Note: Descriptions are shown in the official language in which they were submitted.
CA 02263149 1999-02-ll
W O 98/07426 PCT~US97/14830
DIAGNOSIS OF MIGRAINE WITH AURA, DEPRESSION
AND ANXIETY FROM ALLELIC VARIATIONS
IN DOPAMINERGIC GENES
CROSS ~F~R~C~ TO ~T~TED APPLICATIONS
This application derives priority from 60/024,399,
filed August 22, 1996 and 60/036,091, filed January 17,
1997, which are incorporated by reference in their
entirety for all purposes.
T~CH~IC~T, FI~Tln
The present invention relates generally to the
diagnosis and treatment of a syndrome characterized by
symptoms of migraine with aura, depression and/or
anxiety.
RACKGROUND
Migraine headaches are a type of vascular headaches.
Migraine headaches are characterized in part as recurrent
attacks of headaches, with or without associated visual
and gastrointestinal disturbances. Symptoms of migraine
headaches usually follow a pattern in each patient.
Attacks may be daily or only once in several months.
Untreated attacks may last for hours or even days.
Nausea, vomiting, photophobia and sonophobia are common.
The extremities can become cold and cyanosed, and the
patient can become irritable and seek seclusion. In the
United States alone, approximately 18 million females and
5.7 million males have been estimated to suffer from
severe migraine annually. Migraines are believed to be a
leading cause of lost time from the workplace.
A classification of migraines based on patient
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-2-
symptoms has been proposed by the Committee on the
Classification of Headache of the International Headache
Society, Cephalalgia 8:1-96 (1988). The committee
proposes that migraines be classified a migraine without
aura (formerly known as common migraine), migraine with
aura (formerly known as classic migraine) and hemiplegic
migraine (formerly known as complicated migraine).
Migraine with aura and migraine without aura are the two
most frequent forms of migraine.
A locus for familial hemiplegic migraine has been
reported to occur on chromosome 19, Joutel et al., Nature
Genetics 5, 40-45 (1993); Joutel et al., Am. J. Hum.
Genet. 55, 1166-1172 (1994).; Ophoff et al. Genomics 22,
21-26 (1994); Elliott et al., Ann. Neurol. 39, 100-106
(1996)). However, the genetic bases and corresponding
biochemical mechanisms underlying other forms of migraine
disease, such as migraine with aura and migraine without
aura, have not been reported and it is unknown whether
the different types of migraine are different in kind or
only in degree.
At present no specific genetic or biochemical tests
are available for the positive diagnosis of migraine with
or without aura. Diagnosis and treatment is presently
based solely on patient self-reporting and symptom
description. Although a wide variety of agents, such as
anti-inflammatory drugs, ergots, 5-HTIreceptor agonists
and antiemetics, have been reported to have some benefit
for treatment of migraine, their use is complicated by
the clinical heterogeneity associated with migraine, side
effects of drugs, and the limitations of patient
reporting (Caviness et al., N. Engl. J. Med. 302, 446-450
(1980); Wilkinson, Cephalalgia 3, 61-67 (1983);
Peatfield, Hand~ook of Clinical Neurology ( ed Rosem Raven
Press, New York, 1986) pp. 173-216; Welch, N.E.~.M. 329,
1476-1483 (1993); Peroutka, The Pharmacological Basis of
Therapeutics (eds. Hardman et al., McGraw-Hill, New York,
1996) pp. 487-502. For example, there have been several
reports that antiemetics such as domperidone,
prochlorperzine, and metoclopramide have beneficial
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-3-
effects in some migraine patients. However, because the
subtype of migraine patient in which such drugs may be
effective is not known and because possible side effects
of these drugs mitigate against administration without a
clear expectation of benefit, these drugs have not been
widely administered and have not been approved by the FDA
for treatment of migraine. Thus, it has been concluded
that, at present, migraine is neither efficiently
diagnosed nor managed (Cephalalgia 8, 96 (1988)).
Similarities exist between the epidemiological
characteristics of migraine, anxiety and depression
(Robins et al., Arch. Gen. Psychiatry 41:949-958(1984);
Stewart et al., ~AMA 267:64-69 (1992); Rasmussen & Eisen,
J Clin Psychiatry 55:5-14 (1994); Kessler et al., Arch.
Gen. Psych. 51:8-l9 (1994), Marazziti et al., Biol.
Psychiatr. 31:125-129 (1995). All three disorders
afflict approximately 10 to 25% of the general population
at some point in life and are approximately twice as
common in females than males. Prophylactic medications
for all three disorders have a subacute onset of action,
requiring 3 to 6 weeks of therapy to measure clinical
improvement.
Identification of inheritance pattern(s) and genetic
bases for migraine, depression and anxiety would greatly
facilitate the diagnosis and treatment of these diseases.
The present invention fulfills this and other needs.
SUMMARY OF THE INVENTION
In one aspect, the invention is directed to methods
of diagnosing a patient for susceptibility to a syndrome
characterized by symptoms of migraine with aura,
depression and/or anxiety. The methods entail detecting
a variant allele of one or more dopaminergic genes in the
patient. Dopaminergic genes correlated with the syndrome
include DRDl, DRD2, DRD3 and DAT. For example, the
presence of homozygous A1 alleles of the DRD2 NcoI A1
gene indicates increased susceptibility to the syndrome
relative to the presence of heterozygous A1/A2 alleles,
and the presence of heterozygous A1/A2 alleles indicates
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-4-
increased susceptibility relative to the presence of
homozygous A2/A2 alleles. In some methods, variant
alleles are detected in two or more of the DRDl, DRD2,
DRD3 and DAT, and risk factors associated with the
presence of each variant allele detected are combined to
indicate susceptibility to the syndrome.
The invention further provides methods of
treating a patient suffering from the syndrome described
above. The patient is administered a therapeutically
effective amount of an agent that antagonizes binding of
dopamine to DRDl, DRD2, DRD3 and/or DAT. Some such
agents lack specific binding to DRD4 and/or DRD5.
Exemplary agents are shown in Table l. Some agents are
incapable of permeating the blood-brain barrier. Agents
can be administered intravenously, orally or
intramuscularly. Agents can be administered
therapeutically or prophylactically. Patients amenable
to treatment with such methods include those suffering
from migraine with aura and having homozygous DRD2 NcoI
Al alleles.
In another aspect, the invention provides methods of
screening for a drug effective to treat the syndrome
described above. Such drugs are screened by determining
their capacity to antagonize binding of dopamine to a
dopaminergic receptor or DAT. Optionally, such drugs can
be screened for lack of specific binding to DRD4 and/or
DRD5.
In another aspect, the invention provides for the
use of an agent that antagonizes binding of dopamine to
DRDl, DRD2, DRD3 and/or DAT for the manufacture of a
medicament for use in the treatment of a syndrome
characterized by symptoms of migraine with aura,
depression and/or anxiety in patients having a variant
allele of one or more dopaminergic genes. Such
dopaminergic genes include DRDl, DRD2, DRD3 and DAT.
Some suitable agents are listed in Table l. For some
agents, the blood-brain barrier is impermeable to passage
of the agent. Some agents antagonize DRDl, DRD2, DRD3
and/or DAT without binding to DRD4 or DRD5. In some
. .
CA 02263149 1999-02-11
W 098/07426 PCTAUS97/14830 -5-
uses, the variant allele is DRD2 NcoI Al. The presence
of homozygous Al alleles indicates increased
susceptibility to the syndrome relative to the presence
of heterozygous Al/A2 alleles, and the presence of~ 5 heterozygous Al/A2 alleles indicates increased
susceptibility relative to the presence of homozygous
A2/A2 alleles. Thus, a patient having homozygous DRD2
NcoI Al alleles has a relatively high susceptibility to
the syndrome. In some patients, the syndrome is
manifested by symptoms of migraine with aura. In some of
the uses, the medicament is administered intravenously,
orally or intramuscularly. In some uses noted above, the
medicament is administered prophylactically.
In another aspect, the invention provides methods
for determining the suitability of a patient suffering
from a syndrome characterized by symptoms of migraine
with aura, depression and/or anxiety for treatment with
an agent that antagonizes binding of dopamine to DRDl,
DRD2, DRD3 and/or DAT. The methods entail detecting a
variant allele of one or more dopaminergic genes in the
patient. Some exemplary agents are listed in Table l.
For some agents, the blood-brain barrier is impermeable
to passage of the agent. Some agents antagonize DRDl,
DRD2, DRD3 and/or DAT without binding to DRD4 or DRD5.
Such dopaminergic genes include DRDl, DRD2, DRD3 and DAT.
In some methods, the variant allele is DRD2 NcoI Al and
the presence of homozygous Al alleles indicates increased
suitability relative to the presence of heterozygous
Al/A2 alleles, and the presence of heterozygous Al/A2
alleles indicates increased susceptibility relative to
the presence of homozygous Al/A2 alleles. Thus, a
patient having homozygous DRD2 NcoI Al alleles has a
relatively high susceptibility to the syndrome. In some
patients, the syndrome is manifested by symptoms of
migraine with aura. In some methods, the agent is
administered intravenously, orally or intramuscularly.
The invention further provides for use of an agent
that antagonizes binding of dopamine to DRDl, DRD2, DRD3
and/or DAT for the manufacture of a medicament for
CA 02263149 1999-02-ll
W O 98/07426 PCTrUS97/14830
-6-
therapy. In such uses, a patient is diagnosed for
susceptibility to a syndrome characterized by symptoms of
migraine with aura, depression and/or anxiety by a method
comprising the step of detecting a variant allele of one
or more dopaminergic genes in the patient. Often, the one
or more dopaminergic genes for which a variant allele is
detected are selected from DRDl, DRD2, DRD3 and/or DAT.
In some such uses, the variant allele is DRD2 NcoI Al and
the presence of homozygous Al alleles indicates increased
susceptibility to the syndrome relative to the presence
of heterozygous Al/A2 alleles, and the presence of
heterozygous Al/A2 alleles indicates increased
susceptibility relative to the presence of homozygous
A2/A2 alleles. Thus, a patient having homozygous DRD2
NcoI Al alleles has a relatively high susceptibility to
the syndrome. In some patients, the syndrome is
manifested by symptoms of migraine with aura. After
diagnosis of the patient, if appropriate, a
therapeutically effective amount of an agent that
antagonizes binding of dopamine to DRDl, DRD2, DRD3
and/or DAT is then administered to the patient. Some
exemplary agents are listed in Table l. For some agents,
the blood-brain barrier is impermeable to passage of the
agent. Some agents antagonize DRDl, DRD2, DRD3 and/or
DAT without binding to DRD4 or DRD5 In some of the
above uses, the agent is administered intravenously,
orally or intramuscularly. In some uses, the agent is
administered prophylactically.
The invention further provides diagnostic agents
(e.g., allele-specific probes and primers), for detecting
a variant allele of one or more dopaminergic genes for
use in therapy, prophylaxis or diagnosis. Such dopamine-
rgic genes can be selected from DRDI, DRD2, DRD3 and DAT.
For example, some diagnostic reagents are used to detect
the NcoI Al allele of DRD2.
The invention further provides agents, such as any
of those described above, for use in therapy, prophylaxis
or diagnosis of a syndrome characterized by symptoms of
migraine with aura, depression and/or anxiety. The
CA 02263149 1999-02-ll
W O 98/07426 PCTAUS97/14830
-7-
invention further provides for use of such agent in the
therapy, prophylaxis or diagnosis of migraine with aura.
The invention further provides for the use of an
agent for detecting a variant allele of one or more
dopaminergic genes for the manufacture of a diagnostic
for use in therapy, prophylaxis or diagnosis. Preferred
dopaminergic genes are selected from DRDl, DRD2, DRD3 and
DAT. For example, a suitable variant allele is DRD2 NcoI
Al. The diagnostic is typically used in the therapy,
prophylaxis or diagnosis of a syndrome characterized by
symptoms of migraine with aura, depression and/or
anxiety. Further, the diagnostic can be used in the
therapy, prophylaxis or diagnosis of migraine with aura.
The invention further provides for the use of an
agent that antagonizes binding of dopamine to DRDl, DRD2,
DRD3 and/or DAT for the manufacture of a medicament for
use in the treatment of a syndrome characterized by
symptoms of migraine with aura, depression and/or anxiety
associated with the presence of a variant allele of one
or more dopaminergic genes. In some such uses, a variant
allele is present in one or more dopaminergic genes
selected from DRDl, DRD2, DRD3 and DAT. In some such
uses, the variant allele is DRD2 NcoI Al and the presence
of homozygous Al alleles indicates increased
susceptibility to the syndrome relative to the presence
of heterozygous Al/A2 alleles, and the presence of
heterozygous Al/A2 alleles indicates increased
susceptibility relative to the presence of homozygous
A2/A2 alleles. Thus, a patient having homozygous DRD2
NcoI Al alleles has a relatively high susceptibility to
the syndrome. In some patients, the syndrome is
manifested by symptoms of migraine with aura. Some
exemplary agents are listed in Table l. For some agents,
the blood-brain barrier is impermeable to passage of the
agent. Some agents antagonize DRDl, DRD2, DRD3 and/or
DAT without binding to DRD4 or DRD5. In some uses, the
agent is administered intravenously, orally or
intramuscularly. In some uses, the agent is administered
prophylactically.
~ .
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-8-
B~T~F D~SCRIPTION OF TH~ DRAWINGS
Figure lA-lD show the percentage of individuals
having migraine with aura for different DRD1, DRD2, DRD3
and DAT alleles.
Figure 2 shows a risk factor analysis of migraine
with aura.
DETAIT~n DF~CRIPTION
T. General
The present invention provides methods of diagnosing
and treating a syndrome (mada) characterized by symptoms
of, or susceptibility to, migraine with aura, depression
and/or anxiety, and resulting, at least in part, from
variation in one or more dopaminergic genes. These
methods are premised in part on the insight that
variations in the dopaminergic genes DRD1, DRD2, DRD3 and
DAT are associated with increased susceptibility to
migraine with aura, depression and/or anxiety.
DRDl, DRD2 and DRD3 are three of five G
proteincoupled receptors (DRD1-DRD5) for which dopamine
appears to be the primary neurotransmitter. O'Dowd et
al., "Dopamine Receptors," in Handbook of Receptors and
Channels (ed. Peroutka, CRC Press, Boca Raton, 1994).
DRDl is encoded by an intronless gene (Dearry et al.,
Nature 347:72-76 (1990); Zhou et al., Nature 347:76-80
(1990); Sunahara et al., Nature 347:80-83 (1990)) and is
expressed most abundantly in the caudate, nucleus
accumbens and olfactory tubercle. DRD1 receptors are
thought to act as pre-synaptic autoreceptors modulating
neurotransmitter release.
The DRD2 gene has a length of about 270 kb,
- including six introns, the first of which accounts for
about 200 kb of the gene. A cDNA sequence of 2500 bp has
been reported, which includes some flanking sequences.
Grandy et al., Proc. Natl. Acad. sci. 86, 9762-9766
(1989). DRD2s are localized in numerous anatomical
locations that are believed to play a major role in the
pathogenesis of migraine. The highest density of DRD2s
CA 02263149 1999-02-11
W098l07426 PCT~S97/14830
g
are in the substantia nigra and basal ganglia. In the
substantia nigra, the DRD2s act as presynaptic
autoreceptors which modulate dopamine release (Mengod et
al., Neurochem. Int. 20, 33S-43S (1992)). In addition,
dopamine receptors have been located directly in vascular
beds (e.g., on cerebral arteries) that are believed to be
critical in the pathogenesis of migraine. For example,
dopamine receptors have been localized to pial vessels
(Oudart et al., Arch. Int. Pharmacodyn. 252, 196-209
(1981); Edvinsson et al., Br. J. Pharmac. 85, 403-410
(1985)) the site of neurogenic inflammation that is
believed to play a major role in the headache component
of migraine (Moskowitz, Trends Pharmacol. sci. 13,
307-311 (1992)). DRD2s are also located in the
peripheral and/or central sympathetic nervous system.
DRD2s are also located on presynaptic noradrenergic
sympathetic ganglia, where they act to inhibit the
release from the sympathetic nerve terminals (Clark et
al., Acta Endocrine., Suppl. 216 88, 75-81 (1978);
Ziegler et al., Clin. Pharmacol. ~her. 25, 137-142
(1979); Mercuro, Eur. J. Clin. Pharmacol. 27, 671-675
(1985); Montastruc et al. Eur. J. Pharmacol. 166, 511-514
(1989))
The DRD3 gene has a high degree of sequence identity
with the DRD2 gene (O'Dowd et al., Handbook of Receptors
and Channels: G Protein-coupled Receptors (ed Peroutka,
S.J.) 95-123 (CRC Press, Boca Raton, 1994); Sokoloff et
al., Nature 347:146-151 (1990)). Like DRD2, the DRD3
receptor acts as both a postsynaptic receptor and an
autoreceptor which inhibits dopamine release (Tang et
al., J. Pharmacol. Exp. Ther. 270:475-476 (1994)).
Expression of DRD3 has been localized to the limbic areas
of the brain (Mengod et al., Neurochem. Int. 20:33S-43S
(1992); Sokoloff et al., Nature 347:146-151 (1990))
suggesting that it may be associated with cognitive,
emotional and endocrine functions. Most drugs that
interact with DRDZ also interact with similar affinity
with DRD3 (Sokoloff et al., Nature 347:146-151 (1990)).
However, the density of expressed DRD3 receptors is low,
,
CA 02263149 1999-02-11
W 098107426 PCT~US97114830
-10-
estimated at about 1~ of that of DRD2 (Accili et al.,
Proc. Nat. Acad. sci. 93:1945-1949 (1996)).
The dopamine transporter (DAT) gene is a key
regulatory protein in the dopamine pathway that modulates
the amount of dopamine release and re-uptake (Shimada et
al., Science 254:576-577 (1991)).
Variant alleles of the dopaminergic genes DRD1,
DRD2, DRD3 and DAT probably cause increased
susceptibility to migraine with aura, depression and/or
anxiety as a result of increased dopaminergic
transmission. The proposed role of dopaminergic genes in
migraine with aura is consistent with several clinical
features of the disease. For example, nausea and/or
vomiting are common features of migraine in which
dopamine stimulation is likely. Gastrokinetic changes,
hypotension and other autonomic nervous system changes
are additional migraine symptoms that are consistent with
disturbances in dopaminergic neurotransmission. The
proposed mechanism is also consistent with previous
reports of exaggerated autonomic responses to dopamine
agonists in migraine patients. For example, apomorphine
has been reported to induce symptoms of migraine, as well
as the associated phenomenon of nausea, vomiting,
yawning, hypotension and syncope (DelZompo et al.,
Neadache 35, 222-224 (1995)).
TT. Analysis of Polymorphisms in Dopaminergic Genes
The methods of diagnosis and treatment described
below usually require knowledge of the genotype of an
individual with respect to polymorphisms in the genes
DRD1, DRD2, DRD3, andlor DAT. Exemplary polymorphisms
within each of these genes that correlate with migraine
with aura, depression and/or anxiety are described in the
Examples, as are methods for their detection.
Specifically, these polymorphisms include: an A to G
polymorphism in the 5' untranslated region of DRD1 having
alleles designated B1 and B2 as described by Cichon et
al., ~um. Mol. Genet. 3:209-209 (1994); a C to T
CA 02263149 1999-02-11
W O 98/07426 PCTAUS97/14830
- 1 1 -
polymorphism at codon 313 of DRD2 having alleles
designated NcoI A1 and NcoI A2 (Sarker et al ., Genomics
11:8-14 (1991)); an A to G substitution 25 bp downstream
from the start codon in DRD3 having alleles designated A1
and A2 (Rietschel et al ., Psychiatr. Res . 46:253-259
(1993)); and a polymorphic 40 bp repeat in the 3'
untranslated region of DAT having alleles designated 9
and 10 (Vandenbergh et al., Genomics 14:1104-1106
(1992)). It is expected that the DRD2 TaqI A1 allele
(Noble, Science & Medicine 3, 52-61 (1996)), which is
known to be in linkage disequilibrium with DRD2 NcoI Al,
can be used in diagnostic methods in a similar manner to
DRD2 NcoI A1.
Other variant forms of the DRD1, DRD2, DRD3 and DAT
genes that correlate with migraine with aura, anxiety
and/or depression can be identified as follows. The
first step is to identify additional polymorphic sites
within one of these genes. Such polymorphic sites can be
identified either by comparative sequencing of these
genes in a population of individuals or from the
published literature and databases. For example, several
additional polymorphic sites in the DRD2 gene have been
published including TaqlB within intron 2, FokI B at
position 1105, HphI at position 3208, C311S at position
3413, NcoI at position 3420 and TaqIA within the 3'
untranslated region. (Residues in genomic DNA are
assigned the same number as the corresponding nucleotide
in cDNA when the two are maximally aligned, and
nucleotides in the cDNA are numbered according to the
convention of Dal Toso, EMBO J. 8, 4025-4034 (1989)).
Having identified the location of a polymorphism and the
nature of its polymorphic forms, a correlation is
performed between type of polymorphic form and presence
or absence of migraine with aura, depression, and/or
anxiety in a population. Optionally, the correlation can
be determined with respect to combinations of two or more
polymorphisms within the same gene. For example,
individuals having the NcoI A1 allele are subdivided into
two classes respectively having A1 and A2 alleles of the
.. . . .... . . . . .
CA 02263149 1999-02-11
.
WOg8/07426 PCT~S97/14830
-12-
FokI polymorphism. Thus, for example, one can determine
whether the NcoI Al/ FokI A1 genotype correlates
significantly more strongly with migraine with aura than
the NcoI A1/FokI A2 genotype.
Variant genes can be detected, for example, by
sequencing, allele-specific amplification (Gibbs, Nucleic
Acid Res. 17, 12427-12448 (1989)), restriction enzyme
analysis, allele-specific probe hybridization assays
(Saiki et al., Nature 324, 163-166 (1986)) or
singlestranded conformational analysis (Orita et al.,
Proc. Natl. Acad. Sci . 86, 2766-2770 (1989)). For
example, the NcoI Al and A2 alleles can be distinguished
by NcoI digestion. Only the A2 allele is cut. Reagents
used for detecting variant alleles, such as allele
specific probes and primers can be packaged as diagnostic
reagents. The diagnostic reagents can bear labels
indicating their suitability for use in diagnosis of the
mada syndrome or a symptom thereof.
TTT. Susce~tib;l;ty Analysis
The present data indicate that analysis of DRD1,
DRD2, DRD3 and/or DAT gene in a patient can be used as a
measure of susceptibility to migraine with aura,
depression andtor anxiety. For example, detection of one
or both copies of the NcoI A1 allele of DRD2 indicates
increased susceptibility to migraine with aura,
depression and/or anxiety in the patient, and detection
of both copies indicates increased susceptibility
relative to one copy. Detection of one or both copies of
DRD1 B1 indicates increased risk of migraine with aura
relative to homozygous DRDl B2. Detection of homozygous
DRD3 A2 indicates increased risk of migraine with aura
relative to homozygous or heterozygous DRD3 A1.
Detection of homozygous DAT 10 indicates increased risk
of migraine with aura relative to heterozygous DAT 10/9
and probably 9t9 genotype, although the latter occurs
with insufficient frequency to have been included in the
present analysis.
Although the probability of an individual having any
.. ...
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-13-
one variant allele developing the mada syndrome is low
(no more than 20%), the individual probabilities combine
in an additive fashion. The presence of each variant
allele associated with the mada syndrome can be assigned
a risk factor related to the probability, as discussed in
the Examples. Fig. 2 shows the percentage of individuals
having migraine with aura as a function of number of risk
factors present. It can be seen that no individuals
without any dopaminergic risk factor have symptoms of the
mada syndrome and about 75% of individuals with all five
dopaminergic risk factors have symptoms of the mada
syndrome. Individuals with 1-4 risk factors show
intermediate frequencies of symptoms of the mada syndrome
in relation to the number of risk factors present.
There are probably other genes besides the
dopaminergic genes described above having variant forms
associated with risk of the mada syndrome. The existence
of variant forms of such genes can be detected and
correlated with probabilities of susceptibility to the
syndrome in similar fashion to the analysis of
dopaminergic genes. Combined statistical analysis of
dopaminergic genes with other genes still further
increases the predictive value of the diagnosis.
The analysis is useful in identifying a subset of
patients having a common genetic basis giving rise to the
mada syndrome. Such patients are amenable to treatment
- with antagonists of dopaminergic genes as discussed
below. Treatment with such antagonists may be
ineffective in other patients, who exhibit similar
symptoms to patients with the syndrome, but due to a
different genetic basis. This analysis is also useful in
distinguishing migraine with aura from migraine without
aura, and others diseases, such as stroke, which may
present with similar symptoms. That is, a patient with a
high number of risk factors for the mada syndrome is more
at risk for migraine with aura than for migraine without
aura or stroke.
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-14-
TV. Methods of Tre~tment
The invention further provides methods of treating
patients suffering from, or susceptible to, the mada
syndrome. In these methods, a patient having or
susceptible to symptoms of migraine with aura, depression
and or anxiety is treated with a therapeutically
effective dose of an antagonist to one or more of the
dopaminergic genes DRDl, DRD2, DRD3 and DAT. Such a dose
is sufficient to prevent, arrest or detectably relieve
symptoms of migraine with aura, depression and/or
anxiety. The dose can be administered prophylactically
or therapeutically. The dose can also be administered to
pediatric or handicapped patients but who are unable to
articulate their symptoms but are known to have variant
forms of one or more variant forms of the dopaminergic
genes associated with the disease.
In general, the stronger the binding of an
antagonist to the dopaminergic protein, the greater the
efficacy. Buproprion (2-tert-butylamino-3'-
chloropropiophenone hydroxide) manufactured by GlaxoWellcome is an example of a DAT antagonist. A list of
DRD2 antagonists and appropriate dosages is provided in
Table l. Many of these antagonists also bind to other
dopaminergic receptors, particular DRD3 and DRD4, which
are most closely related to DRD2. DRD2 antagonists
include phenothiazines (chlorpromazine, fluphenazine,
prochlorperazine, promethazine, thioridazine and
trifluoperazine), butyrophenomes (droperidol,
haloperidol, pimozide, spiperone), thioxanthines
(chlorprothixene, thiothixene) and other drugs, such as
clozapine. Some antagonists are capable of crossing the
blood-brain barrier and therefore capable of antagonizing
both central and peripheral dopaminergic receptors.
Other antagonists such as domperidone do not cross the
blood-brain barrier and therefore antagonize only
peripheral receptors. Some agents such as domperidone,
metoclopramide, chlorpromazine, prochloperazine and
flunarazine have previously been reported to have some
value in treating some migraine patients. However, the
CA 02263149 1999-02-ll
W O g8/07426 PCT~US97/14830
-15-
mechanism of action was not known, not was it appreciated
that the agents are most appropriate for administration
to the subset of migraine patients having migraine with
aura and variant forms of one or more of the dopaminergic
genes DRD1, DRD2, DRD3, DRD4 and DAT.
Antagonists can be used to manufacture medicaments
for use in treatment of the syndrome. Antagonists can be
mixed with a pharmaceutical carrier, which can be any
compatible, non-toxic substance suitable to deliver the
antagonist to the patient. Sterile water, alcohol, fats,
waxes, and inert solids can be used as the carrier.
Pharmaceutically-acceptable adjuvants, buffering agents,
dispersing agents, and the like, can also be incorporated
into the pharmaceutical compositions. The concentration
of the active agent in the pharmaceutical composition can
vary widely, i.e., from less than about 0.1% by weight,
usually being at least about 1% by weight to as much as
20% by weight or more. Medicaments can be administered
intravenously, intramuscularly, subcutaneously,
intranasally, cutaneously, via suppository, by inhalation
or orally. Methods for preparing parenterally
administrable compositions are described in more detail
in, for example, ~emington~s Pharmaceutical Science (15th
ed., Mack Publishing Company, Easton, Pennsylvania, 1980)
(incorporated by reference in its entirety for all
purposes).
For oral administration, the active ingredient can
be administered in solid dosage forms, such as capsules,
tablets, and powders, or in liquid dosage forms, such as
elixirs, syrups, and suspensions. Active component(s)
can be encapsulated in gelatin capsules together with
inactive ingredients and powdered carriers, such as
glucose, lactose, sucrose, mannitol, starch, cellulose or
cellulose derivatives, magnesium stearate, stearic acid,
sodium saccharin, talcum, magnesium carbonate and the
like. Examples of additional inactive ingredients that
may be added to provide desirable color, taste,
stability, buffering capacity, dispersion or other known
desirable features are red iron oxide, silica gel, sodium
CA 02263149 1999-02-11
W 098/07426 PCTA~S97/14830 -16-
lauryl sulfate, titanium dioxide, edible white ink and
the like. Similar diluents can be used to make
compressed tablets. Both tablets and capsules can be
manufactured as sustained release products to provide for
continuous release of medication over a period of hours.
Compressed tablets can be sugar coated or film coated to
mask any unpleasant taste and protect the tablet from the
atmosphere, or enteric-coated for selective
disintegration in the gastrointestinal tract. Liquid
dosage forms for oral administration can contain coloring
and flavoring to increase patient acceptance.
V. Screening Druqs
The invention further provides methods of screening
for novel antagonists of DRD1, DRD2, DRD3 and/or DAT for
treatment of the syndrome. Potential agents are screened
for specific binding (Kd < ~M) to human DRD1, DRD2, DRD3
or DAT, optionally in competition with dopamine.
Preferred agents bind with a Kd less than 10 nM and can
therefore usually be used at a dose of about 10
mg/patient. Receptor binding assays can be performed as
described by Ison & Peroutka, Cancer Treatment Reports
70, 637 (1986); Peroutka & Snyder, Am. ~. Psychiatry 137,
12 (1980) using cloned and expressed human receptors or
human receptors located in post-mortem human tissues.
Some agents are screened for lack of specific binding to
at least one of dopaminergic receptors DRD4 or DRD5. The
agents can also be screened for lack of specific binding
to other receptors to minimize side effects. For
example, lack of binding to the ~-adrenergic receptor
minimizes orthostatic hypotensive side-effects.
Preferred agents have a serum half-life of about 24 hr
and can reach peak plasma levels within about 15-60 min
of administration.
.
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-17-
~XAMPT~S
Correl~tions Retween Migr~;ne with AurA ~nd Dopa~inergic
Genes
This example describes analysis of allelic variants
within all five dopamine receptor genes (DRDl, DRD2,
DRD3, DRD4 and DRD5) and the DAT gene in control,
migraine without aura (MO) and MWA individuals.
A. METHODS
1. Sll~jects
Subjects were identified for this study by physician
referral. Individuals were evaluated using the
diagnostic criteria for MO and MWA established by the
International Headache Society (Cephalalgia 8, 1-96
(1988)). The lifetime presence or absence was determined
for each of the criteria in the IHS definition of
migraine. Interviews were conducted by physicians,
nurses and/or trained interviewers. All interviewers
were trained by the present inventor in the use of the
IHS criteria and all clinical data were reviewed by the
same neurologist. Control group individuals did not meet
IHS criteria for migraine (based on direct interview) and
were predominantly unaffected spouses of the individuals
with migraine. Informed consent was obtained and DNA
samples collected. A11 clinical data were obtained
independently of the genotypic data. The average age of
the study participants is 53 + 1 years. No variation was
observed between the 3 study groups in terms of age, sex
or ethnic origin.
2. Genotyping
A total of 246 DNA samples from unrelated indi-
viduals, who were 35 years of age or older, were analyzed
(115 control individuals; 77 MO individuals; 54 MWA indi-
viduals). Genomic DNA was isolated using the Puregene DNA
isolation kit (Gentra Systems, Research Triangle Park,
North Carolina). Genotypes were scored independently by
two individuals blinded to the clinical status.
CA 02263149 1999-02-11
WOg8/07426 PCT~S97/14830
-18-
3. DRn7, D~n2, DRn3 A nd DRn5
DRDl, DRD2, DRD3 and DRD5 were amplified as follows.
Briefly, 40 ng of genomic DNA was amplified in 10 ~L of a
solution containing lx Perkin Elmer PCR amplification
buffer, 400 ~M each dNTP, 0.5 U TaqGold polymerase
(Perkin Elmer, Foster City, CA) and 1 ~M primers. The
enzyme was activated with an initial incubation at 94~C
for 10 minutes, followed by 14 cycles of amplification
with denaturation at 94~C for 20 seconds, annealing at
63~C for 1 minute, elongation at 72~C for 30 seconds with
a decrease of 0.5~C and 3 seconds for each annealing step,
and an additional 40 cycles of denaturation at 94~C for 30
seconds, annealing at 56~C for 30 seconds and elongation
at 72~C for 1 minute. After amplification, 10 uL of a
solution containing 2x restriction enzyme buffer and 4 U
of the appropriate restriction enzyme were added directly
to the amplification reaction and incubated at 3 7~C for
greater than 4 hours. Digested products were separated on
1.5% SFR agarose gels (Amresco, Solon, OH). Primers used
for amplification of each marker, restriction enzymes
used to distinguish genotypes and the expected sizes of
each allele are listed in Table 2.
TABLE 2
ALLELE IDENTIFICATION METHODS
Alhle Refr~rr~
Ll r Prmr - RA-r~ n Err~vmr~
DRDl 5'D1.0 ATTCAGGGGCTTTCTGGTG Dd~l Bl - 205
353'Dl.D AE;CAGGC' ATAGGGGTCAGT B2 = 221
_~ DRD2 DRD2.35 ATCCTGCAGCCATGG Ncol Al ~ ~50
~U 3b'DRD2.38 ATTGTCCGGCTTTACC A2 ~ "50
DRD3 DRD3.PCRl.1 GCTCTATCTCCAACTCTCACA Mscl Al . 304
38DRD3.PCR1.2 AAGTCTACTCACCTCCAGGTA A2 ~ ,-Ob
DRD4 DRD4.S8.PCR3 GTGCACCArCAAC~A'''''' 48-bpr~f~ 4 = 500
39DRD4.SU.PCR4 GCTGCTGCTCTACTGGGC 7 - 750
~;1 DRD5 DRD5-3' GGGTTGAGTGAGGAGTTAG Eco571 A1 = 380
40DRD5.SB.PCR2 GACGTGAATI;CA';AGAACTG A2 = 4flO
DAT T3-5Lono TGTGGTGTAGGGAACGGCCTGAG 40-bp rr)prt~t 9 ~ 440
33T7 ~ ' CTTCCTGGAGGTCACGGCTCAAGG 10 ~ 481)
4. PRD4
DRD4 genotypes were assessed by amplifying 50 ng of
genomic DNA in 10 ~L of lx ThermoPol buffer (New England
Biolabs), 400 uM dNTP, 1 uM of each primer (see Table 2)
and 0.2 U Vent (exo) Polymerase. Amplification
consisted of 35 cycles of denaturation at 98~C for 1
. -- . .. . ..
CA 02263149 1999-02-11
W O 98/07426 PCTrUS97/14830
-19-
minute and annealing/elongation at 70~C for 5 minutes.
Amplification products were analyzed on 1.2% agarose
gels.
5. na~
DAT genotypes were assessed by amplifying 40 ng of
genomic DNA in the presence of 0.5 ~M of fluorescence-
labelled dUTP (Applied Biosystems, Foster City, CA).
Reactions progressed through 35 cycles of denaturation at
94~C for 1 minute and annealing/elongation at 72~C for 1
minute. Amplified products were analyzed on an ABI 373
sequencer using a 6% polyacrylamide gel. Analysis was
performed as described previously (Vandenbergh et al.,
~ol. Brain Res. 15, 161-166 (1992)); Doucette-Stamm et
al. Genet. Epidemiol. 12, 303-308 tl995)).
B. RESULTS
1. D~n1 5' UTR B1 and B2 Allele Fre~uenc;es
An A to G polymorphism has been described in the 5'
untranslated region of the DRD1 gene (Cichon et al.,
Hum. Mol. Genet. 3, 209-209 (1994)). In the current
dataset (n = 246 individuals), the DRD1 B1 allele
frequency is 0.37 and the B2 allele frequency is 0.63.
These values are similar to the DRD1 B1 and B2 allele
frequencies reported in Caucasians (id.). In the overall
dataset, 16% of individuals have the B1/B1 genotype, 41%
have the B1/B2 genotype and 43% display the B2/B2
genotype.
An association of MWA and the DRD1 B1 allele is
apparent in an analysis of genotype distributions (Table
3). No significant difference is observed in the
genotypic distribution between the control group and
individuals with M0. The B2/B2 genotype in the dataset
is significantly less frequent in individuals with MWA
(28%) than in control individuals and individuals with MO
(Chi-square = 6.28; p < 0.006). MWA is observed in 14%
of the B2/B2 individuals, 26% of the B1/B2 individuals
and 31% of the B1/B1 individuals (Figure lA).
.. .. . . .
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-20-
TABLE 3
DOPAMINE Dl RECEPTOR POLYMORPHISM FREQUENCIES
IN A SAMPLE OF 246 INDIVIDUALS
G~notyp~s Allel~ r,l
B1/B1 (%~ B1/B2 (%1 ~2/~2 (%\ ~1 B2
Control~ In=115) 15 113%) 45 (39%1 55 148%~ 0.33 0.67
MO Subjoct~ ~n=77) 12 116%) 30 139%) 35 145%) 0.35 0.65
MWASubj~ct-ln=54) 12 122%) 27 150%) 15 128%) 047 .53''''
TOT~I ~ =246~ 39 ~16%1 102 ~41%1 105 (43%1 0.37 0.63
~ Chi--qu~r~ = 6.71 Ip < 0.01) v~. control ~rcup
''Chi-~qu~r~ = 3.91 Ip c 0.02~ v-. MO ~roup
# Chi-~qu~r~ = 6.75 Ip < 0.0091 v~. th~ combinod control ~nd MO ~roup
The DRD1 B1 and B2 allele frequencies were also
determined in each subgroup of subjects. Similar allele
frequencies are observed in both the control group and
individuals with M0. By contrast, individuals with MWA
have a significantly greater frequency of the DRD2 Bl
allele (0.47) than either the control group (Chi-square =
6.71; p < 0.01) or individuals with M0 (Chi-square =
3.91; p < 0.02).
2. D~n2 NcoT Al and A2 Allele Frequencies
A C to T polymorphism, resulting in a silent
mutation at amino acid 313, has been described in the
DRD2 gene (Sarkar et al ., Genomics 11, 8-14 (1991).). In
the current dataset, the DRD2 NcoI A1 allele frequency is
0.73 and the A2 allele frequency is 0.27. These values
are similar to the DRD2 NcoI allele frequencies reported
in the North American population (id.). In the overall
dataset, 54% of individuals have the A1/A1 genotype, 37%
have the A1/A2 genotype and 8~ display the A2/A2
qenotype.
An association of MWA and the DRD2 A1 allele is
apparent in an analysis of genotype distributions (Table
4). No significant difference is observed in the
genotypic distribution between the control group and
individuals with M0. The Al/Al genotype in the dataset
is significantly more frequent in individuals with MWA
(69%) than in control individuals and individuals with M0
(Chi-square = 5.50; p < 0.01). MWA is observed in 5~ of
the A2/A2 individuals, 17% of the A1/A2 individuals and
28% of the A1/A1 individuals (Figure lA).
, .. , i .. . .
CA 02263149 1999-02-11
W 098t07426 PCTAUS97/14830
-21-
TABLE 4
DOPAMINE D2 RECEPTOR NcoI POLYMORPHISM ~REQUENCIES
IN A SAMPLE OF 246 INDIVIDUALS
G~notypol All~l~ r, ,
A11A1 (%~ Al/A~ (%~ /A2 1%~ A1 A7
Control- ~n=1151 57 150%) 48 ~42%~ 10 ~9%~ 0 70 0 30
MO Subj~ct- In=77) 40 ~52%) 28 136%~ 9 ~12%) 0 70 0 30
MWA S~lbj~ct~ ~n= 54~ 37 ~69%~ 16 ~30~6 1 ~ 296~ 0 83 0 17
TOT/~I ~n=246~ 134 (54%~ 92 (37%) 20 ( 8%~ 0 73 0 27
~ Chi--qu~r~ = 6 45 IP c 0 01~ V5. control oroup
~-Chl--qu~r~ = 5 98 ~p c 0 01~ v~ MO ~roup
J Chi-~qu-r~ = 7 28 ~p < 0 007~ v~ tho combin~d contro( nnd MO ~roup
The DRD2 NcoI A allele frequencies were also deter-
mined in each subgroup of subjects (Table 5). Similar
allele frequencies were observed in both the control
group and individuals with M0. By contrast, individuals
with migraine with aura had a significantly greater
frequency of the DRD2 Al allele (0.83) than either the
control group or individuals with migraine without aura.
3. D~n3 Al an~ A~ Allele Frequencies
A polymorphism resulting in a glycine to serine
substitution at position 9 in the N-~erminal part of the
DRD3 receptor was analyzed (Lannfelt et al., Psychiatr.
Genet. 2, 249-256 (1992)). The polymorphism consists of
a A to G substitution which is 25 bp downstream from the
start codon, creating a restriction site for BalI. This
polymorphism has been hypothesized to play a role in
receptor insertion into the cell membrane (Rietschel et
al., Psychiatr. Res. 46, 253-259 (1993).
In the overall dataset, the DRD3 Al allele frequency
is 0.62 and the A2 allele frequency is 0.37. These
values are similar to the DRD3 allele frequencies
reported in previous studies (id.). In the overall
dataset, 37% of individuals have the Al/A1 genotype, 50%
have the Al/A2 genotype and 12% display the A2/A2
genotype.
No significant difference was observed in the
genotypic distribution between the control group and
individuals with M0 (Table 5). However, the DRD3 A2/A2
genotype in the dataset is significantly more frequent in
individuals with MWA (20%) than in control individuals
and individuals with M0 (Chi-square = 4.32; p < 0.02).
CA 02263l49 l999-02-ll
W O 98/07426 PCTnUS97/14830
-22-
MWA is observed in 22% of the A1/Al individuals, 19% of
the A1/A2 individuals and 37% of the A2/A2 individuals
(Figure lC). The DRD3 A2 allele frequencies is increased
in MWA compared to both control and M0 individuals.
However, this difference does not reach statistical
significance.
TARLE 5
DOPAMINE D3 RECEPTOR POLYMORP~ISM FREQUENCIES
IN A SAMPLE OF 246 INDIVIDUALS
Gonotypes Allele r,
A1/A1 1%1 A1/A2 1%1 A2/A2 ~~61 A1 A~
Controb In=115) 45 139%1 58 150%) 12 110%\ 0.64 0.36
MO Subjecte In=77) 27 135%1 43 156%) 7 19%1 0.63 0.37
MWA Subjecte In=54~ 20 137%1 23 143%) 11 120%1 0 5B 0 42
TOTAI In=2461 92 137~61 124 150~kl 30 ~12~~cl 0 63 0 37
~ Chi--quoro = 4.32 Ip < 0.02~ V8. tho combinod control and MO Rroup
4. D~n4 Al1ele Fre~uencies
The DRD4 gene contains a 48-bp sequence in the third
cytoplasmic loop of the receptor that ranges from 2- to
8-fold repeat units (Van Tol et al., Nature 358, 149-152
(1992). In the current dataset, genotypes were obtained
on 238 of the 246 individuals. The observed allele
frequency distribution is similar to the DRD4 allele
frequencies reported in the North American population
(id.): 2 repeats (n = 38; 0.08 allele frequency), 3
repeats (n = 26; 0.05), 4 repeats (n = 310; 0.65), 5
repeats (n = 1; < 0.01) and 7 repeats (n = 101; 0.21).
In the current dataset, 106 individuals (45%) display the
most common genotype (i.e., 4/4) whereas 91 individuals
(38%) have at least one 7 allele (Table 6).
TABLE 6
DOPAMINE D9 RECEPTOR POLYMORPHISM FREQUENCIES
IN A SAMPLE OF 238 INDIVIDUALS
Gonot.rpec Allolo r,
7 allole 4 7 7 dlolo
Drosent (%1 aenotvDo 1~kl obsent /%~ 4 r 7 ~
Controb /n=1101 38 135%1 30 127%) 72 165%~ 0.70 0.18
MO Subjocte In=75) 34 145%1 20 127%~ 41 155%1 0.57 0.27
MWA Subjocte In=53~ 19 136%) 13 (25%~ 34 164%1 0.65 0.20
TOTAI /n=2381 91 138%1 63 '~7%1 147 162%1 0.65 0.21
No significant difference is observed in the
CA 02263149 1999-02-11
WO 98/07426 PCTAUS97/14830
-23-
genotypic distribution between the control group,
individuals with M0 and individuals with MWA (data on the
most common genotypes are summarized in Table 6). MWA is
observed in 21% of individuals with a 7 allele and 23% of
individuals without a 7 allele. Similar allele
frequencies are observed in the control group,
individuals with M0 and individuals with MWA (Table 6).
5. ~ns A1 ~n~ A2 Allele Frequencies
In the current dataset, the DRD5 Al allele
frequency is 0.68 and the A2 allele frequency is 0.32.
These values are similar to the DRD5 allele frequencies
reported in the North American population (Sommeret al.,
~um. Genet. 92, 633-634 (1993)). In the overall dataset,
47% of individuals have the Al/Al genotype, 43% have the
A1/A2 genotype and 10~ display the A2/A2 genotype.
No significant difference was observed in the
genotypic distribution between the control group,
individuals with M0 and individuals with MWA (Table 7).
MWA is observed in 22% of the Al/Al individuals, 23% of
the A1/A2 individuals and 16% of the A2/A2 individuals.
Similar allele frequencies are observed in the control
group, individuals with M0 and individuals with MWA
(Table 7).
TART.~ 7
DOPAMINE D5 RECEPTOR POLYMORPHISM FREQUENCIES
IN A SAMPLE OF 246 INDIVIDUALS
Genot~rpes Allele Frequencies
Al/Al (%i A1/A2 (%~ AZ~A2 (%) Al A2
Controls ~n=1151 58 (50~) 45 (39~) 12 (10%) 0.70 0.30
M0 Subjects ~n=77) 32 (42%) 36 (47%) 9 (12%) 0.65 0.35
MWA Subjects(n=54) 26 (48%) 24 (44%) 4 (7~) 0.70 0.30
TOTAL (n=246~ 116 (47%) 105 (43%) 25 (10%) 0.68 0.32
6. DAT 9 an~ lQ Allele Frequencies
A polymorphic 40 bp repeat in the 3' untranslated
region as been identified in the DAT gene (Vandenbergh et
al., Genomics 14, 1104-1106 (1992)). In the overall
dataset, the DAT 9 allele frequency is 0.22, the 10
allele frequency is 0.77 and more rare alleles have a
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-24-
frequency of 0.01. These values are similar to the DAT
allele frequencies reported in previous studies (id.).
In the overall dataset, 35% of individuals have the 9/10
genotype and 59% display the 10/10 genotype. The less
frequent DAT genotypes polymorphisms are as follows: 9/9
(n = 11), 1/2 (n = 2) and 2/8 (n=l). Since only 14
individuals (5.7~) have these less frequent genotypes,
these individuals were not analyzed independently in the
present study.
No significant difference was observed in the
genotypic distribution between the control group and
individuals with M0. An association of MWA and the 10/10
genotypes is observed in the present study (Table 8).
MWA is observed in 13% of the 9/10 individuals and 25% of
the 10/10 individuals (Figure lD). The 10/10 genotype
frequency is significantly higher in the MWA group (69%)
in comparison to the 9/10 genotype frequency in the
control subjects (38%; Chi-square = 4.46; p < 0.02) and
to the MO group (40%; Chi-square = 4.41; p < 0.02). A
higher level of statistical significance is observed when
the 10/10 genotype frequency in the MWA group is compared
to the 9/10 genotype in the combined control and M0
groups (39%; Chi-square = 6.46; p < 0.006).
TABLE 8
DOPAMINE TRANSPORTER POLYMORPHISM FREQUENCIES
IN A SAMPLE OF 246 INDIVIDUALS
Genotypes Allele Frequencies
9/10 (~ 10/10 (%~ other (~) 9 10
Controls (n=115) 44 ~38~) 65 (57~) 6 ~ 59a) 0.22 0.78
MO Subjects In=77) 31 (40~) 44 (57~) 2 ( 3~) 0.22 0.77
MWA Subjects (n=54) 11 (20~) 37 (69~ 6 (11#) 0.21 0.79
TOTAL (n=243) 86 (35~) 146 (59~) 14 ( 6~) 0.22 0.78
~ Chl-square = 4.46 Ip < 0.02) vs. control group
~ Chi-square = 4.41 (p < 0.02) vs. MO group
~ Chi-square = 6.46 (p < 0.006) vs. combined control and MO group
7. Allel;c "Risk Factor" Assessment
Risk factor analysis has proven to be an important
approach to the assessment and management of
cardiovascular disease (Kannel, Hosp. Pract. 25, 119-130
(1990); Wilson, Am. J. Hypertens. 7, 7S-12S (1994);
CA 02263149 1999-02-11
W098/07426 PCT~S97114830
-25-
Hancock, Scientific American Medicine (eds Dale, D. C. &
Federman, D. D.) 1-12 (Scientific American, Inc., New
York, 1995). Applying the principles of risk factor
analysis to MWA, an analysis of the data was performed
based on the allelic variants which showed independent
associations with MWA. The goal of this analysis was to
determine if additive and/or synergistic effects exist
between the dopaminergic genes in terms of MWA.
Based on the data in the present study, 5 specific
allelic "risk factors" were identified that were
associated independently with an increased susceptibility
to MWA compared to alternative genotypes at the same
molecular location within the dopaminergic genes: the
DRDl Bl/Bl or Bl/B2 genotype, the DRD2 Al/Al genotype,
the DRD2 Al/A2 genotype, the DRD3 A2/A2 genotype and the
DAT lO/lO genotype. Although the strength of the
associations varied amongst the different genes, an
initial attempt to develop a "risk factor" profile for MWA
assigned equal weight to each allelic "risk factor" with a
single exception: the DRD2 Al allele. Individuals with
the DRD2 Al/Al genotype were assigned a risk factor of "2"
since the frequency of MWA appeared to be related to the
number DRD2 Al alleles present in an individual (Table
4).
The number of allelic "risk factors" were determined
for each individual in the present study (i.e., 0-5
dopaminergic allelic "risk factors" per individual). The
frequency of MWA was then determined in each allelic "risk
factor" group. As summarized in Figure 2, MWA was present
in 0% of individuals (n = 6) with 0 "risk factors", 11% of
individuals (n = l9) with l "risk factor", 14% of
individuals (n = 69) with 2 "risk factors", 18% of
individuals (n = 92), with 3 "risk factors", 39% of
individuals (n = 56) with 4 "risk factors" and 75% of
individuals (n = 4) with all 5 dopaminergic allelic "risk
factors".
Finally, MWA frequency was determined in individuals
with 0, l or 2 allelic "risk factors" vs. individuals with
4 or 5 allelic "risk factors". Individuals with 4 or 5
CA 02263149 1999-02-11
W O 98/07426 PCTrUS97114830
-26-
allelic "risk factors" have a significantly greater (Chi-
square = 16.67; p < 0.00002) incidence of MWA (42%) than
individuals with 0,1 or 2 allelic "risk factors" (13~).
II. A~sociAtion Between Comorhid Migr~;ne, An~iety ~n~
Depression ~n~ DRn2 NcoT Alleles
In epidemiological studies, a clinical diagnosis of
migraine significantly increases the risk of comorbid
anxiety and depression. However, because all of these
diseases are probably multifactorial, the fact that a
specific genetic locus may correlate with one of these
symptoms does not necessarily imply that it correlates
with others. This example tests whether variant forms of
dopaminergic genes correlate with depression and anxiety
as well as with migraine with aura.
A. METHODS
The data described in this study are derived from a
clinical genetic relational database that was developed
initially for the genetic analysis of migraine Peroutka &
Howell, Towards Migraine 2000, (Amsterdam, Elsevier
Science B.V., 1996), pp. 35-48. Potential subjects were
identified by physician or self-referral. Subjects were
evaluated using a semi-structured interview for migraine.
Migraine evaluations were conducted by a neurologist
and/or trained interviewer. The lifetime presence or
absence was determined for each of the criteria in the
International Headache Society (IHS) definition of
migraine with (MWA) (Cephalalgia 8, 1-96 (1988).
A semi-structured interview based on the Structured
Clinical Interview for DSM-III-R (SCID) (Spitzer et al.,
Arch Gen Psychiatr 1992;49:624-629), modified to include
the criteria of the Diagnostic and Statistical Manual of
Mental Disorders-IV (DSM-IV) (Diagnostic and Statistical
Manual of Mental Disorders. Vol. 4. (Washington, DC,
American Psychiatric Association, 1994), pp. pp. 317-391
and 393-444) was used to evaluate anxiety and depressive
disorders in the same individuals interviewed for
CA 02263149 1999-02-11
W098/07426 PCT~S97tl4830
-27-
migraine. The interview included questions that were
appropriate to establish a DSM-IV-based diagnosis of
generalized anxiety disorder (GAD), phobias, panic
attacks, panic disorder, obsessive-compulsive disorder
(OCD) and major depression. Interviews were performed by
physicians or trained psychiatric nurses. Diagnoses
required the concurrence of at least 3 physicians.
Genomic DNA was isolated using the Puregene DNA
isolation kit (Gentra Systems, Research Triangle Park,
North Carolina). Genotyping of the DRD2 NcoI
polymorphism was performed using previously described
primers (Sarkar et al., Genomics 11,8-14 (1991).
Briefly, 40 ng of genomic DNA was amplified in 10 uL of
a solution containing lx Perkin Elmer PCR amplification
buffer, 400 uM each dNTP, 0.5 U TaqGold polymerase
(Perkin Elmer, Foster City, CA) and 1 uM primers DRD2.35
(ATCCTGCAGCCATGG) and DRD2.38 (ATTGTCCGGCTTTACC). The
enzyme was activated with an initial incubation at 94~C
for 10 minutes, followed by 14 cycles of amplification
with denaturation at 94~C for 20 seconds, annealing at
63~C for 1 minute, elongation at 72~C for 30 seconds with
a decrease of 0.5~C and 3 seconds for each annealing step,
and an additional 40 cycles of denaturation at 94~C for 30
seconds, annealing at 56~C for 30 seconds and elongation
at 72~C for 1 minute. After amplification, 10 uL of a
solution containing 2x NEB4 buffer and 2 U NcoI (New
England Biolabs, Beverly, MA) were added directly to the
amplification reaction and incubated at 37~C for greater
than 4 hours. The digested products were separated on a
1.2% agarose SFR gel (Amresco, Solon, OH). Analysis of
the genotype was performed by two individuals blinded to
the clinical status.
B. RESULTS
1. ~linical ch~racteristics of ind;viduals in
~he present stu~y
Direct diagnostic interviews were completed on all
individuals in the present study (n = 242). A diagnosis
was made only if the individual met DSM or IHS criteria
CA 02263149 1999-02-11
WOg8/07426 PCT~S97/14830
-28-
for the disorders listed in Table 9. If a clear clinical
diagnosis could not be made, the subject was not included
in any further statistical analyses for that particular
disorder. For each of the conditions analyzed, a
diagnosis was made in at least 98% of the individuals.
In the overall dataset, 55% (134/242) of individuals were
diagnosed with at least one of the clinical disorders
analyzed. As shown in Table 9, anxiety disorders are
the most common diagnosis, being present in 46% (122/242)
of the current dataset. Major depression is the single
most common diagnosis (i.e., 38%) amongst the group of
analyzed disorders in the present study. The incidences
of panic attacks (31%) and phobia (29%) are similar. MWA
is present in 21~ of the individuals. Panic disorder,
GAD and OCD are present in less than 20% of the current
study group.
TABLE 9
INCIDENCE OF MIGRAINE WITH AURA, ANXIETY DISORDERSAND MAJOR DEPRESSION
IN THE INDIVIDUALS (n=242)
20IN THE PRESENT STUDY
The clinical diagnoses were based on DSM criteria for the anxiety
disorders and major depression and on IHS criteria for MMA. If a clear
diagnosis could not be made, the individual was "not diagnosed" and was
not included in further stat1stical analyses for the disorder.
Affected Unaffected Not ~ osed
MWA, enxietV or J~
Any ~nxiety disorder 4~3 % 54 % o %
M~jor 1~, e~~ , 38% 61% 1%
P~nic Att~cks 31% ~8% 1%
Phobia 29% ~9% Z%
Mi~r~ine with Aurs 21% 79% 0%
Penic Disorder 19% 81% 1%
G . ' ' Anxiety Disorder 17% 81% 2%
Obsoss~ve Comnl~l~;ve Disorder 14% 8~3% 0%
2. Frequency of neuropsychiatric disorders
haSed on D~n2 Nco I genotypes
The incidences of the various clinical diagnoses
based on DRD2 NcoI genotypes is provided in Table 10. A
present or past history of MWA, anxiety disorders or
major depression is present in 69% of the A1/Al
individuals, 53% of the A1/A2 individuals and 22% of the
A2/A2 individuals. The incidence of any of these
neuropsychiatric diagnoses is significantly higher in the
., ,, . ~ .
CA 02263149 1999-02-11
W098/07426 PCT~S97/14830
-29-
A1/A1 individuals when compared to either-the Al/A2
individuals (Chi-square=6.53; p < O.oO5), A2/A2
individuals (Chi-square=15.29; p < 0.00005), or the
combined A2/any group of individuals (Chi-square=12.72; p
< 0.0002).
TART,F: 10
INCIDENCE OF MIGRAINE WITH AURA, ANXIETY DISORDERS AND
M~JOR DEPRESSION IN THE CURRENT DATA~PSE
BASED ON DRD2 NcoI GENOTYPES
-Al/Al AlIA2 A2/A2 Chi--qu~rr ~n~lyd~
/n=1311 ~ns93~ /n=1B~ Al/A1 Vb. A~/nnv n vdu~
MWA Anxbty or dopr~-ion 69% 53% 22~6 12.72 0.0002
Any ~nxioty di-ordor 54~~0 41~6 17% 7.20 0.004
~,, Anxbty Dbord~r 23% 11% 11% 6.11 0.007
M-jor Dop. 45% 33~~ 17% 5.18 0.01
Panic An~ck~ 3~% 26% 17% 4.96 0.01
MiRr~in~ with Aura 26% 17% 6% 4.09 0.02
Phobi- 34% 27% 11% 2.60 0.05
Panic Dbord~r 22% 16% 11% 1.45 n.l;.
Obs~dvo ~ n~ ~ 14% 16% 0% 0.01 n.~.
The presence of an anxiety disorder is significantly
more frequent in the A1/A1 individuals than in either the
A1/A2 individuals (Chi-square=3.87; p < 0.02), A2/A2
individuals (Chi-square=8.92; p < 0.001), or the combined
A2/any group of individuals (Chi-square=7.20; p c 0.004).
A similar pattern in seen with GAD. Major depression,
panic attacks, MWA and phobia are also all increased
significantly in the A1/Al vs. A2/any individuals (Table
10). Although both panic disorder and OCD are more
frequent in the Al/A1 vs. A2/any individuals, the
difference does nor reach statistical significance.
However, OCD is more frequent in the A1/A1 individuals
than in the A2lA2 individuals (Chi-square=2.84, p <
0-05)-
3 . D~n2 Nco I allele frequencies in
nellropsychiatric d;sorders in ~he curren~ study
DRD2 NcoI allele frequencies were determined in
individuals based on the presence or absence of the
neuropsychiatric disorders analyzed in the present study.
In individuals with MWA, anxiety disorders and/or major
depression, the A1 allele frequency is 0.80 and the A2
allele frequency is 0.20. In individuals who have none
of these neuropsychiatric disorders, the A1 allele
CA 02263149 1999-02-11
W O 98/07426 rcTrusg7tl4830
-30-
frequency is 0.63 and the A2 allele frequency is 0.37.
The difference in the DRD2 NcoI Al allele frequencies
between these two groups of individuals is highly
significant (Chi-square=17.13; p < 0.00002).
Table 11
DRD2 NcoI A~ELE FREQUENCIES IN INDIVIDUALS WITH
OR WITHOUT MIGR~INE WITH AUR~, ANXIETY DISORDERS
OR ~JOR DEPRESSION IN THE PRESENT STUDY
A1 ~ Chi-s~uare ~ ~/alue
MWA, anxiety and/or depression 0.80 0.20 17.13 0.00002
No MWA, anxiety or depression 0.63 0.37
In conclusion, the present data indicate that MWA,
anxiety disorders and major depression are comorbidly
associated with allelic variations in the DRD2 gene. As
a result, some manifestations of these diseases may
constitute a distinct clinical syndrome resulting from a
single underlying genetic variation. The clinical
recognition that all three disorders are associated with
the same genetic variant has significant diagnostic and
therapeutic implications.
The foregoing description of the preferred
embodiments of the present invention has been presented
for purposes of illustration and description. They are
not intended to be exhaustive or to limit the invention
to the precise form disclosed, and many modifications and
variations are possible in light of the above teaching.
All publications and patent applications cited herein are
incorporated by reference in their entirety to the same
extent as if each individual publication or patent
application was specifically and individually so denoted.
, .
TABLE 1 3
SPECTRA BIOMEDICAL, INC.
DRD2 D~.. ', Program i~
DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY
NAME AFFINITY RECEPIORS EFl;ECTS: CONTACT PERSON
SED/~YPOTENSION
EPS OTHER
Clinicallv
Effective DRD2
Anti-Mirraine
Dru~s D
e, idol Haldol psychosis 2-20 mg 4 alpha = 14 +/+ McNeil ~~,
Tourette's ADHD PO IM SHT2 = 45 + + + +
~= du.. ~ Motilium 10-30 mg 6 alpha = 74 Janssen (Europe) 1~ r
(Europe) po
ml p~V~ - C~ psychosis 10 mg 7 alpha = 200 generic
anxiety PO IM (SKB)
C ~- - IV PR O
~D chlv.~ Thorazine psychosis 200-800mg 25 alpha = 4 +++/+++ generic
--' anxiety POIM SHT2= 19 ++ (SKB)
~ ~ ~ IV PR
MDI
hiccups
i~i.lC Sibelium 10-20 mg 110 Janssen (Europe)
(Europe) PO
tucl~. ' Reglan GE reflux 10 mg 160 alpha 10,000 generic (Robins) 2
- PO IM
gastric stasis IV ::~
TABLE 1
SPECTRA BIOMEDICAL, INC. o
DRD2 D...' r ' Program
DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY j~
NAME AF~TY RECEPTORS E~t~;CTS: CONTACTPERSON
SED/~YI OI~SION
EPS O'l'~h;R
C ~;ally
Available But
Unlested DRD2
Anta~onists
,i~,u~,ridu.. ~ Risperdal psychosis2-8 mg/day I alpha I < 10 ++/+++ lanssen
PO 5HT2 ++ Dr. Jim Gibb
c~ p."P ' Trilafon psychosis: '- 8-32 mg 1 Schering o
PO IM I
IV I r
cn n.. ~h .. -,; Prolixin psychosis2-20 mg 2 alpha = 8 +/+ Apothecon
PO IM 5HT2 = 25 + + + +
rrl IV ~
C d,op.... i~lol Inapsine -~ 2.5-lOmg 2 alpha= I ++++ Janssen ~
pre-anes IM 5HT2 = 5
CD anxiety IV
Stelazine psychosis5-20 mg 3 alpha = 68 +/+ SKB
anxiety PO IM + + +
IV
pimozide Orap Tourette's 2-6 mg 3 alpha = 78 +/+ Gate P L
po 5HT2 = 25 +++
(half life 55
hours)
.: ' ' Navane psychosis 5-30 mg 3 alpha = 11 + +/+ + Roerig '~
PO IM 5HT2 = 36 +++ ,~
IV x
CA 02263149 1999-02-11
WO 98/07426 PCT/US97/14830
Z~
O ~ ~ LI ~ o '"
e ~
L
+ +
+ o _ +
O ~o ~
Il 11 11 11
V ~
~) ~ Z
~ Q ~ o ~~ o o
8 ~ 8 8 ~ E ~ ~ o o E
~~ ~ 2 U~' ~ ~ ~, 2 ~ ~~, ~, 2 2 ~ ~~ g ~ ~~
~ O
C.~ . . . . . . .
Z
c , e ' e c
: .
RECTIFIED SHEET (RULE 91)
TABLE 1
SPECTRA BIOMEDICAL, INC. O
DRD2 D~.~! r Pro~ram
DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY r
NAME A~NITY RECEPTORS EFFECTS: CONTACT PERSON
SED/HYPOTENSION
EPS OTHER
ihicthj~ Torecan - 10-30 mg " + + + / + + + Roxane Labs
PO IM ++++~
PR
DRD2 Anta~onists
(In De~ch)~ ~.' D
rr
-- amisulpiride launched psychosis25-50 mg (half Synthelabo w
rr life = S hrs) ~
C~ r . . Iid~ launched psychosis 9-36 mg/day r
m aapan)
sultopride launched psychosis Synthelabo
c (Belgium)
r-~ zolepine launched psychosisanxiety 5-HT ant Fuzisawa
; ' ~ l launched psychosis Lundbeck
(except Us)
sertindole Serdolect psychosis anxiety 12-20 mg 5HT2 ant Abbott and Lundbeck
(approved PO alphal ant
7/96) D I
okll. r Zyprex (pre- psychosis2.5-15 mg 5-HT2 ant Lilly ~
(? LY 170053) Il,, ) PO 2
q~ Seroquel psychosis 5-HT2 ant Zeneca
(Phrase m) '~
w
TABLE 1
SPECTRA BIOMEDICAL, INC.
DRD2 D... " ~ Program
DRUG BRAND . INDICATIONS DOSE DRD2 OTHER I~JOR SIDE COMPANY j~
NAME AF~INl~ RECEPTORSEFFECTS: CONTACT PERSON ~'
SED/HYPOTENSION
EPS OTHER
~ir~ Phase m psychosis 40-120 mg 5-HT2A ant (10x Pfizer
(CP-88059) du~ ~ n PO D2)
(half-life = 5-HT2C ant
4 hours) 5-HTID ant
5-HTIA agonist
pe~ Phase m psychosis 5-HT2 ant S_ ~- D
c, ' ~ '~ ~ Phasem psychosis 110 alpha=0.4 HMR
-- (HP-873) 5-HT2A=6
-r 5-HT2c=43 ~ r
rr 5-HT6=31
5-HT7=22
s~u~ Phase m psychosis 5-HT2 ant RW Johnson
~i AD-5423 Phase n psychosis 15 5HT2=8 Dainippon
I--IL~,I)CI;- ~ Phase 11 psychosis <3 5-HTIA agonist RW Johnson
< 3
alpha I ant < 3
D3 ant
hl. ~, iJe Phase n psychosis 5-HTIA agonist Schering AG
Lynn Bothello
1192U90 Phase 11 psychosis 5-HT2 ant Glaxo Wellcome
5-HTIA agonist
~dl-Otl~ ' Phase I psychosis 200 mg 5-HT2 ant Wyeth Ayerst '~
Jnn Barrett
;uplide 1~ ' 3 Schering Plough ~
TABI,E 1
SPECTRA BIOMEDICAL, INC. ~
DRD2 De.. ' r ~ Program -
DRUG BRAND INDICATIONS DOSEDRD2 OTHERMAJOR SIDE COMPANY
NAME AFFINllY RECEPTORSEFFECTS: CONTACT PERSON
SED/HYPOTENSION
EPS OT~R
zalospirone p.~ ' ' American Home
Products
Jim Barrett
remoxipride ' I 110 Astra D
c: cyclic t -,~ --;r~rS ~ psychosis 5-HT2 ant Glaxo ~
~ 5-HTIA agonist Wellcome I
C P 706-A ~ ' ' psychosis 5-HT2 ant Hoechst A.G. I r
p-9662 p.~ ' ' psychosis 5-HT2 ant Hoechst-Roussell
oca~,.. i p.. " I psychosis: 1-2 mg/day 5-HT2 ant Janssen
~ LEK-882 p-~ ' ' psychosis 5-HT2 ant LEK Pl""- ~r~
--' Dl agonist
EMD-56551 P--,~l;.. cal anxiety 5-HTla agonist Merck KGaA
EMD-67478 ~ " I anxiety 5-HTla agonist Merck KGaA
EMD-77697 1,.. ' ' psychosis anxiety 5-HTla agonist Merck KGaA
NNC-22-0031 p.~ ' ' psychosis 5-HT3 ant Novo Nordisk A/S
alphal ant
ORG-10490 " ' psychosis 5-HT ant Organon
ORG-20223 p.~ " ' psychosis 5-HTla agonist Organon x
T~BLE 1
SPECI'RA BIOMEDICAL, INC. ~
DRD2 D~ og~am
DRUG BRAND INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY i~
NAME AFF~NITY RECEPTORS E~FECTS: CONTACT PERSON SEDlHy~ 5NSION
EPS OTllER
OPC-14597 ~ ' ' Otsuka
S-16924 p-~ 'I psychosis 5-HTlA ant Servier
5-HT2 ant
D4 ant
DU-29894 p.~ " ~ psychosis 5-HTIA agonist Solvay Duphar
:~ o
c~ I , u.,., p.~ ' - ' psychosis 5-HTIA agonist Sulvay Duphar
C SM-13496 ~ " ' psychosis 5-HT2 ant S r
C~ SM-9018 p.~ " I psychosis S - ~J
~ri SDZ-MAR-327 preclinical psychosis 5-HTIA agonist Tsububa
5-HT2 ant
Dl agonist
~D ZD-3638 pl~ psychosis 5-HT2 ant Zeneca
alentemol ? psychosis 5-HT2 ant Parrnacia Upjohn
ORG-5222 ! -J ~ psychosis 5-HT ant Organon
a;: r' ' ~ Tindal 40-120 mg ?
(? not in Us) PO
amperoxide inactive psychosis Pha-
Upjohn/Sandoz
HDC-912 p., ' ' psychosis Sandoz '~Availablefor ~censing g~
o
TABLE I
SPECTRA BIOMEDICAL, INC. O
DRD2 D~,.. ' r ' Program
DRUG BRAND . INDICATIONS DOSE DRD2 OTHER MAJOR SIDE COMPANY ~,
NAME AFFINITYRECEPTORSEFFECTS:CONTACT PERSON ~'
SED/HYPOTENSION
EPS OTHER
:~ I ~
~: I r
rr ~
m
C ~
