Note: Descriptions are shown in the official language in which they were submitted.
CA 02242908 1998-07-10
W O 97/25340 PCT~US96/00499
_,
~MAN G-PROTEIN r~FM~K ~ N~ K~W~O~ HSAT~68
This invention relates to newly identi~ied
polynuoleotides, polypeptides encoded by such
polynucleotides, the use o~ such polynucleotides and
polypeptide~, as well as the ~loduction of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is a h~lm~n 7_
tr~n~:m~ e receptor which ha5 been putatively identi~ied
as a rhPmok;~ receptor, 50metimes hereinafter re~erred to
as "G-Protein ~h~mokine Receptor" or "~SATU68". The
invention also relates to inhibiting the action o~ such
polypeptides.
It is well established that many medically signi~icant
biological processes are mediated by proteins participating
in signal tr~n~llction pathways that involve G-proteins
and/or second messengers, e.g., cAMP (Le~kowitz, Nature,
3~1:35~-354 (1991)). Herein these proteins are re~erred to
as proteins participating in pathways with G-proteins or
PPG proteins. Some ~mples o~ these proteins include the
GPC receptors, such as those ~or adrenergic agents and
dor:lm;n~ (Kobilka, B.K., et al., PN~S, 84:46-50 (1987);
Kr~h;lk~, B.~C., et al., Science, 238:6~0-656 ~lg87); ~unzow,
J.R., et al., Nature, 336:783-787 ~1988)), G-proteins
themselves, e~ector proteins, e.g., phospholipase C,
adenyl cyclase, and phosphodie8terase, and actuator
CA 02242908 1998-07-10
WO 97/25340 PCT~US96/00499 proteins, e.g., protein kina~e A and protein kinase C
(Simon, M.I., et al., Science, 2~2:802-8 ~1991)).
For example, in one ~orm of signal transduction, the
e~ect o~ hormone binding is activation of an enzyme,
adenylate cyclase, inside the cell. Enzyme activation by
hormones is dependent on the presence o~ the nucleotide
GTP, and GTP also in~ n~s hormone bi n~i ng . A G~protein
connects the hormone receptors to adenylate cyclase. G-
protein was shown to ~h~nge GTP ~or bound GDP when
activated by hormone receptors. The GTP-carryiny ~orm then
binds to an activated adenylate cyclase. Hydrolysis o~ GTP
to GDP, catalyzed by the G-protein itsel~, returns the G-
protein to its basal, inactive ~orm. Thus, the G-protein
serves a dual role, as an interm~ te that relays the
signal ~rom receptor to e~ector, and as a clock that
controls the duration of the signal.
The membrane protein gene super~amily o~ G-protein
coupled receptors has been characterized as having seven
putative tr~n~ ane ~ i n~ . The ~om~ i n~ are believed
to represent tran~ e ~-helices connected by
extracellular or cytoplasmic loops. G-protein coupled
receptors include a wide range of biologically active
receptors, s~ch as hormone, viral, growth ~actor and
neuroreceptors.
G-protein coupled receptors have been characterized a~
including these seven conserved hydrophobic stretches o~
about 2Q to 30 amino acids, connecting at least eight
divergent hydrophilic loops. The G-protein ~amily o~
coupled receptors includes dopamine receptors which bind to
neuroleptic drugs used f or treating p~ychotic and
neurolo~ical disorders. Other examples o~ mem~ers o~ this
~amily include calcitonin, adrenergic, endothelin, cAMP,
adenosine, muscarinic, acetylcholine, serotonin, hist~m;nP,
throm~in, k; ni n, ~ollicle stimulating hormone, opsins,
endotheli~l di$~erentiation gene-1 receptor and rhodopsins,
odorant, cytomegalovirus receptors, etc.
G-protein coupled receptors can be intracellularly
coupled by heterotrimeric G-proteins to various
CA 02242908 l998-07-lO
W O 97/25340 PCT~US96/001~
intracellular enzymes, ion ~h~nn~ls and transporters ~see,
Johnson et al., Endoc., ~ev.,- 10:3~7-331 (1989)).
Different G-protein ~-subunits preferentially stimulate
particular effectors to modulate various biological
functions in a cell. Phosphorylation of cytoplasmic
residues of G-protein coupled receptors have been
identified as an important mechanism for the regulation of
~-protein coupling of some G-protein coupled receptors. G-
protein coupled receptors are found in numerous sites
within a m~mm~l ~ ~n host.
~ mnkines, also referred to as intercrine cytok~n~s~
are a subfamily of structurally and functionally related
cytokines. These molecules are 8-10 kd in size. In
general, chemokines ~h~ h~ t 2096 to 75~ homology at the
amino acid level and are characterized by four conserved
cysteine residues that form two disulfide bonds. Based on
the arrangement of the first two cysteine residues,
~h~mokines have been classified into two subfamilies, alpha
and beta. In the alpha subfamily, the first two cysteines
are separated by one amino acid and hence are referred to
as the "C-X-C" subfamily. In the beta subfamily, the two
cysteines are in an adjacent position and are, therefore,
re~erred to as the l~C-C~ sub~amily. Thus $ar, at least
nine dif f erent members of this family have been identified
in hllm~n~
The intercrine cytokines exhibit a wide variety of
functions. A hallmark feature is their ability to elicit
chemotactic migration of distinct cell types, including
monocytes, neutrophils, T lymphocytes, basophils and
fibroblasts. Many chemokines have pro-inflammatory
activity and are involved in multiple steps during an
inflammatory reaction. These activities include
st;mn-~tion of histamine release, lysosomal enzyme and
~ leukotriene release, increased adherence of target ~mmllne
cells to endothelial cells, ~nh~nced h~ n~; ng of complement
proteins, induced expression of granulocyte adhesion
molecules and complement receptors, and respiratory burst.
In addition to their involvement in inflammation, certain
--3--
.
CA 02242908 1998-07-10
W O 97/25340 PCT~US96/00499
~h~m~kines have been shown to exhibit other activitie~.
For example, macroph~ge inflammatory protein 1 (MIP-1) is
able to suppress hematopoietic stem cell proliferation,
platelet factor-4 (PF-4) is a potent inhibitor of
endothelial cell growth, Interleukin-8 (IL-8) promotes
proliferation of keratinocytes, and GR0 is an autocrine
growth factor for m~l ~nom~ cell5,
In light of the diverse biological activities, it is
not surprising that chPmokines have been implicated in a
number of physiological and disease conditions, including
lymphocyte trafficking, wound h~l in~, hematopoietic
regulation and ;mmlln~logical disorders such as allergy,
asthma and arthritis.
In accordance with one aspect of the present
invention, there are provided novel mature receptor
polypeptides as well as biologically active and
diagnostically or therapeutically useful fra~Pnts, analogs
and derivatives thereof. The receptor polypeptides o~ the
present invention are of human origin.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid
molecules encoding the receptor polypeptides of the present
invention, including mRNAs, cDNAs, genomic DNA as well as
antisense analogs thereo~ and ~iologically active and
diagnostically or therapeutically useful fragments thereo~.
In accordance with another aspect of the present
invention there is provided an isolated nucleic acid
molecule encoding a mature polypeptide expressed by the
hn~-n cDNA ~nt~i n~ in ATCC Deposit No. 97334.
In accordance with a further aspect of the present
invention, there are provided processes for producing such
receptor polypeptides by reC~mhin~nt techniques comprising
culturing recomh;n~nt prokaryotic and/or eukaryotic host
ce-ls, cont~;n~ng nucleic acid sequences encoding the
receptor polypeptides of the present invPntion, under
conditions promoting expression of said polypeptides and
subse~uent recovery of said polypeptides.
CA 02242908 l998-07-lO
W O 97/25340 PCT~US~C'0015~
In accordance with yet a ~urther aspect o~ the present
invention, there are provided antibodies against such
receptor polypeptides.
In accordance with another aspect o~ the present
invention there are provided methods of screening for
compounds which bind to and activate or inhibit activation
o~ the receptor polypeptides o~ the present invention.
In accordance with still another embodiment o~ the
present invention there are provided processes of
~nm~ni~tering compounds to a host which bind to and
activate the receptor polypeptide o~ the present invention
which are use~ul in stimulating haematopoiesis, wound
hF~l tng~ coagulation, angiogenesis, to treat tumors,
chronic in~ections, leukemia, T-cell mediated auto-immllne
diseases, parasitic in~ections, psoriasis, and to stimu~ate
growth ~actor activity.
In accordance with another aspect of the present
invention there is provided a method o~ A~m;n;stering the
receptor polypeptides of the present invention via gene
therapy to treat conditions related to underexpression o~
the polypeptides or underexpression o~ a ligand ~or the
receptor polypeptide.
In accordance with still another embodiment o~ the
present invention there are provided processes o~
~mtnt~tering compounds to a host which bind to and inhibit
activation o~ the receptor polypeptides o~ the present
invention which are use~ul in the prevention and/or
treatment o~ allergy, atherogenesis, ~n~rhylaxis,
malignancy, chronic and acute in~lammation, histamine and
IgE-mediated allergic reactions, prostagl~n~tn-indep~n~nt
~ever, bone marrow ~ailure, silicosis, sarcoidosis,
rheumatoid arthritis, shock and hyper-eosinophilic
syndrome.
In accordance with yet another aspect of the present
invention, there are provided nucleic acid probes
comprising nucleic acid molecules o~ su~icient length to
speci~ically hybridize to the polynucleotide sequences o~
the present invention.
CA 02242908 1998-07-10
W O 97/~5340 PCTAUS96/00499
In accordance with still another aspect o~ the present
invention, there are provided diagnostic assays for
detecting diseases related to mutations in the nucleic acid
seguences encoding such polypeptides and ~or detecting an
altered level of the soluble ~orm o~ the receptor
polypeptides.
In accordance with yet a further aspect o~ the present
invention, there are provided processes for utilizing ~uch
receptor polypeptides, or polynucleotides encoding s~ch
polypeptides, for in vitro purposes related to scienti~ic
research, synthesis o~ DNA and manu~acture of DNA vectors.
These and other aspects o~ the present invention
should be apparent to those skilled in the art ~rom the
teachings herein.
The ~ollowing drawings are illustrative o~ embo~;m~nt~
of the invention and are not meant to limit the scope o~
the invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and the corresponA;ng
deduced amino acid sequence of the G-protein ~h~m~kine
receptor o~ the present invention The standard one-letter
abbreviation ~or amino acids is used. Seguencing was
per~onmed using a 373 Automated DNA sequencer (Applied
Biosystems, Inc.).
Figure 2 illu~trates an amino acid alisnm~nt of the G-
protein ~hPm~kine receptor of the present invention (top)
and the human interleukin-8 receptor (bottom) (SEQ ID NO:9)
In accordance with an aspect o~ the present invention,
there is provided an isolated nucleic acid (polynucleotide)
which ~nco~ ~or the mature polypeptide having the deduced
amino acid sequence o~ Figure 1 (SEQ ID NO:2).
In accordance with another aspect o~ the present
invention there are provided isolated polynucleotides
encoding a mature polypeptide expressed by the h~ n cDNA
con~A~neA in ATCC Deposit No. 97334, deposited with the
American Type Culture Collection, 12301 Park Lawn Drive,
Rockville, Maryland 20852, USA, on November 6, 1995. The
deposited material is a cDNA insert, encoding a polypeptide
--6--
.
.
CA 02242908 1998-07-10
W O 97/25340 PCT~US~G~
- o~ the present invention, cloned into a pBluescript SK(-)
vector (Stratagene, La Jolla, CA~, which will con~er
ampic;lli n resistance upon trans~ormation.
The deposit(s) has been made under the terms of the
Budapest Treaty on the International Recognition of the
Deposit of Micro-organisms ~or purposes of Patent
Procedure. The strain will be irrevocably and without
restriction or condition released to the public upon the
issuance of a patent. These deposits are provided merely
as convenience to those o~ skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence o~ the polynucleotides cont~;ne~ in the
deposited materials, as well as the amino acid sequence of
the polypeptides encoded thereby, are incorporated herein
by re~erence and are controlling in the event of any
conflict with any description of sequences herein. A
license may be required to make, use or sell the deposited
materials, and no such license i5 hereby granted.
The polynucleotide of this invention was discovered in
a human genomic library derived ~rom human activated T
cells. It is structurally related to the G protein-coupled
receptor ~amily. It cont~i n~ an open reading ~rame
encoding a protein o~ 415 amino acid residues. The protein
exhibits the hiyhest degree of homology at the amino acid
level to a hllm~n interleukin-8 receptor with 39.31 %
identity and 58.405 ~ s~m; 1 ~ity.
The polynucleotide o~ the present invention may be in
the ~orm o~ RNA or in the ~orm o~ DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be
double-stranded or single-str~n~, and i~ single stranded
may be the coding strand or non-coding ~anti-sense) strand.
The coding sequence which encodes the mature polypeptide
may be identical to the coding sequence shown in Figure 1
(SEQ ID NO:1) which coding se~uence, as a result o~ the
re~lln~ncy or degeneracy o~ the genetic code, encodes the
same mature polypeptide as the DNA o~ Figure 1 (SEQ ID
NO:1).
CA 02242908 1998-07-10
WO 97/2534Q PCT/US961'0~ S~l
The polynucleotide which encodes ~or the mature
polypeptide of Figure 1 ~SEQ ID NO:~) may include: only
the coding se~uence for the mature polypeptide; the coding
seguence ~or the mature polypeptide and additional coding
sequence such as a tr~n~mh~ane (TM) or intra-cellular
~n~A;n; the coding sequence for the mature polypeptide (and
optionally additional coding se~uence) and non-coding
sequence, such as introns or non-coding sequence 5~ and/or
3' o~ the coding sequence for the mature polypeptide.
The present invention further relates to variants of
the her~n~hove descri~ed polynucleotides which ~nco~ ~or
~ragments, analogs and derivatives o~ the polypeptide
having the deduced amino acid sequence of Figure 1 ~SEQ ID
NO:2) The variant of the polynucleotide may be a
naturally occurring allelic variant o~ the polynucleotide
or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in Figure 1
(SEQ ID NO:2) as well as variants o~ such polynucleotides
which variants encode for a ~ragment, derivative or analog
of the polypeptide of Figure 1 (SEQ ID NO:2). Such
nucleotide variants include deletion variants, substitution
variants and addition or insertion variants.
As her~;n~bove indicated, the polynucleotide may have
a coding sequence which is a naturally occurring allelic
variant of the coding se~uence shown in Figure 1 (SEQ ID
NO:1). As known in the art, an allelic variant is an
alternate form of a polynucleotide sequence which may have
a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the
function o~ the encoded polypeptide.
The polynucleotides may al~o encode ~or a soluble ~orm
of the G-protein chem~kine receptor polypeptide which is
the extracellular portion of the polypeptide which has been
cleaved ~rom the TM and intracellular ~nm~ ~ n of the full-
length polypeptide o~ the present invention.
The polynucleotides of the present invention may also
have the coding sequence fused in ~rame to a m~rker
--8--
.
CA 02242908 1998-07-10
W O 97/25340 PCTAJS96/00499
sequence which allows ~or puri~ication o~ the polypeptide
of the present inven~ion. The marker se~uence m~y be a
hexa-histidine tag supplied by a pQE vector (Qiagen) to
provide ~or puri~ication o~ the mature polypeptide ~used to
the marker in the case of a bacterial host, or, for
example, the marker sequence may be a hemagglutinin (BA)
tag when a m~mm~ lian host, e.g. COS-7 cells, is used. The
HA tag corresponds to an epitope derived from the influenza
hemagglll~in~n protein ~Wilson, I., et al., Cell, 37:767
(1984)).
The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions
preceding and ~ollowing the coding region ~leader and
trailer) as well as intervening sequences (introns) between
individual codiny segments (exons).
Fragments o~ the ~ull length gene o~ the present
invention may be used as a hybridization probe ~or a cDNA
library to isolate the full length cDNA and to isolate
other cDNAs which have a high sequence sim;l~ity to the
gene or similar biological activity. Probes of this type
preferably have at least 15 bases, preferably 30 bases and
most preferably, may contain, ~or example, 50 or more
bases. The probe may also be used to identi~y a cDNA clone
corresponding to a ~ull lenyth transcript and a genomic
clone or clones that Cont~ n the complete gene including
regulatory and promotor regions, exons, and introns. An
example of a screen comprises isolating the coding region
of the gene by using the known DNA sequence to synthesize
an oligonucleotide probe. Labeled oligonucleotides having
a sequence complementary to that of the gene o$ the present
invention are used to screen a library of h~ n cDNA,
genomic DNA or mRNA to determine which memh~S of the
library the probe hybridizes to.
The present invention ~urther relates to
polynucleotides which hybridize to the hereinabove-
described se~nces i~ there is at least 70~, preferably at
least 90~, and more pre~erably at least 9~ identity
between the sequences. The present invention particularly
_g _
CA 02242908 1998-07-10
W O 97/25340 PCTAUS96/00499
relates to polynucleotides which hybridize under stringent
conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions~ means
hybridization will occur only i~ there is at least 95~ and
preferably at least 97% identity between the sequences.
The polynucleotides which hybridize to the her~in~hove
described polynucleotides in a preferred embodiment encode
polypeptides which either retain substantially the same
biological function or activity as the mature polypeptide
encoded by the cDNA o~ Figure 1 (SEQ ID NO:1).
Alternatively, the polynucleotide may have at least 15
bases, pre~erably 30 bases, and more preferably at least 50
bases which hybridize to a polynucleotide o~ the present
invention and which has an identity thereto, as hereinabove
described, and which may or may not retain activity. For
example, such polynucleotides may be employed as probes ~or
the polynucleotide of SEQ ID NO:1, for example, for
recovery of the polynucleotide or as a diagnostic probe or
as a PCR primer.
The present invention further relates to
polynucleotides which hybridize to the hereinabove-
described sequences i~ there is at least 70~, pre~erably at
least 90~, and more pre~erably at least 95~ identity
between the sequences. The present invention particularly
relates to polynucleotides which hybridize under stringent
conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means
hybridization will occur only i~ there is at least 95~ and
preferably at least 97~ identity between the sequences.
The polynucleotides which hybridize to the hereinabove
described polynucleotides in a preferred Pmhn~;mPnt encode
polypeptides which either retain ~ubst~nti~lly the same
biological function or activity as the mature polypeptide
encoded by the cDNA o~ Figure 1 (SEQ ID NO~
The present invention ~urther relates to a G-protein
çhPmnkine receptor polypeptide which has the deduced amino
acid se~uence of Figure 1 (SEQ ID NO:2), as well as
fragments, analogs and derivatives of such polypeptide.
-10 -
CA 02242908 1998-07-10
W O 97/25340 PCT~US96/00499
The terms ~ragment,~ "derivative" and ~analog~ when
referring to the pol~peptide of Fi~ure 1 ~SEQ ID NO:2) !
means a polypeptide which either retains substantially the
same biological function or activity as such polypeptide,
i.e. functions as a G-protein ~.h~mokine receptor, or
retains the ability to bind the ligand for the receptor,
for example, a soluble form of the receptor. An analog
includes a proprotein which can be activated by cleavage of
the proprotein portion to produce an active mature
polypeptide.
The polypeptide of the present invention may be a
rec~mh;n~nt polypeptide, a natural polypeptide or a
synthetic polypeptide, preferably a rero~hin~nt
polypeptide.
The fragment, derivative or analoy of the polypeptide
of Figure 1 tSEQ ID NO:2) may be (i) one in which one or
more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably
a conser~ed amino acid residue) and such substituted amino
acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii~ one in
which the mature polypeptide is fused with another
compound, such as a compound to increase the hal~-life o~
the polypeptide (for example, polyethylene glycol), or (iv)
one in which the additional amino acids are fused to the
mature polypeptide for purification of the polypeptide or
(v) one in which a fragment of the polypeptide is soluble,
i.e. not ,.,e"~ldne bound, yet still binds ligands to the
1.._..~ dne bound receptor. Such fragments, derivatives and
analogs are deemed to be within the scope of those skilled
in the art from the t~h;ngs herein.
The polypeptides and polynucleotides of the present
- invention are preferably provided in an isolated form, and
preferably are purified to hu~L~yelleity.
Thus, the present invention is directed to
polynucleotides having at least a 70~ identity, preferably
at least 90% and more preferably at least a 95~ identity to
CA 02242908 1998-07-10
W O 97/25340 PCTnJS96/0~499
a polynucleotide which ~nco~s the polypeptide o~ SEQ ID
N0:2 and polynucleotides complementary thereto as well as
portions thereo~, which portions have at least 15
consecutive bases, pre~erably 3~ consecutive ba~es and more
pre~erably at least 50 consecutive bases and to
polypeptides encoded by such polynucleotides.
As known in the art "s;m;l~ity~ between two
polypeptides is determined by comparing the amino acid
sequence and conserved amino acid substitutes thereto of
the polypeptide to the sequence o~ a second polypeptide.
Fragments or portions o~ the polypeptides o~ the
present invention may be employed ~or producing the
corresponding ~ull-length polypeptide by peptide synthesis,
there~ore, the ~ragments may be employed as intenmediates
for producing the full-length polypeptides. Fragments or
portions o~ the polynucleotides o~ the present invention
may be used to synthesize ~ull-length polynucleotides of
the present invention.
The term "gene" means the segment o~ DNA involved in
producing a polypeptide chain; it includes regions
preceding and following the coding region "leader and
trailer~ as well as intervening seguences (introns) between
individual coding segments (exons).
The term "isolated" means that the material is l~ulo~d
~rom its original envi.~-l".e~t (e.g., the natural
envi~olllLIellt if it is naturally occurring). For example, a
naturally-occurring polynucleotide or polypeptide present
in a living ~n~m~l iS not isolated, but the same
polynucleotide or polypeptide, separated ~rom some or all
o~ the coexisting materials in the natural system, is
isolated. Such polynucleotides could ~e part o~ a vector
and/or such polynucleotides or polypeptides could be part
o~ a composition, and still ~e isolated in that such vector
or composition is not part o~ its natural envi~ -t.
The present invention also relates to vectors which
include polynucleotides o~ the present invention, host
cells which are genetically engineered with vectors o~ the
CA 02242908 1998-07-10
W O 97/25340 PCTrUS96/00499
invention and the production o~ polypeptides o~ the
invention by recombinant techniques.
Host cells are yenetically engineered (transduced or
trans~ormed or trans~ected) with the vectors of this
invention which may be, ~or example, a cloning vector or an
expression vector. The vector may be, ~or example, in the
~orm of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modi~ied as appropriate ~or activating
promoters, selecting trans~ormants or amplifying the genes
o~ the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used
with the host cell selected ~or expression, and will be
apparent to the ordinarily skilled artisan.
The polynucleotides o~ the present invention may be
employed for producing polypeptides by rec~mh;n~t
techniques. Thus, ~or example, the polynucleotide may be
included in any one o~ a variety o~ expression vectors ~or
expressing a polypeptide. Such vectors include
chromosomal, non~hromosomal and synthetic DNA seqlPn~,
e.g., derivatives o~ SV40; ~acterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived ~rom
combinations o~ plasmids and phaye DNA, viral DNA such as
vaccinia, adenovirus, ~owl pox virus, and pseudora~ies.
However, any other vector may be used as lon~ as it is
replicable and viable in the host.
The d~LO~ iate DNA sequence may be inserted into the
vector by a variety o~ procedures. In general, the DNA
sequence is inserted into an d~LV~riate restriction
~n~nllClease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope o~
those skilled in the art.
The DNA sequence in the expression vector is
operatively linked to an appropriate expression control
sequence(s) (promoter) to direct mRNA synthesis. As
~ representative examples o~ such promoters, there may be
mentioned: LTR or SV40 promoter, the E. coli. lac or trp,
the phage ~ Amh~l~ PL promoter and other promoters known to
CA 02242908 1998-07-10
WO 97~5340 PCT~US9GtO01~
control expression of genes in prokaryotic or eukaryotic
cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation
and a transcription terminator. The vector may also
include a~riate sequences for amplifying expression.
In addition, the expression vectors preferably contain
one or more selectable marker genes to provide a phenotypic
trait ~or selection of trans~ormed host cells such as
dihydrofolate reductase or neomycin resistance for
eukaryotic cell culture, or such as tetracycline or ampi-
cillin resistance in E. coli.
The vector cont~i n~ ny the d~Lo~riate DNA sequence as
hereinabove described, as well as an appropriate promoter
or control sequence, may be employed to trans~orm an
appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there
may be mentioned: bacterial cells, such as ~. coli,
StreptomYces, S~m~nella tYPhimurium; fungal cells, such as
yeast; insect cells such as Droso~hila and S~odoptera Sf9;
~n~m~l cells such as CHO, COS or Bowes m~l~n~m~;
a~enovirus; plant cel~s, etc. The selection of an
appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
More particularly, the present invention also includes
recombinant constructs ~u,.,~isiny one or more o~ the
se~uences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of
this em~o~mp~t~ the construct further comprises regulatory
sequences, including, for example, a promoter, operably
linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and
are commercially available. The following vectors are
provided by way of example. Bacterial: pQE70, pQE60, pQE-9
(Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK,
pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a,
-14-
CA 02242908 1998-07-10
WO 97/25340 ~CTAJS~G~
pKK223-3, pKK233-3, pDR540, pRIT5 ~Pharmacia). Eukaryotic:
pWLNEO, pSV2CAT, pO~44, pXT1, pSG (Stratagene) p~VK3, pBPV,
pMSG, pSVL (Pharmacia) However, any other plasmid or
vector may be used as long as they are replicable and
viable in the host.
Promoter regions can be selected from any desired gene
using CAT (chlor~r~n~col transferase) vectors or other
vectors with selectable markers. Two appropriate vectors
are PKK232-8 and PCM7. Particular n~m~ bacterial
promoters include lacI, lacZ, T3, T7, gpt, lambda ~?R~ PL and
trp. ~ukaryotic promoters include CMV ~mm~ te early, HSV
thymidine kinase, early and late SV40, LTRs from
retrovirus, and mouse metallothionein-I. Selection o~ the
appropriate vector and promoter is well within the level o~
ordinary skill in the art.
In a ~urther embodiment, the present invention relates
to host cells contA~n~ng the above-described constructs.
The host cell can be a higher eukaryotic cell, such as a
m~m~lian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as
a bacterial cell. Introduction of the construct into the
host cell can be e~fected by calcium phosphate
trans~ection, DEAE-Dextran mediated trans~ection, or
electroporation. (Davis, L., Dibner, M., Battey, I., Basic
Methods in Molecular Biology, ~1986)).
The constructs in host cells can be used in a
conventional m~nn~ to produce the gene product encoded by
the recombinant se~uence. Alternatively, the polypeptides
of the invention can be synthetically produced by
conventional peptide synthesizers.
Mature proteins can be expressed in m~m-lian cells,
yeast, ~acteria, or other cells under the control of
d~riate promoters. ~ell-~ree translation systems can
also be employed to produce such proteins using RNAs
derived ~rom the DNA constructs o~ the present invention.
Appropriate cloning and expression vectors ~or use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory ~nll~l, Second
CA 02242908 1998-07-10
W O 97/25340 PCT~US96/00499
Edition, Cold Spring Harbor, N.Y., (1989), the disclo~ure
of which is hereby i~corporated by reference.
Transcription of the DNA encoding the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an ~nh~ncer seguence into the vector. Rnh~ncers
are cis-acting elements of DNA, usually about from 10 to
300 bp that act on a promoter to increase its
transcription. Examples including the SV40 ~nh~n~er on the
late side of the replication origin bp 100 to 270, a
cytomegalovirus early promoter ~nhAncer, the polyoma
~nh~n~er on the late side of the replication origin, and
adenovirus ~nh~ncers
~ enerally, recombinant expression vectors will includP
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
promoters can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase ~PGK), ~-factor,
acid phosphatase, or heat shock proteins, among others.
The heterologous structural se~uence is assembled in
a~l~riate phase with translation initiation and
termination se~l~nce~, and prefera~ly, a leader sequence
capable o~ directing secretion of translated protein into
the periplasmic space or extracellular medium. Optionally,
the heterologous se~uence can encode a fusion protein
including an N-terminal identification peptide imparting
desired characteristics, e.g., stAh;l~zation or simplified
purification of expressed recombinant product.
Useful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable reading
phase with a functional promoter. The vector will comprise
one or more phenotypic selectable markers and an origin of
replicAt~ on to ensure maintenance of the vector and to, if
desirable, provide amplification within the host Suitable
CA 02242908 1998-07-10
W O 97/25340 PCTAUS96/00499
prokaryotic hosts ~or trans~ormation include E. coli,
Bacillus subtilis, Salmonella tY~h~mllrium and various
species within the genera Psell~omnn~-~, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter o~ choice.
As a representative but nonl~m; ting example, useEul
expression vectors ~or bacterial use can comprise a
selectable marker and bacterial origin of replication
derived from commercially available plasmids comprising
genetic elements o~ the well known cloning vector pB~322
(ATCC 37017). Such commercial vectors include, ~or
example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala,
Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These
pBR322 "ba~-khon~" sections are c-~mhin~d with an a~:L~riate
promoter and the structural se~uence to be expressed.
Following trans~ormation o~ a suitable host strain and
growth o~ the host strain to an d~1o~liate cell density,
the selected promoter is induced by appropriate means
(e.g., temperature shi~t or chemical induction) and cells
are cultured ~or an additional period.
Cells are typical~y harvested by centri~ugation,
disrupted by physical or chemical means, and the resulting
crude extract retained ~or ~urther puri~ication.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including ~reeze-
thaw cycling, sonication, mechanical disruption, or u~e o~
cell lysing agents, such methods are well know to those
~killed in the art.
Various m~mm~l ian cell culture systems can also be
employed to express recombinant protein. Examples of
m~ n expression ~ystems include the COS-7 lines o~
monkey kidney ~ibroblasts, described by Gluzman, Cell,
23:175 ~1981), and other cell lines capable of expressing
a compatible vector, ~or example, the C127, 3T3, CH0, HeLa
and BHK cell lines. ~ ian expression vector~ will
compri~e an origin o~ replication, a suitable promoter and
enh~n~er, and also any necessary ribosome h~ n~ ng sites,
polyadenylation site, spliCe donor and acceptor sites,
CA 02242908 1998-07-10
WO 97/25340 PCTAUS96/00499 transcriptional termination sequences, and 5~ ~l ~nk~ ng
nontranscribed sequences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to
provide the required nontranscribed genetic el~m~nt~.
The ~-protein ch~m~kine receptor polypeptides can be
recovered and puri~ied from recombinant cell cultures by
methods including ~mmon~ um sulfate or ethanol
precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography,
hydropho~ic interaction chromatography, affinity
chromatography, hydroxylapatite chromatography and lectin
chromatography Protein re~olding steps can be used, as
necessary, in completing configuration of the mature
protein. Finally, high performance liquid chromatography
~HPhC) can be employed ~or final puri~ication steps.
The polypeptides of the present invention may be a
naturally puri~ied product, or a product o~ chemical
synthetic procedures, or produced by recnmh;n~nt techniques
~rom a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and m~mmAlian cells
in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-
glycosylated. Polypeptides of the invention may also
include an initial methionine amino acid residue.
The polynucleotides and polypeptides of the present
invention may be employed as research reagents and
materials ~or discovery of tr~tm~nts and diagnostics to
hllm~n disease.
The ~-protein ch~mok~ ne receptors of the present
invention may be employed in a process ~or screening for
c~--~ounds which activate (agonists) or inhibit activation
(antagonists) of the receptor polypeptide o~ the present
invention .
In general, such screening procedures involve
providing appropriate cells which express the receptor
polypeptide of the present invention on the surface
thereof. Such cells include cells from m~m~ yeast,
-18-
CA 02242908 1998-07-10
W O 97/25340 PCT~US96/00499
drosophila or E. Coli. In particular, a polynucleotide
encoding the recepto~ o~ the present invention is employed
to trans~ect cells to thereby express the G-protein
rh~mokine receptor. The expressed receptor is then
contacted with a test compound to observe hi nr~ing,
s~im~ tion or inhibition o~ a functional response.
One such screening procedure involves the use o~
melanophores which are trans~ected to express the G-protein
chemokine receptor of the present invention. Such a
screening technique is described in PCT WO 92/Q1810
published February 6, 1992.
Thus, ~or example, such assay may be employed ~or
screening ~or a compound which inhibits activation o~ the
receptor polypeptide o~ the present invention by contacting
the melanophore cells which encode the receptor with both
the receptor ligand and a compound to be screened.
Tnhi h; tion o~ the signal generated by the ligand indicates
that a compound is a pot~nt;~l antagonist for the receptor,
i.e., i nh; hi ts activation o~ the receptor.
The screen may be employed ~or determining a compound
which activates the receptor by contacting such cells with
compounds to be screened and determining whether such
compound generates a signal, i.e., activates the receptor.
Other screening techni~ues include the use o~ cells
which express the G-protein rh~m~kine receptor (~or
example, trans~ected CHO cells) in a system which measures
extracellular pH changes caused by receptor activation, for
example, as described in Science, volume 246, pages 181-296
(October 1989). For example, compounds may be contacted
with a cell which expresses the receptor polypeptide o~ the
present invention and a second messenger response, e.g.
signal transduction or pH changes, may ~e measured to
determine whether the potential compound activates or
- ;nhi~its the receptor.
Another such screening technique involves introducing
RNA encoding the G-protein ~h~mnki n~ receptor into X~nopus
oocytes to transiently express the receptor. The receptor
oocytes may then be contacted with the receptor ligand and
--19--
CA 02242908 1998-07-10
W O 97~5340 PCTrUS96/00499
a compound to be screened, followed by detection o~
inhibition or activation o~ a calcium signal in the case of
screening ~or compounds which are thought to inhibit
activation o~ the receptor.
Another screening technique involves expressing the G-
protein rh~mnk; n~ receptor in which the receptor is linked
to a phospholipase C or D. As representative examples of
such cells, there may be mentioned endoth~l ~Al cells,
smooth muscle cells, embryonic kidney cells, etc. The
screening may be accomplished as hereinabove described ~y
detecting activation o~ the receptor or i nhi h~ tion of
activation o~ the receptor ~rom the phospholipase second
signal.
Another method invol~es screening ~or compounds which
; nh; h; t activation o~ the receptor polypeptide o~ the
present invention by determining the inhibition o~ h,n~ing
of a labeled ligand to cells which have the receptor on the
sur~ace thereo~. Such a method comprises trans~ecting a
eukaryotic cell with DNA encoding the G-protein ch~mnkine
receptor of the present invention such that the cell
expresses the receptor on its sur~ace and cont~cting the
cell with a compound in the presence o~ a laheled ~orm of
a known ligand. The ligand can be labeled, e.g., hy
radioactivity. The amount of labeled ligand bound to the
receptors is measured, e.g., by measuring radioactivity o~
the receptors. I~ the compound binds to the receptor as
determ;n~ by a reduction o~ labeled ligand which binds to
the receptors, the h; n~;ng of~ la~eled ligand to the
receptor is ;nh; h; ted.
An Ant;hs~y may antagonize a G-protein chemok;n~
receptor o~ the present invention, or in some cases an
oligopeptide, which bind to the ~-protein ~hemokine
receptor but does not elicit a second messenger response
such that the activity of the G-protein ~h~mnk;ne receptors
is ~level~ted. Anti~odies include anti-idiotypic antibodies
which recognize uni~ue determ;n~nts generally associated
with the antigen-h; n~; ng site o~ an antibody. Potential
antagonist compounds also include proteins which are
-20-
,
CA 02242908 l998-07-lO
W O 97/2~340 PCT~US~ 19~
closely related to the ligand of the G-protein ch~m~kine
receptors, i.e. a fragment of the li-gand, which have lost
biological function and when binding to the G-protein
chem~kine receptor elicit no response.
An antisense construct prepared through the use o~
antisense technology, m~y be used to control gene
expression through triple-helix ~ormation or antisense DNA
or RNA, both of which methods are based on binding of a
polynucleotide to DNA or RNA. For example, the 5I coding
portion of the polynucleotide sequence, which encodes for
the m~ture polypeptides of the present invention, i8 used
to design an antisense RNA oligonucleotide of from about 10
to 40 base pairs in length. A DNA oligonucleotide is
designed to be compl~m~nt~y to a region of the gene
involved in transcription (triple helix -see Lee et al.,
Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science,
241:4~6 ~1988); and Dervan et al., Science, 251: 1360
(1991)), thereby preventing transcription and the
production of G-protein rh~m~kine receptor. The antisense
RNA oligonucleotide hybridizes to the mRNA in vivo and
blocks translation of mRNA molecules into G-protein coupled
receptor (antisense - Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene
~xpres~ion, CRC Press, Boca Raton, FL (1988)). The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed
tn vivo to i nht ht t production of G-protein ch~m~ktne
receptor.
A small molecule which binds to the G-protein
ch~okine receptor, making it inaccessible to ligands such
that normal biological activity is prevented, ~or example
small peptides or non-peptide antagonists, m~y also be used
to ; nh; h~ t activation of the receptor polypeptide of the
present invention.
A soluble form of the G-protein ch~mok~n~ receptor,
e.g. a ~ragment o~ the receptors, may be used to ; nh; h; t
activation of the receptor by b; n~; ng to the ligand to a
polypeptide of the present invention and preventing the
CA 02242908 1998-07-10
W O 97~5340 PCT~US96/00499
ligand ~rom interacting with membrane bound G-protein
ch~m~kine receptors.
The compounds which bind to and activate the G-protein
~hemnkine receptors o~ the present invention may be
employed to stimulate haematopoiesis, wound healing,
coagulation, angiogenesis, to treat tumors, chronic
in~ections, leukemia, T-cell mediated auto-;mmnn~ diseases,
parasitic in~ections, psoriasis, and to stimulate growth
~actor activity.
The compounds which bind to and inhibit the G-protein
chemokine receptors o~ the present invention may be
employed to treat alleryy, atherogenesis, ~nAphylaxis,
maliynancy, chronic and acute in~lammation, histAm~ne and
IgE-mediated allergic reactions, prostagl ~n~;n -independent
~ever, bone marrow ~ailure, silicosis, sarcoidosis,
rheumatoid arthritis, shock and hyper-eosinophilic
syndrome.
The compounds m~y be employed in combination with a
suitable pharmaceutical carrier Such compositions
comprise a therapeutically e~ective amount o~ the compound
and a pharmaceutically acceptable carrier or excipient.
Such a carrier includes but is not limited to saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The ~ormulation should suit the mode
o~ A~m; n t~tration.
The invention also provides a pharmaceutical pack or
kit comprising one or more cont~in~s ~illed with one or
more o~ the ingredients o~ the pharmaceutical composition~
o~ the invention. Associated with such cont~;n~s) can be
a notice in the ~orm prescribed by a governmental agency
regulating the manu~acture, use or sale o~ pharmaceutical~
or biological products, which notice re~lects approval ~y
the agency o~ manu~acture, use or sale ~or human
;n;~tration. In addition, the compounds of the present
invention may be employed in conjunction with other
therapeutic compounds.
The ~hArmAceutical compositions may be A~m~ n ~stered in
a convenient mAnn~ such as by the topical, intravenous,
-22-
CA 02242908 1998-07-10
W O 97/2~340 PCTAUS96/00499
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
~mi n~ stered in an amount which is e~ective ~or treating
and/or prophylaxis o~ the speci~ic indication. In general,
the pharmaceutical compositions will be ~mi n; stered in an
amount o~ at least about 10 ~g/kg body weight and in most
cases they will be ~mi n; stered in an amount not in excess
o~ about 8 mg/Kg body weight per day. In most cases, the
dosage is ~rom about 10 ~g/kg to about 1 mg/kg body weight
daily, taking into account the routes of ~m; n i ~tration,
symptoms, etc.
The soluble G-protein ch~mnkine receptor polypeptides
and antagonists or agonists which are polypeptides, may
also be employed in accordance with the present invention
by expression of such polypeptides in vivo, which is o~ten
re~erred to as "gene therapy."
Thus, ~or example, cells ~rom a patient may be
enyineered with a polynucleotide (DNA or RNA) encoding a
polypeptide OE vivo, with the engineered cells then beiny
provided to a patient to be treated with the polypeptide.
Such methods are wel~-known in the art For example, cells
may be engineered by procedures known in the art by use o~
a retroviral particle cont~in;ng RNA encoding a polypeptide
of the present invention.
Similarly, cells may be engineered in vivo ~or
expression o~ a polypeptide in vivo by, ~or example,
procedures known in the art. As known in the art, a
producer cell ~or producing a retroviral particle
cont~;ning RNA encoding the polypeptide of the present
invention may be ~min~stered to a patient ~or engineering
cells in vivo and expression o~ the polypeptide in vivo.
These and other methods ~or ~ministering a polypeptide o~
the present invention by such method should be apparent to
those skilled in the art from the teachings o~ the present
invention. For example, the expression vehicle ~or
- engineering cells may be other than a retrovirus, ~or
example, an adenovirus which may be used to engineer cells
in vivo a~ter cQ~hin~tion with a suitable delivery vehicle.
-23-
.
CA 02242908 1998-07-10
W O 97/25340 PCT~US~6~55
Retroviruses ~rom which the retroviral pla~mid vectors
hereina~ove mentioned may be derived include, but are not
limited to, Moloney Murine Leukemia Virus, spleen necrosis
virus, retroviruses such as Rous Sarcoma Virus, Harvey
Sarcoma Viru~, avian leukosis virus, gibbon ape leukemia
viru~, human ,mmllnode~iciency virus, adenovirus,
Myeloproli~erative Sarcoma Virus, and m~mmA~y tumor viru~.
In one embo~;m~nt, the retroviral plasmid vector is derived
~rom Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not
limited to, the retroviral LTR; the SV40 promoter; and the
hl~mAn cytomegalovirus (CMV) promoter described in Miller,
et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or
any other promoter (e.g., cellular promoters such as
eu~aryotic cellular promoters including, but not limited
to, the histone, pol III, and ~-actin promoter~). Other
viral promoters which may be employed include, but are not
limited to, adenovirus promoters, thymidine ki~ase (TK)
promoters, and Bl9 parvovirus promoters. The selection of
a suitable promoter will be apparent to those skilled in
the art from the teachings contained herein.
The nucleic acid se~uence encoding the polypeptide of
the present invention is under the control of a suitable
promoter. Suitable promoters which may be employed
include, but are not limited to, adenoviral promoters, such
as the adenoviral major late promoter; or hetorologous
promoters, such as the cytomegalovirus (CMV) promoter; the
respiratory syncytial virus (RSV) promoter; ~nAllc;hle
promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the
ApoAI promoter; human globin ~r ~--~oters; viral thymidine
kinase promoters, such as the Herpes Simplex thymidine
kinase promoter; retroviral LTRs (including the modi~ied
retroviral ~TRs her~nAhove described); the ~-actin
promoter; and human growth hormone promoters. The promoter
also may be the native promoter which controls the genes
encoding the polypeptides.
-24-
CA 02242908 1998-07-10
W O 97/25340 PCTAJS96/00499
The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples
o~ packaging cells which may be trans~ected include, but
are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-
14X, VT-19-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAm12, and DAN
cell lines as described in Miller, Human Gene Therapy, Vol.
1, pgs. 5-14 (199~), which is incorporated herein by
reference in its entirety. The vector may transduce the
packaging cells throuyh any means known in the art. Such
means include, but are not limited to, electroporation, the
use o~ liposomes, and CaP04 precipitation. In one
alternative, the retroviral plasmid vector m y be
encapsulated into a liposome, or coupled to a lipid, and
then ~m~n~stered to a host.
The producer cell line generates infectious retroviral
vector particles which include the nucleic acid se~uence~s)
encoding the polypeptides. Such retroviral vector
particles then may be employed, to transduce eukaryotic
cells, either in vitro or in vivo. The transduced
eukaryotic cells will express the nucleic acid sequence(s)
encoding the polypeptide. Eukaryotic cells which may be
transduced include, but are not limlted to, embryonic stem
cells, embryonic carc;nnm~ cells, as well as hematopoietic
stem cells, hepatocytes, ~ibroblasts, myoblasts,
keratinocytes, endoth~ l cells, and bron~h~l epith~li~l
cells.
The present invention also provides a method ~or
determin; ng whether a ligand not known to be cAp~hle o~
h;n~l;ng to a G-protein rh-~mnkine receptor can bind to such
receptor which comprises contacting a m~ n cell which
expresses a G-protein ~h~mnkine receptor with the ligand
under conditions permitting binding o~ ligands to the G-
protein rhem~kine receptor, detecting the presence o~ a
ligand which binds to the receptor and thereby determ;n;ng
whether the ligand binds to the G-protein rh~m~kine
~ receptor. The systems hereinabove described ~or
determ;n;ng agonists and/or antagonists m~y also be
-25-
.
CA 02242908 1998-07-10
W O 97~5340 PCT~US96/00499
employed ~or determt ni ng ligands which bind to the
receptor. - -
This invention also provides a method of detectingexpression of a G-protein ~h~m~k~ne receptor polypeptide of
the present invention on the sur~ace o~ a cell by detecting
the presence of mRNA coding for the receptor which
comprises obt~;n~ng total mRNA ~rom the cell and contacting
the mRNA so obtained with a nucleic acid probe comprising
a nucleic acid molecule of at least 10 nucleotides capable
of speci~ically hybridizing with a sequence included within
the sequence of a nucleic acid molecule encoding the
receptor under hybridizing conditions, detecting the
presence o~ mRNA hybridized to the probe, and thereby
detecting the expression o~ the receptor by the cell.
The present invention also provides a method ~or
identifying receptors related to the receptor polypeptides
of the present invention. These related receptors may be
i~nt; fied by homology to a G-protein chemokine receptor
polypeptide o~ the present invention, by low stringency
cross hybridization, or by identi~ying receptors that
interact with related natural or synthetic ligands and or
elicit s~mt 1~ behaviors after genetic or pharmacological
blockade o~ the ~-hl~m~k~ ne receptor polypeptides of the
present invention.
The present invention also contemplates the use of the
gene of the present invention as a diagnostic, ~or example,
some diseases result from inherited defective gene . These
genes can be detected by comparing the se~l~nce~ of the
de~ective gene with that of a normal one. Subsequent~y,
one can ve~ify that a 'imutant" gene is associated with
a~normal receptor activity. In addition, one can insert
mnt~nt receptor genes into a suitable vector for expression
in a ~unctional assay system (e.g., colorimetric assay,
expression on MacConkey plates, compl~m~nt~tion
exper~nt~, in a receptor deficient strain of ~EK293
cell~) as yet another means to verify or identi~y
mutations. Once ~Imutant~ genes have been identified, one
-26-
. .
CA 02242908 1998-07-10
W O 97/25340 PCT~US~6/C~~9~
can then screen population ~or carriers o~ the "mllt~nt"
receptor gene.
Individuals carrying mutations in the gene o~ the
present invention may be detected at the DNA level by a
variety o~ techniques. Nucleic acids used ~or diagnosis
may be obtained ~rom a patient~s cells, including but not
limited to such as ~rom blood, urine, saliva, tissue biopsy
and autopsy material. The genomic DNA may be used directly
~or detection or may be amplified enzymatically by using
PCR (Saiki, et al., Nature, 324:163-166 1986) prior to
analysis. RNA or cDNA may also be used ~or the same
purpose. As an example, PCR primers compl~m~nt~y to the
nucleic acid o~ the instant invention can be used to
identi~y and analyze mutations in the gene of the present
invention. For example, deletions and insertions can be
detected by a change in size o~ the ampli~ied product in
comparison to the nonmal genotype. Point mutations can be
identi~ied by hybridizing ampli~ied DNA to radio labeled
RNA o~ the invention or alternatively, radio labeled
antisense DNA sequences of the invention. Perfectly
matched se~l~nc~s can be distinguished ~rom m; ~m~tched
duplexes by RNase A digestion or by di~erences in melting
temperatures. Such a diagnostic would be particularly
use~ul ~or prenatal or even n~on~tal testinq.
Sequence differences between the re~erence gene and
~lm~ ntS~ may be revealed by the direct DNA se~lPn~ ng
method. In addition, cloned DNA segments may be used as
probes to detect speci~ic DNA se~m~nt~. The sensitivity o~
this method is greatly Pnh~n~A when combined with PCR.
For example, a sequence primer is used with double str~n~
PCR product or a single str~n~e~ template molecule
generated by a modi~ied PCR. The sequence determination is
per~ormed by conventional procedures with radio labeled
nucleotide or by an automatic se~l~nc~ng procedure with
~luorescent-tags.
Genetic testing based on DNA sequence di~erences may
be achieved by detection o~ alterations in the
electrophoretic mobility o~ DNA ~ragments in gels with or
-27-
-
CA 02242908 1998-07-10
W O 97/25340 PCT~US96/00499
without denaturing agents. Sequences changes at speciEic
locations may also -be revealed by nucleus protection
assays, such RNase and S1 protection or the chemical
cleavage method ~e.g. Cotton, et al., PNAS, USA, 85:4397-
4401 1985).
In addition, some diseases are a result o~, or are
characterized by changes in gene expression which can be
detected by changes in the mRNA. Alternatively, the genes
o~ the present invention can be used as a re~erence to
identify individuals expressing a decrease of ~unctions
associated with receptors o~ this type.
The present invention also relates to a diagnostic
assay ~or detecting altered levels of soluble ~orm o~ the
G-protein ~h~m~k; n~ receptor polypeptides o~ the present
invention in various tissues. Assays used to detect le~els
o~ the soluble receptor polypeptides in a ~ample derived
~rom a host are well known to those o~ skill in the art and
include radio;mmnno~ssays, competitive-b~ nAing assays,
Western blot analy~is and preferably as ELISA as~ay.
An ELISA assay initially comprises preparing an
antibody speci~ic to antigens o~ the G-protein ~h~mokine
receptor polypeptides, pre~erably a monoclonal anti~ody.
In addition a reporter ~nt; hody is prepared against the
monoclonal antibody. To the reporter antibody is attached
a detectable reagent such as radioactivity, ~luorescence or
in this example a horseradish peroxidase enzyme. A sample
is now le,~oved ~rom a host and incubated on a solid
support, e.g. a polystyrene dish, that binds the proteins
in the ~ample. Any ~ree protein hi n~; ng sites on the dish
are then covered by incubating with a non-speci~ic protein
such as bovine serum albumin. Next, the monoclonal
~nt; h~dy is incu-hated in the dish during which time the
monoclonal antibodies attach to any G-protein ~hem~kine
receptor proteins attached to the polystyrene dish. All
unbound monoclonal ~nt;hody is washed out with bu~er. The
reporter antibody l; nk~ to horseradish peroxidase is now
placed in the dish resulting in h; n~ ng of the reporter
~nt; h~Ay to any monoclonal ~nt; hody bound to G-protein
- --28--
CA 02242908 1998-07-10
W O 97/2S340 PCT~US96100499 rhF.m~k; n~ receptor proteins. Unattached reporter antibody
is then washed out. Peroxidase substrates are then added
to the dish and the amount of color developed in a given
time period is a measurement of the amount o~ G-protein
ch~mokine receptor proteins present in a given volume o~
patient sample when compared against a st~n~A~d curve.
The se~uences o~ the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a
particular location on an individual human chromosome.
Moreover, there is a current need for identifying
par~icular sites on the chromosome. Few chromosome mar~ing
reagents based on actual se~uence data (repeat
polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first
step in correlating those sequences with genes associated
with disease.
Briefly, se~l~nc~ can be mapped to chromosomes by
preparing PCR primers (pre~erably 1~-25 bp) from the cDNA.
Computer analysis of the cDNA is used to rapidly select
primers that do not span more than one exon in the genomic
DNA, thus complicating the ampli~ication process. These
pri~ers are then used ~or PCR screening o~ somatic cell
hybrids cont~tn~ng individual hnm~n chromosomes. Only
those hybrids cont~n;ng the hllm~n gene corresponding to
the primer will yield an amplified ~ragment.
PCR mapping of somatic cell hybrids is a rapid
procedure for assigning a particular DNA to a particular
chromosome. Using the present invention with the same
oligonucleotide primers, sublocalization can be achieved
with r~nels o~ ~ra~ments from specific chromosomes or pools
of large genomic clones in an analogous m~nn~r, Other
mapping strategies that can similarly be used to map to it~
cl~. r~ include in situ hybridization, prescreening with
labeled flow-sorted chromosomes and preselection by
hybridization to construct chromosome speci~ic-cDNA
libraries.
' -29-
CA 02242908 1998-07-10
W O 97/25340 PC~US~G/C~199
Fluorescence in situ hy~ridization (FIS~) o~ a cDNA
clone to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 50 or 60 bases.
For a review of this technique, see Verma et al., ~l~m~n
Chromosomes: a ~nll~ 1 of Basic Techniques, PeLydll~oll Press,
New York (1988).
Once a sequence has been mapped to a precise
chromosomal location, the physical position of the seque~ce
on the chromosome can be correlated with genetic map data.
Such data are found, for example, in V. McKusick, M~n~lian
Inheritance in Man (aV~ hl e on line through ~ohns Hopkins
University Welch Medical Library). The relationship
between genes and diseases that have been mapped to the
same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes~.
Next, it is necessary to determine the di~ferences in
the cDNA or genomic sequence between a~ected and
una~ected individuals. I~ a mutation is observed in some
or all of the a~ected individuals but not in any normal
individuals, then the mutation is likely to be the
causative agent o~ the disease.
With current resolution of physical ~apping and
genetic mapping techniques, a cDNA precisely localized to
a chromosomal region associated with the disease could be
one of between 50 and 500 potential causative senes. (This
assumes 1 meyabase mapping resolution and one gene per 20
kb).
The polypeptides, their ~ra~m~nts or other
derivatives, or analogs thereo~, or cells expressing them
can be used as an i~m~lnogen to produce anti~odies thereto.
These antibodies can be, for example, polyclonal or
monoclonal ~n~;hodies The present invention also includes
~him~ric, gingle chain, and hllm~nized antibodies, as well
as Fab ~La~J~ ts~ or the product o~ an Fab expression
library. Various procedures known in the art may be used
for the production of such antibodies and fragment~.
- -30-
CA 02242908 1998-07-10
W O 97/2~340 PCT~US9G/00~
Antibodies generated again~t the polypeptides
corresponding to a sequence o~ the present invention can be
obtained by direct injection o~ the polypeptides into an
~n~m~l or by ~m1 n; stering the polypeptides to an ~nim~l,
preferably a nonhl~m~n. The antibody so obtained will then
bind the polypeptides itsel~. In this m~nn~r, even a
sequence encoding only a ~ragment o~ the polypeptides can
be used to generate ~nt;~odies binding the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide ~rom tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any
technique which provides antibodies produced by continuous
cell line cultures can be used. Examples include the
hybridoma technique (Kohler and Milstein, 1975, Nature,
256:495-497), the trioma technique, the hllm~n B-cell
hybridoma technique ~Kozbor et al., 1983, Tmmllnology Today
4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies ~Cole, et al., 1985, in Monoclonal
Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-
96).
Techniques described for the production o~ single
chain antibodies (U.S. Patent 4,946,778) can be adapted to
produce single chain ant;bc)A; es to immllnogenic polypeptide
products o~ this invention. Also, transgenic mice may be
used to express hllm~n1zed antibodies to ;~mllnogenic
polypeptide products o~ this invention.
The above-described antibodies may be employed to
i~olate the polypeptide o~ the present invention by
atta~hmPnt o~ the antibody to a solid SU~OLL and
per~orming a~inity chromatography by passing the
polypeptide desired to be puri~ied over the column and
recovering the puri~ied polypeptide.
The present invention will be ~urther described with
re~erence to the ~ollowing examples; however, it is to be
understood that the present invention is not limited to
such examples. All parts or amounts, unless otherwise
speci~ied, are by weight.
CA 02242908 1998-07-10
WO 97/25340 PC~fUS96/00499 In order to ~acilitate underst~n~ng o~ the ~ollowing
examples certain ~re~ently occurring methods and/or terms
will be described.
~ 'Plasmidsl' are designated by a lower case p preceded
and/or ~ollowed by capital letters and/or numbers. The
starting plasmids herein are either commercially available,
publicly available on an unrestricted basis, or can be
constructed ~rom available plasmids in accord with
published procedures. In addition, equivalent plasmids to
those described are known in the art and will be apparent
to the ordinarily skilled artisan.
"Digestion" o~ DNA refers to catalytic cleavage o~ the
DNA with a restriction enzyme that acts only at certain
~equences in the DNA. The various restriction enzymes used
herein are c~mm~rcially available and their reaction
conditions, co~actors and other requirements were used as
would be known to the ordinarily skilled artisan. For
analytical purposes, typically 1 ~g o~ plasmid or DNA
~ragment is used with a~out 2 units o~ enzyme in about 20
~1 o~ bu~er solution. For the purpose of isolating DNA
~ragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 units o~ enzyme in a
larger volume. Appropriate bu~ers and substrate amounts
~or particular restriction enzymes are speci~ied by the
manu~acturer. Incubation times o~ about 1 hour at 37 C are
ordinarily used, but may vary in accordance with the
supplier's instructions. A~ter digestion the reaction is
electrophoresed directly on a polyacrylamide gel to isolate
the desired ~ragment.
Size separation o~ the cleaved ~r~gm~n~c is per~ormed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 ~1980).
"Oligonucleotides" re~ers to either a single str~n~
polydeoxynucleotide or two complementary
polydeoxynucleotide strands which may be chemically
synthesized. Such synthetic oligonucleotides have no 5'
phosphate and thus will not ligate to another
oligonucleotide without adding a phosphate with an ATP in
-32-
CA 02242908 1998-07-10
W O 97/25340 PCTAJS96/00499
the presence of a kinase. A synthetic oligonucleotide will
ligate to a ~ragment that has not been dephosphorylated.
'ILigation~ re~ers to the process of ~orming
phosphodiester bonds between two double stranded nucleic
acid fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation may be accomplished using
known bu~fers and conditions with 10 units to T4 DNA ligase
(nligase") per 0.5 ~g o~ approximately equimolar amounts of
the DNA fragments to be ligated.
Unless otherwise stated, trans~ormation was performed
as described in the method of Graham, F. and Van der Eb,
A., Virology, 52:456-457 ~1973).
Exam. ple
Bacterial ExPression and Purification o~ HSATU68
The DNA sequence encoding for HSATU68, ATCC # 97334 is
initially amplified using PCR oligonucleotide primers
corresponding to the 5' and se~l~nr~s of the proces~ed
HSATU68 protein (minus the signal peptide sequence) and the
vector sequences 3' to the HSATU68 gene. Additional
nucleotides correspon~ng to HSATU68 were added to the 5'
and 3' sequences respectively. The 5' oligonucleotide
primer has the sequence 5' CGGGA~ ~CATGGAGTTGAGGAAGTAC 3~
~SEQ ID NO:3) contains a BamHI restriction enzyme site
~ollowed by 18 nucleotides of HSATU68 coding se~uence
starting ~rom the presumed terminal amino acid of the
protein. The 3' sequence 5' GGCGGATCCCGCTCACAAGCCCGAGTAGGA
3' (SEQ ID NO:4) rnnt~n~ compl~m~nt~ry sequences to a
BamHI site and is ~ollowed by 18 nucleotides o~ HSATU68
coding sequence. The restriction enzyme sites correspond
to the restriction enzyme sites on the bacterial expression
vector pQ~-9 (Qiagen, Inc., Chatsworth, CA, 91311). pQE-9
encodes antibiotic resistance (~mpr), a bacterial origin of
~ replication (ori), an IPTG-regulatable promoter operator
(P/O), a ribosome htn~;ng site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 was then digested with
BamHI. The ampli~ied seguences were ligated into pQE-9 and
were inserted in ~rame with the sequence encoding for the
-33-
CA 02242908 1998-07-10
WO 97/2534Q PCT~US96100499 histidine tag and the RBS. The ligation mix~ure was then
used to transfonm E.-coli ~train M15/rep 4 (Qiagen, Inc.)
by the procedure described in Sambrook, J. et al.,
Molecular Cloning: A Laboratory ~nl7~-, Cold Spring
Laboratory Pre~s, (1989). M15Jrep4 cont~tn~ multiple
copies o~ the plasmid pREP4, which expresses the lacI
repressor and also con~ers kanamycin resistance (Kanr).
Transformants are identified by their ability to grow on ~B
plates and ampicillin/kanamycin resistant colonies were
selected. Plasmid DNA was isolated and confirmed by
restriction analysis. Clones cont~;n~ng the desired
constructs were grown overnight (O/N) in liquid culture in
LB media supplemented with both Amp (100 ug/ml) and Kan (25
ug/ml). The O/N culture is used to inoculate a large
culture at a ratio o~ 1:100 to 1:250. The cells were grown
to an optical density 600 (o~D~6~) o~ between 0.4 and 0.6.
IPTG (nIsopropyl-B-D-thiogalacto pyranoside") was then
added to a ~inal concentration o~ 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading
to increased gene expression. Cell~ were grown an extra 3
to 4 hours. Cells were then harvested by centrifugation.
The cell pellet was solubilized in the chaotropic agent 6
Molar Guanidine HCl. A~ter clari~ication, solubilized
HSATU68 was puri~ied ~rom this solution by chromatography
on a Nickel-Chelate column under conditions that allow for
tight binding by proteins cont~ntng the 6-His tag
(Hochuli, E. et al., ~. Chromatography 411:177-184 (1984)).
HSATU68 was e}uted from the column in 6 molar guanidine HCl
pH 5.0 and ~or the purpose o~ renaturation adjusted to 3
molar ~l~n;~;ne HCl, lOOmM sodium phosphate, 10 mmolar
glutathione (reduced) and 2 mmolar glutathione (oxidized).
A~ter tncl~h~tion in this solution for 12 hours the protein
was dialyzed to 10 mmolar sodium phosphate.
~xam~le 2
~xDression o~ Recombinant HSATU68 in COS cells
The expression o~ plasmid, HSATU68 HA is derived ~rom
a vector pcDNAI/Amp (Invitrogen) con~;n~n~ 1) SV40
-34-
CA 02242908 1998-07-10
W 097/25340 PCT~US96/00499 oriyin o~ replication, 2) ampicillin resistance gene, 3)
E.coli replication origin, 4) CMV promoter ~ollowed by a
polylinker region, a SV40 intron and polyadenylation site.
A DNA ~ragment encoding the entire HSATU68 precursor and a
HA tag ~used in ~rame to its 3' end was cloned into the
polylinker region o~ the vector, there~ore, the recom~inant
protein expression is directed under the CMV promoter. The
HA tag correspond to an epitope derived from the in~luenza
hemagglutinin protein as previously described (I. Wilson,
H. Niman, R. Heighten, A Cherenson, M. Connolly, and R.
1erner, 1984, Cell 37, 767). The in~usion of HA tag to the
target protein allows easy detection of the recombinant
protein with an ~nt ~hody that recognizes the HA epitope.
The plasmid construction strategy is described as
~ollows:
The DNA sequence encoding ~or HSATU68, ATCC # 97334,
was constructed by PCR using two primers: the 5' primer 5'
GTCC
AAGCTTGCCACCATGGAGTT~7~GTAC 3' (SBQ ID NO:5) and
contains a HindIII site ~ollowed by 18 nucleotides of
HSATU68 coding sequence starting ~rom the initiation codon
~u n d e r l i n e d) ; t he 3 ' s e q u e n c e 5 '
CTGCTCGAGTCAAGCGTA~ ~ GA~ ~lAl~ w l~AGCACA
AGCCCGAGTAGGA 3' (SEQ ID NO:6) cont~n~ compl~men~y
sequences to an XhoI site, translation stop codon, HA tag
and the last 15 nucleotides o~ the HSATU68 coding sequence
(not including the stop codon). There~ore, the PCR product
cont~n~ a HindIII site HSATU68 coding sequence ~ollowed by
HA tag fused in frame, a tran~lation termination stop codon
next to the HA tag, and an XhoI site. The PCR ampli~ied
DNA ~ragment and the vector, pcDNAI/Amp, were digested with
HindIII and XhoI restriction enzyme and ligated. The
ligation mixture was trans~ormed into E. coli strain SURE
(Stratagene Cloning Systems, La Jolla, C~ 92037) the
trans~ormed culture was plated on ampicillin m~; ~ plates
and resistant colonies were selected. Plasmid DNA was
isolated from transformants and ~mi n~ by restriction
analysis ~or the presence Of the correct fragment. For
- -35-
CA 02242908 1998-07-10
W O 9712~340 PCTrUS96/00499
expression o~ the recombinant HSATU68, COS cell~ were
transfected with the expression vector by DEAE-DEXTRAN
method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular
Cloning: A Laboratory ~Anll~l, Cold Spring Laboratory Press,
(1989)). The expression o~ the HSATU68 HA protein was
detected by radiolabelling and ~mm~lnoprecipitation method
(E. Harlow, D. Lane, ~nt~hodies: A Laboratory ~nll~l, Cold
Spring Harbor Laboratory Press, (1988)). Cells were
labelled for 8 hours with 35S-cysteine two days post
trans~ection. Culture media were then collected and cells
were lysed with detergent (RIPA buf~er (150 mM NaCl, 1~ NP-
40, 0.1~ SDS, 1~ NP-40, 0.5~ DOC, 50mM Tris, pH 7.5)
(Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate
and culture media were precipitated with a HA speci~ic
monoclonal antibody. Proteins precipitated were analyzed
on 15~ SDS-PAGE gels.
E~ample 3
Cloninq and exPression o~ HSATU68 usinq the baculovirus
exPression system
The DNA sequence encoding the ~ull length HSATU68
protein, ATCC # 97334, was ampli~ied using PCR
oligonucleotide primers corresponding to the 5~ and 3
se~uences o~ the gene:
The 5~ primer has the sequence 5' CGGGATCCCTCCC
ATGGAGTTGAGGAAGTAC 3' (SEQ ID NO:7) and cont~;n~ a BamHI
restriction enzyme site ~ollowed by 5 nucleotides
resemhl1 ng an e~icient signal ~or the initiation o~
translation in eukaryotic cells (J. Mol. Biol. 1987, 196,
947-g50, Kozak, M.), and just behind the ~irst 6
nucleotides o~ the HSATU68 gene (the initiation codon ~or
translation is "ATG"). The 3' primer has the sequence 5'
CGGGATCCCGCTCACAAGCCCGAGTAGGA 3' (SEQ ID NO:8) and contains
the cleavage site ~or the restriction Pn~nl~clease BamHI
and 18 nucleotides c~mplem~nt~ry to the 3' non-tran~lated
se~uence o~ the HSATU68 gene. The ampli~ied se~uences were
isolated ~rom a 1~ agarose gel using a commercially
available kit ('IGeneclean,'' BIO 101 Inc., La Jolla, Ca.).
- -36-
CA 02242908 l998-07-lO
W O 97/25340 PCT~US~ 159
The ~ragment was then digested with the ~n~nllclease BamHI
and purified as described above.- This fragment is
designated F2.
The vector pRG1 (modification of pVL941 vector,
discussed below) is used for the expression of the HSATU68
protein using the baculovirus expression system ~for review
see: Summers, M.D. and Smith, G.E. 1987, A mAnn~l of
methods for baculovirus vectors and insect cell culture
procedures, Texas Agricultural Exper~mPntAl Station
Bulletin No. 1555). This expression vector cont~in~ the
strong polyhedrin promoter of the Autographa cali~ornica
nuclear polyhedrosis virus (AcMNPV) ~ollowed by the
recognition sites for the restriction ~n~onllclease BamHI.
The polyadenylation site of the simian virus SV40 is used
for efficient polyadenylation. For an easy selection of
recombinant viruses the beta-galactosidase gene from E.
coli is inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at
~oth sides by viral seguences for the cell-mediated
homologous recombination of co-transfected wild-type viral
DN~. Many other baculovirus vectors could be used in place
of pR&1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and
Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction enzyme
BamHI and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was
then isolated from a 1~ agarose gel as described above.
This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were
ligated with T4 DNA ligase. E. coli B 101 cells were then
trans~ormed and bacteria ~nt; ~ied that cont~ n~ the
plasmid (pBacHSATU68) with the HSATU68 gene using the
enzyme BamHI. The sequence of the cloned fragment was
confirmed by DNA se~l~ncin~.
- 5 ~g of the plasmid pR~r~TU68 were co-transfected
with 1.O ~g of a ~n~mP~cially av~ hle linp~ized
bacu30virus ("BaculoGold~ baculovirus DNA", Pharmingen, San
CA 02242908 l998-07-lO
WO 97/25340 PCT~US9G/00199 Diego, CA.) using the lipofection method ~Felgner et al.
Proc. Natl. Acad. Sci. USA, 84:7413-7417 ~1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid
pBacHSATU68 were mixed in a sterile well of a microtiter
plate contA;n;ng 50 ~l o~ serum free Grace's medium (Li~e
Technologies Inc., Gaithersburg, MD) Afterwards 10 ~l
Lipofectin plus 90 ~l Grace's medium were added, mi~ and
incubated _or 15 minutes at room temperature. Then the
transfection mixture was added drop wise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture
plate with 1 ml Grace' medium without serum. The plate was
rocked back and forth to mix the newly added solution. The
plate was then incubated for 5 hours at 27~C. A~ter 5
hours the trans~ection solution was Lel-l~ved from the plate
and 1 ml o~ Grace's insect medium supplemented with 10~
~etal cal~ serum was added. The plate was put back into an
incubator and cultivation continued at 27~C ~or ~our days.
After four days the supernatant was collected and a
pla~ue assay performed sim;l~ as described by Summers and
Smith ~supra). As a modification an agarose gel with "Blue
Gal~ (Life Technologies Inc., Gaithersburg) was used which
allows an easy isolation of blue st~ n~ plaques. (A
detailed description o~ a "pla~ue assay~ can also be ~ound
in the user's guide ~or insect cell culture and
baculovirology distributed by Life Technologies Inc.,
Gaithersburg, page 9-10).
Four days after the serial dilution, the viruses were
added to the cells and blue st~;ne~ pla~ues were picked
with the tip of an ~ppendor~ pipette. The agar contAinin~
the recombinant viruses was then resuspended in an
- ~ppendorf tube c~ntAtnin~ 200 ~l of Grace's medium. The
agar was ~ ~ved by a brief centrifugation and the
supernatant contA~nin~ the recomhin~nt baculoviruses was
used to infect Sfg cells seeded in 35 mm dishes. Four days
later the supernatants of these culture ~1;~:h~ : were
harvested and then stored at 4~C.
Sf9 cells were grown in Grace's medium supplemented
with 10~ heat-inactivated FBS. The cells were infected
-38-
CA 02242908 l998-07-lO
W O 97/25340 PCT~US~G/0019~
with the recombinant baculo~irus v-HSATU68 at a
multiplicity o~ in~ection (MOI) of 2-. Six hours later the
medium was removed and replaced with SF900 II medium minus
methionine and cysteine ~Li~e Technologies Inc.,
Gaithersburg). 42 hours later 5 ~Ci o~ 35S-methionine and
5 ~Ci 35S cysteine ~Amersham) were added. The cells were
~urther incubated ~or 16 hours before they were harvested
by centri~ugation and the labelled proteins visualized by
SDS-PAG~ and autoradiography.
~xam~le 4
Expression via Gene TheraPy
Fibroblasts are obt~; neA from a subiect by skin
biopsy. The resulting tissue is placed in tissue-culture
medium and separated into small pieces. Small chunks o~
the tissue are placed on a wet sur~ace o~ a tissue culture
~lask, approximately ten pieces are placed in each flask.
The ~lask is turned upside down, closed tight an~ le~t at
room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks o~ tissue
remain ~ixed to the bottom o~ the ~lask and ~resh media
(e.g., Ham's F12 m~; ~ , with 10% FBS, penicillin and
streptomycin, is added. This is then incubated at 37~C ~or
approximately one week. At this time, ~resh m~tA is added
and subsequently changed every several days. A~ter an
additional two weeks in culture, a monolayer o~ ~ibroblasts
emerge. The monolayer is trypsinized and scaled into
larger ~lasks.
pMV-7 (Kir~chmeier, P.T. et al, DNA, 7:219-25 (1988)
~ nke~ by the long terminal repeats o~ the Moloney murine
sarcoma virus, is digested with EcoRI and HindIII and
subsequently treated with cal~ intestinal phosphatase. The
l~neAr vector is ~ractionated on agarose gel and puri~ied,
using glass beads.
The cDNA encoding a polypeptide o~ the present
invention is ampli~ied using PCR primers which correspond
to the 5' and 3' end se9uences respectively. The 5' primer
contA;n~ an EcoRI site and the 3' primer cnntA~n~ a HindIII
-39-
CA 02242908 1998-07-10
WO 97/25340 PCT/US96/00499
site. ~qual quantities o~ the Moloney murine sarcoma virus
1 ,ne~ backbone and the ~coRI and-HindIII ~ragment are
added toyether, in the presence o~ T4 DNA ligase. The
resulting mixture is maintA~ne~ under conditions
appropriate ~or ligation of the two ~r~m~nt~ The
ligation mixture i5 used to trans~orm bacteria HB101, which
are then plated onto agar-ront~tning kanamycin ~or the
purpose o~ con~irming that the vector had the gene o~
interest properly inserted.
The amphotropic pA317 or GP~aml2 packaging cells are
grown in tissue culture to con~luent density in Dulbecco's
Modi~ied ~agles Medium (DMEM) with 10% cal~ serum (CS),
penicillin and streptomycin. The MSV vector c~n~;n~ng the
gene is then ~e~ to the media and the packaging cells are
transduced with the vector. The packaging cells now
produce in~ectious viral particles cont~ning the gene (the
packaging cells are now re~erred to as producer cells).
Fresh m~ iS ~lAetl to the transduced producer cells,
and subsequently, the media is harvested from a 10 cm plate
o~ con~luent producer cells. The spent media, ~ont~n~ng
the in~ectious viral particles, is ~iltered through a
millipore ~ilter to remove detached producer cells and this
media is then used to in~ect ~ibroblast cells. Media is
le..lo~ed ~rom a sub-con~luent plate o~ fibroblasts and
quickly replaced with the media ~rom the producer cells.
This media is removed and replaced with fresh media. If
the titer o~ virus is high, then virtually all ~ibroblasts
will be in~ected and no selection is required. I~ the
titer is very low, then it is necessary to use a retroviral
vector that has a selectable marker, ~uch as neo or his.
- The engineered ~ibroblasts are then injected into the
host. The ~ibroblasts now produce the protein product.
Numerous modi~ications and variations o~ the present
invention are possible in light o~ the above t~h~ngs and,
therefore, within the scope o~ the appended claims, the
invention may be practiced otherwise than as particularly
described.
-40-
