Note: Descriptions are shown in the official language in which they were submitted.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
TARGETED VIRAL VECTORS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of U.S. Provisional Patent
Application USSN 60I015,497 entitled "TARGETED VIRAL VECTORS" with
inventors Gang Yu, Michael Mamounas, Qicheng Yang, Jack Barber and Mang Yu,
filed April 16, 1996, Attorney Docket Number 16556-0009-0. This provisional
application is incorporated by reference in its entirety for a11 purposes. An
application substantially identical to the present application was co-filed in
the United
States Patent Office on April 15, 1997; Attorney Docket Number 16556-0009-10;
Inventors: Michael Mamounas, Gang Yu, Qicheng Yang, Qi-Xiang Li, Jack Barber
and Mang Yu. This U.S. Application is incorporated by reference in its
entirety.
BACKGROUND OF THE INVENTION
Cells can be stably transduced with a number of viral vectors
including those derived from retroviruses, pox viruses, adenoviruses (Ads),
herpes
viruses and parvoviruses. Common viral vectors include those derived from
marine
leukemia viruses (MuLV), gibbon ape leukemia viruses (GaLV), human immuno
deficiency viruses (HIV), adenoviruses, adeno associated viruses, Epstein Ban
viruses, canarypox viruses, cowpox viruses, and vaccinia viruses. Viral
vectors
based upon retroviruses, adeno-associated viruses, herpes viruses and
adenoviruses
are a11 used as gene therapy vectors for the introduction of therapeutic
nucleic acids
into the cells of an organism by ex vivo and in vivo methods.
Prior art viral vectors suffer from a common problem. The vectors
are typically able to transduce only those cells infected by a wild-type virus
corresponding to the vector. Thus, vectors are often either unable to
transfect a
desired target cell, or promiscuously transfect many cell types other than a
specific
target cell. Thus, prior art gene therapy vectors may be ineffective, or have
undesirable side effects due to transduction of non-target cells.
Prior art attempts to make viral vectors cell-specific have been only
partially successful, and have been largely limited to Retroviral vectors. For
instance, retroviruses are typically "pseudotyped" to alter the specificity of
the virus.
In this procedure, viral particle components (typically envelope surface
glycoprotein
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
2
genes) homologous to a given retrovirus are transfected into a cell which
produces
Retroviral particles corresponding to the given retrovirus. The homologous
components are expressed on the outer membrane of the virus, giving the virus
an
altered specificity. For instance, the vesicular stomatitis virus (VSV) env
protein is
relatively promiscuous, and can be used to expand the range of some retroviral
viral
vectors . However, this pseudotyping procedure suffers from two clear
limitations
( 1 ) the pseudotyped virus still infects cells within the host range of the
vector
because the surface of the vector includes both vector and homologous
components,
and (2) the homologous components are typically limited in the cells which
they can
infect.
In addition to pseudotyping procedures, various antibody mediated
procedures have been used to alter the infectivity of particular retroviruses.
See,
Etienne-Julan (1992) Journal of General Virology 73: 3251-3255, and Roux et
al.
(1989) Proc. Natl. Acad. Sci. USA 96: 9079-9083. However, these procedures
have
resulted in low viral infectivity) and result in vectors which retain the
native
specificity of the retrovirus.
Retroviral vectors have recently been engineered to express various
cell receptor ligands in env, enabling the vectors to be targeted to cells
which
express the receptors. See, Cosset et al. ( 1995) Journal of Virology 69: 6314-
6322,
and Somia et al. ( 1995) Proc. Natl. Acad. Sci. USA: 92: 7570-7574. However,
this
procedure results in low infectivity of the vector, and it is not clear what
the
resulting host range of the engineered vectors is. In addition, described
retroviral
vectors only infect dividing cells.
Furthermore, the pseudotyping procedures, antibody mediated
procedures and env engineering procedures have no clear correlate with non-
enveloped viral vectors, because the structural constraints on the surface of
capsid
viruses is more stringent than that observed for env on lipid enveloped
viruses. The
present invention provides new strategies for viral vector targeting, solving
these and
other problems.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
3
SLJMiVIARY OF THE INVENTION
The invention provides targeted viral vectors which transfect selected
cell types, and which do not enter cells through the mechanisms which
ordinarily
permit entry of the corresponding virus into the cell. The vectors of the
invention
have a nucleic acid, and a viral particle which has a targeting ligand. The
particle
substantially lacks a functional wild-type viral cell binding site. The
Targeting
ligand binds to a protein expressed on the surface of a target cell, targeting
the
vector to the target cell.
Typically, the wild-type viral cell binding site on the particle is
deleted by deleting nucleic acid sequence which encode the site (or sites) on
a virus
corresponding to the vector which interact with the viral cell binding site.
In one
class of embodiments, the deleted site is replaced with a targeting ligand
such as
streptavidin, polylysine, a cell receptor ligand, an antibody against a cell
receptor or
an antibody binding Iigand. This yields a targeted viral vector with a ligand
cloned
into the wild-type cell binding site. However, other arrangements are also
appropriate. In cases where the wild-type site is deleted, the targeting
ligand is
optionally cloned into a site other than site of the deletion. In one
embodiment, the
wild-type site is not deleted entirely from the vectors, but is blocked, e.g.,
by
binding an antibody to the wild-type site. In this embodiment, the targeting
ligand is
optionally cloned into the vector, or incorporated into the monoclonal
antibody
which is bound to the vector(e.g., by chemical modification of the antibody
with a
biotin label).
The nature of the viral particle varies depending an the type of
vector. For example, in vectors derived from capsid viruses, such as Ad and
parvoviruses, the particle is essentially a capsid. In enveloped vectors, the
viral
particle includes the lipid envelope and internal nucleic acid packaging
components.
Preferred vectors include recombinant herpes virus vectors, retroviral
vectors,
parvovirus vectors, Ad vectors, pox virus vectors and other vectors known to
persons of skill. Typically, the vectors comprise an expression cassette for
expression of a nucleic acid, which optionally codes for a protein.
The vectors include nucleic acids. In one embodiment, the nucleic
acids encode part or a11 of the vector particle. For instance, the nucleic
acid
optionally encodes AAV or Ad ITRs, or retroviral LTRs, and structural proteins
such as capsid proteins, envelope proteins, or the like. In other embodiments,
the
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
4
nucleic acids in the vectors do not code for the vector, but are packaged by
the
vector. For instance, the nucleic acids optionally include a viral packaging
site such
that when the nucleic acid is bound by viral packaging components it is
packaged
into particles. For example, the nucleic acid is optionally grown in a
packaging cell
which expresses viral packaging components. In other embodiments, the nucleic
acids are unrelated to the vector particle, and are simply associated with the
particle,
e.g.) by chemically coupling the particle to the nucleic acid.
The vectors of the invention are used to transfect a target cell with a
target nucleic acid. Methods of transfection include contacting the cell with
the
vector in vitro or in vivo. Where the vector has a streptavidin moiety on the
surface
of the vector, the method optionally includes the step of binding a
biotinylated
antibody to the vector which binds to a molecule on the surface of the cell to
direct
entry of the vector into the cell.
In one embodiment, the invention provides targeted Ad nucleic acids
and vectors. Preferred nucleic acids have a deletion in the LS region of the
genome,
thereby reducing the natural specificity of the virus. In one preferred
embodiment, a
targeting ligand is cloned into the LS region. The nucleic acid optionally
encodes all
of the components of the viral particle, or is optionally packaged into the
viral
particle with particle components encoded by heterologous nucleic acids, e.g.)
in a
packaging cell.
In another preferred embodiment, the invention provides targeted
AAV vectors. These vectors include a nucleic acid and a capsid which packages
the
nucleic acid. Typically, the capsid has reduced or deleted specificity for the
AAV
cellular receptor. In one preferred embodiment, the AAV vector particle has a
deletion in capsid proteins. For example, deletions in Vpl or Vp3 are
preferred and
typically provide capsids with reduced specificity for the AAV receptor. For
example, in one embodiment, amino acids 239-244 from Vp3 are deleted. In
another embodiment, Vpl has a deletion in the proline rich region, e.g., amino
acids
26-34 in Vpl. Typically, the AAV vectors include a targeting ligand expressed
on
the surface of the capsid. Preferred expression sites include Vpl and Vp3.
Highly
preferred expression sites include amino acids 26-34 of Vpl and 239-244 of
Vp3.
Optionally, the nucleic acid packaged by the AAV particle encodes
the AAV particle. However, the nucleic acid optionally is packaged into the
particle
CA 02251738 1998-10-14
WO 97/38723 PCT/LTS97/06590
in an AAV packaging system, or an AAV transfection system such as an AAV
packaging cell.
As in non-AAV and Ad vector embodiments, the Ad and AAV
vectors of the invention are typically capable of introducing nucleic acids
into target
5 cells. The vectors are brought into contact with the cells, and the vectors
gain entry
to the cell by interaction of the targeting ligand with a molecule on the
surface of the
cell. The Iigand is optionally incorporated into the capsid, or a molecule is
optionally incorporated into the capsid which binds a second molecule such as
a
monoclonal antibody. For example, in one preferred embodiment the cell
targeting
ligand is a biotinylated protein and the capsid comprises a streptavidin
moiety.
In one class of embodiments, The invention provides non-enveloped
vectors such as Ad and AAV based vectors. The vectors have a capsid and a
nucleic acid, where the nucleic acid is typically encapsidated in the capsid.
Antibodies are optionally bound to the capsid, at either the cell binding site
(thus
inhibiting entry of the vector into a cell through normal cellular
mechanisms), or to
a Iigand cloned into the cell binding site. Typically, the antibody is
biotinylated.
The antibody either binds to a cell surface molecule, facilitating entry of
the vector
into cells comprising the surface molecule, or the antibody is coupled through
a
molecular bridge (e.g., a streptavidin intermediate) to a second antibody
which
recognizes a cell surface molecule.
In one class of embodiments, the invention provides combinatorial
methods and libraries for selecting targeting ligands, and for optimization of
vectors
which comprise the targeting Iigands. A targetable vector library comprising a
plurality of recombinant targeted viral vectors having reduced specificity for
a
cellular receptor as compared to a corresponding wild-type virus is provided.
In the
library, each of the targeted viral vectors has a vector nucleic acid encoding
a viral
surface protein-targeting ligand fusion protein. A preferred library is
derived from
AAV,' in which the recombinant targeted vectors are derived from AAV and the
viral surface protein is an AAV capsid (cap) protein. Preferred targets for
the
vectors and libraries of the invention include cell surface proteins such as
CD4 and
CD34.
Method of selecting a targeted vectors using the libraries of the
invention are provided. Typically a targeting nucleic acid encoding a
targeting
peptide which binds to a target cell is provided. This targeting nucleic acid
is
CA 02251738 1998-10-14
WO 97/38723 PCT/IJS97/06590
6
randomly cloned into a vector nucleic acid comprising a mutant surface protein
subsequence which encodes a viral surface protein (typically, this protein has
reduced affinity for a viral receptor as compared to a wild-type virus),
thereby
providing a library of random insertions of the targeting nucleic acid into
the mutant
surface protein subsequence. This library is selected for a vector that
infects a target
cell, thereby selecting the targeted vector. In a preferred embodiment, a
phage
display library is used to select the targeting ligand.
A variety of random cloning strategies are provided, including
creation of random plasmid libraries followed by subcloning into a vector,
random
linker insertion, transposon mutagenesis and the like.
In one embodiment, the invention includes isolated viral vectors
which are isolated using the library screening methods of the invention. For
example, in one embodiment, a vector having a targeting ligand which binds to
a
cell surface protein such as a cell receptor (e. g. , CD34, CD4 an HIV co-
receptor
surface protein or the like} is provided. The vector is made by isolating a
bacteriophage particle, which specifically binds to a cell expressing the
surface
protein, from a random phage display library, thereby providing an identified
bacteriophage particle. The relevant targeting ligand is then subcloned out of
the
display phage (or a synthetic sequence corresponding to the targeting ligand
is
made), and cloned into a viral nucleic acid. The nucleic acid is expressed in
a
vector packaging cell, thereby making a protein comprising the targeting
ligand.
The protein is incorporated into the viral vector in the packaging cell. the
nucleic
acid optionally encodes other features of the vector particle (capsid or
envelope
proteins, or the like), and is optionally packaged by the vector. In one
embodiment,
the vector is an AAV vector.
Polypeptides which specifically bind to CD4 are provided. Preferred
polypeptides include GAVQPRGATSKLYLLRMTDK,
MGEKLI-~RVHIRTNTPSVYSR, LEPRVAQRGQMVKFTYMRLP,
HAWWKPWGWSIEALAPTAGP, and, conservative modifications thereof. Nucleic
acids encoding the polypeptides are also provided. In one embodiment, the
nucleic
acids are encoded in a viral particle which expresses the polypeptides on the
surface
of the particle. For example, the polypeptides can be incorporated into a
viral
surface protein such as an AAV capsid protein.
CA 02251738 1998-10-14
WO 97I38723 PCT/ITS97/06590
7
BRIEF DISCUSSION OF THE DRAWING
Fig. 1. Is a schematic phage particle with a randomized 20-mer at
the n-terminus of the PIII region of the phage capsid protein.
Fig. 2. Is a schematic procedure for selection of high affinity binding
phage.
Fig. 3. describes theoretical mechanisms of AAV entry into a target
cell, including a) AAV vector binds to target cell receptor; b) receptor-
mediated
entry into specific cellular compartment where c) modification/uncoating of
the
vector occurs; d) release from the compartment of modified vector followed by
trafficking to the nucleus; e) hypothetical ligand binds to receptor that fj
is
internalized by mechanism not compatible with AAV transduction. Also,
theoretical
entry of AAV into target cell where I) receptor binding is II) independent
from
mechanism of internalization.
Fig. 4. is a schematic representation for construction of targetable
vector library and subsequent enrichment steps.
Fig. 5. is a simplified diagram of the transposable element AT-2.
Shown are 4 nucleotide U3 elements necessary for integration; unique
restriction
sites RE with --15 nucleotide flanking sequences; selection marker
dihydrofolate
reductase gene (DHFR).
Fig. 6 shows AAV binding mutants.
DEFINITIONS
An "AAV helper virus" is a virus which supplies some or all of the
functions necessary for AAV (or rAAV vector) replication which are not encoded
by
a wild-type AAV. Typically these functions are supplied in traps by viruses
such as
adenovirus or herpes virus during viral replication. Adenovirus and herpes
virus are
examples of AAV helper viruses.
An "AAV ITR sequence" refers to the sequences which comprise the
palindroniic terminal repeats at the 3' and 5' ends of the AAV genome.
Typically,
the repeats are about 150 nucleotides in length. The AAV ITR regions provide
sequences for packaging the AAV provirus (i.e., the AAV genome) into the AAV
viral capsid. The ITR regions also form secondary structures which act as self
primers for AAV replication. Samulski (supra) describes AAV ITR sequences and
structures .
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
8
An "adenovirus ITR" refers to the 3' and 5' terminal regions of the
adenovirus genome. See, e.g., Gingeras et al. (l982) J. Biol. Chem. 257:13475-
13491.
An "antibody" is a polypeptide substantially encoded by an
immunoglobulin gene or immunoglobulin genes, or fragments thereof which
specifically bind and recognize an analyte (antigen). Recognized
immunoglobulin
genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant
region genes, as well as the myriad immunoglobulin variable region genes.
Light
chains are classified as either kappa or lambda. Heavy chains are classified
as
gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin
classes, IgG, IgM, IgA, IgD and IgE, respectively. An exemplary immunoglobulin
(antibody) structural unit comprises a tetramer. Each tetramer is composed of
two
identical pairs of polypeptide chains, each pair having one "light" (about 25
Kd) and
one "heavy" chain (about 50-70 Kd). The N-terminus of each chain defines a
variable region of about 100 to 110 or more amino acids primarily responsible
for
antigen recognition. The terms variable light chain (VL) and variable heavy
chain
(VH) refer to these light and heavy chains respectively. Antibodies exist
e.g., as
intact immunoglobulins or as a number of well characterized fragments produced
by
digestion with various peptidases. Thus, for example, pepsin digests an
antibody
below the disulfide linkages in the hinge region to produce F(ab)'2, a dimer
of Fab
which itself is a light chain joined to VH-CH1 by a disulfide bond. The
F(ab)'2
may be reduced under mild reducing conditions to break the disulfide linkage
in the
hinge region, thereby converting the F(ab)'2 dimer into an Fab' monomer. The
Fab' monomer is essentially an Fab with part of the hinge region (see,
Fundamental
Immunology, Third Edition, W . E. Paul, ed. , Raven Press, N. Y. ( 1993) for a
more
detailed description of other antibody fragments). While various antibody
ftagments
are defined in terms of the digestion of an intact antibody, one of skill will
appreciate that such Fab' fragments may be synthesized de novo either
chemically or
by utilizing recombinant DNA methodology. Single chain antibodies are commonly
referred to a ScAbs. Thus, the term antibody, as used herein, also includes
antibody
fragments either produced by the modification of whole antibodies or those
synthesized de novo using recombinant DNA methodologies. An antibody or other
protein specifically binds to a cognate molecule when it binds with an
affinity (I~) of
at least about 1o-6, preferably about 10-g, and usually about 10-9 or better.
CA 02251738 1998-10-14
WO 97138723 PCTiUS97106590
9
A "cell surface receptor" or a "cell membrane receptor" is a cellular
molecule expressed on the cell's outer membrane surface which is bound by a
ligand. Typically, in the context of the present invention, the binding of a
cell
surface receptor to its cognate ligand causes endocytosis of the receptor and
ligand.
A "cell surface protein" is a protein expressed at least partially on the
outer
membrane of a cell, including transmembrane proteins and proteins associated
with
the outer cell membrane.
Two vectors are "complementary" when the two together encode
functions necessary for vector packaging, and when each individually does not
encode a11 of the functions necessary for packaging. Thus, for instance, when
the
two vectors transduce a single cell they together encode the information for
production of vector particles. The use of such complementary vectors is
preferred
because it increases the safety of any packaging cell made by transformation
with a
vector.
"Encapsidation" xefers to the general process of incorporating a viral
genome into a viral capsid.
"Endocytosis" refers generally to the phenomenon of a cell ingesting
material, e.g., by phagocytosis or pinocytosis. Receptor-mediated endocytosis
provides an efficient means of causing a cell to ingest material which binds
to a cell
surface receptor. See, Wu and Wu ( 1987) J. Biol. Chem. 262:44.29-4432; Wagner
et al. ( 1990) Proc. Natl. Acad. Sci. USA 87: 3410-3414, and EP-A 1 0388 758.
The term "heterologous" when used with reference to a nucleic acid
indicates that the nucleic acid comprises two or more subsequences which are
not
found in the same relationship to each other in nature. For instance, the
nucleic acid
is typically recombinantly produced, having two or more sequences from
unrelated
genes arranged to make a new functional nucleic acid. For example, in one
embodiment, the nucleic acid has a promoter from one gene arranged to direct
the
expression of a coding sequence from a different gene. Thus, with reference to
the
coding sequence, the promoter is heterologous.
A "human cell" is any cell which is substantially human in origin,
including organismal cells, tissue culture cells, and chimeric cells with
human
chromosomes.
The term "nucleic acid" refers to a deoxyribonucleotide or
ribonucleotide polymer in either single- or double-stranded form, and unless
CA 02251738 1998-10-14
WO 97I38723 PCT/US97J06590
otherwise limited, encompasses known analogues of natural nucleotides that
hybridize to nucleic acids in manner similar to naturally occurring
nucleotides.
Unless otherwise indicated, a particular nucleic acid sequence includes the
complementary sequence thereof.
5 A "nucleic acid vector" is a composition which can transduce,
transform, transfect or infect a cell, thereby causing the cell to replicate
and/or
express nucleic acids and/or proteins other than those native to the cell, or
in a
manner not native to the cell. A vector includes a "vector nucleic acid"
(ordinarily
RNA or DNA) to be expressed or replicated by the cell. A vector nucleic acid
10 optionally encodes materials to aid in achieving entry of the nucleic acid
into the
cell, such as a viral particle, liposome, protein coating or the like. A "cell
transformation vector" is a vector which encodes a nucleic acid capable of
transforming a cell once the nucleic acid is transduced into the cell.
The term "operably linked" refers to functional linkage between a
nucleic acid expression control sequence (such as a promoter, or array of
transcription factor binding sites) and a second nucleic acid sequence,
wherein the
expression control sequence directs transcription of the nucleic acid
corresponding to
the second sequence.
The terms "polypeptide", "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid residues. The terms
apply to amino acid polymers in which one or more amino acid residue is an
artificial chemical analogue of a corresponding naturally occurring amino
acid, as
well as to naturally occurring amino acid polymers.
A "potential targeting peptide" is a peptide to be tested for the its
ability to target a vector to a target cell.
A "promoter" is an array of nucleic acid control sequences which
direct transcription of a nucleic acid. As used herein, a promoter includes
necessary
nucleic acid sequences near the start site of transcription, such as, in the
case of a
polymerise II type promoter, a TATA element. The promoter also includes distal
enhancer or repressor elements which can be located as much as several
thousand
base pairs from the start site of transcription. A "constitutive" promoter is
a
promoter which is active under most environmental conditions and states of
development or cell differentiation. An "inducible" promoter responds to an
extracellular stimulus.
CA 02251738 1998-10-14
WO 97/38723 PCT/ZJS97/06590
11
A "receptor-binding ligand" is a biological molecule which binds to a
receptor molecule on the surface of a cell. The molecule is either naturally
occurring or artificial (e.g., synthetic). Typically, in the context of the
present
invention, the binding of the receptor binding ligand to its cognate receptor
results in
endocytosis of the receptor binding ligand, along with materials which are
attached
to the receptor binding ligand.
The term "recombinant" when used with reference to a viral vector
indicates that the vector comprises or is encoded by one or more nucleic acids
which
are derived from a nucleic acid which was artificially constructed. For
example, the
vector can comprise or be encoded by a cloned nucleic acid formed by joining
heterologous nucleic acids as taught, e. g. , in Berger and Kimmel, Guide to
Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press,
Inc. , San Diego, CA (Berger) and in Sambrook et al. ( 1989) Molecular Cloning
- A
Laboratory Manual (2nd ed.) Vol. 1-3 (Sambrook).
A "recombinant expression cassette" is a nucleic acid construct,
generated recombinantly or synthetically, with a series of specified nucleic
acid
elements which permit transcription of a target nucleic acid. The recombinant
expression cassette can be derived from a plasmid, virus, chromosome or
nucleic
acid fragment. Typically, the recombinant expression cassette includes a
nucleic
acid to be transcribed (a target nucleic acid), and a promoter. In some
embodiments, the expression cassette also includes, e. g. , an origin of
replication,
andlor chromosome integration elements such as viral LTRs or viral ITRs.
A vector has "reduced specificity" for a cellular receptor when the
vector binds to the cellular receptor with lower specificity than a
corresponding wild-
type virus, or a vector with a wild-type viral cell recognition protein. For
instance,
in the examples herein, competition binding assays are used to establish that
the
mutant AAVs described bind to cells with less specificity than wild-type AAV.
A
"corresponding wild-type virus" is the virus from which the cell recognition
protein
on the viral vector particle is derived (e. g. , envelope or capsid proteins,
depending
on the vector). A viral "cell recognition protein" is the protein on the
surface of the
viral particle derived from a wild-type virus which binds a cellular receptor,
thereby
mediating entry of the wild-type virus. Some of these proteins, such as those
derived from retroviral vectors, are glycoproteins. Typically, the vector with
CA 02251738 1998-10-14
WO 97I38723 PCTIUS97/06590
12
reduced specificity binds to the cellular receptor at a rate which is 50 % or
lower
than that of a vector or virus with a wild-type cell recognition protein.
Usually, the
vector with reduced specificity binds to the cellular receptor at a rate 25 %
or lower,
and often 1 % or lower than a vector or virus with a wild-type cell
recognition
protein. Binding to the cellular receptor can be measured by cellular uptake
of
nucleic acids, by ELISA assays, by viral competition assays, or by directly
measuring the binding of the cellular receptor to the virus by labeling the
receptor or
the vector.
Where the viral vector with reduced specificity for the cellular
receptor also includes a targeting ligand, the vector typically binds to a
molecule on
a cell through the targeting ligand with high specificity. Thus, specificity
measurements of the binding of the viral vector to a cellular receptor other
than one
which binds the targeting ligand should be carried out on cells which do not
comprise a molecule which binds the targeting ligand. Alternatively, the
binding
mediated through the targeting ligand can be independently estimated and
subtracted
away from the binding results.
"Sequences necessary for AAV packaging" in the context of an AAV
helper nucleic acid include AAV sequences active in trans found between or
within
the AAV ITR regions which encode nucleic acids and proteias necessary for
encapsidation of the rAAV nucleic acid into an AAV capsid, e. g. , typically
the AAV
capsid proteins (Vp 1, Vp 2, Vp3) and replicase proteins (Rep 78, Rep 68, Rep
40,
Rep 52). In the context of the rAAV nucleic acid, "Sequences necessary for AAV
packaging" refer to cis-active sequences which permit the rAAV nucleic acid to
be
"encapsidated" (packaged into an AAV viral capsid; "encapsulated" is
equivalent
terminology herein). These sequences typically include the AAV ITR regions.
A "Subsequence" in the context of a nucleic acid or polypeptide
refers to a sequence corresponding to a portion of the nucleic acid or
polypeptide.
The portion is up to 100 % of the nucleic acid or polypeptide, or can be only
a small
portion of a molecule.
A "target nucleic acid" is a nucleic acid to be transduced into a cell.
The target nucleic acid can integrate into a cell's genome, or remain
episomal.
The term "targeted" when used with reference to a viral vector indicates that
the vector is bound by a specific subset of cells, enabling the vector to
transfer
associated nucleic acids into a cell of the subset.
CA 02251738 1998-10-14
WO 97/38723 PCTIUS97/06590
13
A "targeting ligand" is a molecule which either specifically binds a
cell or is bound by a second molecule or complex of molecules which
specifically
bind a cell. The strength or affinity of binding interactions can be expressed
in
terms of the dissociation constant (Kp) of the interaction, wherein a smaller
Kp
represents a greater affinity. Immunological binding properties of selected
polypeptides can be quantified using methods well known in the art. One such
method entails measuring the rates of antigen-binding site/antigen complex
formation
and dissociation, wherein those rates depend on the concentrations of the
complex
partners, the affinity of the interaction, and on geometric parameters that
equally
influence the rate in both directions. Thus, both the "on rate constant" (Ko")
and the
"off rate constant" (Kbrr) can be determined by calculation of the
concentrations and
the actual rates of association and dissociation. The ratio of K~ff/Ko"
enables
cancellation of all parameters not related to affinity and is thus equal to
the
dissociation constant KD. A cell is specifically bound when the ligand (or
ligand
complex) has a Kp of 10-5 or better, preferably 10-6 or better, more
preferably 10-i or
better, generally 108 or better and usually 10-9 or better. An alternative
measure of
specificity where the targeting ligand is incorporated into a viral vector is
that
nucleic acid associated with the vector is transferred into the cell upon
incubation of
the cell with the vector, while the nucleic acid is transferred into cells
which lack a
receptor for the targeting ligand at a substantially reduced level. Typically,
vector
nucleic acid is transferred into the cell with a receptor which binds the
targeting
ligand at a rate of at least about Sx and preferably at least about 10x that
observed
for a cell which lacks the receptor. A cell lacks a receptor when the cell
cannot be
isolated from a population of cells by FACS using an antibody against the
receptor
as a marker, or when an isotype matched antibody control binds to the cell
with the
same intensity ( t about 5 % ) as an antibody specific for the receptor.
Uptake of
nucleic acid into the cell can be measured by Southern or northern analysis,
quantitative PCR, by expression of encoded proteins (e.g., by ELISA or western
blotting) or the like.
A Targetable vector library" is a collection of related vectors, where
at least one of the vectors in the collection specifically binds to a protein
expressed
on the surface of the cell.
A "targeted vector" is a viral vector which includes a targeting
ligand. Preferably, the vector has reduced binding to a cellular receptor for
the
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
14
corresponding virus. A targeting nucleic acid encodes a targeting ligand such
as a
peptide which binds to a protein expressed on the outer membrane of a cell.
A "target cell" is a cell to be transduced by a selected vector.
"Titers" are numerical measures of the "concentration" of a virus or
viral vector compared to a reference sample, where the concentration is
determined
either by the activity of the virus, or by measuring the number of viruses in
a unit
volume of buffer. The titer of viral stocks are determined, e. g. , by
measuring the
infectivity of a solution or solutions (typically serial dilutions) of the
viruses, e.g.,
on HeLa cells using the soft agar method (see, Graham & Van Der eb (1973)
Virology 52:456-467) or by monitoring resistance conferred to cells, e. g. ,
G418
resistance encoded by the virus or vector, or by quantitating the viruses by
UV
spectrophotometry (see, Chardonnet & Dales (1970) Virology 40:462-4.77).
A cell is "transduced" with a selected nucleic acid when the nucleic
acid is translocated from the extracellular environment into the cell. A cell
is
1 S "stably transduced" with a selected nucleic acid when the selected nucleic
acid is
replicated and passed on to progeny cells. A virus or vector "transduces" a
cell
when it transfers a nucleic acid associated with the vector into the cell. A
cell is
"transformed" by a nucleic acid when a nucleic acid transduced into the cell
becomes stably replicated by the cell, either by incorporation of the nucleic
acid into
the cellular genome, or by episomal replication. A virus or vector is
"infective"
when it transduces a cell, replicates, and (without the benefit of any
complementary
virus or vector) spreads progeny vectors or viruses of the same type as the
original
transducing virus or vector to other cells in an organism or cell culture,
wherein the
progeny vectors or viruses have the same ability to reproduce and spread
throughout
the organism or cell culture. "Transduction" refers to the process in which a
foreign
nucleic acid (which is packaged in a viral particle or associated with a viral
particle
when outside of the cell) is introduced into a cell. The foreign nucleic acid
is
typically integrated into the cellular genome, but in some embodiments remains
episomal. "Transfection" refers broadly to the process of causing a nucleic
acid to
enter a cell. In the art, the term is sometimes used to refer to a process
wherein the
nucleic acid is "naked," i.e.. not in a viral capsid or associated with other
biologicals. For purposes of the present invention "transfection" refers to
the
process of causing a nucleic acid to enter the cell as a "naked" nucleic acid,
and/or
CA 02251738 1998-10-14
WO 97I38723 PCT/US97106590
to the process of causing a nucleic acid which is associated with other
biologicals,
such as nucleic acid binding molecules, viral components, receptor ligands
etc. to
enter a cell.
A "viral particle" in the context of a viral vector refers to virally
5 derived vector material (proteins, glycoproteins, lipids, etc. ) which
package or is
associated with a nucleic acid competent to be packaged by a wild-type virus
in the
vector. For instance, a viral particle can be a capsid (e.g., where the virus
is Ad or
AAV), or a capsid with a lipid envelope (e.g., where the virus is a
retrovirus). A
nucleic acid competent to be packaged by a wild-type viral particle includes
10 packaging sequences recognized by the corresponding virus, such as the psi
site in a
retrovirus or the Ad or AAV ITRs.
It is expected that a viral vector viral particle will ordinarily package
nucleic acid. One preferred measure of packaging is nuclease resistance of the
packaged nucleic acid. If the viral vector particle protects the vector
nucleic acid
15 from a nuclease which ordinarily degrades the nucleic acid, it packages the
nucleic
acid. A particle protects a nucleic acid from degradation when the rate of
cleavage
of the packaged nucleic acid upon exposure to a nuclease is slowed by at least
about
5 %, and preferably at least about 10% , typically at least about 20%, more
typically
at least about 30 % , usually at least about 40 % , ordinarily at least about
50 % , and
generally at least about 60 % . In preferred embodiments, cleavage by the
nuclease is
slowed by 90% or more.
A "viral vector" is a nucleic acid vector which has components
derived from a virus which aid in packaging the nucleic acid and/or
transferring the
nucleic acid into a cell. For example, an AAV viral vector has AAV components
such as AAV capsid proteins, and an HN viral vector has HIV components such as
HIV gag and env proteins. Viral vectors are optionally heterologous, i. e. ,
they
optionally comprise components from more than one virus. For example, a vector
optionally comprises homologous components from more than one virus (e.g., env
proteins from MuLV and VSV on the surface of a viral particle), or
complementary
proteins from more than one virus (e.g., VSV env proteins on the surface of a
retroviral particle with MuLV capsid antigen proteins packaging a nucleic acid
inside
of the retroviral outer lipid envelope).
CA 02251738 1998-10-14
WO 97l38723 PCT/LTS97/06590
16
A "viral surface protein" is a protein expressed on the outer surface
of the protein, such as a capsid protein or an envelope protein. A "viral
surface
protein-targeting iigand fusion protein" is a fusion protein which has a
surface
protein domain, which optionally encodes part or all of the surface protein,
linked to
a ligand protein domain. Ordinarily, the fusion protein is produced by
recombinantly joining a nucleic acid which encodes a targeting ligand peptide
to a
nucleic acid which encodes at least a portion of the surface protein, and
expressing
the resulting recombinant molecule.
A "wild-type viral cell binding site" is an epitope on the surface of a
viral vector which is derived from an epitope on the surface of a wild type
virus
which mediates entry of the virus into a cell within the host range of the
virus. A
"wild-type cell viral binding site" is the site on the cell bound by the
epitope on the
wild-type virus (i.e., the cellular receptor for the virus).
A functional AAV receptor" is a cell surface protein which is bound
by a wild-type AAV, wherein binding of the cell surface protein facilitates
entry of
the AAV into the cell, e.g.) by receptor mediated endocytosis.
DETAILED DISCUSSION OF THE INVENTION AND PREFERRED
EMBODI1VVIENTS
Several cell transformation vectors are becoming increasingly useful
as gene therapy vectors. Some of the most widely used cell transformation
vectors
include those derived from wild-type viruses. Typically, the vectors have
viral
nucleic acid subsequences which permit packaging of the nucleic acid into a
viral
particle corresponding to the virus from which the sequence is derived. For
instance, retroviruses have a packaging site which is typically located
adjacent to the
5' LTR, e. g. , next to the gene for gag. See) Aldovani et al. ( 1990) Journal
of
Virology 64(5): 1920-1926. The packaging sites for parvoviruses such as B 19
and
AAV are located in the viral ITRs. See, Samulski, supra. Adenovirus packaging
sites arelocated in the adenoviral ITRs.
Many vectors also include sequences for chromosomal integration of
vector nucleic acids into a host chromosome. Such sequences include parvovirus
(particularly AAV) ITRs, retroviral LTRs and various known transposable
elements.
Transcription cassettes competent to express genes of interest in a cell are
often
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
17
placed between these chromosome integration elements for integration into the
host
chromosome.
Targeting vectors to particular cell types is of interest for both in vitro
and in vivo transformation of cells. For instance, in replacement gene therapy
where
defective or absent genes are replaced using cell transformation vectors, only
a
subset of all an organism's cells ideally express a replacement gene.
Similarly, only
selected cell types are targets for intracellular immunization procedures
which
immunize cells against virus infection by expressing anti-viral agents in the
cells.
When using gene therapeutic procedures against cancers, it is desirable to
limit
expression of anti-cancer agents to cancer cells.
The present invention provides a general approach to making targeted
gene therapy vectors. The first step in making targeted vectors of the
invention is to
destroy the natural specificity of a given vector. This is done to prevent the
vector
from infecting cells within the host range of the virus from which the vector
is
derived. The natural specificity of a vector is destroyed by recombinantly
deleting
or mutating the site on the vector which is ordinarily recognized by a
cellular
receptor during entry of the vector {the viral cell binding site) . For
instance, where
the vector is derived from a retrovirus, the envelope glycoproteins are
mutated to
prevent recognition by a cellular receptor. For instance, where the cellular
receptor
is CD4 (i.e., when the vector has a particle based upon a primate lentivirus),
the
envelope glycoproteins are mutated such that CD4+ cells no longer permit entry
of
the vector.
Similarly, where the vector is derived from a capsid-based virus such
as an Ad or AAV, the capsid proteins are recombinantly altered so that cells
infectable by the corresponding virus no longer permit entry of the modified
vector.
As an alternative to recombinant modification, the viral cell binding
site can be modified chemically or by binding an antibody (or other moiety) to
the
site to prevent interaction of the site with a cell.
The second step in making a targeted vector is to incorporate a
targeting molecule into the vector. The targeting molecule is typically a
peptide
epitope recognized by a cell, or is a peptide moiety recognized by a coupling
complex. For instance, the epitope can be the binding site for a cellular
receptor
(e. g. , IL-2, IL-4, FcyI, FcyII and Fc~yIII receptors, CD4, CDB, CD34, HIV co-
CA 02251738 1998-10-14
WO 97/38723 PCT/LTS97/06590
18
receptors such as a member of the 7 transmembrane receptor family, such as
Eosin,
CKRS, CKR-3 or CKR-2b or other chemokine receptors) on the surface of a cell.
Many cellular receptor-ligand interactions are known, including those
described in
Hulme (ed) Receptor Ligand Interactions (1992) Oxford University Press (Hulme
1)
and the references therein, and Hulme (ed) Receptor Effector Coupling ( 1990)
Oxford University Press (Hulme 2) and the references therein. Methods of
measuring binding to cellular receptors are also known, and described in Hulme
1
and Hulme 2.
Recently, a seven-transmembrane domain protein was shown to serve
as an accessory factor for T-cell-tropic {T-tropic) HIV-1 isolates. See) Feng
et al. ,
Science 272:872-877, l996, and Berson et al. (1996) J Virol 70 (9): 6288-95.
Expression of this glycoprotein, termed Eosin, in murine, feline, simian and
quail
cell lines, in conjunction with human CD4, rendered these cells permissive for
HIV-1 envelope glycoprotein (Env)-mediated infection. Fusin is an appropriate
target which a targeted vector of the invention can be directed against.
A second member of the seven-transmembrane domain protein family,
the beta-chemokine receptor CKR-5 (alternately known as "CC-CKRS" or as "CCR-
5"), mediates infection of macrophage by M-tropic HIV viruses. Co-expression
of
CKR-5 with CD4 enables nonpermissive cells to form syncytia with cells
infected by
M-tropic, but not T-tropic, HIV-1 env proteins. Expression of CKR-5 and CD4
permits entry of M-tropic, but not T-tropic, virus strain. See, Doranz et al.
( 1996)
Cell 85 (7): 1l49-58; Feng et al. (1996) Science 272 (5263): 872-7; Alkhatib
et al.
( 1996) Sci ence 272 {5270) : 1955-8, and Deng et al. ( 1996) Nature 3 81 (65
84)
66l-6. Some T cells also express CKR-5 (e.g., in addition to Eosin), and CKR-5
can also mediate infection of M-tropic HIV viruses into these T cells. CKR-5
is an
appropriate target which a targeted vector of the invention can be directed
against.
Sequence for the CKRS receptor is found in GenBank at Accesion U57840. See
also, Combadiere et al. (1996) J. Leukoc. Biol. 60 (1), 147-152 and Combadiere
May 9, 1996 Direct Submission to GenBank).
A dual-tropic primary HIV-1 isolate {89.6) utilizes both Fusin and
CKR-5 as entry cofactors. See, Doranz et al. , id. Cells expressing the 89.6
env
protein form syncytia with QT6 cells expressing CD4 and either Fusin or CKR-5.
The beta-chemokine receptors CKR-3 and CKR-2b support HN-1 89.6 env-mediated
CA 02251738 1998-10-14
WO 97/38723 PCT/US97J06590
19
syncytia formation. These known chemokine receptors are also appropriate
targets
for the targeted vectors of the invention.
Combinations of cell surface molecules are also appropriate targets.
For example, a targeting ligand optionally binds more than one cell surface
protein,
such as CD4 and an HIV co-receptor molecule such as Eosin or CKRS.
In another preferred embodiment, the targeting molecule is
streptavidin, and the vector is targeted to a cell by binding a second
biotinylated
targeting molecule to the streptavidin through the biotinylation site. This
second
targeting molecule can be an antibody which recognizes a particular cell type,
or a
cell receptor ligand for a receptor found on a target cell type.
Makin~Vector Nucleic Acids
The vectors of the invention comprise recombinant nucleic acids
which optionally encode targeting molecules, expression cassettes, viral
packaging
sites, chromosomal integration elements (e.g., AAV ITRs or retroviral LTRs)
and
the like. Given the strategy for making the vectors of the present invention,
one of
skill can construct a variety of vectors containing functionally equivalent
nucleic
acids. Cloning methodologies to accomplish these ends, and sequencing methods
to
verify the sequence of nucleic acids are well known in the art. Examples of
appropriate cloning and sequencing techniques, and instructions sufficient to
direct
persons of skill through many cloning exercises are found in Berger and
Kimmel,
Guide to Molecular Cloning Techniques) Methods in Enzymology volume 152
Academic Press, Inc., San Diego, CA (Berger); Sambrook et al. (l989) Molecular
Cloning - A Laboratory Manual (2nd ed.) Vol. 1-3, Cold Spring Harbor
Laboratory,
Cold Spring Harbor Press, NY, (Sambrook); and Current Protocols in Molecular
Biology, F.M. Ausubel et al., eds., Current Protocols, a joint venture between
Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1994
Supplement)
(Ausubel). Product information from manufacturers of biological reagents and
experimental equipment also provide information useful in known biological
methods. Such manufacturers include the SIGMA chemical company (Saint Louis,
MO), R&D systems (Minneapolis, MN), Pharmacia LKB Biotechnology
(Piscataway, NJ), CLONTECH Laboratories, Inc. (Palo Alto, CA), Chem Genes
Corp., Aldrich Chemical Company (Milwaukee, WI), Glen Research, Inc., GIBCO
BRL Life Technologies, Inc. (Gaithersberg, MD), Fluka Chemica-Biochemika
CA 02251738 1998-10-14
WO 97I38723 PCTIUS97/06590
Analytika (Fluky Chemie AG, Buchs, Switzerland), Invitrogen, San Diego, CA,
and
Applied Biosystems (Foster City, CA), as well as many other commercial sources
known to one of skill.
In one preferred embodiment, the steps of reducing the natural
5 specificity of a vector and adding a targeted specificity are combined. In
this
embodiment, a nucleic acid encoding targeting peptide such as a cell receptor
ligand,
or a streptavidin peptide is used in an insertional mutagenesis procedure. The
nucleic acid is inserted into the coding region for a capsid or surface
envelope
protein at locations which potentially encode the natural viral cell binding
site on the
10 surface of the corresponding wild-type vector. The insertion is performed
such that
the reading frame of the coding region is not altered. Resulting vectors are
then
screened for their ability to enter a target cell through the targeting
peptide, and for
their inability to enter a cell through the receptor which recognizes a
corresponding
virus. An example of insertional mutagenesis on herpes virus is found in
Chiang et
15 al. ( 1994) 68(4) : 2529-2543.
The nucleic acid compositions of this invention, whether RNA,
cDNA, genomic DNA, or a hybrid of the various combinations, are isolated from
biological sources or synthesized in vitro. The nucleic acids of the invention
are
present in transformed or transfected whole cells, in transformed or
transfected cell
20 lysates, or in a partially purified or substantially pure form.
In vitro amplification techniques suitable for generating and
amplifying sequences for use as molecular probes or generating nucleic acid
fragments for subsequent subcloning are known. Examples of techniques
sufficient
to direct persons of skill through such in vitro amplification methods,
including the
polymerase chain reaction (PCR) the ligase chain reaction (LCR), Qa-replicase
amplification and other RNA polymerase mediated techniques (e. g. , NASBA) are
found in Berger, Sambrook, and Ausubel, as well as Mullis et al. , ( 1987) U.
S.
Patent' No. 4,683,202; PCR Protocols A Guide to Methods and Applications
(Innis et
al. eds) Academic Press Inc. San Diego, CA ( 1990) (Innis); Arnheim & Levinson
(October 1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3, 81-94;
(Kwoh et al. (1989) Proc. Nail. Acad. Sci. USA 86, 1173; Guatelli et al.
(l990)
Proc. Natl. Acad. Sci. USA 87, 1874; Lomell et al. (1989) J. Clin. Chem 35,
1826;
Landegren et al., (1988) Science 241, i077-1080; Van Brunt (1990)
Biotechnology
CA 02251738 1998-10-14
WO 97J38723 PCT/US97J06590
21
8, 291-294; Wu and Wallace, (1989) Gene 4, 560; Barringer et al. (1990) Gene
89,
117, and Sooknanan and Malek ( 1995) Biotechnology 13: 563-564. Improved
methods of cloning in vitro amplified nucleic acids are described in Wallace
et al.,
U.S. Pat. No. 5,426,039.
Oligonucleotides for use as probes, e.g., in in vitro amplification
methods, for use as gene probes, or as inhibitor components (e.g., ribozymes)
are
typically synthesized chemically according to the solid phase phosphoramidite
triester
method described by Beaucage and Caruthers ( 1981 ), Tetrahedron Letts. ,
22(20):18S9-1862, e.g., using an automated synthesizer, as described in
Needham-VanDevanter et al. (1984) Nucleic Acids Res., 12:6159-6l68.
Oligonucleotides can also be custom made and ordered from a variety of
commercial
sources known to persons of skill. Purification of oligonucleotides, where
necessary, is typically performed by either native acrylamide gel
electrophoresis or
by anion-exchange HPLC as described in Pearson and Regnier (1983) J. Chrom.
255:I37-149. The sequence of the synthetic oligonucleotides can be verified
using
the chemical degradation method of Maxam and Gilbert ( 1980) in Grossman and
Moldave (eds.) Academic Press, New York, Methods in Enzymology 65:499-560.
Making Conservative Substitutions
One of skill can easily generate a nucleic acid sequence by reference
to a given polypeptide sequence by reference to the genetic code, using
synthetic or
recombinant techniques as described, supra. For example, one of skill can
easily
make nucleic acids encoding the polypeptides GAVQPRGATSKLYLLRMTDK,
MGEKLHRVHIRTNTPSVYSR, LEPRVAQRGQMVKFTYMRLP, and
HAWWKPWGWSIEALAPTAGP, as well as conservative modifications of these
proteins. Conservative modifications of the vectors of the invention are also
appropriate.
One of skill will appreciate that many conservative variations of the
nucleic acid and polypeptide constructs of the invention disclosed yield
functionally
identical constructs. For example, due to the degeneracy of the genetic code,
"silent
substitutions" (i.e., substitutions of a nucleic acid sequence which do not
result in an
alteration in an encoded polypeptide) are an implied feature of every nucleic
acid
sequence which encodes an amino acid. Similarly, "conservative amino acid
substitutions," in one or a few amino acids in an amino acid sequence of a
CA 02251738 1998-10-14
WO 97/38723 PCTIUS97106590
22
packaging or packageable construct are substituted with different amino acids
with
highly similar properties and are also readily identified as being highly
similar to a
disclosed construct. Such conservatively substituted variations of each
explicitly
disclosed sequence are a feature of the present invention.
Because of the degeneracy of the genetic code, a large number of
functionally identical nucleic acids encode any given polypeptide. For
instance, the
codons CGU, CGC, CGA, CGG, AGA, and AGG all encode the amino acid
arginine. Thus, at every position where an arginine is specified by a codon,
the
codon can be altered to any of the corresponding codons described without
altering
the encoded polypeptide. Such nucleic acid variations are "silent variations,
" which
are one species of "conservatively modified variations. " Every nucleic acid
sequence which encodes a polypeptide also describes every possible silent
variation.
One of skill will recognize that each codon in a nucleic acid (except AUG,
which is
ordinarily the only codon for methionine) can be modified to yield a
functionally
identical molecule by standard techniques. Accordingly, each "silent
variation" of a
nucleic acid which encodes a polypeptide is implicit in any described
sequence.
Furthermore, one of skill will recognize that individual substitutions,
deletions or
additions which alter, add or delete a single amino acid or a small percentage
of
amino acids (typically less than 5 % , more typically less than 1 %) in an
encoded
sequence are "conservatively modified variations" where the alterations result
in the
substitution of an amino acid with a chemically similar amino acid.
Conservative
substitution tables providing functionally similar amino acids are well known
in the
art. The following six groups each contain amino acids that are conservative
substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2)
Aspartic
acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine
(R),
Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6)
Phenylaianine {F), Tyrosine (Y), Tryptophan (W). See also, Creighton (1984)
Proteins VV.H. Freeman and Compan.. . In a preferred embodiment, a nucleic
acid
which encodes a polypeptide is optimized for translation efficiency by
selecting
codons which are prevalent in the cell type which the virus is to be expressed
in.
Species codon bias tables are well known, and in common use.
A complementary nucleic acid refers to a nucleic acid complementary
to the sense strand. Thus, a sense strand encoding a given polypeptide
hybridizes
under stringent conditions to the complementary strand. Stringent
hybridization or
CA 02251738 1998-10-14
WO 97I38723 PCT/US97106590
23
wash conditions in the context of nucleic acid hybridization experiments such
as
Southern and northern hybridizations are sequence dependent, and are different
under different environmental parameters. An extensive guide to the
hybridization
of nucleic acids is found in Tijssen ( 1993) Laboratory Techniques in
Biochemistry
and Molecular Biology--Hybridization with Nucleic Acid Probes part I chapter 2
"overview of principles of hybridization and the strategy of nucleic acid
probe
assays", Elsevier, New York. Generally, highly stringent hybridization and
wash
conditions are selected to be about S ~ C lower than the thermal melting point
(Tm)
for the specific sequence at a defined ionic strength and ph. The Tm is the
temperature (under defined ionic strength and pH) at which 50 % of the target
sequence hybridizes to a perfectly matched probe. Very stringent conditions
are
selected to be equal to the Tm for a particular probe. An example of stringent
hybridization conditions for hybridization of complementary nucleic acids
which
have more than 100 complementary residues on a filter in a Southern or
northern
blot is 50% formalin with 1 mg of heparin at 42~C, with the hybridization
being
corned out overnight. An example of stringent wash conditions is a .2x SSC
wash
at 65 ~C for 15 minutes (see, Sambrook, supra for a description of SSC
buffer).
Often the high stringency wash is preceded by a low stringency wash to remove
background probe signal. An example low stringency wash is 2x SSC at 40~C for
15 minutes. In general, a signal to noise ratio of 2x (ot~ higher) than that
observed
for an unrelated probe in the particular hybridization assay indicates
detection of a
specific hybridization. A coding nucleic acid refers to the sense strand of a
nucleic
acid. Nucleic acids which do not hybridize to each other under stringent
conditions
are still substantially identical if the polypeptides which they encode are
substantially
identical . This occurs, e. g. , when a copy of a nucleic acid is created
using the
maximum codon degeneracy permitted by the genetic code.
One of skill will recognize many ways of generating alterations in a
given'rnlcleic acid construct. Such well-known methods include site-directed
mutagenesis, PCR amplification using degenerate oligonucleotides, exposure of
cells
containing the nucleic acid to mutagenic agents or radiation (mutagenic agents
and
radiation are collectively referred to herein as "mutagens"), chemical
synthesis of a
desired oligonucleotide (e. g. , in conjunction with ligation and/or cloning
to generate
large nucleic acids) and other well-known techniques. See, Giliman and Smith
CA 02251738 1998-10-14
WO 97/38723 PCT/tJS97/06590
24
(1979) Gene 8:81-97, Roberts et al. (l987) Nature 328:731-734 and Sambrook,
Innis, Ausbel, Berger, Needham VanDevanter and Mullis (all supra).
One of skill can select a desired nucleic acid of the invention based
upon the sequences provided and upon knowledge in the art regarding viruses
generally. The life-cycle, genomic organization, developmental regulation and
associated molecular biology of viruses have been the focus of over a century
of
intense research. The specific effects of many mutations in viral genomes are
known. Moreover, general knowledge regarding the nature of proteins and
nucleic
acids allows one of skill to select appropriate sequences with activity
similar or
equivalent to the nucleic acids and polypeptides disclosed in the sequence
listings
herein. Conservative amino acid substitutions are described herein.
Finally, most modifications to nucleic acids are evaluated by routine
screening techniques in suitable assays for the desired characteristic. For
instance,
changes in the immunological character of encoded polypeptides can be detected
by
an appropriate immunological assay. Modifications of other properties such as
nucleic acid hybridization to a complementary nucleic acid, redox or thermal
stability of encoded proteins, hydrophobicity, susceptibility to proteolysis,
or the
tendency to aggregate are a11 assayed according to standard techniques.
Making Parvovirus Vectors
A general introduction to human parvoviruses is found, e.g., in
Pattison ( 1994) Principles and Practice of Clinical Virology (Chapter 23)
Zuckerman
et al. eds, John Wiley & Sons Ltd. and the references therein. The best
characterized of the human parvoviruses are B 19 and AAV, both of which are
used
as the basis for cell transformation vectors, e.g., for gene therapy. AAVs are
of
particular use for the transformation of cells in vivo and ex vivo with target
nucleic
acids.
AAVs utilize helper viruses such as adenovirus or herpes virus to
achieve productive infection. In the absence of helper virus functions, AAV
integrates (site-specifically) into a host cell's genome, but the integrated
AAV
genome has no pathogenic effect. The integration step allows the AAV genome to
remain genetically intact until the host is exposed to the appropriate
environmental
conditions (e.g., a lytic helper virus), whereupon it re-enters the lytic life-
cycle.
Samulski (1993) Current Opinion in Genetic and Development 3:74-80 and the
CA 02251738 1998-10-14
WO 97/38723 PCTIUS97/06590
references cited therein provides an overview of the AAV life cycle. For a
general
review of AAVs and of the adenovirus or herpes helper functions see, Berns and
Bohensky ( 1987) Advanced in Virus Research, Academic Press. , 32:243-306. The
genome of AAV is described in Laughlin et al. ( l983) Gene, 23:65-73.
Expression
5 of AAV is described in Beaton et al. (1989) J. Virol., 63:4450-4454.
AAV-based vectors are used to transduce cells with target nucleic
acids, e.g., in the in vitro production of nucleic acids and peptides, and in
in vivo
and ex vivo gene therapy procedures. See, West et al. (1987) Virology 160:38-
47;
Carter et al. ( 1989) U. S. Patent No. 4,797, 368; Carter et al. WO 93/24641 {
1993);
10 Kotin ( 1994) Human Gene Therapy 5 : 793-801; Muzyczka ( 1994) J. Clin.
Invst.
94:135l and Samulski (supra) for an overview of AAV vectors. Construction of
recombinant AAV vectors are described in a number of publications, including
Lebkowski, U. S. Pat. No. 5,173,4l4; Tratschin et al. ( 1985) Mol. Cell. Biol.
5( 11):3251-3260; Tratschin, et al. ( 1984) Mol. Cell. Biol. , 4:2072-2081;
Hermonat
15 and Muzyczka ( 1984) Proc. Natl. Acad. Sci. USA, 81:6466-6470; McLaughlin
et al.
( 1988) and Samulski et al. ( 1989) J. Vi rol. , 63 :03822-3828. Cell lines
that can be
transformed by rAAV include those described in Lebkowski et al. ( 1988) Mol.
Cell.
Biol. , 8:3988-3996.
Recombinant AAV vectors (rAAV vectors) deliver foreign nucleic
20 acids to a wide range of mammalian cells (Hermonat & Muzycka ( 1984) Proc
Natl
Acad Sci USA 81:6466-6470; Tratschin et al. ( 1985) Mol Cell Biol 5 :3251-
3260),
integrate into the host chromosome (McLaughlin et al. ( 1988) J Virol 62:
1963-1973), and show stable expression of the transgene in cell and animal
models
(Flotte et al. (1993) Proc Natl Acad Sci USA 90:10613-106l7). rAAV vectors are
25 able to infect non-dividing cells (Podsakoff et al. ( l994) J Virol 68:5656-
66; Flotte
et al. ( 1994) Am. J. Respir. Cell Mol. Biol. 11:5l7-521 ). Further advantages
of
rAAV vectors include the lack of an intrinsic strong promoter, thus avoiding
possible activation of downstream cellular sequences, and the vector's naked
icosohedral capsid structure, which renders the vectors stable and easy to
concentrate
by common laboratory techniques.
rAAV vectors are used to inhibit, e.g., viral infection, by including
anti-viral transcription cassettes in the rAAV vector. For example, Chatterjee
et al.
(Science (1992), 258: 1485-1488, hereinafter Chatterjee et al. 1) describe
anti-sense
CA 02251738 1998-10-14
WO 97I38723 PCT/LTS97/06590
26
inhibition of HIV-1 infectivity in target cells using an rAAV vector with a
constitutive expression cassette expressing anti-TAR RNA. Chatterjee et al.
(PCT
application PCT/US91 /03440 ( 1991 ), hereinafter Chatterjee et al. ~ describe
rAAV
vectors, including rAAV vectors which express antisense TAR sequences.
Chatterjee and Wong (Methods, A companion to Methods in Enzymology ( 1993), 5:
51-59) further describe rAAV vectors for the delivery of antisense RNA.
rAAV vectors have several properties which make them preferred
gene delivery systems in clinical settings. They have no known mode of
pathogenesis and 80 % of people in the United States are currently
seropositive for
AAV (Blacklow et al. ( 1971 ) J Natl Cancer Inst 40:319-327; Blacklow et al. (
1971 )
Am J Epidemiol 94:359-366). Because rAAV vectors have little or no endogenous
promoter activity, specific promoters may be used, depending on target cell
type.
rAAV vectors can be purified and concentrated so that multiplicities of
infection
exceeding 1.0 can be used in transduction experiments . This allows virtually
100
of the target cells in a culture to be transduced, eliminating the need for
selection of
transduced cells.
Targetable AAYs
The basic strategy for creating a targetable rAAV is to destroy the
normal binding region on the AAV capsid and to add a targeting ligand to the
capsid. As set forth in the examples below, the natural specificity of the AAV
capsid was destroyed by mutations in either Vpl or Vp3, while still retaining
the
ability of the viral capsid to protect the encapsidated nucleic acid from
DNAse 1
digestion. Combinatorial methods for rapidly screening AAV mutants are also
provided below.
These AAV vectors are made targetable in one of several ways. In
one preferred embodiment, a nucleic acid encoding a streptavidin peptide is
cloned
into a capsid protein gene, resulting in a capsid protein which binds biotin.
Vectors
comprising the recombinant capsid protein are ta. aeted to particular cells by
binding
a biotinylated targeting agent to the vector which agent is recognized by a
particular
type of cell. For instance, a biotinylated antibody which binds a particular
cell type
is used to target the vector to the cell type. In one particularly preferred
embodiment, the streptavidin nucleic acid is cloned into the site of the
mutation
(e.g., deletion) which makes the capsid unable to bind the AAV cellular
receptor.
CA 02251738 1998-10-14
WO 97I38723 PCTIUS97/06590
27
In other preferred embodiments, a targeting ligand which binds to a
cell receptor, such as a single chain antibody protein against CD34, the C4
peptide
which binds to CD4, or other targeting ligands are cloned into the AAV vector.
In
one embodiment described more fully below, a targeting ligand is identified by
combinatorial screening methods from phage libraries of peptides. The
targeting
ligand is typically about 20 amino acids in length, although longer or shorter
peptides are also useful.
Retroviral Vectors
Retrovirus-based vectors are useful due to their ability to transduce
cells efficiently with target nucleic acids, and because of their ability to
integrate a
target nucleic acid into a cellular genome. The majority of approved gene
transfer
trials in the United States rely on replication-defective retroviral vectors
harboring a
therapeutic polynucleotide sequence as part of the retroviral genome (see,
Miller et
al. (1990) Mol. Cell. Biol. 10:4239 (l990); Kolberg (1992) J. NIH Res. 4:43,
and
Cornetta et al. Hum. Gene Ther. 2:215 (199l)). Widely used vectors include
those
based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV),
Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and
combinations thereof. See, e.g., Buchscher et at. (l992) J. Virol. 66(5) 2731-
2739;
Johann et al. (1992) J. Virol. 66 (5):1635-1640 (1992); Sommerfelt et al.,
(1990}
Virol. l76:58-59; Wilson et al. (1989) J. Virol. 63:2374-2378; Miller et al.,
J.
Virol. 65:2220-2224 (199l); Wong-Staal et al., PCT/US94/05700; Rosenburg and
Fauci ( 1993) in Fundamental Immunology, Third Edition Paul (ed) Raven Press,
Ltd. , New York and the references therein, and Yu et al., Gene Therapy (
1994)
1:13-26.
Various methods of targeting retroviruses have been described. Roux
et al. ( 1989) Proc. Natl Acad. Sci. USA 96:9079-9083 describe a technique for
making biotinylated antibodies and targeting retroviruses to MHC receptors
using
biotinylated antibodies and streptavidin. Cosset et al. , supra describe a
technique
for targeting retroviral vectors to cells expressing epidermal growth factor
receptors
(EGFR) or Ram-1.
Targetable Retroviruses of the invention
The basic strategy for creating a targetable retroviral vector is to
destroy the normal binding region on the retroviral envelope and to add a
targeting
CA 02251738 1998-10-14
WO 97l38723 PCTIUS97/06590
28
ligand to the envelope. As described for rAAVs, this technique is performed
recombinantly, or by adding a targeting agent to the viral particles. Because
the
retroviral particles have a lipid envelope, targeting molecules which bridge
the lipid
envelope are optionally added to the envelope, e. g. , using Iiposomes
comprising the
targeting agent.
One class of preferred retroviral vectors of the invention have a
streptavidin peptide cloned into the N-terminal region of the relevant
retroviral
surface protein. For instance, MLV vectors with Sfi 1 and Not 1 restriction
sites at
codon 6 are available. See, Cosset, id. The retroviral vectors are targeted to
a cell
by complexing the retroviral particle comprising the streptavidin site with an
antibody or other protein specific for a target cell type. Similarly, any
other
targeting ligand as described herein can be cloned into a retroviral vector in
the N
terminal region of an env gene. As described supra, combinatorial methods for
optimizing these vectors are provided.
Herpes Virus Vectors
An introduction to herpes viruses, including herpes simplex, varicella
zoster, cytomegalovirus, Epstein-bar virus and human herpes viruses 6 and 7
are
found in Zuckerman et al. (eds) (1994) John Wiley & Sons, New York Chapter 1
(see, Cleator and Klapper, Kangoro and Harper, Griffiths, Crawford and Fox et
al. ) .
A variety of Herpes virus vectors are described in Cochran et al. ( 1993 ) U .
S . Pat.
No. 5,223,424.
Glycoprotein gD on the HSV envelope, and the homologous
glycoprotein on other herpes envelopes, mediate infectivity of the virus.
Chiang et
al. ( 1994) Journal of Virology 68(4) 2529-2553 and the references therein
describe
the functional regions of the protein, including the receptor binding site. In
the
methods of the invention, the protein is disabled for its ability to bind the
herpes
virus receptor, either recombinantly, or by binding an antibody or other
protein to
the receptor. A targeting molecule is then incorporated into the viral
envelope,
either recombinantly into the gD protein, or using liposomes, or by binding
the
targeting molecule to the surface of the vector.
One class of preferred herpes virus vectors of the invention have a
streptavidin peptide cloned into residues from the region from 270-310 of the
gD
surface protein. The herpes virus vectors are targeted to a cell by complexing
the
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
29
herpesvirus particle comprising the streptavidin site with an antibody
specific for a
target cell type. Other preferred herpes vectors utilize any other peptide
targeting
ligand described herein cloned into the region from 270-3l0 of the gD protein.
Adenovirus Vectors
An introduction to adenoviruses is found in Zuckerman et al. (eds)
( 1994) John Wiley & Sons, New York Chapter 7 (see, Sharp and Wadell) and the
references therein. Adenovirus vectors for gene delivery are described, e.g.,
in
Denefle et al. WO 95l238967; Vigne et al. ( 1995) Restorative Neurology and
Neuroscience 8: 35-36; Kremer and Perricaudet ( 1995) British Medical Bulletin
51(1): 31-44; Haddada et al. (1995) in The Molecular Repitoire of Adenoviruses
lll,
Biology and Pathogenesis 297-304, Springer Verlag, New York, and Randrianson-
Jewtoukoff and Perricaudet (1995) Biologicals 23: I45-157.
Adenovirus capsids are essentially composed of three proteins:
hexons, pentons, and penton fibers. Each virion capsid contains 240 hexon
proteins
1 S that comprise the bulk of the virion icosahedral shell . At each vertex of
the capsid
is a penton base protein which is non-covalently attached to the amino
terminus of
the penton fiber protein. At the carboxy terminus of the penton fiber there is
a
knob-like structure which mediates receptor binding of the virus.
In the constructs of the invention, deletions or other mutations are
made in the binding domain of the carboxy terminus of the fiber protein which
is
located in region LS of the adenoviral genome (85-95 mw). Targeting ligands
are
then cloned into the capsid protein genes, preferably into the mutated region
of the
pention fiber.
In one preferred embodiment, the coding sequence for streptavidin is
cloned into the region corresponding to the fiber binding domain. Streptavidin
is
capable of high affinity binding to biotin (Kd - I o- ~ 3) and procedures are
readily
available for biotinylating proteins of interest. Hence, biotinylated
antibodies (or
other ~ligands) of choice are used to form non-covalent linkage with
adenovirus
containing fiber/streptavidin fusion proteins. This modified vector allows for
cloning genes of interest into typical adenovirus cloning regions and, upon
linkage of
biotinylated targeting protein, is able to specifically bind to target cells
with high
affinity, without significant non-target cell interactions.
CA 02251738 1998-10-14
WO 97/38723 PCT/tJS97/06590
Similarly, other preferred Ad vectors utilize any other peptide
targeting ligand described herein cloned into the LS region.
Making Antibodies
In many embodiments, the vectors of the invention are targeted by
5 binding antibodies specific for a target cell to the vector, or single chain
antibodies
are recombinantly expressed on the surface of a vector of the invention.
Methods of
producing polyclonal and monoclonal antibodies are known to those of skill in
the
art, and many anti-cellular antibodies, including antibodies which recognize
tumors,
virally infected cells, hematopoietic cells and other targets for gene therapy
are
10 commercially available.
For the construction of antibodies generally, See, e. g. , Coligan ( 1991 )
Current Protocols in Immunology Wiley/Greene, NY; and Harlow and Lane ( 1989)
Antibodies: A Laboratory Manual Cold Spring Harbor Press, NY; Stites et al.
(eds.)
Basic and Clinical Immunology (4th ed.) Lange Medical Publications, Los Altos,
15 CA, and references cited therein; Goding ( 1986) Monoclonal Antibodies:
Principles
and Practice (2d ed.) Academic Press, New York, NY; and Kohler and Milstein
( 1975) Nature 256: 495-497. Such techniques include antibody preparation by
selection of antibodies from libraries of recombinant antibodies in phage or
similar
vectors. See, Huse et al. ( 1989) Science 246: 1275-1281; and Ward, et al. (
1989)
20 Nature 341: 544-546. Specific monoclonal and polyclonal antibodies and
antisera
will usually bind with a KD of at least about .1 mM, more usually at least
about 1
~,M, preferably at least about .1 ~,M or better, and most typically and
preferably,
.O1 ~,M or better.
As described supra, the vectors of the invention optionally comprise
25 or encode a target molecule such as a protein or ribozyme. A particular
protein
expressed by the recombinant expression cassettes of the invention can be
quantified
by a variety of immunoassay methods, i.e.) when expression of a protein is
used to
monitor whether the vector transducer a target cell. For a review of
immunological
and immunoassay procedures in general, see Stites and Terr (eds.) 199l Basic
and
30 Clinical Immunology (7th ed.). Moreover, the immunoassays of the present
invention can be performed in any of several configurations, e.g., those
reviewed in
Maggio (ed.) (1980) Enzyme Immunoassay CRC Press, Boca Raton, Florida; Tijan
( 1985) "Practice and Theory of Enzyme Immunoassays, " Laboratory Techniques
in
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
31
Biochemistry and Molecular Biology, Elsevier Science Publishers B.V.,
Amsterdam;
Harlow and Lane, supra; Chan (ed. ) ( 1987) Immunoassay: A Practical Guide
Academic Press, Orlando, FL; Price and Newman (eds. ) ( l991 ) Principles and
Practice of Immunoassays Stockton Press, NY; and Ngo (ed. ) ( 1988) Non
isotopic
S Immunoassays Plenum Press, NY.
Couplin,~ Tar eting Proteins To Biolo ig_cal Agents
In the invention, antibodies or other proteins such as cell receptor
ligands are optionally used as targeting agents. These proteins are either
recombinantly fused to a viral surface protein, such as an adenoviral or adeno
associated viral capsid protein as described supra, or are added to the
vector. In one
embodiment, these proteins are chemically bound to a biological agent such as
biotin
which binds a cognate on the surface of the vector particle, e. g. , a
streptavidin
moiety. The procedure for attaching an agent to a protein will vary according
to the
chemical structure of the agent. Antibodies are proteins which contain a
variety of
1S functional groups; e.g. , carboxylic acid (COOH) or free amine (-NHZ)
groups,
which are available for reaction with a suitable functional group on an agent
molecule to bind the agent thereto. Alternatively, the protein and/or agent
may be
derivatized to expose or attach additional reactive functional groups. The
derivatization may involve attachment of any of a number of linker molecules
such
as those available from Pierce Chemical Company, Rockford, Illinois. A
bifunctional linker having one functional group reactive with a group on a
particular
agent, and another group reactive with an protein, may be used to form the
desired
protein conjugate. Alternatively, derivatization may involve chemical
treatment of
the protein; e. g. , glycol cleavage of the sugar moiety of the glycoprotein
protein
2S with periodate to generate free aldehyde groups . The free aldehyde groups
on the
protein may be reacted with free amine or hydrazine groups on an agent to bind
the
agent thereto. {See U.S. Patent No. 4,671,958). Procedures for generation of
free
sulfhydryl groups on antibodies or protein fragments are also known (See U.S.
Pat.
No. 4,6S9,839). Many procedure and linker molecules for attachment of various
compounds including radionuclide metal chelates, toxins and drugs to proteins
such
as antibodies are known. See, for example, European Patent Application No.
188,2S6; U.S. Patent Nos. 4,671,9S8, 4,6S9,839, 4,414,148, 4,699,784;
4,680,338;
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
32
4,569,789; and 4,589,071; and Borlinghaus et al. Cancer Res. 47: 4071-4075
(l987)).
In a preferred embodiment, biotin is coupled to the targeting protein
to facilitate binding of the targeting protein to the viral particle. Biotin
structure and
biological activity are described, e.g., in Stryer (l988) Biochemistry, third
edition
Freeman and Co. NY. Methods of biotinylating proteins are widely known and
used, and biotinylating reagents and kits are widely available, e.g.) from
Sigma,
Aldrich, and Pierce. Harlow and Lane describe methods of biotinylating
proteins
such as antibodies in Antibodies: A Laboratory Manual ( 1988) By Cold Spring
Harbor Laboratory Press. To prepare biotinylated protein, proteins are
incubated
with a biotinylating reagent such as NHS-LC-biotin (Pierce) overnight at 4~C,
and
then purified on an appropriate column (e.g., a presto desalting column from
Pierce) . See also, Hawkin et al. ( 1992) J. Mol. Biol. 226, 889-896.
In one embodiment, poly-1-lysine is coupled to the protein (e.g.,
where the protein is transferrin which binds the transferrin receptor), or is
itself used
as a targeting agent. Poly-1-lysine or poly-1-lysine-transferrin which has
been linked
to defective adenovirus mutants is delivered to cells with transfection
efficiencies
approaching 90 % (Curiel et al. ( l991 ) Proc Natl Acad Sci USA 88: 8850-8854;
Cotten et al. ( 1992) Proc Natl Acad Sci USA 89:6094-6098; Curiel et al. {
l992)
Hum Gene Ther 3:147-154; Wagner et al. (1992) Proc Natl Acad Sci USA
89:6099-6103; Michael et al. (l993) J Biol Chem 268:6866-6869; Curiel et al.
(1992) Am J Respir Cell Mol Biol 6:247-252, and Harris et al. (1993) Am J
Respir
Cell Mol Biol 9:441-447). Adenovirus-poly-1-lysine-DNA conjugates bind the
normal adenovirus receptor and are subsequently internalized by receptor-
mediated
endocytosis. Herpes viruses have similar properties. Transferrin-poly-1-lysine
conjugates enter cells which comprise transferrin receptors. See) e. g. ,
Curiel ( 1991 )
Proc. Natl. Acad Sci USA 88: 8850-8854 and Wagner et al. ( 1993) Proc. Natl.
Acad. Sci. USA 89:6099-6013.
Expression Cassettes
The vectors of the invention are typically targeted against mammalian
cells. However, because the vectors can be targeted against essentially any
cell by
the selection of the targeting agent, the choice of nucleic acids to place
within any
expression cassette encoded by the vector depends upon the intended target
cell.
CA 02251738 1998-10-14
WO 97/38723 PCTlUS97/06590
33
Examples of cells which can be transformed with the vectors of the invention
include
bacteria, yeast, plant, filamentous fungi, insect and vertabrate cells such as
mammalian cells. It is expected that those of skill in the art are
knowledgeable in
the numerous expression systems available for cloning and expression of
nucleic
acids. Sambrook, Ausbel, and Berger provide a guide to expression cassettes.
This
ability to transduce cells makes the vectors of the invention generally useful
as
recombinant vectors for transducing cells with nucleic acids. One of skill
will
recognize the general need for vectors as tools for recombinant procedures.
Single-Chain Antibody Targeting
Cloned single chain antibody molecules can be generated by PCR
from the variable region of known antibodies where a hybridoma is available,
using
standard technidues. This technology is adapted to target a viral vector
against
essentially any protein of interest. For example, fusions between a viral
surface
protein, such as a retroviral glycoprotein, an adenoviral coat protein or the
AAV cap
protein, and a single chain antibody are provided. A fusion protein strategy
is
favorable since it simplifies large-scale vector production once a vector
design is
established.
As an exemplar strategy, developed single-chain variable region
antibodies (ScAb) against the CD34 marker on stem cells were developed. FACS
binding experiments were performed showing that the ScAbs specifically bind to
the
CD34 marker. In addition, ScAbs were fused to the N-terminus of AAV Vp2 and
used to generate AAV particles in packaging experiments. Furthermore, these
particles had elevated levels of transduction on cell lines expressing CD34
(KG-1)
compared to control vector. FACS binding experiments were performed to
demonstrate that the ScAb-vector was able to specifically bind to the CD34
marker.
Anti-sera against the ScAb are used to directly detect the presence of the
ScAb on
intact particles.
In one embodiment, the construct described above was made using a
wild type (WT) rAAV in the construction of vector comprising the ScAb, so that
the
resulting targetable vector was dual-tropic as it was able to bind to both the
AAV
receptor and to the CD34 marker. A more preferred targetable vector is
defective in
normal AAV binding to avoid significant dilution by such a dual-tropic vector
upon
injection into a human. For example, the SCAB is cloned into the cap protein
of an
CA 02251738 1998-10-14
WO 97I38723 PCT/US97106590
34
AAV binding mutant such as one exemplified herein, which has at least a 100-
fold
decrease in binding affinity compared to the WT.
In one embodiment, a nucleic acid encoding the ScAb was fused to
the Vp2 region of AAV . See, the Examples, supra. Other constructs include the
ScAb nucleic acid fused to the N-terminus of Vpl or Vp3, C-terminal addition
of
ScAb to various cap proteins, and adding ScAb at the site of the mutation.
Vectors
which contain a11 of the capsid elements in cis are desirable, although
vectors
systems delivering the ScAb-Vp2 in traps are also provided.
In ScAb fusions, a hinge region (derived from a native
immunoglobulin) is preferably provided at the site of attachment of the ScAb.
This
hinge region increases the flexibility of fusion proteins comprising single
chain
antibodies and facilitates maintenance of native conformations for the domains
of the
fusion protein. All constructs are optionally evaluated both for their ability
to
express the ScAb-capsid fusion protein, generate vector particles, and for the
presence of the ScAb domain on the surface of the vector particle. Recombinant
vector constructs are assessed for their ability to bind to specific target
cells and for
transducing activity.
One new target cell line provided herein is a Cos cell line expressing
CD34. It was found that the common CD34+ cell line, KG-l, appeared to have a
defect in its ability to be transduced by AAV relative to non-target cells
such as
HeLa cells. Cos cells are readily transducible by AAV and exhibit low native
cross reactivity to CD34 antibodies.
Library Technology
One design consideration for making targetable vectors is determining
the optimal placement of the targeting ligand within a surface protein on a
vector of
the invention. The size of a targeting ligand such as an ScAb is also relevant
as the
size of the targeting ligand has an impact on the overall conformation of
vector
proteins v~rhich are required for correct vector assembly.
Although the receptor for AAV has recently been identified, there is
no information available concerning its normal cellular function, interaction
with
infectious virions, and mechanism of virus internalization. In spite of these
unknowns, as indicated supra, regions on AAV cap proteins that influence AAV
receptor binding are identified herein. Cap fusion proteins which allow
targeting of
AAV to CD34 cell surface proteins with subsequent transduction of specific
target
CA 02251738 1998-10-14
WO 97/387Z3 PCT/L1S97/06590
cells are provided. However, a strategy for optimizing these vectors is also
needed,
and provided herein.
A strategy which allows for unbiased construction of vectors capable
of targeting and efficiently transducing any cell type of interest is provided
herein.
5 Both library technology and in vitro evolution of candidate vectors are
utilized so
that vectors are randomly selected for that have optimal transduction capacity
with
respect to both receptor binding and gene delivery. This system is
specifically
designed within the constraints of limited available information regarding
vector
structure and internalization processes. Furthermore, this system is amenable
to
10 virtually any vector and any target cell, even if a candidate receptor for
that cell has
not been identified.
The library strategy has two basic components: 1) identification of
small targeting peptides by phage display libraries, and 2) randomized
insertion of
those identified peptides in vector surface proteins, followed by
amplification and
15 evolution viable vector particles. For simplicity, the following discussion
relates to
this strategy for developing AAV vectors; however, the strategy is applied to
essentially any vector, including retroviral vectors, adenoviral vectors,
parvoviral
vectors and the like.
In one embodiment, the targeting strategy described herein provides
20 for the isolation of a viral vector having a targeting Iigand which binds
to a cell
receptor such as CD34 or CD4. Typically, the vector is made by isolating a
bacteriophage particle which specifically binds to a cell comprising a
selected
receptor such as CD34 or CD4 from a random phage display library, subcloning a
subsequence derived from the identified bacteriophage particle corresponding
to the
25 targeting ligand into a vector nucleic acid, and expressing the vector
nucleic acid in
a cell, thereby making a targeting protein comprising the targeting ligand.
The
targeting ligand is packaged into the vector, e. g., in a packaging cell which
comprises additional vector components . The additional components are
optionally
supplied in traps, i. e., by traps-complementation as described, supra.
Optionally,
30 one or more additional viral component is encoded in the vector nucleic
acid, in
addition to the targeting ligand. In general, the targeting ligand is cloned
into a viral
surface protein, such as an AAV or Ad capsid protein, or a retroviral envelope
protein, or the like, as described herein.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
36
Ligand Identification and Development
As previously stated, a vector targeting system contains a cell surface
target-binding component (ligand) which can be associated with the vector
surface
protein (e. g. , AAV cap protein) and which redirects the vector to a new cell
surface
target (receptor) of choice. Ideally, the ligand is inserted into the capsid
in the form
of a fusion protein; however, some currently available candidate ligands for
desired
receptors are large in size (e. g. , ScAb) and thus may not be optimal due to
the
influence of the ligand on the overall structure of the virion capsid
assembly.
Consequently, for generation of fusion proteins, it is advantageous to use
small
peptides ( - 20 amino acids) so that incorporation into the capsid protein
results in
minimal changes to the overall conformation of the virion.
Phage display libraries (available, e. g. , from Affymax in Santa Clara,
CA), are used for selection of ligands with unique and high binding affinities
for
specific cell types. These libraries are used both for the selection of
ligands capable
of binding to specific receptors of choice (e. g. , CD34, CD4, etc. ) and
ligands
capable of binding to specific cell types of interest (e. g. , hematopoietic
stem cells,
T-lymphocytes, .etc. ) where a target receptor has not been identified. The
later
situation occurs, for example, where true progenitor cells may be identified
as
CD34+ CD38- as opposed to CD34+ CD38+, with the only known difference in
the receptor profile of these cells being the lack of the CD38 marker in the
target
true progenitor cell, making targeting to these cell more difficult using
previous
techniques .
Phage display libraries containing randomized peptides (e.g., 20
mers, or similar sized peptides) are selected against a target cell type, such
as
primary CD4+ T-cells, CD34+ stem cells or CD34+ CD38- stem cells. Briefly, the
cell type used for selection is incubated with phage library at a
concentration of le5
cells/3e9 phage particles in 2 m1 of PBS/Ca++/ BSA (standard incubation
buffer). at
37~C.' After washing, the cells are lysed and the liberated phage particles
are
amplified in bacteria under standard conditions. The above process is repeated
about
3 times, followed by sequencing of the selected clones (See Figs. 1 and 2).
As an empirical matter, a single peptide species is typically isolated
by this technique which is specific for the target cell in question, rather
than broadly
reactive for many cell types. Presumably this is because the starting
libraries are
CA 02251738 1998-10-14
WO 97I38723 PCTIUS97/06590
37
substantially under-representative of a11 possible combinations for randomized
20-mers, thus many species are not contained within any given library. In
addition,
factors which influence high affinity binding and selection for a given
peptide are
apparently cell type specific. This may be due to receptor abundance or other
factors which influence the overall conformation of surface proteins of a
given cell
type. For example, there are subtle differences in the same protein on
different cell
types which can be rendered targetable by the phage system. Alternatively, the
phage system produces peptides which recognize combinations of surface
proteins
that have unique quaternerary structure on a given cell type.
Once a peptide is identified it is tested for specific binding by adding
a fixed concentration of peptide-phage species in the presence of increasing
concentration of purified homologous free-peptide. The cell associated phage
is then
recovered and titered by standard assays and the resulting affinity value is
calculated
by Scatchard analysis. Similar experiments are performed on typically at least
S
different unrelated cell types to demonstrate the specificity of the isolated
peptide.
Most undesirable targets are essentially ubiquitous (e. g. , the insulin
receptor) and
examination of 5 unrelated cell types should permit elimination of peptides
which
bind to these common receptors.
In the case of peptides against CD34+ CD38- cell types, the library
is selected against CD34+ CD38- cells at low stringency, and the resulting
bound
material is selected against CD34+CD38+ cells at high stringency. The eluate
from
the latter pass (unbound material) is substantially free of phage which bind
to CD34+
CD38+ cells and can thus be selected against CD34+ CD38- cells at high
stringency.
Peptides which are specific for the desired cell type, relative to the
unrelated cell types and which have I~ values greater than or equal to le-6 M,
are
mutagenized in a new library with homology to the isolated peptide
sequence(s).
This new library is subjected to an analysis identical to the above with the
goal of
isolating related peptides with Ka values of greater than or equal to le-9 M.
The
advantages of this procedure is that binding peptides are made against cells
without
concern or knowledge of the receptor profile of the given cells. One
disadvantage
is that even though the peptides are screened for lack of binding against, e.
g. , five
other cell types, it is not certain what the specificity of this peptide is,
since its
binding target is unknown and there is usually no foundation in the literature
to help
establish the tissue distribution of the unidentified receptor. Some of these
concerns
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
38
are minimized by testing in animals (e.g., SCID mice) and empirically
determining
the tissue distribution of an injected vector comprising the targeting
peptide. In
addition, if a particular peptide is identified which has an especially low K~
(i. e. ,
le-11 M) it is desirable to perform cross-linking experiments to identify the
binding
protein in parallel, or prior, to initiating animal studies.
In the alternative strategy, peptides contained in phage display
libraries are will be selected against purified binding proteins of interest
(i.e., a
CD34 protein). For example, methods of screening peptides bound to a solid
matrix
is known. The peptide phage that are isolated by this analysis are then be
screened
against cells of interest that contain the protein in question (i. e., CD34
expressing
cell lines). This pre-selection step with a purified protein limits the
library to the
binding protein of interest, and the subsequent selection steps on intact
cells isolates
phage which bind to regions of the protein that are exposed on the cell
surface.
Similar to above, the isolated peptide are mutagenized with the goal of
obtaining a
peptide with a Kd of at least le-9 M.
In another variation, cell lines which express the protein of interest
(i. e. , CD4, CD34) may be used for subtractive purification of binding phage,
provided that an identical parent cell is available which does not express the
given
protein. Such cell lines are prepared by transfection or by infection with
common
expression vectors such as vaccinia. The phage are bound to the null cell line
to
remove phage that bind to proteins common to the two cell lines, and then
bound
and eluted from the target cell line. All peptides obtained by this and the
above
procedures, and with the appropriate K.~, are used to construct targetable
vector
libraries as outlined below.
Identifying ligand(s) bound to cell surface CD4 molecules is one of
the important tasks in developing a targetable vector that can specifically
deliver
therapeutic genes into human CD4+ T-lymphocytes. Phage display technology was
used as described to explore human CD4 binding peptides from a random peptide
library as candidate binding ligands to human CD4. The following are examples
of
CD4 binding peptides that were identified: GAVQPRGATSKLYLLRMTDK;
MGEKLHRVHIRTNTPSVYSR; LEPRVAQRGQMVKFTYMRLP; and
HAWWKPWGWSIEALAPTAGP.
CA 02251738 1998-10-14
WO 97I38723 PCT/LTS97106590
39
Using phage binding assay, we have shown that these peptides
specifically bind to the purified soluble CD4 molecules and CD4+ cells,
suggesting
a specific binding to cell surface CD4 molecules. We have also demonstrated
that
the phages carrying these peptides can be internalized into CD4+ T-cells upon
binding, which makes these peptides, or their modified versions, ideal
candidate
ligands for targeting human CD4 T-cells in a targetable vector setting. Thus,
these
peptides are useful as epitopes expressed on the surface of a vector to permit
the
vector to transduce a CD4 cell, in vitro, ex vivo or in vivo. This has general
utility
in recombinant techniques for transduction of CD4 cells, and in therapeutic
techniques where the transduction of CD4 cells by a therapeutic vector is
desired,
such as in the case of HIV infection.
After identification of candidate binding ligand with high affinity, it is
not known a priori if that particular ligand, in the context of a vector
surface fusion
protein, will allow for appropriate vector entry and uncoating. For example,
pathways of ligand internalization may be non-existent or may be by a
mechanism
substantially different from normal virus receptor-mediated internalization.
Conversely, the mechanism of normal viral internalization may be by capsid
components which are completely receptor/ binding ligand independent. This
latter
point is supported by examples of some viral systems (e.g., adenovirus and
HN),
where independent accessory proteins mediate viral entry (See also, Fig. 3) To
a
certain extent, these issues are determined empirically by the procedures
described in
the following sections. However, it is desirable, albeit not necessary, to
have a
rapid screen to eliminate ligands which do not mediate appropriate vector
internalization. A description of such a procedure is described in the section
referred to as "Modification of Pre-Formed Vector Particles, below".
Targetable Vector Libraries
Targetable vector libraries are constructed in AAV vector binding
mutants as identified supra. The goal is to generate a vector library with a
iigand of
interest inserted at random locations within the cap coding sequence. This
library is
amplified in host cells so that rare vectors, which have the optimal insertion
point in
the cap coding region for the ligand and forms a functional vector particle,
will be
enriched.
Construction of these libraries is performed, e.g., in the following 7 phases:
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
Phase 1: Subcloning of binding mutant cap region into a small plasmid
backbone;
Phase 2: Random linker insertion into cap region to construct a cap linker
library;
Phase 3: Subcloning of the binding ligand coding sequence into a linker
library to
construct a cap ligand library; Phase 4: Subcloning the cap ligand library
into a WT
5 AAV background to construct the targetable vector library; Phase S:
Packaging of
the targetable vector library; Phase 6: Infection of target cells with
targetable vector
library followed by amplification, enrichment, and in vitro evolution of
targetable
vector; and, Phase 7: sequencing of the enriched vector population. These
phases
are described graphically in Fig. 4.
10 Phase 1: Subcloning of bindin mutant cav region into small DNA
lad smid
This phase isolates the cap coding sequence within a relatively small
DNA plasmid so that subsequent random linker insertion steps, described below,
are concentrated on the cap sequence, rather than on irrelevant flanking
sequences.
15 In this phase, a cap sequence which is binding deficient as described,
supra, is
cloned into a plasmid using standard techniques. See, Sambrook, Ausubel, and
Berger supra. Similarly, this step is performed on surface proteins from other
viruses, such as a retroviral env protein, or an adenoviral capsid protein.
Phase 2: Random linker insertion into cap region to construct cap
20 linker library
The purpose of this phase is the insertion of a linker sequence into the
cap portion of the cap gene (or other surface protein) in the plasmid
constructed in
phase 1, to provide unique restriction sites for cloning of the desired
ligand. The
linker will ultimately be less than 20-30 nucleotides; however, initially a
removable
25 selectable marker is included in the linker so that recombinants containing
linker
sequences can be easily selected for, thereby increasing the frequency of
linker
containing molecules in the library. In parallel procedures, a hinge region of
approximately 30 nucleotides is optionally included in the final linker. This
hinge
region increases the flexibility at the site of ligand addition and reduces
the impact of
30 the ligand on the final conformation of the cap (or other surface) protein,
thereby
facilitating vector packaging functions of the protein. A parameter in the
construction of the library is the degree of randomness that is achieved, with
the
ideal situation being a library that contains a linker insertion at every base
pair
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
41
within the nucleic acid encoding the cap (or other surface) protein. Three
strategies
are optionally analyzed for their ability to produce randomized linker
libraries within
the cap sequence: 1) partial restriction digest 2) chemical mutagenesis and 3)
transposon-based mutagenesis.
In the first strategy, a partial restriction digestion will be performed
on the cap sequence using a restriction enzyme, or multiple enzymes that
recognizes) a four base pair sequence (i. e. , a frequent cutter). The
conditions are
optimized such that digestion results in individual full-length molecules cut
at a
single site. The linker is then added by cohesive end ligation using sites at
the end
of the linker that are compatible with the restriction enzyme used in the
partial
digestion. An advantage of this procedure is its simplicity. A disadvantage is
that it
an optimal degree of randomness may not be achieved, as it will be difficult
to find
restriction enzymes which cut frequently enough.
In an alternative strategy, the DNA encoding the cap (or other
surface) protein is treated with formic acid, which results in de-purination
of the
DNA to create a single stranded nick at random locations. The DNA is then
treated
with exonuclease III to cut both strands of the molecule at the site of the
nick. In
the process of digesting the nick, exonuclease III also cuts back from 0-30
nucleotides so that complete randomness with respect to the site of the cut is
theoretically possible. Blunt-end ligation of the linker is used to produce
closed
circles. The advantage of this procedure are that it is highly random. A
disadvantage is that the chemical treatment and conditions for exonuclease III
digestion may need extensive optimization. This procedure and the partial
digestion
procedure are outlined in more detail in Sambrook, supra.
A final strategy is to use transposon-based mutagenesis to directly
insert the linker into random locations within a DNA encoding the cap or other
surface protein. In this procedure, the cap plasmid is exposed to a transposon
such
as At-2 which contains the dHFR gene (see, Fig. 5). This reaction is performed
entirely in vitro using Ty 1 integrase provided from Ty 1 virus-like
particles.
Conditions are optimized to maximize the frequency of insertion, which can
achieve
the theoretical maximum of one insertion per base pair. See, Devine and Boeke
(1994) Nucleic Acids Research 22(18):3765-72. The mutagenized DNA is
transformed into e. coli and selected first for ampicillin resistance and
subsequently
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
42
selected for resistance to methopterin. The frequency of recombinants is
typically
around 1 amp Tmpr recombinants/ 10e4 ampr transformants; thus, this selection
step
dramatically increases the representation of recombinants in the final
library.
Unique restriction sites are available for removing the dHFR gene so that
approximately 30 nucleotides are left behind as a linker. This procedure is
particularly advantageous because the insertional mutagenesis reaction is a
standard
reaction which is as easy to perform as a routine restriction digest (a beta-
test
version of a kit from Perkin-Elmer can be obtained to facilitate the
reaction). A
disadvantage is that some effort must be made to ensure a maximal level of
random
insertion frequency.
Each of the above procedures can be analyzed for the degree of
randomness in the insertion of the linker by digesting the mutagenized DNA
population with a unique restriction enzyme that lies outside of the cap gene
(i. e., in
the vector plasmid) followed by end-labeling of the DNA with 32P. The DNA is
digested with a restriction enzyme that cuts within the linker sequences.
Subsequently, the end-labeled DNA is run on a sequencing gel, and under
optimal
conditions and a "ladder" pattern indicates the degree of randomness.
Optimally,
the ladder should have a one base pair separation. In addition, the intensity
of each
band will vary according to its relative abundance, such that under optimal
conditions they will be of equal intensity. Different restriction enzymes can
be
chosen to generate the site of end-labeling so that the insertion points can
be
analyzed by "walking" down the entire gene (this step is necessary where the
resolution capacity of the sequencing gel prohibits analysis of the entire
length of the
plasmid in a single run). Furthermore, theoretical maximum sizes can be
calculated
so that only insertions within the cap coding sequence (or other surface
protein
coding sequence) is assessed. The degree of randomness from each analysis is
calculated by determining the mean intensity of the bands and counting the
number
of bands that fall within 20 % of this intensity. The sum of this value is
equal to the
degree of randomness (dR). Each run on the sequencing gel would be expected to
generate a theoretical maximum dR value of 300-400 as this is the typical
resolution
capacity of a standard sequencing gel. The total theoretical maximum dR value
for
cap should be approximately 2500 as this is the length of the cap coding
region.
The library which is generated by the above procedures which contains the
highest
degree of randomness is used in Phase 3.
CA 02251738 1998-10-14
WO 97I38723 PCT/US9?I06590
43
Phase 3: Subcloning of binding, ligand coding sequence into linker
library to construct cap ligand library
The primary consideration for this portion of the project is the choice
of ligand. Several procedures are described supra for ligand selection. Three
S example ligands include 1 ) anti-CD34 ScAb used in the examples, supra; 2)
ligands
generated from phage display libraries, and 3) the HIV C4 region of the HIV
envelope protein.
1) Although success has been achieved by using the anti-CD34 ScAb
in the AAV vectors described supra, it is possible to optimize any recombinant
AAV
(rAAV) vector for replication competence and target cell transducing ability.
Improvements to the current targetable vectors with this new targeting
strategy are
contemplated.
Cloning of this ligand is performed using a PCR strategy in which the
appropriate restriction sites are placed on the ends to allow for insertion
into the
linker library.
2) The criteria for selection of ligands from the phage display
libraries have been outlined above. The ligand that is available with the
optimal K~
value is selected for subcloning into the linker library. Once this sequence
has been
identified, an oligo corresponding to this sequence is synthesized which
contains the
appropriate restriction sites for cloning.
3) Robey et. al. (1995) Journal of Biological Chemistry
270(41 ) :23918-21 have identified a 17 amino acid region on HIV Gp 120 that
is
capable of specific binding to CD4 with a K~ value of 8.5e-9. This peptide
(termed
the C4 peptide) is suitable for targeting CD4+ cells and is optimized using
the
strategy outlined herein. In addition, the peptide is used as a starting
material for
phage display libraries with the intention of improving its I~ value for CD4,
as
described, supra. Cloning of this molecule or modified forms is as described
for the
randovn phage display library ligand. Because it is readily available, the C4
peptide
is also tested on the N-terminus of Vpl and Vp2 in WT AAV, similar to the
tests of
ScAb described, e.g., in the examples. This allows for a quick screen of C4
utility
in AAV vector targeting.
Phase 4: Subcloning cap li~gand library into WT AAV background to
construct tar~etable vector library
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
44
Sub-cloning of the cap ligand library of interest is performed into a
WT AAV background. Briefly, the ligand library is digested with appropriate
restriction enzymes to release the modified cap (or other surface protein)
coding
DNAs which are then "shot-gun" cloned into an otherwise WT AAV background.
Since the plasmid cap library contains one of the previously identified cap
binding
mutations which replaces the wild-type AAV cap protein, the intention is to
restore
binding and replication competence by addition of a foreign ligand to the
resulting
AAV vector. Using a replication competent vector allows for amplification of
rare
recombinants that have the appropriate cap conformation. In addition, chemical
mutagenesis or irradiation of target cells can be included during the
amplification
phase so that random mutations can be introduced to optimize and improve the
infectivity of virions containing viable insertions.
Phase 5: Packagin og- f tar~etable vector library
Packaging of the library is by appropriate standard vector packaging
methods, depending on the particular vector employed.
Phase 6: Infection, amplification, and evolution of targetable vector library
For AAV, target cells of interest are infected with the vector library
in the presence of a helper virus such as adenovirus under standard
conditions.
After maximum cytopathic effect, the cells are harvested and the resulting
lysate is
used in a subsequent round of infection. This procedure is repeated 3-6 times.
In
parallel, a similar experiment is performed, with the exception that during
the
replication phase of the virus, the cells are mutagenized by irradiation under
standard conditions or by treatment with chemical mutagens. The purpose of
this
mutagenesis phase is to increase the rate of evolution of the virus and
subsequent
enrichment of forms optimized for infectivity and replication via the target
receptor.
Vectors which initially have sub-optimal cap conformations gradually acquire
random mutations which confer a selective advantage for growth in a given
target
cell.
In the case of a targeted protein such as a cellular receptor, the
chosen cell type for amplification can be any cell or cell line which
expresses that
protein. If a suitable cell which stably expresses the protein cannot easily
be made
then a vaccinia virus vector is used both for target protein expression and
helper
function for AAV . In the case of a targeted cell, the cell that was used in
the phage
display library selection are used in this experiment as well. Target cells
are
CA 02251738 1998-10-14
WO 97/387Z3 PCT/US97/06590
typically permissive for replication of AAV helper virus (i. e. , adeno,
herpes,
vaccinia), or recombinantly express the necessary AAV helper components .
Phase 7: Sequencing of selected vector
Following Phase 6, the material from the final lysate is PCR
5 amplified using primers for the distal 5' and 3' ends of cap. The amplified
material
is sub-cloned into a standard TA cloning vector and, following transformation,
approximately 50-l00 colonies are selected for subsequent analysis. Initially,
plasmid DNA is prepared and digested to verify that the ligand has been
retained
within the cap coding sequence (preliminary information can be obtained at
this point
10 as to the degree of heterogeneity of the processed library). All positive
clones are
sequenced using a primer specific within the linker sequence with the goal of
identifying flanking sequences which specify the insertion point of the
ligand. New
primers are selected for any sequencing reactions that do not work, as it is
assumed
that significant mutation has taken place at the Iigand locus, thereby
preventing
15 binding of the primer. Using the sequence data, groupings containing 100 %
similarity are made based on the number of unique sequences. These groupings
are
only an estimate of similarity/homology since other important mutations
outside the
region sequenced can be introduced during the amplification phase. This entire
process is improved by incorporation of high-throughput sequencing technology.
20 One clone within each group is packaged and tested for replication
competence on the target cell line of interest, e.g., by slot blot analysis
for
replicating genomic DNA. The most replication competent clone is sequenced in
its
entirety and used to construct an AAV targetable vector packaging plasmid (or
other
vector, as appropriate) and subsequently used to produce recombinant
targetable
25 AAV (rtAAV). In addition, if sequencing of the ITRs show differences
relative to
the WT, these new ITRs are tested in the genomic portion of the vector. Once
final
vector candidates are identified and used to produce targetable AAV vectors,
transduction analysis is performed both on cells which contain the targeting
receptor
of choice and on cells which contain only the WT AAV receptor. Mixing
30 experiments are performed to verify that the vector is capable of
selectively
transducing a small population of target cells in the presence of a high
background
of non-target cells.
Binding mutations
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
46
A number of cap mutants are shown supra. Binding mutations that
have been identified to form particles and disrupt binding as measured by the
b-gal
binding assay are summarized in Fig. 6.
All of the mutations in Fig. 6 represent point mutations or small
deletions. This was done intentionally to minimize the potential for
pleiotropic
effects. However, maximal mutations are also desirable as they potentially
allow for
larger ligands to be inserted, if the overall size of the given cap (or other
surface)
protein is limiting. The deletions are optionally maximized and the effect of
increasing the length of the mutation determined on the phenotype of the
vector as
measured by previously established assays. Once these additional mutants are
identified they are used as a source for DNA encoding the cap (or other
surface
protein) into which a ligand is cloned.
New mutants are generated by random linker insertion into a DNA
encoding a WT cap (or other WT surface protein) similar to strategies outlined
for
the targetable AAV vector. If the C4 peptide is verified to allow for
targeting in the
WT AAV vector (see, Targetable Vector Library, Phase 3), then this could be
used
as a "test" ligand for generating new binding mutants. Hence, the C4 peptide
would
be cloned into the N-terminus of Vpl and Vp2 prior to linker insertion
mutagenesis.
Following mutagenesis the resulting binding mutant library is packaged and
bound to
HeLa cells in the absence of adenovirus to remove any WT receptor binding AAV.
Unbound material is then used to infect HeLa CD4 cells in the presence of
adenovirus, and amplified 3-6 times. After each round of amplification, the
lysate is
passed over normal HeLa cells to remove any WT binding AAV that may have
developed. The final lysate is cloned and sequenced by PCR to determine the
site of
the binding mutations and presence of the C4 ligand. The appropriate clone is
then
tested for targeting and, subsequently, binding in the absence of C4 peptide.
This
binding mutant is used to construct future targetable vectors with ligands
other than
C4 and at more optimal ligand insertion points.
AAV serotype 4 was recently isolated at the NIH. Unlike AAV-2,
which binds to a receptor that is essentially ubiquitous on animal cells, AAV-
4 is
very restricted in terms of its tropism. The only cells which have been
identified as
positive for AAV-4 infection are Cos cells and glial cells. Other standard
cell lines
for AAV-2 (i. e. , HeLa) are not infectable by AAV-4. Furthermore, because
AAV-4 was originally obtained in nature from adenovirus infected monkeys, the
CA 02251738 1998-10-14
WO 97I38723 PCT/US97I06590
47
human population is seronegative for this virus. A recombinant vector system
has
been constructed from AAV-4 and is essentially identical to the AAV-2 system.
In
addition, titers from rAAV-4 are approximately 10-fold higher than AAV-2 in
side-by-side comparisons. If AAV-4 can transduce either CD4+ T-lymphocytes or
CD34+ stem cells, it may be used as a vector to transduce these important cell
types.
If AAV-4 is negative for transduction of these cell types, it is optionally
used as an
alternative to the AAV-2 binding mutants described supra. The advantages of
using
this vector are essentially three-fold: 1 ) because the WT AAV-4 vector can be
used
as a "natural binding mutant" concerns about the impact of mutations on the
overall
conformation of the particle and changes in adaptability for ligand insertion
are
eliminated; 2) any observable defect will solely be due to ligand insertion;
and 3)
the seronegative status of the human population for AAV-4. simplifies in vivo
injection of the final vector.
As another alternative, the expression of the AAV-2 receptor is
knocked-out by expressing a ribozyme in a cell which cleaves the mRNA for the
receptor. Essentially any cell can have the AAV-2 receptor abrogated by
transducing the cell with a vector encoding an appropriate ribozyme.
Alternatively,
AAV receptor null cells can be identified by FACS or other cell sorting
techniques
which measure the expression of the receptor (ELISA, western blotting, etc. )
on the
surface of the cell.
AAV-2 receptor null cells are used in a vector library systems as
follows:
a) In the initial library strategy a potential concern with using binding
mutants is that there is a chance that WT recombinants may form, or
compensatory
mutations may be introduced which restore WT binding. Because of the nature of
the overall strategy, these recombinants or second-site mutants would be
enriched
and may mask enrichment of desired recombinants. Thus, cells which lack WT
AAV' biliding capability would eliminate this concern.
b) In a similar strategy cells which do not bind WT AAV can be
used to enrich a targetable vector within a library which is randomized both
respect
to the insertion point of the ligand and binding mutations. Hence, beginning
with
WT AAV cap, a cap vector will be constructed as described for the previous
library.
Linker insertion mutagenesis will then be performed on this vector. The idea
of this
particular insertion step is to create a random set of AAV binding knock-out
CA 02251738 1998-10-14
WO 97/38723 PCT/ITS97/06590
48
mutants. Following linker insertion, a targetable ligand is either added to
the knock
out linker, or a second round of linker insertion mutagenesis is performed
followed
by ligand addition. This new library is used to infect the AAV-2 receptor null
cells
which express the targeting protein of interest {i. e. , CD34) . Similar to
above,
amplification and evolution is performed. Finally, the resulting vectors are
screened
for tropism, as some of the vectors that are identified by this procedure can
be
dual-tropic (i.e., AAV receptor and CD34 binding). Dual tropic vectors are
eliminated by screening on AAV-2 receptor positive cells.
This approach has the apparent limitation that only cells which lack
the AAV receptor can be utilized in the amplification and evolution phase.
This is
not true, however: 1 ) Ribozyme vectors are constructed to knock out the AAV-2
receptor in any cell type and 2) if the initial amplification/evolution phase
is
performed in a standard cell line lacking the AAV-2 receptor, the resulting
vector
can be used as a true functional binding mutant for construction of subsequent
libraries with other ligands of interest. Thus, the library technology based
on an
AAV-2 receptor null cell is adaptable and useful for generating additional AAV
binding mutants.
Modification of Pre-Formed Vector Particles
It is desirable to create vectors which incorporate targeting ligands
into their capsid protein as a part of the normal assembly process, rather
than adding
these components later as a modification to pre-formed particles. Vectors
containing
targetable capsid fusion proteins are more amenable to a reproducible and
efficient
production process. This approach may be helpful where the strategies outlined
above are not optimal. Where generating targetable vectors via post-assembly
modification is straightforward, this approach offers a method for rapidly
testing
ligand/receptor interactions in the context of internalizing a vector and
delivering the
traps-gene. This approach would thus be useful for analyzing candidate ligands
for
the fusion protein strategy discussed above, where concern exists that a
particular
ligand/receptor interaction may not allow for effective internalization of the
vector.
Several approaches for modifying pre-formed vector particles for purposes of
targeting are outlined below.
The peptide display libraries that were previously described are used
to generate bivalent peptides where one portion binds to AAV and the second
portion binds to the target protein of interest. To accomplish this, two sets
of
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
49
library panning experiments are performed, where the first experiment is to
select
peptides which bind to purified AAV particles and the second experiment, in
parallel, selects binding peptides for the cell surface marker of interest.
The
sequencing information from these two experiments is used to generate a single
linear peptide which has binding affinity for both AAV and the cell surface
marker
of interest. If the binding affinity for the AAV binding peptide is not
sufficiently
high to allow for reliable use of the complex as a targetable vector, then a
cross-linking reaction can be performed to covalently attach these ligands to
the
vector.
Once the AAV binding peptide is identified, this method allows for
rapid pre-screening of candidate ligands as vector targeting molecules prior
to
incorporating them into the various vector libraries described, supra. In
addition, a
bivalent peptide that is successfully used in this procedure can also be used
to
quickly test a panel of binding mutants for transducing function.
A similar method for modifying pre-formed vector particles is to
utilize bivalent antibodies that have affinities for both AAV and the target
receptor of
choice. These antibodies are generated by chemically cross-linking monoclonal
antibodies. Alternatively, streptavidin could be incorporated into the AAV
particle
either as a fusion protein or by cross-linkage directly to the AAV particle.
Following this modification, biotinylated targeting ligands are added by
direct
non-covalent binding to streptavidin. In a variation to this technique, the
AAV
binding peptide technique that is described above may be modified so that the
targeting portion of the peptide is not selected to bind to a specific
receptor but
rather will bind to biotin.
Ceils Transformed by The Vectors of the Invention
The culture of cells used in conjunction with the present invention,
including cell lines and cultured cells from tissue or blood samples,
including stem
cells i's well known in the art. Freshney (Culture of Animal Cells, a Manual
of Basic
Technique, third edition Wiley-Liss, New York ( 1994)) and the references
cited
therein provides a general guide to the culture of cells. See also, Kuchler et
al.
(1977) Biochemical Methods in Cell Culture and Virology, Kuchler, R.J.,
Dowden,
Hutchinson and Ross, Inc, and Inaba et al. (1992) J. Exp. Med. 176, 1693-1702.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
Isolating Stem Cells
Hematopoietic stem cells are the primary targets for many forms of
gene therapy, particularly gene therapy for HIV infection. Accordingly, stem
cells
are a preferred target for the vectors of the invention, particularly when the
vectors
5 encode anti-HIV agents. Many ways of isolating stem cells are known. In
mice,
bone marrow cells are isolated by sacrificing the mouse and cutting the leg
bones
with a pair of scissors. Stem cells are isolated from bone marrow cells by
panning
the bone marrow cells with antibodies which bind unwanted cells, such as
CD4+and
CD8+ (T cells), CD45+ (pang cells), GR-1 (granulocytes), and Iad
(differentiated
10 antigen presenting cells). For an example of this protocol see, In,aba et
al. (l992) J.
Exp. Med. 176, 1693-1702.
In humans, bone marrow aspirations from iliac crests are optionally
performed e.g., under general anesthesia in the operating room. The bone
marrow
aspirations is approximately 1,000 m1 in quantity and is collected from the
posterior
15 iliac bones and crests. If the total number of cells collected is < 2 x
10g/kg, a
second aspiration using the sternum and anterior iliac crests in addition to
posterior
crests is performed. During the operation, two units of irradiated packed red
cells
are administered to replace the volume of marrow taken by the aspiration.
Human
hematopoietic progenitor and stem cells are characterized by the presence of a
CD34
20 surface membrane antigen. This antigen is used for purification. After the
bone
marrow is harvested, the mononuclear cells are separated from the other
components
by means of ficol gradient centrifugation. This is performed by a semi-
automated
method using a cell separator (e.g., a Baxter Fenwal CS3000+ or Terumo
machine). The light density cells, composed mostly of mononuclear cells are
25 collected and the cells are incubated in plastic flasks at 37~C for 1.5
hours. The
adherent cells (monocytes, macrophages and B-Cells) are discarded. The
non-adherent cells are then collected and incubated with a monoclonal anti-
CD34
antibody ( e.g., the murine antibody 9C5) at 4~C for 30 minutes with gentle
rotation. The final concentration for the anti-CD34 antibody is 10 ~,g/ml.
After two
30 washes, paramagnetic microspheres (Dyna Beads, supplied by Baxter
Immunotherapy Group, Santa Ana, California) coated with sheep antimouse IgG
(Fc)
antibody are added to the cell suspension at a ratio of 2 cells/bead. After a
further
incubation period of 30 minutes at 4~C, the rosetted cells with magnetic beads
are
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
51
collected with a magnet. Chymopapain (supplied by Baxter Immunotherapy Group,
Santa Ana, California) at a final concentration of 200 U/ml is added to
release the
beads from the CD34+ cells. Alternatively, and preferably, an affinity column
isolation procedure can be used which binds to CD34, or to antibodies bound to
CD34.
In another preferred embodiment, CD34+ cells are isolated by
peripheral blood leukapheresis after G-CSF mobilization.
Therapeutic Agents
Therapeutic agents of the invention, which are typically expressed by
the expression cassettes of the invention, take several forms. Typically, the
agent is
a nucleic acid which has direct therapeutic activity, such as a replacement
enzyme,
molecular decoy, anti-sense RNA or ribozyme, or indirect anti-viral activity,
i. e. ,
where the inhibitor encodes a direct anti-viral activity such as a therapeutic
protein
or suicide protein.
A variety of enzyme deficiencies are known to cause disease. See,
Berkow (ed.) The Merck Manual of Diagnosis and Therapy, Merck & Co., Rahway,
NJ; and Thorn et al. Harrison's Principles of Internal Medicine, McGraw-Hill,
NY.
For instance, insulin misregulation/deficiency causes diabetes. The present
invention
provides a treatment for such diseases in which a patient's abnormal cell type
(e.g.,
insulin deficient) is transfected with a vector of the invention. The vector
comprises
a nucleic acid encoding the deficient enzyme under the control of an
appropriate
promoter. The vector is targeted to the appropriate cell type using a
targeting agent
of the invention. For instance, where the vector expresses a streptavidin
peptide
which is bound to an antibody against pancreatic cells, the vector can be used
to
transduce pancreatic cells with a vector encoding insulin. Similarly, the
combinatorial screening methods described herein can be used to identify
targeting
ligands which specifically hybridize to pancreatic cells. These targeting
ligands are
optionally recombinantly fused to a protein located on the surface of the
vector
where they are recognized by pancreatic cells, causing the cells to take up
the
nucleic acid associated with the vector.
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
52
Inhibitors: antisense nucleic acids, ribozymes, decoy nucleic acids and trans-
dominant proteins
In many embodiments, the therapeutic agent inhibits growth of a
target cell (i.e., when the agent is an anti-cancer compound), or of a
pathogenic
virus (e.g., HIV). Inhibitors are known in the art. The literature describes
such
genes and their use. See, for example, Yu et al. , Gene Therapy, 1:13 ( 1994);
Herskowitz, Nature, 329:212 (1987) and Baltimore, Nature, 335:395 (1988).
Inhibitors which are optionally incorporated into the expression cassettes of
the
invention include anti-sense genes, suicide genes, ribozymes, decoy genes, and
transdominant proteins.
A suicide gene produces a product which is cytotoxic. In the vectors
of the present invention a suicide gene is operably linked to an inducible
expression
control sequences which is stimulated upon infection of a cell by a pathogen
such as
HIV . Alternatively, the gene is operably linked to a constitutive promoter
where the
vector is used to transduce a pathogenic cell (i . e. , a cancer cell) .
Examples of
suicide genes include thymidine kinase and cytosine deaminase. See, Huber et
al.
European Patent Application 95100248.4 and Mullen et al. U.S. Pat. 5,358,866.
An antisense nucleic acid is a nucleic acid that, upon expression,
hybridizes to a particular RNA molecule, to a transcriptional promoter or to
the
sense strand of a gene. By hybridizing, the antisense nucleic acid interferes
with the
transcription of a complementary nucleic acid, the translation of an mRNA, or
the
function of a catalytic RNA. Antisense molecules useful in this invention
include
those that hybridize to oncogenic and viral gene transcripts. Two example
target
sequences for antisense molecules are the first and second exons of the HIV
genes
tat and rev. Chatterjee and Wong, supra, and Marcus-Sekura (Analytical
Biochemistry (1988) 172, 289-285) describe the use of anti-sense genes which
block
or modify gene expression.
A ribozyme is a catalytic RNA molecule that cleaves other RNA
molecules having particular nucleic acid sequences. General methods for the
construction of ribozymes, including hairpin ribozymes, hammerhead ribozymes,
RNAse P ribozymes (i. e. , ribozymes derived from the naturally occurring
RNAse P
ribozyme from prokaryotes or eukaryotes) are known in the art. Castanotto et
al
( 1994) Advances in Pharmacology 25 : 289-317 provides and overview of
ribozymes
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
53
in general, including group I ribozymes, hammerhead ribozymes, hairpin
ribozymes,
RNAse P, and axhead ribozymes. Ribozymes useful in this invention include
those
that cleave viral transcripts, particularly HIV gene transcripts. Ojwang et
al., Proc.
Nat'l. Acad. Sci., U.S.A., 89:l0802-06 (1992); Wong-Staal et al.
(PCT/US94/05700); Ojwang et al. ( 1993) Proc Natl Acad Sci USA 90:6340-6344;
Yamada et al. ( 1994) Human Gene Therapy l: 39-45; Leavitt et al. ( 1995) Proc
Natl
Acad Sci USA 92: 699-703; Leavitt et al. ( 1994) Human Gene Therapy 5 :11 S 1-
1120;
Yamada et al. (1994) Virology 205:121-126, and Dropulic et al. (1992) Journal
of
Virology 66(3):1432-1441 provide an examples of HIV-1 specific hairpin and
hammerhead ribozymes.
Briefly, two types of ribozymes that are particularly useful in this
invention include the hairpin ribozyme and the hammerhead ribozyme. The
hammerhead ribozyme (see, Rossie et al. ( 1991 ) Pharmac. Ther. 50:245-254;
Forster and Symons ( 1987) Cell 48:211-220; Haseloff and Gerlach ( 1988)
Nature
328:596-600; Walbot and Bruening (1988) Nature 334:196; Haseloff and Gerlach
(1988) Nature 334:585; and Dropulic et al and Castanotto et al., and the
references
cited therein, supra) and the hairpin ribozyme (see, e. g. , Hampel et al. (
1990) Nucl.
Acids Res. 18:299-304; Hempel et al. , ( 1990) European Patent Publication No.
0
360 257; U.S. Patent No. 5,254,678, issued October 19, 1993; Wong-Staal et
al.)
PCT/US94/05700; Ojwang et al . ( 1993) Proc Natl Acad Sci USA 90:6340-6344;
Yamada et al. ( 1994) Human Gene Therapy 1: 39-45; Leavitt et al. ( 199S) Proc
Natl
Acad Sci USA 92:699-703; Leavitt et al. (1994) Human Gene Therapy 5:1151-1120;
and Yamada et al. ( 1994) Vi rology 205 :121-126) are catalytic molecules
having
antisense and endoribonucleotidase activity. Intracellular expression of
hammerhead
ribozymes and a hairpin ribozymes directed against HIV RNA has been shown to
confer significant resistance to HIV infection.
The typical sequence requirement for cleavage by a hairpin ribozyme
is an RNA sequence consisting of NNNG/CN*GUCNNNNNNNN (where N*G is
the cleavage site, and where N is any of G, U, C, or A) . The sequence
requirement
at the cleavage site for the hammerhead ribozyme is an RNA sequence consisting
of
NUX (where N is any of G, U, C, or A and X represents C, U or A).
Accordingly, the same target within the hairpin leader sequence, GUC, is
targetable
by the hammerhead ribozyme. The additional nucleotides of the hammerhead
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
54
ribozyme or hairpin ribozyme which mediate sequence specificity, are
determined by
the common target flanking nucleotides and the hammerhead and hairpin
consensus
sequences.
Altman ( 1995) Biotechnology 13: 327-329 and the references therein
describe the use of RNAse P as a therapeutic agent directed against flu virus.
Similar therapeutic approaches can be used against other viruses as well.
In preferred embodiments, the inhibitors of the invention include anti-
HIV ribozymes, such as hairpin ribozymes (see, Wong-Staal et al. WO 94I26877
and PCT/US94/05700 and the references therein; see also, Yu et al. ( l993)
PNAS
l0 90: 6340-6344; and Yu et al. (199S) Virology 206: 38l-386), hammerhead
ribozymes (see, Dropulic et al. (1992) Jourruzl of Virology, 66(3):1432-l441),
and
RNAse P (see, Castanotto et al. (1994) Advances in Pharmacology Academic Press
25: 289-317). These ribozymes are constructed to target a portion of the Rev-
binding virus' genome or nucleic acid encoded by the genome. Preferred target
sites
in HIV-1 include the US region, and the polymerase gene.
A decoy nucleic acid is a nucleic acid having a sequence recognized
by a regulatory nucleic acid binding protein (i. e. , a transcription factor,
cell
trafficking factor, etc. ). Upon expression, the transcription factor binds to
the decoy
nucleic acid, rather than to its natural target in the genome. Useful decoy
nucleic
acid sequences include any sequence to which a viral transcription factor
binds. For
instance, the TAR sequence, to which the tat protein binds, and the HIV RRE
sequence to which the rev proteins binds are suitable sequences to use as
decoy
nucleic acids.
A transdominant protein is a protein whose phenotype, when supplied
by transcomplementation, will overcome the effect of the native form of the
protein.
For example, tat and rev can be mutated to retain the ability to bind to TAR
and
RRE, respectively, but to lack the proper regulatory function of those
proteins. In
particular, rev can be made transdominant by eliminating the leucine-rich
domain
close to the C terminus which is essential for proper normal regulation of
transcription. Tat transdominant proteins can be generated by mutations in the
RNA
binding/nuclear localization domain of Tat.
Examples of antisense molecules, ribozymes and decoy nucleic acids
and their use can be found in Weintraub, Sci. Am. , 262:40-46 (Jan. 1990);
CA 02251738 1998-10-14
WO 97/38723 PCTIUS97/06590
Marcus-Sekura, Anal. Biochem. , 172:289-95 ( 1988); and Hasselhoff et al. ,
Nature,
334:585-591 (1988).
In Vitro Cell Transformation
The vectors of the invention are useful for in vitro cell
5 transformation. The ability to transform cells is of general commercial
importance
in biological manufacturing, drug screening assays, cloning procedures and the
like.
For instance, the vectors of the invention optionally comprise a nucleic acid
which
encodes a commercially valuable protein such as insulin, TPA, erythropoietin,
etc.
The vector is used to transform a cell) which expresses the protein.
10 Ex Vivo Therany
The vectors of the invention are useful as cloning vectors for gene
transfer in vitro. In addition, the vectors are useful as gene therapy vectors
in both
ex vivo and in vivo procedures. Ex vivo methods of gene therapy involve
transducing a target cell ex vivo with a vector of this invention, and
introducing the
15 cell into the organism. Target cells are selected based upon the range of
the targeted
vector. See, e.g., Freshney et al., supra and the references cited therein,
and the
discussion provided herein for a discussion of how to isolate and culture
cells from
patients. Alternatively, the cells can be those stored in a cell bank (e. g. ,
a blood
bank).
20 Thus, for example, a patient infected with a virus such as HIV-1 can
be treated for the infection by transducing a population of their cells with a
vector of
the invention and introducing the transduced cells hack into the patient as
described
herein. Thus, the present invention provides a method of protecting cells from
infection in vitro, ex vivo or in vivo.
25 In Vivo Theranv
Current protocols for clinical use of gene therapy vectors typically
involve removal of the target tissue from the patient, transduction of the
traps-gene,
and re-infusion of the modified cells. In some isolated cases it has been
suggested
that the therapeutic vector could be directly delivered to the target tissue
by surgical
30 means, or by aerosol in the case of the lungs. Clearly, for sake of its
simplicity, a
non-surgical and broadly applicable method for direct delivery of the vector
in vivo
would be favored over ex vivo therapy. Moreover, maintaining the target cells
in
vivo throughout therapy prevents undesired alterations in their phenotype
which may
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
56
occur during ex vivo approaches, and thereby enhance the reconstitution
properties
of the transduced cells. For example, in the case of HIV infection it would be
advantageous to directly inject therapeutic vectors intravenously and obtain
targeting
of both CD4+ cells and stem progenitor cells. Thus, there is no need to place
these
cells in an artificial ex vivo environment which may significantly influence
their
ability to respond to various stimuli and inhibitors that are part of normal
immune
function and/or stem cell development. Furthermore, this dual approach to in
viva
targeting for HIV infection would be ideal as it eliminates concerns about the
origin
of CD4+ cells in HIV+ adults (i. e. , from stem cells or by proliferation of
existing
CD4+ cells).
Vectors of the invention can be administered directly to the organism
for transduction of cells in vivo. Administration of vectors comprising the
therapeutic agents of the invention, and cells transduced with the gene
therapy
vectors is by any of the routes normally used for introducing a molecule into
ultimate contact with blood or tissue cells.
The vectors or cells are administered in any suitable manner,
preferably with pharmaceutically acceptable carriers. Suitable methods of
administering such vectors or cells in the context of the present invention to
a patient
are available, and, although more than one route can be used to administer a
particular composition, a particular route can often provide a more immediate
and
more effective reaction than another route.
Pharmaceutically acceptable carriers are determined in part by the
particular composition being administered, as well as by the particular method
used
to administer the composition. Accordingly, there is a wide variety of
suitable
formulations of pharmaceutical compositions of the present invention.
Formulations suitable for oral administration can consist of (a) liquid
solutions, such as an effective amount of the vector dissolved in diluents,
such as
water; saline or PEG 400; (b) capsules, sachets or tablets, each containing a
predetermined amount of the active ingredient, as liquids, solids, granules or
gelatin;
(c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet
forms
can include one or more of lactose, sucrose, mannitol, sorbitol, calcium
phosphates,
corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia,
gelatin,
colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate,
stearic
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
57
acid, and other excipients, colorants, fillers, binders, diluents, buffering
agents,
moistening agents, preservatives, flavoring agents, dyes, disintegrating
agents, and
pharmaceutically compatible carriers. Lozenge forms can comprise the active
ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as
pastilles
comprising the active ingredient in an inert base, such as gelatin and
glycerin or
sucrose and acacia emulsions, gels, and the like containing, in addition to
the active
ingredient, carriers known in the art.
The vectors, alone or in combination with other suitable components,
can be made into aerosol formulations to be administered via inhalation.
Aerosol
formulations can be placed into pressurized acceptable propellants, such as
dichlorodifluoromethane, propane, nitrogen, and the like.
Suitable formulations for rectal administration include, for example,
suppositories, which consist of the vector with a suppository base. Suitable
suppository bases include natural or synthetic triglycerides or paraffin
hydrocarbons.
In addition, it is also possible to use gelatin rectal capsules which consist
of a
combination of the vector with a base, including, for example, liquid
triglyercides,
polyethylene glycols, and paraffin hydrocarbons.
Formulations suitable for parenteral administration, such as, for
example, by intraarticular (in the joints), intravenous, intramuscular,
intradermal,
intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous,
isotonic
sterile injection solutions, which can contain antioxidants, buffers,
bacteriostats, and
solutes that render the formulation isotonic with the blood of the intended
recipient,
and aqueous and non-aqueous sterile suspensions that can include suspending
agents,
solubilizers, thickening agents, stabilizers, and preservatives.
Intravenous administration is the preferred method of administration
for gene therapy vectors and transduced cells of the invention. The
formulations of
vector can be presented in unit-dose or multi-dose sealed containers, such as
ampules
and vials, Jand in some embodiments, can be stored in a freeze-dried
(lyophilized)
condition requiring only the addition of the sterile liquid carrier, for
example, water,
for injections, immediately prior to use. For many vectors, this mode of
administration will not be appropriate, because many particles are destroyed
by
lyophilization. Some vectors (e.g., vectors utilizing an AAV capsid), however,
tolerate lyophilization well.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
58
Extemporaneous injection solutions and suspensions can be prepared
from sterile powders, granules, and tablets of the kind previously described.
Cells
transduced by the vector, e.g., as described above in the context of ex vivo
therapy,
can also be administered parenterally as described above, except that
lyophilization
is not generally appropriate, since cells are destroyed by lyophilization.
The dose administered to a patient, in the context of the present
invention should be sufficient to effect a beneficial therapeutic response in
the patient
over time, or to inhibit infection by a pathogen. The dose will be determined
by the
efficacy of the particular vector employed and the condition of the patient,
as well as
the body weight or surface area of the patient to be treated. The size of the
dose
also will be determined by the existence, nature, and extent of any adverse
side-
effects that accompany the administration of a particular vector, or
transduced cell
type in a particular patient.
In determining the effective amount of the vector to be administered
in the treatment or prophylaxis of virally-mediated diseases such as AIDS, the
physician evaluates circulating plasma levels, vector toxicities, progression
of the
disease, and the production of anti-vector antibodies. In general, the dose
equivalent
of a naked nucleic acid from a vector is from about 1 ~,g to 100 ~,g for a
typical 70
kilogram patient, and doses of gene therapy vectors which include viral
particle such
as AAV or retroviral vectors are calculated to yield. an equivalent amount of
inhibitor nucleic acid.
In the practice of this invention, compositions can be administered,
for example, by intravenous infusion, orally, topically, intraperitoneally,
intravesically or intrathecally. The preferred method of administration will
often be
oral, rectal or intravenous, but the vectors can be applied in a suitable
vehicle for
the local and topical treatment of virally-mediated conditions. The vectors of
this
invention can supplement treatment of virally-mediated conditions by any known
conventional therapy, including cytotoxic agents, nucleotide analogues and
biologic
response modifiers.
For administration, inhibitors and transduced cells of the present
invention can be administered at a rate determined by the LD-50 of the
inhibitor,
vector, or transduced cell type, and the side-effects of the inhibitor, vector
or cell
type at various concentrations, as applied to the mass and overall health of
the
patient. Administration can be accomplished via single or divided doses.
CA 02251738 1998-10-14
WO 97/38723 PCTIUS97/06590
59
Prior to infusion, blood samples are obtained and saved for analysis.
Between 1 X 10g and 1 X 1012 transduced cells are infused intravenously over
60-
200 minutes. Vital signs and oxygen saturation by pulse oximetry are closely
monitored. Blood samples are obtained 5 minutes and 1 hour following infusion
and
saved for subsequent analysis. Leukopheresis, transduction and reinfusion are
repeated every 2 to 3 months for a total of 4 to 6 treatments in a one year
period.
After the first treatment, infusions can be performed on a outpatient basis at
the
discretion of the clinician. If the reinfusion is given as an outpatient, the
participant
is monitored for at least 4, and preferably 8 hours following the therapy.
Transduced cells are prepared for reinfusion according to established
methods. See, Abrahamsen et al. (1991) J. Clin. Apheresis 6:48-53; Carter et
al.
( 1988) J. Clin. Arpheresis 4:113-117; Aebersold et al. ( l988), J. Immunol.
Methods
112: 1-7; Muul et al. (1987) J. Immunol. Methods 101:171-181 and Carter et al.
( 1987) Transfusion 27:362-365. After a period of about 2-4 weeks in culture,
the
cells should number between 1 X 10g and 1 X 1012. In this regard, the growth
characteristics of cells vary from patient to patient and from cell type to
cell type.
About 72 hours prior to reinfusion of the transduced cells, an aliquot is
taken for
analysis of phenotype, and percentage of cells expressing the therapeutic
agent.
If a patient undergoing infusion of a vector or transduced cell
develops fevers, chills, or muscle aches, he/she receives the appropriate dose
of
aspirin, ibuprofen or acetaminophen. Patients who experience reactions to the
infusion such as fever, muscle aches, and chills are premedicated 30 minutes
prior to
the future infusions with either aspirin, acetaminophen, or diphenhydramine.
Meperidine is used for more severe chills and muscle aches that do not quickly
respond to antipyretics and antihistamines. Cell infusion is slowed or
discontinued
depending upon the severity of the reaction.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
EXAMPLES
The following examples are provided by way of illustration only and
not by way of limitation. Those of skill will readily recognize a variety of
noncritical parameters which could be changed or modified to yield essentially
5 similar results.
Example 1: AAV Tar~etin~
Ideally, a targetable gene therapy vector should have the following
characteristics: 1) it should be simple to produce at an effective titer, 2)
it should be
stable so that storage and manipulation of the vector are not prohibitive
issues, 3) it
10 should bind specifically and deliver genes of interest to target cells, 4)
It should be
relatively void of binding to non-target cells, and 5) it should possess
safety features
which allow for effective and ethical use of the vector, ideally in a large
number of
individuals .
Toward these goals, mutations within the AAV capsid protein were
15 identified which significantly reduce binding of the particle to the normal
AAV
receptor. In addition, evidence is presented in Example 2 demonstrating that a
single-chain antibody was incorporated into an AAV vector particle as a cap
fusion
protein, and that these vectors target the particle to a new surface marker of
interest
(CD34). Based on these results and additional strategies outlined in this
document,
20 recombinant adeno-associated virus vectors (rAAV) can be genetically
engineered to
deliver genes of interest (e. g. , ribozymes) to specific target cell types
and will
contain all of the desirable features listed above. Described herein are three
general
strategies for accomplishing these goals in AAV vectors: 1) incorporation of
targetable single-chain antibodies into vector particle capsid fusion proteins
at
25 specified regions of the protein (i. e. , N-terminus, C-terminus and
location of binding
mutation); 2) combinatorial library technology both for production of new
targeting
peptides and optimization of targetable vector assembly; and, 3) attaching
targeting
molecules of interest to the surface of pre-formed vector particles.
The basic strategy for creating a targetable rAAV vector was to first
30 delete the normal binding region on the AAV capsid protein and then replace
the
region with a ligand capable of targeting the virus to a receptor other than
AAV .
The initial stages of this work were performed in the context of the WT virus,
because it is easier to work with than recombine virus. Subsequently, the
CA 02251738 1998-10-14
WO 97l38723 PCT/US97/06590
61
appropriate mutant capsid proteins were transferred to an rAAV helper plasmid
used
in standard rAAV packaging experiments.
Because the receptor binding region on AAV was previously
unknown, a series of mutagenesis experiments were performed (see, below) to
identify AAV receptor binding regions. The strategy for selecting the various
sites
for mutagenesis is indicated in Table 1. Two of the mutants made were binding
deficient (Vplhydro and D4). These vectors are used to construct a vector
targeting
CD34+ cells with stem cell factor (SCF).
Table 1
Mutations in the AAV capsid proteins
Vpl
Do
Vp2
D 1 D2 D3 D4
Vp3 ~ I I
Position
Mutation iamino acid)Comments
Vpl 24-135 eliminates Vpl
Vp2 24-175 eliminates Vpl and Vp2
Vpl hydro 26-34 deletes proline rich region
in Vpl
Do 192-l97 S amino acid deletion in Vp2*
D1 208-213 5 amino acid deletion in Vp3*
D2 217-222 5 amino acid deletion in Vp3*
D3 229-234 5 amino acid deletion in Vp3*
D4 239-244 5 amino acid deletion in Vp3*
*These mutations correspond gion that has homology to the
to a re known binding
site of the parvovirus
B 19
AAV Mutants. Oligonucleotide site-directed mutagenesis was performed by
polymerase chain reaction (PCR). For this purpose, the Bst EII-Sna B 1
fragment
spanning nucleotides 1700 to 4496 in the AAV-2 genome (Srivatava, et al. (
1983) J.
Virol., 45: 555-564) was excised from pAV2, and site directed mutagenesis was
performed on the purified fragment. Subsequently, the fragment was cloned back
into pAV2, or alternatively into the AAV helper plasmid Ad8 (Samulski et al.
(1989) J. Virol. 63: 3822-3828).
CA 02251738 1998-10-14
WO 97I38723 PCT/US97106590
62
The Vplhydro deletion is shown in bold underline text with flanking
nucleic acids. The deletion corresponds to nucleic acids 2278-2304 as given in
Srivatava, et al. (1983) J. Virol. 45: 555-564.
Vplhydro: cagtggtggaagctcaaacct~gcccaccaccaccaaagcccgcagagcggcataa.
The Dl deletion is shown in bold underline text with flanking nucleic
acids. The deletion corresponds to nucleic acids 2828-2834 as given in
Srivatava, et
al. (1983) J. Virol. 45: 555-564.
Dl: gctacaggcagtggcgcaccaatg~cagaca
The DZ deletion is shown in bold underline text with flanking nucleic
acids. The deletion corresponds to nucleic acids 2855-2868 as given in
Srivatava, et
al. (1983) J. Virol. 45: 555-564.
D2: ataacgagggcgccgacgeaet~g-taattcctccggaa
The D3 deletion is shown in bold underline text with flanking nucleic
acids. The deletion corresponds to nucleic acids 2890-2905 as given in
Srivatava, et
al. (1983) J. Virol. 45: 555-564.
D3: attggcattgcgattccacat~aatgggcga
The D4 deletion is shown in bold underline text with flanking nucleic
acids. The deletion corresponds to nucleic acids 2921-2935 as given in
Srivatava, et
al. (1983) J. Virol. 45: 555-564.
D4: cagagtcatcaccaccagcacccgaacctgggccc
One of skill will readily appreciate that certain minor corrections have
been reported to the sequence of AAV-2 as originally given by Srivatava, et
al.
(1983) J. Virol. 45: 555-564.
Panicle formation assay: After generating the above mutants, the plasmid
DNAs were transfected into adenovirus infected HeLa cells to produce packaged
vector. Cell lysates were generated by freeze thaw and subsequently treated
with
DNase 1. The genome of intact particles were protected from DNase 1 digestion.
Each sample was then digested with proteinase K and extracted with
phenol/chloroform, and serial dilutions of the extracts were loaded onto a
slot blot
apparatus. Hybridization was performed using a labeled probe complementary to
a
region of AAV not contained within the deletions. Intact particle (virion)
formation
was evident in the WT control, and in the Vplhydro and D4 mutants.
CA 02251738 1998-10-14
WO 97I38723 PCTlUS97/06590
63
In one illustrative experiment, adenovirus infected cells were
transfected with rAAV containing the b-gal gene plus wild-type, Vplhydro or D1
mutant AAV helper piasmid and 72 hours later the cells were lysed by
freeze/thaw,
clarified by centrifugation, heated to 56~C for 45 min and then incubated with
DNase 1 for 60 min at 37~C. Subsequently, the samples were treated with
proteinase K, phenol/chloroform extracted, and bound to a solid matrix with a
slot
blot apparatus. Vector nucleic acids were hybridized to a 32-P labeled b-gal
probe
(the b-gal gene is present in each vector). Results showed that a Vplhydro
mutation with a stem cell factor insert had levels of particle formation
similar to wild
type AAV .
Infectivity assay:
Following particle formation, samples positive for particle formation
(WT, Vplhydro and D4) were normalized in terms of genome content and used to
infect adenovirus infected HeLa cells. Cell lysates were then treated in a
manner
identical to the particle formation assay.
There was a significant reduction in the ability of Vplhydro and D4
to replicate in HeLa cells relative to WT AAV. Because both of these mutations
lead to intact particle formation as measured by nuclease resistance, the data
suggests that the deletions result in reduced binding, rather than post-
binding,
events. This is particularly shown by the fact that transfection of the mutant
DNAs
in the particle formation assay gave a much stronger signal than the
infectivity assay,
even though transfection is usually much less efficient than infection.
Decreased
signals of Vp 1 hydro and D4 relative to the WT in the particle formation
assay are
expected since the mutations prevent subsequent rounds of infection after
transfection. Conversely, after transfection the WT was able to infect
untransfected
cells and thereby amplify the signal that was observed.
Competition Binding Assay: the following competition binding assay was
performed to demonstrate that the capsid mutations reduce the ability of the
mutant
virus to bind to host cells. 200 Cos cells were seeded onto a 24 well plate
containing RPMI + 10% FBS in triplicate for each determination. After 24 hours
incubation at 37~C the cells were transferred to 4~C and the indicated amounts
of the
various competitor virus was added in the presence of a fixed concentration of
WT
rAAV vector containing the b-gal gene. The cells were incubated for 60 min at
4~C
and washed three times with cold RPMI and fresh RPMI + 10 % FBS was added
CA 02251738 1998-10-14
WO 97/38723 PCT/ITS97/06590
64
followed by incubation at 37C overnight. Subsequently, the cells were
processed
for b-gal staining by standard techniques. A decrease in the number of
positive cells
in the presence of increasing competitor is indicative of virus binding.
number of % positive cells
competitor
virions per well
WT WT(hi)* Vplhydro Vplhydro/SCF
0 35.1 26.0 31.5 33.9
10~ 23.0 22.8 36.6 33.0
108 l4.6 25.0 28.3 25.9
109 10.3 29.0 26.6 24.9
101 8.5 28.3 24.0 ND
* WT AAV that has been denatured by heat inactivation at 100C for 15
. minutes
A small degree of binding to the normal AAV receptor is evident in
the mutants; however, binding is substantially diminished compared to WT AAV
as
the competitor. Specifically, using WT AAV as the competitor reduces binding
by a
maximum of 75 % while using the mutant as a competitor only reduces binding by
15%.
Targeting Analysis: The indicated cell lines (Table 2) were transduced with
rAAV vectors containing capsid proteins AAV/Ad (WT AAV capsid), AAV/Ad
vplhydro (AAV binding mutant capsid), or AAV/Ad vplhydro SCF (AAV binding
mutant capsid with SCF insert). A11 vectors contained the b-gal gene as a
reporter.
As an additional positive control an adenovirus vector, Ad b-gal, was
included.
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
Table 2
A. Cos cells 5,000 cells per transduction
blue
cells
AAV/Ad 80
5 AAV/Ad vplhydro 0
AAV/Ad vplhydro SCF 0
Control (normal cell lysate) 0
B. HeLa cells 5,000 cells per transduction
blue
cells
10 AAV/Ad 41
AAV/Ad vplhydro 0
AAV/Ad vpl hydro SCF 0
Ad b-gal 92
Control (normal cell lysate) 0
15 C. NCI 187 cells 5000 cells per transduction
blue
cells
AAV /Ad 62
AAV/Ad vplhydro 0
AAV/Ad vplhydro SCF 46
20 Ad b-gal (MOI 10) 246
Ad b-gal (MOI 30) 612
Control (normal cell lysate) 0
Example 2: Targeted Delivery of Recombinant Adeno-associated Virus Vector
25 (rAAV) Using Single Chain Antibody Against CD34
To achieve targeted delivery of rAAV in vivo, we engineered a
chimeric AAV virion protein (VP) carrying coding sequences for the variable
regions of a single chain antibody (scFv) against human CD34 molecules.
Inclusion
of CD34 single chain antibody-AAV capsid chimeric proteins in rAAV virions
30 dramatically increased the infectivity of rAAV to CD34+ KG-1 cells, a human
myelogenous leukemia cell line that is normally resistant to rAAV
transduction.
Hematopoietic stem cells are important targets for gene therapy.
After the transduced stem cells differentiate, they reconstitute the
hematopoietic
system and can carry integrated transgenes into desired lineages of blood
cells.
35 Adenoviral vectors are good candidates for direct in vivo gene delivery to
hematopoietic stem cells because they can transduce non-dividing cells (unlike
retroviral vectors) and can mediate the integration of transgenes into host
genomes
(Fisher-Adams, G. , et al. , Blood 88:492 ( 1996)) . However, for safety
concerns,
to transduce hematopoietic stem cells in vivo, it is desirable to develop AAV
vectors
40 that bind specifically to these cells.
CA 02251738 1998-10-14
WO 97/387Z3 PCT/US97/06590
66
In this Example, we incorporated the single chain fragment variable
region (scFv) of a monoclonal antibody against human CD34 molecule, a marker
for
hematopoietic stem cells, (Civin, C. I. , et al. , J. Immunol. 133:157 (
1984); Ogawa,
M. Blood 81:2844 ( 1993)), into the AAV virion via a VP-scFv chimeric protein.
A. Cell culture and DNA transfection.
HeLa cells were grown in Delbecco's Modified Eagle Media
(DMEM) supplemented with antibiotics and 10 % fetal bovine serum. KG-1 (ATCC
CCL-246), a human acute myelogenous leukemia cell line that expresses CD34
molecules, (Koeffler, H. P. and Golde, D. W. , Science 200:1153 ( 1978);
Simmons,
D. L. , et al., J. Immunol. 148:267 ( 1992); and Civin, C. L, et al.) (
1984)), was
cultured in Iscove's Modified Eagle Medium supplemented with 20 % fetal bovine
serum. The anti-CD34 hybridoma My-10 (ATCC HB8483) was cultured in RPMI
medium in the presence of 10 % fetal bovine serum. All cells were maintained
at
37C in a 5 .0 % COZ atmosphere. DNA transfections of HeLa cells were performed
by calcium phosphate transfection one day after plating onto culture dishes
(see,
Ausubel F.M., et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene
Publishing Associates, Brooklyn, N.Y. (1987)).
B. Cloning and Expression of scFv From My-10 Hybridoma.
PCR amplification with degenerate primers from an Ig-primer kit
(Novagen) was utilized to clone the variable heavy and light chain sequences
of the
My-10 hybridoma genome. Briefly, total RNA was isolated from My-10 cells and
the mRNA reverse transcribed into cDNA with AMV reverse transcriptase. PCR
amplification of the heavy chain and light chain sequences was carried out
with
different combinations of degenerate primers provided for in the kit. The
resulting
PCR fragments (about 450 base pairs) were subcloned into TA cloning vectors
{Invitrogen) and sequenced {Sequenase, U.S.B). Three out of six of the light
and
heavy chain primer pairs produced PCR products upon amplification; however,
only
primer pairs MulgkVLS'-G and MulgkVL3'-1, and MulgVHS'-C and MulgVH3'-2 of
the Ig-Primer kit generated DNA fragments which coded for the N-terminal and
C-terminal consensus sequence of VL and VH, respectively. The sequences of
multiple clones were compared and representative clones were chosen and
ligated
into pBlueScript vectors (Strategene) carrying a linker sequence, (GGGGS)3.
CA 02251738 1998-10-14
WO 97/38723 PCT/US97/06590
67
The resulting scFv with a structure of VH-(GGGGS)3-VL comprised an N-terminal
heavy chain region of 116 amino acids followed by the linker sequence and a C-
terminal light chain region of 112 amino acids.
The cloned scFv gene was inserted into a pTrc/his vector (Invitrogen)
for bacterial expression of the scFv with a polyhistidine tag. The histidine
tagged
scFv protein was purified using a nickel column under denaturing conditions.
Renaturation was performed by dialyzing the purified proteins against 10 mM
Tris-
HCI, pH 7.8, and 0.1 % Triton X-100. Any undissolved proteins were removed
before further use and the solubilized protein was identified as scFv-his by
western
blot analysis using an anti-his C-terminal antibody (Invitrogen).
C. Expression of ScFv AA V capsid chimeric proteins in vitro and in
vivo.
Standard procedures were followed for plasmid construction, growth
and purification (see, Ausubel, supra). The capsid genes for VP1, VP2, and VP3
were amplified from the pAV2 plasmid, which contains the full length AAV-2
genome (Laughlin, C.A., et al., Gene 23:65 {l983)). The 3' primers
corresponded
to the end of the AAV capsid gene open reading frame and the 5' primers
corresponded to the start codon of individual capsid genes, i.e. position 2203-
2229
for V P 1, 2617-2640 for V P2, and 2810-2833 for V P3 . The 3' and 5' primers
were
synthesized so that Sal I and Xba I sites would be incorporated into the VP
sequences for ligation into vectors. The amplified sequences with the
incorporated
restriction sites were subcloned into pCDNA3 expression vectors (Invitrogen)
via
Xho I and Xba I sites to generate pVPl, pVP2, and pVP3 plasmids.
The above cloned anti-CD34 scFv sequence was ligated to the S' end
of the VP1, VP2, and VP3 sequences using Hind III and Not I sites to generate
the
plasmids pVPI-scFv, pVP2-scFv, and pVP3-scFv.
The expression of the various AAV virion proteins and the chimeric
proteins were verified in vitro using a TNT transcription and translation kit
(Promega). We detected the expression of AAV VP1, VP2, and VP3 proteins as
well as VP1-scFv, VP2-scFv, and VP3-scFv.
For in vivo expression, 2 wg of the plasmids were transfected into
2 x 105 HeLa cells in 60 mm dishes by calcium phosphate transfection. Forty
eight
hours later, the cells were collected and cell lysates prepared by adding 30
~,L lysis
CA 02251738 1998-10-14
WO 97/38723 PCT/LJS97/06590
68
buffer (10 mM Tris, pH 7.8, 2 mM PMSF, 5 mM MgCl2, 0.3 M NaCI, and a
proteinase inhibitor cocktail from Boehringer Mannheim) and boiling for 15 min
with 10 ~,L 3X electrophoresis loading buffer. The presence of intracellular
chimeric proteins was verified by western blot analysis using guinea pig anti-
AAV2
antibody (NIH) and HRP-conjugated goat anti-guinea pig antibody. The ECL
system (Amersham) was used to detect positive signals.
From the western blot analysis, it was clear that the VP2-scFv and
VP3-scFv could be detected after transient transfection. Due to non-specific
binding
of the detection antibody to cellular proteins, it was not clear whether VP3-
scFv was
expressed.
D. Production of rAAV Vector and rAAV Transduction.
Initial attempts to make a packaging a recombinant AAV (rAAV)
genome containing one or two of the chimeric virion proteins failed to produce
any
intact viral particles. To overcome this obstacle, we included wild type AAV
capsid
proteins into the packaging process. We employed a triple plasmid DNA
co-transfection strategy, namely co-infecting cells with (1) pAV/Ad, (2)
pAAVgaI
conjugated to polylysine coupled adenovirus, and (3) the individual pVP-scFv
chimeric protein-containing plasmid.
To produce the rAAV particles, about 1 x10 HeLa cells in T162
flasks were transfected with 10 ~g of plasmid pAV/Ad, which has the entire
coding
sequence for AAV replication and capsid genes (Samulski, R.J., et al., J.
Virol.
63:3822 (1989)), and 10 pg plasmid pAVgal, an AAV vector plasmid containing a
bacterial lacZ gene under the control of the cytomegalovirus (CMV) early
promoter,
conjugated to 100 ~,L polylysine coupled adenovirus (M.O.I. about 10)
(Mamounas,
M. , et al. , Gene Ther. 2:429 ( l995)). After 48-72 hr, about 80 % of cells
showed
maximum cytopathic effect (CPE) and the cells were harvested and resuspended
into
a small volume of culture medium.
The rAAV particles were extracted from HeLa cells after three
freezing and thawing cycles. The crude lysates were spun in a microcentrifuge
for
10 min at maximum speed. The rAAV particles were purified by CsCI
centrifugation. 30-40 T 162 flasks of rAAV-containing lysates were combined
and
CsCI was added to the lysate to a final density of 1.4 g/ml. After
centrifugation at
35,000 rpm, cell debris and the majority of the adenoviruses were removed and
a
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
69
second centrifugation was performed. The contents of the centrifuge tube were
collected in 1 mL fractions. Each fraction was tested for the presence of
intact
rAAV particles by slot blot analysis using a lacZ gene probe. The fractions
with the
highest rAAV particle titer were pooled and dialyzed against DMEM medium for 2
hr at 40C with one change of dialysis medium.
For transduction with rAAV particles, about 2 x 104 KG-1 or HeLa
cells were plated in 24-well plates one day prior to transduction. Appropriate
amounts of rAAV were added to the media, and the particles and cells were
incubated overnight. After the incubation period, the cells were washed and
the
expression of the lacZ gene was detected by X-gal staining.
To generate AAV vectors (vAAV) which contained the VP-scFv
chimeric proteins; 1 x 10~ HeLa cells in T 162 flasks were transfected with,
in
addition to the plasmids pAV/Ad and pAVgal, l0~ug of pVPl-scFv, pVP2-scFv, and
pVP3-scFv.
Screening of vVPI-scFvgal, vVP2-scFvgal, and vVp3-scFvgal (the
vAAV purified from HeLa cells) for their infectivity on HeLa cells and CD34+
KG-1 cells demonstrated that the inclusion of pVP2-scFv greatly increased the
infectivity of vAAV on KG-1 cells, which normally is resistant to rAAV
infection
under the conditions we used. Consequently, we focused our efforts on vVP2-
scFv.
We produced large quantities of vVP2-scFvgal and purified it by CsCI gradient
centrifugation. The differential infectivity of vVP2-scFvgal and vAAVgaI on KG-
1
cells is summarized in Table 3. Although similar transduction efficiency was
observed in HeLa cells, vVP2-scFvgal transduced KG-1 cells at a titer about
100
infectious particles/ml, while vAAVgaI failed to transduce at all. The
increased
transduction by vVP2-scFvgal on KG-1 cells has been observed using crude
lysates
as well.
CA 02251738 1998-10-14
WO 97I38723 PCT/US97/06590
Table 3: infectivity of CsCI Purified vAAVgaI on HeLa and KG-1 Cells
Infection (Titer/mL)
Viruses
HeLa Cells KG-1 cells (CD34+)
vAAVgaI 1.3 x 106 0
vVP2-scFvgal 8.8 x 105 90
5
E. Flow Cytometry and Binding of scFv to CD34 Molecules.
For the binding of histidine tagged scFv from transformed E. coli to
CD34 molecules, about 1 x 105 of KG-1 cells were incubated with or without 1
~,g
of scFv protein or control proteins at 40C for 30 min. About 0.05 ~,g of
10 phycoerythrin conjugated ICH3 antibody (PE-ICH3, lmg/ml, Caltag Lab., CA)
was
added and incubated for an additional 30 min.. After washing with PBS, the
stained
cells were subject to flow cytometry analysis using FACS Vantage (Becton
Dickinson) .
To analyze the binding of CsCI-purified vAAVgaI carrying VP2-scFv
15 chimeric proteins to CD34 molecules, about 1 x 105 of KG-1 cells were
incubated
with or without 1 x 101 particles of vVP2-scFvgal or 1 x 101 particles of
vAAVgaI
at 40C for 30 min. About 0.05 ~.g of PE-ICH3 was added and incubated for an
additional 30 min. After washing with PBS, the stained cells were subject to
flow
cytometry analysis using FACS Vantage (Becton Dickinson).
20 We next studied the specificity of vVP2-scFvgal for CD34 in
transduced KG-1 cells. Because of difficulties in conjugating My-10 antibodies
with
commercially available fluorescent reagents, it proved to be difficult to
investigate
the binding of purified histidine tagged scFv to CD34 molecules on the surface
of
KG-1 cells. As a result, we developed a competitive binding assay based on the
25 observation that My-10 monoclonal antibodies blocked the binding of ICH3
monoclonal antibodies to CD34 molecules (Gaudernack, G. and Egeland, T.,
LEUCOCYTE TYPING V; WHITE CELL DIFFERENTIATION ANTIGENS, PROCEEDINGS OF
THE FIFTH INTERNATIONAL WORKSHOP AND CONFERENCE, VOL. L, Schlossman S. F.
et al. (eds.), Boston, MA, November 3-7, 1993, Oxford University Press, New
30 York (1995)).
We first determined that 0.05 ~,g PE-ICH3 was the minimum amount
required for detection of 1 x 105 KG-1 cells. In the competitive binding
assay, we
CA 02251738 1998-10-14
WO 97l38723 PCT/LTS97/06590
71
preincubated KG-1 cells with 1 ~,g of histidine tagged scFv or control protein
for 30
minutes before the addition of PE-ICH3 antibody. The addition of dialysis
medium,
control IgG, or histidine tagged lacZ protein did not interfere with the
binding of
ICH3 to KG-1 cells, however, the presence of purified scFv reduced the binding
of
ICH3 to CD34 by more than 90 % . This indicates that the scFv we purified
bound
to CD34 molecules on the KG-1 cell surface.
The preincubation of 1 x 10o particles of vVP2-scFv reduced the
binding of ICH3 antibody to CD34 molecules by almost 90%, while vAAVgaI
reduced binding of ICH3 by about 35 % . This was most likely due to non-
specific
inhibition of ICH3.
By increasing the amount of PE-ICH3 added to the cells, the
inhibition by vVP2-scFvgal was no longer observed. This demonstrated that the
VP2-scFv chimeric protein expressed on the vVP2-scFvgal surface mediated the
binding of vVP2-scFvgal to CD34 molecules on KG-1 cell surface. This finding
showed that specific targeting of AAV vectors into KG-1 cells as well as other
CD43+ cells can be achieved.
All publications and patent applications cited in this specification are
herein incorporated by reference as if each individual publication or patent
application were specifically and individually indicated to be incorporated by
reference.
Although the foregoing invention has been described in some detail by
way of illustration and example for purposes of clarity of understanding, it
will be
readily apparent to those of ordinary skill in the art in light of the
teachings of this
invention that certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
CA 02251738 1999-04-15
72
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Immusol Incorporated
(B) STREET: 3050 Science Park Road
(C) CITY: San Diego
(D) STATE: California
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 92121
(G) TELEPHONE: (619) 677-0l82
(H) TELEFAX: (619) 677-0587
(I) TELEX:
(ii) TITLE OF INVENTION: Targeted Viral Vectors
(iii) NUMBER OF SEQUENCES: 11
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fetherstonhaugh & Co.
(B) STREET: Box 11560, Vancouver Centre, 2200 - 650 West Georgia
(C) CITY: Vancouver
(D) STATE: British Columbia
(E) COUNTRY: Canada
(F) ZIP: V6B 4N8
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,251,738
(B) FILING DATE: 15-April-1997
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/015,497
(B) FILING DATE: 16-APR-1996
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Kingwell, Brian G.
(B) REFERENCE/DOCKET NUMBER: 40330-1392
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (604) 682-7295
(B) TELEFAX: (604) 682-0274
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
CA 02251738 1999-04-15
73
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Gly Ala Val Gln Pro Arg Gly Ala Thr Ser Lys Leu Tyr Leu Leu Arg
1 5 10 15
Met Thr Asp Lys
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Gly Glu Lys Leu His Arg Val His Ile Arg Thr Asn Thr Pro Ser
1 5 10 15
Val Tyr Ser Arg
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Leu Glu Pro Arg Val Ala Gln Arg Gly Gln Met Val Lys Phe Thr Tyr
1 5 10 15
Met Arg Leu Pro
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
His Ala Trp Trp Lys Pro Trp Gly Trp Ser Ile Glu Ala Leu Ala Pro
1 5 10 15
CA 02251738 1999-04-15
74
Thr Ala Gly Pro
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
NNNSNGUCNN rfNNNNN 16
(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 56 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mutation
(B) LOCATION: replace(16..42, "")
(D) OTHER INFORMATION: /note= "Vplhydro deletion
corresponds to positions 2278-2304 from
adeno associated virus-2 (AAV-2) genome"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
CAGTGGTGGA AGCTCAAACC TGGCCCACCA CCACCAAAGC CCGCAGAGCG GCATAA 56
(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mutation
(B) LOCATION: replace(16..30, "")
(D) OTHER INFORMATION: /note= "D1 deletion corresponds to
positions 2828-2834 from adeno
associated virus-2 (AAV-2) genome"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
CA 02251738 1999-04-15
GCTACAGGCA GTGGCGCACC AATGGCAGAC A 31
(2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mutation
(B) LOCATION: replace(12..26, "")
(D) OTHER INFORMATION: /note= "D2 deletion corresponds to
positions 2855-2868 from adeno
associated virus-2 (AAV-2) genome"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
ATAACGAGGG CGCCGACGGA GTGGGTAATT CCTCCGGAA 39
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mutation
(B) LOCATION: replace(9..23, "")
(D) OTHER INFORMATION: /note= "D3 deletion corresponds to
positions 2890-2905 from adeno
associated virus-2 (AAV-2) genome"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
ATTGGCATTG CGATTCCACA TGGATGGGCG A 31
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: mutation
CA 02251738 1999-04-15
76
(B) LOCATION: replace(8..22, "")
(D) OTHER INFORMATION: /note= "D4 deletion corresponds to
positions 2921-2935 from adeno
associated virus-2 (AAV-2) genome"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CAGAGTCATC ACCACCAGCA CCCGAACCTG GGCCC 35
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
