Note: Descriptions are shown in the official language in which they were submitted.
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
obesity Protein Formulations
This application claims the benefit of U.S.
Provisional Application No. 60~010,257, filed January 19,
1996.
The present invention is in the field of human
medicine, particularly in the treatment of obesity and
disorders associated with obesity. More specifically, the
present invention relates to formulations of an obesity
protein analog.
Obesity, and especially upper body obesity, is a
common and very serious public health problem in the United
States and throughout the world. According to recent
statistics, more than 25% of the United States population and
27% of the Canadian population are overweight. Kuczmarski,
Amer. J. of Clin. Nutr. 55: 495S - 502S (1992); Reeder et.
al., Can. Med. Ass. J., 23: 226-233 ~1992). Upper body
obesity is the strongest risk factor known for type II
diabetes mellitus, and is a strong risk factor for
cardiovascular disease and cancer as well. Recent estimates
for the medical cost of obesity are $150,000,000,000 world
wide. The problem has become serious enough that the surgeon
general has begun an initiative to combat the ever increasing
adiposity rampant in American society.
Much of this obesity induced pathology can be
attributed to the strong association with dyslipidemia,
hypertension, and insulin resistance. Many studies have
demonstrated that reduction in obesity by diet and exercise
reduces these risk factors dramatically. Unfortunately,
these treatments are largely unsuccessful with a failure rate
reaching 95%. This failure may be due to the fact that the
condition is strongly associated with genetically inherited
factors that contribute to increased appetite, preference for
highly caloric foods, reduced physical activity, and
increased lipogenic metabolism. This indicates that people
inheriting these genetic traits are prone to becoming obese
regardless of their efforts to combat the condition.
CA 02243~18 1998-07-l~
WO97/26011 P~T~S97/OOS68
-- 2 --
There~ore, a pharmacological agent that can correct this
adiposity handicap and allow the physician to success~ully
treat obese patients in spite o~ their genetic inheritance is
needed.
The ob/ob mouse is a model o~ obesity and diabetes
that is known to carry an autosomal recessive trait linked to
a mutation in the sixth chromosome. Recently, Yiying Zhang
and co-workers published the positional cloning of the mouse
gene linked with this condition. Yiying Zhang et al. Nature
372: ~25-32 (1994). This report disclosed the murine and
human protein expressed in adipose tissue. ~ikewise,
Murakami et al., in Biochemical and Bio~hvsical Research
Communications 209(3):944-52 (1995) report the cloning and
expression of the rat obese gene. The protein, which is
encoded by the ob gene, has demonstrated an ability to
effectively regulate adiposity in mice. Pelleymounter et
al., Science 269: 540-543 (1995).
A parenteral formulation containing insoluble
protein causes problems relating to inconsistency in the
dose-response as well as unpredictability. The
unpredictability is believed to be due to greater variability
in the pharamacokinetics in suspension ~ormulations. The
insoluble ~ormulations must ~irst dissolve prior to
adsorption. It is hypothesized that this step has
signi~icant variability in a subcutaneous depot.
Furthermore, non native association and aggregation under
physiological conditions can lead to precipitation of the
protein at the site o~ injection, which could lead to
irritation or other immune response. For these reasons, a
~ormulation o~ human obesity protein that developed insoluble
protein particles would be unacceptable to patients seeking
its bene~its and to regulatory agencies.
Un~ortunately, the naturally occurring obesity
proteins demonstrate a propensity to aggregate making the
preparation o~ a soluble, pharmaceutically acceptable
parenteral ~ormulation exceedinyly dif~icult. The molecular
interactions amongst the preservative, buf~er, ionic
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/~0568
strength, pH, temperature, and any additional excipients such
as a surfactant, or sugar are highly unpredictable in view of
the propensity for the obesity protein to aggregate and
precipitate from the formulation.
obesity protein analogs have been developed and
have demonstrated pharmacological activity. Some of these
analogs demonstrate significant improvement in physical
properties and stability. Analogs included in the present
invention are disclosed in Basinski et al., in WO 96/23515
and WO 96/23517.
The present invention provides conditions under
which solubility of an obesity protein analog is enhanced.
Thus, permitting a longer shelf life, ease of manufacture,
and more convenient patient delivery. Most unexpectedly, the
physical stability of the formulation is greatly enhanced in
the presence of methylparaben, ethylparaben, propylparaben,
butylparaben, chlorobutanol or a mixture thereof. That is,
when ~ormulated under the conditions described herein, the
obesity protein analog r~m~i n~ soluble at much higher
concentrations and at a pH range acceptable for a soluble,
multi-use parenteral formulation. Accordingly, the present
invention provides a soluble, parenteral formulations of an
obesity protein analog.
This invention provides a soluble parenteral
formulation, comprising an obesity protein analog and a
preservative selected from the group consisting of
alkylparaben, chlorobutanol, or a mixture thereof.
The invention further provides a process for
preparing a soluble parenteral formulation, which comprises
mixing an obesity protein analog and a preservative selected
from the group consisting of alkylparaben, chlorobutanol, or
~ a mixture thereof.
Additionally, the invention provides a method of
treating obesity in a mammal in need thereof, which comprises
administering to said m~mm~l a soluble parenteral formulation
of the present invention.
CA 02243~18 1998-07-1~
WO~7/26011 PCT~S97/00568
For purposes o~ the present invention, as disclosed
and claimed herein, the ~ollowing terms and abbre~iations are
de~ined as ~ollows:
Alkylparaben -- re~ers to a Cl to C4 alkyl paraben.
Pre~erably, alkylparaben is methylparaben, ethylparaben,
propylparaben, or butylparaben.
Base pair (bp) -- re~ers to DNA or RNA. The
abbreviations A,C,G, and T correspond to the 5'-monophosphate
~orms o~ the nucleotides (deoxy)adenine, (deoxy)cytidine,
(deoxy)guanine, and (deoxy)thymine, respectively, when they
occur in DMA molecules. The abbreviations U,C,G, and T
correspond to the 5~-monophosphate ~orms o~ the nucleosides
uracil, cytidine, guanine, and thymine, respectively when
they occur in RNA molecules In double stranded DNA, base
pair may re~er to a partnership o~ A with U or C with G. In
a DNA/RNA heteroduplex, base pair may re~er to a partnership
of T with U or C with G.
Obesity protein analog -- re~ers to a protein o~
the Formula (I):
205 l0 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Xaa Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
3~~ 85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
4~ Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/OOS68
,
-- 5 --
145
Gly cys (SEQ ID NO:l) (I)
wherein: Xaa at position 28 is Gln or absent; said protein
ha~ing at least one of the following substitutions:
Gln at position 4 is replaced with Glu;
Gln at position 7 is replaced with Glu;
Asn at position 22 is replaced with Gln or Asp;
Thr at position 27 is replaced with Ala
Xaa at position 28 is replaced with Glui
Gln at position 34 is replaced with Glu;
Met at position 54 is replaced with methionine
sulfoxide, Leu, Ile, Val, Ala, or Gly;
Gln at position 56 is replaced with Glu;
Gln at position 62 is replaced with Glu
Gln at position 63 is replaced with Glui
Met at position 68 is replaced with methionine
sulfoxide, Leu, Ile, Val, Ala, or Gly;
Asn at position 72 is replaced with Gln, Glu, or Asp;
Gln at position 75 is replaced with Glu;
Ser at position 77 is replaced with Alai
Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp;
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
Pro, Thr, or Val;
Ser at position 102 is replaced with Arg;
Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Proi
Asp at position 108 is replaced with Glui
Gly at position 111 is replaced with Asp;
Gly at position 118 is replaced with Leui
Gln at position 130 is replaced with Glu;
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
-- 6 --
Gln at position 134 is replaced with Glu;
Met at position 136 is replaced with methionine
sulfoxide, Leu, Ile, Val, Ala, or Gly;
Trp at position 138 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu; or
Gln at position 139 is replaced with Glu;
or a pharmaceutically acceptable salt thereof. Obesity
protein analog includes those proteins having a leader
sequence. A leader sequence is one or more amino acids on
the N-terminus to aid in production or purification of the
protein. A preferred leader sequence is Met-Rl- wherein Rl
is absent or any amino acid except Pro.
Plasmid -- an extrachromosomal sel~-replicating
genetic element.
Reading frame -- the nucleotide sequence from which
translation occurs "read" in triplets by the translational
apparatus of tRNA, ribosomes and associated factors, each
triplet corresponding to a particular amino acid. Because
each triplet is distinct and of the same length, the coding
sequence must be a multiple of three. A base pair insertion
or deletion (termed a frameshift mutation) may result in two
different proteins being coded for by the same DMA segment.
To insure against this, the triplet codons corresponding to
the desired polypeptide must be aligned in multiples of three
from the initiation codon, i.e. the correct ~'reading ~rame~
must be maintained. In the creation of fusion proteins
containing a chelating peptide, the reading frame of the DNA
sequence encoding the structural protein must be maintained
in the DNA sequence encoding the chelating peptide.
Recombinant DNA Cloning Vector -- any autonomously
replicating agent including, but not limited to, plasmids and
phages, comprising a DNA molecule to which one or more
additional DNA segments can or have been added.
Recombinant DNA Expression Vector -- any
recombinant DNA cloning vector in which a promoter has been
incorporated.
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
.
-- 7
Replicon -- A DNA sequence that controls and allows
for autonomous replication of a plasmid or other vector
Transcription -- the process whereby information
contained in a nucleotide sequence of DNA is transferred to a
~ 5 complementary RNA se~uence.
Translation -- the process whereby the genetic
information of messenger RNA is used to specify and direct
the synthesis of a polypeptide chain.
Vector -- a replicon used for the transformation of
cells in gene manipulation bearing polynucleotide se~uences
corresponding to appropriate protein molecules which, when
combined with appropriate control sequences, confer specific
properties on the host cell to be transformed. Plasmids,
viruses, and bacteriophage are suitable vectors, since they
are replicons in their own right. Artificial vectors are
constructed by cutting and joining DNA molecules from
different sources using restriction enzymes and ligases.
Vectors include Recombinant DNA cloning vectors and
Recombinant DNA expression vectors.
Treating -- as used herein, describes the
management and care of a patient for the purpose of combating
the disease, condition, or disorder and includes the
administration of a protein of present invention to prevent
the onset of the symptoms or complications, alleviating the
symptoms or complications, or eliminating the disease,
condition, or disorder. Treating as used herein includes the
administration of the protein for cosmetic purposes. A
cosmetic purpose seeks to control the weight of a mammal to
improve bodily appearance.
Isotonicity agent -- isotonicity agent refers to an
agent that is physiologically tolerated and embarks a
suitable tonicity to the formulation to prevent the net flow
of water across the cell membrane. Compounds, such as
glycerin, are commonly used for such purposes at known
concentrations. Other possible isotonicity agents include
salts, e.g., NaC1, dextrose, mannitol, and lactose.
CA 02243~l8 l998-07-l~
WO9~/26011 PCT~S97/00568
.
-- 8 --
Physiologically tolerated bu~er -- a
physiologically tolerated bu~fer is known in the art. A
physiologically tolerated bu~fer is pre~erably a phosphate
bu~fer, like sodium phosphate. Other physiologically
tolerated buffers include TRIS, sodium acetate, or sodium
citrate. The selection and concentration of bu~er is known
in the art.
The nucleotide and amino acid abbreviations are
accepted by the United States Patent and Trademark O~ice as
set ~orth in 37 C.F.R. 1.822 (b)(2) (1993). Unless
otherwise indicated the amino acids are in the L
con~iguration.
As noted above, the invention provides a soluble
parenteral ~ormulation, comprising an obesity protein analog
and a preservative selected from the group consisting of an
alkylparaben or chlorobutanol. In the presence of these
preservatives, the obesity protein analog remains in solution
making a soluble, parenteral ~ormulation possible.
A parenteral formulation must meet guidelines ~or
~0 preservative e~e~tiveness to be a commercially viable
product. Preservatives known in the art as being acceptable
in parenteral formulations include: phenol, m-cresol, benzyl
alcohol, methylparaben, chlorobutanol, p-cresol,
phenylmercuric nitrate, thimerosal and various mixtures
thereo~. See, e.g., WALLHAUSER, K.--H., DEvELoP. BIOL. STANDARD.
24, pp. 9-28 (Basel, S. Krager, 1~74).
Most unexpectedly, a select number of prese~vatives
have been identi~ied that provide good formulation stability
These select preservatives are an alkylparaben or
chlorobutanol. Most preferrably, the preservative is
methylparaben, propylparaben, or butylparaben. Most
unexpectedly, the obesity protein analog does not aggregate
in the presence of these preservatives at the conditions
necessary to formulate, and particularly conditions at 37~C.
The concentration o~ obesity protein analog in the
~ormulation is about l.0 mg/mL to about l00 mg/mL; preferably
about 5.0 mg/mL to about 50.0 mg/mL; most pre~erably, about
CA 02243~18 1998-07-1~
WO97/26011 PCT~S97/0~68
_ g _
l0.0 mg/mL. The concentration of preservative required is
the concentration necessary to maintain preservative
effectiveness. The relative amounts of preservative
necessary to maintain preservative e~fectiveness varies with
the preservative used. Generally, the amount necessary can
be found in WALLHAusER, K.- H ., DEVELOP . BIoL. STANDARD . 2 4, pp .
9-28 (Basel, S. Krager, 1974), herein incorporated by
reference. The optimal concentration of the preservative
depends on the preservative, its solubility, and the pH of
the formulation.
Also included as optional embodiments are agents
known to be synergistic with the preservative to provide
enhanced antimicrobial effect. Such agents are recognized in
the art and include for example ethylene diaminetetraacetic
acid (EDTA), 1, 2-di(2-aminoethoxy)ethane-
N,N,N',N'=tetraacetaic acid (EGTA), citrate, and caprylic
acid. The concentration of these agents varies with the
desired preservation effect. A preferred agent is EDTA,
particularly in conjunction with an alkylparaben at a
concentration of about 0.025% to 0.4%. Notably, in
preparations including EDTA or EGTA, the bu~fer concentration
is reduced to m;n;m; ze ionic strength.
The present formulations may optionally contain a
physiologically tolerated solvent such as glycerol, propylene
25 glycol, phenoxy ethanol, phenyl ethyl alcohol. Such solvents
are generally added to enhance the solubility of the protein
in the preservation effectiveness of the formulation.
An isotonicity agent, preferably glycerin, may be
addltionally added t~ the ~r~ulation. The concentration o~
the isotonicity agent is in the range known in the art for
parenteral formulations, preferably about l to 20 mg/mL, mcre
- preferably about 8 to 16 mg/mL, and still more preferably
about 16 mg/mL. The pH of the formulation may also be
buffered with a physiologically tolerated buffer, preferably
35 a phosphate buffer, like sodium phosphate (at about 5mM to
about 15 mM). Other acceptable physiologically tolerated
buffers include TRIS, sodium acetate, or sodium citrate. The
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
-- 10 --
selection and concentration of buffer is known in the art;
however, the formulations of the present invention are
preferably prepared with the m; ni m~lly acceptable
concentration of buffer.
other additives, such as a pharmaceutically
acceptable solubilizers like Tween 20 ~polyoxyethylene (20)
sorbitan monolaurate), Tween 40 (polyoxyethylene (20)
sorbitan monopalmitate), Tween 80 (polyoxyethylene (20)
sorbitan monooleate), Pluronic F68 (polyoxyethylene
polyoxypropylene block copolymers), BRIJ 35 (polyoxyethylene
(23) lauryl ether), and PEG (polyethylene glycol) may
optionally be added to the formulation to reduce aggregation.
These additives are particularly useful i~ a pump or plastic
container is used to administer the formulation. The
presence of pharmaceutically acceptable surfactant mitigates
the propensity for the protein to aggregate.
The parenteral formulations of the present
invention can be prepared using conventional dissolution and
mixing procedures. To prepare a suitable formulation, for
example, a measured amount of obesity protein analog in water
is combined with the desired preservative in water in
~uantities sufficient to provide the protein and preservative
at the desired concentration. The formulation is generally
sterile filtered prior to administration. Variations of this
process would be recognized by one of ordinary skill in the
art. For example, the order the components are added, the
surfactant used, the temperature and pH at which the
formulation is prepared may be opt'imized for the
concentration and means of administration used.
The unexpected preservative effect on formulation
stability was demonstrated by preparing formulations
comprising methylparaben, propylparaben, butylparaben,
chlorobutanol, cresol, phenol, benzyl alcohol, or a mixture
thereof and comparing the amount of protein r~m~ining in
solution after 3 days at 4~C and 37~C. The data in Table 1
demonstrate that the stability and solubility of the protein
is enhanced in the presence of an alkylparaben or
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
.
chlorobutanol. The ~ormulations used to generate the data of
Table 1 were prepared in a manner analogous to Examples 1 and
2.
Table 1. Recovery of the protein of SEQ ID NO:6 as a function
of preservative and conditions. Values are the
calculated least square means and standard errors
determined ~rom ~itting the raw data to a ~actorial
model o~ the second degree containing the effects of
preservative, acid excursion, bu~er, conditions,
and all two-factor interactions (R2 = 0 945
(Prob > F) = 2.88e~38, total observations = 125).
Percent of protein in solution is calculated using a
theoretical target of 1.6 mg protein/mL.
Protein in Solution
(% of theoretical)
PreservativePreservative3 days ~ 3 days @
Concentration (%) 4~C 7~C
methylparaben 0.17 = '.02 ~.6 =
propylparaben 0.16 - .02 . = . ,. = _.
butylparaben0. 1 . = .
chlorobutenol 0.5 ~r, = t 8 . ~ = _ .
methylparaben + 0.18 i 0.02 . = .~ 70. = .
propylparaben 0.017 + 0.002
benzyl alcohol 1.0 81.4 + 3.6 28.9 i 3.6
methylparaben + 0.16 i 0.02 81.6 i 3.6 11.9 + 3.6
propylparaben +0.02 i 0.002
benzyl -~lcohol 0.~
m-creso 0. 5~.~ = .0 ~ .6 = -.
p-creso_ 0. 7~
phenol 0. 6-. = _.~ '.2 = ~.'
The stabilizing e~fect by the alkylparabens is most
unexpected in view of the structural similarities to other
preservatives. The data clearly show that the alkylparabens
and chlorobutanol are superior at 37~C, which is the
temperature re~uired ~or in-use physical stability testing.
Preferably, the pH of the present ~ormulations is
about pH 7.0 to about 8.0 and, most preferably 7.6 to 8Ø
The ~ormulations are pre~erably prepared under basic
conditions by mixing the obesity protein analog and
preservative at a pH greater than pH 7Ø Pre~erably, the pH
25 is about 7.6 to 8.0, and most preferably about pH 7.8.
Ideally, a preservative and water solution is mixed at pH 7.6
to 8Ø Added to this solution is obesity protein analog in
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
.
- 12 -
water. The pH is adjusted, as necessary, to about pH 7.6 to
8Ø The solution is then held until the components are
dissolved, approximately 20 to 40 ~inutes, preferably about
30 minutes. The base used to adjust the pH o~ the
formulation may be one or more pharmaceutically acceptable
bases such as sodium hydroxide or potassium hydroxide. The
preferred base is sodium hydroxide.
The formulations prepared in accordance with the
present invention may be used in a syringe, in~ector, pumps
or any other device recognized in the art ~or parenteral
administration.
Pre~erred obesity protein analo~s employed in the
formulations of the present invention are those of Formula I,
wherein:
Gln at position 4 is repLaced with Glu;
Gln at position 7 is replaced with Glu;
Asn at position 22 i5 replaced with Gln or Asp;
Thr at position 27 is replaced with Ala;
Gln at position 28 is replaced with Glu;
Gln at position 34 is replaced with Glu;
Met at position 54 is replaced with methionine
sulfoxide, Leu, or Ala;
Gln at position 56 is replaced with Glu;
Gln at position 62 is replaced with Glu;
Gln at position 63 is replaced with Glu;
Met at position 68 is replaced with methionine
sulfoxide, or Leu;
Asn at position 72 is replaced with Gln or Asp;
Gln at position 75 is replaced with Glu;
3D Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp;
Gln at position 130 is replaced with Glu;
Gln at position 134 is replaced with Glu;
Met at position 136 is replaced with methionine
sulfoxide, Leu, Ile; or
Gln at position 139 is replaced with Glu.
CA 02243~18 1998-07-1~
WO9-7/26011 PCT~S97/00568
other pre~erred obesity protein analogs employed in
the ~ormulations of the present invention are those of
- Formula I, wherein:
Asn at position 22 is replaced with Gln or Asp;
Thr at position 27 is replaced with Ala;
Met at position 54 is replaced with methionine
sulfoxide, Leu, or Ala;
Met at position 68 is replaced with methionine
sul~oxide, or Leu;
Asn at position 72 is replaced with Gln or Asp;
Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp; or
Met at position 136 is replaced with methionine
sulfoxide, Leu, or Ile.
Still yet additional preferred proteins employed in
the ~ormulations o~ the present inventin are those o~ Eormula
I, wherein:
Asn at position 22 is replaced with Gln or Asp;
Thr at position 27 is replaced with Ala;
Met at position 54 is replaced with Leu, or Ala;
Met at position 68 is replaced with Leu;
Asn at position 72 is replaced with Gln or Asp;
Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp; or
Met at position 136 is replaced with Leu, or Ile.
Pre~erred species employed in the ~ormulations o~
the present invention are those o~ SEQ ID NO:2 and SEQ ID
NO:3:
5 lO 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asp Asp Ile Ser His Thr Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
so 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
CA 02243~18 1998-07-1~
WO~-7/26011 PCT~S97/00568
.
- 14 -
70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser ~rg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys ( SEQ ID NO: 2)
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg I le Asn Asp Ile Ser His Ala Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
3 0 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys ( SEQ ID NO:3)
Most signi:Eicantly, other pre~erred proteins o~ the
present ~ormulations are speci~ic substitutions to amino acid
residues 97 to lll, and/or 138 O~ the proteins o:E SEQ ID
NO:l. These substitutions result in additional stability and
are superior therapeutic agents. These speci~ic proteins are
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/OOS68
more readily formulated and are more pharmaceutically
elegant, which results in superior delivery o~ therapeutic
doses. Accordingly, pre~erred embodiments are formulations
comprising obesity protein analogs o~ the Formula II:
5 10 15
Val Pro Ile Gln Ly~ Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Xaa Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
15 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
3 0 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
1~5
Gly Cys (SEQ ID NO:4) (II)
wherein:
Xaa at position 28 is Gln or absent;
said protein having at least one substitution selected ~rom
the group consisting o~:
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position lOO is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position lO1 is replaced with Ser, Asn, Gly, His,
Pro, Thr, or Val;
Ser at position 102 iS replaced with Arg;
Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
CA 022435l8 l998-07-l5
WO57/26011 PCT~S97/00~68
- 16 -
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or
Trp at position 138 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
or a pharmaceutically acceptable salt thereo~.
Other pre~erred embodiments are ~ormulations
comprising obesity protein analogs of the Formula III:
0 Val Pro Ile Gln Ly~ Val Gln Asp Asp Thr Lys Thr Leu Ile Ly~ Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu ~is Pro Ile
50 55 6~
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn ~eu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu A~p Ser Leu Gly Gly
115 120 125
Val L~u Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Me~ Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys (SEQ ID NO:5) (III)
said protein having at least one substitution selected ~rom
the group consisting o~:
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser, or Pro;
Trp at position 100 is replaced with Ala, &lu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
Pro, Thr, or Val;
Ser at position 10~ is replaced with Arg;
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
- 17 -
Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or
Trp at position 138 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
or a pharmaceutically acceptable salt thereo~.
More preferred embodiments are ~ormulations
comprising obesity protein analogs o~ the Formula III,
wherein:
His at position 97 is replaced with Gln, Asn, Ala, Gly,
Ser or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His,
Pro, Thr or Val;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or
Trp at position 138 is replaced with Ala, Glu, Asp, Asn,
Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu.
other pre~erred embodiments are ~ormulations
comprising obesity protein analogs o~ the Formula III,
wherein:
His at position 97 is replaced with Ser or Pro;
Trp at position 100 is replaced with Ala, Gly, Gln, Val,
Ile, or Leu;
Ala at position 101 is replaced with Thr; or
Trp at position 138 is replaced with Ala, Ile, Gly, Gln,
Val or Leu.
CA 02243~18 1998-07-1~
WO~7/26011 PCT~S97/00568
- 18 -
Additional pre~erred embodiments are ~ormulations
comprising obesity protein analo~s of the Formula III,
wherein:
His at position 97 is re~laced with Ser or Pro;
Trp at position lOO is replaced with Ala, Gln or Leu;
Ala at position lOl is replaced with Thr; or
Trp at position 138 is replaced with Gln.
Most pre~erred embodiments are ~ormulations
comprising obesity protein analogs havin~ a di-sul~ide bon~
l~ between Cys at position 96 and Cys at positio~ 146. Examples
o~ most preferred embodimenets include formulations
comprising obesity protein analogs o~ SEQ ID NO:6-13, said
obesity protein analogs having intramolecular di-sul~ide
bonds between Cys at position 96 and Cys at position 146, or
pharmaceutically acceptable salts thereo~:
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser Xis Thr Gln Ser Val Ser Ser
~0 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
3 5 His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys (SEQ ID NO: 6 )
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
CA 02243~l8 l998-07-l~
WO g'7t26011 PCT/US97/00568
- 19 --
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
15 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 . 110
His Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys ( SEQ ID MO: 7)
5 10 15
3 0 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
3 5 35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
45 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
Gly Cys (SEQ ID MO: 8)
CA 02243~l8 l998-07-l~
WO 9~/26011 PCT/US97/OOS68
-- 20 -
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
lQ Lys Gln Lys Val Thr Gly Leu A5p Phe Ile Pro Gly Leu His Pro Ile
6Q
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
5 65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
lQO 105 110
His Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
3D 145
Gly Cys (SEQ ID NO: 9)
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser His Ala Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
5Q Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
lQO 105 110
His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
CA 02243~l8 l998-07-l~
WO g7/26011 PCT/US97/00568
.
-- 21 --
Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro
145
Gly Cys ( SEQ ID NO: 10 )
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
0 20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser ~Iis Thr Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
20 Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
3 5 Gly Cys ( SEQ ID ~O
CA 02243~l8 l998-07-l~
WO g7126011 PCT/US97/00568
-- 22 --
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
3Q
5 Ile Val Thr Arg Ile Asn A5p Ile Ser His Thr Gln Ser Val Ser Ser
4S
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
0 50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp lleu Leu His Val Leu Ala Phe Ser Lys Ser Cys
100 105 110
2 0 Ser Leu Pro Gln Thr Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 135 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
145
Gly Cys (SEQ ID NO: 12 )
5 10 15
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr
20 25 30
Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser
35 40 45
Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile
~0
50 55 60
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile
65 70 75 80
4~ Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu
85 90 95
Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys
lQ0 lQ5 - llO
Ser heu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly
115 120 125
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg
130 13~ 140
Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
- 23 -
145
Gly Cys (SEQ ID NO:13)
The obesity protein analogs of the present
invention can be prepared by any of a variety o~ recognized
peptide synthesis techniques including classical (solution)
methods, solid phase methods, semi synthetic methods, and
more recent recombinant DNA methods. Recombinant methods are
preferred if a high yield is desired. The basic steps in the
recombinant production of protein include:
a) construction of a synthetic or semi-synthetic
(or isolation from natural sources) DMA
encoding the obesity protein analog,
b) integrating the coding sequence into an
expression vector in a manner suitable for the
expression of the protein either alone or as a
fusion protein,
c) transforming an appropriate eukaryotic or
prokaryotic host cell with the expression
vector, and
d) recovering and purifying the recombinantly
produced protein.
Synthetic genes, the n vitro or ln v vo
transcription and translation of which will result in the
production of the protein may be constructed by techniques
well known in the art. Owing to the natural degeneracy of
the genetic code, the skilled artisan will recognize that a
sizable yet definite number of DNA sequences may be
constructed which encode the desired proteins. In the
preferred practice of the invention, synthesis is achieved by
recombinant DNA technology.
Methodology of synthetic gene construction is well
known in the art. For example, see Brown, et al. (1979)
Methods in Enzymology, Academic Press, N.Y., Vol. 63, pgs.
lD9-151. The DNA sequence corresponding to the synthetic
claimed protein gene may be generated using conventional DNA
synthesizing apparatus such as the Applied Biosystems Model
CA 02243~18 1998-07-1~
WO97/26011 PCT~S97/00568
- 24 -
380A or 380B DNA synthesizers (commercially available ~rom
Applied Biosystems, Inc., 850 Llncoln Center Drive, Foster
City, CA 94~04). It may be desirable in some applications to
modify the coding sequence of the obesity protein analog so
as to incorporate a convenient protease sensitive cleavage
site, e.g., between the signal peptide and the structural
protein ~acilitatina the controlled excision of the signal
peptide ~rom the ~usion protein construct.
The gene encoding the obesity protein analog may
also be created by using polymerase chain reaction (PCR).
The template can be a cDNA library (commercially available
from CLONETECH or STRATAGENE) or mRNA isolated ~rom the
desired arrival adipose tissue. Such methodologies are well
known in the art Maniatis, e~ al. Molecular Clonina: A
L~horatorv Manual, Cold Sprina Harbor Press, Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York (1989).
The constructed or isolated DNA sequences are
use~ul for expressing the obesity protein analog either by
direct expression or as fusion protein. When the sequences
~=0 are used in a fusion yene, the resulting product will re~uire
en~ymatic or chemical cleavage. A variety of peptidases
which cleave a polypeptide at specific sites or digest the
peptides ~rom the amino or carboxy termini ~e.g.
diaminopeptidase~ of the peptide chain are known.
Furthermore, particular chemicals (e.g. cyanogen bromide~
will cleave a polypeptide chain at speci~ic sites. The
skilled artisan will appreciate the modi~ications necessary
to the amino acid sequence (and synthetic or semi-synthetic
coding sequence i~ recombinant means are employed~ to
incorporate site-specific internal cleavage sites. ~ U.S.
Patent No. 5,126,249; Carter P., Site Speci~ic Proteolysis
o~ Fusion Proteins, Ch. 13 in Protein Purification: From
~Qlecular Mechanisms to rarae Scale Processes, American
Chemical Soc., Washington, D.C. (l990~.
Construction o~ suitable vectors cont~;n;ng the
desired coding and control sequences employ standard ligation
techniques. Isolated plasmids or DNA ~ragments are cleaved,
-
CA 02243~18 1998-07-1~
WO9~J26~11 PCT~S97/00568
- 25 -
tailored, and religated in the form desired to form the
plasmids required.
To effect the translation of the desired protein,
one inserts the engineered synthetic DNA sequence in any of a
b 5 plethora of appropriate recombinant DNA expression vectors
through the use of appropriate restriction endonucleases. A
synthetic coding sequence may be designed to possess
restriction endonuclease cleavage sites at either end of the
transcript to facilitate isolation from and integration into
lO these expression and amplification and expression plasmids.
The isolated CDNA coding sequence may be readily modified by
the use of synthetic linkers to facilitate the incorporation
of this sequence into the desired cloning vectors by
techniques well known in the art. The particular
15 endonucleases employed will be dictated by the restriction
endonuclease cleavage pattern of the parent expression vector
to be employed. The restriction sites are chosen so as to
properly orient the coding sequence with control sequences to
achieve proper in-frame reading and expression o~ the
20 protein.
In general, plasmid vectors containing promoters
and control sequences which are derived ~rom species
compatible with the host cell are used with the~e hosts The
vector ordinarily carries a replication origin as well as
25 marker sequences which are capable of providing phenotypic
selection in transformed cells. For example, E. coli is
typically transformed using pBR322, a plasmid derived from an
E. coli species ~Bolivar, et al., Gene 2: 95 (1977)).
Plasmid pBR322 contains genes for ampicillin and tetracycline
30 resistance and thus provides easy means for identifying
transformed cells. The pBR322 plasmid, or other microbial
plasmid must also contain or be modified to contain promoters
and other control elements commonly used in recombinant DNA
technology.
The desired coding sequence is inserted into an
expression vector in the proper orientation to be transcribed
~rom a promoter and ribosome binding site, both of which
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
.
- 26 -
should ~e functional in the host cell in which the protein is
to be expressed. An example of such an expression vector is
a plasmid described in Belagaje et al., U.S. patent Mo.
5,304,493, the teachings of which are herein incorporated by
reference. The gene encoding A-C-B proinsulin described in
U.S. patent No. 5,304,493 can be removed from the plasmid
- pRB182 with restriction enzymes ~I and ~mHI. The isolated
DNA sequences can be inserted into the plasmid backbone on a
NdeI/BamHI restriction fragment cassette.
In general, procaryotes are used for cloning of DNA
se~uences in constructing the vectors useful in the
invention. For example, E. coli K12 strain 294 (ATCC No.
31446) is particularly useful. Other microbial strains which
may be used include E. coli B and E. Goli X1776 (ATCC No.
1~ 31537). These examples are illustrative rather than limiting.
Procaryotes also are used for expression. The
aforementioned strains, as well as E~ coli W3110
~prototrophic, ATCC No. 27325), bacilli such as Bacillus
subtilis, and other enterobacteriaceae such as S~lmonella
t~himurium or Serratia marcescans, and various pseudomonas
species may be used. Promoters suitable for use with
prokaryotic hosts include the ~-lactamase (vector pGX2907
~ATCC 39344] contains the replicon and ~-lactamase gene) and
lactose promoter systems (Chang et al., Nature, 275:615
25 (1978); and Goeddel et ~1., Matl~re 281:544 (1979)), alkaline
phosphatase, the tryptophan (trp) promoter system (vector
pATHl rATCC 37695] is designed to facilitate expression of an
open reading frame as a trpE fusion protein under control o~
the trp promoter) and hybrid promoters such as the tac
30 promoter (isolatable from plasmid pDR540 ATCC-37282).
However, other ~unctional bacterial promoters, whose
nucleotide ~equences are generally known, enable one o~ skill
in the art to ligate them to DNA encoding the protein using
linkers or adaptors to supply any required restriction sites.
Promoters for use in bacterial systems also will contain a
Shine-Dal~arno sequence operably linked to the DNA encoding
protein.
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
.
- 27 -
The DNA molecules may also be recombinantly
produced in eukaryotic expression systems. Preferred
promoters controlling transcription in m~mm~l ian host cells
may be obtained from various sources, for example, the
genomes of viruses such as: polyoma, Simian Virus 40 (SV40),
adenovirus, retroviruses, hepatitis-B virus and most
preferably cytomegalovirus, or from heterologous mammalian
promoters, e.g. ~-actin promoter. The early and late
promoters of the SV40 virus are conveniently obtained as an
SV40 restriction fragment which also contains the SV40 viral
origin of replication. Fiers, e~ al., Nature, 273:113
(1978). The entire SV40 genome may be obtained from plasmid
psRsv, ATCC ~5019. The immediate early promoter of the human
cytomegalovirus may be obtained from plasmid pCMBb (ATCC
77177). Of course, promoters from the host cell or related
species also are useful herein.
Transcription of the D~A by higher eucaryotes is
increased by inserting an enhancer sequence into the vector.
Enhancers are cis-acting elements of DNA, usually about 10-
300 bp, that act on a promoter to increase its transcription.Enhancers are relatively oriented and positioned
independently and have been found 5' (T-~; mi n~, L. et al.,
7~:993 (1981)) and 3' (Lusky, M. L., et al., Mol Cell
~Q~ 3:1108 (1983)) to the transcription unit, within an
intron (Banerji, J. L. et al., Cell 33:729 (1983)) as well as
within the coding sequence itself (Osborne, T. F., et al.,
Mol. Cell Bio. 4:1293 (1984)). Many enhancer sequences are
now known from mammalian genes (globin, RSV, SV40, EMC,
elastase, albumin, alpha-fetoprotein and insulin).
Typically, however~ one will use an enhancer from a
eukaryotic cell virus. Examples include the SV40 late
enhancer, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin,
and adenovirus enhancers.
Expression vectors used in eukaryotic host cells
(yeast, fungi, insect, plant, animal, human or nucleated
cells from other multicellular organisms) will also contain
CA 02243~l8 l998-07-l~
WO9~/26011 PCT~S97/00S68
- 28 -
sequences necessary for the termination o~ transcription
which may a~fect mRNA expression. These regions are
transcribed as polyadenylated segments in the untranslated
portion o~ the mRNA encoding protein. The 3~ untranslated
regions also include transcription termination sites.
Expression vectors may contain a selection gene,
also termed a selectable marker. Examples o~ suitable
selectable markers for mammalian cells are dihydrofolate
reductase (DHER, which may be derived from the ~lII/HindIII
restriction ~ragment of pJOD-10 [ATCC 68815]), thymidine
kinase (herpes simplex virus thymidine kinase is contained on
the ~mHI ~ragment o~ vP-5 clone [ATCC 2028]) or neomycin
(G418) resistance genes (obtainable from pNN414 yeast
artificial chromosome vector [ATCC 37682~). When such
selectable markers are success~ully transferred into a
m~mm~l ian host cell, the transfected m~mm~l ian host cell can
survive if placed under selective pressure. There are two
widely used distinct categories o~ selective regimes. The
first category is based on a cell~s metabolism and the use o~
2~ a mutant cell line which lacks the ability to grow without a
supplemented media. Two examples are: CHO DHFR- cells ~ATCC
CRL-9~96) and mouse LTK- cells (L-M(TK-) ATCC CCL-2.3).
These cells lack the ability to grow without the addition of
such nutrients as thymidine or hypoxanthine. Because these
cells lack certain genes necessary for a complete nucleotide
synthesis pathway, they cannot survive unless the missing
nucleotides are provided in a supplemented media. An
alternati~e to supplementing the media ls to introduce an
intact DXFR or TK gene into cells lacking the respective
genes, thus altering their growth requirements. Individual
cells which were not trans~ormed with the DHFR or TK gene
will not be capable of survival in nonsupplemented media.
The second ~ategory is dominant selection which
refers to a selecticn scheme used in any cell type and does
not require the use o~ a mutant cell line. These schemes
typically use a drug to arrest growth o~ a host cell. Those
cells which have a novel gene would express a protein
CA 02243~l8 l998-07-l~
W0~7126011 PCT~S97/00568
- 29 -
conveying drug resistance and would survive the selection.
Examples of such ~oml n~nt selection use the drugs neomycin,
Southern P. and Berg, P., J. Molec. A~l. Genet. 1: 327
~1982), mycophenolic acid, Mulligan, R. C. and serg, P.
Sci~nce 20~:1422 (1980), or hygromycin, Sugden, B. et al.,
Mol Cell. Biol. 5:410-413 (1985). The three examples given
above employ bacterial genes under eukaryotic control to
convey resistance to the appropriate drug G418 or neomycin
(geneticin), xgpt (mycophenolic acid) or hygromycin,
respectively.
A preferred vector for eucaryotic expression is
pRc/CMV. pRc/CMV is commercially available from Invitrogen
Corporation, 3985 Sorrento Valley Blvd., San Diego, CA
92121. To confirm correct se~uences in plasmids constructed,
the ligation mixtures are used to transform ~. coli K12
strain DHlOB (ATCC 31446) and successful transformants
selected by antibiotic resistance where appropriate.
Plasmids ~rom the transformants are prepared, analyzed by
restriction and/or se~uence by the method of Messing, et al.,
~l]cleic Acids Res. 9:309 (1981).
Host cells may be transformed with the expression
vectors of this invention and cultured in conventional
nutrient media modified as is appropriate for inducing
promoters, selecting transformants or amplifying genes. The
culture conditions, such as temperature, pH and the like, are
those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan. The techni~ues of transforming cells with the
aforementioned vectors are well known in the art and may be
found in such general references as Maniatis, et al.,
Molecular Clonin~: A Laboratorv Manual, Cold Spring Harbor
ress, Cold Spring Harbor Laboratory, Cold Spring Harbor, ~ew
York (lg8g), or Current Protocols in Molecular Bioloov
~1989~ and supplements.
Preferred suitable host cells for expressing the
vectors encoding the claimed proteins in higher eucaryotes
include: African green monkey kidney line cell line
CA 02243~l8 l998-07-l~
WO9i~26011 PCT~S97/00568
- 30 -
transformed by SV40 (COS-7, ~TCC CRL-1651); transformed human
primary embryonal kidney cell line 293,(Graham, F. L. et al.,
J. Gen Virol. 36:59-72 (1977), V~roloov 77:319-329, Viroloov
86:10-21); ba~y hamster kidney cells (BHK-21(C-13), ATCC CCL-
10, ViroloqY 16:147 (1962)3; Chinese hamster ovary cells CHO-
DHFR- (ATCC CRL-9096), mouse Sertoli cells (TM4, ATCC CRL-
1715, Biol. Re~rod. 23:243-250 (1980)); African green monkey
kidney cells (VERO 76, ATCC CRL-1587); human cervical
epitheloid carcinoma cells (HeLa, ATCC CCL-2); canine kidney
cells ~MDCK, ATCC CCL-34); buffalo rat liver cells (BRL 3A,
ATCC CRL-1442); human diploid lung cells (WI-38, ATCC CCL-
75); human hepatocellular carcinoma cells (Hep G2, ATCC Hs-
8065);and mouse m~mm~ry tumor cells (MMT 060562, ATCC CCL51).
In addition to prokaryotes, unicellular eukaryotes
such as yeast cultures may also be used. Saccharomvces
cerevisiae, or common baker~s yeast is the most commonly used
eukaryotic microorganism, although a number of other strains
are commonly available. For expression in Saccharomyces, the
plasmid YRp7, for example, (ATCC-40053, Stinchcomb, et al.,
Nature 282:39 (1979); Kingsman ~ al., Gene 7:141 (1979);
Tschemper et ~l-, Gene 10:157 (1980)) is commonly used. This
plasmid already contains the trp gene which provides a
selection marker for a mutant strain o~ yeast lacking the
ahility to grow in tryptophan, for example ATCC no. 44076 or
PEP4-1 (Jones, Genetics 85:12 (1977)).
suitable promoting se~uences ~or use with yeast
hosts include the promoters for 3-phosphoglycerate kinase
(found on plasmid pAP12BD ATCC 53231 and described in U.S.
Patent ~o. 4,935,350, June 19, 19903 or other glycolytic
enzymes such as enolase (found on plasmid pACl ATCC 39532),
glyceraldehyde-3-phosphate dehydrogenase (derived from
plasmid pHcGAPCl ATCC 57090, 57Q91), zymomonas mobilis
(United States Patent No. 5,000,000 issued March 19, 1991),
hexokinase, pyruvate decarboxylase, phospho~ructokinase,
glucose-6-phosphate isomerase, 3-phosphoglycerate mutase,
pyruvate kinase, triosephosphate isomerase, phosphoglucose
isomerase~ and glucokinase.
-
CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568
other yeast promoters, which contain inducible
promoters having the additional advantage o~ transcription
controlled by growth conditions, are the promoter regions for
alcohol dehydrogenase 2, isocytochrome C, acid phosphatase,
degradative enzymes associated with nitrogen metabolism,
metallothionein (contained on plasmid vector pCL28XhoLHsPV
ATCC 39475, United States Patent No. 4,840,896),
glyceraldehyde 3-phosphate dehydrogenase, and enzymes
responsible for maltose and galactose (GA~l ~ound on plasmid
pRY121 ATCC 37658) utilization. Suitable vectors and
promoters for use in yeast expression are ~urther described
in R. Hitzeman et al., European Patent Publication No.
73,657A. Yeast enhancers such as the UAS Gal from
~accharomvces cerevisiae (found in conjunction with the CYCl
promoter on plasmid YEpsec--hIlbeta ATCC 67024), also are
advantageously used with yeast promoters.
Pre~aration 1
The plasmid cont~;ning the DNA sequence encoding
the desired protein, is digested with PmlI and Bsu36I. The
recognition sequences ~or'these enzymes lie within the coding
region ~or the protein at nucleotide positions 275 and 360
respectively. The cloning vector does not contain these
recognition sequences. Conse~uently, only two ~ragments are
seen ~ollowing restriction enzyme digestion with PmlI and
ssu36I, one corresponding to the vector ~ragment, the other
corresponding to the ~85 base pair ~ragment liberated ~rom
within the protein coding sequence. This sequence can be
replaced by any DNA sequence encoding the amino acid
substitutions between positions 91 and 116 o~ the present
invention. These DNA sequences are synthesized chemically as
two oligonucleotides with complementary bases and ends that
are compatible with the ends generated by digestion with PmlI
and Bsu36I. The chemically synthesized oligonucleotides are
mixed in equimolar amounts (1-10 picomoles/microliter),
heated to 95 degrees and allow to anneal by slowly decreasing
the temperature to 20-25 degrees. The annealed
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/OOS68
- 32 -
oligonucleotides are used in a standard ligation reaction.
Ligation products are transformed and analyzed as described
in Example 1. Other substitutions are pre~erably carried out
in a similar manner using appropriate restriction cites.
Pre~aration 2
A DNA sequence encoding SEQ ID No:6 with a Met Arg
leader sequence was obtained using the plasmid and procedures
described in preparation 1. The plasmid was digested with
PmlI and Bsu36I. A synthetic DMA fragment of the sequence
5"-SEQ ID NO:14:
(SEQ ID NO:14)
GT~CTGGCCTTCTCTAAAAGTTGCCACTTGCCAGCTGCCAGTGGCCTGGAGACATTGGACA
GTCTGGGCGGAGTCCTGGAAGCC
~5 annealed with the sequence 5'-SEQ ID NO:15:
(SEQ ID NO:15)
TGAGGCTTCCAGGACTCCCCCCAGACTGTCCAATGTCTCCAGGCCACTG~CAGCTGGCAAG
TGGCAACTTTTAGAGAAGGCCAGCAC
was inserted between the PmlI and the Bsu36I sites.
Following ligation, transformation and plasmid isolation, the
sequence of the synthetic fragment was veri~ied by DNA
sequence analysis.
The techniques of trans~orming cells with the
a~orementioned vectors are well known in the art and may be
found in such general references as Maniatis, et al. (1988)
Molecular Clonina: A Laboratorv ~anual, Cold Spring Harbor
Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New
30 York or Current Protocols in Molecular Biolo3v (1989) and
supplements. The techniques involved in the transformation
of ~. coli cells used in the preLerred practice of the
invention as exemplified herein are well known in the art.
The precise conditions under which the transformed E. coli
cells are cultured is dependent on the nature o~ the ~ coli
CA 02243~l8 l998-07-l~
WO97126011 PCT~S97/00568
- 33 -
host cell line and the expression or cloning vectors
employed. For example, vectors which incorporate
thermoinducible promoter-operator regions, such as the c1857
thermoinducible lambda-phage promoter-operator region,
require a temperature shift ~rom about 30 to about 40 degrees
C. in the culture conditions so as to induce protein
synthesis.
In the preferred embodiment of the invention E.
coli K12 RV308 cells are employed as host cells but numerous
other cell lines are available such as, but not limited to,
. coli K12 L201, L687, L693, L507, L640, L641, L695, L814
(E. coli B). The transformed host cells are then plated on
appropriate media under the selective pressure of the
antibiotic corresponding to the resistance gene present on
the expression plasmid. The cultures are then incubated for
a time and temperature appropriate to the host cell line
employed.
Proteins that are expressed in high-level bacterial
expression systems characteristically aggregate in granules
~0 or inclusion bodies which contain high levels o~ the
overexpressed protein. Kreuger et al., in Protein Foldina,
Gierasch and King, eds., pgs 136-142 (1990), American
Association for the Advancement o~ Science Publication No.
89-18S, Washington, D.C. Such protein aggregates must be
dissolved to provide further puri~ication and isolation of
the desired protein product. Id. A variety o~ techniques
using strongly denaturing solutions such as guanidinium-H~l
andJor weakly denaturing solutions such as urea are used to
solubilize the proteins. Gradual removal of the denaturing
agents ~often by dialysis) in a solution allows the denatured
protein to assume its native con~ormation. The particular
~ conditions ~or denaturation and ~olding are determined by the
particular protein expression system and/or the protein in
question.
Pre~aration 3
The protein o~ SEQ ID NO:6 with a Met Arg leader
sequence was expressed in E.col; granules were isolated in 8M
CA 022435l8 l998-07-l5
WO57f26011 PCT~S97/00568
.
- 34 -
urea and 5mM cysteine. The protein was purified ~y anion
exchange chromatography in 8M urea, and ~olded by dilution
into 8M urea (containing 5 mM cysteine) and exhaustive
dialysis against PBS. Following final purification of the
proteins by size exclusion chromatography the proteins were
concentrated to 3-3.5 mg/mL in PBS.
Pre~aration 4
A DMA sequence encoding the protein of SEQ ID NO:2
was assembled from chemically synthesized single stranded
oligonucleotides to generate a double stranded DNA sequence.
The oligonucleotides used to assemble this DNA se~uence are
as follows:
(SEQ ID NO:16)
TATGAGGGTACCTATCCAAAAAGTACAAGATGACACCAAAACACTGATAAAGACAATAGTC
ACAAG
(SEQ ID NO:17)
GATAGATGATATCTCACACACACAGTCAGTCTCATCTAAACAGAAAGTCACAGGCTTGGAC
TTCATACCTGG
(SEQ ID NO:18)
GCTGCACCCCATACTGACATTGTCTAAAATGGACCAGACACTGGCAGTCTATCAACAGATCTTAAC
AAGTATGCCTT
(SEQ ID NO:l9)
CTAGAAGGCATACTTGTTAAGATCTGTTGATAGACTGC
(SEQ ID NO:20)
CAGTGTCTGGTCCATTTTAGACAATGTCAGTATGGGGTGCAGCCCAGGTATGAAGTCCAAG
C
(SEQ ID NO:21)
CTGTGACTTTCTGTTTAGATGAGACTGACTGTGTGTGTGAGATATCATCTATCCTTGTGAC
TATTGTCTTTATCAGTGTTTTG
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
.
- 35 -
~SEQ ID NO:22)
GTGTCATCTTGTA~L~ GGATAGGTACCCTCA
(SEQ ID NO:23)
T5 CTAGA~ACGTGATACAAATATCTAACGACCTGGAGAACCTGCGGGATCTGCTGCACGTGCT
GGCCTTCTCTAAAAGTTGCCACTTGCCATGG
(SEQ ID NO:24)
GCCAGTGGCCTGGAGACATTGGACAGTCTGGGGGGAGTCCTGGAAGCCTCAGGCTATTCTACA
10 GAGGTGGTGGC
~SEQ ID NO:25)
CCTGAGCAGGCTGCAGGGGTCTCTGCAAGACATGCTGTGGCAGCTGGACCTGAGCCCCGGG
TGCTAATAG
(SEQ ID NO:26)
GATCCTATTAGCACCCGGGGCTCAGGTCCAGCTGCCACAGCATGTCTTGCAGAGACC
(SEQ ID NO:27)
20 CCTGCAGCCTGCTCAGGGCCACCACCTCTGTAGAATAGCCTGAGGCTTCCAGGACTCCC
(SEQ ID No:28)
CCCAGACTGTCCAATGTCTCCAGGCCACTGGCCCATGGCAAGTGGCAACTTTTAGAGAAGG
(SEQ ID NO:29)
CCAGCACGTGCAGCAGATCCCGCAGGTTCTCCAGGTCGTTAGATATTTGTATCACGTTT
Oligonucleotides 16 - 22 were used to generate an
approximately 220 base-pair segment which extends from the
NdeI site to the XbaI site at position 220 within the coding
sequence. The oligonucleotides 23 - 29 were used to generate
- an approximately 240 base-pair segment which extends ~rom the
XbaI site to the BamHI site.
To assemble the 220 and 240 base-pair fragments,
the respective oligonucleotides were mixed in equimolar
amounts/ usually at concentrations of about 1-2 picomoles per
microliters. Prior to assembly, all but the oligonucleotides
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
- 36 -
at the 5" -ends of the segment were phosphorylated in
standard kinase buf~er with T4 DNA kinase using the
conditions specified by the supplier of the reagents. The
mixtures were heated to 95~C and allowed to cool slowly to
room temperature over a period of 1-2 hours to ensure proper
annealing of the oligonucleotides. The oligonucleotides were
then ligated to each other and into a cloning vector, PUCl9
was used~ but others are operable using T4 DNA ligase. The
PUCl9 bu~fers and conditions are those recommended by the
supplier of the enzyme. The vector ~or the 220 base-pair
fragment was digested with NdeI and XbaI, whereas the vector
for the 240 base-pair fragment was digested with XbaI and
BamHI prior to use. The ligation mixes were used to
transform ~. coli DHlQB cells (commercially available ~rom
GibcofBRL) and the transformed cells were plated on tryptone-
yeast (TY) plates containing 100 ~g/ml of ampicillin, X-gal
and IPTG. Colonies which grow up overnight were grown in
li~uid TY medium with 100 ~g/ml of ampicillin and were used
for plasmid isolation and DNA seguence analysis. Plasmids
~0 with ~he correct sequence were kept for the assembly of the
complete gene. This was accomplished by gel-purification of
the 22~ base-pair and the 240 base-pair fragments and
ligation of these two fragments into PUClg linearized with
NdeI and BamHI. The ligation mix was trans~ormed into E.
2~ ~Qli DHlOB cells and plated as described previously. Plasmid
DNA was isolated from the resulting transformants and
digested with NdeI and BglII. The large vector fragment was
gel-puri~ied and ligated with a approximately 195 base-pair
segment which was assembled as described previously from six
chemically synthesized oligonucleotides as show below.
(SE~ ID MO:30)
TAT GCG GGT ACC GAT CCA GAA AGT TCA GGA CGA CAC CAA AAC CCT
GAT CAA AAC CAT CGT TAC
CA 02243~18 1998-07-1~
WO97126011 PCT~S97/OOS68
(SEQ ID NO:31)
GCG TAT CAA C~A CAT CTC CCA CAC CCA GTC CGT GAG CTC CAA ACA
GAA GGT TAC CGG TCT GGA CTT CAT CCC GG
(SEQ ID NO:32)
GTC TGC ACC CGA TCC TGA CCC TGT CCA AAA TGG ACC AGA CCC TGG
CTG TTT ACC A~C A
(SEQ ID NO:33)
l0 ATA CGC ~TA ACG ATG GTT TTG ATC AGG GTT TTG GTG TCG TCC TGA
ACT TTC TGG ATC GGT ACC CGC A
(SEQ ID NO:34)
TGC AGA CCC GGG ATG AAG TCC AGA CCG GTA ACC TTC TGT TTG GAG
l5 CTC ACG GAC TGG GTG TGG GAG ATG TCG TTG
(SEQ ID NO:35)
GAT CTG CTG GTA AAC AGC CAG GGT CTG GTC CAT TTT GGA CAG GGT
CAG GAT CGG G
20 The ligation was transformed into ~. coli cells as described
previously.
The DNA from the resulting transformants was
isolated and the sequence was verified by DNA sequence
analysis. The plasmid with the correct se~uence was digested
25 with NdeI and Bam~I and the approximately 450 base-pair
insert was recloned into an expression vector.
The protein was expressed in E.coli, isolated and
was folded either by dilution into PBS or by dilution into 8M
urea ~hoth cont~;ning 5 ~mM cysteine) and ~haustive dialysis
30 against PBS. Following final purification of the proteins by
size exclusion chromatography the proteins were co~centrated
t to 3-3.5 mgJmL in PBS. Amino acid composition was confirmed.
Pre~aration 5
The protein of SEQ ID NO:6 with a Met Arg leader
se~uence was expressed in E.col;, isolated and folded as
described previously. The Met Arg leader se~uence was
CA 02243~18 1998-07-1~
WO9~/2~011 PCT~S97/00568
- 38 -
cleaved by the addition o~ 6-l0 milliunits dDAP per mg of
prctein. The conversion reaction was allowed to proceed for
2-8 hours at room temperature. The progress of the reaction
was monitored by high performance reversed phase
chromatography. The reaction was terminated by adjusting the
pH to 8 with NaOH. The des(Met-Arg) protein was ~urther
purified by cation exchange chromatography in 7-8M urea and
size exclusion chromatography in PBS. Following ~inal
puri~ication o~ the proteins by size exclusion chromatography
the proteins were concentrated to 3-3.~ mg/mL in PBS.
Preferably, the DNA sequences are expressed with a
dipeptide leader sequence encoding Met-Ar~ or Met-Tyr as
described in U.S. Patent No. 5,126,249, herein incorporated
by re~erence. This approach ~acilitates the e~icient
expression o~ proteins and enables rapid conversion to the
active protein form with Cathepsin C or other
dipeptidylpeptidases. The purification o~ proteins is by
techniques known in the art and includes reverse phase
chromatography, af~inity chromatography, and size exclusion.
2~ The ~ollowing examples and preparations are
provided merely to ~urther illustrate the preparation of the
~ormulations o~ the invention. The scope of the invention is
not construed as merely consistin~ of the ~ollowing examples.
Example l
Obesitv Protein Analoq Formulation
To generate a solution of a protein o~ SEQ ID No:6
~hereinafter, Protein No:6) the lyophilized solid material
was first dissolved in water to generate a stock solution
(stock l~. The concentration o~ Protein NO:6 in stock l was
3~ verified by W/Vis spectrophometry using the known extinction
coef~icient ~or Protein NO:6 at the maximum spectral
absorbance (279nm or 280nm), measuring the maximum spectral
absorbance ~279nm or 280nm), and utilizing the dilution
~actor. A stock preservative solution containing
methylparaben, for example, was prepared by dissolving the
solid in water (stock 2). A solution o~ Protein NO:6 at l.6
-
CA 02243~l8 l998-07-l~
WO97126011 PCT~S97/00568
- 39 -
mg/mL was prepared by addition of an aliquot of stock 1 to a
container which held an aliquot of stock 2 along with the
required quantity of water, at an alkaline pH (7.8+0.3);
adjusted i~ necessary with HCl or NaOH. After an appropriate
incubation period at room temperature ~30 minutes), the
solution pH was examined and adjusted if necessary with trace
~L quantities of HCl or NaOH, to yield Protein NO:6 solution
at 1.6 mg/mL with 0.17 % methylparaben pH 7.8+0.1. The
solution was then hand-filtered using a glass syringe with an
attached 0.22~m syringe filter into a glass vial.
Example 2
Obesit~ Protein Analoa Formulation
To generate a solution of a protein of SEQ ID NO:6
(hereinafter Protein NO:6), the lyophilized solid material
was first dissolved in water to generate a stock solution
(stock 1). The concentration of Protein NO:6 in stock 1 was
veri~ied by UV/Vis Spectrophometry using the known extinction
coefficie~t ~or Protein NO:6 at the maximum spectral
absorbance (279nm or 280nm), measuring the maximum spectral
absorbance (279nm or 280nm), and utilizing the dilution
factor. A stock preservative solution containing
chlorobutanol, for example, was prepared by dissolving the
solid in water (stock 2). A solution of Protein NO:6 at 1~6
mg/mL was prepared by addition of an aliquot of stock 1 to a
container which held an aliquot of stock 2 along with the
required quantity of water, at an alkaline pH (7.8+0.3~;
adjusted if necessary with HCl or ~aOH. After an appropriate
incubation period at room temperature (30 minutes), the
solution pH was examined and adjusted if necessary with trace
~L quantities of HCl or NaOH, to yield an Protein No:6
solution at 1.6 mg~mL with 0.50% chlorobutanol pH 7.8+0.1.
The solution was then hand-filtered using a glass syringe
with an attached 0.22~m syringe filter into a glass vial.
CA 02243~l8 l998-07-l~
WO9~/26011 PCT~S97/00S68
- 40 -
Example 3
Obesitv Protein Analoa Formulation
To generate a solution of a protein o~ SEQ ID NO:6
(hereinafter Protein Mo:6), the solid bulk material,
lyophilized from a neutral water solution, was redissolved in
water to generate a stock solution (stock 1) The
concentration of Protein NO:6 in stock 1 was verified by
W /Vis Spectrophometry by multiplying the maximum spectral
absorbance (279nm or 280nm) by the dilution factor divided by
the known extinction coefficient for Protein NO:6. A stock
preservative solution containing methylparaben was prepared
by dissolving the solid in water (stock 2). A stock of an
isotonicity agent, such as glycerin, was ~repared by
dissolving the neat liquid in water (stock 3). A stock o~ a
physiologically-tolerated bu~fer, such as sodium phosphate
was prepared by dissolving the solid in water (stock 4). A
solution of Protein NO:6 at 1.6 mg/mL was prepared by
addition of an aliquot of stock 1 to a container which held
an aliquot o~ stock 2 along with an aliquot of stock 3 along
with the required quantity of water, adjusted i~ necessary
with HCl or NaOH to an alkaline pH (7.8i0.3). A~ter an
appropriate incubation period at room temperature (30
minutes) an aliquot of stock 4 was added. The solution pH
was then readjusted if necessary with trace ~L quantities of
HCl or NaOH, to yield Protein No:6 solution,.for example, at
1.6 mg/mL with 0.17~ methylparaben, 16 mg/mL glycerin, and
14mM sodium phosphate at pH 7.8+0.1. The solution was then
hand-filtered using a glass syringe with an attached 0.22~m
syringe filter into a glass vial.
3~0 Example 4
obesitv Protein Analoa Formulation
To generate a solution of Human Obesity Analog
Protein (Protein NO:6), the solid bulk material, lyophilized
from a neutral water solution, was redissolved in water to
3~ generate a stock solution (stock 1). The concentration of
CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568
~ 41 -
Protein N~:6 in stock 1 was verified by W /Vis
Spectrophometry by multiplying the maximum spectral
absorbance (279nm or 280nm) by the dilution factor divided by
the known extinction coe~ficient for Protein MO:6. A stock
preservative solution containing chlorobutanol, for example,
was prepared by dissolving the solid in water (stock 2). A
stock of an isotonicity agent, such as glycerin, was prepared
by dissolving the neat li~uid in water (stock 3). A stock of
a physiologically-tolerated buffer, such as sodium phosphate
was prepared by dissolving the solid in water (stock 4). A
solution of Protein No:6 at 1.6 mg/mL was prepared by
addition of an aliquot of stock 1 to a container which held
an aliquot of stock 2 along with an aliquot of stock 3 along
with the required quantity of water, adjusted if necessary
with HCl or NaOH to an alkaline pH (7.8~0.3). After an
appropriate incubation period at room temperature (30
minutes) an aliquot of stock 4 was added. The solution pH
was then readjusted if necessary with trace ~L quantities of
HCl or NaOH, to yield Protein NO:6 solution, for example, at
1.6 mg/mL with 0.5% chlorobutanol, 16 mg/mL glycerin, and
14mM sodium phosphate at pH 7.8+0.1. The solution was then
hand-filtered using a glass syringe with an attached 0.22~m
syringe filter into a glass vial.
The principles, preferred embodiments and modes of
operation of the present invention have been described in the
foregoing specification. The invention which is intended to
be protected herein, however, is not to be construed as
limited to the particular forms disclosed, since they are to
be regarded as illustrative rather than restrictive.
Variations and changes may be made by those skilled in the
art without departing from the spirit of the invention.
