Note: Descriptions are shown in the official language in which they were submitted.
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
1
USE OF A NOVEL GLUCOSYL TRANSFF'RASE
This _nvention relates to a method for i:~ducing
plant defence and resistance responses and regulating
plant developmental events. More particularly, this
invention relates to methods for inducing the
production of plant defence proteins such as
pathogenesis-related (PR) proteins and proteinase
inhibitor (pin) proteins and to methods for regulating
resistance and acquired resistance to predators,
insects, bacteria, fungi and viruses in plants, through
manipulating levels of the plant hormones: salicylic
acid, jasmonic acid, cytokinins and ethylene, and to
methods for regulating developmental events that depend
on these hormones, particularly, plant growth,
reproduction and senescence.
Adaptation of a plant to its environment is brought
about by recognition and response to external stimuli
which cause changes in cellular activity. A chain of
events link the initial recognition of the stimu2us to
chances in cells of the plant that ultimately lead to
adaptation. These events constitute a signal
transduction pathway, in which sequential molecular
interactions transduce (lead) the signal from its
perception through to the end-effects caused.
Plants respond to a vast range of environmental
stimuli that include, for example: changes in their
growing conditions (light, heat, cold, drought, water-
logging etc); mechanical damage leading to injury, and
challenge by pests and pathogens (herbivores, insects,
fungi, bacteria, viruses etc). These stimuli lead to
cellular events at the sites) of perception, but also
can trigger long-range events throughout the plant,
CA 02255830 1998-11-19
WO 97/45546 PCTlGB97101473
leading to systemic changes. Thus, Lor example, in
response to wounding and to pest/pathogen challenge,
there are local and systemic events induced with signal
transduc~ion pathways occurring at the local site,
systemic signals) communicating the local events
around the plant, and signal transduction pathways
occurring in distant cells that are responding to the
systemic signal(s). Networking and cross-talk between
infra- and inter-cellular signal transduction pathways
is recognised to be an important means through which
the plant integrates all of the information received
from the environment.
Plant hormones play a central role in these induced
responses to environmental stimuli, since they act as
the intermediate molecular signals which trigger the
transduction pathways leading from the external
changes) in the environment to the internal end-
effect(s) within the plant. For example, in a variety
of plant species, jasmonic acid is known to accumulate
transiently during the wound response and has been
implicated in transduction events linking mechanical
injury to activation ef wound-responsive genes.
Another example is during the interactions of plants
with pests and pathogens, when salicylic acid is known
to increase in quantity (together with its precursor,
benzoic acid and its volatile form, methyl salicylate)
and is considered to be a central regulator of local
and systemic acquired resistance and the activation of
defence-related genes associated with resistance.
Whilst salicylic acid is a positive regulator ef these
induced resistance responses, there is evidence to show
that the hormone is also a negative regulator of the
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
wound response, such that if a plant is pre-treated
with aspirin or salicylic acid, wound-responsive genes
dependent on jasmonic acid for their expression are not
induced X1,2,3,4]. This suggests there is
' 5 communication between the signalling pathways induced
by mechanical injury and induced by pests/pathogens,
such that they do not occur simultaneously.
Senescence is the natural process which normally leads
to cell death, either in a selected population of cells
such as abscission cells or in whole organs such as
flowers, leaves and fruits. This process of senescence
can be developmentally regulated, such as, for example,
in the ripening process, wilting and fading of flowers,
yellowing and abscission of leaves. Alter:~atively,
senescence and cell death can be induced by trauma,
such as caused by, for example, chemicals, temr~erature
extreme, pest and pathogen damage, disease or
mechanical wounding.
The level of an active plant hormone in plant cells and
tissues at any one time is dependent on the relative
rates of its synthesis and degradation, the rates of
transr~ort to or from the cells/tissue, and the relative
rates of ,'~ts conversion to and from inactive
metabolite(s). For plant hormones, this conversion to
an inactive metabolite can involve the conjugation of
the free active form of the hormone to a polar
molecular species, such as a sugar, amino acid or
peptide. endogenous hormones made by the plant, and
exogenous hormones applied to and taken up by the plant
are subject to conjugation in this manner. When large
quantities of exogenous hormones are applied to the
plant the conjugation process has been likened to
CA 02255830 1998-11-19
WO 97!45546 PCT/GB97/01473
detoxification since it effectively clears the active
rormones from the system rapidly.
S_nce the process of conjugation is known to be
retrersible in plants, at least for some hormones, it
provides a flexible mechanism for regulating the pool
size of active hormone in the absence of synthesis and
degradation. Also, since most plant hormones are
either apolar or amphiphilic, their reversible
conjugation to a polar molecule provides a useful
mechanism for containing the hormone on one side or
other of a membrane, such as in the apoplast, or in a
particular compartment of the symplast.
Whilst many different conjugates of plant hormones have
been identified, a commonly found conjugate is the
glucoside, formed through the transfer of glucose from
a sugar nucleotide donor to the hormone via a Vii, O-
glycosidic linkage. The enzymes responsible are
Q~ucosyl transferases and the available evidence
i::dicates that each transferase is highly specific for
~~e particular hormone it conjugates. For example, the
c~~_ucosyi transferase responsible for conjugation of the
p-pant hormone, indole 3-acetic acid, has been
identified and shown to be specific for the auxin
substrate [5]. Similarly, the glucosylation of
salicylic acid has also been investigated, and an
enzyme activity identified in a variety of plant
species has been shown to be specific for salicylic
acid and the sugar nucleotide donor, UDP glucose [6].
A~:other important hormone is ethylene which is a gas
u..~.der physiological conditions that influences a wide
_ange of events in plants, including the regulation of
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
growth, cellular differentiation and developmental
processes. In particular, ethylene is the key
regulator of senescence, which as stated above, is a
genetically controlled process cf degeneration normally
leading to cell death and which occurs in specific
cell-types and in whole organs such as flowers, leaves
and fruits. The effects of ethylene on developmental
processes are of considerable commercial importance.
The effects can occur at low concentrations, whether
the gas is produced by the plant itself or applied
exogenously to the plant. Ethylene is also involved in
defence/stress and resistance responses, such as
directing how the plant combats challenges from pests
and pathogens, and during the consequences of abiotic
stimuli, for example, mechanical injury and water-
logging. In these defence/stress and resistance
responses, ethylene has a direct effect on the
activation of specific genes, as well as a role in
inducing cell death associated with hypersensitive
responses.
Generally, ethylene is maintained at very low levels
in plant tissue, but production can be rapid and
massive during the senescence process, or during
stress/trauma caused by biotic and abiotic stimuli.
During the degenerative process of senescence, ethylene
synthesis is regulated by positive feedback, such that
one action of the ethylene produced is the up-
regulation of the synthetic machinery and thus further
production of more ethylene leading to an autocatalytic
avalanche of increased levels of the hormone. In
contrast, during stress/trauma, she "wound" or "stress"
ethylene produced is regulated by negative feedback,
leading to a hormone transient. Ethylene has been
CA 02255830 1998-11-19
WO 97/45546 PCTIGB97/01473
6
shown unequivocally to be a requirement for the
developmental senescence process. The role of "wound"
ethylene is less defined.
The ethylene signal transduction pathway is the most
characterised of all plant hormones to date, with the
identification of genes encoding a receptor, a negative
regulator protein and a number of proteins implicated
genetically in downstream events f7]. In contrast,
very little is known of the regulation or the
mechanismis) by which ethylene levels rise in response
to the environmental stimuli and to pest and pathogen
attack.
Since plants have evolved inducible mechanisms of
defence that respond to attack by pests and pathogens,
there is considerable commercial interest in
identifying methods of induction which will protect and
even enhance the natural resistance of the crop plant.
This is particularly relevant when the only
agrochemicals available are hazardous both to the
environment and the consumer. Often, during the
natural course of a defence response to pest and
pathogen challenge, a broad spectrum of defence-related
genes and physiological events are induced in parallel
and their success at conferring resistance arises from
the multiplicity of their actions. Long-term efficacy
of this strategy is much greater than that achieved by
genetically modifying crop plants with single defence-
related genes. This is because in field situations the
alteration or insertion of a single defence-related
gene can be overcome by pests and pathogens rapidly
evolving and adapting to the single gene change. In
addition, decreased crop yields and decreased product
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
7
quality are features commonly encountered in resistant
cultivars. Thus, there exists a strong requirement for
' new materials and processes to improve the resistance
of plants under attack by pests and pathogens. This
' S would preferably be through the induction of the
plant's own defence systems.
There is also considerable commercial interest in
identifying the molecular "switches" which respond to
non-hazardous chemicals applied to the plant, and in
turn, recrulate developmental and defence responses,
where and when applied. Whilst some inducible
promoters have been found that are responsive to
various chemicals, (e. g. PR gene promoters responsive
to dichloroisonicotinic acid (DCINA) [8] which can be
used to drive the expression of genes of interest), the
range of applications envisaged could be increased
dramatically if more promoters and more chemical
inducers were identified. By way of background, DCINA
is a widely used agrochemical which induces systemic
acquired resistance (SAR) and is thought to act at a
point downstream of salicylic acid in the transduction
pathway leading to SAR gene expression.
For plant resistance and post-harvest protection of raw
material quality, the speed of the defence response
mounted by the plant cells/tissues, often determines
the overall success-rate. Therefore, major interest
lies in identifying rapidly responding promoters and,
dependent on the application, those that are either
capable of driving expression in a wide range of cell-
types or those that are highly specific to a particular
cell-type or tissue, for example, epidermal cells or
lsaves, but not stems, etc.
CA 02255830 1998-11-19
WO 97145546 PCT/GB97/01473
8
There is also major commercial interest in identifying
ways in which senescence can either be controlled,
prevented completely, the time-span of senescence
regulated, or its occurrence induced only when
required. Since senescence is intimately associated
with ethylene, the problems of senescence are really
problems of ethylene quantity and ethylene action. For
example, in the post-harvest care of fruits, vegetables
and flowers, cuts and bruising can stimulate ethylene
production which in turn causes cell death in the
traumatised tissues as well as affecting the adjacent
fresh produce. This in turn leads to massive losses in
the quality of these materials during transportation
and storage. Traditional technologies addressing post-
harvest issues have been tried for decades but suffer
from problems of side-effects, toxicity, high costs and
an inability to shut down completely ethylene synthesis
[9] .
In the present invention, a gene TWI1, whose existence
had previously been established as merely being a
"wound inducible" gene but whose true function, until
now, was completely unknown, is disclosed. It is now
known by way of our invention that the TWI1 gene codes
for a giucosyl transferase (GTase) which regulates
levels of a key signalling intermediate. Through
detailed analyses of the expression patterns of TWI1 in
tomato, this gene is believed to function in those
signalling pathways leading to developmental and
defence responses controlled by ethylene. Using
transgenic plants with modified levels of TWI1
expression, we demonstrate a key role for this gene in
plant responses to wounding and to pathogens.
CA 02255830 1998-11-19
WO 97/45546 PCTIGB97/01473 _
9
A disclosure oz a partial sequence on an EMBL database
of a wounded tomato leaf library indicated that the
TWI1 cDNA might possibly encode ror a GTase. However,
no indication was given as to the induction patterns of
the TWI1 gene nor the possible function oz its product.
These factors were not deducible from the partial
sequence disclosed, nor from the source of the mRNA
from which the cDNA was derived. This invention,
therefore, provides the first-ever correlation between
GTase action and the regulation of ethylene, a common
intermediate in a diverse process in plants.
Accordingly, the present invention provides a method of
altering the signalling pathways of a plant involving
salicylic acid, ethylene and jasmonic acid. The method
comprises interfering with the normal functioning of
the TWI1 gene encoding a GTase _:, plants. This is
particularly useful in tomato plants, however, this
invention would apply with similar advantage to other
dicotyiedonous or monocotyledonous plants (i.e. broad-
leaved plant species as well as grasses and cereals).
This invention is applicable to any horticultural or
agricultural species, including hose in which fruit-
ripening and/or post-harvest storage are important
considerations.
according to one aspect of this invention, there is
provided a recombinant or isolated DNA molecule which
encodes for a glucosyl transferase in plants. In
preferred embodiments, the GTase gene (TWI1) comprises
the nucleic acid~sequence or at least portions (or
fragments) of the nucleic acid sequence shown in FIGS 1
and 2. Also sequences having substantial sequence
homology with the TWI1 gene of :IGS 1 and 2 are also
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
claimed .-~_ this invention. Moreover, sequences having
substantial sequence homology with the amino acid
sequence encoded by the TWI1 gene (FIG 3) are claimed
as part c~ this invention.
5
The term "portions" or "fragments" as used herein
should be interpreted to mean that a sufficient number
of nucleic acid or amino acid residues are present for
the fragment to be useful (i.e. to act as or encode a
10 GTase). Typically, at least four, five, six, up to 20
or more residues may be present in a fragment. Useful
fragments include those which are the same as or
similar or equivalent to those naturally produced by
the TWI1 Qene or its equivalent gene and enzyme in
other plants, for example, as in FIGS 4 and 5 for rice
and tobacco, respectively.
As used i~ the present application, substantial
sequence homology means close structural relationship
between nucleotides or amino acids. For example,
substantially homologous DNA sequences may be 60%
homologous, preferably 80o and most preferably around
90 to 95% homologous, or more, and substantially
homologous amino acid sequences may preferably be 35%,
more preferably 500, most preferably more than 50%
homologous. Homology also includes a relationship
wherein one or several subsequences of nucleotides or
amino acids are missing, or subsequences with
additional nucleotides or amino acids are
interdispersed. When high degrees of sequence identity
are present there may be relatively few differences in
the amino acid sequences. Thus, for example, they may
be less than 20, less than 10, or even less than 5
differences in amino acid sequences.
CA 02255830 1998-11-19
WO 97145546 PCT/GB97/01473
11
The degree of amino acid sequence identity can be
calculated, for example, using a program such as
"BESTFIT" 'Smith and Waterman, Advances in Applied
Mathematics, pp. 482-489 !1981)) to find the best
segment ~~ similarity between any two sequences. The
alignment is based on maximising the score achieved
using a matrix of amino acid similarities, such as that
described by Schwarz and Dayhof !Atlas of protein
Sequence and Structure, Dayhof, :~I.O., pp. 353-358).
Using the TWI1 cDNA sequence as a probe to analyze
expression of the GTase during a pathogen response in
tomato, we observed that the gene is induced during
gene-for-gene mediated resistance (R) response
involving the Cf9 R gene to Cladosporium fulvum.
Similarly, using a homologous GTase gene which we
isolated from tobacco as a probe (FIG 4), we also found
induction during gene-for-gene mediated R response
involving the N gene to tobacco mosaic virus (TMV). In
this latter system, induction of the GTase gene in
response to TMV was causally dependent upon the
elevation of salicylic acid. These data imply a role
for the TWI1 gene product in salicylic acid-mediated
pathogen responses. Thus, an object of this invention
is the use of TWI1 gene in stimulating or improving
pathogen. related responses in plants, through induction
of the GTase and thus effecting the levels of salicylic
acid normally present in the plant (i.e. a wild-type
plant ) .
In transgenic tobacco plants which constitutively
express t:~e GTase at a high level) we found that the
~ formation of necrotic lesions and the induction of PR-
gene expression in response to the bacterial elicitor,
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
i2
harpin L10], is completely suppressed. In contrast, in
plants ~n whim GTase expression is repressed, the
response to harpin is enhanced. These data show that
the GTase gene product impacts directly on events at
the local site of challenge with consequences on the
process of acquired resistance. Importantly, the
implication is that in transgenic plants expressing an
antisense gene to the GTase, a hypersensitive response
(HR) and acquired resistance to pathogen challenge may
be enhanced.
In wound response, JA and ethylene are causally
required for pin gene expression. The elevation of
endogenous JA is very rapid and transient and is
dependent on ethylene action [Bowies, et aI,
unpublished dataj. Salicylic acid applied to plants
prior to wounding inhibits this elevation in JA
completely and also inhibits pin gene expression
[Bowies, et a1, unpublished data]. The wound induction
of the GTase is also very rapid with a parallel time-
course to the elevation in JA. In plants expressing
the TWI1 antisense gene, wounding does not induce pint
expression. Expression of the gene encoding ethyiene-
forming enzyme occurs as normal, but in contrast to
wild-type plants, in the transgenic plants the down
regulation no longer occurs. This provides further
direct evidence for the role of the GTase gene product
in the regulation of ethylene and ethylene-dependent
responses.
GTase activity as it relates to ethylene has never
previously been identified nor contemplated. This
would not be an obvious nor routine method to follow
despite existing literature on GTases. Further, the
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
~3
developmental pattern of expression of any GTase is
developmentally-regulated. This is demonstrated by the
attached examples, wherein GTase is expressed at high
levels in ethylene-mediated processes such as fruit-
s ripening and senescence. Moreover, since the gene was
not previously available for relevant antisense
experiments, the opportunity to analyze the effects of
GTase down-regulation on ethylene did not exist prior
to this invention.
In this invention, we utilise antisense technology to
demonstrate that down-regulation of GTase leads to
prolonged levels of stress ethylene. Therefore, a
further aspect of this invention is the use of the
aforementioned GTase or any functional homologues
thereto for use in down regulating GTase in a plant of
interest.
Thus, according to a further embodiment of this
invention, there is provided antisense nucleic acid
which includes a transcribable strand of DNA
complementary to at least part of the strand of DNA
that is naturally transcribed in a gene encoding GTase.
This involves the construction of transformation
vectors possessing either the entire or partial coding
sequence of the homologous GTase crene from the species
to be transformed in the reverse orientation, under the
transcriptional control of a constitutive promoter such
as the Cauliflower Mosaic Virus 35S promoter and a
transcription terminator sequence such as the
Agrobacterium tumefaciens nos terminator. Also present
in the vector, it is preferable, but not necessary, to
include a plant selectable marker gene which enables a
plant transformed with the TWI1 gene or a gene
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97101473 _
14
substantially homologous thereto, to be distinguished
from giants not so transformed. Such markers may
include, nor example, neomycin phosphotransferase II or
hygromycin phosphotransferase. Typically these
select,:~ve markers are for antibiotic or herbicide
resistance. Vectors containing these sequences may
either be broad host range binary vectors useful for
Agrobacterium-mediated transformation such as those
derived from pBinl9 [13], or standard E. coli vectors
useful for production of high levels of plasmid for
transformation mediated by particle delivery. In
addition to the tomato GTase antisense construct
described in the examples below, we have also produced
an antisense construct using sequences from the tobacco
GTase gene of FIG. 4.
To achieve over-expression of the GTase, the coding
sequence or portion of the coding sequence of the
tomato TWI1 cDNA, or a coding sequence encoding an
active homologous GTase isolated from any other
organism or a nucleic acid sequence synthetically
produced by means well-known to those skilled in the
art, may be placed under the control of promoters
activated specifically in the tissues of interest,
these being preferably ripening fruit and senescing
leaves or flowers, and followed by a transcription
terminator sequence.
In the present invention, through use of Northern
analyses, we show for the first time that a high
expression of GTase exists in senescence and in ripened
fruits. The implications of this are great, namely
there may be an increased "need" for the GTase in
ethylene-mediated events.
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473 _
,;
On an application point, it is easier to obtain the
over-expression effects in any plant species since a
heteroiogous gene will produce the same effects. For
an antisense approach, the homologous gene is preferred
and may be isolated for any commercially important
plant or crop.
Another aspect oz this invention is the use of a
promoter comprising the 5' upstream region of the TWI1
'_0 GTase gene. The promoter claimed under this invention
or one similar substantially homologous? to that of
FIG 2 isolated from plants other than tomato would
exhibit activation characteristics including rapid
activation following mechanical wounding or pathogen
~.5 attack, including activation by salicylic acid, various
salicylic acid analogues thereof and the functionally-
related compound, DCINA. We show that the wound
induction of the TWI1 gene and the induction by the
chemical elicitors is via two independent pathways.
20 Also, promoters of homologous GTase genes from other
plant species exhibiting similar activation
characteristics in their respective species are also
claimed by way of this inver_tion.
25 Activation of the GTase at the appropriate times using
promoters derived from other sources is also claimed
within the scope of this invention ((e.g. at the onset
of senescence; e.g. Arabidopsis SAG12 promoter [11]) or
at the onset of ripening (e. g. tomato poiygalacturonase
30 promoter [12] ) ) .
The promoters in the present inventicn were isolated
from clones obtained from a commercial genomic library
of tomato by using TWI1 cDNA sequence as a probe.
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
16
Sequencing of such clones identified the GTase coding
sequence, with the 5' upstream region to approximately
kilobases of the GTase transcription start sequence
considered to be the promoter. Promoters of similar or
5 substantially homologous GTase genes to the TWI1 gene
of wounded tomato plants may be isolated from other
genomic plant libraries or by utilising isolation
techniques well-known to those skilled in the art,
including, for example, the use of inverse polymerise
chain reaction.
The promoter from the TWI1 gene is useful as a sequence
capable of regulating the rapid accumulation of
desirable gene products at sites of physical injury to
a plant. Gene products considered desirable for such
control include, but are not limited to: polypeptides
with anti-microbial, antifungal, anti-insect etc
activities, or polypeptides which have an activity
which would protect the plant from further damage, for
example, by altering cell wall synthesis activities.
The promoter would also be useful in driving the
regulated expression of a particular gene product
following application of SA or SA analogues to the
plant. The TWI1 promoter of FIG 2 could similarly be
used to drive the expression of other wound inducible
genes substantially homologous to the TWI1 gene in
plants other than tomatoes, such as in dicotyledonous
and monocotyledonous plants.
It is a further aspect of this invention to provide
transformed host cells comprising recombinant DNA
encoding a plant GTase in operable linkage with
expression signals including promoter and termination
sequences which permit expression of said DNA in the
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
17
host cell. Preferably, DNA is transformed into plant
cells using a disarmed Ti-plasmid vector and carried by
Agrobacterium in procedures known in the art, for
example as described in EP-A-0116718 and ~P-A0270822.
Alternatively, the foreign DNA could be introduced
directly into plant cells using electrical discharge
apparatus. This method is preferred where
Agrobacterium is ineffective, for example, where the
recipient plant is monocotyledonous. Any other method
that provides for the stable incorporation of the DNA
within the nuclear DNA of any plant cell cf any species
would be suitable. This includes species of plants
which are not currently capable of genetic
transformation.
i5
Another aspect of the present invention includes the
production of transgenic plants (or parts of them, such
as propagating material) containing DNA in accordance
with the invention as described above. The constructs
would include a promoter and coding sequence from, for
example, ~he tomato TWI1 gene, or another promoter and
coding sequence of plant GTase exhibiting an analogous
activation pattern for the purpose of regulated
expression of desirable gene products at sites of
attack or following elicitor application. Further,
transgenic plants containing the TWI1 coding secruence,
other sequence encoding a homologous plant GTa~e, or
fragments thereof, in sense or antisense orientation,
under the control of constitutive, developmental or
tissue-specific promoters for the purpose of altering
the natural levels of GTase activity are also within
the scope of this invention.
CA 02255830 1998-11-19
WO 97145546 PCT/GB97/01473
18
Transgene constructs are produced preferably using
available promoters and terminator sequences from
standard E. col.i cloning vectors in combination with a
GTase coding sequence (such as FIGS. 1, 2, 3 or 4).
Constructs can either then be cloned into other E. coli
vectors containing plant selectable marker genes,
either to be used directly for particle bombardment
transformation, or for Agrobacterium-mediated
transformation when a binary vector will be used.
One of the objects of this invention is activation of
specific enzyme activity, namely GTase. The activation
of GTase by transfer of sequences encoding GTase to
other species will not necessarily be species-
dependent. For down-regulation strategies however, it
would be a preferred method to use the homologous gene
from the target species to enable an efficient
antisense effect.
It is another aspect of the invention to provide a
method for improving the resistance of plants to a very
broad spectrum of pests and pathogens by regulating the
levels of key signalling intermediates and thus
increasing the natural defence responses of plants to
any challenge. In particular, this invention will
benefit crops growing in the field and benefit post-
harvest care and protection of plant products. For
instance, increased basal levels of an unconjugated
intermediate in GTase antisense plants could induce a
"resistant state". In ethylene-mediated senescence,
this invention seeks to improve the shelf-life/vase-
life of products, whether fruit, vegetables, cut
flowers, leaves, pot plants etc. This invention also
teaches a method of controlling the senescent process,
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
19
i.e. inducing ripening at a particular time in response
to a spray or chanced condition.
The following non-limiting examples are provided as an
illustration of the usefulness of the above-described
invention, wherein reference is made to the following
figures:
FIG. 1 The cDNA sequence for the GTase encoded by
the TWI1 gene, isolated from tomato.
.0 FIG. 2 The 5'upstream region for the TWI1 gene
up to the start codon and including the promoter
region.
FIG. 3 Amino acid (glucosyl transferase protein)
sequence of the TWI1 gene.
_.~ FIG. 4 Nucleic acid sequence for a homologous
GTase enzyme isolated from tobacco.
FIG. 5 Nucleic acid sequence for a homologous
GTase enzyme isolated from rice.
FIG. 6 Reference gel demonstrating TWI1
20 expression during stages of tomato fruit development.
RNA extracted from tomato fruits at different
developmental stages and subjected to Northern Blotting
and probed with TWI1 cDNA are shown. Lane 1: immature
green fruit; Lane 2: mature green fruit; Lane 3:
25 breaker stage; Lane 4: pink-ripe; and Lane : red-ripe
fruit.
FIG. 7 Reference gel showing the expression of
the proteinase inhibitor (pin)2 gene and ethylene-
forming enzyme (ACO) in transgenic tomato lines
30 expressing a TWI1 antisense gene prevents wound-induced
pin gene expression and prolongs ACO expression.
FIG. 8 Reference gel electrophoresis
demonstrating the accumulation of TWI1 mRNA (GTase)
during wounding and elicitor treatment in tomato
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473 -
plants. Each lane of gel is described in full in
Example 2.
FIG. 9 Reference gel demonstrating a time-course
of TWI1 mRNA accumulation by wounding and salicylic
5 acid (2 mM) treatment in tomato. Each lane is
described in full in Example 3.
FIG. 10 Reference gel showing that wound-induced
TWIT expression is SA-independent.
FIG. 11 Reference gel demonstrating local and
10 long range expression of TWI1 on wounding tomato plant
leaves.
FIG. 12 Reference gel illustrating the effect of
anti-sense suppression of ACO expression on wound
induced pin-2 expression by comparing the levels of
15 transcript accumulation in wounded transformed and
wild-type 21 day old tomato plants.
FIG. 13 Reference gel demonstrating wound-induced
pin gene expression can be inhibited by norbornadiene.
FIG. 14 Reference gel demonstrating that aspirin
20 inhibits wound induced pint gene expression. Details
of each lane are given in Example 6.
FIG. 15 Reference gels demonstrating TWI1 mRNA
accumulation in cotyledons of tomato plants injected
with either intercellular fluid containing the Avr9
avirulence protein from Cladosporium fulvum (IF9) or
water. Tomato plants carrying the Cf9 resistance gene
(Cf9) or without the resistance gene (Cf0) were used.
FIG. 16 Tobacco TWI1 expression and salicylate
accumulation in response to TMV infection in tobacco NN
plants. The reference gels show the accumulation of
the tobacco TWI1 homologue mRNA in TMV-infected wild-
type tobacco plants, but no accumulation in mock
(water) inoculated plants, nor in plants transgenic for
nahG salicylate hydroxylase gene. The time course
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97101473 -
21
indicates time after transfer of plants from 30°C to
24°C at which point the resistance response is
initiated.
FIG. 17 Histograms indicating the levels of the
free and conjugated salicylate present i:. leaves of the
same plants at the time-points (hours) indicated on the
x-axis. Significant SA accumulation only occurs in
wild-type NN tobacco, but not NN+ NahG tobacco.
FIG. 18 Photographs showing the effects on
tobacco leaves of injection of harpin (HrpN) protein
into leaves of plants which are wild-type (WT) or
transgenic for over-expression of the tobacco TWI1
homologue (OVER) or antisensed for the GTase (ANTI).
FIG. 19 Reference gel showing tobacco acidic
chitinase (PR3A) accumulation in water- or harpin-
treated tobacco leaves at either 1, 2 or 3 days after
injections, and in healthy (H) leaves. The plants are
either wild-type (WT) or transgenic for over-expression
(OVER) or antisensed (ANTI) of the tobacco GTase gene.
EXAMPLE 1
The TWI1 (tomato wound-inducible) gene was first
identified and analyzed as a partial cDNA from a
differential screen of a tomato-wounded-leaf cDNA
library.
Using the partial cDNA as a probe in Northern
analyses TWI1 mRNA was confirmed as wound-inducible,
with transcripts detectable by 15 minutes after injury
to the leaves. Expression of the gene corresponding to
TWI1 was also found to be developmentally-regulated.
Whilst not expressed in unwounded leaves of a young
tomato plant, TWI1 mRNA became abundant in older yellow
leaves and was also found at high levels v_n red-ripe
tomato fruit (FIG 6). The pattern of induction of TWI1
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473 _
22
by elicitors of other wound responsive genes was also
analyzed. The TWI1 was observed to be induced by plant
cell wail Fragments and salicylic acid, suggesting at
the time ~:P J 0'Donnell, 1995, Doctoral Thesis from
Leeds University) TWI1 belonged to the family of
defence-related proteins, know as the pathogenesis-
related (PR) proteins, all of which are induced by
salicylic acid and some of which are also induced by
mechanical injury.
When a full-length cDNA of TWI1 was obtained and
sequenced, homology was found to a large family of
previously identified sequences encoding glucosyl
transferases. The closest homology to existing
sequences was observed to be that of Mesculenta Crantz
cDNAs, mecgtl, encoding a UDP-glucose glucosyl
transferase (54.3%) and mecgt5 encoding a UTP-glucose
glucosyl transferase (52.2%). These have been
identified as transferases involved in glucosylation of
secondary metabolites. High homology was also found to
a glucosyl transferase of Zea mat's, involved in the
glucosylation of IAA (S2.So) and to a ripening-related
glucosyl transferase of tomato (ERT1B) known to
glucosylate secondary metabolites.
The standard approach to identifying function is to use
an antisense strategy, in which a transgene is
constructed which expresses the gene of interest in
antisense orientation, thereby leading to
constitutively negligible levels of the gene product.
The phenotype of the plants can then be analyzed to
determine the effects of knocking out the expression of
the gene. Using this antisense techno,.~ogy, tomato
plants were transformed with TWI1 coding sequence in
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473 _
23
antisense orientation whose expression was
constitutively driven by a Cauliflower Mosaic Virus
(35S) promoter. A 480bp fragment from the 5' end of
the TWI1 cDNA clone was produced by Polymerase Chain
Reaction using the following primers:
5' primer - TCTTTCCTCTAGAATGCAAGGTC
incorporating a Xbal restriction site
3' primer - GTTCAGGTACCGATGACACATTC
incorporating a Kpnl restriction site
When digested with Xbal and kpnl, a 461 by fragment was
produced. This was sub-cloned into Xbal/Kpnl digested
site of the binary vector pJRlRi, giving a construct
with the TWI1 fragment in the antisense orientation.
After transformation into E.coli, the plasmid was
transferred into the Agrobacteriurn strain ~BA4404, by
triparental mating. Cultures were then selectively
grown up of Agrobacterium containing the plasmid.This
was then used to transform tomato plants via
AgrobacLerium. Selection of potential transformed
plants was on the basis of resistance to kanamycin.
Regenerated planes were studied by RNA analysis to
investigate the effect of the TWI1 antisense transgene.
It was discovered in three independently transformed
primary transformants that the response to injury had
changed. The standard wound-response gene marker,
proteinase inhibitor was not expressed, whereas the
gene encoding ethylene-forming enzyme (ACO), normally
exr~ressed transiently was not down-regulated and wound
etrvlene levels were maintained at high levels (FIG 7).
The revelation that TWI1 was wound-inducible in no way
implicates the gene product in a regulatory role, quite
CA 02255830 1998-11-19
WO 97145546 PCT/GB97/01473
24
the opposite. This gene is responding to wound-induced
signals. The fact the TWI1 gene shared homology to
those enccding known glucosyl transferases would not
implicate the gene product in a regulatory role, since
many glucosyl transferases merely glucosyiate secondary
metabolites such as ERT1B [14].
EXAMPLE 2
Accumulation of TWI1 mRNA by mechanical wounding and
elicitor treatments was assessed. Results can be seen
in FIG 8. Wounding was carried out by crushing the
terminal leaflets of 21 day old tomato plants
(Lycopersicon esculentum Mil.) cultivar Moneymaker,
with a pair of tweezers. For all elicitor treatments
21 day old plants were excised at the base of the stem
and incubated for 30 minutes in the various treatments,
at the stated concentrations. After 30 minutes in the
elicitor, the plants were transferred into water for
the remainder of the incubation period. For all
treatments, plants were maintained under constant light
at 22°C. Leaf material was harvested at 1 hour after
wounding/treatment in each case, and total RNA was then
extracted. 10 ~cg of total RNA from each sample was
separated by agarose gel electrophoresis in gels
containing 7a formaldehyde, blotted onto Hybond-N
membrane and probed with P32 labelled TWI1 cDNA. In
FIG. 8 the results are demonstrated, with the labels
being: ~~) healthy leaf; 2) wounded leaf; 3) HBO; 4)
jasmonic acid (100 ICM); 5) systemin (100 nM); 6)
salicylic acid (2nM); 7) aspirin (2mM); 8) benzoic acid
(2mM); 9) 3,4 di-OH benzoic acid (2 mM); 10) 2,6 di-OH
benzoic acid (2mM); 11) DCINA (1mM). The filter was
exposed to film for 3 days. Equal loading was
confirmed by re-hybridising the stripped blot with a 32P
labelled ribosomal RNA probe.
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97101473
EXAMPLE 3: Time Course of Expression of TWI1 and
Response to Wounding And Salicylic Acid
FIG. 9 is a Northern analysis comparing the time-course
5 of induction of GTase and PRla (PR= pathogenesis-
related) gene expression following application of SA to
the tomato plants through the transpiration stream.
The increase in steady-state levels of the GTase
transcripts is very rapid when compared to those of
10 PRla, and become detectable within 10-15 minutes of
treatment. To our knowledge, this is the fasted SA-
responsive gene so far identified, since the kinetics
of up-regulation of SAR genes in tobacco and tomato are
all known to be comparable to that of the PRla shown in
15 FIG. 9.
The time-course of TWI1 mRNA accumulation by wounding
and salicylic acid (2mM) treatment is specifically
demonstrated in FIG. 9, including the induction of PR1
20 by SA treatment. 21 day old tomato plants were
wounded, or excised at the base of the stem and
incubated with 2 mM salicylic acid, as described in
Example 2. Leaf material was harvested at each time
point shown, and total RNA extracted. 10 ~.g of total
25 RNA was fractionated through an agarose gel containing
7% formaldehyde, blotted onto Hybond-N membrane and
probed with 'ZP labelled TWI1 cDNA, or PR1 cDNA. Time
shown in FIG. 9 is in hours after wound/SA application.
the filters was exposed to film for 24 hours (TWI1
filters) or 7 days (PR1 filters) .
To assess whether SA might be a wound-induced signal
which induced TWI1 expression, we also wounded leaves
of transgenic tomato plants harbouring the salicylate
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
26
hydroxylase gene (NahG), which presents SA
accumulation. As shown in FIG 10, the response of TWI1
to wounding in NahG tomato plants is not significantly
different from the response in wild-type plants,
indicating that wound induction of this gene is SA-
independent.
EXAMPLE a: (Local and Systemic Wound Induction of TWI1
mRNA)
FIG. 11 compares the timing of wound-induction GTase
expression in the leaf that is damaged and in the
systemically responding undamaged leaf of the plant.
In FIG. 11, mechanical wounding was carried out on the
terminal leaflets the first leaf of 21 day old tomato
plants, as described in Example 2. Leaf material was
harvested from wounded leaf (local) and the unwounded
leaf 2 (systemic) at the stated times, and total RNA
extracted. 10 ~g of total RNA was separated through an
agarose gel containing 7a formaldehyde, blotted onto
Hybond-N membrane and probed with 32P labelled TWI1
cDNA. Time given is hours after mechanical wound. The
hybridised filter was exposed to film for 8 days.
EXAMPLE 5
The effect of antisense suppression of the ethylene -
forming enzyme (ACO) expression on wound induced pin-2
expression was assessed by comparing the levels of
transcrit~t accumulation in wounded transformed and
wild-type plants. 21 day old tomato plants
(lycopersicon esculentum Mill) cultivar Alisa Craig,
expressing an ACO construct in anti-sense orientation
and driven by the 35S CaMV promoter were wounded as
discussed in Example 2, above. Leaf material was
CA 02255830 1998-11-19
WO 97145546 PCT/GB97/01473
27
harvested at the indicated times, total RNA was
extracted and analyzed for pin-2 gene expression by
Northern blot. Control wild type plants were wounded
and leaf material harvested at 8 hours for Northern
analysis.
we also found that the inhibitory effect of NBD
(norbarnadiene, a competitive inhibitor of ethylene on
pint) expression can be overcome by excess exogenous
ethylene, which is consistent with its action as an
inhibitor (FIG. 12). This strongly suggests that
ethylene must be present in wound response. Results
illustrating pint gene expression following these
treatments are shown in FIGS 12 and 13.
EXAMPLE 6
Aspirin inhibition of pin-2 gene expression can be
overcome by jasmonic acid and ethylene, but not by JA
or ethylene alone. Plants were pretreated in water or
ASA (aspirin) for 30 minutes, in gas tight chambers,
before removal of the plants and incubation in the
open. ASA pretreated plants were treated with either
ethylene (100 ppm), JA, JA + 5ppm of ethylene, JA + 10
ppm ethylene, JA + 50 ppm ethylene or JA + 100ppm
ethylene for 30 minutes in gas tight chambers before
transfer to the open. Control plants were treated with
water for the experimental duration. Leaf material was
harvested at 4 hours post-treatment, total RNA
extracted and northern analysis performed using the
pin-2 cDNA (FIG 14).
EXAMPLE 7
The expression of TWI1 in response to gene-for-g'ne
mediated pathogen resistance was assessed using Avr9-
CA 02255830 1998-11-19
WO 97145546 PCT/GB97/01473
2S
containing extracts to elicit a resistance response in
tomato harbouring the Cf9 resistance gene. Elicitor
was injected into cotyledons of Cf9 plants or control
plants with no Cf9 gene (Cf0) and as a further control,
Cf9 cotyledons were injected with water. At various
time-points after injection, RNA was extracted and
subjected to Northern blotting using the TWI1 cDNA as a
probe (FIG 15). Significant induction of TWI1
expression was only detected in Cf9 plants injected
with Avr9 elicitor, demonstrating a pathogen-resistance
response-specific activation of the GTase.
EXAMPLE 8
The expression of the tobacco TWI1 homologue during a
pathogen-resistance response was investigated in
tobacco plants harbouring the N-resistance gene
infected with tobacco mosaic virus (TMV). Wild-type
tobacco, or tobacco transformed with a salicylate
hydroxylase gene (NahG) which cannot accumulate
salicylic acid (SA), were inoculated with TMV or mock-
inoculated with water and grown for 2 days at 30°C to
permit virus spread. The plants were then transferred
to 24°C to initiate the resistance response and RNA, SA
and SA conjugates were extracted at various time-
points. As shown in FIGS 16 and 17, GTase expression
was only induced in wild-type NN tobacco infected with
TMV. No GTase expression was observed in the NahG
transformants which did not significantly accumulate
SA, whereas expression in wild-type plants correlated
with the timing of SA production.
EXAMPLE 9
The tomato TWI1 cDNA sequence can be used as a
heterologous probe to identify the SA GTase from a
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97/01473
29
range of Solanaceous species as shown by Southern
blotting. We have isolated full-length cDNA clones
corresponding to the SA GTase of tobacco using the
tomato TWIT sequence as a probe (FIG 4). These two
genes show around 85o identity in primary sequence.
Additional GTases have been identified in DNA sequence
databases of expressed sequence tags from rice (FIG 5).
EXAMPLE 10 - Production of transQenic plants
Plasmid constructs containing the tobacco TWI1 GTase
homologue in either sense or antisense orientation were
produced using the pJRlRi vector, placing expression of
the sense or antisense genes under the control of the
CaMV 35S promoter and nos polyadenylation signal.
These plasmids were transferred to Agrobacterium
tumefaciens strain LBA4404 by tri-parental matings.
Leaf disks from tobacco Nicotiana tabacum cv (Samsun
NN) were inoculated with the transformed Agrobacterium
strains and transgenic plants regenerated using
standard protocols.
These plants were used in experiments using the
bacterial elicitor, harpin (the HrpN gene product from
Erwinia arnylovora). In wild-type tobacco plants, and
plants expressing an antisense GTase gene, harpin
injection into leaves caused the formation of necrotic
lesions, but such lesions were not observed in plants
over-expressing the GTase (sense construct) (FIG 17).
RNA was extracted from the injected leaves and the
expression of PR genes assessed by Northern blotting
(FIG 18). In wild-type plants, PR3a gene expression
peaked at 1 day post-injection and was present at high
levels throughout the time-course. In antisense
plants, the peak at 1 day was maintained over the whole
CA 02255830 1998-11-19
WO 97/45546 PCT/GB97101473
time course, whereas in over-expressing plants, PR3a
expression was significantly suppressed.
These data suggest that a key signal which controls
5 lesion formation and PR gene expression is affected by
GTase expression levels.
CA 02255830 1998-11-19
WO 97145546 PCTIGB97/01473
31
1. Doherty, HM, Selvendran, RR, Bowler, DJ (1988)
Physiol. :'~lol. Plant Pathoi. 33; 377-384.
2. Doherty, HM, Bowler, DJ (1990) Plant Cell Environ.
13, 851-855.
3. Pena-Cortes, H, Albrecht, T, Prat, S, Weiler, EW,
Willmitzer, L (1993) Planta 191; i23-128.
4. Doares, SH, Narvaez-Vasquez, J, Conconi, A, Ryan, CA
(1995) Plant Physiol. 108; 1741-1746.
5. Szerszen, JB, Szczyglowski, K, Bandurski, RS (1994)
Science 265; 1699-1701.
6. Yalpani, N, Schulz, M, Davis, MP, Balke, NE (1992)
Plant Physiol. 100; 457-463.
7. Ecker, JR, Davis, RW (1995) Science 268:667-675.
8. Ward, ER, Uknes, SJ, Williams, SC, Dincher, SS,
Wiederhold, DL, Alexander, DC, Ahl-Goy, P, Metraux, J-
P, Ryals, JA (1991) Plant Cell 3; 1085-1094.
9. Abeles, FB, Morgan, PW, Saltveit, ME Jr. "Ethylene
in plant biology," Academic Press.
10. Wei, Z.M., Laby, R.J., Zumoff, C.H., Bauer, D.W.,
He, S.Y., Collmer,A., Beer, S.V. (1992) Science 257:
85-88.
11. Gan, S, Amasino, RM (1995) Science 270; 1986-1988.
12. Nicholass, FJ, Smith, CJS, Schuch, W, Bird CR,
Grierson,D (1995) Plant Mol. Biol. 28; 423-435.
i3. Bevan, M (1984) Nucleic Acids Res. 12; 8711.
14. Picton, S, Gray, J, Barton, S, Abu Bakar, U, Lowe,
A, Grierson, D (1993) Plant Mol. Biol. 23; 193-207.
CA 02255830 1999-OS-26
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: THE UNIVERSITY OF YORK
(C) CITY: Heslington, York
(E) COUNTRY: Great Britain
(F) POSTAL CODE: Y01 5DD
(ii) TITLE OF INVENTION: USE OF NOVEL GLUCOSYL TRANSFERASE
(iii) NUMBER OF SEQUENCES: 7
(iv) CORRESPONDENCE ADDRESS:
John H. Woodley
Sim & McBurney
330 University Avenue, 6t'' Floor
Toronto, Canada M5G 1R7
(v) COMPUTER READABLE FORM:
(A) COMPUTER: IBM PC compatible
(B) OPERATING SYSTEM: PC-DOS/MS-DOS
(C) SOFTWARE: PatentIn Release #1.0, Version #125 (EPO)
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,255,830
(B) FILING DATE: May 30, 1997
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: GB 9611420.2
(B) FILING DATE: May 31, 1996
(viii)PATENT AGENT INFORMATION:
(A) NAME: John H. Woodley
(B) REFERENCE NUMBER: JHW 6841-24
(2) INFORMATION FOR SEQ. ID. NO. 1
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1624 nucleotides
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 1:
tcattttttc ttctttcccg atgatgctca aggtcatatg atacctacac ttgacatggc 60
gaacgttgtc gcttgtcgtg gtgttaaagc cactataatc acaacacctc tcaatgaatc 120
tgttttctct aaagctattg agagaaacaa gcatttaggt attgaaattg atattcgttt 180
actaaaattc ccagctaagg agaatgattt gcctgaagat tgtgagcgtc ttgatcttgt 240
CA 02255830 1999-OS-26
accttctgat gacaaactcc caaacttctt aaaagctgcg gctatgatga aagatgaatt 300
tgaggagctt attggagaat gtcgccctga ttgtcttgtt tctgatatgt tccttccatg 360
gactactgat agtgcagcca aatttagcat accaagaatt gtattccatg gaactagtta 420
ctttgccctt tgtgttggcg atacgatcag gcgtaataag cctttcaaga atgtgtcatc 480
ggatactgaa acttttgttg taccggattt gccacatgaa attaggctaa ctagaacaca 540
gttgtctccg tttgagcaat cggatgaaga gacgggtatg gctcccatga ttaaagctgt 600
gagggaatcg gatgcgaaga gctatggagt tatattcaat agcttttatg agcttgaatc 660
agattatgtt gaacattaca ctaaggttgt aggtagaaaa aattgggcta ttggtccgct 720
ttcgctgtgc aatagggata ttgaagataa agcggaaaga gggaggaaat catctatcga 780
tgaacacgcg tgcttgaaat ggcttgattc gaagaaatca agttccattg tttatgtttg 840
ttttggaagt acagcagatt tcactacagc acagatgcaa gaacttgcta tggggctaga 900
agcctctgga caagatttca tttgggttat cagaacaggg aatgaagatt ggctcccaga 960
aggattcgag gaaagaacaa aagaaaaagg tttaatcata agaggatggg caccccaaag 1020
tgtgattctt gatcacgaag ctattggagc ttttgttact cattgtggat ggaactcgac 1080
actggaagga atatcagcag gggtaccaat ggtgacatgg ccagtatttg cggaacagtt 1140
tttcaatgag aagttggtga ctgaggtaat gagaagtgga gctggtgttg gttctaagca 1200
atggaagaga acagctagtg aaggagtgaa aagagaagca atagcaaagg cgataaagag 1260
agtaatggcg agtgaagaaa cagagggatt cagaagcaga gcaaaagagt acaaagaaat 1320
ggcaagagaa gctattgaag aaggaggatc atcttacaat ggatgggcta ctttgataca 1380
agacataact tcatatcgtt aactagttga tgcaaaaaaa gaaaaaacat gtgtgtttct 1440
atattctgtc ttctgttttg ctgatttgat catattacgt acttcttcat gataattaat 1500
gacatcaata gaatccaaga tcaatcatct cgaaattcaa cgttaaaata tttcgacatt 1560
tgaataatac atcgacttaa aatggaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620
aaaa 1624
(2) INFORMATION FOR SEQ. ID. NO. 2
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1040 nucleotides
(B) TYPE: nucleic acid
CA 02255830 1999-OS-26
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. N0: 2:
aagcttacaa gatagtgtca tgtaggccga aaaagataga aaattattaa taaattaaat 60
ttaagaggta atataacctt attataatat aaatgtgtat ctaaaatttc tgacataaat 120
ctagggaata gttatacatt attctttatt attattattg agtcgtcaaa aaatattatt 180
agaatttatg agctaataca tatttaattt tataatgtaa atatattttt ttaaaaattt 240
accgacttca atagaacccc acgaacctta tctatatccg cctcgtgacc accaccttct 300
caagtattcc gccaaaatca aatggcaatt accggttcct actgcaataa tttagcagct 360
aatgaacaaa atgcatcttg tcatcttcta gatgatttgt acttctttct gcttaataat 420
aatcgttgac cgttgattta acataaaaag acaaatgact cgaaataatg attaaaaata 480
ataaatgata aaggtactat aatactgtac taactagcat ttgtattttc gtctttgagc 540
aaagcactgt cgttaaatta acttaaataa taaaagaaaa gtttgtgttt caattgacct 600
gtgaggggag ggcatatgtc acctgtaaag ttacatctgc caagaaattc catacgctgg 660
tccccgctat tgccggtttc cttcattgac aaggccagtt atttttgaga ttgaatttat 720
ttcacctccg attattagat atttattaaa atcgatatat gtttagtcat gattttatat 780
ataaaatagt tatgatcacg aaatatttcg atcttaaact aataaaacct tgatgagttg 840
tttagggttt gtctgttaaa tcaaccacgt gagtgcttac gtgacttctt tacgtccaac 900
ttgaaataac aagttaatct cttatgcaac ttcaacgaaa gtcttcaaac aattcgacgt 960
atatataacg tgacactaat gcaattacaa ctcaaaaagt atttactcct ctttgtttca 1020
ttcaagcatt tccacaaatg 1040
(2) INFORMATION FOR SEQ. ID. N0. 3
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 470 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 3:
Met Gly Glu Leu His Phe Phe Phe Phe Pro Asp Asp Ala Gln Gly His
CA 02255830 1999-OS-26
1 5 10 15
Met Ile Pro Thr Leu Asp Met Ala Asn Val Val Ala Cys Arg Gly Val
20 25 30
Lys Ala Thr Ile Ile Thr Thr Pro Leu Asn Glu Ser Val Phe Ser Lys
35 40 45
Ala Ile Glu Arg Asn Lys His Leu Gly Ile Glu Ile Asp Ile Arg Leu
50 55 60
Leu Lys Phe Pro Ala Lys Glu Asn Asp Leu Pro Glu Asp Cys Glu Arg
65 70 75 80
Leu Asp Leu Val Pro Ser Asp Asp Lys Leu Pro Asn Phe Leu Lys Ala
85 90 95
Ala Ala Met Met Lys Asp Glu Phe Glu Glu Leu Ile Gly Glu Cys Arg
100 105 110
Pro Asp Cys Leu Val Ser Asp Met Phe Leu Pro Trp Thr Thr Asp Ser
115 120 125
Ala Ala Lys Phe Ser Ile Pro Arg Ile Val Phe His Gly Thr Ser Tyr
130 135 140
Phe Ala Leu Cys Val Gly Asp Thr Ile Arg Arg Asn Lys Pro Phe Lys
145 150 155 160
CA 02255830 1999-OS-26
Asn Val Ser Ser Asp Thr Glu Thr Phe Val Val Pro Asp Leu Pro His
165 170 175
Glu Ile Arg Leu Thr Arg Thr Gln Leu Ser Pro Phe Glu Gln Ser Asp
180 185 190
Glu Glu Thr Gly Met Ala Pro Met Ile Lys Ala Val Arg Glu Ser Asp
195 200 205
Ala Lys Ser Tyr Gly Val Ile Phe Asn Ser Phe Tyr Glu Leu Glu Ser
210 215 220
Asp Tyr Val Glu His Tyr Thr Lys Val Val Gly Arg Lys Asn Trp Ala
225 230 235 240
Ile Gly Pro Leu Ser Leu Cys Asn Arg Asp Ile Glu Asp Lys Ala Glu
245 250 255
Arg Gly Arg Lys Ser Ser Ile Asp Glu His Ala Cys Leu Lys Trp Leu
260 265 270
Asp Ser Lys Lys Ser Ser Ser Ile Val Tyr Val Cys Phe Gly Ser Thr
275 280 285
Ala Asp Phe Thr Thr Ala Gln Met Gln Glu Leu Ala Met Gly Leu Glu
290 295 300
CA 02255830 1999-OS-26
Ala Ser Gly Gln Asp Phe Ile Trp Val Ile Arg Thr Gly Asn Glu Asp
305 310 315 320
Trp Leu Pro Glu Gly Phe Glu Glu Arg Thr Lys Glu Lys Gly Leu Ile
325 330 335
Ile Arg Gly Trp Ala Pro Gln Ser Val Ile Leu Asp His Glu Ala Ile
340 345 350
Gly Ala Phe Val Thr His Cys Gly Trp Asn Ser Thr Leu Glu Gly Ile
355 360 365
Ser Ala Gly Val Pro Met Val Thr Trp Pro Val Phe Ala Glu Gln Phe
370 375 380
Phe Asn Glu Lys Leu Val Thr Glu Val Met Arg Ser Gly Ala Gly Val
385 390 395 400
Gly Ser Lys Gln Trp Lys Arg Thr Ala Ser Glu Gly Val Lys Arg Glu
405 410 415
Ala Ile Ala Lys Ala Ile Lys Arg Val Met Ala Ser Glu Glu Thr Glu
420 425 430
Gly Phe Arg Ser Arg Ala Lys Glu Tyr Lys Glu Met Ala Arg Glu Ala
435 440 445
Ile Glu Glu Gly Gly Ser Ser Tyr Asn Gly Trp Ala Thr Leu Ile Gln
~
CA 02255830 1999-OS-26
450 455 460
Asp Ile Thr Ser Tyr Arg
465 470
(2) INFORMATION FOR SEQ. ID. NO. 4
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 644 nucleic acids
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. N0: 4:
aagaactgaa aacaaccaca cgtctttact tttctttctg ctttctgata ctaaactaca 60
tttttctttc tttcattcaa acattttcac aaatgggtca gctccatttt ttcttctttc 120
ctgtgatggc tcatggccac atgattccta cgctagacat ggccaagctc gttgcttcac 180
gtggagttaa ggccactata atcacaaccc cactcaatga atccgttttc tccaaatcta 240
ttcaaagaaa caagcatttg ggtatcgaaa tcgaaatccg tttgatcaaa ttcccagctg 300
ttgaaaatgg cttacctgaa gaatgcgagc gcctcgatct catcccttca gatgataagc 360
tcccaaactt cttcaaagct gtagctatga tgcaagaacc actagaacag cttattgaag 420
aatgtcgacc caattgtctt gtttctgata tgttccttcc ttggactact gatactgcag 480
ccaaatttaa catgccaaga atagtttttc atggcacaag cttgtttgct ctttgtgtcg 540
agaatagcat caggctaaat aagcctttca agaatgtctc ctctgattct gaaacttttg 600
ttgtaccgaa tgtgcctcac gaaataaatg accagaccca gttg 644
(2) INFORMATION FOR SEQ. ID. NO. 5
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 354 nucleic acids
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
CA 02255830 1999-OS-26
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 5:
ctttcccggc cgccgaggcg cntnanccgg aggggtgcga gagggtggac cacgtcccct 60
cgccggacat ggtgccgagc ttcttcgacg ccgccatgca gttcggcgac gcagtggcgc 120
anactncngg cgcctcacgg ggccgcgccg gctgagctgc ctcatcgccg ggatatctca 180
cacgtgggcg cacgtcctgg cgcgcnactc ggcgctccgt gcttcatctt ccacggtttc 240
tgcgcgttct ccctgctctg ctgcnagtac ctgcacgcgc acaggccgca cgaggcggtc 300
tcctcgccgg acgagctctt tgacgtccct gtcctgccgn ctttcgagtt cagg 354
(2) INFORMATION FOR SEQ. ID. N0. 6
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 nucleic acids
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 6:
tctttcctct agaatgcaag gtc 23
(2) INFORMATION FOR SEQ. ID. NO. 7
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 nucleic acids
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 7:
gttcaggtac cgatgacaca ttc 23
