Note: Descriptions are shown in the official language in which they were submitted.
CA 02248868 1998-09-14
WO 97/349ll PCT/US96/16966
Apoptosis Inducing Molecule II
- Background of tlte Inven~ion
Field of the Invention
The present invention relates to a novel member of the TNF-Ligand
superfamily. More specifically, isolated nucleic acid molecules are provided
encoding a human Apoptosis Inducing Molecule II (AIM II). AIM II
polypeptides are also provided, as are vectors, host cells and recombinant
methods for producing the same. The invention further relates to screening
methods for identifying agonists and antagonists of AIM II activity. Also
I0 provided are therapeutic methods for treating Iymphadenopathy, autoimmune
disease, graft versus host disease, and to inhibit neoplasia, such as tumor cellgrowth.
Related Art
Human tumor necrosis factors a (TNF-a) and ~ (TNF-,B, or Iymphotoxin)
I5 are related members of a broad class of polypeptide mediators, which includes the
interferons, interleukins and growth factors, collectively called cytokines
(Beutler, B. and Cerami. A., Annu. Re~,. Immunol., 7:625-655 (1989)).
Tumor necrosis factor (TNF-a and TNF-~) was originally discovered as
a result of its anti-tumor activity, however, now it is recognized as a pleiotropic
cytokine capable of numerous biological activities including apoptosis of some
transformed cell lines, mediation of cell activation and proliferation and also as
playing important roles in immune regulation and infl~mm~tion.
To date, known members of the TNF-ligand superfamily include TNF-a,
TNF-~ (Iymphotoxin-a). LT-~, OX40L, Fas ligand, CD30L, CD27L, CD40L and
4-IBBL. The ligands of the TNF ligand superfamily are acidic, TNF-like
molecules with approximately 20% sequence homology in the extracellular
domains (range, 12%-36%) and exist mainly as membrane-bound forms with the
biologically active form being a trimeric/multimeric complex. Soluble forms of
CA 02248868 1998-09-14
W O 97/34911 PCT~U~96/16966
-2~
the TNF ligand superfamily have only been identified so far for TNF, LTo~, and
Fas ligand (for a general review, see Gruss, H. and Dower, S.K., Blood,
85(12):3378-3404 (1995)), which is hereby incorporated by reference in its
entirety.
These proteins are involved in regulation of cell proliferation, activation,
and differentiation, including control of cell survival or death by apoptosis orcytotoxicity (Arrnitage, R.J., Curr. Opin. Immunol. 6:407 (1994) and Smith,
C.A., Cell 75:959 (1994)).
Mamm~lian development is dependent on both the proliferation and
differentiation of cells as well as programmed cell death which occurs through
apoptosis (Walker, etal., MethodsAchiev. Exp. Pathol. 13:18 (1988). Apoptosis
plays a critical role in the destruction of immune thymocytes that recognize self
antigens. Failure of this normal elimin~tion process may play a role in
autoimmune diseases (Gammon et al., Immunology Today 12:193 (1991)).
Itoh et al. (Cell 66:233 (1991)) described a cell surface antigen, Fas/CD95
that mediates apoptosis and is involved in clonal deletion of T-cells. Fas is
expressed in activated T-cells, B-cells, neutrophils and in thymus, liver, heart and
lung and ovary in adult mice (Watanabe-Fllkun~g;~ et al., ~ Immunolo. 148: 1274
(1992)) in addition to activated T-cells, B-cells, neutorophils. In experiments
where a monoclonal Ab to Fas is cross-linked to Fas, apoptosis is induced
(Yonehara et al., J. Exp. Med 169:1747 (1989); Trauth et al., Science 245:301
(1989)). In addition, there is an example where binding of a monoclonal Ab to
Fas may stim~ t~ T-cells under certain conditions (Alderson et al., J. Exp. Med
1 78:2231 (1993)).
Fas antigen is a cell surface protein of relative MW of 45 Kd. Both
human and murine genes for Fas have been cloned by Watanabe-Fukunaga et al.,
(J. Immunol. 148: 1274 (1992)) and Itoh et al. (Cell 66:233 (1991)). The proteins
encoded by these genes are both transmembrane proteins with structural
homology to the Nerve Growth Factor/Tumor Necrosis Factor receptor
CA 02248868 1998-09-14
WO 97/34911 PCr/US96/16966
-3 -
superfamily, which includes two TNF receptors, the low affinity Nerve Growth
Factor receptor and the LT~ receptor CD40, CD27, CD30, and OX40.
Recently the Fas ligand has been described (Suda et al., Cell 75:II69
(1993)). The amino acid sequence indicates that Fas ligand is a type II
transmembrane protein belonging to the TNF farnily. Fas ligand is expressed in
splenocytes and thymocytes. The purified Fas ligand has a MW of 40 kd.
Recently, it has been demonstrated that Fas/Fas ligand interactions are
required for apoptosis following the activation of T-cells (Ju et al., Nature
373:444 (1995); Brunner et al., Nature 373:441 (1995)). Activation of T-cells
induces both proteins on the cell surface. Subsequent interaction between the
ligand and receptor results in apoptosis of the cells. This supports the possible
regulatory role for apoptosis in~ ced by Fas/Fas ligand interaction during normal
immune responses.
The polypeptide of the present invention has been identified as a novel
member of the TNF ligand super-family based on structural and biological
similarities.
Clearly, there is a need for factors that regulate activation, and
differentiation of normal and abnormal cells. There is a need, therefore, for
identification and characterization of such factors that modulate activation anddifferentiation of cells, both normally and in disease states. In particular, there
is a need to isolate and characterize additional Fas ligands that control apoptosis
ofr the treatment of autoimmune disease, graft versus host disease and
Iymphz~denopathy.
Summary of the Invention
The present invention provides isolated nucleic acid molecules comprising
a polynucleotide encoding the AIM II polypeptide having the arnino acid
sequence shown in Figures IA-C (SEQ ID NO:2) or the amino acid sequence
hE~ FltD SHEET (RUlE 91)
CA 02248868 1998-09-14
W O 97~4911 PCT~US96/16966
-4-
encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit
Number 97689 on August 22, 1996.
The present invention also relates to recombinant vectors, which include
the isolated nucleic acid molecules of the present invention, and to host cells
cont~ining the recombinant vectors, as well as to methods of making such vectorsand host cells and for using them for production of AIM II polypeptides or
peptides by recombinant techniques.
The invention further provides an isolated AIM II polypeptide having an
amino acid sequence encoded by a polynucleotide described herein.
As used herein the term "AIM II" polypeptide includes membrane-bound
proteins (comprising a cytoplasmic domain, a transmembrane domain, and an
extracellular domain) as well as truncated proteins that retain the AIM II
polypeptide activity. In one embodiment, soluble AIM II polypeptides comprise
all or part of the extracellular domain of an AIM II protein, but lack the
tr~n.cmsmbrane region that would cause retention of the polypeptide on a cell
membrane. Soluble AIM II may also include part of the transmembrane region
or part of the cytoplasmic domain or other sequences, provided that the soluble
AIM II protein is capable of being secreted. A heterologous signal peptide can
be fused to the N-t~rminuc of the soluble AIM II polypeptide such that the soluble
AIM II polypeptide is secreted upon expression.
The invention also provides for AIM II polypeptides, particularly human
AIM-II polypeptides, which may be employed to treat lymphadenopathy,
autoimmune disease, graft versus host disease, which may be used to stimulate
peripheral tolerance, destroy some transformed cell lines, mediate cell activation
and proliferation and are functionally linked as primary mediators of immune
regulation and infl~mm~tory response.
The invention further provides compositions comprising an AIM II
polynucleotide or an AIM II polypeptide for ~-lministration to cells in vitro, to
cells ex vivo and to cells in vivo. or to a multicellular org~ni~m In certain
particularly preferred embodiments of this aspect of the invention, the
CA 02248868 1998-09-14
WO 97134911 PCT/US96/16966
-5 -
compositions comprise an AIM II polynucleotide for expression of an AIM II
polypeptide in a host organism for tre~tment of disease. Particularly ple~"~d inthis regard is expression in a human patient for treatment of a dysfunction
associated with aberrant endogenous activity of an AIM II.
. The present invention also provides a screening method for identifyin$
compounds capable of enhancing or inhibiting a cellular response induced by
AIM II, which involves contacting cells which express AIM II with the candidate
compound, assaying a cellular response, and comparing the cellular response to
a standard cellular response, the standard being assyed when contact is made in
absence ofthe candidate compound; whereby, an increased cellular response over
the standard indicates that the compound is an agonist and a decreased cellular
response over the standard indicates that the compound is an antagonist.
In another aspect, a screening assay for AIM II agonists and antagonists
is provided. The antagonists may be employed to prevent septic shock,
inflzlrnm~tion, cerebral malaria, activation of the HIV virus, graft-host rejection,
bone resorption, rheumatoid arthritis and cachexia (wasting or malnutrition).
An additional aspect of the invention is related to a method for treating an
individual in need of an increased level of AIM II activity in the body comprising
a~mini~tPring to such an indivdual a composition comprising a therapeutically
effective amount of an isolated AIM II polypeptide of the invention or an agonist
thereof.
A still filrther aspect of the invention is related to a method for treating an
individual in need of a decreased level of AIM II activity in the body comprising,
~lmini~tering to such an individual a composition comprising a therapeutically
effective amount of an AIM II antagonist.
Brief Description of fhe Figures
Figures lA-C show the nucleotide (SEQ ID NO:l) and deduced amino
acid (SEQ ID NO:2) sequences of AIM II. The protein has a deduced molecular
P~EL;l l~ltD SHEEt (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCTrUS96/16966
-6-
weight of about 26.4 kDa. The predicted Transmembrane Domain of the AIM
II protein is underlined.
Figures 2A-F show the regions of similarity between the amino acid
sequences of the AIM II protein and human TNF-a (SEQ ID NO: 3), hurnan
TNF-~ (SEQ ID NO:4), human lymphotoxin (SEQ ID NO:5) and human Fas
Ligand (SEQ ID NO:6).
Figures 3A-F show an analysis of the AIM II amino acid sequence.
Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity;
amphipathic regions; flexible regions; antigenic index and surface probability are
shown. In the "Antigenic Index - Jameson-Wol~' graph, about amino acid
residues 13-20~ 23-36,69-79, 85-94, 167-178, 184-196, 221-233 in Figures lA-C
correspond to the shown highly antigenic regions of the AIM II protein.
Def~ile~1 Descrip~ion
The present invention provides isolated nucleic acid molecules comprising
a polynucleotide encoding an AIM II polypeptide having the amino acid
sequence shown in Figures lA-C (SEQ ID NO:2), which was determined by
sequencing a cloned cDNA. The AIM II protein of the present invention shares
sequence homology with human TNF-a (SEQ ID NO: 3), human TNF-~ (SEQ
ID NO:4), human Iymphotoxin (SEQ ID NO:5) and hurnan Fas Ligand (SEQ ID
NO:6) (Figures 2A-F). The nucleotide sequence shown in Figures lA-C (SEQ
ID NO: 1) were obtained by sequencing the a cDNA clone, which was deposited
on August 22, 1996 at the American Type Culture Collection, 12301 Park Lawn
Drive, Rockville~ Maryland 20852, and given accession number 97689. The
deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, La
Jolla, CA).
~t~;l lHtU SHEET (RULE 91)
CA 02248868 1998-09-14
WO 97/34911 PCT/US96/16966
--7 -
NucleicAcid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino
acid sequences of polypeptides encoded by DNA molecules det~rmine~ herein
were predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined by this
automated approach, any nucleotide sequence deterrnined herein may contain
some errors. Nucleotide sequences determined by automation are typically at
least about 90% identical, more typically at least about 95% to at least about
99.9% identical to the actual nucleotide sequence of the sequenced DNA
molecule. The actual sequence can be more precisely deterrnined by other
approaches including manual DNA sequencing methods well known in the art.
As is also known in the art, a single insertion or deletion in a determined
nucleotide sequence compared to the actual sequence will cause a frarne shift intranslation of the nucleotide sequence such that the predicted amino acid
sequence encoded by a determined nucleotide sequence will be completely
different from the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or deletion.
Using the information provided herein, such as the nucleotide sequence
in Figures lA-C, a nucleic acid molecule of the present invention encoding an
AIM II polypeptide may be obtained using standard cloning and screening
procedures, such as those for cloning cDNAs using mRNA as starting material.
Illustrative of the invention, the nucleic acid molecule described in Figures 1 A-C
(SEQ ID NO:1) was discovered in a cDNA library derived from human
macrophage ox LDL (HMCCB64). The gene was also identified in cDNA
libraries from activated T-cells (HT4CC72). The determined nucleotide sequence
of the AIM II cDNA of Figures l A-C (SEQ ID NO: 1 ) contains an open reading
frame encoding a protein of 240 amino acid residues, with an initiation codon at
REl;I l~ltLI SHEET (RULE 91)
CA 02248868 1998-09-14
W O 97~,4911 PCT~US96/16966
-8-
positions 49-51 ofthe nucleotide sequence in Figures lA-C (SEQ ID NO:1), an
extracellular domain comprising amino acid residues from about 60 to about 240
in Figures lA-C (SEQ ID NO:2), a transmembrane domain comprising amino
acid residues from about 37 to about 59 in Figures lA-C (SEQ ID NO:2), a
intracellular domain comprising amino acid residues from about 1 to about 36 in
Figures lA-C (SEQ ID NO:2) and a deduced molecular weight of about 26.4
kDa. The AIM II protein shown in Figures lA-C (SEQ ID NO:2) is about 27%
identical and about 51% similar to the amino acid sequence of human Fas
Ligand(Figures 2A-F) and is about 26% identical and about 47% similar to the
amino acid sequence of human TNF-c~ (Figures 2A-F).
As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors discussed above, the predicted AIM II polypeptide encoded by
the deposited cDNA comprises about 240 amino acids, but may be anywhere in
the range of 230-250 amino acids. It will further be appreciated that, depending~5 on the criteria used, concerning the exact "address" of the extracelluar,intracelluar and tr~n~m~rnhrane domains of the AIMII polypeptide differ slightly.
For example, the exact location of the AIM II extracellular domain in
Figures lA-C [SEQ ID NO:2] may vary slightly (e.g., the address may "shift" by
about 1 to 5 residues) depending on the criteria used to define the domain.
As indicated, nucleic acid molecules of the present invention may be in
the form of RNA, such as mRNA, or in the form of DNA, including, for instance,
cDNA and genomic DNA obtained by cloning or produced synthetically. The
DNA may be double-stranded or single-stranded. Single-stranded DNA or RNA
may be the coding strand, also known as the sense strand, or it may be the
non-coding strand, also referred to as the anti-sense strand.
By "isolated" nucleic acid molecule(s) is intended a nucleic acid molecule,
DNA or RNA, which has been removed from its native environment For
example, recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further examples of isolatedDNA molecules include recombinant DNA molecules m~ t~in~d in heterologous
flECI l~ltL~ SHEET (RU~E 91)
CA 02248868 1998-09-14
W O 97/34911 PCTAJS96/16966
g
host cells or purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA
molecules of the present invention. Isolated nucleic acid molecules according tothe present invention further include such molecules produced synthetically.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising an open reading frame (ORF) shown in Figures lA-C
(SEQ ID NO:1); DNA molecules comprising the coding sequence for the AIM
II protein shown in Figures lA-C (SEQ ID NO:2); and DNA molecules which
comprise a sequence substantially different from those described above but
which, due to the degeneracy of the genetic code, still encode the AIM II protein.
Of course, the genetic code is well known in the art. Thus, it would be routine for
one skilled in the art to generate such degenerate variants.
In another aspect, the invention provides isolated nucleic acid molecules
encoding the AIM II polypeptide having an arnino acid sequence encoded by the
cDNA clone cont~inlod in the plasmid deposited as ATCC Deposit No. 97689 on
August 22, 1996. Preferably, this nucleic acid molecule will encode the
polypeptide encoded by the above-described deposited cDNA clone. The
invention further provides an isolated nucleic acid molecule having the nucleotide
sequence shown in Figures lA-C (SEQ ID NO:l) or the nucleotide sequence of
the AIM II cDNA contained in the above-described deposited clone, or a nucleic
acid molecule having a sequence complementary to one of the above sequences.
Such isolated molecules, particularly DNA molecules, are useful as probes for
gene mapping, by in situ hybridization with chromosomes, and for detecting
expression of the AIM II gene in human tissue, for instance, by Northern blot
analysis.
The present invention is further directed to fragments of the isolated
nucleic acid molecules described herein. By a fragment of an isolated nucleic
acid molecule having the nucleotide sequence of the deposited cDNA or the
nucleotide sequence shown in Figures lA-C (SEQ ID NO:1) is intended
fr~gment~ at least about 15 nt. and more preferably at least about 20 nt, still more
~tE(;~I~ltu SHEET (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCTAJS96/16966
-10-
preferably at }east about 30 nt, and even more ,vrere ably, at least about 40 nt in
length which are useful as diagnostic probes and primers as ~isc~ssed herein. Ofcourse, larger fr~nPntc 50-1500 nt in length are also useful ncc~ d.ng to the
present invention as are fra~n~nt~ corresponding to most, if not all, of the
nucleotide sequpnre ofthe deposited cDNA or as shown in Figures lA-C (SEQ
ID NO:l). By a fragment at least 20 nt in length, for ex~mple, is int~n~ed
fr~gmentc which include 20 or more conti~lQus bases from the nucleotide
sequence of the deposited cDNA or the nucleotide sequence as shown in
Figures lA-C (SEQ ID NO: 1).
~le~.,ed nucleic acid fr~ ntc ofthe present invention include nucleic
acid molecules encoding epitope-bearing portions of the AIM II protein. In
particular, such nucleic acid L~-..~.11~ ofthe present invention include nucleic acid
m~lo~les ~ o~ g a polypeptide co..,~ g amino acid residues from about 13
to about 20 in Figures lA-C (SEQ ID NO:2); a polypeptide comprising amino
acid residues from about 23 to about 36 in Figures lA-C (SEQ ID N0:2); a
polypeptide c<,...~ , amino acid residues from about 69 to about 79 in Figures
lA-C (SEQ D~ NO:2); a polypeptide comprising arnino acid residues from about
85 to about 94 in Figures lA-C (SEQ ID NO:2);a polypeptide comprising amino
acid residues from about 167 to about 178 in Figures lA-C (SEQ ID NO:2);a
polypeptide co~ ,.isillg amino acid residues from about 184 to about 196 in
Figures lA-C (SEQ ID NO:2); and a polypeptide co-.,p.i~ g amino acid residues
from about 221 to about 233 in Figures lA-C (SEQ ID NO:2). The inventors
have determined that the above poly~ytide fr~ ntc are ~n~ig~nic. regions of the
AIM II protein. Methods for dete~ning other such epitope-bearing portions of
the AIM II protein are desclil,ed in detail below.
AIM-II polynucleotides may be used in accordal~ce with the present
invention for a variety of applications, particularly those that make use of thech~mic~l and biological p-up~-lies ofthe AIM-II. Among these applications in
P~El.;ll~ltD SHEET ~RULE 91~
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
- 1 1 -
autoimml-ne disease and aberrant cellular proliferation. Additional applicationsrelate to diagonsis and to treatment of disorders of cells, tissues, and org~nism~.
This invention is also related to the use of the AIM-II polynucleotides to
detect complement~ry polynucleotides such as, for example, as a diagnostic
reagent. Detection of a mutated form of an AIM-II associated with a dysfunction
will provide a diagnostic tool that can add or define a diagnosis of a disease or
susceptibility to disease which reults from under-expression, over-expression oraltered expression of AIM-II, such as, for example, autoimmune diseases. The
polynucleotide encoding the AIM-II may also be employed as a diagnostic
marker for expression of the polypeptide of the present invention since the geneis found in many tumor cell lines including pancreatic tumor, testes tumor,
endometrial tumor and T-cell Iymphoma.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising a polynucleotide which hybridizes under stringent hybridization
conditions to a portion of the polynucleotide in a nucleic acid molecule of the
invention described above, for instance, the cDNA clone contained in ATCC
Deposit 97689. By "stringent hybridization conditions" is intended overnight
incubation at 42~C in a solution comprising: 50% formamide, Sx SSC (150 mM
NaCI, 1 SmM trisodium citrate), S0 mM sodium phosphate (pH 7.6), Sx
Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon
sperm DNA, followed by washing the filters in O.lx SSC at about 65~C.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide
is intended a polynucleotide (either DNA or RNA) hybridizing to at least about
l S nucleotides (nt), and more preferably at least about 20 nt, still more preferably
at least about 30 nt, and even more preferably about 30-70 nt of the reference
polynucleotide. These are useful as diagnostic probes and primers as discussed
above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for example,
is intended 20 or more contiguous nucleotides from the nucleotide sequence of
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-12-
the reference polynucleotide (e.g., the deposited cDNA or the nucleotide
sequence as shown in Figures lA-C (SEQ ID NO:1)).
Of course, a polynucleotide which hybridizes only to a poly A sequence
(such as the 3' termin~l poly(A) tract of the AIM II cDNA shown in
Figures lA-C (SEQ ID NO:1)), or to a complementary stretch of T (or U) resides,
would not be included in a polynucleotide of the invention used to hybridize to
a portion of a nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule cont~ining a poly (A) stretch or the
complement thereof (e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which
encode an AIM II polypeptide may include, but are not limited to those encoding
the amino acid sequence of the polypeptide, by itself; the coding sequence for the
polypeptide and additional sequences, such as those encoding a leader or
secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding
sequence of the polypeptide, with or without the aforementioned additional
coding sequences, together with additional, non-coding sequences, including for
example, but not limited to introns and non-coding 5' and 3 ' sequences, such asthe transcribed, non-tr~n~l~te~l sequences that play a role in transcription, mRNA
processing, including splicing and polyadenylation signals, for example -
ribosome binding and stability of mRNA; an additional coding sequence which
codes for additional amino acids, such as those which provide additional
functionalities. Thus, the sequence encoding the polypeptide may be fused to a
marker sequence, such as a sequence encoding a peptide which facilitates
purification of the fused polypeptide. In certain prer~lled embodiments of this
aspect of the invention, the marker amino acid sequence is a hexa-histidine
peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others,
many of which are commercially available. As described in Gentz et al., Proc.
Natl. Acad. Sci. USA 86:821-824 (1989), for in~t~n~e, hexa-histidine provides for
convenient purification of the fusion protein. The "HA" tag is another peptide
useful for purification which corresponds to an epitope derived from the influenza
R~;l IFIEU SHEET (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-13-
hen~gplutinin protein, which has been described by Wilson et al., Cell 37: 767
(1984). As (1i~cu~ed below, other such fusion proteins include the AIM II fused
to Fc at the N- or C-t~rrninlls.
Nucleic acid molecules according to the present invention further include
those encoding the full-length AIM-II polypeptide lacking the N-tçnnin:~l
methonine.
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode portions, analogs or derivatives
of the AIM II protein. Variants may occur naturally, such as a natural allelic
variant. By an "allelic variant" is intended one of several alternate forms of agene occupying a given locus on a chromosome of an organism. Genes Il, Lewin,
B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants
may be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions,
deletions or additions which may involve one or more nucleotides. The variants
may be altered in coding regoins, non-coding regions, or both. Alterations in the
coding regions may produce conservative or non-conservative amino acid
substitutions, deletions or additions. Especially preferred among these are silent
substitutions, additions and deletions, which do not alter the properties and
activities of the AIM II protein or portions thereof. Also especially preferred in
this regard are conservative substitutions.
Further embotliment.~ of the invention include isolated nucleic acid
molecules comrn ~ing a polynucleotide having a nucleotide sequence at least 90%
identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to
(a) a nucleotide sequence encoding the AIM II polypeptide having the complete
amino acid sequence in Figures IA-C (SEQ ID NO:2); (b) a nucleotide sequence
encoding the AIM II polypeptide having the complete amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 97689; (c) a
nucleotide sequence encoding the AIM II polypeptide extracellular domain; (d~
a nucleotide sequence encoding the AIM II polypeptide transmembrane domain;
~ct~ ltU SHEET (RULE 91)
CA 02248868 1998-09-14
W O 97~4911 PCTAJS96/16966
-14-
(e) a nucleotide sequence encoding the AIM II polypeptide intracellular domain;
(f) a nucleotide sequence encoding a soluble AIM II polypeptide having the
extracellular and intracellular domains but lacking the transmembrane domain;
and (g) a nucleotide sequence compl~ment~ry to any of the nucleotide sequences
in (a), (b), (c), (d), (e) or (f) above.
By a polynucleotide having a nucleotide sequence at least, for exarnple,
95% "identical" to a reference nucleotide sequence encoding an AIM II
polypeptide is intended that the nucleotide sequence of the polynucleotide is
identical to the reference sequence except that the polynucleotide sequence may
include up to five point mutations per each 100 nucleotides of the reference
nucleotide sequence encoding the AIM II polypeptide. In other words, to obtain
a polynucleotide having a nucleotide sequence at least 95% identical to a
reference nucleotide sequence, up to 5% of the nucleotides in the reference
sequence may be deleted or substituted with another nucleotide, or a number of
nucleotides up to 5% of the total nucleotides in the reference sequence may be
inserted into the reference sequence. These mutations of the reference sequence
may occur at the 5 ' or 3 ' termin~l positions of the reference nucleotide sequence
or anywhere between those terminal positions, interspersed either individually
among nucleotides in the reference sequence or in one or more contiguous groups
within the reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least 90%, 95%, 96%, 97%, 98% or 99% identical to, for in~t~n~e, the nucleotide
sequence shown in Figures lA-C or to the nucleotides sequence of the deposited
cDNA clone can be determined conventionally using known computer programs
such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8
for Unix, Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, WI 53711. Bestfit uses the local homology algorithm of Smith
and W~t~ n, ~ldvances in Applied Mathematics 2: 482-489 (1981), to find the
best segment of homology between two sequences. When using Bestfit or any
other sequence alignment program to determine whether a particular sequence is,
t~t~ ltu S~lEET (RULE 91~
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-15-
for instance, 95% identical to a reference sequence according to the present
invention, the parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference nucleotide sequence and thatgaps in homology of up to 5% of the total number of nucleotides in the referencesequence are allowed.
The present application is directed to nucleic acid molecules at least 90%,
95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
Figures lA-C (SEQ ID NO:1) or to the nucleic acid sequence of the deposited
cDNA, irrespective of whether they encode a polypeptide having AIM II activity.
This is because even where a particular nucleic acid molecule does not encode a
polypeptide having AIM II activity, one of skill in the art would still know howto use the nucleic acid molecule, for instance, as a hybridization probe or a
polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of
the present invention that do not encode a polypeptide having AIM II activity
include, inter alia, (1) isolating the AIM II gene or allelic variants thereof in a
cDNA library; (2) in situ hybridization (e.g., "FISH") to met~ph~e chromosomal
spreads to provide precise chromosomal location of the AIM II gene, as describedin Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon
Press, New York (1988); and Northern Blot analysis for detecting AIM II
mR~A expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least
90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown
in Figures lA-C (SEQ ID NO: 1) or to the nucleic acid sequence of the deposited
cDNA which do, in fact, encode a polypeptide having AIM II protein activity.
By "a polypeptide having AIM II activity" is intended polypeptides exhibiting
activity similar, but not nece~.s~rily identical, to an activity of the AIM II protein
of the invention, as measured in a particular biological assay. For example, AIMII protein cytotoxic activity can be measured using propidium iodide staining todemonstrate apoptosis as described by Zarres et al., Cell 70: 31-46 (1992).
~tl;l I~l~D SHEFI ~RULE 9~)
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-16-
Altematively, AIMII ind~cecl apoptosis can also be measured using TUNEL
staining as described by Gavierli et al., J. Cell. Biol. 119: 493-501 (1992).
Briefly, the propidium iodide staining is perfommed as follows. Cells
either from tissue or culture are fixed in fomlaldehyde, cut into frozen sections
and stained with propidium iodide. The cell nuclei are visualized by propidiurn
iodide using confocal fluorescent microscopy. Cell death is indicated by pyknotic
nuclei ( chromosome clurnping, shrinking and/or fragmentation of nuclei).
Of course, due to the degeneracy ofthe genetic code, one of ordinary skill
in the art will immediately recognize that a large number of the nucleic acid
molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99%
identical to the nucleic acid sequence of the deposited cDNA or the nucleic acidsequence shown in Figures lA-C (SEQ ID NO:l) will encode a polypeptide
"having AIM II protein activity." In fact, since degenerate variants of these
nucleotide sequences all encode the same polypeptide, this will be clear to the
skilled artisan even without perfomming the above described comparison assay.
It will be further recognized in the art that, for such nucleic acid molecules that
are not degenerate variants, a reasonable number will also encode a polypeptide
having AIM II protein activity. This is because the skilled artisan is fully aware
of amino acid substitutions that are either less likely or not likely to significantly
effect protein function (e.g., replacing one aliphatic amino acid with a second
aliphatic amino acid).
For example, guidance conceming how to make phenotypically silent
amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science
2~7:1306-1310 (1990), wherein the authors indicate that proteins are surprisingly
tolerant of amino acid substitutions.
RECIIFIED SHEEr (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCTAUS96tl6966
-17-
Vectors and Host Cells
The present invention also relates to vectors which include the isolated
DNA molecules of the present invention, host cells which are genetically
engineered with the recombinant vectors, and the production of AIM II
polypeptides or fragments thereof by recombinant techniques.
The polynucleotides may be joined to a vector cont~;ning a selectable
marker for propagation in a host. Generally, a plasmid vector is introduced in aprecipitate, such as a calcium phosphate precipitate, or in a complex with a
charged lipid. If the vector is a virus, it may be packaged in vitro using an
appropriate packaging cell line and then transduced into host cells.
The DNA insert should be operatively linked to an appropl;ate promoter,
such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the
SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
Other suitable promoters will be known to the skilled artisan. The expression
constructs will fùrther contain sites for transcription initiation, terrnin~tion and,
in the transcribed region, a ribosome binding site for translation. The coding
portion of the mature transcripts expressed by the constructs will preferably
include a translation initiating at the beginning and a termination codon (UAA,
UGA or UAG) ~pplopliately positioned at the end of the polypeptide to be
tr~n~l~te~l
As indicated, the expression vectors will preferably include at least one
selectable marker. Such markers include dihydrofolate reductase or neomycin
resi.~t~nce for eukaryotic cell culture and tetracycline or arnpicillin resistance
genes for culturing in E. coli and other bacteria. Representative examples of
app~opliate hosts include. but are not limited to, bacterial cells, such as E. coli,
Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells;
insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as
CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture
mediums and conditions for the above-described host cells are known in the art.
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-18-
Among vectors preferred for use in bacteria include pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
Among preferred eukaryotic vectors are pW~NEO, pSV2CAT, pOG44, pXT1
and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Pharrnacia. Other suitable vectors will be readily apparent to the
skilled artisan.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-dextran mediated transfection, cationic
lipid-mediated transfection, electroporation, transduction, infection or other
methods. Such methods are described in many standard laboratory m~nu~l~, such
as Davis et al., Basic Methods In Molecular Biology (1986).
The polypeptide may be expressed in a modified form, such as a fusion
protein, and may include not only secretion signals, but also additional
heterologous functional regions. For instance, a region of additional amino acids,
particularly charged amino acids, may be added to the N-terminus of the
polypeptide to improve stability and persistence in the host cell, during
purification or during subsequent h~n~lling and storage. Also, peptide moieties
may be added to the polypeptide to facilitate purification. Such regions may be
removed prior to final preparation of the polypeptide. The addition of peptide
moieties to polypeptides to engender secretion or excretion, to improve stability
and to facilitate purification, among others, are f~milis~r and routine techniques
in the art. A plefel,ed fusion protein comprises a heterologous region from
immunoglobulin that is useful to solubilize proteins. ~or example, EP-A-O 464
533 (C~n~ n counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with another
human protein or part thereof. In many cases, the Fc part in a fusion protein isthoroughly advantageous for use in therapy and diagnosis and thus results, for
example~ in improved pha~nacokinetic properties (EP-A 0232 262). On the other
CA 02248868 1998-09-14
WO 97/34911 PCT/US96/16966
_19_
hand, for some uses it would be desirable to be able to delete the Fc part after the
fusion protein has been expressed, detected and purified in the advantageous
manner described. This is the case when Fc portion proves to be a hindrance to
use in therapy and diagnosis, for example when the fusion protein is to be used
S as antigen for immunizations. In drug discovery, for example, human proteins,
such as, hIL5- has been fused with Fc portions for the purpose of high-throughput
screening assays to identify antagonists of hIL-5. See, D. Bennett et al., Journal
of Molecular Recognition, Vol. 8:52-58 (1995) and K. Johanson et al., The
Journal of Biological Chemistry, Vol. 270, No. 16:9459-9471 (1995).
The AIM II protein can be recovered and purified from recombinant cell
cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction~chromatography,
affinity chromatography, hydroxylapatite chromatography and lectin
chromatography. Most preferably, high performance liquid chromatography
("HPLC") is employed for purification. Polypeptides of the present invention
include naturally purified products, products of chemical synthetic procedures,
and products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and
m~mm~ n cells. Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present invention may be
glycosylated or may be non-glycosylated. In addition, polypeptides of the
invention may also include an initial modified methionine residue, in some casesas a result of host-mediated processes.
AIMII Polypeptides and Frag~ "l~
The invention further provides an isolated AIM II polypeptide having the
amino acid sequence encoded by the deposited cDNA, or the amino acid
sequence in Figures lA-C (SEQ ID NO:2), or a peptide or polypeptide
comprising a protion of the above polypeptides.
RtCl~lw SHEET (RULE 91~
CA 02248868 1998-09-14
W O 97134911 PCT~US96/16966
-20-
It will be recognized in the art that some amino acid sequences of the
AIM II polypeptide can be varied without significant effect of the structure or
function of the protein. If such differences in sequence are contemplated, it
should be remembered that there will be critical areas on the protein which
~letçrmine activity.
Thus, the invention further includes variations of the AIM II polypeptide
which show substantial AIM II polypeptide activity or which include regions of
AIM II protein such as the protein portions discussed below. Such mutants
include deletions, insertions, inversions, repeats, and type substitutions. As
indicated above, guidance concerning which amino acid changes are likely to be
phenotypically silent can be found in Bowie, J.U., et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science
247:1306-1310 (1990).
Thus, the fragment, derivative or analog of the polypeptide of
Figures lA-C (SEQ ID NO:2), or that encoded by the deposited cDNA, may be
(i) one in which one or more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably a conserved amino
acid residue) and such substituted amino acid residue may or may not be one
encoded by the genetic code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii) one in which the mature polypeptide
is fused with another compound, such as a compound to increase the half-life of
the polypeptide (for example, polyethylene glycol), or (iv) one in which the
additional amino acids are fused to the mature polypeptide, such as an IgG Fc
fusion region peptide or leader or secretory sequence or a sequence which is
employed for purification of the mature polypeptide or a proprotein sequence.
Such fr~gment.s, derivatives and analogs are deemed to be within the scope of
those skilled in the art from the teachings herein.
Of particular interest are substitutions of charged amino acids with
another charged amino acid and with neutral or negatively charged amino acids.
The latter results in proteins with reduced positive charge to improve the
ht~ ltU StlEr (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCTAJS96/16966
-21-
characteristics of the AIM II protein. The prevention of aggregation is highly
desirable. Aggregation of proteins not only results in a loss of activity but can
also be problematic when preparing pharmaceutical formulations, because they
can be immunogenic. (Pinckard et al., Clin Exp. Immunol. 2:331-340 (1967);
Robbins et al., Diabetes 36:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic
Drug Carrier Systems 10:307-377 (1993)).
The replacement of arnino acids can also change the selectivity of binding
to cell surface receptors. Ostade et al., Na~ure 361:266-268 (1993) describes
certain mutations resulting in selective binding of TNF-o~ to only one of the two
known types of TNF receptors. Thus, the AIM II receptor of the present
invention may include one or more amino acid substitutions, deletions or
additions, either from natural mutations or human manipulation.
As indicated, changes are preferably of a minor nature, such as
conservative amino acid substitutions that do not significantly affect the folding
or activity of the protein (see Table 1).
TABLE 1. Conservative Amino Acid Substitutions.
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic Leucine
Isoleucine
Valine
Polar Glutamine
Asparagine
20 Basic Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-22-
Amino acids in the AIM II protein of the present invention that are
essential for function can be identified by methods known in the art, such as site-
directed mutagenesis or alanine-sç~nning mutagenesis (Cllnnin~h~m and Wells,
Science 244:1081-1085 (1989)). The latterprocedure introduces single alanine
mutations at every residue in the molecule. The resulting mutant molecules are
then tested for biological activity such as receptor binding or in vitro, or in vitro
proliferative activity. Sites that are critical for ligand-receptor binding can also
be determined by structural analysis such as cryst~lli7~tion, nuclear magnetic
resonance or photoaffinity labeling (Smith et al., J. Mol. 13iol. 224:899-904
(1992) and de Vos etal. Science 255:306-312 (1992)).
The polypeptides of the present invention are preferably provided in an
isolated form. By "isolated polypeptide" is intended a poypeptide removed from
its native environment. Thus, a polypeptide produced and contained within a
recombinant host cell is considered "isolated" for purposes of the present
invention. Also int~n~led as an "isolated polypeptide" are polypeptides that have
been purified, partially or subst~nti~lly, from a recombinant host. For example,a recombinantly produced version of the AIM II polypeptide can be subst~nti~lly
purified by the one-step method described in Smith and Johnson, Gene 67:31-40
(1988).
The polypeptides ofthe present invention include the polypeptide encoded
by the deposited cDNA, the polypeptide of Figures lA-C (SEQ ID NO:2), the
polypeptide of Figures lA-C (SEQ ID NO:2) lacking the N-terminal methinone,
the extracellular domain, the transmembrane domain, the intracellular domain,
soluble polypeptides comprising all or part of the extracellular and intracelluar
domains but lacking the transmembrane domain, as well as polypeptides which
are at least 80% identical, more preferably at least 90% or 95% identical, stillmore preferably at least 96%, 97%, 98% or 99% identical to the polypeptide
encoded by the deposited cDNA, to the polypeptide of Figures lA-C (SEQ ID
NO:2), and also include portions of such polypeptides with at least 30 amino
acids and more preferably at least 50 amino acids.
nt~ D SHEEr(F(ULE 91
CA 02248868 1998-09-14
WO 97/34911 PCT/US96/16966
-23-
By a polypeptide having an amino acid sequence at least, for exarnple,
95% "identical" to a reference amino acid sequence of an AIM II polypeptide is
intended that the amino acid sequence of the polypeptide is identical to the
reference sequence except that the polypeptide sequence may include up to five
amino acid alterations per each 100 amino acids of the reference amino acid of
the AIM II polypeptide. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a reference amino acid sequence, up to 5%
of the amino acid residues in the reference sequence may be deleted or substituted
with another amino acid, or a number of amino acids up to 5% of the total amino
acid residues in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at the amino or
carboxy terminal positions of the reference amino acid sequence or anywhere
between those termin~l positions, interspel~ed either individually among residues
in the reference sequence or in one or more contiguous groups within the
reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%, 97%, 98% or 99% identical to, for in.~t~nce, the amino acid sequence
shown in Figures IA-C (SEQ ID NO:2) or to the amino acid sequence encoded
by deposited cDNA clone can be determined conventionally using known
computer programs such the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8 for Unix, Genetics Computer Group, University Research
Park, 575 Science Drive, Madison, WI 53711. When using Bestfit or any other
sequence alignment program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the present
invention, the parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference amino acid sequence and thatgaps in homology of up to 5% of the total number of amino acid residues in the
reference sequence are allowed.
As used herein the term "AIM II" polypeptide includes membrane-bound
proteins (comprising a cytoplasmic domain, a transmembrane domain, and an
RE~ IFEClSIIEEr(RULE91)
CA 02248868 1998-09-14
W O 97t34911 PCTAJS96/16966
-24-
extracellular domain) as well as truncated proteins that retain the AIM II
polypeptide activity. In one embodiment, soluble AIM II polypeptides comprise
all or part of the extracellular domain of an AIM II protein, but lack the
tr~n.~m~mbrane region that would cause retention of the polypeptide on a cell
membrane. Soluble AIM II may also include part of the tr~n~memhrane region
or part of the cytoplasmic domain or other sequences, provided that the soluble
AIM II protein is capable of being secreted. A heterologous signal peptide can
be fused to the N-terminus of the soluble AIM II polypeptide such that the soluble
AIM II polypeptide is secreted upon expression.
The polypeptide of the present invention could be used as a molecular
weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns
using methods well known to those of skill in the art.
In another aspect, the invention provides a peptide or polypeptide
comprising an epitope-bearing portion of a polypeptide of the invention. The
epitope of this polypeptide portion is an immunogenic or antigenic epitope of a
polypeptide described herein. An "immunogenic epitope" is defined as a part of
a protein that elicits an antibody response when the whole protein is the
immunogen. On the other hand, a region of a protein molecule to which an
antibody can bind is defined as an "antigenic epitope." The number of
immunogenic epitopes of a protein generally is less than the number of antigenicepitopes. See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-
4002 (1983).
As to the selection of peptides or polypeptides bearing an antigenic
epitope (i.e., that contain a region of a protein molecule to which an antibody can
bind), it is well known in that art that relatively short synthetic peptides that
mimic part of a protein sequence are routinely capable of eliciting an antiserumthat reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G.,
Shinnick, T. M., Green, N. and Learner, R.A. (1983) Antibodies that react with
predeterrnined sites on proteins. Science 219:660-666. Peptides capable of
eliciting protein-reactive sera are frequently represented in the primary sequence
CA 02248868 1998-09-14
W O 97/34911 PCT~US96tl6966
-25-
of a protein, can be characterized by a set of simple chemical rules, and are
confined neither to immunodominant regions of intact proteins (i.e.,
immunogenic epitopes) nor to the amino or carboxyl terminals.
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore useful to raise antibodies, including monoclonal antibodies, that bindspecifically to a polypeptide of the invention. See, for instance, Wilson et al. Cell
37. 767-778 (1984) at 777.
Antigenic epitope-bearing peptides and polypeptides of the invention
preferably contain a sequence of at least seven, more preferably at least nine and
most preferably between about at least about 15 to about 30 amino acids
contained within the amino acid sequence of a polypeptide of the invention.
Non-limiting examples of antigenic polypeptides or peptides that can be
used to generate AIM II-specific antibodies include: a polypeptide comprising
amino acid residues from about 13 to about 20 in Figures lA-C (SEQ ID NO:2);
a polypeptide comprising amino acid residues from about 23 to about 36 in
Figures lA-C (SEQ ID NO:2); a polypeptide comprising amino acid residues
from about 69 to about 79 in Figures lA-C (SEQ TD NO:2); a polypeptide
comprising amino acid residues from about 85 to about 94 in Figures lA-C (SEQ
ID NO:2);a polypeptide comprising amino acid residues from about 167 to about
178 in Figures lA-C (SEQ ID NO:2); a polypeptide comprising amino acid
residues from about 184 to about 196 in Figures lA-C (SEQ ID NO:2); and a
polypeptide comprising amino acid residues from about 221 to about 233 in
Figures lA-C (SEQ ID NO:2). As indicated above, the inventors have
determined that the above polypeptide fragments are antigenic regions of the AIMII protein.
The epitope-bearing peptides and polypeptides of the invention may be
produced by any conventional means. Houghten, R. A. (1985) General method
for the rapid solid-phase synthesis of large numbers of peptides: specificity ofantigen-antibody interaction at the level of individual amino acids. Proc. Natl.Acad. Sci USA 82:5131-5135. This "Simultaneous Multiple Peptide Synthesis
RE~ lt~ SHEET (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCTAJS96/16966
-26-
(SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten
etal. (1986).
The AIM II polypeptide of the present invention may be employed to treat
lymphoproliferative disease which results in lymphadenopathy, the AIM II
mediates apoptosis by stimulating clonal deletion of T-cells and may therefore,
be employed to treat autoimmune disease, to stimulate peripheral tolerance and
cytotoxic T-cell mediated apoptosis. The AIM II may also be employed as a
research tool in elucidating the biology of autoimmune disorders including
systemic lupus erythematosus (SLE), immunoproliferative disease
lymphadenopathy (IPL), angioimmunoproliferative Iymphadenopathy (AIL),
immunoblastive lymphadenopathy (IBL), rheumatoid arthritis, diabetes, and
multiple sclerosis, allergies and to treat graft versus host disease.
The AIM II polypeptide of the present invention may also be employed
to inhibit neoplasia, such as turnor cell growth. The AIM II polypeptide may be
responsible for tumor destruction through apoptosis and cytotoxicity to certain
cells. AIM II may also be employed to treat diseases which require gro~,vth
promotion activity, for example, restenosis, since AIM II has proliferation effects
on cells of endothelial origin. AIM II may, therefore, also be employed to
regulate hematopoiesis in endothelial cell development.
This invention also provides a method for identification of molecules,
such as receptor molecules, that bind AIM II. Genes encoding proteins that bind
AIM II, such as receptor proteins, can be identified by numerous methods known
to those of skill in the art, for exarnple, ligand panning and FACS sorting. Such
methods are described in many laboratory m~nll~l.c such as, for instance, Coligan
et al, C~rren~ Protocols in Imm2mology, 1(2):Chapter 5 (1991).
For instance, expression cloning may be employed for this purpose. To
this end polyadenyiated RNA is prepared from a cell responsive to AIM II, a
cDNA library is created from this RNA, the library is divided into pools and thepools are transfected individually into cells that are not responsive to AIM II.The transfected cells then are exposed to labeled AIM II. (AIM II can be labeled
CA 02248868 1998-09-14
W O 97/34911 PCTAUS96/16966
-27-
by a variety of well-known techniques including standard methods of
radio-iodination or inclusion of a recognition site for a site-specific protein
kinase.) Following exposure, the cells are fixed and binding of AIM II is
determined. These procedures conveniently are carried out on glass slides.
Pools are identified of cDNA that produced AIM II-binding cells.
Sub-pools are prepared from these positives, transfected into host cells and
screened as described above. Using an iterative sub-pooling and re-screening
process, one or more single clones that encode the putative binding molecule,
such as a receptor molecule, can be isolated.
Alternatively a labeled ligand can be photo affinity linked to a cell extract,
such as a membrane or a membrane extract, prepared from cells that express a
molecule that it binds, such as a receptor molecule. Cross-linked material is
resolved by polyacrylarnide gel electrophoresis ("PAGE") and exposed to X-ray
film. The labeled complex cont~ining the ligand-receptor can be excised,
resolved into peptide fragments, and subjected to protein microsequencing. The
amino acid sequence obtained from microsequencing can be used to design
unique or degenerate oligonucleotide probes to screen cDNA libraries to identifygenes encoding the putative receptor molecule.
Polypeptides of the invention also can be used to assess AIM II binding
capacity of AIM II binding molecules, such as receptor molecules, in cells or incell-free preparations.
As one of skill in the art will appreciate, AIM II polypeptides of the
present invention and the epitope-bearing fragments thereof described above can
be combined with parts of the constant domain of immunoglobulins (IgG),
resulting in chimeric polypeptides. These fusion proteins facilitate purification
and show an increased half-life in vivo. This has been shown, e.g., for chimericproteins consisting of the first two domains of the hurnan CD4-polypeptide and
various domains of the constant regions of the heavy or light chains of
m~mm~ n imrnunoglobulins (EPA 394,827; Traunecker et al., Na-ure 331:84-
86 (1988)). Fusion proteins that have a disulfide-linked dimeric structure due to
CA 02248868 1998-09-14
W O 97/34911 PCTAUS96/16966
-28-
the IgG part can also be more efficient in binding and neutralizing other
molecules than the monomeric AIM II protein or protein fragment alone
(Fountoulakis et al., JBiochem 270:3958-3964 (1995)).
The present inventors have discovered that AIM II is expressed in spleen,
S thymus and bone marrow tissue. For a number of disorders, such as septic
shock, infl:~mm~tion, cerebral malaria, activation of the HIV virus, graft-host
rejection, bone resorption, rheumatoid arthritis and cachexia, it is believed that
significantly higher or lower levels of AIM II gene expression can be detected in
certain tissues (e.g., spleen, thymus and bone marrow tissue) or bodily fluids
(e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an
individual having such a disorder, relative to a "standard" AIM II gene
expression level, i.e., the AIM II expression level in tissue or bodily fluids from
an individual not having the disorder. Thus, the invention provides a diagnosticmethod useful during diagnosis of a disorder, which involves: (a) assaying AIM
II gene expression level in cells or body fluid of an individual; (b) comparing the
AIM II gene expression level with a standard AIM II gene expression level,
whereby an increase or decrease in the assayed AIM II gene expression level
compared to the standard expression level is indicative of a disorder.
AIMII Agonists and Antagonists
The invention also provides a method of screening compounds to identify
those which ~nh:~nce or block the action of AIM II on cells, such as its interaction
with AIM II-binding molecules such as receptor molecules. An agonist is a
compound which increases the natural biological functions of AIM II or which
functions in a manner similar to AIM II. while antagonists decrease or elimin~te~
such functions.
For example, a cellular co~ )al ~lnent, such as a membrane preparation,
may be prepared from a cell that expresses a molecule that binds AIM II, such asa molecule of a signaling or regulatory pathway modulated by AIM II. The
CA 02248868 1998-09-14
Wo 97/34911 PCT/USg6/16966
-29-
preparation is incubated with labeled AIM II in the absence or the presence of acandidate molecule which may be an AIM II agonist or antagonist. The ability
of the candidate molecule to bind the binding molecule or AIM II itself is
reflected in decreased binding of the labeled ligand. Molecules which bind
gratuitously, i. e., without inducing the effects of AIM II when bound to the AIM
II binding molecule, are most likely to be good antagonists. Molecules that bindwell and elicit effects that are the same as or closely related to AIM II, are good
agonists.
AIM II-like effects of potential agonists and antagonists may by
measured, for instance, by determining activity of a second messenger system
following interaction of the candidate molecule with a cell or appropl;ate cell
p,epaldlion, and comparing the effect with that of AIM II or molecules that elicit
the same effects as AIM II. Second mes~nger systems that may be useful in this
regard include but are not limited to AMP guanylate cyclase, ion channel or
phosphoinositide hydrolysis second messenger systems.
Another example of an assay for AIM II antagonists is a competitive assay
that combines AIM II and a potential antagonist with membrane-bound AIM II
receptor molecules or recombinant AIM II receptor molecules under appropriate
conditions for a competitive inhibition assay. AIM II can be labeled, such as byradioactivity, such that the number of AIM II molecules bound to a receptor
molecule can be deterrnined accurately to assess the effectiveness of the potential
antagonist.
Potential antagonists include small organic molecules, peptides,
polypeptides and antibodies that bind to a polypeptide of the invention, and
thereby inhibit or extinguish its activity. Potential antagonists also may be small
organic molecules, a peptide, a polypeptide such as a closely related protein orantibody that binds the sarne sites on a binding molecule, such as a receptor
molecule, without inducing AIM II-induced activities, thereby preventing the
action of AIM II by excluding AIM II from binding.
.. .. .... . , . ,, . ~, . ,
CA 02248868 1998-09-14
W O 97t34911 PCTAUS96/16966
-30-
Other potential antagonists include antisense molecules. Antisense
technology can be used to control gene expression through antisense DNA or
RNA or through triple-helix formation. Antisense techniques are discussed, for
example, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as
Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
Triple helix formation is discussed in, for instance, Lee e~ al., Nucleic Acids
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1360 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA. For example, the 5' coding
portion of a polynucleotide that encodes the mature polypeptide of the present
invention may be used to design an ~nti.c~n~e RNA oligonucleotide of from about
10 to 40 base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription thereby
preventing transcription and the production of AIM II. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the
mRNA molecule into AIM II polypeptide. The oligonucleotides described above
can also be delivered to cells such that the antisense RNA or DNA may be
expressed in vivo to inhibit production of AIM II.
The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter described.
The antagonists may be employed for instance to treat cachexia which is
a lipid clearing defect resulting from a systemic deficiency of lipoprotein lipase,
which is believed to be suppressed by AIM II. The AIM II antagonists may also
be employed to treat cerebral malaria in which AIM II may play a pathogenic
role. The antagonists may also be employed to treat rheumatoid arthritis by
inhibiting AIM~ duced production of infl~mm~tory cytokines, such as IL1 in
the synovial cells. When treating arthritis, AIM II antagonists are preferably
injected intra-articularly.
CA 02248868 1998-09-14
Wo 97/349l l PCTn~S96/l 6966
-3 1 -
The AIM II antagonists may also be employed to prevent graft-host
rejection by preventing the stimulation of the immune system in the presence of
a graft.
The AIM II antagonists may also be employed to inhibit bone resorption
and, therefore, to treat and/or prevent osteoporosis.
The antagonists may also be employed as anti-infl~mm~tory agents, and
to treat endotoxic shock. This critical condition results from an exaggerated
response to bacterial and other types of infection.
Cancer Prognosis
It is believed that certain tissues in m~mm~l~ with cancer express
significantly reduced levels of the AIM II protein and mRNA encoding the AIM
II protein when compared to a corresponding "standard" m~mm~l, i.e., a m~mm~l
of the same species not having the cancer. Further, it is believed that reduced
levels of the AIM II protein can be detected in certain body fluids (e.g., sera,plasma, urine, and spinal fluid) from m~mm~l~ with cancer when compared to
sera from m~mm~l~ of the same species not having the cancer. Thus, the
invention provides a diagnostic method useful during tumor diagnosis, which
involves assaying the expression level of the gene encoding the AIM II protein
in m~mm~ n cells or body fluid and comparing the gene expression level with
a standard AIM II gene expression level, whereby an decrease in the gene
expression level over the standard is indicative of certain tumors.
Where a tumor diagnosis has already been made according to
conventional methods, the present invention is useful as a prognostic indicator,whereby patients exhibiting enhanced AIM II gene expression may experience
a better clinical outcome relative to patients expressing the gene at a lower level.
By "assaying the expression level of the gene encoding the AIM II
protein" is intended qualitatively or quantitatively measuring or estim~ting thelevel of the AIM II protein or the level of the mRNA encoding the AIM II
protein in a first biological sample either directly (e.g., by dete~nining or
CA 02248868 1998-09-14
WO 97/34911 PCTrUS96/16966
-32-
estim~tin~ absolute protein level or mRNA level) or relatively (e.g., by
comparing to the AIM II protein level or mRNA level in a second biological
sample).
Preferably, the AIM II protein level or mRNA level in the first biological
sample is measured or estimated and compared to a standard AIM II protein level
or mRNA level, the standard being taken from a second biological sample
obtained from an individual not having the cancer. As will be appreciated in theart. once a standard AIM II protein level or mRNA level is known, it can be usedrepeatedly as a standard for comparison.
By "biological sample" is intended any biological sample obtained from
an individual, cell line, tissue culture, or other source which contains AIM II
protein or mRNA. Biological samples include m~mm~ n body fluids (such as
sera, plasma, urine, synovial fluid and spinal fluid) which contain secreted mature
AIM II protein, and ovarian, prostate, heart, placenta, pancreas liver, spleen, lung,
breast and umbilical tissue.
The present invention is useful for detecting cancer in m~mm~1~. In
particular the invention is useful during diagnosis of the of following types ofcancers in m~mm~ breast, ovarian, prostate, bone, liver, lung, pancreatic, and
spleenic. Preferred m~mm~ls include monkeys, apes, cats, dogs, cows, pigs,
horses, rabbits and humans. Particularly preferred are humans.
Total cellular RNA can be isolated from a biological sample using the
single-step guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162: 156-159 (1987). Levels of mRNA
encoding the AIM II protein are then assayed using any ~ opl;ate method.
These include Northern blot analysis (Harada et al., Cell 63:303-312 (1990)), S I
nuclease mapping (Fujita et al., Cell 49:357-367 (1987)), the polymerase chain
reaction (PCR), reverse transcription in combination with the polymerase chain
reaction (RT-PCR) (Makino et al., Technique 2:295-301 (1990)), and reverse
transcription in combination with the ligase chain reaction (RT-LCR).
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966 -33-
Assaying AIM II protein levels in a biological sample can occur using
antibody-based techniques. For example, AIM II protein expression in tissues
can be studied with classical immunohistological methods (Jalkanen, M., et al.,
J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol.
105:3087-3096(1987)).
Other antibody-based methods useful for detecting AIM II protein gene
expression include immunoassays, such as the enzyme linked immunosorbent
assay (ELISA) and the radioimmunoassay (RIA).
Suitable lables are known in the art and include enzyme lables, such as,
Glucose oxidase, and radioisotopes, such as iodine ('2sI, '7'I), carbon (14C),
sulpher (35S), tritiurn (3H), indium ("2In), and technetium (99mTc), and fluorescent
labels, such as fluorescein and rhodamine, and biotin.
Tllerapeutics
The AIM II polypeptides, particularly human AIM-II polypeptides, may
be employed to treat neoplasia, Iymphadenopathy, autoimmune disease, graft
versus host disease. In addition. the AIM II polypeptide of the present invention
may be employed to inhibit neoplasia, such as tumor cell growth. The AIM II
polypeptide may be responsible for tumor destruction through apoptosis and
cytotoxicity to certain cells. AIM II may also be employed to treat diseases which
require growth promotion activity, for example, restenosis, since AIM II has
proliferation effects on cells of endothelial origin. AIM II may, therefore, also
be employed to regulate hematopoiesis in endothelial cell development.
Modes oSadministration
It will be appreciated that conditions, such as those discussed above, can
be treated by ~rlmini~tration of AIM II protein. Thus, the invention further
provides a method of treating an individual in need of an increased level of AIMIl activity comprising ~lmini~tering to such an individual a pharmaceutical
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-34-
composition comprising an effective amount of an isolated AIM II polypeptide
of the invention, particularly a mature form of the AIM II, effective to increase
the AIM II activity level in such an individual.
As a general proposition, the total pharrnaceutically effective amount of
AIM II polypeptide a~mini.stered parenterally per dose will be in the range of
about 1 llg/kg/day to l 0 mg/kg/day of patient body weight, although, as noted
above, this will be subject to therapeutic discretion. More preferably, this dose
is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01
and I mg/kg/day for the hormone. If given continuously, the AIM II polypeptide
is typically a~lmini.stered at a dose rate of about l ~lg/kg/hour to about 50
~lg/kg/hour, either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag solution may
also be employed.
Ph~ reutical compositions cont~ining the AIM II of the invention may
be a~lmini.stered orally, rectally, parenterally, intracistemally, intravaginally,
inkaperitoneally~ topically (as by powders, ointments, drops or transdermal
patch), bucally, or as an oral or nasal spray. By "pharmaceutically acceptable
carrier" is meant a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or formulation auxiliary of any type. The term
"parenteral" as used herein refers to modes of ~-lmini~tration which include
intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and
intraarticular injection and infusion.
In addition to soluble AIM II polypeptides, AIM II polypeptides
cont~ining the transmembrane region can also be used when a~ro~liately
solubilized by including detergents, such as triton X- l 00, with buffer.
Cl~romosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to and can
CA 02248868 1998-09-14
Wo 97/3491~ PCT/US96/16966
-35-
hybridize with a particular location on an individual human chromosome. The
mapping of DNAs to chromosomes according to the present invention is an
important first step in correlating those sequences with genes associated with
disease.
In certain preferred embodiments in this regard, the cDNA herein
disclosed is used to clone genomic DNA of an AIM II protein gene. This can be
accomplished using a variety of well known techniques and libraries, which
generally are available commercially. The genomic DNA then is used for in situ
chromosome mapping using well known techniques for this purpose.
In addition, in some cases, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3 ' untranslated region of the gene is used to rapidly select primers that do
not span more than one exon in the genomic DNA, thus complicating the
amplification process. These primers are then used for PCR screening of somatic
cell hybrids cont~ining individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a
metaphase chromosomal spread can be used to provide a precise chromosomal
location in one step. This technique can be used with probes from the cDNA as
short as 50 or 60 bp. For a review of this technique, see Verma et al., Human
Chromosomes. A Manual Of Basic Techniques, Pergamon Press, New York
(1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the sequence on the chromosome can be correlated with
genetic map data. Such data are found, for example, in V. McKusick, Mendelian
Inheritance In Man, available on-line through Johns Hopkins University, Welch
Medical Library. The relationship between genes and diseases that have been
mapped to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessar~ to determine the differences in the cDNA or genomic
sequence between affected and unaffected individuals. If a mutation is observed
~ . , ., . .. . ~ . . . . .
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-36-
in some or all of the affected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the disease.
Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by way
of illustration and are not intended as limiting.
Examples
Example 1: Expression and Purif cation of AIMII in E. coli
A Expression of AIMII with an N-terminul HA tag
The DNA sequence encoding the AIM II protein in the deposited cDNA
clone is amplified using PCR oligonucleotide primers specific to the amino
terrnin~l sequences of the AIM II protein and to vector sequences 3 ' to the gene.
Additional nucleotides cont~ining restriction sites to facilitate cloning are added
to the 5 ' and 3 ' sequences respectively.
A 22 kDa AIM II protein fragment (lacking the N-terminus and
transmembrane region) is expressed using the following primers:
The 5 ' oligonucleotide primer has the sequence 5 '
GCGGGATCCGGAGAGATGGTCACC 3' (SEQ ID NO:7) containing the
underlined BarnHI restriction site, which encodes 244-258 nucleotides of the
AIM II protein coding sequence in Figures IA-C (SEQ ID NO:l).
The 3 ' primer has the sequence 5'
CGCAAGCTTCCTTCACACCATGAAAGC 3' (SEQ ID NO:8) cont~ining the
underlined Hind III restriction site followed by 756-783 nucleotides as shown inFigures IA-C.
The entire AIM II protein can be expressed using the following primers:
The 5' oligonucleotide primer has the sequence 5' GACC GGA~CC ATG
GAG GAG AGT GTC GTA CGG C 3 ' (SEQ ID NO:9) cont~ining the underlined
Bam HI restriction site, which encodes 22 nucleotides of the AIM II protein
coding sequence in Figures lA-C (SEQ ID NO: 1).
h~ n ItU S~lEET (RULE 91
CA 02248868 l998-09-l4
W O 97/34911 PCTAJS96/16966
-37-
The 3 ' primer has the sequence 5 ' CGC AAGCTT CCT TCA CAC CAT
GAA AGC 3' (SEQ ID NO: 10) cont~ining the underlined HindIII restriction site
followed followed by 756-783 nucleotides as shown in Figures lA-C.
The restriction sites are convenient to restriction enzyme sites in the
bacterial expression vector pQE9, which are used for bacterial expression in these
examples. (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE9
encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin
of replication ("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), a 6-His tag and restriction enzyme sites.
The amplified AIM II DNA and the vector pQE9 both are digested with
BamHI and Hind III and the digested DNAs are then ligated together. Insertion
of the AIM II protein DNA into the restricted pQE9 vector places the AIM II
protein coding region downstream of and operably linked to the vector's IPTG-
inducible promoter and in-frame with an initiating AUG al)plo~.l;ately positioned
for translation of AIM II protein.
B. ~xpression of AIM II with a C-terminal HA tag
The bacterial expression vector pQE60 is used for bacterial expression in this
example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311). pQE60
encodes ampicillin antibiotic resistance ("Arnpr") and contains a bacterial origin
of replication ("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), six codons encoding histidine residues that allow affinity purificationusing nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN,
Inc., supra~ and suitable single restriction enzyme cleavage sites. These elements
are arranged such that an inserted DNA fragment encoding a polypeptide
expresses that polypeptide with the six His residues (i.e., a "6 X His tag")
covalentl~ linked to the carboxyl terminus of that polypeptide.
The DNA sequence encoding the desired portion of the AIM II protein
is amplified from the deposited cDNA clone using PCR oligonucleotide primers
which anneal to the amino termin~l sequences of the desired portion of the AIM
II protein and to sequences in the deposited construct 3' to the cDNA coding
REC~lFlED SHEET (RULE 91)
CA 02248868 1998-09-14
W O 97/34911 PCTnJS96tl6966
-38-
sequence. Additional nucleotides contzlining restriction sites to facilitate cloning
in the pQE60 vector are added to the 5' and 3' sequences, respectively.
For cloning the protein, the 5' primer has the sequence 5' GACGC
CCATGG AG GAG GAG AGT GTC GTA CGG C 3' (SEQ ID NO: 17)
cont~ining the underlined NcoI restriction site followed by nucleotides
complementary to the amino terminal coding sequence of the AIM II sequence
in Figures lA-C. One of ordinary skill in the art would appreciate, of course, that
the point in the protein coding sequence where the 5' primer begins may be varied
to amplify a DNA segment encoding any desired portion of the complete protein
(shorter or longer). The 3' primer has the sequence 5' GACC GGATCC CAC
CAT GAA AGC CCC GAA GTA AG 3' (SEQ ID NO: 18) cont~ining the
underlined BarnHI restriction site followed by nucleotides complementary to the
3' end of the coding sequence immediately before the stop codon in the AIM II
DNA sequence in Figures lA-C, with the coding sequence aligned with the
restriction site so as to m~int~in its reading frarne with that of the six His codons
in the pQE60 vector.
The amplified AIM II DNA fragment and the vector pQE60 are digested
with BamHI and Nco I and the digested DNAs are then ligated together.
Insertion of the AIM II DNA into the restricted pQE60 vector places the AIM II
protein coding region downstream from the IPTG-inducible promoter and in-
frarne with an initiating AUG and the six histidine codons.
The ligation mixture from the HA tagged expression constructs made in
A or B, above, is transformed into competent E. coli cells using standard
procedures. Such procedures are described in Sambrook et al., Molecular
Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1989). E. coli strain M15/rep4, cont~ining multiple
copies of the plasmid pREP4, which expresses lac repressor and confers
kanamycin resistance ("Kanr"), is used in carrying out the illustrative exarnpledescribed herein. This strain, which is only one of many that are suitable for
expressing AIM II protein, is available comrnercially from Qiagen.
REC'rlFIED SHEEr (RULE 91)
CA 02248868 1998-09-14
W O 97134911 PCT~US96/16966
-39-
Transformants are identified by their ability to grow on LB plates in the
presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant
colonies and the identity of the cloned DNA confirmed by restriction analysis.
Clones cont~ining the desired constructs are grown overnight ("O/N") in
liquid culture in LB media supplemented with both ampicillin (100 ~lg/ml) and
kanamycin (25 ~g/ml).
The O/N culture is used to inoculate a large culture, at a dilution of
approximately 1:100 to 1:250. The cells are grown to an optical density at 600nm("OD600") of between 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside
("IPTG") is then added to a final concentration of 1 mM to induce transcription
from lac repressor sensitive promoters, by inactivating the lacI repressor. Cells
subsequently are incubated further for 3 to 4 hours. Cells then are harvested bycentrifugation and disrupted, by standard methods. Inclusion bodies are purifiedfrom the disrupted cells using routine collection techniques, and protein is
solubilized from the inclusion bodies into 8M urea. The 8M urea solution
cont~inin~ the solubilized protein is passed over a PD-10 column in 2X
phosphate-buffered saline ("PBS"), thereby removing the urea, exch~nging the
buffer and refolding the protein. The protein is purified by a further step of
chromatography to remove endotoxin. Then, it is sterile filtered. The sterile
filtered protein preparation is stored in 2X PBS at a concentration of 95 ,u/ml.
C. ~xpression and Purification of flIM Il without an HA tag
The bacterial expression vector pQE60 is used for bacterial expression in
this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311).
pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterialorigin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), six codons encoding histidine residues that allow affinity purificationusing nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN,
Inc., supra, and suitable single restriction enzyme cleavage sites. These elements
are arranged such that a DNA fragment encoding a polypeptide may be inserted
CA 02248868 1998-09-14
-W O 97134911 PCTAUS96/16966
-40-
in such as way as to produce that polypeptide with the six His residues (i.e., a "6
X His tag") covalently linked to the carboxyl terminus of that polypeptide.
However, in this example, the polypeptide coding sequence is inserted such that
translation of the six His codons is prevented and, therefore, the polypeptide is
produced with no 6 X His tag.
The DNA sequence encoding the desired portion of the AIM II protein
lacking the hydrophobic leader sequence is amplified from the deposited cDNA
clone using PCR oligonucleotide primers which anneal to the arnino terminal
sequences of the desired portion of the AIM II protein and to sequences in the
deposited construct 3' to the cDNA coding sequence. Additional nucleotides
cont~ining restriction sites to facilitate cloning in the pQE60 vector are added to
the 5' and 3' sequences, respectively.
For cloning the protein, the 5' primer has the sequence 5'GACGC
CCATGG AG GAG GAG AGT GTC GTA CGG C 3' (SEQ ID NO: 17)
cont~inin~; the underlined NcoI restriction site followed by nucleotides
complementary to the amino termin~l coding sequence of the AIM II sequence
in Figures lA-C. One of ordinary skill in the art would appreciate, of course, that
the point in the protein coding sequence where the 5' primer begins may be varied
to arnplify a desired portion of the complete protein (i.e., shorter or longer). The
3' primer has the sequence 5' CGC AAGCTT CCTT CAC ACC ATG AAA GC
3' (SEQ ID NO: 19) cont~ining the underlined Hind III restriction site followed
by nucleotides complementary to the 3' end of the non-coding sequence in the
AIM II DNA sequence in Figures lA-C.
The amplified AIM II DNA fragments and the vector pQE60 are digested
with NcoI and Hind III and the digested DNAs are then ligated together.
Insertion of the AIM II DNA into the restricted pQE60 vector places the AIM II
protein coding region including its associated stop codon downstream from the
IPTG-inducible promoter and in-frarne with an initiating AUG. The associated
stop codon pre- ents translation of the six histidine codons downstrearn of the
insertion point.
RE~ IEL) SHEET (RULE ~1
CA 02248868 1998-09-14
W O 97/34911 PCTAJS96/16966
-41-
The ligation mixture is transformed into competent E. coli cells using
standard procedures such as those described in Sambrook et al., Molecular
Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY (1989). E. coli strain Ml5/rep4, cont~ining multiple
copies of the plasmid pREP4, which expresses the lac repressor and confers
kanamycin resistance ("Kanr"), is used in carrying out the illustrative exarnpledescribed herein. This strain, which is only one of many that are suitable for
expressing AIM II protein, is available commercially from QIAGEN, Inc., supra.
Transformants are identified by their ability to grow on LB plates in the presence
of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies
and the identity of the cloned DNA confirmed by restriction analysis, PCR and
DNA sequencing.
Clones con~ining the desired constructs are grown overnight ("O/N") in
liquid culture in LB media supplemented with both ampicillin (100 ~g/ml) and
kanarnycin (25 llg/ml). The O/N culture is used to inoculate a large culture, at a
dilution of approximately 1:25 to 1:250. The cells are grown to an optical density
at 600 nm ("OD600") of between 0.4 and 0.6. Isopropyl-b-D-
thiogalactopyranoside ("IPTG") is then added to a final concentration of I mM
to induce transcription from the lac repressor sensitive promoter, by inactivating
the lacI repressor. Cells subsequently are incubated fùrther for 3 to 4 hours.
Cells then are harvested by centrifugation.
The cells are then stirred for 3-4 hours at 4~C in 6M guanidine-HCI, pH8.
The cell debris is removed by centrifugation, and the supernatant containing theAIM II is dialyzed against 50 mM Na-acetate buffer pH6, supplemented with 200
mM NaCI. Alternatively, the protein can be successfully refolded by dialyzing
it a~ainst 500 mM NaCI, 20% glycerol, 25 mM Tris/HCI pH7.4, Cont~ining
protease inhibitors. After renaturation the protein can be purified by ion
exchange. hydrophobic interaction and size exclusion chromatography.
Alternatively, al1 affinity chromatography step such as an antibody column can
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-42-
be used to obtain pure AIM II protein. The purified protein is stored at 4~C or
frozen at -80~C.
Exnmple 2: Cloning and Expression of AIM II protein in a Bnculovirus
Expression System
The cDNA sequence encoding the full length AIM II protein in the
deposited clone is amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences ofthe gene:
The 5 ' primer has the sequence 5 'GCT CCA GGA TCC GCC ATC ATG
GAG GAG AGT GTC GTA CGG C3' (SEQ ID NO:11) cont~inin~ the
underlined Bam HI restriction enzyme site followed by 22 bases of the sequence
of AIM II protein in Figures lA-C. Inserted into an expression vector, as
described below, the 5' end of the amplified fragment encoding AIM II provides
an efficient signal peptide. An efficient signal for initiation of translation in
eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987) is~plopl;ately located in the vector portion of the construct.
The 3' primerhas the sequence 5'GA CGC GGT ACC GTC CAA TGC
ACC ACG CTC CTT CCT TC 3' ~SEQ ID NO:12) con~ining the underlined
Asp 718 restriction site followed by nucleotides complementary to 769-795
nucleotides of the AIM II set out in Figures lA-C.
The amplified fragment is isolated from a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
fragJment then is digested with Bam HI and Asp 718 and again is purified on a 1 %
agarose gel. This fragment is de~ign~ted herein F2.
The vector pA2-GP is used to express the AIM II protein in the
baculovirus expression system, using standard methods, as described in Sumrners
et ~ll., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture
Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
This expression vector contains the strong polyhedrin promoter of the
hcC~ ltu SHEEr (RULE 91)
CA 02248868 1998-09-14
wo 97/34911 PCT/US96tl6966
-43 -
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by
convenient restriction sites. The signal peptide of AcMNPV gp67, including the
N-terminal methionine, is located just upstream of a BamHI site. The
polyadenylation site of the simian virus 40 ("SV40") is used for efficient
polyadenylation. For an easy selection of recombinant virus the beta-
galactosidase gene from E. coli is inserted in the same orientation as the
polyhedrin promoter and is followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral
sequences for cell-mediated homologous recombination with wild-type viral
DNA to generate viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of pA2-GP, such
as pAc373, pVL941 and pAcIMl provided, as those of skill readily will
appreciate, that construction provides a~ylo~,~iately located signals for
transcription, translation, trafficking and the like, such as an in-frame AUG and
a signal peptide, as required. Such vectors are described in Luckow et al.,
Yirology 170: 31-39, among others.
The plasmid is digested with the restriction enzyme Bam HI and Asp 718
and then is dephosphorylated using calf intestinal phosphatase, using routine
procedures known in the art. The DNA is then isolated from a 1% agarose gel
using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
This vector DNA is designated herein "V".
Fragment F2 and the dephosphorylated plasmid V2 are ligated together
with T4 DNA ligase. E. coli HBIOI cells are transformed with ligation mix and
spread on culture plates. Bacteria are identified that contain the plasmid with the
human AIM II gene by digesting DNA from individual colonies using XbaI
and then analyzing the digestion product by gel electrophoresis. The sequence ofthe cloned fragment is confirmed by DNA sequencing. This plasmid is
designated herein pBac AIM II .
5 ~lg of the plasmid pBac AIM II is co-transfected with 1.0 llg of a
comrnercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus
CA 02248868 1998-09-14
W O 97/34911 PCT/US96/16966
-44-
DNA", Ph:~rmingen, San Diego, CA.), using the lipofection method described by
Felgner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). l~g of
BaculoGoldTM virus DNA and 5 ~g of the plasmid pBac AIM II are mixed in
a sterile well of a microtiter plate cont~ining 50 !11 of serum-free Grace's medium
(Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~1 Lipofectin plus 90
~11 Grace's medium are added, mixed and incubated for 15 minutes at room
temperature. Then the transfection mixture is added drop-wise to Sfg insect cells
(ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's
medium without serum. The plate is rocked back and forth to mix the newly
added solution. The plate is then incubated for 5 hours at 27~C. After 5 hours the
transfection solution is removed from the plate and I ml of Grace's insect medium
supplemented with 10% fetal calf serum is added. The plate is put back into an
incubator and cultivation is continued at 27~C for four days.
After four days the supernatant is collected and a plaque assay is
perforrned, as described by Summers and Smith, cited above. An agarose gel
with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy
identification and isolation of gal-expressing clones, which produce blue-stained
plaques. (A detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and baculovirology distributed by
Life Technologies Inc., Gaithersburg, page 9-10).
Four days after serial dilution, the virus is added to the cells. After
appropriate incubation, blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar cont~ining the recombinant viruses is then
resuspended in an Eppendorf tube con~ining 200~1l of Grace's medium. The agar
is removed by a brief centrifugation and the supernatant containing the
recombinant baculovirus is used to infect Sf9 cells seeded in 35 rnm dishes. Four
days later the supernatants of these culture dishes are harvested and then they are
stored at 4~C. A clone cont~ining properly inserted hESSB I, II and III is
identified by DNA analysis including restriction mapping and sequencing. This
is designated herein as V-AIM II .
CA 02248868 1998-09-14
wo 97t349tl PCT/US96/16966
-45 -
Sf9 cells are grown in Grace's medium supplemented with 10% heat-
inactivated FBS. The cells are infected with the recombinant baculovirus V-
AIM II at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3). Six
hours later the medium is removed and is replaced with SF900 II medium minus
methionine and cysteine (available from Life Technologies Inc., Gaithersburg).
42 hours later, 5 ~ICi of 35S-methionine and 5 llci 35S-cysteine (available fromAmersham) are added. The cells are further incubated for 16 hours and then they
are har~ ested by centrifugation, Iysed and the labeled proteins are visualized by
SDS-PAGE and autoradiography.
0 Exnmple 3: Cloning and Expression in Mammalian Cells
Most of the vectors used for the transient expression of the AIM II protein
gene sequence in m~mm~ n cells should carry the SV40 origin of replication.
This allows the replication of the vector to high copy numbers in cells (e.g., COS
cells) ~~hich express the T antigen required for the initiation of viral DNA
synthesis. Any other m~mmAli~n cell line can also be utilized for this purpose.
A typical m~mmz~ n expression vector contains the promoter element,
which mediates the initiation of transcription of mRNA, the protein coding
sequence, and signals required for the tt-rmin~tion of trancription and
polyadenylation of the transcript. Additional elements include enhancers, Kozak
sequences and intervening sequences flanked by donor and acceptor sites for
RNA splicing. Highly efficient transcription can be achieved with the early and
late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses,
e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
However. cellular signals can also be used (e.g., human actin promoter). Suitable
expression vectors for use in practicing the present invention include, for
example. vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden),
pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBCl2MI (ATCC
67109). ~mm~ n host cells that could be used include, human Hela, 283, H9
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-46-
and Jurkart cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, African
green monkey cells, quail QC1-3 cells, mouse L cells and Chinese hamster ovary
cells.
Alternatively, the gene can be expressed in stable cell lines that contain
the gene integrated into a chromosome. The co-transfection with a selectable
marker such as dhfr, gpt, neomycin, hygromycin allows the identification and
isolation of the transfected cells.
The transfected gene can also be amplified to express large arnounts of the
encoded protein. The DHFR (dihydrofolate reductase) is a useful marker to
develop cell lines that carry several hundred or even several thousand copies ofthe gene of interest. Another useful selection marker is the enzyme glutamine
synthase (GS) (Murphy et al., Biochen7 J. 227.277-279 (1991); Bebbington et al.,Bio/Technology 10:169-175 (1992)). Using these markers, the mzlmm~ n cells
are grown in selective medium and the cells with the highest resistance are
selected. These cell lines contain the amplified gene(s) integrated into a
chromosome. Chinese hamster ovary (CHO) cells are often used for the
production of proteins.
The expression vectors pC 1 and pC4 contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology,
438-447 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart el al.,
Cell 41:521-530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme
cleavage sites BamHI, XbaI and Asp718, facilitate the cloning ofthe gene of
interest. The vectors contain in addition the 3 ' intron, the polyadenylation and
termination signal of the rat preproinsulin gene.
Example 3(a): Cloning and Expression in COS Cells
The expression plasmid, pAIM II HA, is made by cloning a cDNA
encoding AIM II into the expression vector pcDNAItAmp (which can be obtained
from Invitrogen, Inc.).
CA 02248868 l998-09-l4
W O 97~4911 PCTAUS96/16966
-47-
The expression vector pcDNAI/amp contains: (I) an E.coZi origin of
replication effective for propagation in E. coli and other prokaryotic cells; (2) an
ampicillin resistance gene for selection of plasmid-cont~ining prokaryotic cells;
(3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMVS promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so
that a cDNA conveniently can be placed under expression control of the CMV
promoter and operably linked to the SV40 intron and the polyadenylation signal
by means of restriction sites in the polylinker.
A DNA fragment encoding the AIM II protein and an HA tag fused in
frame to its 3' end is cloned into the polylinker region of the vector so that
recombinant protein expression is directed by the CMV promoter. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin protein
described by Wilson et al., Cell 37: 767 (1984). The fusion of the HA tag to thetarget protein allows easy detection of the recombinant protein with an antibodythat recognizes the HA epitope.
The plasmid construction strategy is as follows. The AIM II cDNA of the
deposited clone is amplified using primers that contain convenient restriction
sites, much as described above regarding the construction of expression vectors
for expression of AIM II in E. coli. To facilitate detection, purification and
characterization of the expressed AIM II, one of the primers contains a
hemagglutinin tag ("HA tag") as described above.
Suitable primers include the following, which are used in this example.
The 5 ' primer, cont~ining the underlined BamHI site, and an AUG start codon
has the following sequence:
S'G CTC GGA TCC GCC ATC ATG 3' (SEQ ID
NO:13).
The 3' primer, cont~inin~ the underlined Xba I site, a stop codon, 9
codons thereafter forming the hemagglutinin HA tag, and 31 bp of 3' coding
sequence (at the 3 ' end) has the following sequence:
CA 02248868 l998-09-l4
W O 97/34911 PCT~US96/16966
-48-
5'GAT GTT CTA GAA AGC GTA GTC TGG GAC GTC
GTA TGG GTA CAC CAT GAA AGC CCC GAA GTA AGA
CCG GGT AC 3' (SEQ ID NO:14).
The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are
digested with HindIII and XhoI and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene Cloning
Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the
transformed culture is plated on ampicillin media plates which then are incubated
to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies and examined by restriction analysis and gel sizing for the
presence of the AIM II -encoding fragment.
For expression of recombinant AIM II, COS cells are transfected with an
expression vector, as described above, using DEAE-DEXTRAN, as described, for
instance, in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold
Spring Laboratory Press, Cold Spring Harbor, New York (1989). Cells are
incubated under conditions for expression of AIM II by the vector.
Expression of the AIM II HA fusion protein is detected by radiolabelling
and irnrnunoprecipitation~ using methods described in, for example Harlow et al.,
Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York (1988). To this end, two days after
transfection, the cells are labeled by incubation in media cont~ining 35S-cysteine
for 8 hours. The cells and the media are collected, and the cells are washed andthe lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40,
0.1% SDS, 1%NP-~0, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson
et al. cited above. Proteins are precipitated from the cell lysate and from the
culture media usin~ an HA-specific monoclonal antibody. The precipitated
proteins then are analyzed by SDS-PAGE gels and autoradiography. An
expression product of the expected size is seen in the cell lysate, which is not seen
in negative controls.
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-49-
Example 3(b): Cloning and Expression in CHO Cells
The vector pC4 is used for the expression of AIM II protein. Plasmid pC 1
is a derivative of the plasmid pSV2-dhfr [ATCC Accession No. 371461. Both
plasmids contain the mouse DHFR gene under control of the Sv40 early
promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity
that are transfected with these plasmids can be selected by growing the cells ina selective medium (alpha minus MEM, Life. Technologies) supplemented with
the chemotherapeutic agent methotrexate. The amplification of the DHFR genes
in cells resistant to methotrexate (MTX) has been well documented (see, e.g., Alt,
F.W.. Kellems, R.M., Bertino, J.R., and Schimke, R.T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys. Acta,
1097:107-143, Page, M.J. and Sy~i~nh~m, M.A. 1991, Biotechnology Vol. 9:64-
68). Cells grown in increasing concentrations of MTX develop resistance to the
drug by overproducing the target enzyme, DHFR, as a result of amplification of
the DHFR gene. If a second gene is linked to the DHFR gene it is usually co-
amplified and over-expressed. It is state of the art to develop cell lines carrying
more than 1.000 copies of the genes. Subsequently, when the methotrexate is
withdrawn~ cell lines contain the amplified gene integrated into the
chromosome(s).
Plasmid pC4 contains for expressing the gene of interest the strong
promoter of the long t~rmin~l repeat (LTR) of the Rous Sarcoma Virus (Cullen,
et al.. Molecular and Cellular Biology, March 1985:438-447) plus a fragment
isolated from the enhancer of the immediate early gene of human
cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530 (1985)). Downstream
of the promoter are Bam HI, XbaI, and Asp718 restriction enzyme cleavage sites
that allow integration of the genes. Behind these cloning sites the plasmid
contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
Other high efficiency promoters can also be used for the expression, e.g., the
human ~-actin promoter, the SV40 early or late promoters or the long terminal
CA 02248868 l998-09-l4
W O 97/34911 PCTAUS96/16966
-50-
repeats from other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and
Tet-On gene expression systems and similar systems can be used to express the
AIM II in a regulated way in m~mm~ n cells (Gossen, M., & Bujard, H. 1992,
Proc. Natl. Acad. Sci. US,4 89: 5547-5551). For the polyadenylation of the
mRNA other signals, e.g., from the human growth horrnone or globin genes can
be used as well. Stable cell lines carrying a gene of interest integrated into the
chromosomes can also be selected upon co-transfection with a selectable marker
such as gpt, G418 or hygromycin. It is advantageous to use more than one
selectable marker in the be~inning, e.g., G418 plus methotrexate.
The plasmid pC4 is digested with the restriction enzymes Bam HI and
Asp 718 and then dephosphorylated using calf intestinal phosphatase by
procedures known in the art. The vector is then isolated from a 1 % agarose gel.The DNA sequence encoding the complete AIM II protein including its
leader sequence is amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences of the gene. The 5' primer has the sequence 5'GCT
CCA GGA TCC GCC ATC ATG GAG GAG AGT GTC GTA CGG C3 ' (SEQ
ID NO: 15) containing the underlined Bam HI restriction enzyme site followed
by an efficient signal for initiation of translation in eukaryotes, as described by
Kozak, M., J. Mol. Biol. 196:947-950 (1987), and 22 bases of the coding
sequence of AIM II shown in Figures 1 A-C (SEQ ID NO: 1). The 3' primer has
the sequence 5'GA CGC GGT ACC GTC CAA TGC ACC ACG CTC CTT CCT
TC 3' (SEQ ID NO:16) containing the underlined Asp 718 restriction site
followed by nucleotides complementary to nucleotides 769-795 of the AIM II
gene shown in Figures lA-C (SEQ ID NO:l).
The amplified fragment is digested with the endonucleases BamHI and
Asp718 and then purified again on a 1% agarose gel. The isolated fragment and
the dephosphorylated vector are then ligated with T4 DNA ligase. E. coli HB101
or XL-1 Blue cells are then transformed and bacteria are identified that containthe fragment inserted into plasmid pC4 using, for instance, restriction enzyme
analysis.
~t~ ltU SHEET (RULE 91
CA 02248868 1998-09-14
W O 97/34911 PCTAUS96/16966
-51-
Chinese harnster ovary cells lacking an active DHFR gene are used for
transfection. S ,ug of the expression plasmid pC4 is cotransfected with 0.5 ~g of
the plasmid pSV2-neo using lipofectin (Felgner et al., supra). The plasmid
pSV2neo contains a dominant selectable marker, the neo gene from TnS encoding
an enzyme that confers resistance to a group of antibiotics including G4 18. Thecells are seeded in alpha minus MEM supplemented with 1 mg/ml G4 18. After
2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of
metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are
trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM).
Clones growing at the highest concentrations of methotrexate are then transferred
to new 6-well plates cont~ining even higher concentrations of methotrexate
M, 2 ~lM, S ~,lM, 10 mM, 20 mM). The sarne procedure is repeated until
clones are obtained which grow at a concentration of 100 - 200 IlM. Expression
of the desired gene product is analyzed, for instance, by SDS-PAGE and Western
blot or by reverse phase HPLC analysis.
Example 4: Tisslle distribution of AIMII protein expression
Northern blot analysis is carried out to examine AIM II gene expression
in human tissues, using methods described by, among others, Sambrook et al.,
cited above. A cDNA probe Cont~ining the entire nucleotide sequence of the
AIM II protein (SEQ ID NO:l) is labeled with 32p using the rediprimeTM DNA
labeling system (Amersham Life Science), according to manufacturer's
instructions. After labelling, the probe is purified using a CHROMA SPIN- 1 OOTMcolumn (Clontech Laboratories, Inc.)~ according to manufacturer's protocol
number PT1200-1. The purified labelled probe is then used to examine various
human tissues for AIM II mRNA.
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-52-
Multiple Tissue Northern (MTN) blots cont~ining various human tissues
(H) or human immune system tissues (IM) are obtained from Clontech and are
examined with labelled probe using ExpressHybTM hybridization solution
(Clontech) according to manufacturer's protocol number PT1190-1. Following
hybridization and washing, the blots are mounted and exposed to film at -70 ~C
overnight, and films developed according to standard procedures.
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are
possible in light of the above tç~hings and, therefore, are within the scope of the
appended claims.
The entire disclosure of all publications (including patents, patent
applications, journal articles, laboratory m~n~ , books, or other documents)
cited herein are hereby incorporated by reference.
CA 02248868 1998-09-14
W O 97~4911 PCT~US96/16966
- 53 -
SEQUENCE LISTING
(I) GENERAL INFORMATION:
(I) APPLICANT: Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville, MD 20850
United States of America
APPLICANTS/INVENTORS: Ebner, Reinhard
Yu, Guo-Liang
Ruben, Steven M.
(ii) TITLE OF INVENTION: Apoptosis Inducing Molecule 11
(iii) NUMBER OF SEQUENCES: 19
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Sterne, Kessler, Goldsteirl & Fox, P.L.L.C.
(B) STREET: 1100 New York Ave., Suite 600
(C) CITY Washington
(D) STATE: DC
(E) COUNTRY: USA
(F) ZIP: 20005-3934
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: TBA
(B) FILING DATE: Herewith
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/013,923
(B) FILING DATE: 22 MARCH 1996
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Goldstein, Jorge A.
(B) REGISTRATION NUMBER: 29,021
(C)REFERENCE/DOCKETNUMBER: 1488.065PC01/JAG/EKS/KMT
(ix) TELECOMMUNlCATlON INFORMATION:
(A) TELEPHONE: 202-371-2600
(B) TELEFAX: 202-371 -2540
(2) INFORMATION FOR SEQ ID NO:l:
(I) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1169 base pairs
(B) TYPE: nucleic acid
(C) STRAI~'DEDNESS: double
- (D) TOPOLOGY: linear
~ii) MOLECULE TYPE: DNA (genomic)
CA 02248868 l998-09-l4
W O 97/34911 PCTfUS96/16966
-54-
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 49..768
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
GAGGTTGAAG GACCCAGGCG TGTCAGCCCT GCTCCAGAGA CCTTGGGC ATG GAG GAG 57
Met Glu Glu
AGT GTC GTA CGG CCC TCA GTG TTT GTG GTG GAT GGA CAG ACC GAC ATC 105
Ser Val Val Arg Pro Ser Val Phe Val Val Asp Gly Gln Thr Asp Ile
5 10 15
CCA TTC ACG AGG CTG GGA CGA AGC CAC CGG AGA CAG TCG TGC AGT GTG 153
Pro Phe Thr Arg Leu Gly Arg Ser His Arg Arg Gln Ser Cys Ser Val
20 25 30 35
GCC CGG GTG GGT CTG GGT CTC TTG CTG TTG CTG ATG GGG GCT GGG CTG 201
Ala Arg Val Gly Leu Gly Leu Leu Leu Leu Leu Met Gly Ala Gly Leu
40 45 50
GCC GTC CAA GGC TGG TTC CTC CTG CAG CTG CAC TGG CGT CTA GGA GAG 249
Ala Val Gln Gly Trp Phe Leu Leu Gln Leu His Trp Arg Leu Gly Glu
55 60 65
ATG GTC ACC CGC CTG CCT GAC GGA CCT GCA GGC TCC TGG GAG CAG CTG 297
Met Val Thr Arg Leu Pro Asp Gly Pro Ala Gly Ser Trp Glu Gln Leu
70 75 80
ATA CAA GAG CGA AGG TCT CAC GAG GTC AAC CCA GCA GCG CAT CTC ACA 345
Ile Gln Glu Arg Arg Ser His Glu Val Asn Pro Ala Ala His Leu Thr
85 90 95
GGG GCC AAC TCC AGC TTG ACC GGC AGC GGG GGG CCG CTG TTA TGG GAG 393
Gly Ala Asn Ser Ser Leu Thr Gly Ser Gly Gly Pro Leu Leu Trp Glu
100 105 110 115
ACT CAG CTG GGC CTG GCC TTC CTG AGG GGC CTC AGC TAC CAC GAT GGG 441
Thr Gln Leu Gly Leu Ala Phe Leu Arg Gly Leu Ser Tyr His Asp Gly
120 125 130
GCC CTT GTG GTC ACC AAA GCT GGC TAC TAC TAC ATC TAC TCC AAG GTG 489
Ala Leu Val Val Thr Lys Ala Gly Tyr Tyr Tyr Ile Tyr Ser Lys Val
135 140 145
CAG CTG GGC GGT GTG GGC TGC CCG CTG GGC CTG GCC AGC ACC ATC ACC 537
Gln Leu Gly Gly Val Gly Cys Pro Leu Gly Leu Ala Ser Thr Ile Thr
150 155 160
CAC GGC CTC TAC AAG CGC ACA CCC CGC TAC CCC GAG GAG CTG GAG CTG 585
His Gly Leu Tyr Lys Arg Thr Pro Arg Tyr Pro Glu Glu Leu Glu Leu
165 170 175
CA 02248868 l998-09-l4
W O 97/34911 PCTAJS96/16966
-55-
TTG GTC AGC CAG CAG TCA CCC TGC GGA CGG GCC ACC AGC AGC TCC CGG 633
Leu Val Ser Gln Gln Ser Pro Cys Gly Arg Ala Thr Ser Ser Ser Arg
180 185 190 195
GTC TGG TGG GAC AGC AGC TTC CTG GGT GGT GTG GTA CAC CTG GAG GCT 681
Val Trp Trp Asp Ser Ser Phe Leu Gly Gly Val Val His Leu Glu Ala
200 205 210
GGG GAG GAG GTG GTC GTC CGT GTG CTG GAT GAA CGC CTG GTT CGA CTG 729
Gly Glu Glu Val Val Val Arg Val Leu Asp Glu Arg Leu Val Arg Leu
215 220 225
CGT GAT GGT ACC CGG TCT TAC TTC GGG GCT TTC ATG GTG TGAAGGAAGG 778
Arg Asp Gly Thr Arg Ser Tyr Phe Gly Ala Phe Met Val
230 235 240
AGCGTGGTGC ATTGGACATG GGTCTGACAC GTGGAGAACT CAGAGGGTGC CTCAGGGGAA 838
AGAAAACTCA CGAAGCAGAG GCTGGGCGTG GTGGCTCTCG CCTGTAATCC CAGCACTTTG 898
GGAGGCCAAG GCAGGCGGAT CACCTGAGGT CAGGAGTTCG AGACCAGCCT GGCTAACATG 958
GCAAAACCCC ATCTCTACTA AAAATACAAA AATTAGCCGG ACGTGGTGGT GCCTGCCTGT 1018
AATCCAGCTA CTCAGGAGGC TGAGGCAGGA TAATTTTGCT TAAACCCGGG AGGCGGAGGT 1078
TGCAGTGAGC CGAGATCACA CCACTGCACT CCAACCTGGG AAACGCAGTG AGACTGTGCC 1138
TCAAAAAAAA AA~UUU WAAA AAAAAAAAAA A 1169
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 240 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Glu Glu Ser Val Val Arg Pro Ser Val Phe Val Val Asp Gly Gln
1 5 10 15
~hr Asp Ile Pro Phe Thr Arg Leu Gly Arg Ser His Arg Arg Gln Ser
Cys Ser Val Ala Arg Val Gly Leu Gly Leu Leu Leu Leu Leu Met Gly
Ala Gly Leu Ala Val Gln Gly Trp Phe Leu Leu Gln Leu His Trp Arg
Leu Gly Glu Met Val Thr Arg Leu Pro Asp Gly Pro Ala Gly Ser Trp
CA 02248868 l998-09-l4
W O 97/34911 PCT~US96/16966
-56-
Glu Gln Leu Ile Gln Glu Arg Arg Ser His Glu Val Asn Pro Ala Ala
~is Leu Thr Gly Ala Asn Ser Ser Leu Thr Gly Ser Gly Gly Pro Leu
100 105 110
Leu Trp Glu Thr Gln Leu Gly Leu Ala Phe Leu Arg Gly Leu Ser Tyr
115 120 125
His Asp Gly Ala Leu Val Val Thr Lys Ala Gly Tyr Tyr Tyr Ile Tyr
130 135 140
Ser Lys Val Gln Leu Gly Gly Val Gly Cys Pro Leu Gly Leu Ala Ser
145 150 155 160
~hr Ile Thr His Gly Leu Tyr Lys Arg Thr Pro Arg Tyr Pro Glu Glu
165 170 175
~eu Glu Leu Leu Val Ser Gln Gln Ser Pro Cys Gly Arg Ala Thr Ser
180 185 190
Ser Ser Arg Val Trp Trp Asp Ser Ser Phe Leu Gly Gly Val Val His
195 200 205
Leu Glu Ala Gly Glu Glu Val Val Val Arg Val Leu Asp Glu Arg Leu
210 215 220
Val Arg Leu Arg Asp Gly Thr Arg Ser Tyr Phe Gly Ala Phe Met Val
225 230 235 240
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 455 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: not relevant
(D) TOPOLOGY: not relevant
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu
1 5 10 15
Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro
His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys
CA 02248868 1998-09-14
W O 97/34911 PCTAUS96/16966 -57-
Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys
Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp
Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu
Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val
100 105 110
Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg
115 120 125
Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe
130 135 140
Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu
145 150 155 160
Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu
165 170 175
Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr
180 185 190
Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser
195 200 205
Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu
210 215 220
Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp Lys
225 230 235 240
Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu
245 250 255
Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser
260 265 270
Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pro Val
275 280 285
Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys
290 295 300
Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly
305 310 315 320
Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn
325 330 335
CA 02248868 1998-09-14
W O 97/34911 PCTAUS96/16966
-58-
~ro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser Leu Asp
340 345 350
Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro
355 360 365
Leu Arg Trp Lys Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu
370 375 380
Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln
385 390 395 400
Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala
405 410 415
Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu Gly
420 425 430
Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro
435 440 445
Pro Ala Pro Ser Leu Leu Arg
450 455
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 205 amino acids
tB) TYPE: amino acid
(C) sTR~NnRnNR~s not relevant
(D) TOPOLOGY: not relevant
(ii) MOLECULE TYPE: protein
(xi) ~Q~N~ DESCRIPTION: SEQ ID NO:4:
Met Thr Pro Pro Glu Arg Leu Phe Leu Pro Arg Val Cys Gly Thr Thr
l 5 l0 15
Leu His Leu Leu Leu Leu Gly Leu Leu Leu Val Leu Leu Pro Gly Ala
Gln Gly Leu Pro Gly Val Gly Leu Thr Pro Ser Ala Ala Gln Thr Ala
Arg Gln His Pro Lys Met His Leu Ala His Ser Thr Leu Lys Pro Ala
Ala His Leu Ile Gly Asp Pro Ser Lys Gln Asn Ser Leu Leu Trp Arg
Ala Asn Thr Asp Arg Ala Phe Leu Gln Asp Gly Phe Ser Leu Ser Asn
CA 02248868 l998-09-l4
W O 97/34911 PCT~US96/16966
-59-
Asn Ser Leu Leu Val Pro Thr Ser Gly Ile Tyr Phe Val Tyr Ser Gln
100 105 110
Val Val Phe Ser Gly Lys Ala Tyr Ser Pro Lys Ala Thr Ser Ser Pro
115 120 125
Leu Tyr Leu Ala His Glu Val Gln Leu Phe Ser Ser Gln Tyr Pro Phe
130 135 140
His Val Pro Leu Leu Ser Ser Gln Lys Met Val Tyr Pro Gly Leu Gln
145 150 155 160
Glu Pro Trp Leu His Ser Met Tyr His Gly Ala Ala Phe Gln Leu Thr
165 170 175
Gln Gly Asp Gln Leu Ser Thr His Thr Asp Gly Ile Pro His Leu Val
180 185 190
Leu Ser Pro Ser Thr Val Phe Phe Gly Ala Phe Ala Leu
195 200 205
(2) INFORMATION FOR SEQ ID NO:5:
( i ) S~U~N-~'~ CHARACTERISTICS:
(A) LENGTH: 205 amino acids
(B) TYPE: amino acid
(C) sTR~Nn~nN~s not relevant
(D) TOPOLOGY: not relevant
(ii) MOLECULE TYPE: protein
(Xi) S~U~N~ DESCRIPTION: SEQ ID NO:5:
Met Thr Pro Pro Glu Arg Leu Phe Leu Pro Arg Val Cys Gly Thr Thr
1 5 10 15
Leu His Leu Leu Leu Leu Gly Leu Leu Leu Val Leu Leu Pro Gly Ala
Gln Gly Leu Pro Gly Val Gly Leu Thr Pro Ser Ala Ala Gln Thr Ala
Arg Gln His Pro Lys Met His Leu Ala His Ser Thr Leu Lys Pro Ala
Ala His Leu Ile Gly Asp Pro Ser Lys Gln Asn Ser Leu Leu Trp Arg
Ala Asn Thr Asp Arg Ala Phe Leu Gln Asp Gly Phe Ser Leu Ser Asn
CA 02248868 1998-09-14
W O 97/3491l PCTAJS96/16966
-60-
~sn Ser Leu Leu Val Pro Thr Ser Gly Ile Tyr Phe Val Tyr Ser Gln
100 105 110
Val Val Phe Ser Gly Lys Ala Tyr Ser Pro Lys Ala Thr Ser Ser Pro
115 120 125
Leu Tyr Leu Ala His Glu Val Gln Leu Phe Ser Ser Gln Tyr Pro Phe
130 135 140
His Val Pro Leu Leu Ser Ser Gln Lys Met Val Tyr Pro Gly Leu Gln
145 150 155 160
Glu Pro Trp Leu His Ser Met Tyr His Gly Ala Ala Phe Gln Leu Thr
165 170 175
Gln Gly Asp Gln Leu Ser Thr His Thr A5p Gly Ile Pro His Leu Val
180 185 190
Leu Ser Pro Ser Thr Val Phe Phe Gly Ala Phe Ala Leu
195 200 205
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 281 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: not relevant
(D) TOPOLOGY: not relevant
(ii) MOLECULE TYPE: protein
(Xi) ~QU~N~ DESCRIPTION: SEQ ID NO:6:
Met Gln Gln Pro Phe Asn Tyr Pro Tyr Pro Gln Ile Tyr Trp Val Asp
1 5 10 15
Ser Ser Ala Ser Ser Pro Trp Ala Pro Pro Gly Thr Val Leu Pro Cys
Pro Thr Ser Val Pro Arg Arg Pro Gly Gln Arg Arg Pro Pro Pro Pro
Pro Pro Pro Pro Pro Leu Pro Pro Pro Pro Pro Pro Pro Pro Leu Pro
Pro Leu Pro Leu Pro Pro Leu Lys Lys Arg Gly Asn His Ser Thr Gly
Leu Cys Leu Leu Val Met Phe Phe Met Val Leu Val Ala Leu Val Gly
Leu Gly Leu Gly Met Phe Gln Leu Phe His Leu Gln Lys Glu Leu Ala
CA 02248868 l998-09-l4
W O 97/34911 PCT~US96/16966
-61-
.100 105 110
Glu Leu Arg Glu Ser Thr Ser Gln Met Hls Thr Ala Ser Ser Leu Glu
115 120 125
Lys Gln Ile Gly His Pro Ser Pro Pro Pro Glu Lys Lys Glu Leu Arg
130 135 140
Lys Val Ala His Leu Thr Gly Lys Ser Asn Ser Arg Ser Met Pro Leu
145 150 155 160
Glu Trp Glu Asp Thr Tyr Gly Ile Val Leu Leu Ser Gly Val Lys Tyr
165 170 175
Lys Lys Gly Gly Leu Val Ile Asn Glu Thr Gly Leu Tyr Phe Val Tyr
180 185 190
Ser Lys Val Tyr Phe Arg Gly Gln Ser Cys Asn Asn Leu Pro Leu Ser
195 200 205
His Lys Val Tyr Met Arg Asn Ser Lys Tyr Pro Gln Asp Leu Val Met
210 215 220
Met Glu Gly Lys Met Met Ser Tyr Cys Thr Thr Gly Gln Met Trp Ala
225 230 235 240
Arg Ser Ser Tyr Leu Gly Ala Val Phe Asn Leu Thr Ser Ala Asp His
245 250 255
Leu Tyr Val Asn Val Ser Glu Leu Ser Leu Val Asn Phe Glu Glu Ser
260 265 270
Gln Thr Phe Phe Gly Leu Tyr Lys Leu
275 280
(2) INFORMATION FOR SEQ ID NO:7:
(i) S~Q~ CHARACTERISTICS:
(A) LENGTH: 24 base pairs
~) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GCGGGATCCG GAGAGATGGT CACC 24
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
...... .. ........ . . .
CA 02248868 1998-09-14
W O 97/34911 PCT~US96/16966
-62-
~A) LENGTH: 27 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) ~Qu~ DESCRIPTION: SEQ ID NO:8:
CGCAAGCTTC CTTCACACCA TGAAAGC 27
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GACCGGATCC ATGGAGGAGA ~L~c~l~AcG GC 32
(2) INFORMATION FOR SEQ ID NO:l0:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l0:
CGCAAGCTTC CTTCACACCA TGAAAGC 27
(2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
CA 02248868 1998-09-14
WO 97134911 PCTIUS96/16966
-63 -
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
GCTCCAGGAT CCGCCATCAT GGAGGAGAGT GTCGTACGGC 40
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GACGCGGTAC CGTCCAATGC ACCACGCTCC TTCCTTC 37
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GCTCGGATCC GCCATCATG 19
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 71 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
_ . . .. . . . ..
CA 02248868 1998-09-14
W O 97/349ll PCTAJS96/l6966
-64-
(xi) S~U~N~ DESCRIPTION: SEQ ID NO:14:
GA1~11~1AG AAAGCGTAGT CTGGGACGTC GTATGGGTAC ACCATGAAAG CCCCGAAGTA 60
AGACCGGGTA C 71
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 baSe PairS
(B) TYPE: nUC1eiC aCid
(C) STR~Nn~nN~S: Sing1e
(D) TOPOLOGY: 1inear
(ii) MOLECULE TYPE: CDNA
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GCTCCAGGAT CCGCCATCAT GGAGGAGAGT GTCGTACGGC 40
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 baSe PairS
(B) TYPE: nUC1eiC aCid
(C) STRANDEDNESS: Sing1e
(D) TOPOLOGY: 1inear
(ii) MOLECULE TYPE: CDNA
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
GACGCGGTAC CGTCCAATGC ACCACGCTCC TTCCTTC 37
(2) INFORMATION FOR SEQ ID NO:17:
(i) S~U~N~ CHARACTERISTICS:
(A) LENGTH: 32 baSe PairS
(B) TYPE: nUC1eiC aCid
(C) STRANDEDNESS: Sing1e
(D) TOPOLOGY: 1inear
(ii) MOLECULE TYPE: CDNA
(X~ U~N~ DESCRIPTION: SEQ ID NO:17:
CA 02248868 1998-09-14
WO 97/34911 PCTAJS96/16966
-65-
GACGCCCATG GAGGAGGAGA GTGTCGTACG GC 32
(2) INFORMATION FOR SEQ ID NO:18:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
GACCGGATCC CACCATGAAA GCCCCGAAGT AAG 83
(2) INFORMATION FOR SEQ ID NO:l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) S~U~N~'~ DESCRIPTION: SEQ ID NO:l9:
CGCAAGCTTC CTTCACACCA TGAAAGC 27
CA 02248868 1998-09-14
W O 97~4911 PCTfUS96/16966
65.1
¦rcfcrénrcnurltber 148& 06 jPC01 ~ o
INDICATIONS I~EL~TING TO A DErOSlTE D 1~5lcRooRGANlsM
(PCT Rule 13bls)
A. Thc indlr tions made beiow rcbte to the L reierrcd lo in Ihe desoription on p~se 4 Iine
i3. In~'. ~ CATION OF DErOSrr Funher deposits ~e identified on ~n additionsl sbeet O
i~me Or deposn-rv insntUliOn
AMERICAN T5ZPF CULIIJRE C~'IT T F~
Aridrcss Or deposil~rr inslilUtion /ircl~ pasl~l codc ~n~ couutr,vJ
12301 Parklawn Drive
~x~ville, M3ryland 20852
United States of h~ica
D~te Or dcposn ¦ Accession Number
22 August 1996 ¦ ATCC n~ nAtlrnn 97689
C. A~DDlTlONALlNDlCATlONS/kavc blar~iJ~opp/ic blc) Tbis ' is rontinuedonJn~dditionJlsheel O
~ Plasmid AIM-2
D. D~SIGNATED STATES FOR ~'}~ICI~ INDICATIONS ARE MADE (iJlhcin~l~auolls~rc~Jor~//eesi~e~5~s~
E. SEPARATE FURNISHING OF INDICATIONS /lee~col~ iJnol ~pplicool~)
Thcindir~l,onslisledbelOwwillbe5ub,n-lledl0lhe~ ~r l~ spyi~ulc~r~er~ reoJ~ e-6-, 'A~io~
N~brr of D~05i-')
For recelvlng Oft-ice use onn For I ~ ' 8ur~u usc onl!
Cl Thls sneel was recr lved wilb Ihc Inlern~noAal aprJhcalion ~ Thls sheel w~s received bv Ihe Imern~llon~l 8ure~u on
Aulhorl;lcd of~lccr ~uln~rl~,cd ol'llc~r
I orm l~~r,~o 1311Jul~ I99'!
