to the rolling circle replication
primer (RCRP).
11
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Each OCP should have a single primeir complement portion. This allows rolling
circle
replication to initiate at a single site on ligated OCPs. The primer
complement portion and the
cognate primer can have any desired sequence so long as they are complementary
to each other.
In general, the sequence of the primer complement can be chosen such that it
is not significantly
similar to aiiy other portion of the OCP. The primer complement portion can be
any length that
supports spe;cific and stable hybridization between the primer complement
portion and the
primer. Foir this purpose, a length of 10 to 35 nucleotides is preferred, with
a primer
complement portion 16 to 20 nucleotides long being most preferred. The primer
complement
portion can be located anywhere within the spacer region of an OCP. It is
preferred that the
primer complement portion is adjacent to the right target probe, with the
right target probe
portion and the primer complement portion preferably separated by three to ten
nucleotides, and
most preferably separated by six nucleotides. This location prevents the
generation of any other
spacer sequf:nces, such as detection tags and secondary target sequences, from
unligated open
circle probes during DNA replication.
3. Detection Tag Portions
Detection tag portions are part of the spacer region of an open circle probe.
Detection
tag portions have sequences matching ithe sequence of the complementary
portion of detection
probes. These detection tag portions, when amplified during rolling circle
replication, result in
TS-DNA having detection tag sequences that are complementary to the
complementary portion
of detection probes. If present, there inay be one, two, three, or more than
three detection tag
portions on an OCP. It is preferred that an OCP have two, three or four
detection tag portions.
Most preferably, an OCP will have thi=ee detection tag portions. Generally, it
is preferred that
an OCP have 60 detection tag portions or less. There is no fundamental limit
to the number of
detection tag portions that can be present on an OCP except the size of the
OCP. When there
are multiple detection tag portions, they may have the same sequence or they
may have different
sequences, with each different sequence complementary to a different detection
probe. It is
preferred th.3t an OCP contain detection tag portions that have the same
sequence such that they
are all complementary to a single detection probe. For some multiplex
detection methods, it is
preferable ttlat OCPs contain up to six detection tag portions and that the
detection tag portions
have differe:nt sequences such that each of the detection tag portions is
complementary to a
different detection probe. The detection tag portions can each be any length
that supports
specific and stable hybridization between the detection tags and the detection
probe. For this
purpose, a length of 10 to 35 nucleoticles is preferred, with a detection tag
portion 15 to 20
nucleotides long being most preferred.
12
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
4. Secondary Target Sequence: Portions
Secondary target sequence portions are part of the spacer region of an open
circle probe.
Secondary target sequence portions have sequences matching the sequence of
target probes of a
secondary open circle probe. These secondary target sequence portions, when
amplified during
rolling circlle replication, result in TS-DNA having secondary target
sequences that are
complementary to target probes of a secondary open circle probe. If present,
there may be one,
two, or more than two secondary target sequence portions on an OCP. It is
preferred that an
OCP have one or two secondary target sequence portions. Most preferably, an
OCP will have
one secondary target sequence portion. Generally, it is preferred that an OCP
have 50
secondary target sequence portions or less. There is no fundamental limit to
the number of
secondary target sequence portions thait can be present on an OCP except the
size of the OCP.
When there are multiple secondary target sequence portions, they may have the
same sequence
or they may have different sequences, with each different sequence
complementary to a different
secondary OCP. It is preferred that ain OCP contain secondary target sequence
portions that
have the saine sequence such that they are all complementary to a single
target probe portion of
a secondary OCP. The secondary target sequence portions can each be any length
that supports
specific andi stable hybridization betwesen the secondary target sequence and
the target sequence
probes of its cognate OCP. For this purpose, a length of 20 to 70 nucleotides
is preferred, with
a secondary target sequence portion 30 to 40 nucleotides long being most
preferred. As used
herein, a secondary open circle probe is an open circle probe where the target
probe portions
match or are complementary to secondary target sequences in another open
circle probe or an
amplification target circle. It is contemplated that a secondary open circle
probe can itself
contain secondary target sequences that match or are complementary to the
target probe portions
of another secondary open circle probe. Secondary open circle probes related
to each other in
this manner are referred to herein as nested open circle probes.
5. Address Tag Portion
The address tag portion is part of either the target probe portions or the
spacer region of
an open circle probe. The address tag portion has a sequence matching the
sequence of the
complementary portion of an address probe. This address tag portion, when
amplified during
rolling circ].e replication, results in TS-DNA having address tag sequences
that are
complementary to the complementary portion of address probes. If present,
there may be one,
or more than one, address tag portions on an OCP. It is preferred that an OCP
have one or two
address tag portions. Most preferably, an OCP will have one address tag
portion. Generally, it
is preferred that an OCP have 50 address tag portions or less. There is no
fundamental limit to
the number of address tag portions that can be present on an OCP except the
size of the OCP.
13
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
When there; are multiple address tag portions, they may have the same sequence
or they may
have different sequences, with each d:ifferent sequence complementary to a
different address
probe. It is preferred that an OCP contain address tag portions that have the
same sequence
such that they are all complementary to a single address probe. Preferably,
the address tag
portion overlaps all or a portion of the target probe portions, and all of any
intervening gap
space (Figure 6). Most preferably, the address tag portion overlaps all or a
portion of both the
left and right target probe portions. 'Che address tag portion can be any
length that supports
specific ancl stable hybridization between the address tag and the address
probe. For this
purpose, a length between 10 and 35 nucleotides long is preferred, with an
address tag portion
15 to 20 nucleotides long being most preferred.
6. Promoter Portion
The promoter portion corresponds to the sequence of an RNA polymerase
promoter. A
promoter portion can be included in an open circle probe so that transcripts
can be generated
from TS-DNA. The sequence of any promoter may be used, but simple promoters
for RNA
polymerases without complex requirernents are preferred. It is also preferred
that the promoter
is not recognized by any RNA polymerase that niay be present in the sample
containing the
target nucleic acid sequence. Preferably, the promoter portion corresponds to
the sequence of a
T7 or SP6 ItNA polymerase promoter. The T7 and SP6 RNA polymerases are highly
specific
for particular promoter sequences. Other promoter sequences specific for RNA
polymerases
with this characteristic would also be preferred. Because promoter sequences
are generally
recognized by specific RNA polymerases, the cognate polymerase for the
promoter portion of
the OCP should be used for transcriptional amplification. Numerous promoter
sequences are
known and any promoter specific for a suitable RNA polymerase can be used. The
promoter
portion can be located anywhere withim the spacer region of an OCP and can be
in either
orientation. Preferably, the promoter portion is immediately adjacent to the
left target probe and
is oriented to promote transcription toward the 3' end of the open circle
probe. This orientation
results in transcripts that are complernentary to TS-DNA, allowing independent
detection of TS-
DNA and tl:ie transcripts, and prevents transcription from interfering with
rolling circle
replication.
B. Gap Oligonucleotides
Gap oligonucleotides are oligonucleotides that are complementary to all or a
part of that
portion of a target sequence which covers a gap space between the ends of a
hybridized open
circle probe. An example of a gap oligonucleotide and its relationship to a
target sequence and
open circle probe is shown in Figure '2. Gap oligonucleotides have a phosphate
group at their 5'
ends and a hydroxyl group at their 3' ends. This facilitates ligation of gap
oligonucleotides to
14
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
open circle probes, or to other gap oligonucleotides. The gap space between
the ends of a
hybridized open circle probe can be filled with a single gap oligonucleotide,
or it can be filled
with multiple gap oligonucleotides. For example, two 3 nucleotide gap
oligonucleotides can be
used to fill a six nucleotide gap space, or a three nucleotide gap
oligonucleotide and a four
nucleotide gap oligonucleotide can be used to fill a seven nucleotide gap
space. Gap
oligonucleotides are particularly usefiil for distinguishing between closely
related target
sequences. For example, multiple gap oligonucleotides can be used to amplify
different allelic
variants of a target sequence. By placing the region of the target sequence in
which the
variation occurs in the gap space formed by an open circle probe, a single
open circle probe can
be used to amplify each of the individual variants by using an appropriate set
of gap
oligonucleotides.
C. Amplification Target Circles
An amplification target circle i(ATC) is a circular single-stranded DNA
molecule,
generally containing between 40 to 1000 nucleotides, preferably between about
50 to 150
nucleotides, and most preferably between about 50 to 100 nucleotides. Portions
of ATCs have
specific functions making the ATC useful for rolling circle amplification
(RCA). These portions
are referreci to as the primer complement portion, the detection tag portions,
the secondary target
sequence portions, the address tag poiRions, and the promoter portion. The
primer complement
portion is a required element of an aniplification target circle. Detection
tag portions, secondary
target sequence portions, address tag lportions, and promoter portions are
optional. Generally,
an amplification target circle is a single-stranded, circular DNA molecule
comprising a primer
complemen.t portion. Those segments of the ATC that do not correspond to a
specific portion of
the ATC can be arbitrarily chosen sequences. It is preferred that ATCs do not
have any
sequences that are self-complementary. It is considered that this condition is
met if there are no
complementary regions greater than six nucleotides long without a mismatch or
gap. It is also
preferred that ATCs containing a proinoter portion do not have any sequences
that resemble a
transcription terminator, such as a run of eight or more thymidine
nucleotides. Ligated open
circle probes are a type of ATC, and as used herein the term amplification
target circle includes
ligated open circle probes. An ATC can be used in the same manner as described
herein for
OCPs that have been ligated.
An amplification target circle, when replicated, gives rise to a long DNA
molecule
containing multiple repeats of sequences complementary to the amplification
target circle. This
long DNA molecule is referred to herein as tandem sequences DNA (TS-DNA). TS-
DNA
contains sequences complementary to the primer complement portion and, if
present on the
amplification target circle, the detection tag portions, the secondary target
sequence portions, the
CA 02236161 1998-05-21
WO 97/191921 PCT/US96/18812
address tag portions, and the promoter portion. These sequences in the TS-DNA
are referred to
as primer sequences (which match the sequence of the rolling circle
replication primer), spacer
sequences (complementary to the spacer region), detection tags, secondary
target sequences,
address tags, and promoter sequences. Amplification target circles are useful
as tags for specific
binding mo;lecules.
D. Rolling Circle Replication Primer
A rcdling circle replication prirner (RCRP) is an oligonucleotide having
sequence
complemenl:ary to the primer complenient portion of an OCP or ATC. This
sequence is referred
to as the complementary portion of the RCRP. The complementary portion of a
RCRP and the
cognate prhner complement portion can have any desired sequence so long as
they are
complementary to each other. In general, the sequence of the RCRP can be
chosen such that it
is not significantly complementary to any other portion of the OCP or ATC. The
complemeni:ary portion of a rolling circle replication primer can be any
length that supports
specific and stable hybridization between the primer and the primer complement
portion.
Generally this is 10 to 35 nucleotides long, but is preferably 16 to 20
nucleotides long.
It is preferred that rolling circle replication primers also contain
additional sequence at
the 5' end cif the RCRP that is not cornplementary to any part of the OCP or
ATC. This
sequence is referred to as the non-complementary portion of the RCRP. The non-
complementary portion of the RCRP, if present, serves to facilitate strand
displacement during
DNA replication. The non-complementary portion of a RCRP may be any length,
but is
generally 1 to 100 nucleotides long, and preferably 4 to 8 nucleotides long.
The rolling circle
replication primer may also include modified nucleotides to make it resistant
to exonuclease
digestion. :For example, the primer can have three or four phosphorothioate
linkages between
nucleotides at the 5' end of the primer. Such nuclease resistant primers allow
selective
degradation of excess unligated OCP Euid gap oligonucleotides that might
otherwise interfere
with hybridization of detection probes, address probes, and secondary OCPs to
the amplified
nucleic acid.. A rolling circle replication primer can be used as the tertiary
DNA strand
displacemerit primer in strand displacement cascade amplification.
E. Detection Labels
To <<id in detection and quantitation of nucleic acids amplified using RCA and
RCT,
detection labels can be directly incorporated into amplified nucleic acids or
can be coupled to
detection molecules. As used herein, a detection label is any molecule that
can be associated
with amplified nucleic acid, directly or indirectly, and which results in a
measurable, detectable
signal, either directly or indirectly. Ntany such labels for incorporation
into nucleic acids or
coupling to nucleic acid or antibody probes are known to those of skill in the
art. Examples of
16
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
detection labels suitable for use in RCA and RCT are radioactive isotopes,
fluorescent
molecules, phosphorescent molecules, enzymes, antibodies, and ligands.
Examples of suitable fluorescent labels include fluorescein (FITC), 5,6-
carboxymethyl
fluorescein, Texas red, nitrobenz-2-ox:a-1,3-diazol-4-yl (NBD), coumarin,
dansyl chloride,
rhodamine, 4'-6-diamidino-2-phenylinodole (DAPI), and the cyanine dyes Cy3,
Cy3.5, Cy5,
Cy5.5 and Cy7. Preferred fluorescent labels are fluorescein (5-
carboxyfluorescein-N-
hydroxysuccinimide ester) and rhodaniine (5,6-tetramethyl rhodamine).
Preferred fluorescent
labels for combinatorial multicolor coding are FITC and the cyanine dyes Cy3,
Cy3.5, Cy5,
Cy5.5 and Cy7. The absorption and emission maxima, respectively, for these
fluors are: FITC
(490 nm; 520 nm), Cy3 (554 nm; 568; nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm:
672 nm),
Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their
simultaneous
detection. 'The fluorescent labels can be obtained from a variety of
commercial sources,
including Molecular Probes, Eugene, OR and Research Organics, Cleveland, Ohio.
Labeled nucleotides are preferred form of detection label since they can be
directly
incorporateci into the products of RCA, and RCT during synthesis. Examples of
detection labels
that can be incorporated into amplifiect DNA or RNA include nucleotide analogs
such as BrdUrd
(Hoy and Schimke, Mutation Research 290:217-230 (1993)), BrUTP (Wansick et
al., J. Cell
Biology 122:283-293 (1993)) and nucleotides modified with biotin (Langer et
al., Proc. Natl.
Acad. Sci. SA 78:6633 (1981)) or wiith suitable haptens such as digoxygenin
(Kerkhof, Anal.
Biochem. 205:359-364 (1992)). Suitable fluorescence-labeled nucleotides are
Fluorescein-
isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP (Yu et al., Nucleic
Acids Res.,
22:3226-32:32 (1994)). A preferred nucleotide analog detection label for DNA
is BrdUrd
(BUDR triphosphate, Sigma), and a pireferred nucleotide analog detection label
for RNA is
Biotin-16-uridine-5'-triphosphate (Biot.in-16-dUTP, Boehringher Mannheim).
Fluorescein, Cy3,
and Cy5 can be linked to dUTP for direct labelling. Cy3.5 and Cy7 are
available as avidin or
anti-digoxygenin conjugates for secondary detection of biotin- or digoxygenin-
labelled probes.
Detection labels that are incorporated into amplified nucleic acid, such as
biotin, can be
subsequently detected using sensitive methods well-known in the art. For
example, biotin can be
detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.),
which is bound to the
biotin and subsequently detected by chemiluminescence of suitable substrates
(for exatnple,
chemiluminescent substrate CSPD: disodium, 3-(4-methoxyspiro-[1,2,-dioxetane-3-
2'-(5'-
chloro)tricyclo [3.3.1.13,']decane]-4-yl) phenyl phosphate; Tropix, Inc.).
A preferre.d detection label for use in detection of amplified RNA is
acridinium-ester-
labeled DNA probe (GenProbe, Inc., as described by Arnold et al., Clinical
Chemistry 35:1588-
1594 (1989)). An acridinium-ester-labeled detection probe permits the
detection of amplified
17
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
RNA without washing because unhybridized probe can be destroyed with alkali
(Arnold et al.
(1989)).
Mole:cules that combine two or more of these detection labels are also
considered
detection labels. Any of the known detection labels can be used with the
disclosed probes, tags,
and method to label and detect nucleic acid amplified using the disclosed
method. Methods for
detecting and measuring signals generated by detection labels are also known
to those of skill in
the art. For example, radioactive isotopes can be detected by scintillation
counting or direct
visualization; fluorescent molecules can be detected with fluorescent
spectrophotometers;
phosphorescent molecules can be detected with a spectrophotometer or directly
visualized with a
camera; enzymes can be detected by detection or visualization of the product
of a reaction
catalyzed by the enzyme; antibodies can be detected by detecting a secondary
detection label
coupled to the antibody. Such methods can be used directly in the disclosed
method of
amplificatioii and detection. As used herein, detection molecules are
molecules which interact
with amplified nucleic acid and to which one or more detection labels are
coupled.
F. Detection Probes
Deteaaion probes are labeled oligonucleotides having sequence complementary to
detection tags on TS-DNA or transcripts of TS-DNA. The complementary portion
of a detection
probe can be any length that supports specific and stable hybridization
between the detection
probe and the detection tag. For this purpose, a length of 10 to 35
nucleotides is preferred, with
a complementary portion of a detection probe 16 to 20 nucleotides long being
most preferred.
Detection probes can contain any of the detection labels described above.
Preferred labels are
biotin and fluorescent molecules. A particularly preferred detection probe is
a molecular
beacon. Molecular beacons are detection probes labeled with fluorescent
moieties where the
fluorescent rnoieties fluoresce only when the detection probe is hybridized
(Tyagi and Kramer,
Nature Biotechnology 14:303-308 (1996)). The use of such probes eliminates the
need for
removal of iuihybridized probes prior to label detection because the
unhybridized detection
probes will not produce a signal. This is especially useful in multiplex
assays.
A preferred form of detection probe, referred to herein as a collapsing
detection probe,
contains two separate complementary portions. This allows each detection probe
to hybridize to
two detectioin tags in TS-DNA. In this way, the detection probe forms a bridge
between
different parts of the TS-DNA. The combined action of numerous collapsing
detection probes
hybridizing to TS-DNA will be to form a collapsed network of cross-linked TS-
DNA.
Collapsed T;S-DNA occupies a much smaller volume than free, extended TS-DNA,
and includes
whatever detection label present on the detection probe. This result is a
compact and discrete
detectable signal for each TS-DNA. Collapsing TS-DNA is useful both for in
situ hybridization
18
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
applications and for multiplex detection because it allows detectable signals
to be spatially
separate even when closely packed. C'ollapsing TS-DNA is especially preferred
for use with
combinatorial multicolor coding.
TS-1)NA collapse can also be accomplished through the use of ligand/ligand
binding pairs
(such as biotin and avidin) or hapten/antibody pairs. As described in Example
6, a nucleotide
analog, BUDR, can be incorporated into TS-DNA during rolling circle
replication. When
biotinylated antibodies specific for BUDR and avidin are added, a cross-linked
network of TS-
DNA forms, bridged by avidin-biotin-antibody conjugates, and the TS-DNA
collapses into a
compact structure. Collapsing detection probes and biotin-mediated collapse
can also be used
together to collapse TS-DNA.
G. Address Probes
An address probe is an oligonucleotide having a sequence complementary to
address tags
on TS-DNA, or transcripts of TS-DNA. The complementary portion of an address
probe can be
any length that supports specific and stable hybridization between the address
probe and the
address tag. For this purpose, a length of 10 to 35 nucleotides is preferred,
with a
complementary portion of an address probe 12 to 18 nucleotides long being most
preferred.
Preferably, the complementary portion of an address probe is complementary to
all or a portion
of the target: probe portions of an OCF'. Most preferably, the complementary
portion of an
address probe is complementary to a portion of either or both of the left and
right target probe
portions of an OCP and all or a part of any gap oligonucleotides or gap
sequence created in a
gap-filling operation (see Figure 6). Address probe can contain a single
complementary portion
or multiple complementary portions. :Preferably, address probes are coupled,
either directly or
via a spacer molecule, to a solid-state support. Such a combination of address
probe and solid-
state support are a preferred form of solid-state detector.
H. DNA Strand Displacement Primers
Primers used for secondary DNA strand displacement are referred to herein as
DNA
strand displacement primers. One form of DNA strand displacement primer,
referred to herein
as a secondary DNA strand displacement primer, is an oligonucleotide having
sequence matching
part of the sequence of an OCP or ATC. This sequence is referred to as the
matching portion of
the secondary DNA strand displacement primer. This matching portion of a
secondary DNA
strand displacement primer is complementary to sequences in TS-DNA. The
matching portion
of a secondary DNA strand displacement primer may be complementary to any
sequence in TS-
DNA. However, it is preferred that it not be complementary TS-DNA sequence
matching either
the rolling circle replication primer or a tertiary DNA strand displacement
primer, if one is
being used. This prevents hybridization of the primers to each other. The
matching portion of a
19
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
secondary DNA strand displacement primer may be complementary to all or a
portion of the
target sequence. In this case, it is preferred that the 3' end nucleotides of
the secondary DNA
strand displacement primer are complementary to the gap sequence in the target
sequence. It is
most preferred that nucleotide at the 3' end of the secondary DNA strand
displacement primer
falls complementary to the last nucleotide in the gap sequence of the target
sequence, that is, the
5' nucleotide in the gap sequence of the target sequence. The matching portion
of a secondary
DNA strand displacement primer can be any length that supports specific and
stable
hybridization between the primer and its complement. Generally this is 12 to
35 nucleotides
long, but is preferably 18 to 25 nucleotides long.
It is preferred that secondary DNA strand displacement primers also contain
additional
sequence at their 5' end that does not imatch any part of the OCP or ATC. This
sequence is
referred to as the non-matching portioin of the secondary DNA strand
displacement primer. The
non-matchir.-g portion of the secondary DNA strand displacement primer, if
present, serves to
facilitate strand displacement during DNA replication. The non-matching
portion of a secondary
DNA strand displacement primer may be any length, but is generally 1 to 100
nucleotides long,
and preferably 4 to 8 nucleotides long..
Another form of DNA strand displacement primer, referred to herein as a
tertiary DNA
strand displacement primer, is an oligonucleotide having sequence
complementary to part of the
sequence of an OCP or ATC. This sequence is referred to as the complementary
portion of the
tertiary DNA strand displacement primer. This complementary portion of the
tertiary DNA
strand displacement primer matches sequences in TS-DNA. The complementary
portion of a
tertiary DNA strand displacement prinier may be complementary to any sequence
in the OCP or
ATC. However, it is preferred that it not be complementary OCP or ATC sequence
matching
the secondairy DNA strand displacement primer. This prevents hybridization of
the primers to
each other. Preferably, the complementary portion of the tertiary DNA strand
displacement
primer has sequence complementary to a portion of the spacer portion of an
OCP. The
complementary portion of a tertiary DNA strand displacement primer can be any
length that
supports specific and stable hybridization between the primer and its
complement. Generally
this is 12 to 35 nucleotides long, but is preferably 18 to 25 nucleotides
long. It is preferred that
tertiary DNA strand displacement primers also contain additional sequence at
their 5' end that is
not complernentary to any part of the OCP or ATC. This sequence is referred to
as the non-
complementary portion of the tertiary DNA strand displacement primer. The non-
complementary portion of the tertiary DNA strand displacement primer, if
present, serves to
facilitate strand displacement during DNA replication. The non-complementary
portion of a
tertiary DNA strand displacement primer may be any length, but is generally 1
to 100
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
nucleotides long, and preferably 4 to 8 nucleotides long. A rolling circle
replication primer is a
preferred fo:rm of tertiary DNA strand displacement primer.
DNA strand displacement primers may also include modified nucleotides to make
them
resistant to exonuclease digestion. For example, the primer can have three or
four
phosphorothioate linkages between nucleotides at the 5' end of the primer.
Such nuclease
resistant primers allow selective degraclation of excess unligated OCP and gap
oligonucleotides
that might otherwise interfere with hybridization of detection probes, address
probes, and
secondary OCPs to the amplified nucleic acid. DNA strand displacement primers
can be used
for secondaiy DNA strand displacement and strand displacement cascade
amplification, both
described below.
1. Interrogation Probes
An interrogation probe is an oligonucleotide having a sequence complementary
to
portions of 'TS-DNA or transcripts of TS-DNA. Interrogation probes are
intended for use in
primer extension sequencing operations following rolling circle amplification
of an OCP or
amplification target circle (for example, USA-SEQ and USA-CAGESEQ).
Interrogation probes
can be used directly as interrogation primers in a primer extension sequencing
operation, or they
can be combined with other interrogation probes or with degenerate probes to
form interrogation
primers. As use herein, interrogation primers are oligonucleotides serving as
primers for primer
extension sequencing. The relationship of interrogation probes to sequences in
OCPs or ATCs
(and, therefore, in amplified target sequences) is preferably determined by
the relationship of the
interrogation primer (which is formed from the interrogation probe) to
sequences in OCPs or
ATCs.
The complementary portion of an interrogation probe can be any length that
supports
hybridization between the interrogatior.i probe and TS-DNA. For this purpose,
a length of 10 to
40 nucleotid.es is preferred, with a complementary portion of an interrogation
probe 15 to 30
nucleotides long being most preferred. The preferred use of interrogation
probes is to form
interrogation primers for primer extension sequencing of an amplified target
sequence. For this
purpose, interrogation probes should hybridize to TS-DNA 5' of the portion of
the amplified
target sequences that are to be sequenced.
For primer extension sequencing operations (for example, USA-CAGESEQ), it is
preferred that a nested set of interrogation probes are designed to hybridize
just 5' to a region of
amplified target sequence for which the sequence is to be determined. Thus,
for example, a set
of interrogation probes can be designed where each probe is complementary to a
20 nucleotide
21
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
region of the target sequence with eacli 20 nucleotide region offset from the
previous region by
one nucleotide. This preferred relationship can be illustrated as follows:
Probe 1 TCTCGACATCTAACGATCGA
Probe 2 CTCGACATCTAACGATCGAT
Probe 3 TCGACATCTAACGATCGATC
Probe 4 CGACATCTAACGATCGATCC
Probe 5 GACATCTAACGATCGATCCT
HiiHiiiiHiiiiHii
Target TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
Probe 1 is nucleotides 76 to 95 of SEQ ID NO:25, probe 2 is nucleotides 77 to
96 of SEQ ID
NO:25, probe 3 is nucleotides 78 to 97 of SEQ ID NO:25, probe 4 is nucleotides
79 to 98 of
SEQ ID NO:25, probe 5 is nucleotides 80 to 99 of SEQ ID NO:25, and the target
(shown 3' to
5') is nucleotides 19 to 60 of SEQ ID NO:19. It is preferred that the number
of interrogation
probes in such a nested set be equal to the length of the degenerate probes
used in the primer
extension sequencing operation.
It is also preferred that the 3' hydroxyl of interrogation probes be
reversibly blocked in
order to prevent unwanted ligation to other oligonucleotides. Such blocked
probes allow
controlled ligation of additional probes, such as degenerate probes, to an
interrogation probe.
For example, USA-CAGESEQ, a form of degenerate probe primer extension
sequencing, makes
use of reversibly blocked interrogatiori probes to allow sequential, and
controlled, addition of
degenerate probes to interrogation probes. Any of the known means of
reversibly blocking 3'-
hydroxyls in oligonucleotides can be used to produce blocked interrogation
probes. Preferred
forms of reversible blocking elements are the cage structures described below.
Caged
oligonucleotides useful as blocked interrogation probes are described below.
J. Degenei-ate Probes
Degenerate probes are oligonuu:,leotides intended for use in primer extension
sequencing
operations following rolling circle amplification of an OCP or amplification
target circle (for
example, USA-SEQ and USA-CAGESEQ). Degenerate probes are combined with
interrogation
probes to form interrogation primers. This is accomplished by hybridizing an
interrogation
probe and degenerate primers to TS-DNA and ligating together the interrogation
probe and
whichever degenerate probe that is hybridized adjacent to the interrogation
probe. For this
purpose, it is preferred that a full set of degenerate probes be used
together. This ensures that at
least one of' the degenerate probes will be complementary to the portion of TS-
DNA immediately
22
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
adjacent to gi hybridized interrogation probe. This preferred relationship can
be illustrated as
follows:
I:nterrogation probe Degenerate probe
GACATCTAACGATCGATCCTAGTGT
TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
Target
The interrogation probe and degenerate probe together represent nucleotides 80
to 104 of SEQ
ID NO:25, and the target (shown 3' to 5') is nucleotides 19 to 60 of SEQ ID
NO:19. The
underlined sequence represents the degenerate probe which is ligated to the
interrogation probe
(non-underlined portion of the top sequence).
It is preferred that a full set of degenerate probes be used in primer
extension sequencing
operations iiivolving degenerate probes. As used herein, a full set of
degenerate probes refers to
a set of oligonucleotides, all of the sanie length, where every possible
nucleotide sequence is
represented. The number of such probes is described by the formula 4" where 4
represents the
four types of nucleotides found in DNA (or in RNA) and N is the length of the
oligonucleotides
in the set. 'Chus, a full set of degenerate probes three nucleotides in length
would include 64
different oligonucleotides, a full set of degenerate probes four nucleotides
in length would
include 256 different oligonucleotides, and a full set of degenerate probes
five nucleotides in
length would include 1024 different oligonucleotides. It is preferred that the
number of
interrogation probes in such a nested set be equal to the length of the
degenerate probes used in
degenerate probe primer extension sequencing. Sets of degenerate probes can be
used with a
single interrogation probe or with sets of interrogation probes. It is
preferred that such sets of
interrogatioii probes represent a nested set as described above.
In a primer extension operation, only one of the degenerate probes in a set of
degenerate
probes will hybridize adjacent to a given interrogation probe hybridized to an
amplified target
sequence. I'he nucleotide sequence adjacent to (that is, 3' of) the region of
the target sequence
hybridized to the interrogation probe determines which degenerate probe will
hybridize. Only
degenerate probes hybridized immediately adjacent to the interrogation probe
should be ligated
to the interrogation probe. For this reason, it is preferred that the region
of the target sequence
to be sequericed is adjacent to the region hybridized to the interrogation
probe. Preferably, this
region is a gap sequence in TS-DNA (representing all or a portion of a filled
gap space). The
use of gap-filling ligation allows the presence of gap sequences in TS-DNA
representing a
potential, expected, or known region of sequence variability in the target
nucleic aid which is
amplified in RCA.
23
CA 02236161 1998-05-21
WO 97/19193, PCT/US96/18812
Degenerate probes can be combined with interrogation probes or with other
degenerate
probes to farm interrogation primers. As used herein, interrogation primers
are oligonucleotides
serving as primers for primer extension sequencing.
It is also preferred that the 3' liydroxyl of degenerate probes be reversibly
blocked in
order to prevent unwanted ligation to other oligonucleotides. Such blocked
probes allow
controlled l:igation of additional degenerate probes to a degenerate probe.
For example, USA-
CAGESEQ makes use of reversibly blocked degenerate probes to allow sequential,
and
controlled, -addition of the degenerate probes to interrogation probes. Any of
the known means
of reversibly blocking 3'-hydroxyls in oligonucleotides can be used to produce
blocked
degenerate probes. Preferred forms of reversible blocking elements are the
cage structures
described below. Caged oligonucleotides useful as blocked degenerate probes
are described
below.
Where a nested set of interrogation probes are used, they can be used in a set
of primer
extension sequencing operations to determine the identity of adjacent
nucleotides. Using the set
of interrogation probes illustrated above, and a full set of pentamer
degenerate probes, the
highlighted nucleotides in the target sequence can be identified where a
single degenerate probe
is ligated to each of the interrogation probes:
Probe 1 TCTCGACATCTAACGATCGA
Probe 2 CTCGACATCTAACGATCGAT
Probe 3 TCGACATCTAACGATCGATC
Probe 4 CGACATCTAACGATCGATCC
Probe 5 GACATCTAACGATCGATCCT
i~~~~ii~I~i~~i~~ii
~ii~~~~
1111iiiit~ iii
Target TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
Probe 1 is nucleotides 76 to 95 of SEQ ID NO:25, probe 2 is nucleotides 77 to
96 of SEQ ID
NO:25, probe 3 is nucleotides 78 to 97 of SEQ ID NO:25, probe 4 is nucleotides
79 to 98 of
SEQ ID NO:25, probe 5 is nucleotides 80 to 99 of SEQ ID NO:25, and the target
(shown 3' to
5') is nucleaatides 19 to 60 of SEQ ID NO: 19. The highlighted nucleotides
represent the
nucleotides adjacent to (that is, 3' of) the interrogation primers formed by
the ligation of the
interrogation probes and the degenerate primers. The identity of additional
nucleotides can be
determined by ligating additional degenerate probes to the degenerate probes
already ligated to
the interrogation probes. This process is illustrated Example 10. It is
preferred that the length
of the degeiaerate probes be equal to the number of interrogation probes in a
nested set.
K. Interrogation Primers
An interrogation primer is an oligonucleotide having a sequence complementary
to
portions of TS-DNA or transcripts of TS-DNA. Interrogation primers are
intended for use in
24
CA 02236161 1998-05-21
WO 97/19192; PCT/US96/18812
primer extension sequencing operatior.is following rolling circle
amplification of an amplification
target circle (for example, USA-SEQ and USA-CAGESEQ). Preferably, an
interrogation primer
is complementary to a portion of the target sequences in TS-DNA representing
all or a portion
of the left target probe portion of an OCP. For use with secondary TS-DNA, it
is preferred that
interrogation primers are complementary to a portion of the target sequences
in secondary TS-
DNA representing the right target probe portion of an OCP. Such interrogation
primers are also
preferably complementary to a portiori of the spacer region adjacent to the
left target probe
portion. Thus, preferred interrogatiori primers are complementary to a
contiguous segment of
TS-DNA representing the 5' end of the OCP. This preferred relationship allows
primer
extension sequencing of gap sequences in TS-DNA. An example of this preferred
relationship
between interrogation primers and an OCP is shown in Figure 15. An
interrogation probe can,
however, be complementary to any desired sequence in amplified nucleic acid.
In general, interrogation primers can be an unligated interrogation probe, a
combination
of two or rnore interrogation probes (that is, interrogation probes ligated
together), or a
combinatiori of one or more interrogation probes and one or more degenerate
probes (that is,
interrogation probes and degenerate probes ligated together). Thus,
interrogation probes can be
used directly as interrogation primers in a primer extension sequencing
operation, or they can be
combined with other interrogation probes or with degenerate probes to form
interrogation
primers. As use herein, interrogation primers are oligonucleotides serving as
primers for primer
extension sequencing. Where an interrogation primer is made from probes with
blocked 3'-
hydroxyls, and the resulting interrogation primer is blocked, the block must
be removed prior to
the primer extension operation.
The complementary portion of an interrogation primer can be any length that
supports
specific and. stable hybridization between the interrogation primer and TS-
DNA. For this
purpose, a length of 10 to 40 nucleotides is preferred, with a complementary
portion of an
interrogation primer 15 to 30 nucleotides long being most preferred. The
preferred use of
interrogation primers as primers in primer extension sequencing of an
amplified target sequence.
For this puipose, interrogation primers should hybridize to TS-DNA 5' of the
portion of the
amplified target sequences that are to be sequenced. It is preferred that the
portion of the
amplified target sequences that are to be sequenced represent gap sequences.
Such gap
sequences preferably collectively represent known, expected, or potential
sequence variants
present in t)he portion of the target nucleic acid opposite the gap space
formed when an OCP
hybridizes t:o the target nucleic acid. For this purpose, it is preferred that
the gap space is filled
by DNA pcdymerase in a gap-filling ligation operation.
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
L. Caged Oligonudeotides
Caged oligonucleotides are oligonucleotides having a caged nucleotide at their
3' end.
The cage structure is a removable blocking group which prevents the 3'
hydroxyl from
participating in nucleotide addition and ligation reactions. Caged
oligonucleotides are useful as
primers and probes as described above for use in the amplification, detection,
and sequencing
operations disclosed herein. Many cage structures are known. A preferred form
of cage
structure are: photolabile structures which allow their removal by exposure to
light. Examples of
cage structures usefal for reversibly blocking the 3' end of oligonucleotides
are described by
Metzker et cal., Nucleic Acids Research 22:4259-4267 (1994), Burgess and
Jacutin, Am. Chem
Soc. Abstracts volume 221, abstract 281 (1996), Zehavi et al., J. Organic
Chem. 37:2281-2288
(1972), Kaplan et al., Biochem. 17:1929-1935 (1978), and McCray et al., Proc.
Natl. Acad.
Sci. USA 77:7237-7241 (1980). Preferred forms of caged nucleotides for use in
caged
oligonucleotides are described by Metzker et al. A most preferred cage
structures is a 3'-O-(2-
nitrobenzyl) group, which is labile upon exposure to ultraviolet light
(Pillai, Synthesis 1-26
(1980)). Removal of this cage structure is preferably accomplished by
illuminating the material
containing the caged nucleotide with lcing wavelength ultraviolet light
(preferably 354 nm) using
a transilluminator for 3 to 10 minutes.
Disc:losed and known cage structures can be incorporated into oligonucleotides
by
adapting known and established oligonucleotide synthesis methodology
(described below) to use
protected caged nucleotides or by adding the cage structure following
oligonucleotide synthesis.
As described above, caged oligonucleotides can be used as interrogation probes
or
degenerate probes. Caged oligonucleotides can also be used as replication
primers, such as
rolling circle replication primers, either for the entire population of, or a
portion of, the primers
in an amplification reaction. This allows the pool of functional (that is,
extendable) primers to
be increased at a specified point in the reaction or amplification operation.
For example, when
using different rolling circle replication primers to produce different
lengths of TS-DNA (see
Section II B below), one of the rolling circle replication primers can be a
caged oligonucleotide.
M. Peptide Nucleic Acid Clamps
Peptide nucleic acids (PNA) are a modified form of nucleic acid having a
peptide
backbone. Peptide nucleic acids form extremely stable hybrids with DNA (Hanvey
et al.,
Science 258:1481-1485 (1992); Nielsen et al., Anticancer Drug Des. 8:53-63
(1993)), and have
been used as specific blockers of PCR reactions (Orum et al., Nucleic Acids
Res., 21:5332-5336
(1993)). PNA clamps are peptide nucleic acids complementary to sequences in
both the left
target probe: portion and right target pirobe portion of an OCP, but not to
the sequence of any
gap oligonucleotides or filled gap space in the ligated OCP. Thus, a PNA clamp
can hybridize
26
CA 02236161 2006-10-04
75304-70
only to the ligated junction of OCPs that have been illegitimately ligated,
that is, ligated in a
non-target-directed manner. The PNA clamp can,be any length that supports
specific and stable
hybridization between the clamp and its complement. Generally this is 7 to 12
nucleotides long,
but is preferably 8 to 10 nucleotides long. PNA clamps can be used to reduce
background
signals in rolling circle amplifications by preventing replication of
illegitimately ligated OCPs.
N. Oligonucleotide synthesis
Open circle probes, gap oligonucleotides, rolling circle replication primers,
detection
probes, address probes, amplification target circles, DNA strand displacement
primers, and any
other oligonucleotides can be synthesized using established oligonucleotide
synthesis methods.
Methods to produce or synthesize oligonucleotides are well known in the art.
Such methods can
range from standard enzymatic digestion followed by nucleotide fragment
isolation (see for
example, Sambrook er al., Molecular Cloning: A Laboratory Manual, 2nd Edition
(Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) Chapters 5, 6) to
purely synthetic
methods, for example, by the cyanoethyl phosphoramidite method using a
Milligen or Beckman
System 1Plus DNA synthesizer (for example, Model 8700 automated synthesizer of
Milligen-
Biosearch, Burlington, MA or ABI Model 380B). Synthetic methods useful for
making
oligonucleotides are also described by Ikuta et al., Ann. Rev. Biochem. 53:323-
356 (1984),
(phosphotriester and phosphite-triester methods), and Narang et al., Methods
Enzymol., 65:610-
620 (1980), (phosphotriester method). Protein nucleic acid molecules can be
made using known
methods such as those described by Nielsen et al., Bioconjug. Chem. 5:3-7
(1994).
Many of the oligonucleotides described herein are designed to be complementary
to
certain portions of other oligonucleotides or nucleic acids such that stable
hybrids can be formed
between them. The stability of these hybrids can be calculated using known
methods such as
those described in Lesnick and Freier, Biochemistry 34:10807-10815 (1995),
McGraw et al.,
Biotechniques 8:674-678 (1990), and Rychlik er al., Nucleic Acids Res. 18:6409-
6412 (1990).
0. Solid-State Detectors
Solid-state detectors are solid-state substrates or supports to which address
probes or
detection molecules have been coupled. A preferred form of solid-state
detector is an array
detector. An array detector is a solid-state detector to which multiple
different address probes or
detection molecules have been coupled in an array, grid, or other organized
pattern.
Solid-state substrates for use in solid-state detectors can include any solid
material to
which oligonucleotides can be coupled. This includes materials such as
acrylamide, cellulose,
nitrocellulose, glass, polystyrene, polyethylene vinyl acetate, polypropylene,
polymethacryiate,
polyethylene, polyethylene oxide, glass, polysilicates, polycarbonates,
teflon, fluorocarbons,
nylon, silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid,
polyorthoesters,
*Trade-mark
27
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
polypropylfinnerate, collagen, glycosaininoglycans, and polyamino acids. Solid-
state substrates
can have any useful form including thin films or membranes, beads, bottles,
dishes, fibers,
woven fibers, shaped polymers, partic]'es and microparticles. A preferred form
for a solid-state
substrate is a microtiter dish. The most preferred form of microtiter dish is
the standard 96-well
type.
Address probes immobilized or.i a solid-state substrate allow capture of the
products of
RCA and RCT on a solid-state detector. Such capture provides a convenient
means of washing
away reaction components that might interfere with subsequent detection steps.
By attaching
different adclress probes to different regions of a solid-state detector,
different RCA or RCT
products can be captured at different, and therefore diagnostic, locations on
the solid-state
detector. For example, in a microtiter plate multiplex assay, address probes
specific for up to
96 different TS-DNAs (each amplified via a different target sequence) can be
innnobilized on a
microtiter plate, each in a different well. Capture and detection will occur
only in those wells
corresponditig to TS-DNAs for which the corresponding target sequences were
present in a
sample.
Methods for immobilization of oligonucleotides to solid-state substrates are
well
established. Oligonucleotides, including address probes and detection probes,
can be coupled to
substrates using established coupling rriethods. For example, suitable
attachment methods are
described by Pease et al., Proc. Natl. Acad. Sci. USA 91(11):5022-5026 (1994),
and Khrapko et
al., Mol Biol (Mosk) (USSR) 25:718-730 (1991). A method for inunobilization of
3'-amine
oligonucleotides on casein-coated slides is described by Stimpson et al.,
Proc. Natl. Acad. Sci.
USA 92:6379-6383 (1995). A preferred method of attaching oligonucleotides to
solid-state
substrates is described by Guo et al., Nucleic Acids Res. 22:5456-5465 (1994).
Some solid-state detectors usefiil in RCA and RCT assays have detection
antibodies
attached to ai solid-state substrate. Such antibodies can be specific for a
molecule of interest.
Captured molecules of interest can thein be detected by binding of a second,
reporter antibody,
followed by RCA or RCT. Such a use of antibodies in a solid-state detector
allows RCA assays
to be developed for the detection of any molecule for which antibodies can be
generated.
Methods for immobilizing antibodies to solid-state substrates are well
established.
Immobilizatiion can be accomplished by attachment, for example, to aminated
surfaces,
carboxylatecl surfaces or hydroxylated surfaces using standard immobilization
chemistries.
Examples oi' attachment agents are cyanogen bromide, succinimide, aldehydes,
tosyl chloride,
avidin-biotiri, photocrosslinkable agents, epoxides and maleimides. A
preferred attachment agent
is glutaraldehyde. These and other attachment agents, as well as methods for
their use in
attachment, are described in Protein irnmobilization: fundamentals and
applications, Richard F.
28
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Taylor, ed. (M. Dekker, New York, 1991), Johnstone and Thorpe, Immunochemistry
In Practice
(Blackwell Scientific Publications, Oxford, England, 1987) pages 209-216 and
241-242, and
Immobilized Affinity Ligands, Craig T. Hermanson et al., eds. (Academic Press,
New York,
1992). Antibodies can be attached to a substrate by chemically cross-linking a
free amino group
on the antibody to reactive side groups present within the solid-state
substrate. For example,
antibodies may be chemically cross-liiilced to a substrate that contains free
amino or carboxyl
groups using glutaraldehyde or carbodiimides as cross-linker agents. In this
method, aqueous
solutions containing free antibodies are incubated with the solid-state
substrate in the presence of
glutaraldehyde or carbodiimide. For crosslinking with glutaraldehyde the
reactants can be
incubated with 2% glutaraldehyde by volume in a buffered solution such as 0.1
M sodium
cacodylate at pH 7.4. Other standard immobilization chemistries are known by
those of skill in
the art.
P. Solid-State Samples
Solid-state samples are solid-state substrates or supports to which target
molecules or
target sequences have been coupled or adhered. Target molecules or target
sequences are
preferably delivered in a target sample; or assay sample. A preferred form of
solid-state sample
is an array sample. An array sample is a solid-state sample to which multiple
different target
samples or assay samples have been coupled or adhered in an array, grid, or
other organized
pattern.
Solid-state substrates for use iri solid-state samples can include any solid
material to
which target molecules or target sequences can be coupled or adhered. This
includes materials
such as acrylamide, cellulose, nitrocellulose, glass, polystyrene,
polyethylene vinyl acetate,
polypropylene, polymethacrylate, polyethylene, polyethylene oxide, glass,
polysilicates,
polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides,
polyglycolic acid,
polylactic acid, polyorthoesters, polypropylfumerate, collagen,
glycosaminoglycans, and
polyamino acids. Solid-state substrates can have any useful form including
thin films or
membranes., beads, bottles, dishes, slides, fibers, woven fibers, shaped
polymers, particles and
microparticles. Preferred forms for a solid-state substrate are microtiter
dishes and glass slides.
The most preferred form of microtiter dish is the standard 96-well type.
Target molecules and target sequences immobilized on a solid-state substrate
allow
formation of target-specific TS-DNA localized on the solid-state substrate.
Such localization
provides a convenient means of washing away reaction components that might
interfere with
subsequent detection steps, and a convenient way of assaying multiple
different samples
simultaneously. Diagnostic TS-DNA can be independently formed at each site
where a different
sample is adhered. For immobilization of target sequences or other
oligonucleotide molecules to
29
CA 02236161 1998-05-21
WO 97/1919.3 PCT/US96/18812
form a solid-state sample, the methods described above for can be used. Where
the target
molecule is a protein, the protein can be immobilized on a solid-state
substrate generally as
described above for the immobilization of antibodies.
A preferred form of solid-state substrate is a glass slide to which up to 256
separate
target or assay samples have been adhesred as an array of sma11 dots. Each dot
is preferably
from 0.1 to 2.5 nun in diameter, and rnost preferably around 2.5 mm in
diameter. Such
microarrays can be fabricated, for exasnple, using the method described by
Schena et al.,
Science 270:487-470 (1995). Briefly, microarrays can be fabricated on poly-L-
lysine-coated
microscope slides (Sigma) with an arraying machine fitted with one printing
tip. The tip is
loaded with l 1 of a DNA sample (0.5 mg/ml) from, for exa.mple, 96-well
microtiter plates and
deposited -- 0.005 l per slide on multiple slides at the desired spacing. The
printed slides can
then be rehydrated for 2 hours in a hurnid chamber, snap-dried at 100 C for 1
minute, rinsed in
0.1 % SDS, and treated with 0.05% succinic anhydride prepared in buffer
consisting of 50% 1-
methyl-2-pyi-rolidinone and 50% boric acid. The DNA on the slides can then be
denatured in,
for example, distilled water for 2 minu.tes at 90 C immediately before use.
Microarray solid-
state samples can scanned with, for example, a laser fluorescent scanner with
a computer-
controlled XY stage and a microscope objective. A mixed gas, multiline laser
allows sequential
excitation of multiple fluorophores.
Q. Reporter Binding Agents
A reporter binding agent is a specific binding molecule coupled or tethered to
an
oligonucleot:ide. The specific binding imolecule is referred to as the
affuiity portion of the
reporter bincling agent and the oligonucleotide is referred to as the
oligonucleotide portion of the
reporter binciing agent. As used hereiri, a specific binding molecule is a
molecule that interacts
specifically with a particular molecule or moiety. The molecule or moiety that
interacts
specifically with a specific binding molecule is referred to herein as a
target molecule. It is to
be understood that the term target molecule refers to both separate molecules
and to portions of
molecules, such as an epitope of a protein, that interacts specifically with a
specific binding
molecule. Antibodies, either member of a receptor/ligand pair, and other
molecules with
specific binding affmities are examples of specific binding molecules, useful
as the affinity
portion of a reporter binding molecule. A reporter binding molecule with an
affinity portion
which is anantibody is referred to herein as a reporter antibody. By tethering
an a.mplification
target circle or coupling a target sequence to such specific binding
molecules, binding of a
specific bindiing molecule to its specific target can be detected by
amplifying the ATC or target
sequence with rolling circle amplification. This amplification allows
sensitive detection of a
very small number of bound specific binding molecules. A reporter binding
molecule that
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
interacts specifically with a particular target molecule is said to be
specific for that target
molecule. For example, a reporter binding molecule with an affinity portion
which is an
antibody that binds to a particular antigen is said to be specific for that
antigen. The antigen is
the target molecule. Reporter binding agents are also referred to herein as
reporter binding
molecules. Figures 25, 26, 27, 28, and 29 illustrate examples of several
preferred types of
reporter binding molecules and their use. Figure 29 illustrates a reporter
binding molecule using
an antibody as the affinity portion.
A spescial form of reporter binding molecule, referred to herein as a reporter
binding
probe, has an oligonucleotide or oligonucleotide derivative as the specific
binding molecule.
Reporter binding probes are designed for and used to detect specific nucleic
acid sequences.
Thus, the t.arget molecule for reporter binding probes are nucleic acid
sequences. The target
molecule for a reporter binding probe can be a nucleotide sequence within a
larger nucleic acid
molecule. It is to be understood that the term reporter binding molecule
encompasses reporter
binding probes. The specific binding niolecule of a reporter binding probe can
be any length
that supports specific and stable hybridization between the reporter binding
probe and the target
molecule. For this purpose, a length of 10 to 40 nucleotides is preferred,
with a specific
binding molecule of a reporter binding probe 16 to 25 nucleotides long being
most preferred. It
is preferred that the specific binding molecule of a reporter binding probe is
peptide nucleic
acid. As described above, peptide nucleic acid forms a stable hybrid with DNA.
This allows a
reporter bindling probe with a peptide nucleic acid specific binding molecule
to remain firmly
adhered to the target sequence during siubsequent amplification and detection
operations. This
useful effect can also be obtained with reporter binding probes with
oligonucleotide specific
binding molecules by making use of the triple helix chemical bonding
technology described by
Gasparro et al., Nucleic Acids Res. 1994 22(14):2845-2852 (1994). Briefly, the
affinity portion
of a reporter binding probe is designed to form a triple helix when hybridized
to a target
sequence. This is accomplished generally as known, preferably by selecting
either a primarily
homopurine or primarily homopyrimidine target sequence. The matching
oligonucleotide
sequence which constitutes the affinity portion of the reporter binding probe
will be
complementary to the selected target sequence and thus be primarily
homopyrimidine or
primarily ho:mopurine, respectively. The reporter binding probe (corresponding
to the triple
helix probe (lescribed by Gasparro et al.) contains a chemically linked
psoralen derivative.
Upon hybridization of the reporter binding probe to a target sequence, a
triple helix forms. By
exposing the triple helix to low wavelength ultraviolet radiation, the
psoralen derivative mediates
cross-linking of the probe to the target sequence. Figures 25, 26, 27, and 28
illustrate examples
of reporter binding molecules that are reporter binding probes.
31
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
The specific binding molecule in a reporter binding probe can also be a
bipartite DNA
molecule, such as ligatable DNA probes adapted from those described by
Landegren et al.,
Science 241:1077-1080 (1988). When using such a probe, the affinity portion of
the probe is
assembled by target-mediated ligation of two oligonucleotide portions which
hybridize to
adjacent regions of a target nucleic aciid. Thus, the components used to form
the affinity portion
of such reporter binding probes are aitruncated reporter binding probe (with a
truncated affinity
portion whi(;h hybridizes to part of the target sequence) and a ligation probe
which hybridizes to
an adjacent part of the target sequence such that it can be ligated to the
truncated reporter
binding probe. The ligation probe cari also be separated from (that is, not
adjacent to) the
truncated reporter binding probe when. both are hybridized to the target
sequence. The resulting
space between them can then be filled by a second ligation probe or by gap-
filling synthesis.
For use in t:he disclosed methods, it is preferred that the truncated affinity
portion be long
enough to allow target-mediated ligation but short enough to, in the absence
of ligation to the
ligation probe, prevent stable hybridization of the truncated reporter binding
probe to the target
sequence during the subsequent amplification operation. For this purpose, a
specific step
designed to eliminate hybrids between the target sequence and unligated
truncated reporter
binding probes can be used following the ligation operation.
In one embodiment, the oligonucleotide portion of a reporter binding agent
includes a
sequence, re:ferred to as a target sequence, that serves as a target sequence
for an OCP. The
sequence of the target sequence can be arbitrarily chosen. In a multiplex
assay using multiple
reporter binding agents, it is preferred that the target sequence for each
reporter binding agent
be substantially different to limit the possibility of non-specific target
detection. Alternatively, it
may be desirable in some multiplex assays, to use target sequences with
related sequences. By
using different, unique gap oligonucleotides to fill different gap spaces,
such assays can use one
or a few OC'Ps to amplify and detect a. larger number of target sequences. The
oligonucleotide
portion can be coupled to the affinity portion by any of several established
coupling reactions.
For example:, Hendrickson et al., Nucleic Acids Res., 23(3):522-529 (1995)
describes a suitable
method for coupling oligonucleotides to antibodies.
In ar.tother embodiment, the oligonucleotide portion of a reporter binding
agent includes a
sequence, referred to as a rolling circle replication primer sequence, that
serves as a rolling
circle replication primer for an ATC. This allows rolling circle replication
of an added ATC
where the ressulting TS-DNA is coupled to the reporter binding agent. Because
of this, the TS-
DNA will be effectively immobilized at the site of the target molecule.
Preferably, the
immobilized TS-DNA can then be collapsed in situ prior to detection. The
sequence of the
rolling circle replication primer sequence can be arbitrarily chosen. In a
multiplex assay using
32
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
multiple reporter binding agents, it is preferred that the rolling circle
replication primer sequence
for each reporter binding agent be substantially different to limit the
possibility of non-specific
target detection. Alternatively, it may be desirable in some multiplex assays,
to use rolling
circle replication primer sequences with related sequences. Such assays can
use one or a few
ATCs to de:tect a larger number of tar=get molecules. When the oligonucleotide
portion of a
reporter biruiing agent is used as a rolling circle replication primer, the
oligonucleotide portion
can be any length that supports specific and stable hybridization between the
oligonucleotide
portion and the primer complement portion of an amplification target circle.
Generally this is 10
to 35 nucleotides long, but is preferably 16 to 20 nucleotides long. Figures
25, 26, 27, 28, and
29 illustrate examples of reporter bincling molecules in which the
oligonucleotide portion is a
rolling circ:le replication primer.
In another embodiment, the oligonucleotide portion of a reporter binding agent
can
include an alnplification target circle which serves as a template for rolling
circle replication. In
a multiplex assay using multiple reporter binding agents, it is preferred that
address tag portions
and detection tag portions of the ATC comprising the oligonucleotide portion
of each reporter
binding agent be substantially different to unique detection of each reporter
binding agent. It is
desirable, however, to use the same primer complement portion in all of the
ATCs used in a
multiplex assay. The ATC is tethered to the specific binding molecule by
looping the ATC
around a te!ther loop. This allows the ATC to rotate freely during rolling
circle replication while
remaining coupled to the affinity portion. The tether loop can be any material
that can form a
loop and be: coupled to a specific binding molecule. Linear polymers are a
preferred material
for tether loops.
A pireferred method of producing a reporter binding agent with a tethered ATC
is to form
the tether loop by ligating the ends of oligonucleotides coupled to a specific
binding molecule
around an ATC. Oligonucleotides can be coupled to specific binding molecules
using known
techniques. For example, Hendricksori et al. (1995), describes a suitable
method for coupling
oligonucleotides to antibodies. This method is generally useful for coupling
oligonucleotides to
any protein. To allow ligation, oligonucleotides comprising the two halves of
the tether loop
should be coupled to the specific binding molecule in opposite orientations
such that the free end
of one is the 5' end and the free end of the other is the 3' end. Ligation of
the ends of the
tether oligonucleotides can be mediated by hybridization of the ends of the
tether
oligonucleotides to adjacent sequences in the ATC to be tethered. In this way,
the ends of the
tether oligonucleotides are analogous to the target probe portions of an open
circle probe, with
the ATC ccintaining the target sequence.
33
CA 02236161 1998-05-21
WO 97/19193i PCT/US96/18812
Another preferred method of producing a reporter binding agent with a tethered
ATC is
to ligate an open circle probe while hybridized to an oligonucleotide tether
loop on a specific
binding molecule. This is analogous to the ligation operation of LM-RCA. In
this case, the
target sequence is part of an oligonucleotide with both ends coupled to a
specific binding
molecule. In this method, both ends of a single tether oligonucleotide are
coupled to a specific
binding molecule. This can be accorr.iplishe:d using known coupling techniques
as described
above.
The ends of tether loops can be coupled to any specific binding molecule with
functional
groups that can be derivatized with suitable activating groups. When the
specific binding
molecule is a protein, or a molecule vvith similar functional groups, coupling
of tether ends can
be accomplished using known methods of protein attachment. Many such methods
are described
in Protein immobilization: fundamentals and applications Richard F. Taylor,
ed. (M. Dekker,
New York, 1991).
Antiibodies useful as the affinity portion of reporter binding agents, can be
obtained
commercially or produced using well established methods. For example,
Johnstone and Thorpe,
on pages 30-85, describe general mettiods useful for producing both polyclonal
and monoclonal
antibodies. The entire book describes many general techniques and principles
for the use of
antibodies in assay systems.
R. DNA ligases
Any DNA ligase is suitable for use in the disclosed amplification method.
Preferred
ligases are ithose that preferentially foirn phosphodiester bonds at nicks in
double-stranded DNA.
That is, ligases that fail to ligate the free ends of single-stranded DNA at a
significant rate are
preferred. Thermostable ligases are especially preferred. Many suitable
ligases are known,
such as T4 DNA ligase (Davis et al., Advanced Bacterial Genetics - A Manual
for Genetic
Engineering (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1980)),
E. coli DNA
ligase (Panasnko et al., J. Biol. Chem. 253:4590-4592 (1978)), AMPLIGASE
(Kalin et al.,
Mutat. Res., 283(2):119-123 (1992); Winn-Deen et al., Mol Cell Probes
(England) 7(3):179-186
(1993)), Taq DNA ligase (Barany, Proc. Natl. Acad. Sci. USA 88:189-193 (1991),
Thermus
thermophilus DNA ligase (Abbott Laboratories), Thermus scotoductus DNA ligase
and
Rhodothermus marinus DNA ligase (Thorbjarnardottir et al., Gene 151:177-180
(1995)). T4
DNA ligase is preferred for ligations involving RNA target sequences due to
its ability to ligate
DNA ends involved in DNA:RNA hylbrids (Hsuih et al., Quantitative detection of
HCV RNA
using novel ligation-dependent polymerase chain reaction, American Association
for the Study of
Liver Diseases (Chicago, IL, November 3-7, 1995)).
34
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
The frequency of non-target-directed ligation catalyzed by a ligase can be
determined as
follows. LM-RCA is performed with an open circle probe and a gap
oligonucleotide in the
presence of a target sequence. Non-targeted-directed ligation products can
then be detected by
using an address probe specific for the open circle probe ligated without the
gap oligonucleotide
to capture TS-DNA from such ligated probes. Target directed ligation products
can be detected
by using an address probe specific for the open circle probe ligated with the
gap oligonucleotide.
By using a solid-state detector with regions containing each of these address
probes, both target
directed anci non-target-directed ligation products can be detected and
quantitated. The ratio of
target-directed and non-target-directed TS-DNA produced provides a measure of
the specificity
of the ligation operation. Target-directed ligation can also be assessed as
discussed in Barany
(1991).
S. DNA polymerases
DNA polymerases useful in the rolling circle replication step of RCA must
perform
rolling circlle replication of primed single-stranded circles. Such
polymerases are referred to
herein as rcdling circle DNA polymerases. For rolling circle replication, it
is preferred that a
DNA polynnerase be capable of displacing the strand complementary to the
template strand,
termed strand displacement, and lack a 5' to 3' exonuclease activity. Strand
displacement is
necessary to result in synthesis of multiple tandem copies of the ligated OCP.
A 5' to 3'
exonuclease activity, if present, might result in the destruction of the
synthesized strand. It is
also preferred that DNA polymerases for use in the disclosed method are highly
processive. The
suitability caf a DNA polymerase for use in the disclosed method can be
readily determined by
assessing its ability to carry out rolling circle replication. Preferred
rolling circle DNA
polymerases are bacteriophage 029 DNA polymerase (U.S. Patent Nos. 5,198,543
and
5,001,050 to Blanco et al.), phage M2 DNA polymerase (Matsumoto et al., Gene
84:247
(1989)), phage OPRD1 DNA polymerase (Jung et al., Proc. Natl. Acad. Sci. USA
84:8287
(1987)), VENT DNA polymerase (Kong et al., J. Biol. Chem. 268:1965-1975
(1993)),
Klenow fragment of DNA polymerase I (Jacobsen et al., Eur. J. Biochem. 45:623-
627 (1974)),
T5 DNA polymerase (Chatterjee et al., Gene 97:13-19 (1991)), PRD1 DNA
polymerase (Zhu
and Ito, Biochim. Biophys. Acta. 1219:267-276 (1994)), modified T7 DNA
polymerase (Tabor
and Richarclson, J. Biol. Chem. 262:15330-15333 (1987); Tabor and Richardson,
J. Biol. Chem.
264:6447-6458 (1989); Sequenase~m (U.S. Biochemicals)), and T4 DNA polymerase
holoenzyme
(Kaboord and Benkovic, Curr. Biol. 5:149-157 (1995)). 029 DNA polymerase is
most
preferred.
Strand displacement can be facilitated through the use of a strand
displacement factor,
such as helicase. It is considered that any DNA polymerase that can perform
rolling circle
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
replication in the presence of a strand displacement factor is suitable for
use in the disclosed
method, even if the DNA polymerase does not perform rolling circle replication
in the absence
of such a factor. Strand displacement factors useful in RCA include BMRF1
polymerase
accessory subunit (Tsurumi et al., J. Virology 67(12):7648-7653 (1993)),
adenovirus DNA-
binding proltein (Zijderveld and van der Vliet, J. Virology 68(2):1158-1164
(1994)), herpes
simplex viral protein ICP8 (Boehmer and Lehman, J. Virology 67(2):711-715
(1993); Skaliter
and Lehman, Proc. Natl. Acad. Sci. USA 91(22):10665-10669 (1994)), single-
stranded DNA
binding proteins (SSB; Rigler and Romano, J. Biol. Chem. 270:8910-8919
(1995)), and calf
thymus helicase (Siegel et al., J. Biol. Chem. 267:13629-13635 (1992)).
The ability of a polymerase to carry out rolling circle replication can be
determined by
using the polymerase in a rolling circle replication assay such as those
described in Fire and Xu,
Proc. Natl. Acad. Sci. USA 92:4641-4645 (1995) and in Example 1.
Anoither type of DNA polymerase can be used if a gap-filling synthesis step is
used, such
as in gap-filling LM-RCA (see Example 3). When using a DNA polymerase to fill
gaps, strand
displacement by the DNA polymerase is undesirable. Such DNA polymerases are
referred to
herein as gap-filling DNA polymerases. Unless otherwise indicated, a DNA
polymerase
referred to herein without specifying ilt as a rolling circle DNA polymerase
or a gap-filling DNA
polymerase, is understood to be a roll:ing circle DNA polymerase and not a gap-
filling DNA
polymerase. Preferred gap-filling DNA polymerases are T7 DNA polymerase
(Studier et al.,
Methods Enzymol. 185:60-89 (1990)), DEEP VENT DNA polymerase (New England
Biolabs,
Beverly, MA), modified T7 DNA polymerase (Tabor and Richardson, J. Biol. Chem.
262:15330-15333 (1987); Tabor and Richardson, J. Biol. Chem. 264:6447-6458
(1989);
SequenaseT"' (U.S. Biochemicals)), and T4 DNA polymerase (Kunkel et al.,
Methods Enzymol.
154:367-382 (1987)). An especially preferred type of gap-filling DNA
polymerase is the
Thermus flavus DNA polymerase (MBR, Milwaukee, WI). The most preferred gap-
filling DNA
polymerase is the Stoffel fragment of 'Taq DNA polymerase (Lawyer et al., PCR
Methods Appl.
2(4):275-287 (1993), King et al., J. Biol. Chem. 269(18):13061-13064 (1994)).
The ability of a polymerase to fill gaps can be determined by performing gap-
filling LM-
RCA. Gap-filling LM-RCA is perfor,med with an open circle probe that forms a
gap space
when hybriiiized to the target sequence. Ligation can only occur when the gap
space is filled by
the DNA polymerase. If gap-filling occurs, TS-DNA can be detected, otherwise
it can be
concluded that the DNA polymerase, or the reaction conditions, is not useful
as a gap-filling
DNA polynxerase.
36
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
T. RNA polymerases
Any RNA polymerase which can carry out transcription in vitro and for which
promoter
sequences have been identified can be used in the disclosed rolling circle
transcription method.
Stable RNA polymerases without complex requirements are preferred. Most
preferred are T7
RNA polym.erase (Davaaziloo et al., Proc. Natl. Acad. Sci. USA 81:2035-2039
(1984)) and SP6
RNA polymerase (Butler and Chamberlin, J. Biol. Chem. 257:5772-5778 (1982))
which are
highly specific for particular promoter sequences (Schenborn and Meirendorf,
Nucleic Acids
Research 13:6223-6236 (1985)). Other RNA polymerases with this characteristic
are also
preferred. 13ecause promoter sequences are generally recognized by specific
RNA polymerases,
the OCP or ATC should contain a promoter sequence recognized by the RNA
polymerase that is
used. Numerous promoter sequences are known and any suitable RNA polymerase
having an
identified promoter sequence can be used. Promoter sequences for RNA
polymerases can be
identified using established techniques..
The materials described above can be packaged together in any suitable
combination as a
kit useful for performing the disclosed method.
I:I. Method
The disclosed rolling circle amplification (RCA) method involves replication
of circular
single-stranded DNA molecules. In RCA, a rolling circle replication primer
hybridizes to
circular OC:P or ATC molecules followed by rolling circle replication of the
OCP or ATC
molecules using a strand-displacing DNA polymerase. Amplification takes place
during rolling
circle replication in a single reaction cycle. Rolling circle replication
results in large DNA
molecules containing tandem repeats of the OCP or ATC sequence. This DNA
molecule is
referred to as a tandem sequence DNA. (TS-DNA). Rolling circle amplification
is also referred
to herein as unimolecular segment amplification (USA). The term unimolecular
segment
amplification is generally used herein to emphasis the amplification of
individual segments of
nucleic acid, such as a target sequence, that are of interest.
A preferred embodiment, ligation-mediated rolling circle amplification (LM-
RCA)
method involves a ligation operation prior to replication. In the ligation
operation, an OCP
hybridizes to its cognate target nucleic acid sequence, if present, followed
by ligation of the ends
of the hybridized OCP to form a covalently closed, single-stranded OCP. After
ligation, a
rolling circle replication primer hybridizes to OCP molecules followed by
rolling circle
replication of the circular OCP molecules using a strand-displacing DNA
polymerase.
Generally, LM-RCA comprises
37
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
(a) mixing an open circle probe (OCP) with a target sample, resulting in an
OCP-target
sample mixture, and incubating the OCP-target sample mixture under conditions
promoting
hybridization between the open circle probe and a target sequence,
(b) mixing ligase with the OCP-target sample mixture, resulting in a ligation
mixture,
and incubating the ligation mixture under conditions promoting ligation of the
open circle probe
to form an iunplification target circle (ATC),
(c) inixing a rolling circle replication primer (RCRP) with the ligation
mixture, resulting
in a primer-ATC mixture, and incubating the primer-ATC mixture under
conditions that promote
hybridization between the amplification target circle and the rolling circle
replication primer,
(d) imixing DNA polymerase with the primer-ATC mixture, resulting in a
polymerase-
ATC mixture, and incubating the polymerase-ATC mixture under conditions
promoting
replication of the amplification target circle, where replication of the
amplification target circle
results in formation of tandem sequence DNA (TS-DNA).
The open circle probe is a single-stranded, linear DNA molecule comprising,
from 5' end
to 3' end, a 5' phosphate group, a right target probe portion, a primer
complement portion, a
spacer region, a left target probe portion, and a 3' hydroxyl group, wherein
the left target probe
portion is complementary to the 5' region of a target sequence and the right
target probe portion
is complementary to the 3' region of the target sequence.
The left and right target probe portions hybridize to the two ends of the
target nucleic
acid sequence, with or without a central gap to be filled by one or more gap
oligonucleotides.
Generally, LM-RCA using gap oligonucleotides can be performed by, in an LM-RCA
reaction,
(1) using a target sequence with a central region located between a 5' region
and a 3' region,
and an OCP where neither the left target probe portion of the open circle
probe nor the right
target probe portion of the open circle probe is complementary to the central
region of the target
sequence, and (2) mixing one or more gap oligonucleotides with the target
sample, such that the
OCP-target sample mixture contains the open circle probe, the one or more gap
oligonucleotides,
and the target sample, where each gap oligonucleotide consists of a single-
stranded, linear DNA
molecule co:mprising a 5' phosphate group and a 3' hydroxyl group, where each
gap
oligonucleotide is complementary all or a portion of the central region of the
target sequence.
A. The Ligation Operation
An open circle probe, optionally in the presence of one or more gap
oligonucleotides, is
incubated w:ith a sample containing DNA, RNA, or both, under suitable
hybridization
conditions, and then ligated to form a covalently closed circle. The ligated
open circle probe is
a form of amplification target circle. 'This operation is similar to ligation
of padlock probes
described by Nilsson et al., Science, 265:2085-2088 (1994). The ligation
operation allows
38
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
subsequent Eunplification to be dependent on the presence of a target
sequence. Suitable ligases
for the ligation operation are described above. Ligation conditions are
generally known. Most
ligases require Mg++. There are two inain types of ligases, those that are ATP-
dependent and
those that are NAD-dependent. ATP cir NAD, depending on the type of ligase,
should be
present during ligation.
The liigase and ligation conditions can be optimized to limit the frequency of
ligation of
single-strandled termini. Such ligation events do not depend on the presence
of a target
sequence. In the case of AMPLIGASE -catalyzed ligation, which takes place at
60 C, it is
estimated thit no more than 1 in 1,000,000 molecules with single-stranded DNA
termini will be
ligated. This is based on the level of non-specific amplification seen with
this ligase in the
ligase chain reaction. Any higher nonspecific ligation frequency would cause
enormously high
background amplification in the ligase chain reaction. Using this estimate, an
approximate
frequency for the generation of non-specifically ligated open circles with a
correctly placed gap
oligonucleotide in at the ligation junction can be calculated. Since two
ligation events are
involved, the frequency of such events using AMPLIGASE should be the square
of 1 in
1,000,000, or 1 in 1 X 10'Z. The number of probes used in a typical ligation
reaction of 50 l
is 2 X 10'2. Thus, the number of non-specifically ligated circles containing a
correct gap
oligonucleot:ide would be expected to be about 2 per reaction.
When RNA is to be detected, it is preferred that a reverse transcription
operation be
performed to make a DNA target sequence. An example of the use of such an
operation is
described in Example 4. Alternatively., an RNA target sequence can be detected
directly by
using a ligase that can perform ligation on a DNA:RNA hybrid substrate. A
preferred ligase for
this is T4 D1NA ligase.
B. The Replication Operation
The circular open circle probes formed by specific ligation and amplification
target
circles serve as substrates for a rolling circle replication. This reaction
requires the addition of
two reagents: (a) a rolling circle replication primer, which is complementary
to the primer
complement portion of the OCP or ATC, and (b) a rolling circle DNA polymerase.
The DNA
polymerase catalyzes primer extension and strand displacement in a processive
rolling circle
polymerization reaction that proceeds as long as desired, generating a
molecule of up to 100,000
nucleotides or larger that contains up to approximately 1000 tandem copies of
a sequence
complementary to the amplification target circle or open circle probe (Figure
4). This tandem
sequence DNA (TS-DNA) consists of, in the case of OCPs, alternating target
sequence and
spacer sequence. Note that the spacer sequence of the TS-DNA is the complement
of the
sequence between the left target probe and the right target probe in the
original open circle
39
CA 02236161 1998-05-21
WO 97/1919' 3 PCT/US96/18812
probe. A preferred rolling circle DNA polymerase is the DNA polymerase of the
bacteriophage
029.
During rolling circle replication one may additionally include radioactive, or
modified
nucleotides such as bromodeoxyuridine triphosphate, in order to label the DNA
generated in the
reaction. Alternatively, one may include suitable precursors that provide a
binding moiety such
as biotinylaited nucleotides (Langer et al. (1981)).
Rolling circle amplification caii be engineered to produce TS-DNA of different
lengths in
an assay involving multiple ligated OCPs or ATCs. This can be useful for
extending the number
of different targets that can be detecteci in a single assay. TS-DNA of
different lengths can be
produced in several ways. In one embodiment, the base composition of the
spacer region of
different classes of OCP or ATC can be designed to be rich in a particular
nucleotide. Then a
small amount of the dideoxy nucleotide complementary to the enriched
nucleotide can be
included in the rolling circle amplification reaction. After some
amplification, the dideoxy
nucleotides will terminate extension of the TS-DNA product of the class of OCP
or ATC
enriched for the complementary nucleotide. Other OCPs or ATCs will be less
likely to be
terminated, since they are not enricheci for the complementary nucleotide, and
will produce
longer TS-I)NA products, on average.
In another embodiment, two different classes of OCP or ATC can be designed
with
different primer complement portions. These different primer complement
portions are designed
to be complementary to a different rolling circle replication primer. Then the
two different
rolling circle replication primers are used together in a single rolling
circle amplification
reaction, but at significantly different concentrations. The primer at high
concentration
immediately primes rolling circle replication due to favorable kinetics, while
the primer at lower
concentration is delayed in priming due to unfavorable kinetics. Thus, the TS-
DNA product of
the class of OCP or ATC designed for the primer at high concentration will be
longer than the
TS-DNA product of the class of OCP or ATC designed for the primer at lower
concentration
since it will have been replicated for a longer period of time. As another
option, one of the
rolling circle replication primers can be a caged oligonucleotide. In this
case, the two rolling
circle replication primers can be at similar concentrations. The caged rolling
circle replication
primer will not support rolling circle replication until the cage structure is
removed. Thus, the
first, uncaged rolling circle replication primer begins amplification of its
cognate amplification
target circle(s) when the replication operation begins, the second, caged
rolling circle replication
primer begins amplification of its cognate amplification target circle(s) only
after removal of the
cage. The amount of TS-DNA produced from each rolling circle replication
primer will differ
proportiona!te to the different effective times of replication. Thus, the
amount of TS-DNA made
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
using each type of rolling circle replication primer can be controlled using a
caged primer. The
use of such a caged primer has the advantage that the caged primer can be
provided at a
sufficient concentration to efficiently initiate rolling circle replication as
soon as it is uncaged
(rather than at a lower concentration).
C. Modifications And Additional Operations
1. Detection of Amplification Products
Current detection technology makes a second cycle of RCA unnecessary in many
cases.
Thus, one tnay proceed to detect the pi-oducts of the first cycle of RCA
directly. Detection may
be accomplished by primary labeling or by secondary labeling, as described
below.
(a) Primary Labeling
Primary labeling consists of incorporating labeled moieties, such as
fluorescent
nucleotides, biotinylated nucleotides, digoxygenin-containing nucleotides, or
bromodeoxyuridine,
during rollirig circle replication in RCA, or during transcription in RCT. For
example, one may
incorporate cyanine dye UTP analogs (Yu et al. (1994)) at a frequency of 4
analogs for every
100 nucleotides. A preferred method for detecting nucleic acid amplified in
situ is to label the
DNA during amplification with BrdUrd, followed by binding of the incorporated
BUDR with a
biotinylated anti-BUDR antibody (Zymed Labs, San Francisco, CA), followed by
binding of the
biotin moiet:ies with Streptavidin-Peroxidase (Life Sciences, Inc.), and
finally development of
fluorescence with Fluorescein-tyramide: (DuPont de Nemours & Co., Medical
Products Dept.).
(b) Secondary Labeling with Detection Probes
Secondary labeling consists of using suitable molecular probes, referred to as
detection
probes, to detect the amplified DNA or RNA. For example, an open circle may be
designed to
contain several repeats of a known arbitrary sequence, referred to as
detection tags. A
secondary hybridization step can be used to bind detection probes to these
detection tags (Figure
7). The detection probes may be labeled as described above with, for example,
an enzyme,
fluorescent tnoieties, or radioactive isotopes. By using three detection tags
per open circle
probe, and four fluorescent moieties per each detection probe, one may obtain
a total of twelve
fluorescent signals for every open circle probe repeat in the TS-DNA, yielding
a total of 12,000
fluorescent inoieties for every ligated open circle probe that is amplified by
RCA.
(c) Multiplexing and Hybridization Array Detection
RCA. is easily multiplexed by using sets of different open circle probes, each
set carrying
different target probe sequences designed for binding to unique targets. Note
that although the
target probe sequences designed for each target are different, the primer
complement portion
may remain unchanged, and thus the primer for rolling circle replication can
remain the same
for all targets. Only those open circle probes that are able to find their
targets will give rise to
41
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
TS-DNA. The TS-DNA molecules generated by RCA are of high molecular weight and
low
complexity; i:he complexity being the length of the open circle probe. There
are two alternatives
for capturing a given TS-DNA to a fixed position in a solid-state detector.
One is to include
within the spacer region of the open circle probes a unique address tag
sequence for each unique
open circle probe. TS-DNA generated from a given open circle probe will then
contain
sequences corresponding to a specific address tag sequence. A second and
preferred alternative
is to use the target sequence present on the TS-DNA as the address tag.
(d) C'ombinatorial Multicolor C'oding
A preferred form of multiplex detection involves the use of a combination of
labels that
either fluoresce at different wavelengths or are colored differently. One of
the advantages of
fluorescence for the detection of hybridization probes is that several targets
can be visualized
simultaneously in the same sample. Using a combinatorial strategy, many more
targets can be
discriminated than the number of spectrally resolvable fluorophores.
Combinatorial labeling
provides the simplest way to label probes in a multiplex fashion since a probe
fluor is either
completely aibsent (-) or present in unit amounts (+); image analysis is thus
more amenable to
automaton, and a number of experimental artifacts, such as differential
photobleaching of the
fluors and the effects of changing excitation source power spectrum, are
avoided.
The combinations of labels establish a code for identifying different
detection probes and,
by extension., different target molecules to which those detection probes are
associated with.
This labeling scheme is referred to as Combinatorial Multicolor Coding (CMC).
Such coding is
described by Speicher et al., Nature Genetics 12:368-375 (1996). Any number of
labels, which
when combir-ed can be separately detected, can be used for combinatorial
multicolor coding. It
is preferred that 2, 3, 4, 5, or 6 labels be used in combination. It is most
preferred that 6 labels
be used. The number of labels used establishes the number of unique label
combinations that
can be formed according to the formula 2"-1, where N is the number of labels.
According to
this formula, 2 labels forms three label combinations, 3 labels forms seven
label combinations, 4
labels forms 15 label combinations, 5 labels form 31 label combinations, and 6
labels forms 63
label combinations.
For combinatorial multicolor coding, a group of different detection probes are
used as a
set. Each type of detection probe in the set is labeled with a specific and
unique combination of
fluorescent labels. For those detection probes assigned multiple labels, the
labeling can be
accomplisheci by labeling each detection probe molecule with all of the
required labels.
Alternatively, pools of detection probes of a given type can each be labeled
with one of the
required labels. By combining the pools, the detection probes will, as a
group, contain the
combination of labels required for that type of detection probe. This can be
illustrated with a
42
CA 02236161 1998-05-21
WO 97/191921 PCT/US96/18812
simple example. Starting with seven different types of detection probe, each
complementary to a
different detection tag and designated 1 through 7, unique identification
requires three different
labels used in seven combinations. Assigning the combinations arbitrarily, one
coding scheme
is:
Detection probe 1 2 3 4 5 6 7
labe;l A + + + +
labe:l B + + + +
labe:l C + + + +
As can be seen, detection probe 7 must be labeled with three different labels,
A, B, and C. This
can be accomplished by labels A, B, and C to each individual detection probe 7
molecule. This
is the first option described above. Alternatively, three pools of detection
probe 7 can be
separately labeled, one pool with label. A, one pool with label B, and one
pool with label C. In
each pool, individual detection molecules are labeled with a single type of
label. Mixing the
pools results in a solution of detection probe 7 that collectively contains
all three labels as
required. Labeling of detection probes requiring different numbers of probes
can be
accomplished in a similar fashion.
Of course, the two types of labeling schemes described above can be combined,
resulting
in detection probe molecules with multiple labels combined with detection
probe molecules of
the same type multiply labeled with different labels. This can be illustrated
using the example
above. Two pools of detection probe type 7 can be separately labeled, one pool
with both labels
A and B, aiid one pool with only label C. Mixing the pools results in a
solution of detection
probe 7 that collectively contains all three labels as required. Combinatorial
multicolor coding is
further illustrated in Examples 7 and 8.
Where each detection probe is labeled with a single label, label combinations
can also be
generated by using OCPs or ATCs with coded combinations of detection tags
complementary to
the different detection probes. In this scheme, the OCPs or ATCs will contain
a combination of
detection tags representing the combination of labels required for a specific
label code. Using
the example: above, a set of seven OC:Ps or ATCs, designated 1 though 7, would
contain one,
two, or three detection tags, chosen from a set of three detection tag
sequences designated dtA,
dtB, and dtC. Each detection tag sequence corresponds to one of the labels, A,
B, or C, with
each label c:oupled to one of three detection probes, designated dpA, dpB, or
dpC, respectively.
An example of the resulting coding scheme would be:
43
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
OCP or ATC 1 2 3 4 5 6 7
dtA + + + +
dtB + + + +
dtC + + + +
Hybridization could be performed with a pool of all the different labeled
detection probes, dpA,
dpB, and dpC. The result would be that TS-DNA generated from OCP 7 would
hybridize to all
three detection probes, thus labeling the TS-DNA with all three labels. In
contrast, TS-DNA
generated from OCP 4, for example, would hybridize only to detection probes
dpA and dpB,
thus labeling the OCP 4-derived TS-DNA with only labels A and B. This method
of coding and
detection is preferred. Use of this cod:ing scheme is illustrated in Examples
7 and 8.
As described above, rolling circle amplification can be engineered to produce
TS-DNA of
different len,gths in an assay involving multiple ligated OCPs or ATCs. The
resulting TS-DNA
of different llength can be distinguished simply on the basis of the size of
the detection signal
they generate. Thus, the same set of detection probes could be used to
distinguish two different
sets of generated TS-DNA. In this scheme, two different TS-DNAs, each of a
different size but
assigned the same color code, would b+-, distinguished by the size of the
signal produced by the
hybridized detection probes. In this way, a total of 126 different targets can
be distinguished on
a single solid-state sample using a code with 63 combinations, since the
signals will come in two
flavors, low amplitude and high amplitude. Thus one could, for example, use
the low amplitude
signal set of 63 probes for detection of an oncogene mutations, and the high
amplitude signal set
of 63 probes for the detection of a tumor suppressor p53 mutations.
Speicher et al. describes a set of fluors and corresponding optical filters
spaced across the
spectral interval 350-770 nm that give a high degree of discrimination between
all possible fluor
pairs. This fluor set, which is preferred for combinatorial multicolor coding,
consists of 4'-6-
diamidino-2-phenylinodole (DAPI), fluorescein (FITC), and the cyanine dyes
Cy3, Cy3.5, Cy5,
Cy5.5 and Cy7. Any subset of this preferred set can also be used where fewer
combinations are
required. The absorption and emissior.i maxima, respectively, for these fluors
are: DAPI (350
nm; 456 nm), FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588
nm), Cy5
(652 nm; 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm). The
excitation and
emission spectra, extinction coefficients and quantum yield of these fluors
are described by Ernst
et al., Cytor,netry 10:3-10 (1989), Mujiundar et al., Cytometry 10:11-19
(1989), Yu, Nucleic
Acids Res. 22:3226-3232 (1994), and Waggoner, Meth. Enzymology 246:362-373
(1995). These
fluors can al[l be excited with a 75W Xenon arc.
To attain selectivity, filters with bandwidths in the range of 5 to 16 nm are
preferred.
To increase signal discrimination, the fluors can be both excited and detected
at wavelengths far
44
CA 02236161 1998-05-21
WO 97/19193, PCTIUS96/18812
from their spectral maxima. Emission bandwidths can be made as wide as
possible. For low-
noise detectors, such as cooled CCD cameras, restricting the excitation
bandwidth has little
effect on attainable signal to noise ratios. A list of preferred filters for
use with the preferred
fluor set is listed in Table 1 of Speicher et al. It is important to prevent
infra-red light emitted
by the arc lwnp from reaching the detector; CCD chips are extremely sensitive
in this region.
For this purpose, appropriate IR blocking filters can be inserted in the image
path immediately
in front of tl:ie CCD window to minimize loss of image quality. Image analysis
software can
then be usecl to count and analyze the spectral signatures of fluorescent
dots.
Discrimination of individual signals in combinatorial multicolor coding can be
enhanced
by collapsing TS-DNA generated duririg amplification. As described above, this
is preferably
accomplished using collapsing detection probes, biotin-antibody conjugates, or
a combination of
both. A collapsed TS-DNA can occupy a space of no more than 0.3 microns in
diameter.
Based on this, it is expected that up to a million discrete signals can be
detected in a 2.5 mm
sample dot. Such discrimination also results in a large dynamic range for
quantitative signal
detection. For example, where two separate signals are detected in the same
sample dot, a ratio
of the two signals up to 1:500,000 can be detected. Thus, the relative numbers
of different
types of signals (such as multicolor codes) can be determined over a wide
range. This is
expected to allow determination of, for example, whether a particular target
sequence is
homozygous or heterozygous in a genomic DNA sample, whether a target sequence
was
inherited or represents a somatic mutation, and the genetic heterogeneity of a
genomic DNA
sample, sucli as a tumor sample. In the first case, a homozygous target
sequence would produce
twice the number of signals of a heterozygous target sequence. In the second
case, an inherited
target sequence would produce a number of signals equivalent to a homozygous
or heterozygous
signal (that jis, a large number of signals), while a somatic mutation would
produce a smaller
number of signals depending on the source of the sample. In the third case,
the relative number
of cells, froin which a sainple is derived, that have particular target
sequences can be
determined. The more cells in the sample with a particular target sequence,
the larger the
signal.
(e) Detecting Groups of Target Sequences
Multiplex RCA assays are particularly useful for detecting mutations in genes
where
numerous distinct mutations are associated with certain diseases or where
mutations in multiple
genes are involved. For example, although the gene responsible for
Huntington's chorea has
been identified, a wide range of mutations in different parts of the gene
occur among affected
individuals. The result is that no single test has been devised to detect
whether an individual has
one or more: of the many Huntington's mutations. A single LM-RCA assay can be
used to
CA 02236161 1998-05-21
WO 97/19193, PCT/US96/18812
detect the presence of one or more members of a group of any number of target
sequences.
This can be accomplished, for example, by designing an open circle probe (and
associated gap
oligonucleotides, if desired) for each t:arget sequence in the group, where
the target probe
portions of each open circle probe are different but the sequence of the
primer portions and the
sequence of the detection tag portions of all the open circle probes are the
same. All of the open
circle probes are placed in the same C-CP-target sample mixture, and the same
primer and
detection probe are used to amplify and detect TS-DNA. If any of the target
sequences are
present in the target sample, the OCP for that target will be ligated into a
circle and the circle
will be amplified to form TS-DNA. Since the detection tags on TS-DNA resulting
from
amplification of any of the OCPs are the same, TS-DNA resulting from ligation
of any of the
OCPs will be detected in that assay. Detection indicates that at least one
member of the target
sequence group is present in the target sample. This allows detection of a
trait associated with
multiple target sequences in a single tube or well.
If a positive result is found, the specific target sequence involved can be
identified by
using a multiplex assay. This can be facilitated by including an additional,
different detection
tag in each of the OCPs of the group. In this way, TS-DNA generated from each
different
OCP, representing each different target sequence, can be individually
detected. It is convenient
that such rnultiple assays need be performed only when an initial positive
result is found.
The above scheme can also be used with arbitrarily chosen groups of target
sequences in
order to screen for a large number of target sequences without having to
perform an equally
large number of assays. Initial assays can be performed as described above,
each using a
different group of OCPs designed to liybridize to a different group of target
sequences.
Additional assays to determine which target sequence is present can then be
performed on only
those groups that produce TS-DNA. Such group assays can be further nested if
desired.
(f) In Situ Detection Using RCA
In situ hybridization, and its naost powerful implementation, known as
fluorescent in situ
hybridization (FISH), is of fundamental importance in cytogenetics. RCA can be
adapted for
use in FISH, as follows.
Open circle probes are ligated on targets on microscope slides, and incubated
in situ with
fluorescent precursors during rolling circle replication. The rolling circle
DNA polymerase
displaces the ligated open circle probe from the position where it was
originally hybridized.
However, ithe circle will remain topologically trapped on the chromosome
unless the DNA is
nicked (Ni:lsson et al. (1994)). The presence of residual chromatin may slow
diffusion of the
circle along the chromosome. Alternatively, fixation methods may be modified
to minimize this
diffusional effect. This diffusion has an equal probability of occurring in
either of two directions
46
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
along the chromosome, and hence net diffusional displacement may be relatively
small during a
minute incubation. During this time rolling circle replication should generate
a linear
molecule of approximately 25,000 nucleotides containing approximately 2,500
bromodeoxyuridine moieties, which can be detected with a biotinylated anti-
BUDR IgG (Zymed
Labs, Inc.) and fluorescein-labeled avidin. This level of incorporation should
facilitate recording
of the image using a microscope-based CCD system. Diffusion may also be
limited because the
TS-DNA should be able to hybridize with the complement of the target strand.
A preferred method of in situ detection is Reporter Binding Agent Unimolecular
Rolling
Amplification (RBAURA), which is described below. In RBAURA, a reporter
binding agent is
used where the oligonucleotide portior.i serves as a rolling circle
replication primer. Once the
reporter binding agent is associated with a target molecule, an amplification
target circle is
hybridized to the rolling circle replication primer sequence of the reporter
binding agent
followed by amplification of the ATC by RCA. The resulting TS-DNA has the
rolling circle
replication primer sequence of the reporter binding agent at one end, thus
anchoring the TS-
DNA to the site of the target molecule. Peptide Nucleic Acid Probe
Unimolecular Rolling
Amplification (PNAPURA) and Locked Antibody Unimolecular Rolling Amplification
(LAURA), described below, are prefe:rred forms of RBAURA.
Localization of the TS-DNA for in situ detection can also be enhanced by
collapsing the
TS-DNA using collapsing detection probes, biotin-antibody conjugates, or both,
as described
above. Mu:ltiplexed in situ detection c:an be carried out as follows: Rolling
circle replication is
carried out using unlabeled nucleotides. The different TS-DNAs are then
detected using
standard multi-color FISH with detection probes specific for each unique
target sequence or each
unique detection tag in the TS-DNA. Alternatively, and preferably,
combinatorial multicolor
coding, as clescribed above, can be used for multiplex in situ detection.
(g) Enzyme-linked Detection
Amplified nucleic acid labeled by incorporation of labeled nucleotides can be
detected
with established enzyme-linked detection systems. For example, amplified
nucleic acid labeled
by incorporation of biotin-16-UTP (Boehringher Mannheim) can be detected as
follows. The
nucleic acid. is immobilized on a solid glass surface by hybridization with a
complementary DNA
oligonucleotide (address probe) complementary to the target sequence (or its
complement)
present in the amplified nucleic acid. After hybridization, the glass slide is
washed and
contacted with alkaline phosphatase-streptavidin conjugate (Tropix, Inc.,
Bedford, MA). This
enzyme-stre:ptavidin conjugate binds to the biotin moieties on the amplified
nucleic acid. The
slide is again washed to remove excess enzyme conjugate and the
chemiluminescent substrate
47
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
CSPD (Tropix, Inc.) is added and covered with a glass cover slip. The slide
can then be imaged
in a Biorad :Fluorimager.
(h) Collapse of Nucleic Acids
As described above, TS-DNA or TS-RNA, which are produced as extended nucleic
acid
molecules, can be collapsed into a compact structure. It should also be
understood that the same
collapsing procedure can be performed on any extended nucleic acid molecule.
For example,
genomic DNA, PCR products, viral RNA or DNA, and cDNA samples can all be
collapsed into
compact stnictures using the disclosed collapsing procedure. It is preferred
that the nucleic acid
to be collapsed is immobilized on a substrate. A preferred means of collapsing
nucleic acids is
by hybridizing one or more collapsing probes with the nucleic acid to be
collapsed. Collapsing
probes are oligonucleotides having a p;lurality of portions each complementary
to sequences in
the nucleic acid to be collapsed. These portions are referred to as
complementary portions of
the collapsir.ig probe, where each complementary portion is complementary to a
sequence in the
nucleic acid to be collapsed. The sequences in the nucleic acid to be
collapsed are referred to as
collapsing target sequences. The complementary portion of a collapsing probe
can be any length
that supports specific and stable hybridization between the collapsing probe
and the collapsing
target sequeince. For this purpose, a length of 10 to 35 nucleotides is
preferred, with a
complementary portion of a collapsing probe 16 to 20 nucleotides long being
most preferred. It
is preferred that at least two of the complementary portions of a collapsing
probe be
complementary to collapsing target sequences which are separated on the
nucleic acid to be
collapsed or to collapsing target sequences present in separate nucleic acid
molecules. This
allows each detection probe to hybridize to at least two separate collapsing
target sequences in
the nucleic acid sample. In this way, the collapsing probe forms a bridge
between different
parts of the nucleic acid to be collapsed. The combined action of numerous
collapsing probes
hybridizing to the nucleic acid will be to form a collapsed network of cross-
linked nucleic acid.
Collapsed nucleic acid occupies a much smaller volume than free, extended
nucleic acid, and
includes whatever detection probe or detection label hybridized to the nucleic
acid. This result
is a compact: and discrete nucleic acid structure which can be more easily
detected than extended
nucleic acid. Collapsing nucleic acids is useful both for in situ
hybridization applications and for
multiplex detection because it allows detectable signals to be spatially
separate even when closely
packed. Collapsing nucleic acids is especially preferred for use with
combinatorial multicolor
coding.
Collapsing probes can also contain any of the detection labels described
above. This
allows detection of the collapsed nucleic acid in cases where separate
detection probes or other
means of detecting the nucleic acid are not employed. Preferred labels are
biotin and fluorescent
48
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
molecules. A particularly preferred detection probe is a molecular beacon.
Molecular beacons
are detection probes labeled with fluorescent moieties where the fluorescent
moieties fluoresce
only when the detection probe is hybridized. The use of such probes eliminates
the need for
removal of unhybridized probes prior ito label detection because the
unhybridized detection
probes will not produce a signal. This is especially useful in multiplex
assays.
TS-DNA collapse can also be accomplished through the use of ligand/ligand
binding pairs
(such as biotin and avidin) or hapten/antibody pairs. As described in Example
6, a nucleotide
analog, BUDR, can be incorporated into TS-DNA during rolling circle
replication. When
biotinylated antibodies specific for BUDR and avidin are added, a cross-linked
network of TS-
DNA forms, bridged by avidin-biotin-antibody conjugates, and the TS-DNA
collapses into a
compact stn.icture. Biotin-derivatized nucleic acid can be formed in many of
the common
nucleic acid replication operations such as cDNA synthesis, PCR, and other
nucleic acid
amplification techniques. In most cases, biotin can be incorporated into the
synthesized nucleic
acid by either incorporation of biotin-derivatized nucleotides or through the
use of biotin-
derivatized ;primers. Collapsing probes and biotin-mediated collapse can also
be used together to
collapse nucleic acids.
2. Nested LM-RCA
Afte:r RCA, a round of LM-RC'A can be performed on the TS-DNA produced in the
first
RCA. This new round of LM-RCA is performed with a new open circle probe,
referred to as a
secondary open circle probe, having target probe portions complementary to a
target sequence in
the TS-DNA produced in the first round. When such new rounds of LM-RCA are
performed,
the amplification is referred to herein as nested LM-RCA. Nested LM-RCA is
particularly
useful for irt situ hybridization applications of LM-RCA. Preferably, the
target probe portions
of the secondary OCP are complementary to a secondary target sequence in the
spacer sequences
of the TS-DNA produced in the first RCA. The complement of this secondary
target sequence
is present iri the spacer portion of the OCP or ATC used in the first RCA.
After mixing the
secondary C)CP with the TS-DNA, ligation and rolling circle amplification
proceed as in LM-
RCA. Eacli ligated secondary OCP generates a new TS-DNA. By having, for
example, two
secondary target sequence portions in the first round OCP, the new round of LM-
RCA will yield
two secondary TS-DNA molecules for every OCP or ATC repeat in the TS-DNA
produced in
the first RCA. Thus, the a.mplification yield of nested LM-RCA is about 2000-
fold. The
overall amplification using two cycles of RCA is thus 1000 X 2000 = 2,000,000.
Nested LM-
RCA can follow any DNA replication or transcription operation described
herein, such as RCA,
LM-RCA, secondary DNA strand displacement, strand displacement cascade
amplification, or
transcriptioin.
49
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Generally, nested LM-RCA involves, following a first RCA,
(a) mixing a secondary open circle probe with the polymerase mixture,
resulting in an
OCP-TS mixture, and incubating the OCP-TS mixture under conditions promoting
hybridization
between the: secondary open circle prcibe and the tandem sequence DNA,
(b) mixing ligase with the OCP-TS mixture, resulting in a secondary ligation
mixture,
and incubating the secondary ligation mixture under conditions promoting
ligation of the
secondary open circle probe to form a, secondary amplification target circle,
(c) mixing a rolling circle replication primer with the secondary ligation
mixture,
resulting in a secondary primer-ATC mixture, and incubating the secondary
primer-ATC mixture
under conditions that promote hybridization between the secondary
amplification target circle
and rolling circle replication primer,
(d) mixing DNA polymerase with the secondary primer-ATC mixture, resulting in
a
secondary polymerase-ATC mixture, and incubating the secondary polymerase-ATC
mixture
under conditions promoting replication of the secondary amplification target
circle, where
replication of the secondary amplification target circle results in formation
of nested tandem
sequence DNA.
An exonuclease digestion step can be added prior to performing the nested LM-
RCA.
This is especially useful when the target probe portions of the secondary open
circle probe are
the same as those in the first open circle probe. Any OCP which has been
ligated will not be
digested since ligated OCPs have no free end. A preferred way to digest OCPs
that have
hybridized to TS-DNA during the first round of LM-RCA is to use a special
rolling circle
replication primer containing at least about four phosphorothioate linkages
between the
nucleotides at the 5' end. Then, following rolling circle replication, the
reaction mixture is
subjected to, exonuclease digestion. By using a 5' exonuclease unable to
cleave these
phosphorotliioate linkages, only the OCPs hybridized to TS-DNA will be
digested, not the TS-
DNA. The TS-DNA generated during the first cycle of amplification will not be
digested by the
exonuclease: because it is protected by the phosphorothioate linkages at the
5' end. A preferred
exonuclease for this purpose is the T7 gene 6 exonuclease. The T7 gene 6
exonuclease can be
inactivated prior to adding the secondary open circle probe by heating to 90 C
for 10 minutes.
By using an exonuclease digestion, nested LM-RCA can be performed using the
same
target sequence used in a first round of LM-RCA. This can be done, for
example, generally as
follows. After the first round of LM-RCA, the unligated open circle probes and
gap
oligonucleotides hybridized to TS-DNA are digested with T7 gene 6 exonuclease.
The
exonuclease is inactivated by heating for 10 minutes at 90 C. Then a second
open circle probe
is added. In this scheme, the second open circle probe has target probe
portions complementary
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
to the same original target sequence, but which contain a different
(arbitrary) spacer region
sequence. A second round of LM-RCA is then performed. In this second round,
the target of
the second open circle probes comprise:s the repeated target sequences
contained in the TS-DNA
generated by the first cycle. This procedure has the advantage of preserving
the original target
sequence in the amplified DNA obtained after nested LM-RCA.
Nested LM-RCA can also be performed on ligated OCPs or ATCs that have not been
amplified. l:n this case, LM-RCA can be carried out using either ATCs or
target-dependent
ligated OCPs. This is especially useful for in situ detection. For in situ
detection, the first,
unamplified OCP, which is topologically locked to its target sequence, can be
subjected to nested
LM-RCA. By not amplifying the first OCP, it can remain hybridized to the
target sequence
while LM-RCA amplifies a secondary OCP topologically locked to the first OCP.
This is
illustrated in Figure 12.
3. Secondary DNA strand displacement and Strand Displacement Cascade
Amplification
Secondary DNA strand displacement is another way to amplify TS-DNA. Secondary
DNA strand displacement is accomplished by hybridizing secondary DNA strand
displacement
primers to 7'S-DNA and allowing a DNA polymerase to synthesize DNA from these
primed sites
(Figure 11). Since a complement of the secondary DNA strand displacement
primer occurs in
each repeat of the TS-DNA, secondary DNA strand displacement can result in a
level of
amplification similar to or larger than that obtained in RCT. The product of
secondary DNA
strand displacement is referred to as secondary tandem sequence DNA or TS-DNA-
2.
Secondary DNA strand displacement can be accomplished by performing RCA to
produce TS==DNA in a polymerase-ATC mixture, and then mixing secondary DNA
strand
displacement primer with the polymerase-ATC mixture, resulting in a secondary
DNA strand
displacement mixture, and incubating the secondary DNA strand displacement
mixture under
conditions promoting replication of the: tandem sequence DNA. The secondary
DNA strand
displacemen.t primer is complementary to a part of the OCP or ATC used to
generated TS-DNA
as described earlier. It is preferred that the secondary DNA strand
displacement primer is not
complementary to the rolling circle replication primer, or to a tertiary DNA
strand displacement
primer, if used.
Secondary DNA strand displacement can also be carried out simultaneously with
rolling
circle replication. This is accomplished by mixing secondary DNA strand
displacement primer
with the po].ymerase-ATC mixture prior to incubating the mixture for rolling
circle replication.
For simultaneous rolling circle replication and secondary DNA strand
displacement, it is
preferred that the rolling circle DNA polymerase be used for both
replications. This allows
optimum conditions to be used and results in displacement of other strands
being synthesized
51
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
downstrearn as shown in Figure 11B. Secondary DNA strand displacement can
follow any DNA
replication operation disclosed herein, such as RCA, LM-RCA or nested LM-RCA.
To optimize the efficiency of secondary DNA strand displacement, it is
preferred that a
sufficient concentration of secondary DNA strand displacement primer be used
to obtain
sufficiently rapid priming of the growing TS-DNA strand to outcompete any
remaining unligated
OCPs and gap oligonucleotides that might be present for binding to TS-DNA. In
general, this is
accomplished when the secondary DNA strand displacement primer is in very
large excess
compared to the concentration of single-stranded sites for hybridization of
the secondary DNA
strand displacement primer on TS-DNA. Optimization of the concentration of
secondary DNA
strand displacement primer can be aided by analysis of hybridization kinetics
using methods such
as those described by Young and Anderson, "Quantitative analysis of solution
hybridization" in
Nucleic Acid Hybridization: A Practical Approach (IRL Press, 1985) pages 47-
71. For example,
assuming ttiat 029 DNA polymerase is used as the rolling circle DNA
polymerase, TS-DNA is
generated at a rate of about 53 nucleotides per second, and the rolling circle
DNA polymerase
generates approximately 10 copies of the amplification target circle in 19
seconds. Analysis of
the theoretical solution hybridization kinetics for an OCP driver DNA
(unligated OCP) present at
a concentration of 80 nM (a typical concentration used for a LM-RCA ligation
operation), and
the theoretical solution hybridization kinetics for a secondary DNA strand
displacement primer
driver DNA present at a concentratioii of 800 nM, indicates that the secondary
DNA strand
displacement primer will bind to those 10 copies within 30 seconds, while
unligated OCP will
hybridize to less than one site in 30 seconds (8% of sites filled). If the
concentration of DNA
polymerase is relatively high (for this example, in the range of 100 to 1000
nM), the polymerase
will initiate DNA synthesis at each available 3' terminus on the hybridized
secondary DNA
strand displacement primers, and these elongating TS-DNA-2 molecules will
block any
hybridization by the unligated OCP molecules. Alternatively, the efficiency of
secondary DNA
strand displiacement can be improved by the removal of unligated open circle
probes and gap
oligonucleotides prior to amplificatiori of the TS-DNA. In secondary DNA
strand displacement,
it is preferred that the concentration of secondary DNA strand displacement
primer generally be
from 500 nM to 5000 nM, and most preferably from 700 nM to 1000 nM.
As a secondary DNA strand displacement primer is elongated, the DNA polymerase
will
run into the 5' end of the next hybridized secondary DNA strand displacement
molecule and will
displace its 5' end. In this fashion a tandem queue of elongating DNA
polymerases is formed
on the TS-IDNA template. As long as the rolling circle reaction continues, new
secondary DNA
strand displacement primers and new DNA polymerases are added to TS-DNA at the
growing
52
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
end of the rolling circle. The generation of TS-DNA-2 and its release into
solution by strand
displacement is shown diagrammatically in Figure 11.
Generally, secondary DNA strand displacement can be performed by, simultaneous
with
or following RCA, mixing a secondazy DNA strand displacement primer with the
polymerase-
ATC mixture, and incubating the polymerase-ATC mixture under conditions that
promote both
hybridization between the tandem sequence DNA and the secondary DNA strand
displacement
primer, and replication of the tandem sequence DNA, where replication of the
tandem sequence
DNA results in the formation of secondary tandem sequence DNA.
When secondary DNA strand displacement is carried out in the presence of a
tertiary
DNA strand displacement primer, an exponential atnplification of TS-DNA
sequences takes
place. This special and preferred mode of secondary DNA strand displacement is
referred to as
strand displiacement cascade amplification (SDCA). In SDCA, illustrated in
Figure 13, a
secondary IDNA strand displacement primer primes replication of TS-DNA to form
TS-DNA-2,
as described above. The tertiary DNA strand displacement primer strand can
then hybridize to,
and prime ireplication of, TS-DNA-2 to form TS-DNA-3. Strand displacement of
TS-DNA-3 by
the adjacent, growing TS-DNA-3 strands makes TS-DNA-3 available for
hybridization with
secondary ]DNA strand displacement primer. This results in another round of
replication
resulting in. TS-DNA-4 (which is equivalent to TS-DNA-2). TS-DNA-4, in turn,
becomes a
template for DNA replication primed by tertiary DNA strand displacement
primer. The cascade
continues tlhis manner until the reaction stops or reagents become limiring.
This reaction
amplifies DNA at an almost exponential rate, although kinetics are not truly
exponential because
there are stochastically distributed priming failures, as well as steric
hindrance events related to
the large size of the DNA network produced during the reaction. In a preferred
mode of
SDCA, the rolling circle replication primer serves as the tertiary DNA strand
displacement
primer, thus eliminating the need for a separate primer. For this mode, the
rolling circle
replication primer should be used at a concentration sufficiently high to
obtain rapid priming on
the growin;g TS-DNA-2 strands. To optimize the efficiency of SDCA, it is
preferred that a
sufficient concentration of secondary DNA strand displacement primer and
tertiary DNA strand
displacement primer be used to obtaiii sufficiently rapid priming of the
growing TS-DNA strand
to outcompete TS-DNA for binding to its complementary TS-DNA, and, in the case
of
secondary DNA strand displacement primer, to outcompete any remaining
unligated OCPs and
gap oligoniucleotides that might be present for binding to TS-DNA. In general,
this is
accomplished when the secondary DNA strand displacement primer and tertiary
DNA strand
displacement primer are both in very large excess compared to the
concentration of single-
stranded sites for hybridization of the DNA strand displacement primers on TS-
DNA. For
53
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
example, it is preferred that the secondary DNA strand displacement primer is
in excess
compared to the concentration of single-stranded secondary DNA strand
displacement primer
complement sites on TS-DNA, TS-DNA-3, TS-DNA-5, and so on. In the case of
tertiary DNA
strand displacement primer, it is preferred that the tertiary DNA strand
displacement primer is in
excess compared to the concentration of single-stranded tertiary DNA strand
displacement primer
complement sites on TS-DNA-2, TS-DNA-4, TS-DNA-6, and so on. Such an excess
generally
results in a primer hybridizing to its complement in TS-DNA before amplified
complementary
TS-DNA can hybridize. Optimization of primer concentrations can be aided by
analysis of
hybridizatior.L kinetics (Young and Anderson). In a strand displacement
cascade amplification, it
is preferred that the concentration of both secondary and tertiary DNA strand
displacement
primers generally be from 500 nM to 5000 nM, and most preferably from 700 nM
to 1000 nM.
As in the case of secondary DNA strand displacement primers, if the
concentration of
DNA polymerase is sufficiently high, the polymerase will initiate DNA
synthesis at each
available 3' terminus on the hybridized tertiary DNA strand displacement
primers, and these
elongating TS-DNA-3 molecules will block any hybridization by TS-DNA-2. As a
tertiary DNA
strand displacement primer is elongatedi to form TS-DNA-3, the DNA polymerase
will run into
the 5' end of' the next hybridized tertiary DNA strand displacement primer
molecule and will
displace its S' end. In this fashion a tandem queue of elongating DNA
polymerases is formed
on the TS-DNA-2 template. As long as the reaction continues, new rolling
circle replication
primers and new DNA polymerases are added to TS-DNA-2 at the growing ends of
TS-DNA-2.
This hybridia.ation/replication/strand displacement cycle is repeated with
hybridization of
secondary DNA strand displacement primers on the growing TS-DNA-3. The cascade
of TS-
DNA generation, and their release into solution by strand displacement is
shown
diagrammatically in Figure 13.
Gene:rally, strand displacement cascade amplification can be performed by,
simultaneous
with, or following, RCA, mixing a seo:)ndary DNA strand displacement primer
and a tertiary
DNA strand displacement primer with ithe polymerase-ATC mixture, and
incubating the
polymerase-ATC mixture under conditions that promote hybridization between the
tandem
sequence DNA and the secondary DNA, strand displacement primer, replication of
the tandem
sequence DNA -- where replication of the tandem sequence DNA results in the
formation of
secondary tandem sequence DNA -- hybridization between the secondary tandem
sequence DNA
and the tertiary DNA strand displacement primer, and replication of secondary
tandem sequence
DNA -- where replication of the secondary tandem sequence DNA results in
formation of
tertiary tandem sequence DNA (TS-DNA-3).
54
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
An example of the amplification yield generated by a strand displacement
cascade
amplification can be roughly estimated as follows: A rolling circle reaction
that proceeds for 35
minutes at 53 nucleotides per second will generate 1236 copies of a 90
nucleotide amplification
target circle. Thus, TS-DNA-1 contains 1236 tandem repeats. As these 1236
tandem repeats
grow, priming and synthesis with seccindary DNA strand displacement primers
can generate at
least 800 TS-DNA-2 molecules, taking into account delays and missed priming
events. These
new molecules will have lengths linearly distributed in the range of 1 to 799
repeats. Next,
priming events on TS-DNA-2 by tertiary DNA strand displacement primers can
generate at least
500 TS-DNA-3 molecules, taking into account delays and missed priming events,
and these new
molecules will have lengths linearly distributed in the range of 1 to 499
repeats. Then, priming
events on TS-DNA-3 by secondary DNA strand displacement primers can generate
at least 300
TS-DNA-4 molecules, taking into account delays and missed priming events, and
these new
molecules vvill have lengths linearly distributed in the range of 1 to 299
repeats. A conservative
overall amplification yield, calculated as the product of only these four
amplification levels, is
estimated to be 1.86 X 1010 repeats of the original OCP or ATC. Thus, SDCA is
capable of
extremely high amplification yields in an isothermal 35-minute reaction.
Secondary DNA strand displacement can also be carried out sequentially.
Following a
first round of secondary DNA strand displacement, a tertiary DNA strand
displacement primer
can be mixed with the polymerase-ATC mixture, and the polymerase-ATC mixture
can be
incubated under conditions that promore hybridization between the secondary
tandem sequence
DNA and the tertiary DNA strand displacement primer, and replication of
secondary tandem
sequence DNA, where replication of the secondary tandem sequence DNA results
in formation
of tertiary uuidem sequence DNA (TS-DNA-3). This round of strand displacement
replication
can be referred to as tertiary DNA strand displacement. However, all rounds of
strand
displacement replication following rolling circle replication can also be
referred to collectively as
secondary DNA strand displacement.
A modified form of secondary:DNA strand displacement results in amplification
of TS-
DNA and is referred to as opposite strand amplification (OSA). OSA is the same
as secondary
DNA strand displacement except that a special form of rolling circle
replication primer is used
that prevents it from hybridizing to TS-DNA-2. This can be accomplished in a
number of ways.
For example, the rolling circle replication primer can have an affinity tag
coupled to its non-
complementary portion allowing the rolling circle replication primer to be
removed prior to
secondary DNA strand displacement. Alternatively, remaining rolling circle
replication primer
can be crippled following initiation of rolling circle replication. One
preferred form of rolling
circle replication primer for use in OSA is designed to form a hairpin that
contains a stem of
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
perfectly base-paired nucleotides. The stem can contain 5 to 12 base pairs,
most preferably 6 to
9 base pairs. Such a hairpin-forming rolling circle replication primer is a
poor primer at lower
temperature: (less than 40 C) because the hairpin structure prevents it from
hybridizing to
complementary. sequences. The stem should involve a sufficient number of
nucleotides in the
complementary portion of the rolling circle replication primer to interfere
with hybridization of
the primer to the OCP or ATC. Generally, it is preferred that a stem involve 5
to 24
nucleotidesõ and most preferably 6 to 18 nucleotides, of the complementary
portion of a rolling
circle replication primer. A rolling circle replication primer where half of
the stem involves
nucleotides in the complementary portion of the rolling circle replication
primer and the other
half of the stem involves nucleotides in the non-complementary portion of the
rolling circle
replication primer is most preferred. Such an arrangement eliminates the need
for self-
complemenitary regions in the OCP or ATC when using a hairpin-forming rolling
circle
replication lprimer.
When starting the rolling circlE: replication reaction, secondary DNA strand
displacement
primer and rolling circle replication primer are added to the reaction
mixture, and the solution is
incubated briefly at a temperature sufficient to disrupt the hairpin structure
of the rolling circle
replication primer but to still allow hybridization to the primer complement
portion of the
amplification target circle (typically greater than 50 C). This incubation
permits the rolling
circle replication primer to hybridize to the primer complement portion of the
amplification
target circle. The solution is then brought to the proper temperature for
rolling circle
replication, and the rolling circle DNA polymerase is added. As the rolling
circle reaction
proceeds, TS-DNA is generated, and as the TS-DNA grows in length, the
secondary DNA
strand displacement primer rapidly initiates DNA synthesis with multiple
strand displacement
reactions orr TS-DNA. These reactiorrs generate TS-DNA-2, which is
complementary to the TS-
DNA. While TS-DNA-2 contains sequences complementary to the rolling circle
replication
primer, the primer is not able to hybr:idize nor prime efficiently at the
reaction temperature due
to its hairpin structure at this temperature. Thus, there is no further
priming by the rolling
circle replication primer and the only products generated are TS-DNA and TS-
DNA-2. The
reaction cornes to a halt as rolling circ:le amplifrcation stops and TS-DNA
becomes completely
double-stranded. In the course of the reaction, an excess of single-stranded
TS-DNA-2 is
generated.
Another form of rolling circle replication primer useful in OSA is a chimera
of DNA and
RNA. In this embodiment, the rolling circle primer has deoxyribonucleotides at
its 3' end and
ribonucleotides in the remainder of the primer. It is preferred that the
rolling circle replication
primer have five or six deoxyribonucleotides at its 3' end. By making part of
the rolling circle
56
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
replication primer with ribonucleotide, the primer can be selectively degraded
by RNAse H
when it is h,ybridized to DNA. Such hybrids form during OSA as TS-DNA-2 is
synthesized.
The deoxyribonucleotides at the 3' end allow the rolling circle DNA polymerase
to initiate
rolling circle replication. RNAse H can then be added to the OSA reaction to
prevent priming
of TS-DNA.-2 replication.
An example of the amplification yield generated by OSA can be roughly
estimated as
follows. A rolling circle reaction that proceeds for 45 minutes at 53
nucleotides per second will
generate tandem 1590 copies of a 90 nucleotide amplification target circle.
Thus, TS-DNA-1
contains 1590 tandem repeats. As these 1590 tandem repeats grow, priming and
displacement
reactions with secondary DNA strand displacement primers will generate and
release up to 1400
TS-DNA-2 molecules, and those new inolecules will have lengths linearly
distributed in the
range of 1 to 1399 repeats. Calculations indicate that after 45 minutes,
single-stranded TS-
DNA-2 exceeds the amount of TS-DNA by a factor of about 700. OSA is useful for
generating
single-stranded DNA that contains the reverse complement of the target
sequence. Overall
amplificatioin can be of the order of one million fold.
If secondary DNA strand displacement is used with a ligated OCP, unligated
OCPs and
gap oligonucleotides may be removed prior to rolling circle replication to
eliminate competition
between unligated OCPs and gap oligonucleotides and the secondary DNA strand
displacement
primer for hybridization to TS-DNA. An exception would be when secondary DNA
strand
displacement is used in conjunction with gap-filling LM-RCA, as described
below.
Alternatively, the concentration of the secondary DNA strand displacement
primer can be made
sufficiently :high so that it outcompetes unligated OCP for hybridization to
TS-DNA. This
allows secondary DNA strand displacement to be performed without removal of
unligated OCPs.
The DNA generated by secondary DNA strand displacement can be labeled and/or
detected usimg the same labels, labeling methods, and detection methods
described for use with
TS-DNA. Most of these labels and methods are adaptable for use with nucleic
acids in general.
A preferred method of labeling the DNA is by incorporation of labeled
nucleotides during
synthesis.
4. Dilultiple Ligation Cycles
Using a thermostable DNA ligtse, such as AMPLIGASE (Epicentre Technologies,
Inc.), the open circle probe ligation reaction may be cycled a number of times
between a
annealing temperature (55 C) and a melting temperature (96 C). This cycling
will produce
multiple ligitions for every target sequence present in the sample. For
example, 8 cycles of
ligation would provide and approximate 6-fold increase in the number of
ligated circles. A
preferred cycling protocol is 96 C for 2 seconds, 55 C for 2 seconds, and 60 C
for 70 seconds
57
CA 02236161 1998-05-21
WO 97/19193, PCT/US96/18812
in a Perkin Elmer 9600 thermal cycler. If the number of cycles is kept small,
the linearity of
the amplification response should not be compromised.
The expected net amplification yield using eight ligation cycles, secondary
fluorescent
tags, and array hybridization can be calculated as shown below.
Ligation cycling yield: 6
OSA yield 1,000,000
number of fluorescent tags/circle 5
20% array liybridization yield 0.2
Net yield = 6 X 1,000,000 X 5 X 0.2 = 6,000,000
100 target r.nolecules X 6,000,000 = 6 X 108 fluors bound on the surface
5. 'Transcription Following RCA (RCT)
Once TS-DNA is generated using RCA, further amplification can be accomplished
by
transcribing the TS-DNA from promoters embedded in the TS-DNA. This combined
process,
referred to as rolling circle replication with transcription (RCT), or
ligation mediated rolling
circle replication with transcription (LM-RCT), requires that the OCP or ATC
from which the
TS-DNA is made have a promoter portion in its spacer region. The promoter
portion is then
amplified along with the rest of the OCP or ATC resulting in a promoter
embedded in each
tandem repeat of the TS-DNA (Figure 8). Since transcription, like rolling
circle a.mplification,
is a process that can go on continuously (with re-initiation), multiple
transcripts can be produced
from each af the multiple promoters present in the TS-DNA. RCT effectively
adds another level
of amplification of ligated OCP sequences.
Generally, RCT can be accomplished by performing RCA to produce TS-DNA in a
polymerase--OCP mixture or polymerase-ATC mixture, and then mixing RNA
polymerase with
the polymerase-OCP mixture or polynierase-ATC mixture, resulting in a
transcription mixture,
and incubating the transcription mixture under conditions promoting
transcription of the tandem
sequence DNA. The OCP or ATC must include the sequence of a promoter for the
RNA
polymerase (a promoter portion) in its spacer region for RCT to work. The
transcription step in
RCT generally can be performed using established conditions for in vitro
transcription of the
particular RNA polymerase used. Preferred conditions are described in the
Examples.
Alternatively, transcription can be carried out simultaneously with rolling
circle replication.
This is accomplished by mixing RNA polymerase with the polymerase-OCP mixture
or
polymerase--ATC mixture prior to incubating the mixture for rolling circle
replication. For
simultaneous rolling circle replication and transcription the rolling circle
DNA polymerase and
RNA polynierase must be active in the same conditions. Such conditions can be
optimized in
order to balance and/or maximize the activity of both polymerases. It is not
necessary that the
58
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
polymerase achieve their maximum activity, a balance between the activities is
preferred.
Transcription can follow any DNA replication operation described herein, such
as RCA, LM-
RCA, nexteci LM-RCA, secondary DNA strand displacement, or strand displacement
cascade
amplification.
The transcripts generated in RCT can be labeled and/or detected using the same
labels,
labeling methods, and detection methods described for use with TS-DNA. Most of
these labels
and methods are adaptable for use with nucleic acids in general. A preferred
method of labeling
RCT transci=ipts is by direct labeling of the transcripts by incorporation of
labeled nucleotides,
most preferably biotinylated nucleotides, during transcription.
6. Gap-Filling Ligation
The gap space formed by an OCP hybridized to a target sequence is normally
occupied
by one or more gap oligonucleotides as described above. Such a gap space may
also be filled in
by a gap-filling DNA polymerase during the ligation operation. As an
alternative, the gap space
can be partially bridged by one or more gap oligonucleotides, with the
remainder of the gap
filled using DNA polymerase. This modified ligation operation is referred to
herein as gap-
filling ligation and is the preferred fonn of the ligation operation. The
principles and procedure
for gap-filliiig ligation are generally analogous to the filling and ligation
perfonmed in gap LCR
(Wiedmann et al., PCR Methods and Applications (Cold Spring Harbor Laboratory
Press, Cold
Spring Harbor Laboratory, NY, 1994) pages S51-S64; Abravaya et al., Nucleic
Acids Res.,
23(4):675-6:32 (1995); European Patent Application EP0439182 (1991)). In the
case of LM-
RCA, the gap-filling ligation operation is substituted for the normal ligation
operation. Gap-
filling ligation provides a means for discriminating between closely related
target sequences. An
example of this is described in Example 3. Gap-filling ligation can be
accomplished by using a
different DNA polymerase, referred to herein as a gap-filling DNA polymerase.
Suitable gap-
filling DNA polymerases are described above. Alternatively, DNA polymerases in
general can
be used to fill the gap when a stop base is used. The use of stop bases in the
gap-filling
operation of' LCR is described in European Patent Application EP0439182. The
principles of
the design of gaps and the ends of flanking probes to be joined, as described
in EP0439182, is
generally applicable to the design of ttie gap spaces and the ends of target
probe portions
described herein.
To prevent interference of the gap-filling DNA polymerase with rolling circle
replication, the gap-filling DNA polynierase can be removed by extraction or
inactivated with a
neutralizing antibody prior to performing rolling circle replication. Such
inactivation is
analogous to the use of antibodies for blocking Taq DNA polymerase prior to
PCR (Kellogg et
al., Biotechniques 16(6):11341137 (1994)).
59
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Gap-filling ligation is also preferred because it is highly compatible with
exponential
amplification of OCP sequences similar to the strand displacement cascade
amplification (SDCA)
as describeci above. As TS-DNA is formed during rolling circle replication,
unligated OCP
molecules present in the reaction hybridize to TS-DNA, leaving gap spaces
between every OCP
repeat. The hybridized OCP molecules serve as primers for secondary DNA
synthesis.
Generally, gap-filling LM-RCA can be performed by, in an LM-RCA reaction, (1)
using
a target sequence with a central regior.i located between a 5' region and a 3'
region, and an OCP
where neither the left target probe portion of the open circle probe nor the
right target probe
portion of the open circle probe is complementary to the central region of the
target sequence,
and (2) mixing gap-filling DNA polymerase with the OCP-target sample mixture.
7. Ligation Mediated Rolling Circle Amplification with Combinatorial
Multicolor
Coding
A preferred form of rolling ci;rcle amplification involving multiplex
detection is Ligation
Mediated Rolling Circle Amplificatiori with Combinatorial Multicolor Coding
(LM-RCA-CMC),
which is a combination of LM-RCA and CMC, both as described above. In LM-RCA-
CMC,
open circle probes and corresponding gap oligonucleotides are designed for the
detection of a
number of distinct target sequences. ]JNA samples to be tested are
incorporated into a solid-
state sample, as described above. The solid-state substrate is preferably a
glass slide and the
solid-state sample preferably incorporates up to 256 individual target or
assay samples arranged
in dots. Multiple solid-state samples can be used to either test more
individual samples, or to
increase the: number of distinct target sequences to be detected. In the later
case, each solid-state
sample has an identical set of sarnple dots, and LM-RCA will be carried out
using a different set
of open circle probes and gap oligonucleotides, collectively referred to as a
probe set, for each
solid-state sample. This allows a large number of individuals and target
sequences to be assayed
in a single assay. By using up to six different labels, combinatorial
multicolor coding allows up
to 63 distinct targets to be detected on a single solid-state sample. When
using multiple solid-
state substrates and performing LM-RCA with a different set of OCPs and gap
oligonucleotides
for each sollid-state substrate, the same labels can be used with each solid-
state sample (although
differences between OCPs in each set may require the use of different
detection probes). For
example, 10 replica slides, each with 256 target sample dots, can be subjected
to LM-RCA using
different sets of OCPs and gap oligonucleotides, where each set is designed
for combinatorial
multicolor coding of 63 targets. This result in an assay for detection of 630
different target
sequences. Where two or more different target sequences are closely spaced in
the DNA of the
target or assay sample (for example, 'vhen multiple closely spaced mutations
of the same gene
are targets), it is preferred that the OCPs and gap oligonucleotides for each
of the closely spaced
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
target sequences be placed in a different probe set. For this purpose, it is
considered that target
sequences within 20 nucleotides of each other on a DNA molecule in a target or
assay sample
are closely spaced. It is not required that multiple targets within the same
gene be detected with
a different probe set. It is merely preferred that closely spaced target
sequences, as defined
above, be separately probed.
After rolling circle amplification, a cocktail of detection probes is added,
where the
cocktail contains color combinations that are specific for each OCP. The
design and
combination of such detection probes for use in combinatorial multicolor
coding is described
above. It is preferred that the OCPs be designed with combinatorially coded
detection tags to
allow use of a single set of singly labeled detection probes. It is also
preferred that collapsing
detection probes be used. As describEA above, collapsing probes contain two
complementary
portions. 7'his allows each detection probe to hybridize to two detection tags
in TS-DNA. In
this way, the detection probe forms a bridge between different parts of the TS-
DNA. The
combined action of numerous collapsing detection probes hybridizing to TS-DNA
will be to
form a collapsed network of cross-linlced TS-DNA. Collapsed TS-DNA occupies a
much
smaller voli une than free, extended TS-DNA, and includes whatever detection
label present on
the detection probe. This result is a compact and discrete detectable signal
for each TS-DNA.
Probe binding will, upon collapse, trap a unique combination of colors that
was designed a
priory on the basis of each probe sequence.
As discussed above, rolling circle amplification can be engineered to produce
TS-DNA
of different lengths for different OCPs. Such products can be distinguish
simply on the basis of
the size of the detection signal they generate. Thus, the same set of
detection probes could be
used to distinguish two different sets of generated TS-DNA. In this scheme,
two different TS-
DNAs, each of a different size class but assigned the same color code, would
be distinguished
by the size of the signal produced by the hybridized detection probes. In this
way, a total of
126 different targets can be distinguished on a single solid-state sample
using a code with 63
combinations, since the signals will come in two flavors, low amplitude and
high amplitude.
Thus one could, for example, use the low amplitude signal set of 63 probes for
detection of an
oncogene niutations, and the high amplitude signal set of 63 probes for the
detection of a tumor
suppressor p53 mutations.
8. Reporter Binding Agent Unimolecular Rolling Amplification
Reporter Binding Agent Unimolecular Rolling Amplification (RBAURA) is a form
of
RCA where a reporter binding agent provides the rolling circle replication
primer for
amplification of an amplification target circle. In RBAURA, the
oligonucleotide portion of the
reporter binding agent serves as a roliling circle replication primer. RBAURA
allows RCA to
61
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
produce an amplified signal (that is, TS-DNA) based on association of the
reporter binding agent
to a target rnolecule. The specific primer sequence that is a part of the
reporter binding agent
provides the link between the specific interaction of the reporter binding
agent to a target
molecule (via the affinity portion of the reporter binding agent) and RCA. In
RBAURA, once
the reporter binding agent is associated with a target molecule, an
amplification target circle is
hybridized to the rolling circle replication primer sequence of the reporter
binding agent,
followed by amplification of the ATC by RCA. The resulting TS-DNA incorporates
the rolling
circle replication primer sequence of the reporter binding agent at one end,
thus anchoring the
TS-DNA to the site of the target molecule. RBAURA is a preferred RCA method
for in situ
detections. For this purpose, it is preferred that the TS-DNA is collapsed
using collapsing
detection probes, biotin-antibody conjugates, or both, as described above.
RBAURA can be
performed using any target molecule. Preferred target molecules are nucleic
acids, including
amplified nucleic acids such as TS-DNA and amplification target circles,
antigens and ligands.
Examples of the use of such target molecules are illustrated in Figures 25A to
29B. Peptide
Nucleic Acid Probe Unimolecular Rolling Amplification (PNAPURA) and Locked
Antibody
Unimolecular Rolling Amplification (LAURA), described below, are preferred
forms of
RBAURA.
(a) Peptide Nucleic Acid Probe Unimolecular Rolling Amplification
In PNAPURA, chimeric PNA:DNA molecules are used as reporter binding probes,
referred to as PNA reporter binding p:robes. The oligonucleotide portion of
the PNA reporter
binding agent serves as a rolling circle replication primer. The affinity
portion of the PNA
reporter binding probe is a peptide nucleic acid, preferably 12 to 20
nucleotide bases in length
and more pireferably 15 to 18 bases in length, designed to hybridize to a
target nucleic acid
sequence of interest. In PNAPURA, the PNA reporter binding probe is first
allowed to
hybridize ta a target sequence (illustrated in Figure 25A). Once the PNA
reporter binding probe
is hybridized to a target sequence, an amplification target circle is
hybridized to the rolling circle
replication primer sequence of the PNA reporter binding probe (illustrated in
Figure 25B),
followed by amplification of the ATC by RCA. The resulting TS-DNA incorporates
the rolling
circle replication primer sequence of the PNA reporter binding probe at one
end, thus anchoring
the TS-DNA to the site of the target n:iolecule. Reporter binding agents
having any form of
affinity portion can be used in a similar manner.
PNAPURA is preferably performed with a solid-state substrate and in
combination with
CMC. For this purpose, DNA samples to be tested are incorporated into a solid-
state sample, as
described above. The solid-state substrate is preferably a glass slide and the
solid-state sample
preferably incorporates up to 256 individual target or assay samples arranged
in dots. Multiple
62
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
solid-state samples can be used to either test more individual samples, or to
increase the number
of distinct target sequences to be detected. In the later case, each solid-
state sample has an
identical set of samples dots, and PNAPURA will be carried out using a
different set of PNA
reporter binding probes and amplification target circles, collectively
referred to as a probe set,
for each solid-state sample. This allows a large number of individuals and
target sequences to
be assayed :in a single assay. By using up to six different labels,
combinatorial multicolor
coding allows up to 63 distinct targets to be detected on a single solid-state
sample. When using
multiple solid-state substrates and performing PNAPURA with a different set of
PNA reporter
binding probes and amplification target circles for each solid-state
substrate, the same labels can
be used with each solid-state sample (although differences between ATCs in
each set may
require the use of different detection probes). For example, 10 replica
slides, each with 256
target sample dots, can be subjected to PNAPURA using 10 different sets of PNA
reporter
binding probes and amplification target circles, where each set is designed
for combinatorial
multicolor c;oding of 63 targets. This results in an assay for detection of
630 different target
sequences. Where two or more different target sequences are closely spaced in
the DNA of the
target or assay sample (for example, vvhen multiple closely spaced mutations
of the same gene
are targets), it is preferred that the PNA reporter binding probe for each of
the closely spaced
target sequences be placed in a different probe set. For this purpose, it is
considered that target
sequences vvithin 20 nucleotides of each other on a DNA molecule in a target
or assay sample
are closely spaced. It is not required that multiple targets within the same
gene be detected with
a different probe set. It is merely preferred that closely spaced target
sequences, as defined
above, be separately probed.
After rolling circle amplification, a cocktail of detection probes is added,
where the
cocktail contains color combinations that are specific for each ATC. The
design and
combinatioil of such detection probes for use in combinatorial multicolor
coding is described
above. It is preferred that the ATCs be designed with combinatorially coded
detection tags to
allow use of a single set of singly labeled detection probes. It is also
preferred that collapsing
detection probes be used. As described above, collapsing probes contain two
complementary
portions. This allows each detection P robe to hybridize to two detection tags
in TS-DNA. In
this way, the detection probe forms a bridge between different parts of the TS-
DNA. The
combined a.etion of numerous collapsing detection probes hybridizing to TS-DNA
will be to
form a collapsed network of cross-linked TS-DNA. Collapsed TS-DNA occupies a
much
smaller volume than free, extended TS-DNA, and includes whatever detection
label present on
the detection probe. This result is a compact and discrete detectable signal
for each TS-DNA.
63
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Probe binding will, upon collapse, trap a unique combination of colors that
was designed a
priory on the basis of each probe sequence.
(b) Locked Antibody Unimolecular Rolling Amplification
In LAURA, a covalently coupled antibody and oligonucleotide is used as a
reporter
binding agent. The oligonucleotide portion of the reporter binding agent
serves as a rolling
circle replication primer. The affinity portion of the reporter binding agent
is an antibody
specific for a target molecule of interest. The reporter binding agent is
conjugated to the target
molecule as in a conventional inununoassay (illustrated in Figure 29A). Unlike
conventional
immunoassatys, detection of this interaction is mediated by rolling circle
amplification. After
conjugation and washing, the inunune complexes are fixed in place with a
suitable fixation
reaction (fo:r example, methanol-acetic acid) to immobilize the antibody. As
in conventional
immunoassays, unconjugated antibodies (in this case, in the form of reporter
binding agents) are
removed by washing. Once the reporter binding agent is conjugated to a target
molecule, an
amplification target circle is hybridized to the rolling circle replication
primer sequence of the
reporter binding agent (illustrated in F'igure 29B), followed by amplification
of the ATC by
RCA. The resulting TS-DNA incorporates the rolling circle replication primer
sequence of the
reporter binding agent at one end, thus anchoring the TS-DNA to the site of
the target molecule.
In a. variant of this method, the oligonucleotide portion of the reporter
binding agent can
be a peptide nucleic acid, instead of DNA. After fixation of the reporter
binding agent to the
target molecule, the PNA can be hybridized an oligonucleotide that contains a
portion
complement:ary to the PNA, referred to as the complementary portion, and a
portion that
remains single stranded, referred to as the primer portion. The primer portion
can then be used
as a rolling circle primer in LAURA as described above.
LAIURA is preferably performed with a solid-state substrate and in combination
with
CMC. For this purpose, DNA samples to be tested are incorporated into a solid-
state sample, as
described above. The solid-state substrate is preferably a glass slide and the
solid-state sample
preferably incorporates up to 256 individual target or assay samples arranged
in dots. Multiple
solid-state samples can be used to either test more individual samples, or to
increase the number
of distinct target sequences to be detected. In the later case, each solid-
state sample has an
identical ser, of samples dots, and LAiJRA will be carried out using a
different set of reporter
binding agents and amplification target circles, collectively referred to as a
probe set, for each
solid-state sample. This allows a large number of individuals and target
sequences to be assayed
in a single assay. By using up to six different labels, combinatorial
multicolor coding allows up
to 63 distinct targets to be detected or.i a single solid-state sample. When
using multiple solid-
state substrates and performing LAUF.A with a different set of reporter
binding agents and
64
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
amplifrcation target circles for each solid-state substrate, the same labels
can be used with each
solid-state swnple (although differences between ATCs in each set may require
the use of
different detection probes). For example, 10 replica slides, each with 256
target sample dots,
can be subjected to LAURA using 10 different sets of reporter binding agents
and amplification
target circles, where each set is designed for combinatorial multicolor coding
of 63 targets. This
results in an. assay for detection of 630 different target sequences. Where
two or more different
target sequences are closely spaced in the DNA of the target or assay sample,
it is preferred that
the PNA reporter binding probe for each of the closely spaced target sequences
be placed in a
different probe set, as discussed above.
After rolling circle amplification, a cocktail of detection probes is added,
where the
cocktail contains color combinations that are specific for each ATC. The
design and
combination of such detection probes f'or use in combinatorial multicolor
coding is described
above. It is preferred that the ATCs be designed with combinatorially coded
detection tags to
allow use of a single set of singly labeled detection probes. It is also
preferred that collapsing
detection prDbes be used. As described above, collapsing probes contain two
complementary
portions. This allows each detection probe to hybridize to two detection tags
in TS-DNA. In
this way, the detection probe forms a bridge between different parts of the TS-
DNA. The
combined action of numerous collapsirig detection probes hybridizing to TS-DNA
will be to
form a collapsed network of cross-linked TS-DNA. Collapsed TS-DNA occupies a
much
smaller vohnne than free, extended TS-DNA, and includes whatever detection
label present on
the detection probe. This result is a compact and discrete detectable signal
for each TS-DNA.
Probe bindi;ng will, upon collapse, trap a unique combination of colors that
was designed a
priory on the basis of each probe sequence.
9. :Primer Extension Sequencing
Following amplification, the nucleotide sequence of the amplified sequences
can be
determined either by conventional me:a.ns or by primer extension sequencing of
amplified target
sequence. Primer extension sequencing is also referred herein as chain
terminating primer
extension sesquencing. A preferred foim of chain terminating primer extension
sequencing,
referred to herein as single nucleotide primer extension sequencing, involves
the addition of a
single chain-terminating nucleotide to a primer (no other nucleotides are
added). This form of
primer extension sequencing allows interrogation (and identification) of the
nucleotide
immediately adjacent to the region to which the primer is hybridized. Two
preferred modes of
single nucleotide primer extension sequencing are disclosed.
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
(a) Unimolecular Segment Amplification and Sequencing
Unimolecular Segment Amplification and Sequencing (USA-SEQ) involves
interrogation
of a single iiucleotide in an amplified target sequence by incorporation of a
specific and
identifiable nucleotide based on the identity of the interrogated nucleotide.
In Unimolecular
Segment Arnplification and Sequencing (USA-SEQ) individual target molecules
are amplified by
rolling circle amplification. Following amplification, an interrogation primer
is hybridized
immediately 5' of the base in the target sequence to be interrogated, and a
single chain-
terminating nucleotide is added to the end of the primer. The identity of the
interrogated base
determines which nucleotide is added. By using nucleotides with unique
detection signatures
(e.g. differe:nt fluorescent labels), the identity of the interrogated base
can be determined. The
interrogation primer can be a pre-forrned single molecule or it can be formed
by hybridizing one
or more interrogation probes to the amplified target sequences and ligating
them together to form
an interrogation primer.
USA-SEQ is useful for identifying the presence of multiple distinct sequences
in a
mixture of target sequences. In particular, if the sample from which the
target sequences are
amplified contains different forms of the target sequence (that is, different
alleles of the target
sequence), then USA-SEQ can identif;y not only their presence but also provide
information on
the relative abundance of the different forms. This is possible because each
TS-DNA molecule
is amplified from a single target sequence molecule and each TS-DNA molecule
can be
individually detected.
Prirner extension sequencing can be performed generally as follows. After
amplification
of a target iiucleic acid sequence using any of the rolling circle
amplification techniques
disclosed herein, an interrogation primer is hybridized to the amplified
nucleic acid (for
example, to TS-DNA). The mixture of amplified nucleic acid and interrogation
primer is
referred to as an interrogation mixture. The interrogation primer is designed
to hybridize
adjacent to (that is 3' of) the nucleotide in the TS-DNA that is to be
interrogated (that is,
sequenced). Of course, since the target sequence is repeated numerous times in
a TS-DNA
molecule, numerous interrogation probes will hybridize to a single TS-DNA
molecule. Next, at
least two differently labeled chain terrninating nucleotides and DNA
polymerase are added to the
interrogation mixture. This results in addition of a single nucleotide to the
end of the
interrogation primer, the identity of which is based on the identity of the
interrogated nucleotide
(that is, the first template nucleotide after the end of the interrogation
primer). Finally, the
identity of the nucleotide incorporatedl for each TS-DNA molecule is
determined by fluorescence
microscopy. For this purpose, it is preferred that the TS-DNA be collapsed
prior to detection of
the incorporated nucleotide. Example: 9 describes an example of the use of USA-
SEQ to detect
66
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
of homo- or heterozygosity at a particular nucleotide in a genetic sample. It
is specifically
contemplated that primer extension sequencing can be used to determine the
identity of one or
more specific nucleotides in any amplified nucleic acid, including nucleotides
derived from a
target nucleic acid, and nucleotides present as arbitrarily chosen sequences
in the spacer region
of an OCP or ATC. In the later case, primer extension sequencing can be used
to distinguish or
identify a specific OCP or ATC whicti has been amplified. As described
elsewhere, the
detection of' specific OCPs and ATCs, from among an original pool of OCPs or
ATCs,
amplified based on the presence of a specific target molecule or nucleic acid
is a preferred use
for the disclosed amplification and detection methods.
Preferred chain terminating nucleotides are dideoxynucleotides. Other known
chain
terminating nucleotides (for example, nucleotides having substituents at the
3' position) can also
be used. Fluorescent forms of dideoxynucleotides are known for use in
conventional chain
terminating sequencing, any of which are suitable for the disclosed primer
extension sequencing.
Preferred forms of fluorescent or haptenated chain-terminating nucleotides
include fluorescein-
N6-ddATP, biotin-N6-ddATP, fluorescein-l2-ddATP, fluorescein- 12-ddCTP,
fluorescein-12-
ddGTP, fluorescein-12-ddUTP, lissamine-5-ddGTP, eosin-6-ddCTP, coumarin-ddUTP,
tetramethyhnodamine-6-ddUTP, Texas Red-5-ddATP (all available from NEN Life
Sciences).
(b) Degenerate Probe Primer Extension Sequencing
Degenerate probe primer exteiision sequencing involves sequential addition of
degenerate
probes to aii interrogation primer hybridized to amplified target sequences.
Addition of multiple
probes is prevented by the presence of a removable blocking group at the 3'
end. After addition
of the degenerate probes, the blocking group is removed and further degenerate
probes can be
added or, as the final operation, the nucleotide next to the end of the
interrogation probe, or the
last added degenerate probe, is interrogated as described for single
nucleotide primer extension
sequencing to determine its identity. :lt is contemplated that degenerate
probes having any form
of removable 3' end block can be useci in a primer extension sequencing
procedure. A preferred
form of reniovable blocking group is the cage structure, as described herein.
In each case,
conditions specific for removal of the particular blocking structure are used
as appropriate. A
preferred form of amplification and degenerate probe primer extension
sequencing is
Unimolecular Segment Amplification and CAGE Sequencing (USA-CAGESEQ).
Priiner extension sequencing using blocked degenerate probes (that is,
degenerate probe
primer extension sequencing, of which CAGESEQ is a preferred form) can be
performed
generally as follows. One or more interrogation probes and a plurality of
degenerate probes are
mixed with an DNA sacnple to be sequenced to form an interrogation mixture. It
is preferred
that the nucleic acid to be sequenced is a nucleic acid amplified using any of
the rolling circle
67
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
amplification techniques disclosed herein. In this case it is further
preferred that the nucleic acid
to be sequenced is amplified form an amplification target circle formed by gap-
filling ligation of
an open circle probe. For degenerate probe primer extension sequencing it is
also preferred that
a full set of degenerate probes, as described above, be used. The
interrogation probes are
designed to hybridize to the target nucleic acid such that the region of the
target nucleic acid to
be sequenced lies past the 3' end of the interrogation probe. The
interrogation mixture is
incubated urider conditions that promotes hybridization of the interrogation
probe and the
degenerate primers to the nucleic acid to be sequenced. Only one of the
degenerate probes will
form a perfe:ct hybrid with the nucleic acid sequence adjacent to the
interrogation probe. It is
preferred that incubation conditions be chosen which will favor the formation
of perfect hybrids.
Once the interrogation and degenerate probes are hybridized, the interrogation
mixture is
subjected to ligation. This joins the interrogation probe and the degenerate
primer. Finally, the
blocking group present at the 3' end of the ligated degenerate probe is
removed. When using
photolabile caged oligonucleotides, the cage structure is removed by exposure
to appropriate
light. This makes the end of the ligated degenerate probe available for either
ligation of another
degenerate probe or primer extension. These hybridization, ligation, and block
removal steps
are referred to herein as a round of degenerate probe ligation. Additional
rounds of degenerate
probe ligation can be performed following removal of the blocking structure.
It is preferred that
a set of prinier extension sequencing assays be performed, using identical
samples, in which a
different nuinber of rounds of degenerate probe ligation are performed prior
to primer extension.
It is also prE:ferred that a nested set of interrogation probes be used in a
set of such a set of
primer extension sequencing assays. The use of such a set of assays is
illustrated in Example
10. Once alll the rounds of degenerate probe ligation are performed (thus
forming an
interrogation primer), the interrogatiori mixture is subjected to primer
extension. For this, at
least two dil:ferently labeled chain terminating nucleotides and DNA
polymerase are added to the
interrogation mixture. This results in addition of a single nucleotide to the
end of the
interrogation primers, the identity of which is based on the identity of the
interrogated nucleotide
(that is, the first template nucleotide after the end of the interrogation
primer). Finally, the
identity of the nucleotide incorporated for each interrogation primer for each
target nucleic acid
is determined by fluorescence microscopy. For this purpose, it is preferred
that the nucleic acid
be collapsed prior to detection of the incorporated nucleotide.
Example 10 describes an example of USA-CAGESEQ where a nested set of
interrogation primers are extended by sequential addition of degenerate
primers in an array of
amplified nucleic acids. The principles of the primer extension sequencing
operation illustrated
in this exarr.iple can be analogously applied to the use of different numbers
of sample and
68
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
interrogation probes, different arrangeinents of samples and different forms
of blocking
structures. It is contemplated that sets of assays can be performed on arrays
of sample dots (as
shown in Example 10), in arrays of samples (such as in microtiter dishes), or
in individual
reaction vessels. In particular, the use of a multiwell dish, such as a
microtiter dish, allows
multiple.separate reactions on the same dish to be easily automated. The use
of multiple wells
also allows ~r,omplete freedom in the selection of the sample and
interrogation probe in each well.
For example, rather than performing primer extension sequencing using five
separately treated
slides (as in example 10), primer exterksion sequencing samples and components
could be
arranged in any convenient order in the wells. Using the components of Example
10, for
example, a five well by five well array of identical nucleic acid samples
could be used where
each of the wells in a given column has the same interrogation probe. The
first column of wells
would have the first interrogation probe, the second column of wells would
have the second
interrogatioii probe, and so on. As in example 10, the mask would be moved
down to cover
one additional row prior to each cage removal step. The resulting sequence
obtained using this
arrangement would be read across and then down.
As ciescribed above, specific portions of TS-DNA or TS-RNA can be sequenced
using a
primer exteiision sequencing operation. It should also be understood that the
same primer
extension sequencing procedure can be performed on any nucleic acid molecule.
For example,
genomic DNA, PCR products, viral RNA or DNA, and cDNA samples can all be
sequenced
using the disclosed primer extension sequencing procedure. A preferred primer
extension
sequencing lprocedure for this purpose is CAGE sequencing. For this purpose,
interrogation
probes and degenerate probes are hybridized to a nucleic acid sample of
interest (rather than TS-
DNA or TS-RNA), ligated, and subjected to chain-terminating primer extension,
all as described
above in connection with USA-CAGESEQ.
D. Discrimunation Between Closely Related Target Sequences
Open circle probes, gap oligonucleotides, and gap spaces can be designed to
discriminate
closely relat.ed target sequences, such as genetic alleles. Where closely
related target sequences
differ at a s:ingle nucleotide, it is preferred that open circle probes be
designed with the
complement of this nucleotide occurring at one end of the open circle probe,
or at one of the
ends of the gap oligonucleotide(s). Where gap-filling ligation is used, it is
preferred that the
distinguishiing nucleotide appear opposite the gap space. This allows
incorporation of alternative
(that is, allelic) sequence into the ligated OCP without the need for
alternative gap
oligonucleoddes. Where gap-filling ligation is used with a gap
oligonucleotide(s) that partially
fills the gap, it is preferred that the distinguishing nucleotide appear
opposite the portion of gap
space not filled by a gap oligonucleotide. Ligation of gap oligonucleotides
with a mismatch at
69
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
either terminus is extremely unlikely because of the combined effects of
hybrid instability and
enzyme discrimination. When the TS-DNA is generated, it will carry a copy of
the gap
oligonucleotide sequence that led to a correct ligation. Gap oligonucleotides
may give even
greater discrimination between related target sequences in certain
circumstances, such as those
involving wobble base pairing of alleles. Features of open circle probes and
gap
oligonucleoi:ides that increase the target-dependency of the ligation
operation are generally
analogous to such features developed for use with the ligation chain reaction.
These features can
be incorporated into open circle probes and gap oligonucleotides for use in LM-
RCA. In
particular, European Patent Application EP0439182 describes several features
for enhancing
target-deperidency in LCR that can be adapted for use in LM-RCA. The use of
stop bases in the
gap space, as described in European Patent Application EP0439182, is a
preferred mode of
enhancing the target discrimination of a gap-filling ligation operation.
A preferred form of target sequence discrimination can be accomplished by
employing
two types of open circle probes. These two OCPs would be designed essentially
as shown in
Figure 2, with small modifications. In one embodiment, a single gap
oligonucleotide is used
which is thes same for both target sequences, that is, the gap oligonucleotide
is complementary to
both target sequences. In a preferred embodiment, a gap-filling ligation
operation can be used
(Example 3). Target sequence discrimination would occur by virtue of mutually
exclusive
ligation events, or extension-ligation events, for which only one of the two
open-circle probes is
competent. Preferably, the discriminator nucleotide would be located at the
penultimate
nucleotide from the 3' end of each of the open circle probes. The two open
circle probes would
also contain. two different detection tags designed to bind alternative
detection probes and/or
address pro'bes. Each of the two detection probes would have a different
detection label. Both
open circle probes would have the sanie primer complement portion. Thus, both
ligated open
circle probes can be amplified using a single primer. Upon array
hybridization, each detection
probe would produce a unique signal, for example, two alternative fluorescence
colors,
corresponding to the alternative target sequences.
E. Optimization of RCA
1. Assay Background
A potential source of background signals is the formation of circular
molecules by non-
target-direcited ligation events. The contribution of such events to
background signals can be
minimized using five strategies, alone or in combination, as follows:
(a) The use of a thermostable DNA ligase such as AMPLIGASE (Kalin et al.
(1992))
or the T. thermophilus DNA ligase (Barany (1991)) will minimize the frequency
of non-target-
directed ligation events because ligation takes place at high temperature (50
to 75 C).
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
(b) In the case of in situ hybridization, ligation of the open circle probe to
the target
sequence permits extensive washing. This washing will remove any circles that
may have been
formed by non-target-directed ligation, while circles ligated on-target are
impossible to remove
because they are topologically trapped (Nilsson et al. (1994)).
(c) The use of one or more gap oligonucleotides, or a combination of gap
oligonucleoitides and gap-filling DNA synthesis, provides additional
specificity in the ligation
event. Using a gap oligonucleotide greatly reduces the probability of non-
target-directed
ligation. Particularly favored is the use of a gap oligonucleotide, or a gap-
filling ligation
operation, coupled to a capture hybridization step where the complementary
portion of an
address prolbe spans the ligation junction in a highly discriminatory fashion,
as shown below and
in Figure 6.
complement of gap oligonucleotide (11 nucleotides)
...NNNTA{GTCAGATCAGA}TANNNNN... TS-DNA
i~ iiiiiiii ii
A'r CAGTCTAGTCT ATNNNNN ... address probe
complementary portion of address probe (15 nucleotides hybridized)
Brackets ({;0 mark sequence complementary to the gap oligonucleotide (or the
gap space when
filled in). The TS-DNA shown is SEQ ID NO: 10 and the address probe sequence
shown is SEQ
ID NO:4. 'This system can be used with gap oligonucleotides of any length.
Where the gap
between the ends of an open circle probe hybridized to a target sequence is
larger than the
desired address probe length, an address probe can be designed to overlap just
one of the
junctions bestween the gap sequence and the open circle probe sequence. By
designing open
circle probes to place discriminating nucleotides opposite the gap space, a
single OCP can be
used in gap-filling LM-RCA to generate ligated open circle probes having
different sequences,
which depend on the target sequence.
The capture step involves hybridization of the amplified DNA to an address
probe via a
specific sequence interaction at the ligation junction, involving the
complement of the gap
oligonucleotide, as shown above. Guo et al. (1994), have shown that 15-mer
oligonucleotides
bound covalently on glass slides using; suitable spacers, can be used to
capture amplified DNA
with reasonably high efficiency. This system can be adapted to detection of
amplified nucleic
acid (TS-DNA or TS-RNA) by using address probes to capture the amplified
nucleic acid. In
the example shown above, only LM-RCA amplified DNA generated from correct
ligation events
will be captured on the solid-state detector.
71
CA 02236161 1998-05-21
WO 97/1919:3 PCT/US96/18812
Optionally one may use additional immobilizing reagents, known in the art as
capture
probes (Syvanen et al., Nucleic Acids Res., 14:5037 (1986)) in order to bind
nucleic acids
containing the target sequence to a solid surface. Suitable capture probes
contain biotinylated
oligonucleotides (Langer et al. (1981)) or terminal biotin groups.
Immobilization may take place
before or after the ligation reaction. Immobilization serves to allow removal
of unligated open
circle probes as well as non-specifrcally ligated circles.
(d) Using ligation conditions that favor intramolecular ligation. Conditions
are easily
found where circular ligation of OCPs occurs much more frequently than tandem
linear ligation
of two OCIPs. For example, circular ligation is favored when the temperature
at which the
ligation operation is performed is near the melting temperature (T,,,) of the
least stable of the left
target probe portion and the right target probe portion when hybridized to the
target sequence.
When ligation is carried out near the T. of the target probe portion with the
lowest Tm, the
target probe portion is at association/dissociation equilibrium. At
equilibrium, the probability of
association in cis (that is, with the other target probe portion of the same
OCP) is much higher
than the probability of association in trans (that is, with a different OCP).
When possible, it is
preferred that the target probe portions be designed with melting temperatures
near suitable
temperatures for the ligation operation. The use of a thermostable ligase,
however, allows a
wide range of ligation temperatures to be used, allowing greater freedom in
the selection of
target sequences.
(e) Peptide nucleic acids form extremely stable hybrids with DNA, and have
been used
as specific blockers of PCR reactions (Orum et al., Nucleic Acids Res.,
21:5332-5336 (1993)).
A special F'NA probe, referred to herein as a PNA clamp, can be used to block
rolling circle
amplification of OCPs that have been ligated illegitimately (that is, ligated
in the absence of
target). By using one or more gap oligonucleotides during ligation, by using
gap-filling ligation,
or by using; a combination of gap oligonucleotides and gap-filling ligation,
illegitimately ligated
circles will lack the gap sequence and. they can be blocked with a PNA clamp
that is
complementary to the sequence resulting from the illegitimate ligation of the
3' end and the 5'
end of the OCP. This is illustrated in the diagram below, where the PNA clamp
llllrrrr is
positioned exactly over the junction:
llllrrx=r PNA clamp
...LLLLLLLLLLRRRRRRRRRR... ligated OCP
ligation site
In this diagram, "L" and "1" represent a nucleotide in the left target probe
portion of the OCP
and its complement in the PNA clarnp, and "R" and "r" represent a nucleotide
in the right target
72
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
probe portion of the OCP and its complement in the PNA clamp. The most
preferred length for
a PNA clamp is 8 to 10 nucleotides. 'Che PNA clamp is incapable of hybridizing
to unligated
OCP because it can only form four to five base pairs with either target probe
portion, and it is
also incapable of hybridizing with correctly ligated OCP because a gap
sequence is present.
However, ttie PNA clamp will hybridize strongly with illegitimately ligated
OCP, and it will
block the progress of the rolling circle reaction because the DNA polymerase
is incapable of
displacing a hybridized PNA molecule. This prevents amplification of
illegitimately ligated
OCPs.
2. Removing Excess Unligated OCPs
The gene 6 exonuclease of phage T7 provides a useful tool for the elimination
of excess
open circle probes and excess gap oligonucleotides that will bind to the TS-
DNA or LM-RCT
transcripts and interfere with its hybridization to detection probes. This
exonuclease digests
DNA startir.ig from the 5'-end of a double-stranded structure. It has been
used successfully for
the generation of single-stranded DNA after PCR amplification (Holloway et
al., Nucleic Acids
Res. 21:3905-3906 (1993); Nikiforov et al., PCR Methods and Applications 3:285-
291(1994)).
In an LM-RCA assay this enzyme can be added after ligation, together with the
rolling circle
DNA polyrrierase. To protect TS-DNA from degradation, the rolling circle
replication primer
can contain 3 or 4 phosphorothioate linkages at the 5' end, to make this
molecule resistant to the
exonuclease (Nikiforov et al. (1994)). The exonuclease will degrade excess
open circle probe
molecules as they become associated with the rolling circle DNA product. The
use of this
nuclease eliminates the need for capture probes as well as the need for
washing to remove excess
probes. In general, such a nuclease digestion should not be used when
performing LM-RCT,
since unligated OCPs and gap oligonucleotides are needed to form a double-
stranded
transcriptioii template with the TS-DNA. This nuclease digestion is a
preferred method of
eliminating unligated OCPs and gap oligonucleotides when nested LM-RCA is to
be performed.
Examples
Example 1: Target-mediated Ligatiori of Open Circle Probes and Rolling Circle
Replication of
Ligated Open Circle Probes
1. Ligation of open circle probes
Linear oligonucleotides with 5'-phosphates are efficiently ligated by ligase
in the
presence of a complementary target sequence. In particular, open circle probes
hybridized to a
target sequence as shown in Figure 1, and open circle probes with gap
oligonucleotides
hybridized to a target sequence as shown in as shown in Figure 2, are readily
ligated. The
efficiency of such ligation can be measured by LM-RCA.
The following is an example of target-dependent ligation of an open circle
probe:
73
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
A L)NA sample (target sample) is heat-denatured for 3 minutes at 95 C, and
incubated
under ligation conditions (45 minutes at 60 C) in a buffer consisting of 20 mM
Tris-HCl (pH
8.2), 25 mrrl KCI, 10 mM MgCIZ, 0.5 mM NAD, 0.05% Triton X-100, in the
presence of (a)
DNA ligase (AMPLIGASE , Epicentre Technologies) at a concentration of 1 unit
per 50 l, and
(b) the following 5'-phosphorylated oligonucleotides:
Open circle probe (111 nucleotides):
5'-GCCTGTCCAGGGATCTGCTCAAGACTCGTCATGTCTCAGTAGCTTCTAACGGTCACA
AGCTTCT.AACGGTCACAAGCTTCTAACGGTCACATGTCTGCTGCCCTCTGTATT-3'
(SEQ ID NO:1)
Gap oligonucleotide: 5'-CCTT-3'
This results in hybridization of the open circle probe and gap oligonucleotide
to the
target sequence, if present in the target sample, and ligation of the
hybridized open circle probe
and gap oligonucleotide.
2. Measuring the rate of rolling circle replication
(a) On large template: 7 kb single-stranded phage M13 circle
The rate of oligonucleotide-primed rolling circle replication on single-
stranded M13
circles mediated by any DNA polymerase can be measured by using the assay
described by
Blanco et al., J. Biol. Chem. 264:8935-8940 (1989). The efficiency of primed
synthesis by the
029 DNA polymerase is stimulated about 3-fold in the presence of Gene-32
protein, a single-
stranded DNA binding protein.
(b) On small templates: 1.10-nucleotide ligated open circle probes
The rate of oligonucleotide-primed rolling circle replication on single-
stranded small
circles of 110 bases was measured using the 029 DNA polymerase generally as
described in
Example 2. After five minutes of incubation, the size of the DNA product is
approximately 16
kilobases. 'This size corresponds to a polymerization rate of 53 nucleotides
per second. The
rate of synthesis with other DNA polymerases can be measured and optimized
using a similar
assay, as described by Fire and Xu, Proc. Natl. Acad. Sci. USA 92:4641-4645
(1995). It is
preferred that single-stranded circles of 110 nucleotides be substituted for
the 34 nucleotide
circles of Fire and Xu.
The 029 DNA polymerase provides a rapid rate of polymerization of the 029
rolling
circle reaction on 110 nucleotide circular templates. At the observed rate of
50 nucleotides per
second, a 35 minute polymerization reaction will produce a DNA product of
approximately
105,000 bases. This would yield an amplification of 954-fold over the original
110-base
template. Fire and Xu (1995) shows that rolling circle reactions catalyzed by
bacterial DNA
polymerases may take place on very small circular templates of only 34
nucleotides. On the
74
CA 02236161 2006-10-04
75304-70
basis of the results of Fire and Yu, rolling circle replication can be carried
out using circles of
less than 90 nucleotides.
Example 2: Detection of a mutant ornithine transcarbamylase (OTC) gene using
LM-RCA
followed by transcription (LM-RCT)
This example describes detection of human DNA containing a mutant form (G to
C) at
position 114 of exon 9 of the ornithine transcarbamylase gene (Hata et al., J.
Biochem. 103:302-
308 (1988)). Human DNA for the assay is prepared by extraction from buffy coat
using a
standard phenol procedure.
1. Two DNA samples (400 ng each) are heat-denatured for 4 minutes at 97 C, and
incubated under ligation conditions in the presence of two 5'-phosphorylated
oligonucleotides, an
open circle probe and one gap oligonucleotide:
Open circle probe (95 nucleotides):
5'-GAGGAGAATAAAAGTTTCTCATAAGACTCGTCATGTCTCAGCAGCTTCTAACGGTC
ACTAATACGACTCACTATAGGTTCTGCCTCTGGGAACAC-3' (SEQ ID NO:5)
Gap oligonucleotide for mutant gene (8 nucleotides)
5'-TAGTGATG-3'
Gap oligonucleotide for wild type gene (8 nucleotides)
5'-TAGTGATC-3'
T4 DNA ligase (New England Biolabs) is present at a concentration of 5 units
per gl, in a buffer
consisting of 10 mM Tris-HCI (pH 7.5), 0.20 M NaC1, 10 mM MgC12, 2 mM ATP. The
concentration of open circle probe is 80 nM, and the concentration of gap
oligonucleotide is 100
nM. The total volume is 40 1. Ligation is carried out for 25 minutes at 37 C.
2. 25 l are taken from each of the above reactions and mixed with an equal
volume of a
buffer consisting of 50 mM Tris-HCl (pH 7.5), 10 mM MgC12, 1 mM DTT, 400 M
each of
dTTP, dATP, dGTP, dCTP, which contains an 18-base rolling circle replication
primer
5'-GCTGAGACATGACGAGTC-3' (SEQ ID NO:6), at a concentration of 0.2 M. The ~29
DNA polymerase (160 ng per 50 l) is added and the reaction mixture is
incubated for 30
minutes at 30 C.
3. To the above solutions a compensating buffer is added to achieve the
following
concentrations of reagents: 35 mM Tris-HCI (pH 8.2), 2 mM spermidine, 18 mM
MgCI2, 5
mM GMP, 1 mM of ATP, CTP, GTP, 333 M UTP, 667 M Biotin-16-UTP (Boehringher-
Mannheiin), 0.03% Tween-20, 2 Units per i of T7 RNA polymerase. The reaction
is
incubated for 90 rninutes at 37 C.
4. One-tenth volume of 5 M NaCI is added to the above reactions, and the
resulting
solution is mized with an equal volume of ExpressHy~ reagent (Clontech
Laboratories, Palo
*Trade-mark
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Alto, CA). Hybridization is performed by contacting the amplified RNA
solution, under a cover
slip, with the surface of a glass slide (Guo et al. (1994)) containing a 2.5
mm dot with 2 X 1011
molecules of a covalently bound 29-mer oligonucleotide with the sequence 5'-
TTTTTTTTT
TTCCAACCTCCATCACTAGT-3' (SEQ ID NO:7). The last 14 nucleotides of this
sequence
are complementary to the amplified mutant gene RNA, and hence the mutant RNA
binds
specifically. Another 2.5 mm dot on the slide surface contains 2 X 101 1
molecules of a
covalently bound 29-mer oligonucleotide with the sequence 5'-
TTTTTTTTTTTCCAACCT
CGATCACTAGT-3' (SEQ ID NO:8). The last 14 nucleotides of this sequence are
complementary to the amplified wild type gene RNA, and hence the wild type RNA
binds
specifically. The glass slide is washed once with 2X SSPE as described (Guo et
al. (1994)),
then washed twice with 2X SSC (0.36 M sodium saline citrate), and then
incubated with
fluoresceinated avidin (5 g/ml) in 2X SSC for 20 minutes at 30 C. The slide is
washed 3 times
with 2X SSC and the slide-bound fluorescence is imaged at 530 nm using a
Molecular Dynamics
Fluorimager.
Example 3: Detection of a mutant ornithine transcarbamylase (OTC) gene using
Gap-filling
LM-RCT
This example describes detection of human DNA containing a mutant form (G to
C) at
position 114 of exon 9 of the ornithine transcarbamylase gene (Hata et al.
(1988)) using gap-
filling LM-RCT. Human DNA for the assay is prepared by extraction from buffy
coat using a
standard phenol procedure. In this example, two different open circle probes
are used to detect
the mutant :rnd wild type forms of the gene. No gap oligonucleotide is used.
1. Two DNA samples (400 ng each) are heat-denatured for 4 minutes at 97 C, and
incubated in the presence of one of the following 5'-phosphorylated open
circle probes.
Open circle probe for mutant gene (96 nucleotides):
5'-TAAAAGACTTCATCATCCATCTCATAAGACTCGTCATGTCTCAGCAGCTTCTAACGG
TCACTAATACGACTCACTATAGGGGAACACTAGTGATGG-3' (SEQ ID NO:11) . When
this probe hybridizes to the target sequence, there is a gap space of seven
nucleotides between
the ends of the open circle probe.
Open circle probe for wild type gene (96 nucleotides):
5'-TAAAA,GACTTCATCATCCATCTCATAAGACTCGTCATGTCTCAGCAGCTTCTAACGG
TCACTAATACGACTCACTATAGGGGAACACTAGTGATCG-3' (SEQ ID NO:12). When
this probe tiybridizes to the target sequence, there is a gap space of seven
nucleotides between
the ends of the open circle probe.
Each of the OCP-target sample mixtures are incubated in an extension-ligation
mixture
as described by Abravaya et al. (1995). The reaction, in a volume of 40 l,
contains 50 mM
76
CA 02236161 2006-10-04
75304-70
Tris-HCI (pH 7.8), 25 mM MgC12, 20 tnM potassium acetate, 10 M NAD, 80 nM
open circle
probe, 40 M dATP, 40 M dGTP, 1 Unit Thernucs flavus DNA polymerase (lacking
3'-5'
exonuclease activity; MBR, Milwaukee, WI), and 4000 Units Thermus
therrrwphifus DNA ligase
(Abbott laboratories). The reaction is incubated for 60 seconds at 85 C, and
50 seconds at
60 C in a thermal cycler. No thermal cycling is performed. This results in
hybridization of the
open circle probe to the target sequence, if present, filling in of the gap
space by the T..flavus
DNA polymerase, and ligation by the T. thermophilus ligase. The discriminating
nucleotide in
the open circle probes above is the penultimate nucleotide. T. flaw DNA
polymerase is used in
the reaction to match the thermal stability of the T. thermophilus ligase.
2. 25 l are taken from each of the above reactions and mixed with an equal
volume of a
buffer consisting of 50 mM Tris-HCI (pH 7.5), 10 mM MgCIZ1 1 mM DTT, 400 M
each of
dTTP, dATP, dGTP, dCTP; and containing the 18-base oligonucleotide primer
5'-GCTGAGACATGACGAGTC-3' (SEQ ID NO:6), at a concentration of 0.2 M. The 029
DNA polymerase (160 ng per 50 l) is added and the reaciion mixture is
incubated for 30
minutes at 30 C to perform rolling circle amplification catalyzed by 4629 DNA
polymerase. The
Therrnus flavus DNA polymerase does not significantly interfere with rolIing
circle replication
because it has little activity at 30 C. If desired, the 7herntus,tlavus DNA
polymerase can be
inactivated, prior to rolling circle replication, by adding a neutralizing
antibody analogous to
antibodies for blocidng Taq DNA polymerase prior to PCR (Kellogg et al.,
Biotechniques
16(6):1134-1137 (1994)).
3. To each of the above solutions are added compensating buffer to achieve the
following
concentrations of reagents: 35 mM Tris-HCI (pH 8.2), -2 mM spermidine, 18 mM
MgC12, 5
mM GMP, 1 mM of ATP, CTP, GTP, 333 M UTP, 667 M Biotin-16-UTP (Boehringher-
Mannheim), 0.03 % Tween-20, 2 Units per Ecl of T7 RNA polymerase. The
reactions are
incubated for 90 minutes at 37 C.
4. One-tenth volume of 5 M NaCI is added to the each solution containing the
biotinylated
RNA generated by T7 RNA polymerase, and the resulting solution is mixed with
an equal
volume of ExptessHyb reagent (Clontech laboratories, Palo Alto, CA).
Hybridization is
performed by contacting the amplified RNA solution, under a cover slip, with
the surface of a
glass slide (Guo er al. (1994)) containing a 2.5 tnm dot with 2 X 1011
molecules of a covalently
bound 29-mer address probe with the sequence 5'- TCCAAATTCTCCT
CCATCA-3' (SEQ ID NO:13). The last 14 nucleotides of this sequence are
complementary to
the amplified mutant gene RNA, and hence the mutant RNA binds specifically.
Another 2.5
mm dot on the slide surface contains 2 X 1011 molecules of a covalently bound
29-mer address
probe with the sequence 5'-TTTTTTTTTTTCCAAATTCTCCTCGATCA-3' (SEQ ID N0:14).
*Trade-mark 77
CA 02236161 2006-10-04
75304-70
The last 14 nucleotides of this sequence are complementary to the amplif~ied
wild type gene
RNA, and hence the wild type RNA binds specifically. The glass slide is washed
once with 2X
SSPE as described (Guo et al. (1994)), then washed twice with 2X SSC (0.36 M
sodium saline
citrate), and then incubated with fluoresceinated avidin (5 g/ml) in 2X SSC
for 20 minutes at
30 C. The slide is washed 3 times with 2X SSC and the slide-bound fluorescence
is imaged at
530 nm using a Molecular Dynamics Fluorimager.
Example 4: Reverse transcription of ornithine transcarbamylase (OTC) nzRNA
followed by
mutant cDNA detection using Gap-filling LM-RCT
This example describes detection of human mRNA containing a mutant form= (G to
C) at
position 114 of exon 9 of the ornithine transcarbamylase gene (Hata et al.
(1988)) using cDNA
generated by reverse transcription. RNA for the assay is prepared by TRIzol
(Life
Technologies, Inc., Gaithersburg, MD) extraction from liver biopsy.
1. OTC exon 9 cDNA is generated as follows:
A liver biopsy sample is stored at -80 C in a 0.5 ml. reaction tube containing
40 Units of RNase
inhibitor (Boehringher Mannheim). Total RNA is extracted from the frozen
sample using
*
TRIzol reagent (Life Technologies, Inc., Gaithersburg, MD), and dissolved in
10 p.1 water. A
19 l reaction mixture is prepared containing 4 l of 25 mM MgCl2, 2 l of 400
mM KC1, 100
mM Tris-HCI (pH 8.3), 8 l of a 2.5 mM mixture of dNTP's (dATP, dGTP, dTTP,
dCTP), 1
l of MuLV reverse transcriptase (50 U, Life Technologies, Inc., Gaithersburg,
MD), I l of
MuLV reverse transcriptase primer (5'-TGTCCACTTTCTGTTTTCTGCCTC-3'; SEQ ID
NO:15), 2 l of water, and I l of RNase inhibitor (20 U). The reaction
mixture is added to
1 l of the Trizol-purified RNA solution, and incubated at 42 C for 20
minutes to generate
cDNA.
2. Two 20 l cDNA samples from step 1 are heat-denatured for 4 minutes at 98
C, and
incubated under ligation conditions in the presence of two 5'-phosphorylated
probes:
Open circle probe (95 nucleotides):
5'-ATCACTAGTGTTCCTTCTCATAAGACTCGTCATGTCTCAGCAGCTTCTAACGGTCAC
TAATACGACTCACTATAGGGGATGATGAAGTC'ITTTAT-3' (SEQ ID NO:16)
Gap probe for mutant gene (8 nucleotides):
5'-TAGTGATG-3'
Gap probe for wild type gene (8 nucieotides):
5'-TAGTGATC-3'
T4 DNA ligase (New England Biolabs) is added at a concentration of 5 units per
1, in a buffer
consisting of 10 mM Tris-HCI (pH 7.5), 0.20 M NaCI, 10 mM MgClz, 2 mM ATP. The
*Trade-mark
78
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
concentration of open circle probe is 80 nM, and the concentration of gap
oligonucleotide is 100
nM. The total volume is 40 liters. Ligation is carried out for 25 minutes at
37 C.
3. 25 ttl are taken from each of the above reactions and mixed with an equal
volume of a
buffer consisting of 50 mM Tris-HCI (pH 7.5), 10 mM MgC12, 1 mM DTT, 200 M
each of
dTTP, dATP, dGTP, dCTP; and containing the 18-base rolling circle replication
primer
5'-GCTGA(JACATGACGAGTC-3' (SEQ ID NO:6), at a concentration of 0.2 M. The 029
DNA polymerase (160 ng per 50 ul) is added and the reaction mixtures are
incubated for 30
minutes at 30 C.
4. To t:he above solutions are added compensating buffer to achieve the
following
concentrations of reagents: 35 mM Tris-HCI (pH 8.2), 2 mM spermidine, 18 mM
MgC12, 5
mM GMP, 1 mM of ATP, CTP, GTP, 333 M UTP, 667 M Biotin-16-UTP (Boehringher-
Mannheim), 0.03 % Tween-20, 2 Units per l of T7 RNA polymerase. The reaction
is
incubated for 90 minutes at 37 C.
5. One-tenth volume of 5 M NaCl is added to the each solution containing the
biotinylated
RNA generated by T7 RNA polymerase, and the resulting solution is mixed with
an equal
volume of F'sxpressHyb reagent (Clontech laboratories, Palo Alto,CA).
Hybridization is
performed by contacting the amplified RNA solution, under a cover slip, with
the surface of a
glass slide (Guo et al. (1994)) containing a 2.5 mm dot with 2 x 1011
molecules of a covalently
bound 29-mer address probe with the sequence 5'-TTTTTTTTTTTTTTfTGATGGA
GGAGAAT-3' (SEQ ID NO: 17). The last 14 nucleotides of this sequence are
complementary to
the amplified mutant gene RNA, and hence the mutant RNA binds specifically.
Another 2.5
nun dot on the slide surface contains 2 X 1011 molecules of a covalently bound
29-mer address
probe with the sequence 5'-TTTTTTTTTTTTTTTTGATCGAGGAGAAT-3' (SEQ ID NO:9).
The last 14 nucleotides of this sequence are complementary to the amplified
wild type gene
RNA, and hence the wild type RNA binds specifically. The glass slide is washed
once with 2X
SSPE as described (Guo et al. (1994)), then washed twice with 2X SSC (0.36 M
sodium saline
citrate), and then incubated with fluoresceinated avidin (5 g.g/ml) in 2X SSC
for 20 minutes at
30 C. The slide is washed 3 times with 2X SSC and the slide-bound fluorescence
is imaged at
530 nm usirig a Molecular Dynamics Fluorimager.
Example 5: Multiplex Immunoassay coupled to rolling circle amplification
This example describes an exarnple of multiplex detection of different target
molecules
using reporter antibodies. The signal that is detected is produced by rolling
circle arnplification
of the targel, sequence portion of the reporter antibodies.
1. Three different monoclonal antibodies, each specific for a different target
molecule, are
coupled to three different arbitrary DNA sequences (A, B, C) that serve as
unique identification
79
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
tags (target sequences). In this example, the three antibodies are maleimide-
modified and are
specific for a-galactosidase, hTSH, and human chorionic gonadotropin (hCG).
The antibodies
are coupled to aminated DNA oligonucleotides, each oligonucleotide being 50
nucleotides long,
using SATA chemistry as described by Hendrickson et al. (1995). The resulting
reporter
antibodies are called reporter antibody A, B, and C, respectively.
2. Anitibodies specific for the target molecules (not the reporter antibodies)
are immobilized
on microtiter dishes as follows: A 50 l mixture containing 6 g/ml of each of
the three
antibodies in sodium bicarbonate (pH 9) is applied to the wells of a
microtiter dish, incubated
overnight, and washed with PBS-BLA (10 mM sodium phosphate (pH 7.4), 150 mM
sodium
chloride, 2% BSA, 10% rri-lactose, 0.02% sodium azide) to block non-adsorbed
sites.
3. Serial dilutions of solutions containing one or a combination of the three
target molecules
(hTSH, hCG, and 0-galactosidase) are added to the wells. Some wells are
exposed to one target
molecule, a mixture of two target molecules, or a mixture of all three target
molecules. After 1
hour of incubation, the wells are washed three times with TBS/Tween wash
buffer as described
by Hendrickson et al. (1995).
4. Fifl:y microliters of an appropriately diluted mixture of the three
reporter antibodies
(A+B+C) are added to each well of the microtiter dish. The plate is incubated
at 37 C for 1
hour, and then washed four times with TBS/Tween buffer.
5. To each well is added a mixture of three pairs of open circle probes and
gap
oligonucleotides, each pair specific for one of the three target sequence
portions of the reporter
antibodies. In this example, the open circle probes have the same spacer
region of 49 bases
including a universal primer complement portion, and different 18 nucleotide
target probe
portions at each end. Each cognate pair of open circle probe and gap
oligonucleotide is
designed to hybridize to a specific target sequence (A, B, or C) in the target
sequence portion of
the reporter antibodies. Specifically, Open circle probe A' has left and right
target probe
portions complementary to two 18-base sequences in tag sequence A separated by
8 bases that
are compleinentary to the 8-nucleotide gap oligonucleotide A'. The same is the
case for open
circle probe and gap oligonucleotide pairs B' and C'. The concentration of
each open circle
probe is 80 nM, and the concentration of each gap oligonucleotide is 120 nM.
6. T4 DNA ligase (New England Biolabs) is added to each microtiter well at a
concentration of 5 units per l, in a reaction buffer consisting (10 mM Tris-
HC1 (pH 7.5), 40
mM potassiium acetate, 10 mM MgClz, 2 mM ATP). The total volume in each well
is 40
liters. Ligation is carried out for 45 minutes at 37 C.
7. To each microtiter well is added 20 l of a compensating solution
containing dTTP,
dATP, dG7'P, dCTP (400 M each), the universal 18-base oligonucleotide primer
CA 02236161 2006-10-04
75304-70
5'-GCTGAGACATGACGAGTC -3' (SEQ ID NO:6) (at a final concentration of 0.2
~cM),, and
(~29 DNA polymerase (at 160 ng per 50 l). The reaction for 30 minutes at 30
C.
8. After incubation, a compensating buffer is added to each well to achieve
the following
concentrations of reagents: 35 mM Tris-HCI (pH 8.2), 2 mM spermidine, 18 mM
MgC12, 5 mNi
GMP, 1 mM of ATP, CTP, GTP, 333 M UTP, 667 AM Biotin-16-UTP (Boehringher-
Mannheim), 0.03 % Tween-20, 2 Units per l of 77 RNA polymerase. The reaction
is
incubated for 90 minutes at 37 C, generating biotinylated RNA.
9. One-tenth volume of 5 M NaCI is added to each well, and the resulting
solution is mixed
with and equal volume of ExpressHyb reagent (Clontech laboratories, Palo Alto,
CA).
Hybridizafion is performed by contacting the mixture of amplified RNAs, under
a cover slip,
with the surface of a glass slide containing three separate dots of 2 X 10"
molecules of three
different covalently bound 31-mer oligonucleotides (A, B, C) (Guo et al.
(1994)). The last 16
bases of each oligonucleotide are complementary to a specific segment (4 bases
+ 8 bases + 4
bases), centered on the 8-base gap sequence, of each of the possible amplified
RNAs generated
from tag sequences A, B, or C. Hybridization is carried out for 90 minutes at
37 C. The glass
slide is washed once with 2X SSPE as described (Guo et al. (1994)), then
washed twice with 2X
SSC (0.36 M sodium saline citrate), and then incubated with fluoresceinated
avidin (5 ggiml) in
2X SSC for 20 minutes at 30 C. The slide is washed 3 times with 2X SSC and the
surface-
bound fluorescence is iniaged at 530 nm using a Molecular Dynamics Fluorimager
to determine
if any of tag sequences A or B or C was amplified.
Example 6: In situ detection of Ornithine transcarbamylase (OTC) and Cystic
Fibrosis (CF)
target sequences using LM-RCA
l. DNA samples were prepared as follows:
A sample of lymphocytes was washed twice in PBS, with the cells collected by
centrifugation for 5 minutes at 1500 RPM. The cells were resuspended in 10 mM
PIPES, pH
7.6, 100 mM NaCI, 0.3 M sucrose, 3 tnM MgC1z1 and 0.5% Triton X-100. The cells
were then
incubated on ice for 15 minutes, centrifuged for 5 minutes at 1700 RPM, and
resuspend at 2 X
105 nuclei/nil. Samples of 1.0 X 103 nuclei (0.5 ml) were centrifuged onto
slides (5 minutes at
500 g, setting #85) in Cytospin centrifuge. The slides were then rinsed twice
for 3 minutes with
PBS, rinsed once for 6 tninutes with agitation in 2 M NaCI, 10 mM PIPES, pH
6.8, 10 mM
EDTA, 0.5% Triton X-100, 0.05 mM Spermine, and 0.125 mM Spermidine. The slides
were
then rinsed for one minute in lOX PBS, for one minute in 5X PBS, for one
minute in 2X PBS,
for 2 minutes in 1X PBS, for one minute in 10% ethanol, for one minute in 30%
ethanol, for
one minute in 70 % ethanol, and for one minute in 95 % ethanol. Finally, the
slides were air
dried and then fixed by baking at 70 C for 2 hours.
*Trade-mark 81
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
2. The following DNA molecules were used:
OTC Open Circle Probe (OTC OCP, for OTC target sequence):
5'-GAGGA.GAATAAAAGTTTCTCA.TAAGACTCGTCATGTCTCAGCAGCTTCTAACGGTC
ACTAATACGACTCACTATAGGTTCTGCCTCTGGGAACAC-3'
OTC Gap oligonucleotide:
5'-TAGTG.ATC-3'
Cystic fibrosis Open Circle Probe (CF OCP, for CF target sequence):
5'-TATTT'CCTTTA.ATGGTTTCTCTGACTCGTCATGTCTCAGCTTTAGTTTAATACGACTC
ACTATAGGATCTATATTCATCATAGGAAACAC-3'
Cystic fibrosis Gap oligonucleotide
5'-CAAAGATGA-3'
3. DNA on the sample slides was denatured by washing the slides for 5 minutes
in 2X
SSC, incubating in denaturation buffer (2X SSC, 70% formamide, pH 7.2) for 1
minute and 45
seconds in a pre-heated large Coplin jar at 71 C. Heating was stopped
immediately by washing
the slides for three minutes in ice-colcl 70 % ethanol, for two minutes in 90
% ethanol, and for
three minutes in 100% ethanol.
4. LM.-RCA was performed as follows:
In three separate reactions, the OCPs and gap oligonucleotides were hybridized
and
ligated to target sequences on the sample slides.
a. OTC and CF ligation operation: 421il of the mixture below was placed on
each of
two slides.
9 1 lOX ligation buffer (Ampligase)
5141 BSA, 2 mg/mi stock
9 1 OTC Gap oligo (15 g]VI) [final 1500 nM]
91A1 CF Gap oligo (10 .M) [final 1000 nM]
3/.cl OTC OCP, (61LM stock) [fina1=200 nMolar]
31c1 CF OCP, (61iM stock) [fina1=200 nMolar]
15p.1 Ampligase (5 U/ l) [final=0.833 U/IAl]
38 l H20
The reactio:n was incubated for 120 minutes at 50 C.
b. OTC ligation operation: 42 I of the mixture below was placed on a slide.
61t1 lOX ligation buffer (A,mpligase)
3.5,u1 BSA, 2 mg/mi stock
6 l OTC Gap oligo (15 M) [final 1500 nM]
21L1 OTC OCP, (6 M stock) [final=200 nMolar]
82
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
1 Ampligase (5 U/ l) [final=0.833 U/ l]
33 1 H20
The reaction was incubated for 120 minutes at 50 C.
c. CF ligation operation: 42A1 of the mixture below was placed on a slide.
6 1 lOX ligation buffer (Ampligase)
3.51,1 BSA, 2 mg/mi stock
6 l CF Gap oligo (10 M) [final 1000 nM]
2tc1 CF OCP, (61AM stock) [fmal = 200 nMolar]
l0 l Ampligase (5 U/ l) [fina1=0.833 U/ l]
33til H20
The reaction was incubated for 120 minutes at 50 C.
All of the slides were washed twice for 5 minutes with 2X SSC with 20%
formamide at
42 C, washed for two minutes with 20 mM Tris, pH 7.5, 0.075 M NaCI to remove
the
formamide, and washed for three minutes with 50 mM Tris, pH 7.5, 40 mM KOAc,
10 mM
MgC1Z, 10 mM DTT, 100 g/ml BSA.
The amplification operation was performed by placing 24 l of the following
mixture on
each slide.
18.0 1 H20 [total volume = 100 l for 4 slides]
20.O 1 5X 029 buffer with BSA BSA is 200 ug/ml
16.01i1 dNTPs (A, G, and C, each 2.5 mM)
5.01L1 dTTP (2.5 mM)
15.01A1 BUdR (2.5 mM)
7.OEc1 rolling circle replication primer (10 M)
3.0id Gene32 Protein (1.37 Ag/ l) (final 41 g/ml)
16.0 1 029 DNA polymerase (1:6 dilution, 16 141=768 ng)
The reaction was incubated 20 minutes in 37 C oven.
All slides were then washed twice for four minutes with 2X SSC with 20%
formamide at
25 C, and t.hen washed twice for four minutes with 2X SSC, 3% BSA, 0.1 % Tween-
20 at
37 C.
5. The TS-DNA generated in the amplification operation was collapsed and
detected as
follows:
50 ),t1 of a solution of AntiBUDR-Mouse.IgG (7 g/ml) in 2X SSC, 3 % BSA, 0.1
%
Tween-20 vras placed on each slide, and the slides were incubated for 30
minutes at 37 C.
Then the slides were washed three times for five minutes with 2X SSC, 3% BSA,
0.1 % Tween-
at 37 C. Next, 50,ul of a solution of FITC-Avidin (61Ag/ml) was placed on each
slide, and
83
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
the slides were incubated for 30 minutes at 37 C. Then the slides were washed
three times for
five minutes with 2X SSC, 3% BSA, I).1 % Tween-20 at 37 C, and then incubated
for 2.6
minutes witli 2X SSC, 0.1 g/ml DAF'I (26 jcl in 50 ml) at room temp. Next,
the slides were
washed 10 minutes with 1X SSC, 0.01 % Tween at room temperature and then
covered with 24
iL1 antifade. Finally, the slides were examined in a microscope with CCD
camera for DAPI
nuclear fluoirescence and discrete fluorescein signals.
Example 7: Multiplex detection of multiple target sequences using LM-RCA-CMC
This example illustrates multiplex detection using 31 different OCPs and gap
oligonucleotide pairs, each designed to generate 31 different color
combinations using 5 basic
colors.
1. Slides containing samples are prepared as follows:
Poly-L-Lysine coated microscope slides are prepared, and DNA is spotted using
an
arraying machine as described above using the method described by Schena et
al. The size of
each spot of sample DNA is 2.5 mm. DNA is denatured as described above using
the method
described by Schena et al.
2. A mixture of gap oligonucleotides and open circle probes is designed and
prepared,
containing 31 different OCPs and 31 different gap oligonucleotides. The OCPs
and gap
oligonucleotides are designed as pairs 'with each OCP and gap probe pair
containing sequences
complementary to a specific target sequence of interest. The spacer regions of
each of the 31
OCPs contain unique, alternative combinations of five possible detection tags,
designated lt, 2t,
3t, 4t, and 5t. The combinations are coded according to the scheme shown
below. The set of
pairs is desi;gnated as follows:
Gap oligo OCP it 2t 3t 4t 5t
gl ocpl +
g2 ocp2 +
g3 ocp3 +
g4 ocp4 +
g5 ocp5 +
g6 ocp6 + +
..... and so on
g25 ocp25 + + +
g26 ocp26 + + + +
g27 ocp27 + + + +
84
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
g28 ocp28 + + + +
g29 ocp29 + + + +
g30 ocp30 + + + +
g31 ocp3l + + + + +
3. LM-RCA is performed as follows:
The OCPs and gap oligonucleotides are hybridized and ligated to target
sequences on the
sample slides with 50 g1 of the following mixture.
1.5 l lOX ligation buffer (Ampligase)
8.8 l BSA, 2 mg/ml stock
15 l Mixture of 31 Gal) oligonucleotides [final 400 nM for each]
',i l Mixture of 31 OC:Ps [final = 100 nMolar for each]
25 1 Ampligase (5 U/iz1)
82 1 H20
The reaction is incubated for 60 minutes at 52 C.
The: slides are washed twice for 5 minutes with 2X SSC with 20% formamide at
42 C,
washed for two minutes with 20 mM Tris, pH 7.5, 0.075 M NaCI to remove the
formamide,
and washed for three minutes with 50 mM Tris, pH 7.5, 40 mM KOAc, 10 mM MgC12,
10 mM
DTT, 100 ~ug/nil BSA.
The, amplification operation is performed by placing 24 l of the following
mixture on
each slide.
18.O 1 H20 [total volume = 100 l for 4 slides]
20.0 1 5X 029 buffer with BSA BSA is 200 g/ml
16.01,1 dNTPs (A, G, and C, each 2.5 mM)
5.0,u1 dTTP (2.5 mM)
15.011 BUdR (2.5 mM)
7.0,u1 rolling circle replication primer (10 M)
3.0,u1 Gene32 Protein (1.37 g/ l) (final 41 g/ml)
16.O1A1 029 DNA polymerase (1:6 dilution, 16 l=768 ng)
The reaction is incubated 15 minutes in 37 C oven.
All slides were then washed twice for four minutes with 2X SSC with 20%
formamide at
25 C.
4. The 5 collapsing detection probes, each with a different label and each
complementary to
one of the :5 detection tags, are hybridized to the TS-DNA on the slides in a
solution of 4X SSC.
The detection probes correspond to the detection tags as follows:
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Detection probe Label Detection tag
dp l fluorescein lt
dp2 Cy3 2t
dp3 Cy3.5 3t
dp4 Cy5 4t
dp5 Cy7 5t
All slides were then washed twice for four minutes with 2X SSC with 20%
formamide at
25 C, and then washed twice for four minutes with 2X SSC, 3% BSA, 0.1 % Tween-
20 at
37 C.
5. The TS-DNA generated in the amplification operation is further collapsed
and detected
as fcdlows:
50 l of a solution of AntiBUDR-Mouse.IgG (7 g/ml) in 2X SSC, 3% BSA, 0.1 %
Tween-20 is placed on each slide, and the slides are incubated for 30 minutes
at 37 C. Then
the slides are washed three times for five minutes with 2X SSC, 3% BSA, 0.1 %
Tween-20 at
37 C. Next, 50 l of a solution of Avidin DN (6 g/ml) in 2X SSC, 3% BSA, 0.1
% Tween-20
is placed on each slide, and the slides are incubated for 30 minutes at 37 C.
Then the slides are
washed three times for five minutes with 2X SSC, 3% BSA, 0.1 % Tween-20 at 37
C, washed 5
minutes with 2X SSC, 0.01 % Tween at room temperature, and then covered with
24 l antifade.
Finally, the slides are scanned in a fluorescence scanning device with
appropriate filters (for
example, those described by Schena et al.). Image analysis software is used to
count and
analyze the spectral signatures of the fluorescent dots.
Example 8: Multiplex detection of multiple target sequences using LM-RCA-CMC
This example illustrates multiplex detection using 15 different OCPs and 30
different gap
oligonucleotides, where pairs of gap oligonucleotides are associated with each
OCP. The OCPs
and gap oligonucleotides are designed ito generate 30 different color
combinations using 6 basic
label colors.
1. Slides containing samples are prepared as follows:
Poly-L-Lysine coated microscope slides are prepared, and DNA is spotted using
an
arraying machine as described above using the method described by Schena et
al. The size of
each spot of sample DNA is 2.5 mm. DNA is denatured as described above using
the method
described by Schena et al.
2. A mixture of gap oligonucleotides and open circle probes is designed and
prepared,
containing 15 different OCPs and 30 different gap oligonucleotides. The OCPs
and gap
oligonucleotides are designed as pairs with each OCP and gap probe pair
containing sequences
complementary to a specific target sequence of interest. The spacer regions of
each of the 15
86
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
OCPs contain unique, alternative combinations of four possible detection tags,
designated lt, 2t,
3t, and 4t. Additional detection tags are generated by ligation of an OCP to a
gap
oligonucleotide. These form two different detection tags depending on which of
the pair of gap
oligonucleotides is ligated to a given OCP. The combinations are coded
according to the scheme
shown below. The set of pairs is designated as follows:
Gap oligo OCP it 2t 3t 4t
gl ocpl +
g2 ocp 1 +
g3 ocp 2 +
g4 ocp 2 +
g5 ocp 3 +
g6 ocp 3 +
.... and so on
g25 ocp 13 + + +
g26 ocp 13 + + +
g27 ocp 14 + + +
g28 ocp 14 + + +
g29 ocp 15 + + + +
g30 ocp 15 + + + +
3. LM :RCA is performed as follows:
The OCPs and gap oligonucleotides are hybridized and ligated to target
sequences on the
sample slides with 50 l of the following mixture.
1.5 l lOX ligation buffer (Ampligase)
8.8 l BSA, 2 mg/mi stock
15 l Mixture of 30 Gap oligonucleotides [final 400 nM for each]
l Mixture of 15 OCPs [fmal =100 nMolar for each]
25 l Ampligase (5 U/ l)
82 1 H20
The reaction is incubated for 60 minutes at 52 C.
The slides are washed twice for 5 minutes with 2X SSC with 20% formamide at 42
C,
washed for two minutes with 20 mM Tris, pH 7.5, 0.075 M NaCI to remove the
formamide,
and washed for three minutes with 50 mM Tris, pH 7.5, 40 mM KOAc, 10 mM MgCl2,
10 mM
DTT, 100 Ecg/ml BSA.
87
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
The: amplification operation is performed by placing 24 l of the following
mixture on
each slide.
18.01A1 H20 [total volume = 100 t for 4 slides]
20.O i 5X 029 buffer with BSA BSA is 200 g/ml
16.01L1 dNTPs (A, G, and C, each 2.5 mM)
5.0 1 dTTP (2.5 mM)
15.Otc1 BUdR (2.5 mM)
7.0).L1 rolling circle replication primer (10 M)
3.Ojz1 Gene32 Protein (1.37 iLg/ l) (final 41 g/rnl)
16.O141 029 DNA polymerase (1:6 dilution, 16 1= 768 ng)
The reaction is incubated 15 minutes in 37 C oven.
All slides were then washed twice for four minutes with 2X SSC with 20%
formamide at
25 C.
4. Fouir collapsing detection probes, each with a different label and each
complementary to
one of the 4 detection tags, it, 2t, 3t, and 4t, along with 30 collapsing
detection probes, each
with one of two labels and each complementary to one of the detection tags
formed by the
ligation of an OCP and gap oligonucleotide, are hybridized to the TS-DNA on
the slides in a
solution of 4X SSC. The detection probes correspond to the detection tags as
follows:
Detection probe Label Detection tag
dp 1 fluorescein it
dp2 Cy3 2t
dp3 Cy3.5 3t
dp4 Cy5.5 4t
dp5 Cy5 g i
dp6 Cy7 g2
dp7 Cy5 g3
dp8 Cy7 g4
dp9 Cy5 g5
dplO Cy7 g6
dpil Cy5 g7
dpl2 Cy7 g8
dpl3 Cy5 g9
dp14 Cy7 gl0
dp 15 Cy5 g l l
dp16 Cy7 g12
88
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
dp17 Cy5 g13
dp18 Cy7 g14
dp19 Cy5 g15
dp20 Cy7 g16
dp2l Cy5 g17
dp22 Cy7 g18
dp23 Cy5 g19
dp24 Cy7 g20
dp25 Cy5 g21
dp26 Cy7 g22
dp27 Cy5 g23
dp28 Cy7 g24
dp29 Cy5 g25
dp30 Cy7 g26
dp31 Cy5 g27
dp32 Cy7 g28
dp33 Cy5 g29
dp34 Cy7 g30
All slides were then washed twice for four minutes with 2X SSC with 20%
formamide at
25 C, and then washed twice for four minutes with 2X SSC, 3% BSA, 0.1 % Tween-
20 at
37 C.
5. The- TS-DNA generated in the amplification operation is further collapsed
and detected
as follows:
50 ul of a solution of AntiBU:DR-Mouse.IgG (7 g/ml) in 2X SSC, 3% BSA, 0.1 %
Tween-20 is placed on each slide, and the slides are incubated for 30 minutes
at 37 C. Then
the slides a:re washed three times for five minutes with 2X SSC, 3% BSA, 0.1 %
Tween-20 at
37 C. Next, 50 l of a solution of Avidin DN (6 icg/ml) in 2X SSC, 3% BSA, 0.1
% Tween-20
is placed oii each slide, and the slides are incubated for 30 minutes at 37 C.
Then the slides are
washed three times for five minutes with 2X SSC, 3% BSA, 0.1 % Tween-20 at 37
C, washed 5
minutes wit:h 2X SSC, 0.01 % Tween at room temperature, and then covered with
24 l antifade.
Finally, the slides are scanned in a fluorescence scanning device with
appropriate filters (for
example, those described by Schena et al.). Image analysis software is used to
count and
analyze the spectral signatures of the fluorescent dots.
89
CA 02236161 1998-05-21
WO 97/191931 PCT/US96/18812
Example 9: Unimolecular Segment Amplification and Sequencing
This example illustrates unimcilecular segment amplification (that is, rolling
circle
amplification) followed by single nucleotide primer extension sequencing. In
this example, an
OCP is hybridized to a target nucleic acid so as to leave a gap in a region of
known sequence
variation. After formation of an atnplification target circle using gap-
filling ligation, and rolling
circle amplification of the amplification target circle, the amplified DNA is
subjected to chain
terminating primer extension sequencing using uniquely labeled chain-
terminating nucleotides.
Detection oiF the incorporated label identifies the nucleotide of interest.
An Open Circle Probe designed to hybridize with the Cystic Fibrosis
Transmembrane
Regulator G542X mutant locus is designed so as to leave a gap of four bases,
encompassing the
mutant base. The gap is to be filled by a DNA polymerase in a gap-filling
ligation operation,
thereby incorporating whatever sequence is present in the target Cystic
Fibrosis Transmembrane
Regulator G542X.
The sequence of the 5'-phosphorylated OCP (82 bases) is as follows:
GAACTAT.ATTGTCTTTCTCTGTTTTCTTGCATGGTCACACGTCGTTCTAGTACGCTTCTA
ACTTAGTGTGATTCCACCTTCT (nucleotides 1 to 82 of SEQ ID NO:20)
The underliined ends of this probe hybridize with the target human DNA as
indicated below
(target sequence shown in reverse, 3' to 5'):
(mutant) (it)
gtgagtcacactaaggtggaagaggttcttgatataacagaaagagacgtttga
IIIllllilllllllflllllllllllllllllll~lllflll
AGTGTGATTCCACCTTCT GAACTATATTGTCTTTCTCTG
Left target probe Right target probe
18 gap 21
The target DNA is SEQ ID NO:21. T'he left target probe is nucleotides 65 to 82
of SEQ ID
NO:20. The right target probe is nucleotides 1 to 21 of SEQ ID NO:20. The
region in the
target DNA opposite the gap encompasses a nucleotide which is either g (wild
type) or t
(mutant). Ii: is this nucleotide position which is interrogated (that is,
sequenced).
1. Microscope slides containing bound DNA samples are prepared as described by
Schena
et al.
2. Gap-filling ligation in the presence of 150 nMolar Open Circle Probe,
Ampligase DNA
ligase, and 7yiermus flavus DNA polyrnerase is carried out as described
earlier (generally using
the conditions described by Abravaya et al., Nucleic Acids Research 23:675-682
(1995)), in the
presence of dATP and dCTP, so that the gap is filled and immediately ligated.
The reaction is
carried out with the slides covered with a 22 by 40 mm cover slip, in a volume
of 28 l, and is
incubated for 1 hour at 58 C. The filling reaction adds the base sequence CCAA
for the wild
type , or the sequence CAAA for the mutant gene, respectively.
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
3. Wash slides twice in 2X SSC with 20% formamide for 5 minutes at 42 C.
4. Wash slides for 2 minutes with 20 mM Tris, pH 7.5, 0.075 M NaCI.
5. Rolling Circle Amplification is carried out in situ for 15 minutes at 30 C
in a buffer
containing the following components: 50 mM Tris-HC1, pH 7.5, 10 mM MgC12, 1 mM
DTT,
400 AM each of dCTP, dATP, and dGTP, 95 M dTTP, 380 tcM BUDR triphosphate
(SIGMA), t;he 18 nucleotide rolling circle replication primer,
ACGACGTGTGACCATGCA
(SEQ ID NO:22), at a concentration of 0.7 iLM, Phage T4 Gene-32 protein at a
concentration
of 1000 nMolar, and 029 DNA polymerase at 200 nM. This reaction generates
approximately
400 copies of TS-DNA containing faithful copies of the gene sequence.
6. Wash twice in 2X SSC with 20% formamide for 5 minutes at 25 C.
7. Incubate the slides with the 20 nucleotide interrogation primer,
TAGTGTGATTCCACCTTCTC (nucleotides 64 to 83 of SEQ ID NO:20), designed to
hybridize
with the TS.-DNA adjacent to the nucleotide being interrogated, shown below as
a boldface N:
Primer TAGTGTGATTCCACCTTCTC
i
iiIiiiiiiiiii
iiiiii
~~~~~~~~I~11lt111111
TS-DNA ..gaagattgaatcacactaaggtggaagagNttcttgata...
The TS-DNA is SEQ ID NO:22. The slides are incubated 10 minutes at 37 C in the
following
conditions:
Four Units Sequenase DNA polymerase (Amersham-USB), in 25 l of 50 mM Tris-
HCI,
pH 7.5, 20 mM MgC12, 50 mM NaCI, 5 mM DTT, 50 g/ml Bovine Serum Albumin
(Molecular :Biology grade from Life Sciences, Inc.), 50 M fluorescent-ddATP,
fluorescent-
ddCTP, fluorescent-ddGTP, and fluorescent-ddTTP. The four fluorescent
dideoxynucleoside
triphosphates each have different emission spectra and can be obtained from a
standard DNA
sequencing kit (Applied Biosystems, Inc.).
Sequenase DNA polymerase incorporates only one ddNTP, where the incorporated
ddNTP is complementary to the nucleotide being interrogated. This is
illustrated below where
when the interrogated nucleotide is a T (the mutant form), fluorescent ddATP
is incorporated:
Extended primer TAGTGTGATTCCACCTTCTCA*
Hiiiiiiiiiiiiii11iii
TS-DNA ...gaagattgaatcacactaaggtggaagagTttcttgata...
The extended primer is nucleotides 64 to 84 of SEQ ID NO:20. If the
interrogated nucleotide is
G (the wild type), fluorescent ddCTP is incorporated.
8. Wash for 5 minutes in 2X SSC at 25 C.
9. Wash for 4 minutes in 2X SSC, 2.8% BSA, 0.12% Tween-20 at 37 C.
10. Incubate 30 minutes at 37 C in 50 l (under cover slip) using 5Ag/ml
Biotinylated
AntiBUDR-Mouse.IgG (Zymed Labs) in 2X SSC, 2.8% BSA, and 0.12% Tween-20.
11. Wash three times in 2X SSC, 2.8% BSA, and 0.12% Tween-20 for 5 minutes at
37 C.
91
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
12. Incubate 30 minutes at 37 C in 50 Fcl (under cover slip) using FITC-
Avidin, 5 g/ml, in
2X SSC, 2. 8% BSA, and 0.12 % Tween-20.
13. Wash three times in 2X SSC, 2.8% BSA, and 0.12% Tween-20 for 5 minutes at
37 C.
14. Wa..h 5 minutes with 2X SSC, and 0.01 % Tween-20 at room temperature.
15. An image of the slide is captui-ed using a microscope-CCD camera system
with
appropriate filter sets. Each TS-DNA, each with multiple extended primers,
occupy a small area
on the slides. The incorporated fluorescent nucleotides produce individual
fluorescent dots for
each TS-DNA. The fluorescent emission color defines the nucleotide
incorporated at the specific
extension position in each fluorescent dot. Thus, in a sample containing a
mixture of wild type
and mutant sequences, the presence of each is indicated by the presence of
fluorescent dots
having the fluorescent emission color of the fluorescent ddATP (indicating the
mutant form) and
of fluorescent dots having the fluorescent emission color of the fluorescent
ddCTP (indicating the
wild type). The dots will be distinct and distinguishable due to the small
area occupied by each
TS-DNA due to its collapse.
Expected results for heterozygous and homozygous samples are depicted in
Figure 16.
The large circles represent a target sample dot on the slide. The small
circles represent
individual T'S-DNA molecules, amplified in situ at the location of target
nucleic acids in the
sample, which have been subjected to primer extension sequencing. In an actual
assay, hundreds
or thousands of individually detectable TS-DNA molecules would be present in a
sample dot,
and the area. occupied by the collapsed TS-DNA would be much smaller. Fewer
and larger TS-
DNA spots are depicted in Figure 16 for clarity of illustration. The
nucleotide incorporated is
identified by its fluorescent spectrum and is based on the nucleotide present
at the interrogated
position in ihe TS-DNA. Figure 16A is representative of a sample that is
homozygous for the
wild type sequence (indicated by incorporation of cystine). All of the cells
in the sample (and
thus, all of the target nucleic acids in the sample) have the same sequence
resulting in the same
incorporatecl nucleotide for all of the TS-DNA molecules in the sample. Figure
16B is
representative of a sample that is heterozygous for the wild type and a mutant
(indicated by an
equal number of TS-DNA molecules resulting in incorporation of cystine and
adenine). All of
the cells in the sample (and thus, all of the target nucleic acids in the
sample) have one copy of
both sequences (that is, wild type and mutant), resulting in the incorporation
of two different
nucleotides; each for half of the TS-DNA molecules in the sample. Figure 16C
is representative
of a sample that is homozygous but includes a few cells with a somatic
mutation. Most of the
cells in the sample (and thus, most of the target nucleic acids in the sample)
have the same
sequence (that is, wild type), and only a few have the mutant sequence. This
results in the
incorporation of one nucleotide for most of the TS-DNA molecules, and
incorporation of a
92
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
different nucleotide for a few TS-DNA molecules. The ratio of the number of TS-
DNA
molecules fDr which a given nucleotide is incorporated is an accurate measure
of the ratio of the
corresponding target nucleic acid in the sample. Such sensitive detection of
somatic mutations
will be particularly useful for detecting, for example, a few cancer cells, or
a few virally
infected cells, in a sample containing mostly normal or uninfected cells.
Example 10: Unimolecular Segment Amplification and CAGE Sequencing
This example illustrates unimolecular segment amplification (that is, rolling
circle
amplification) followed by degenerate probe primer extension sequencing using
caged
oligonucleotides. In this example, an OCP is hybridized to a target nucleic
acid so as to leave a
gap in a region of known sequence variation. After formation of an
amplification target circle
using gap-filling ligation, and after rolling circle amplification of the
amplification target circle,
interrogation probes are hybridized to the amplified DNA. Interrogation
primers are then
formed by lligating degenerate probe to the interrogation probes. The
interrogation primers are
then extended in chain terminating primer extension sequencing using uniquely
labeled chain-
terminating nucleotides. This example illustrates the use of sequential
addition of degenerate
probes to hybridized interrogation probes in an arrayed solid-state sample.
Detection of the
incorporated label identifies the nucleotide sequence in the region of
interest.
An Open Circle Probe (OCP.96) of 96 bases with a 5'-phosphate is designed to
hybridize with a GT repeat polymorphic locus. The probe is designed to leave a
gap in the GT
repeat region when hybridized to the target DNA. The gap is to be filled by a
DNA polymerase
in a gap-fillling ligation operation, thereby incorporating the entire GT
repeat region into the
ligated OCP.
The sequences of the OCP (96 bases) is as follows:
ATCTAGCTATGTACGTACGTGAACTTTTCTTGCATGGTCACACGTCGTTCTAGTACGCT
TCTAACTTTTAACATATCTCGACATCTAACGATCGAT (nucleotides 1 to 96 of SEQ ID
NO:25)
The underl:ined ends of this probe hybridize with the target DNA as indicated
in Figure 17. In
Figure 17, the gap space is indicated as "Fill sequence". Figure 17A shows
hybridization of the
OCP to tar,get DNA having 10 repeats of CA. Figure 17B shows hybridization of
the OCP to
target DNA having 9 repeats of CA. As will be shown, USA-CAGESEQ is a useful
and
accurate method of determining the nucleotide sequence in a highly repetitive
region of DNA.
1. Five microscope slides, each containing at least one vertically aligned
column of five
identical bound denatured DNA samples are prepared as described by Schena et
al. Each slide
may contain from one to 100 regularly spaced columns of DNA samples, as long
as the number
of sample dots in each column is five. The slides should be identical (or at
least have an
93
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
identical set: of DNA samples). An example of a slide with an array of bound
DNA samples is
shown in Fiigure 18A. The five sample dots in each colunm are identical (that
is, they are from
the same D:NA sample). Each columri of sample dots is preferably made from
different sample
samples.
2a. The slides are incubated in 50 mM Tris-HCI, pH 7.5, 0.3 M NaCI, 0.5 mM
EDTA, and
150 nM OCP.96 oligo, for 1 hour at 48 C to achieve hybridization of the OCP.
The slides are
then washeci for 2 minutes in 50 mM Tris-HCI, pH 7.5, 100 mM M KC1, and 0.05 %
Triton X-
100.
2b. Gap-filling ligation is carried out in the presence of Ampligase DNA
ligase and Thermus
flavus DNA, polymerase using the conditions described above (generally using
conditions
described by Abravaya et al.) in the presence of dATP, dCTP, dGTP, and dTTP,
so that the gap
is filled and immediately ligated. The incubation is carried out with the
slides covered with a 22
by 40 mm cover slip, in a volume of :28 1, for 45 minutes at 54 C.
3. Wash slides twice in 2X SSC with 20% formamide for 5 minutes at 42 C.
4. Wash slides for 2 minutes with 20 mM Tris, pH 7.5, and 0.075 M NaCI.
5. Rolling Circle Amplification is carried out in situ for 15 minutes at 30 C
in a buffer
containing ihe following components: 50 mM Tris-HCl pH 7.5, 10 mM MgC12, 1 mM
DTT,
400 M each of dCTP, dATP, dGTP, 95 ILM dTTP, 360 ItM BUDR triphosphate
(SIGMA), the
18 nucleotide rolling circle replication primer, ACGACGTGTGACCATGCA (SEQ ID
NO:22),
at a concenitration of 700 nM, Phage T4 Gene-32 protein at a concentration of
1000 nMolar, and
029 DNA polymerase at 200 nM. Ttcis reaction generates approximately 400
copies of TS-DNA
containing i:aithful copies of the target DNA.
6. Wash twice in 2X SSC with 20% formamide for 5 minutes at 25 C.
7a. Incubate one slide (slide number 1) in 2X SSC and 300 nMolar of a first 20
nucleotide
interrogation probe (interrogation probe 1), TCTCGACATCTAACGATCGA (nucleotides
76 to
95 of SEQ ID NO:25), which hybridizes with the TS-DNA.
7b. Inciibate another slide (slide number 2) in 2X SSC and 300 nMolar of a
second 20
nucleotide interrogation probe (interragation probe 2), CTCGACATCTAACGATCGAT
(nucleotides 77 to 96 of SEQ ID NO::25), which hybridizes with the TS-DNA.
7c. Incubate another slide (slide number 3) in 2X SSC and 300 nMolar of a
third 20
nucleotide interrogation probe (interrogation probe 3), TCGACATCTAACGATCGATC
(nucleotides 78 to 97 of SEQ ID NO:25), which hybridizes with the TS-DNA.
7d. Inciubate another slide (slide number 4) in 2X SSC and 300 nMolar of a
fourth 20
nucleotide iinterrogation probe (interrogation probe 4), CGACATCTAACGATCGATCC
(nucleotides 79 to 98 of SEQ ID NO:25), which hybridizes with the TS-DNA.
- 94
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
7e. Incubate another slide (slide number 5) in 2X SSC and 300 nMolar of a
fifth 20
nucleotide interrogation probe (interrogation probe 5), GACATCTAACGATCGATCCT
(nucleotides 80 to 99 of SEQ ID NO:25), which hybridizes with the TS-DNA.
Thi: five interrogation probes constitute a nested set as described earlier.
Their
relationship to the amplified TS-DNA. is shown below:
Probe 1 TCTCGACATCTAACGATCGA
Probe 2 CTCGACATCTAACGATCGAT
Probe 3 TCGACATCTAACGATCGATC
Probe 4 CGACATCTAACGATCGATCC
Probe 5 GACATCTAACGATCGATCCT
itiii~tii~iiiii,iiiii
iiiiiitii iii iiiii
TS-DNA TAGAGCTGTAGATTGCTAGCTAGGATCACACACACACACACA
Probe 1 is nucleotides 76 to 95 of SEQ ID NO:25, probe 2 is nucleotides 77 to
96 of SEQ ID
NO:25, probe 3 is nucleotides 78 to 97 of SEQ ID NO:25, probe 4 is nucleotides
79 to 98 of
SEQ ID NO:25, probe 5 is nucleotides 80 to 99 of SEQ ID NO:25, and the TS-DNA
(shown 3'
to 5') is nucleotides 19 to 60 of SEQ ID NO:19.
8. The slides are washed for 2 niinutes in 50 mM Tris-Cl pH 7.5, 150 mM KCI,
and 0.05
% Triton X-100.
9. The slides are then subjected to five sequential rounds of degenerate probe
ligation.
Each round consists of the following steps:
(a) The 5 slides are incubated with a ligation reaction mixture that contains
the following
components:
(i) A full set of pentainer degenerate probes (that is, a mixture of
oligonucleotides representing all 1,024 possible pentameric sequences), each
degenerate
probe at a concentration of 40 nMolar, where each degenerate probe has a 5'
phosphate
and a modified nucleotide at the 3' end (that is, a block at the 3' end). In
this example,
the modified nucleotides are caged nucleotides which are of the following
form:
2'-Deoxy-3'-O-(2-nitrobenzyl)adenosine
2'-Deoxy-3'-O-(2-nitrobenzyl)guanosine
2'-Deoxy-3'-O-(2-nitrobenzyl)thymidine
2' -Deoxy-3'-O-(2-nitrobenzyl)cytosine
These nucleotides are described by Metzker et al., Nucleic Acids Research
22:4259-4267 (1994). The modified bases protect (that is, block) the 3'-
hydroxyl and
render the degenerate probes incapable of participating in DNA polymerase
extension or
DNA ligation.
(ii) A suitable DNA ligase, preferably Phage T4 DNA ligase.
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
Ligation is carried out with T4 DNA ligase (New England Biolabs) at a
concentration of
8 units per l , in a buffer consisting of 10 mM Tris-HC1, pH 7.5, 0.18 M
NaCI, 12 mM
MgC1Z, 2 nzM ATP, and 10 % polyethylene glycol. The total volume is 25 l.
Ligation is
carried out for 40 minutes at 32 C.
(b) A primer extension reaction is carried out for 5 minutes at 37 C in 25 l,
under a
cover slip, in the presence of 5 Units Sequenase DNA polymerase (Amersham-
USB), 50 mM
Tris-HC1, pH 7.5, 20 mM MgC12, 50 mM NaCI, 5 mM DTT, 50 g/ml Bovine Serum
Albumin
(Molecular Biology grade from Life Sciences, Inc.) 50 M ddATP, ddCTP, ddGTP,
ddTTP.
This reaction blocks all the primer 3' ends that failed to participate in a
ligation event. The
slides are viashed for 5 minutes in 2IX SSC at 25 C to remove any unligated
degenerate probes.
After these steps, all of the interrogation probes are ligated to a degenerate
probe. In
the first round of degenerate probe ligation, an opaque "mask" is laid over
the first row of
DNA sample dots in all of the slides (see Figure 18B). This mask thus covers
the first sample
dot of each column. The slides are exposed to UV light for 4 minutes to remove
the cage
structures from all the ligated degenet=ate probes in all the sample rows
except row 1, which is
not illumirrated.
For the second round of degenerate probe ligation, steps (a) and (b) are
repeated.
Degenerate probes can only be ligated to DNA sample dots in rows 2 to 5 since
the cage
structure remains at the 3' end of the degenerate probes ligated to the DNA
sample dots in the
first row. After these steps, the interrogation probes in rows 2 to 5 are
ligated to two
degenerate probes. Then the opaque imask is laid over the first and second
rows of DNA sample
dots in all of the slides (see Figure 18C). The mask thus covers the first and
second sample dots
of each column. The slides are exposed to UV light for 4 minutes to remove the
cage structures
from all the ligated degenerate probes in all the sample rows except rows 1
and 2, which are not
illuminated.
For the third round of degenerate probe ligation, steps (a) and (b) are
repeated.
Degenerate probes can only be ligated to DNA sample dots in rows 3 to 5 since
the cage
structure remains at the 3' end of the degenerate probes ligated to the DNA
sample dots in rows
1 and 2. After these steps, the interrogation probes in rows 3 to 5 are
ligated to three
degenerate probes. Then the opaque mask is laid over rows 1, 2 and 3 of DNA
sample dots in
all of the slides (see Figure 18D). The mask thus covers the first, second and
third sample dots
of each column. The slides are exposed to UV light for 4 minutes to remove the
cage structures
from all the ligated degenerate probes in the fourth and fifth sample rows.
The cage structures
are not removed from the degenerate probes in sample rows 1, 2 and 3 since
they are not
illuminated.
96
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
For the fourth round of degenerate probe ligation, steps (a) and (b) are
repeated.
Degenerate probes can only be ligated to DNA sample dots in the fourth and
fifth rows since the
cage structu:re remains at the 3' end of the degenerate probes ligated to the
DNA sample dots in
rows 1, 2 and 3. After these steps, the interrogation probes in the fourth and
fifth rows are
ligated to four degenerate probes. Then the opaque mask is laid over rows 1,
2, 3 and 4 of
DNA sampL-I dots in all of the slides (see Figure 18E). The mask thus covers
the first, second,
third and fourth sample dots of each column. The slides are exposed to UV
light for 4 minutes
to remove the cage structures from all the ligated degenerate probes in the
fifth sample row.
The cage structures are not removed from the degenerate probes in sample rows
1, 2, 3 and 4
since they ai-e not illuminated.
For the fifth round of degenerate probe ligation, steps (a) and (b) are
repeated.
Degenerate probes can only be ligated to DNA sample dots in the fifth row
since the cage
structure rernains at the 3' end of the degenerate probes ligated to the DNA
sample dots in rows
1, 2, 3 and 4. After these steps, the interrogation probes in the fifth row
are ligated to five
degenerate probes. The slides are then exposed to UV light without the mask
for 4 minutes to
remove the cage structures from all the ligated degenerate probes in all the
sample rows. This
leaves all of the ligated probes (which can now be considered interrogation
primers) ready for
chain terminating primer extension.
Figures 21A, 21B, 23A, and 23B depict the results of the above degenerate
probe
ligation. The interrogation primers (the top, shorter sequences following the
row labels) formed
by ligation of degenerate probes to the interrogation probes are shown
hybridized to TS-DNA
(the longer sequences below each interrogation primer) for all of the five
sample dots in one
column of each of the five slides. In each slide, one additional degenerate
probe has been added
in each succeeding row, which is a consequence of successively covering one
additional row of
sample dots during each round of degenerate probe ligation. The non-underlined
portions of the
interrogation primers represent the interrogation probe. The underlined
portions of the
interrogation primers represent degenerate probes ligated to the end of the
interrogation probe.
Careful exarnination of all the interrogation primers in each set of five
slides reveals that each
ends adjacer.it to a different nucleotide in the TS-DNA. This allows an entire
stretch of
nucleotides i:o be separately interrogated (that is, sequenced). Figures 21A
and 21B depict the
results with a normal target sequence (that is, having 10 repeats of CA).
Figures 23A and 23B
depict the results with a mutant target sequence (that is, having only nine
repeats of CA).
10. The slides are then subjected to chain terminating primer extension
carried out for 5
minutes at 37 C in a volume of 25 I, under a cover slip, in the presence of 5
Units Sequenase
DNA polymerase (Amersham-USB), 50 mM Tris-Cl, pH 7.5, 20 mM MgCIZ, 50 mM NaCl,
5
97
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
mM DTT, 50 g/ml Bovine Serum Albumin (Molecular Biology grade from Life
Sciences, Inc.)
50 juM fluorescent-ddATP, 50 M fluorescent-ddCTP, 50 M fluorescent-ddGTP, 50
M
fluorescent-d:dTTP, each fluorescent dNTP being able to generate a signal with
a different
emission spectrum (Applied Biosystems, Inc. Sequencing kit). In this reaction,
one fluorescent
nucleotide is added to the end of each interrogation primer. The identity of
the added nucleotide
is based on the identity of the template nucleotide (the nucleotide adjacent
to the interrogation
primer).
11. Wash 5 minutes in 2X SSC at 25 C.
12. Wash 4 minutes in 2X SSC, 2.8% BSA, 0.12% Tween-20 at 37 C.
13. Incubate 30 minutes at 37 C in 50 l (under cover slip) using 5 g/ml
Biotinylated
AntiBUDR-Mouse.IgG (Zymed Labs) in 2X SSC, 2.8% BSA, 0.12% Tween-20. This
reaction
collapses the TS-DNA molecules into a compact structures on the slides.
14. Wasla three times for 5 minutes in 2X SSC, 2.8% BSA, 0.12% Tween-20 at 37
C.
15. Incubate 30 minutes at 37 C iin 50 l (under cover slip) using FITC-
Avidin, 5 g/ml. in
2X SSC, 2.8% BSA, 0.12% Tween-20. This labels each TS-DNA molecule with
fluorescein.
16. Wasl1 three time for 5 minutes in 2X SSC, 2.8% BSA, 0.12% Tween-20 at 37
C.
17. Wash 5 minutes with 2X SSC, 0.01 % Tween-20 at room temperature.
18. The image of each slide is captured using a microscope-CCD camera system
with
appropriate filter sets. The fluorescent emission color of each fluorescent
nucleotide defines the
nucleotide at the specific extension pos:ition in each fluorescent spot. Each
spot corresponds to a
single molecule of TS-DNA. Figures 22A, 22B, 24A, and 24B depict the results
chain
terminating primer extension. The interrogation primers, now with a
fluorescent nucleotide (in
boldface) added to the end, are shown hybridized to TS-DNA for all of the five
sample dots in
one column of each of the five slides. In each slide, a different nucleotide
in a stretch of
nucleotides in the TS-DNA has served as the template for the incorporation of
a chain
terminating fluorescent nucleotide. Thus, each of the nucleotides in this
stretch has been
separately interrogated (that is, sequenced). Figures 22A and 22B depict the
results with a
normal target sequence (that is, having 10 repeats of CA). Figures 24A and 24B
depict the
results with a mutant target sequence (that is, having only nine repeats of
CA).
19. The sequence is assembled frorn the fluorescent spot data obtained from
all five slides,
by reading t]ze incorporated nucleotide in each related sample dot in the
order. Figures 19 and
21 diagrammatically depict the incorporated nucleotides for each sample dot in
corresponding
columns of each of the five slides. Figure 19 represents the results with the
normal target
sequence (that is, having 10 repeats of CA). Figure 20 represents the results
with a mutant
target sequence (that is, having only nine repeats of CA). The nucleotides are
read first from
98
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
the first sample dot in a given column from each slide in order (that is, the
sample dot in row 1
of slide 1, the sample dot in row 1 of slide 2, the sample dot in row 1 of
slide 3, the sample dot
in row 1 of slide 4, and the sample dot in row 1 of slide 5). The next
nucleotides are read from
the second sample dot in the column from each slide in order (that is, the
second sample dot in
row 2 of slides 1 to 5 in order). The reading of nucleotides continues in the
same manner for
sample dots in rows 3, 4, and 5 in order. The relationship of the sample dots
which leads to
this order of reading can be seen by carefully examining the relationship of
the interrogated
nucleotides in Figures 22A, 22B, 24A, and 24B. The sequence read from the
slides depicted in
Figure 19 is ~GTGTGTGTGTGTGTGTGTGTCAATC (nucleotides 105 to 125 of SEQ ID
NO:25). The sequence read from the slides depicted in Figure 20 is GTGTGTGTGTG
TGTGTGTCAATCTG (nucleotides 30 to 50 of SEQ ID NO: 18). The difference in the
number
of GT repeats between these two sequeiices is readily apparent.
Exatnple 11: Immunoassay for human TSH coupled to rolling circle amplification
This example describes single-niolecule detection of human thyroid stimulating
hormone
(hTSH) using a capture antibody, and a reporter antibody. The reporter
antibody is of the form
illustrated in Figure 29A where an antibody is coupled to a rolling circle
replication primer.
The signal that is detected is produced by rolling circle amplification primed
by the rolling circle
replication primer portion of the reporter antibody.
1. A ma.lemide-modified monoclonal antibody specific for hTSH is coupled to
the 5'-end of
the 28-base oligonucleotide 5'-[amino]-TTTTTTTTTTGCTGAGACATGACGAGTC-3' (SEQ ID
NO:27) using SATA chemistry as described by Hendrickson et al. to form a
reporter antibody.
The 18 nucleotides at the 3' end of this oligonucleotide are complementary to
the ATC described
below. This oligonucleotide serves as the rolling circle replication primer
for the amplification
operation below.
2. hTSH capture antibodies, specific for a different epitope from that
recognized by the
reporter antibody, are immobilized at defined positions using droplets of 2 mm
diameter on
derivatized glass slides (Guo et al. (1994)) to make a solid-state detector.
Droplets of 1.5
microliters, containing 5 g/ml of the antibody in sodium bicarbonate pH 9 are
applied at each
defined posit:ion on the slides, incubatecl overnight, and then the entire
slide is washed with PBS-
BLA (10 mN[ sodium phosphate, pH 7.4, 150 mM sodium chloride, 2% BSA, 10% Beta-
lactose, 0.02% sodium azide) to block non-adsorbed sites.
3. Serial dilutions of hTSH are added to each of several identical slides,
under cover slips.
After 1 hour of incubation, the slides are washed three times with TBS/Tween
wash buffer
(Hendricksor.i et al.). The hTSH is now captured on the surface of the glass
slides.
99
CA 02236161 1998-05-21
WO 97/19193 PCTIUS96/18812
4. Thirty microliters of appropriately diluted mixture of the reporter
antibody (antibody
coupled to i-olling circle replication primer) is added to each slide, under a
cover slip. The
slides are ir-cubated at 37 C for 1 hour, and then washed four times, for 5
minutes each wash,
with 2X SSC, 2.8% BSA, 0.12% Tween-20 at 37 C.
5. The ATC is a 94-base closed circular oligonucleotide of the following
sequence
5'-AAATCTCCAACTGGAAACTGT'TCTGACTCGTCATGTCTCAGCTCTAGTACGCTGATC
TCAGTCTGATCTCAGTCATTTGGTCTCAAAGTGATTG-3' (SEQ ID NO:28). This ATC
oligonucleotide is incubated in a volurne of 30 microliters on the surface of
the glass slide, under
a cover slip, in a buffer consisting of 50 mM Tris-Cl, pH 7.4, 40 mM KOAC, 10
mM MgC12,
in order to hybridize the ATC to the rolling circle replication primer portion
of the reporter
antibodies. This hybridization is illustrated in Figure 29B.
6. In situ Rolling Circle Amplification is carried out for 12 minutes at 30 C,
under a cover
slip, in 30 inicroliters of a buffer containing the following components: 50
mM Tris-HC1 pH
7.5, 10 mM MgC12, 400 M each of dCTP, dATP, dGTP, 95 M dTTP, 380 uM BUDR
triphosphate (SIGMA), Phage T4 Gene-32 protein at a concentration of 1000
nMolar, and 029
DNA polynierase at 200 W. This reaction generates approximately 350 tandem
copies of the
ATC. The copies remain bound to the antibody as a single TS-DNA molecule since
the rolling
circle replication primer is incorporated within the TS-DNA (at the 5' end)
and the rolling circle
replication primer remains coupled to the antibody.
7. The slide is washed three times for 5 minutes in 2X SSC, 2.8 % BSA, 0.12 %
Tween-20
at 37 C.
8. The slide is then incubated 30 minutes at 37 C in 50 l (under cover slip)
of 2X SSC,
2.8 % BSA, 0.12 % Tween-20, and 5jig/ml Biotinylated AntiBUDR-Mouse.IgG (Zymed
Labs).
9. The slide is washed three times for 5 minutes in 2X SSC, 2.8 % BSA, 0.12 %
Tween-20
at 37 C.
10. The: slide is then incubated 30 minutes at 37 C in 50 l (under cover
slip) of 2X SSC,
2.8 % BSA, 0.12 % Tween-20, and FI'TC-Avidin at 5 g/ml.
11. The slide is washed 3 X 5 miii. in 2x ssc, 2.8% BSA, 0.12% Tween-20 at 37
C.
12. The: slide is washed 10 minutes with IX SSC, 0.01 % Tween-20 at room
temperature.
13. An image of the slide is captured using a microscope-CCD camera system
with
appropriate filter sets for fluorescein dete.ction, and the number of
fluorescent dots is counted.
This indicates the presence of, and relative amount of, hTSH present in the
sample since each
dot represents a single collapsed TS-I1NA molecule and each TS-DNA molecule
represents a
single hTSH molecule captured on the slide.
100
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Yale University
(ii) 'TITLE OF INVENTION: Unimolecular Segment Amplification
And Detection
(iii) :MMBER OF SEQUENCES: 28
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Patrea L. Pabst
(B) STREET: 2800 One Atlantic Center
1201 West Peachtree Street
(C) CITY: Atlanta
(D) STATE: Georgia
(E) COUNTRY: USA
(F) ZIP: 30306-3450
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) C'CTRR.ENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/563,912
(B) FILING DATE: November 21, 1995
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/016,677
(B) FILING DATE: May 1, 1996
(C) CLASSIFICATION:
(viii) A'TTORNEY/AGENT INFORMATION:
(A) NAME: Pabst, Patrea L.
(B) REGISTRATION NUMBER: 31,284
(C) REFERENCE/DOCKET NUMBER: YU115CIP2PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (404)873-8794
(B) TELEFAX: (404)8'73-8795
(2) INFORMATION FOR SEQ ID NO:1:
( i ) S:EQUENCE CHARACTERIST:CCS :
(A) LENGTH: 111 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) S:EQUENCE DESCRIPTION: SEQ ID NO:l:
GCCTGTCCAG GGATCTGCTC AAGACTCGTC ATGTCTCAGT AGCTTCTAAC GGTCACAAGC 60
TTCTAACGG'T CACAAGCTTC TAACGGTCAC ATGTCTGCTG CCCTCTGTAT T 111
(2) INFOR:MATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2
GAGCAGATCC CTGGACAGGC AAGGAATACA GAGGGCAGCA GACA 44
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRAMEDNESS: single
101
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3
GTATTCCTTG CCTGGTATTC CTTGCCT(3 28
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
( i i i) HYPOTHETI CAL : NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4
ATCAGTCTAG TCTATNNNNN 20
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 95 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) Al>TTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5
GAGGAGAATA AAAGTTTCTC ATAAGACTCG TCATGTCTCA GCAGCTTCTA ACGGTCACTA 60
ATACGACTCA CTATAGGTTC TGCCTCTGGG AACAC 95
(2) INFORI4ATION FOR SEQ ID NO : 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
( D ) TOPOLOGY : l ineair
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6
GCTGAGACA'T GACGAGTC 18
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERIST:LCS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) S:EQUENCE DESCRIPTION: SEQ ID NO:7
TTTTTTTTT'T TCCAACCTCC ATCACTAGT 29
(2) INFORMATION FOR SEQ ID NO:8:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8
TTTTTTTTTT TCCAACCTCG ATCACTAGT 29
102
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linea:r
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9
TTTTTTTTTT TTTTTTGATC GAGGAGAAT 29
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linea:r
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10
NNNNNATAGA CTAGACTGAT NNN 23
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 96 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linea:r
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11
TAAAAGACTT CATCATCCAT CTCATAAGAC TCGTCATGTC TCAGCAGCTT CTAACGGTCA 60
CTAATACGAC TCACTATAGG GGAACACTAG TGATGG 96
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 96 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12
TAAAAGACT'T CATCATCCAT CTCATAAGAC TCGTCATGTC TCAGCAGCTT CTAACGGTCA 60
CTAATACGAC TCACTATAGG GGAACACTAG TGATCG 96
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MfOLECULE TYPE: DNA
(iii) BYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13
TTTTTTTTT'T TCCAAATTCT CCTCCATCA 29
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
103
CA 02236161 1998-05-21
WO 97/191921 PCT/US96/18812
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14
TTTTTTTTTT TCCAAATTCT CCTCGATCA 29
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:15
TGTCCACTTT CTGTTTTCTG CCTC 24
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 95 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16
ATCACTAGT'G TTCCTTCTCA TAAGACT'CGT CATGTCTCAG CAGCTTCTAA CGGTCACTAA 60
TACGACTCA.C TATAGGGGAT GATGAAGTCT TTTAT 95
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERIST'ICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17
TTTTTTTTTT TTTTTTGATG GAGGAGAAT 29
(2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHAR.ACTERIST'ICS:
(A) LENGTH: 51 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) N[OLECULE TYPE: DNA
( i i i) F?(YPOTHETI CAL : NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18
TCTCGACAZ'C TAACGATCGA TCCTAGTGTG TGTGTGTGTG TGTCAATCTG T 51
(2) INFOF:MATION FOR SEQ ID NO :19 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base: pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
( i i) MOLECULE T'YPE : DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:19
CTAGATAC'.hG ATTGACACAC ACACACACAC ACACTAGGAT CGATCGTTAG ATGTCGAGAT 60
(2) INFOP.MATION FOR SEQ ID NC):20:
104
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
( i ) S:EQUENCE CHARACTERIST:ECS :
(A) LENGTH: 86 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) AbTTI-SENSE: NO
(xi) S:EQUENCE DESCRIPTION: SEQ ID NO:20
GAACTATAT'T GTCTTTCTCT GTTTTCTTGC ATGGTCACAC GTCGTTCTAG TACGCTTCTA 60
ACTTAGTGTG ATTCCACCTT CTCNAA 86
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERIST:ICS:
(A) LENGTH: 54 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) A1qTI-SENSE: NO
(xi) S:EQUENCE DESCRIPTION: SEQ ID NO:21
AGTTTGCAGA GAAAGACAAT ATAGTTCTTK GAGAAGGTGG AATCACACTG AGTG 54
(2) INFORWIATION FOR SEQ ID NO:22:
( i ) S:EQUENCE CHARACTERIST:CCS :
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear.
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22
ATAGTTCTTN GAGAAGGTGG AATCACACTA AGTTAGAAG 39
(2) INFORMATION FOR SEQ ID NO:23:
( i ) SEQUENCE CHARACTERIST:LCS :
(A) LENGTH: 78 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: s:ingle
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23
AAGTTCACG'T ACGTACATAG CTAGATA('.-AG ATTGACACAC ACACACACAC ACTAGGATCG 60
ATCGTTAGAT GTCGAGCC 78
(2) INFORMATION FOR SEQ ID NO:24:
( i ) SEQUENCE CHAR.ACTERIST:CCS :
(A) LENGTH: 80 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) H'YPOTHETICAL: NO
(iv) AbTTI-SENSE: NO
(xi) S:EQUENCE DESCRIPTION: SEQ ID NO:24
AAGTTCACG'T ACGTACATAG CTAGATACAG ATTGACACAC ACACACACAC ACACTAGGAT 60
CGATCGTTAG ATGTCGAGCC 80
(2) INFORIMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 128 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
105
CA 02236161 1998-05-21
WO 97/19193 PCT/US96/18812
(ii) 14OLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) t3EQUENCE DESCRIPTION: SEQ ID NO:25
ATCTAGCMT GTACGTACGT GAACTTTTCT TGCATGGTCA CACGTCGTTC TAGTACGCTT 60
CTAACTTTTA ACATATCTCG ACATCTAACG ATCGATCCTA GTGTGTGTGT GTGTGTGTGT 120
CAATCTGT 128
(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 58 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: lineeir
( i i) 14OLECULE TYPE : DNA
(iii) HYPOTHETICAL: NO
(iv) iUiTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION:, SEQ ID NO:26
CTAGATACAG ATTGACACAC ACACACACAC ACTAGGATCG ATCGTTAGAT GTCGAGAT 58
(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic zicid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION:: SEQ ID NO:27
TTTTTTTTTT GCTGAGACAT GACGAGTC 28
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 94 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) PQOLECULE TYPE: DNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28
AAATCTCCAP. CTGGAAACTG TTCTGAC'TCG TCATGTCTCA GCTCTAGTAC GCTGATCTCA 60
GTCTGATCTC AGTCATTTGG TCTCAP,AGTG ATTG 94
106
