Note: Descriptions are shown in the official language in which they were submitted.
CA 02263830 1999-02-23
W O98/07881 PCTrUS96/13777
Tl Receptor-Like Ligand I
Background of the Invenfion
Field of tl2e Invenfion
The present invention concerns a novel Tl receptor (TlR)-like ligand I
protein. In particular, isolated nucleic acid molecules are provided encoding the
TlR-like ligand I protein. TlR-like ligand I polypeptides are also provided, as
are recombinant vectors and host cells for expressing the same.
Rela~ed Art
Inferleukin-l (IL-l). Interleukin-1 (IL-la and IL-1~) is a
"multi~nctional" cytokine that affects nearly every cell type, and often in concert
with other cytokines or small mediator molecules. (Dinarello, C.A., Blood
87:2095-2147 (March 15, 1996).) There are three members of the L-l gene
farnily: IL-I a, IL-l ~, and IL- I receptor antagonist (IL-lRa). IL-1 a and IL-l ~ are
agonists and IL-lRa is a specific receptor antagonist. IL-lo~ and ~ are
synthesized as precursors without leader sequences. The molecular weight of
each precursor is 31 kD. Processing of IL-l a or IL-l ~ to "mature" forrns of 17kD requires specific cellular proteases. In contrast, IL-1 Ra evolved with a signal
peptide and is readily transported out of the cells and termed secreted IL-lRa
(sIL-lRa).
n-l Recep~or and Ligands. The receptors and ligands of the IL-l
pathway have been well defined (for review, see Dinarello, C.A., FASEB ~
8:1314-1325 (1994); Sims, J.E. et al., Interleukin-l signal transduction:
Advances in Cell and Molecular Biology of Membranes and Organelles, Vol. 3,
JAI Press, Inc., Greenwich, CT (1994), pp. 197-222). Three ligands, IL la,
IL-l ~, and IL-l receptor antagonist (IL-lra) bind three forms of IL-l receptor, an
80-kDa type I IL-l receptor (IL-lRl) (Sims, J.E. et al., Science 241:585-589
(1988)), a 68-kDa type II IL-1 receptor (IL-lRII) (McMahan, C.J. et al., ~MBO
CA 02263830 1999-02-23
W O ~t~7aBl PCT~US96tl3777
J. 10:2821-2832 (1991)), and a soluble form of the type II IL-lR (sIL-lRII)
(Colotta, F. et al., Science 261:472-475 (1993)).
The interactions between the Il,- 1 ligands and receptors play an essential
role in the stimulation and regulation of the IL-l -m~ te~1 host response to injury
and infection. Cells ~ es~ g IL- 1 Rl and treated with IL- 1 a or IL- I ,B respond
in several specific ways, including stimulating nuclear loc~li7~tion of the rel-related transcription factor, NF-lc~ (for review, see Thanos, D. & ~flni~ti.~, T.,
Cell 80:529-532 (1996)), activation of protein kinases of the mitogen-activated
protein kinase superfamily that phosphorylate residue threonine 669 (Thr-669)
of the epidermal growth factor receptor (EGFR) (Guy, G.R. et al., J. Biol. Chem.267: 1846-1852 (1992); Bird, T.A. et al., J Biol. Chem. 268:22861 -22870 (1991);Bird, T.A. e~ al., J. Biol. chem. 269:31836-31844 (1994)), and stimulation of
transcription of the IL-8 gene (Mukaida, N. et al., ~ Biol. chem. 265:21128-
21133 (1990)).
IL~ likefamily. Many proteins from diverse systems show homology
to the cytoplasmic domain of the IL-lRI. This e~cr~n~lin~ IL-lRI-like farnily
includes m~mm~ n proteins, Drosophila proteins, and a plant (tobacco) protein.
(Gay, N.J. & Keith, F.J., Nature 351:355-356 (1991); Hashimoto, C. et al., Cell
52:269-279 (1988); Schneider, D.S. et al., Genes & Dev. 5:797-807 (1991); Edon,
E. ct al., Development 120:885-899 (1994); Mitchan, J.L. et al., J. Biol. Chem
271:5777-5782 (March 8, 1996)).
The m~mms~ n IL-lRI-like receptor family members include a murine
protein MyD88 (Lord, K.A. et al., Oncogene 5: 1095- 1097 (1990)) and a human
gene, rsc786 (Nomura, N. et al., DNA Res. 1:27-35 (1994)). Another murine
receptor member, Tl/ST2, was previously characterized as a novel primary
response gene expressed in BAL/c-3T3 cells (Klemenz, R. et al., Proc. Natl.
Acad. Sci US~ 86:5708-5712 (1989); Tomin~ S., FEBSLett. 258:301-304
(1989); Tominga, S. et al., FEBSLett. 318:83-87 (1993)). The tr~n.cmemhrane
protein mulL-lR AcP (Greenfeder, S.A. et al., J. Biol. Chem. 270: 13757-13765
(1995)) has homology to both the type I and type II IL-lR. IL-lR AcP has
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
recently been shown to increase the affinity of IL-lRI for IL-l~ and may be
involved in meAi~tin~ the IL-1 response.
Tl Receptors. Tl/ST2 receptors (hereinafter, "Tl receptors"), as a
memberoftheIL-l receptorfamily(Bergers,G.,etal., EMBO~ 13:1176(1994))
has various homologs in different species. In the rat, it is called Fit-1, an
estrogen-inducible, c-fos-dependent transmembrane protein that shares 26% to
29% amino acid homology to the mouse IL-lRI and II, respectively, In the
mouse, the Fit-l protein is called ~T2 and in the human it is called T1. The
organization of the two IL- 1 receptors and the Fit- 1 /ST2/T1 genes indicates they
are derived from a common ancestor (Sims, J.E., et al., Cytokine 7:483 (1995)).
Fit-l exists in two forms: a membrane form (Fit-lM) with a cytosolic domain
similarly to that ofthe IL-lRI and Fit-lS, which is secreted and composed of theextracellular domain of Fit-M.
In many ways, these two forms of the Fit-1 protein are similar to those of
the membrane-bound and soluble IL-lRI. It has been shown that the IL-lsRI is
derived from proteolytic cleavage of the cell-bound form (Sims, J.E., et al.,
Cyto/ane 7:4~3 (1995)). On the other hand, the Fit-1 gene is under the control of
two promoters, which results in two isoforms coding for either the membrane or
soluble form of the receptor. Two RNA transcripts result from alternative RNA
splicing ofthe 3' end ofthe gene. Although IL-l,B binds weakly to Fit-1 and doesnot tr~n.~ ce a signal (Reikerstorger, A., et al., ~ Biol. Chem. 270:17645
(1995)), a chimeric receptor con~ ting of the e~ctracellular murine IL-lRI fusedto the cytosolic Fit-I tr~n~ducçs an IL-I signal (Reikerstorger, A., et al., J. Biol.
Chem. 270:17645 (1995)). The cytosolic portion of Fit-1 align with GTPase-like
sequences of IL-I RI (Hopp, T.P., Protein Sci. 4: 1851 (1995)) (see below).
IL-l prod~ction in various disease states. lncreased IL-I production has
been reported in patients with various viral, bacterial, fungal, and parasitic
infections; intravascular coagulation; high-dose IL-2 therapy; solid tumors;
lellk~ h~im~r's rii~ç~e; HIV-1 infection; autoimmune disorders; trauma
(surgery); hemodialysis; ischemic ~ e~cs (myocardial infarction); noninfectious
hepatitis; ~thm~; UV radiation; closed head injury; pancreatitis; periodontitis;
CA 02263830 1999-02-23
W O 98/07881 PCT~US96113777
graft-versus-host ~ e~e; transplant rejection; and in healthy subjects after
strenuous exercise. There is an association of increased IL-1,B production in
patients with ~17heimPr's disease and a possible role for IL- 1 in the release of the
amyloid precursor protein (Vasilakos, J.P., et al., FEBS Lett. 354:289 (1994)).
However, in most conditions, IL- 1 is not the only cytokine exhibiting increasedproduction and hence the specificity of the IL-l findings as related to the
pathogenesis of any particular disease is l~e~ing. In various disease states, IL- 1,B
but not IL-1 a is detected in the circulation.
lL-l in T/terapy. Although IL-1 has been found to exhibit many
important biological activities, it is also found to be toxic at doses that are close
to therapeutic dosages. (Dinarello, C.A., Blood 87:2095-2147 (March 15,
1996)). In general, the acute toxicities of either isoform of IL-l were greater after
intravenous compared with subcutaneous injection. Subcutaneous injection was
associated with signi~lcant local pail, erythema, and swelling (Kitamura, T., &
Takaku, F., Exp. Med. 7:170 (1989); T ~-lghlin, M.J., ~nn. Hematol. 67:267
(1993)). Patients receiving intravenous IL-l at doses of 100 ng/kg or greater
experienced significant hypotension. Patients receiving IL-1 ~ from 4 to 32 ng/kg
subcutaneously, there was only one episode of hypotension at the highest dose
level (I .al-ghlin, M.J., Ann. ~Iematol. 6~:267 (1993)).
Contrary to IL-1-associated myelostimulation in patients with normal
marrow reserves, patients with aplastic anemia treated with 5 daily doses of IL- 1 a
(30 to 100 ng/kg) had no increases in peripheral blood counts or bone marrow
cellularity (Walsh, C.E., et al., Br. J. Haematol 80:106 (1992)). IL-1 has been
~lmini~tPred to patients undergoing various re~;...~..l.~; of chemotherapy to reduce
the nadir of neutropenia and thrombocytopenia.
Daily tre~tm~nt with 40 ng/kg IL-la from day 0 to day 13 of autologous
bone marrow or stem cells resulted in an earlier recovery of n~ul,openia (median,
12 days; P < .001) (Weisdorf, D., etal., Blood84:2044 (1994)). After 14 days
of tre~tm~nt~ the bone marrow was significantly enriched with committed
myeloid progenitor cells. Similar results were reported in patients with AML
receiving 50 ng/kg/d of IL-l ~ for 5 days starting at the time of transplantation
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
with purged or nonpurged bone marrow (Nemunaitis, J., ef al., Blood 83:3473
(1994)). Injecting humans with low doses of either IL~ or IL- 1 ~ confirms the
ples~ive pyrogenic and hypotension-inducing properties of the molecules.
Ameliorafion of Disease Using Soluble II~l Receptors. Administration
S of murine IL-lsRI to mice has increased the survival of heterotopic hear
allografts and reduced the hyperplastic lymph node response to allogeneic cells
(Fanslow, W.C., e~ al., Science 248:739 (1990)). In a rat model of antigen-
in-lul~ec~ arthritis, local instillation ofthe murine IL-lsRI reduced joint swelling
and tissue destruction (Dower, S.K., el al., Therapeutic Immunol. 1:113 (1994)).These data suggest that the arnount of IL-lsRI ~mini~tered in the normal,
contralateral joint was acting systemically. In a model of experimental
autoimmllne encephalitits, the IL-lsRI reduced the severity of this disease
(Jacobs, C.A., et al., J. Immunol. 146:2983 (1991)).
Summary of the Inven~ion
The present invention provides isolated nucleic acid molecules comprising
a polynucleotide encoding a human T1 receptor-(TlR-)like ligand I polypeptide
having the amino acid sequence in FIG. I (SEQ ID N 0:2). The TlR-like ligand
I contains an open reading frame encoding a polypeptide of about 217 amino acid
residues including an N-t~rmin~l methionine, a leader sequence of about 27
amino acid residues, an extraceilular mature domain of about 151 residues, a
potential tr~n.~m~mhrane domain of about 23 residues and an intracellular domainof about 16 amino acid residues, and a deduced molecular weight of about 25
kDa. The 151 amino acid sequence ofthe expected mature extracellular TlR-like
ligand I protein is shown in FIG. I and in SEQ ID NO:2 (residues 28-178).
In another aspect, the invention provides isolated nucleic acid molecules
encoding an TlR-like ligand I having an amino acid sequence encoded by the
cDNA of the clone deposited as ATCC Deposit No. 97656 on July 12,1996.
Preferably, the nucleic acid molecule will encode the mature polypeptide encodedby the above-described deposited cDNA.
CA 02263830 1999-02-23
W O 98/07881 PCTAUS96113777
The invention is further directed to nucleic acid fragments of the nucleic
acid molecules described herein. By a fragment of an isolated nucleic acid
molecule having the nucleotide sequence of the deposited cDNA or the nucleotide
sequence shown in Figure I (SEQ ID NO: 1) is inten(led fragments at least about
15 nt, and more preferably at least about 20 nt, still more preferably at least about
30 nt, and even more preferably, at least about 40 nt in length which are usefulas diagnostic probes and primers as discussed herein. Of course, larger fr~gm~nt~
50-738 nt in length are also useful according to the present invention as are
fragments corresponding to most, if not all, of the nucleotide sequence of the
deposited cDNA or as shown in Figure 1 (SEQ ID NO: 1). By a fragment at least
20 nt in length, for example, is intended fr~gment.~ which include 20 or more
contiguous bases from the nucleotide se~uence of the deposited cDNA or the
nucleotide sequence as shown in Figure 1 (SEQ ID NO: 1). Since the gene has
been deposited and the nucleotide sequence shown in Figure 1 (SEQ ID NO:1)
is F~rovided, generating such DNA fragments would be routine to the skilled
artis~n. For example, restriction endonuclease cleavage or shearing by sonication
could easily be used to generate fragments of various sizes. Alternatively, suchfragments could be generated synthetically.
Preferred nucleic acid fragments include nucleic acid molecules which
encode: a leader sequence of about 27 amino acid residues (amino acid residues
from about I to about 27 in Figure 1 (SEQ ID NO:2); an extracellular mature
domain of about 15 lresidues (amino acid residues from about 28 to about 178 in
Figure l (SEQ ID NO:2); a tr~n.~memhrane domain of about 23 amino acids
(amino acid residues from about 179 to about 201 in Figure 1 (SEQ ID NO:2);
an intracellular domain of about 16 amino acids (amino acid residues from about
202 to about 217 in Figure 1 (SEQ ID NO:2); and a polypeptide comprinsing the
extracellular and intracellular domains having all or part of the transmembrane
region deleted.
Further embodiments of the invention include an isolated nucleic acid
molecule having a nucleotide sequence that is at least 90% identical and, more
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
preferably, at least 95%, 96%, 97%, 98%, or 99% identical to the nucleotide
sequence of any of the nucleic acid molecules described herein.
The present invention also relates to recombinant vectors which include
the isolated nucleic acid molecules ofthe present invention, host cells cont~ining
the recombinant vectors, and the production of TlR-like ligand I polypeptides orfragments thereof by recombinant techniques.
The polypeptides ofthe present invention include the polypeptide encoded
by the deposited cDNA, the polypeptide of Figure 1 (SEQ ID NO:2) (in particular
the mature polypeptide), as well as polypeptides having an amino acid sequence
with at least 90% similarity, more preferably at least 95% similarity to the amino
acid sequence of the polypeptide encoded by the deposited cDNA, the
polypeptide of Figure 1 (SEQ ID NO:2), or a fragment thereof. Further
polypeptides of the present invention include polypeptides having an amino acid
sequence at least 80% identical, more preferably, at least 90% or 95% identical
to the amino acid sequence of the polypeptide encoded by the deposited cDNA,
the polypeptide of Figure 1 (SEQ ID NO:2), or a fragment thereof.
Preferred polypeptide fr~gment.c according to the present invention
include a polypeptide comprising: the mature polypeptide, the extracellular
domain, the transmembrane domain, the intracellular clom~in, or the extracellular
and intracellular domain with all or part of the transmembrane domain deleted.
An additional embodiment of the invention relates to a polypeptide or
peptide having the amino acid sequence of an epitope-bearing portion of an Tl R-like ligand I described herein. Peptides or polypeptides having the amino acid
sequence of an epitope-bearing portion of an Il,-1-like polypeptide of the
invention include portions of such polypeptides with at least 6-30 or 9-50 arnino
acids, although epitope-bearing polypeptides of any length up to and including
the entire amino acid sequence of a polypeptide of the invention described herein
also are included.
In another embodiment the invention provides an isolated antibody that
binds specifically to an TlR-like ligand I polypeptide having an amino acid
sequence as described herein.
.
CA 02263830 1999-02-23
wo 98/07881 PCT~US96/13777
It is believed that biological activities of the TlR-like ligand I of the
present invention are similar to the biological activities of the T1 R ligand and IL-
1. Significantly, higher or lower levels of TlR-like ligand I may be detected intissues or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid)
taken from an individual having a TlR ligand- or IL-l-related disorder, relativeto a "normal" TlR-like ligand I gene expression level, i.e., the expression level
in tissue or bodily fluids from an individual not having the Tl R ligand- or IL- 1-
related disorder. Thus, ~letecting ~ cs~ion of TlR-like ligand I gene expressionaccording to the present invention is a diagnostic marker.
In a further embodiment, the invention is related to a method for treating
an individual in need of an increased or decreased level of TlR-like ligand I
activity in the body, comprising a~imini~tering to such an individual a
composition comprising a TlR-like ligand I polypeptide or an inhibitor thereof.
The invention further provides methods for isolating antibodies that bind
specifically to an TlR-like ligand I polypeptide having an amino acid sequence
as described herein. Such antibodies may be useful diagnostically or
therapeutically as described above.
Brief Descrip~ion of fhe Figures
FIG. I shows the nucleotide (SEQ ID NO:1) and deduced amino acid
(SEQ ID N 0:2) sequences of the TlR-like ligand I protein determined by
sequencing the cDNA clone contained in ATCC Deposit No. 97656. Amino
acids from about 1 to about 27 represent the signal peptide (first underlined
sequence); amino acids from about 28 to about 178 the extracellular domain
(sequence between the first and second underlined sequences); amino acids from
about 179 to about 201 the transmembrane domain (second underlined sequence);
and amino acids from about 201 to about 217 the intracellular domain (the
rem~inin~ sequence).
CA 02263830 1999-02-23
W O98/07881 PCTrUS9~/13777
FIG. 2 shows the regions of similarity between the amino acid sequences
of the TlR-like ligand I and the protein sequence of GenBank accession No.
U41804 (SEQ ID NO:3), showing an overall 33% identity.
FIG. 3 provides an analysis of the Tl R-like ligand I amino acid sequence.
Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity;
Amphir~thic regions; flexible regions; antigenic index and surface probability are
shown.
De~ailed Description of fhe Invention
The present invention provides an isolated nucleic acid molecule
comprising a polynucleotide encoding a TlR-like ligand I protein having an
amino acid sequence shown in Figure 1 (SEQ ID NO:2), which was determin.o~l
by sequencing a cloned cDNA. The TlR-like ligand I protein of the present
invention shares sequence homology with the TlR ligand (Figure 2).
The nucleotide sequence in FIG. 1 (SEQ ID NO:l) was obtained by
sequencing the HEMEM90 clone, which was deposited on July 12, 1996 at the
Arnerican Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland
20852, and given accession number 97656. The deposited clone is contained in
the pBluescript SK(-) plasmid (Stratagene, LaJolla, CA).
Nucleic Acid MolPculP~
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino
acid sequences of peptide, polypeptides or proteins encoded by DNA molecules
dPt~nnin~d herein were expected by translation of a DNA sequence determined
as above. Therefore, as is known in the art for any DNA sequence determined by
this automated approach, any nucleotide sequence det~ ed herein can contain
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
- 10-
some errors. Nucleotide sequences d~tennined by automation are typically at
least about 90% identical, more typically at least about 95% to at least about
99.9% identical to the actual nucleotide sequence of the sequenced DNA
molecule.
The actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in the art.
As is also known in the art, a single insertion or deletion in a determined
nucleotide sequence compared to the actual sequence will cause a frame shift in
translation of the nucleotide sequence such that the expected amino acid sequence
encoded by a determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA molecule,
beginning at the point of such an insertion or deletion.
Unless otherwise indicated, each "nucleotide sequence" set forth herein
is presented as a sequence of deoxyribonucleotides (abbreviated A, G, C and T).
However, by "nucleotide sequence" of a nucleic acid molecule or polynucleotide
is intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotides (A, G, C and U) where each thymidine
deoxynucleotide (T) in the specified deoxynucleotide sequence in is replaced by
the ribonucleotide uridine (U). For instance, reference to an RNA molecule
having the sequence in SEQ ID NO:1 set forth using deoxyribonucleotide
abbreviations is intended to indicate an RNA molecule having a sequence in
which each deoxynucleotide A, G or C in SEQ ID NO: I has been replaced by the
corresponding ribonucleotide A, G or C, and each deoxynucleotide T has been
replaced by a ribonucleotide U.
By "isolated" nucleic acid molecule(s) is int~n-1erl a nucleic acid molecule,
DNA or RNA, which has been removed from its native environment For
example, recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further examples of isolatedDNA molecules include recombinant DNA molecules m~int~ined in heterologous
host cells or purified (partially or substantially) DNA molecules in solution.
CA 02263830 1999-02-23
WO 9~ 8I PCT/US96/13777
Isolated RNA molecules include in vivo or in vitro RNA ~ SCliylS of the DNA
molecules of the present invention. Isolated nucleic acid molecules according tothe present invention further include such molecules produced synthetically.
Using the information provided herein, such as the nucleotide sequence
in FIG. l (SEQ ID NO:1), a nucleic acid molecule of the present invention
encoding an TlR-like ligand I polypeptide can be obtained using standard cloningand screening procedures, such as those for cloning cDNAs using mRNA as
starting material. Illustrative of the invention, the nucleic acid molecule
described in FIG. I (SEQ ID NO:I) was discovered in a cDNA library derived
from human endothelial tissue. Further, the gene was also found in cDNA
libraries derived from the following types of human cells: adult heart, TNF
induced amniotic cells, chondrosarcoma, fetal kidney, fetal heart, hippocampus,
Jurkat T-cells, Jurkat membrane bound polysomes, microvascular endothelial,
smooth muscle, salivary gland, tonsils, thymus, activated T-cells, fetal liver
spleen, and infant brain.
The TlR-like ligand I cDNA contains an open reading frame encoding a
protein of about 217 amino acid residues whose initiation codon is at positions
88-90 of the nucleotide sequence shown in FIG. I (SEQ ID NO. I); a predicted
leader sequence of about 27 amino acid residues and a d~ r.ed molecular weight
of about 26 kDa. The amino acid sequence of the mature TlR-like ligand I
protein is shown in FIG. l (SEQ ID NO:2) from amino acid residue 28 to residue
217. The mature TlR-like ligand I protein has three main structural domains.
These include the extracellular domain, from amino acid residue about 28 to
about 17~ in FIG. 1 (SEQ ID NO:2); the tr~n.cmçmbrane domain, from amino acid
residue about 179 to about 201 in FIG. 1 (SEQ ID NO:2)); and the intracellular
domain, from amino acid residue about 202-217 in FIG. I (SEQ ID NO:2)). The
TlR-like ligand I protein of the present invention in Figure I (SEQ ID NO:2) is
about 33 % identical and about 52 % similar to the TIR ligand, which can be
~ccç~sed on GenBank as Accession No. U41804.
As one of o~di~l~uy skill would appreciate, due to the possibilities of
sequencing errors ~iiecl1~cecl above, as well as the variability of cleavage sites for
CA 02263830 1999-02-23
W O98/07881 PCTrUS96113777
leaders in different known proteins, the actual TlR-like ligand I encoded by thedeposited cDNA comprises about 217 amino acids, but can be anywhere in the
range of 200-225 amino acids; and the dedllcecl leader sequence of this protein is
about 27 amino acids, but can be anywhere in the range of about 15 to about 40
amino acids. Further, for example, the exact locations of the T1 R-like ligand Iprotein extracellular, intracellular and transmembrane domains in Figure l (SEQ
ID NO:2) may vary slightly (e.g., the exact amino acid positions may differ by
about 1 to about 5 residues coll,pa~ed to that shown in Figure 1 ) depending on the
criteria used to define the domain.
As indicated, nucleic acid molecules of the present invention can be in the
form of RNA, such as mRNA, or in the forrn of DNA, including, for instance,
cDN~ and genomic DNA obtained by cloning or produced synthetically. The
DNA can be double-stranded or single-stranded. Single-stranded DNA or RNA
can be the coding strand, also known as the sense strand, or it can be the non-
coding strand, also referred to as the anti-sense strand.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising an open reading frame (ORF) with an initiation codon at
positions 88-90 of the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1 ) and
further include DNA molecules which comprise a sequence subst~nti~lly dirre,~nt
that all or part of the ORF whose initiation codon is at position 88-90 of the
nucleotide sequence in FIG. I (SEQ ID NO: 1) but which, due to the degeneracy
of the genetic code, still encode the TlR-like ligand I protein or a fragment
thereof. Of course, the genetic code is well known in the art. Thus, it would beroutine for one skilled in the art to generate the degenerate variants describedabove.
In another aspect, the invention provides isolated nucleic acid molecules
encoding the TlR-like ligand I protein having an amino acid sequence encoded
by the cDNA clone contained in the plasmid deposited as ATCC Deposit No.
97656 on July 12, 1996. Preferably, this nucleic acid molecule will encode the
mature polypeptide encoded by the above-described deposited cDNA clone.
CA 02263830 1999-02-23
wo 3~,~7a~l PCT/US96/13777
The invention further provides an isolated nucleic acid molecule having
the nucleotide sequence shown in FIG. I (SEQ ID NO:1) or the nucleotide
sequence of the TlR-like ligand I cDNA contained in the above-described
deposited clone, or having a sequence complementary to one of the above
sequences. Such isolated molecules, particularly DNA molecules, are useful as
probes for gene mapping by in situ hybridization with chromosomes and for
detecting expression of the TlR-like ligand I gene in human tissue, for instance,
by Northern blot analysis. As described in detail below, detecting altered TlR-
like ligand I gene expression in certain tissues may be indicative of certain
I 0 disorders.
The present invention is further directed to fragments of the isolated
nucleic acid molecules described herein. By a fragment of an isolated nucleic
acid molecule having the nucleotide sequence of the deposited cDNA or the
nucleotide sequence shown in Figure 1 (SEQ ID NO. 1) is intended fragments at
least about 15 nt, and more preferably at least about 20 nt, still more preferably
at least about 30 nt, and even more preferably, at least about 40 nt in length which
are useful as diagnostic probes and primers as discussed herein. Of course, larger
fragments 50-1200 nt in length are also useful according to the present invention
as are fir~gment.~ corresponding to most, if not all, of the nucleotide sequence of
the deposited cDNA or as shown in Figure l (SEQ ID NO. 1 ) . By a fragment at
least 20 nt in length, for example, is intended fr~gm~nt.c which include 20 or more
contiguous bases from the nucleotide sequence of the deposited cDNA or the
nucleotide sequence as shown in Figure 1 (SEQ ID NO. 1). Since the gene has
been deposited and the nucleotide sequence shown in Figure 1 (SEQ ID NO 1 )
is provided, generating such DNA fragments would be routine to the skilled
artisan. For example, restriction endonuclease cleavage or ~he~ring by sonication
could easily be used to generate fMgm~ntc of various sizes. Alternatively, such
fragments could be generated synthetically.
Preferred nucleic acid fragmPnt~ of the present invention include nucleic
acid molecules encoding: a polypeptide comprising the TlR-like ligand I
extracellular domain (amino acid residues from about 28 to about 178 in Figure
CA 02263830 1999-02-23
WO ~ hl PCI/US96/13777
- 14-
1 (SEQ ID NO: I); a polypeptide comprising the TlR-like ligand I
transmembrane domain (amino acid residues from about 179 to about 201 in
Figure I (SEQ ID NO 1)); a polypeptide comprising the TlR-like ligand I
intracellular domain (amino acid residues from about 202 to about 217 in Figure
S 1 (SEQ ID NO. 2)); and a polypeptide comprising the TlR-like ligand I
extracellular and intracellular domains having all or part of the transmembrane
domain deleted. Further preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of the T1 R-like
ligand I protein. In particular, isolated nucleic acid molecules are provided
encoding polypeptides comprising the following amino acid residues in Figure
1 (SEQ ID NO:2), which the present inventors have determined are antigenic
regions of the TlR-like ligand I protein: a polypeptide comprising amino acid
residues from about 20 to about 53 in Figure 1 (SEQ ~D NO:2); a polypeptide
comprising amino acid residues from about 82 to about 98 in Figure 1 (SEQ ID
NO:2); a polypeptide comprising amino acid residues from about 106 to about
134 in Figure I (SEQ ID NO:2); and a polypeptide comprising amino acid
residues from about 155 to about 184. Methods for determining other such
epitope-bearing portions of the Tl R-like ligand I protein are described in detail
below.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising a polynucleotide which hybridizes under stringent hybridization
conditions to a portion of the polynucleotide in a nucleic acid molecule of the
invention described above, for instance, the cDNA clone contained in ATCC
Deposit 97656. By "stringent hybridization conditions" is inten(led overnight
incllb~tion at 42~C in a solution comprising: 50% formamide, 5x SSC (150 mM
NaCl, 1 5mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5x
Denhardt's solution, 10% dextran sulfate, and 20 ~lg/ml denatured, sheared
salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65DC.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide is
int~n~le~l a polynucleotide (either DNA or RNA) hybridizing to at least about 15nucleotides (nt), and more preferably at least about 20 nt, still more preferably at
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
least about 30 nt, and even more preferably at least about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and primers as
discussed above and in more detail below.
Of course, polynucleotides hybridizing to a larger portion of the reference
polynucleotide (e.g., the deposited cDNA clone), for instance, a portion 100-750nt in length, or even to the entire length of the reference polynucleotide, alsouseful as probes according to the present invention, as are polynucleotides
corresponding to most, if not all, of the nucleotide sequence of the deposited
cDNA or the nucleotide sequence as shown in FIG. I (SEQ ID NO:1). By a
portion of a polynucleotide of "at least 20 nt in length," for exarnple, is intended
20 or more contiguous nucleotides from the nucleotide sequence of the reference
polynucleotide, (e.g, the deposited cDNA or the nucleotide sequence as shown
in FIG. I (SEQ ID NO: 1)). As indicated, such portions are useful diagnosticallyeither as a probe according to conventional DNA hybridization techniques or as
primers for amplification of a target sequence by the polymerase chain reaction
(P~R), as described, for instance, in Sambrook, J. et aL, eds., Molecular Cloning,
A Laboratory Manual, 2nd. edition, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY (1989).
Since an TlR-like ligand I cDNA clone has been deposited and its
dete~nined nucleotide sequence is provided in FIG. 1 (SEQ ID NO: 1), generating
polynucleotides which hybridize to a portion of the TlR-like ligand I cDNA
molecule would be routine to the skilled artisan. For example, restriction
endonuclease cleavage or shearing by sonication of the T1 R-like ligand I cDNA
clone could easily be used to generate DNA portions of various sizes which are
polynucleotides that hybridize to a portion of the TlR-like ligand I cDNA
molecule. Alternatively, the hybridizing polynucleotides of the present invention
could be generated synthetically according to known techniques.
Of course, a polynucleotide which hybridizes only to a poly A sequence
(such as the 3 ' terminal poly(A) tract of the T1 R-like ligand I cDNA shown in
FIG. I (SEQ ID NO: 1)), or to a complementary stretch of T (or U) resides, wouldnot be included in a polynucleotide of the invention used to hybridi~ to a portion
,
CA 02263830 1999-02-23
W 03~~'C/~&l PCT~US96113777
- 16-
of a nucleic acid of the invention, since such a polynucleotide would hybridize
to any nucleic acid molecule contain a poly (A) stretch or the complement thereof
(e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which
encode the TlR-like ligand I can include, but are not limited to, those encodingthe amino acid sequence of the mature polypeptide, by itself; the coding sequence
for the mature polypeptide and additional sequences, such as those encoding the
about 27 amino acid leader sequence, such as a pre-, or pro- or prepro- protein
sequence; the coding sequence of the mature polypeptide, with or without the
aforementioned additional coding sequences, together with additional, non-
coding sequences, including for example, but not limited to introns and non-
coding S' and 3' se~uences, such as the transcribed, non-tran~l~ted sequences that
play a role in transcription, mRNA processing - including splicing and
polyadenylation signals, e.g., ribosome binding and stability of mRNA; an
additional coding sequence which codes for additional amino acids, such as thosewhich provide additional functionalities. Thus, the sequence encoding the
polypeptide can be fused to a marker sequence, such as a sequence encoding a
peptide which facilitates purification of the fused polypeptide. In certain
preferred embo~liment~ of this aspect of the invention, the marker amino acid
sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are publicly and/or commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. US~ 86:821-824
(1989), for instance, hexa-histidine provides for convenient purification of thefusion protein. The "HA" tag is another peptide useful for purification which
corresponds to an epitope derived from the influenza h~m:~gglutinin (HA) protein,
which has been described by Wilson et al., Cell 3 7:767 (1984). Other such fusion
proteins include the TlR-like ligand I protein or a fragment thereof fused to Fcat the N- or C-termin~
The present invention further relates to variants of the nucleic acid
molecules ofthe present invention, which encode portions, analogs or derivativesof the TlR-like ligand I protein. Variants can occur naturally, such as a natural
CA 02263830 l999-02-23
W O 98/07881 PCT~US96/13777
allelic variant. By an "allelic variant" is intended one of several alternate forms
of a gene occupying a given locus on a chromosome of an org~nism Non-
naturally occurring variants can be produced, e.g, using art-known mutagenesis
techniques.
Such variants include those produced by nucleotide substitutions,
deletions or additions. The substitutions, deletions or additions can involve one
or more nucleotides. The variants can be altered in coding or non-coding regionsor both. Alterations in the coding regions can produce conservative or non-
conservative amino acid substitutions, deletions or additions. Especially
plc~ d among these are silent substitutions, additions and deletions, which do
not alter the properties and activities of the TlR-like ligand I or portions thereof.
Also especially pl~r~lled in this regard are conservative substitutions.
Further embodiments of the invention include isolated nucleic acid
molecules compr-~ing a polynucleotide having a nucleotide sequence at least 90%
identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical to
(a) a nucleotide sequence encoding the full-length TlR-like ligand I having the
complete amino acid sequence (including the leader) sho~vn in FIG. 1 (SEQ ID
NO:2) or as encoded by the cDNA clone contained in ATCC Deposit No. 97656;
(b) a nucleotide sequence encoding the mature TlR-like ligand I (full-length
polypeptide with the leader sequence removed) having the amino acid sequence
at positions from about 28 to about 217 in FIG. 1 (SEQ ID NO:2) or as encoded
by the cDNA clone contained in ATCC Deposit No. 97656; (c) a nucleotide
sequence çncof~ing the TlR-like ligand I extracellular domain having the amino
acid sequence at positions from about 28 to about 178 in FIG. 1 (SEQ ID NO:2)
or as encoded by the cDNA clone contained in ATCC Deposit No. 97656; (d) a
nucleotide sequence encoding the TlR-like ligand I transmembrane domain
having the amino acid sequence at positions from about 179 to about 201 in FIG.
1 (SEQ ID NO:2) or as encoded by the cDNA clone contained in ATCC Deposit
No. 97656; (e) a nucleotide sequence encoding the T1 R-like ligand I intracellular
domain having the arnino acid sequence at positions from about 202 to about 217
in FIG. 1 (SEQ lD NO:2) or as encoded by the cDNA clone contained in ATCC
.
CA 02263830 1999-02-23
W O98/07881 PCT~US96/13777
-18-
Deposit No. 97656; or (f) a nucleotide sequence complementary to any of the
nucleotide sequences in (a), (b), (c), (d), or (e).
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a TlR-like ligand
I polypeptide is intended that the nucleotide sequence of the polynucleotide is
identical to the reference sequence except that the polynucleotide sequence can
include up to five mutations per each 100 nucleotides of the reference nucleotide
sequence encoding the TlR-like ligand I polypeptide. In other words, to obtain
a polynucleotide having a nucleotide sequence at least 95% identical to a
reference nucleotide sequence, up to 5% of the nucleotides in the reference
sequence can be deleted or substituted with another nucleotide, or a number of
nucleotides up to 5% of the total nucleotides in the reference sequence may be
inserted into the reference sequence. These mutations of the reference sequence
can occur at the 5' or 3' terminal positions of the reference nucleotide sequence
or anywhere between those termin~l positions, interspersed either individually
among nucleotides in the reference sequence or in one or more contiguous groups
within the reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least 90%, 95%, 96%, 97%, 98%, or 99% identical to, for instance, the nucleotidesequence shown in FIG. 1 or to the nucleotide sequence of the deposited cDNA
clone can be determined conventionally using known computer programs such
as the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
Madison, WI 53711. BESTFIT uses the local homology algorithm of Smith and
Waterman,,4dv. Appl. Math. 2:482-489 (1981), to find the best segment of
homology bet~veen two sequences. When using BESTFIT or any other sequence
alignment program to determine whether a particular sequence is, for instance,
95% identical to a reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity is calculated
over the full length of the reference nucleotide sequence and that gaps in
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
- 19-
homology of up to 5% of the total nurnber of nucleotides in the reference
sequence are allowed.
The present application is directed to nucleic acid molecules at least 90%,
95%, 96%, 97%, 98%, or g9% identical to a nucleic acid sequence described
above irrespective of whether they encode a polypeptide having T1 R-like ligand
I protein activity. This is because, even where a particular nucleic acid molecule
does not encode a polypeptide having Tl R-like ligand I activity, one of skill in
the art would still know how to use the nucleic acid molecule, for instance, as a
hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the
nucleic acid molecules of the present invention that do not encode a polypeptidehaving TlR-like ligand I activity include, inter alia, (1) isolating the TlR-like
li~and I gene or allelic variants thereof in a cDNA library; (2) in situ
hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide
precise chromosomal location of the TlR-like ligand I gene as described in
Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon
Press, New York (1988); and (3) Northern Blot analysis for detecting TlR-like
ligand I mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least
90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence
described above which do, in fact, encode a polypeptide having TlR-like ligand
I protein activity.
By "a polypeptide having Tl R-like ligand I protein activity" is int~nr~ed
polypeptides exhibiting activity similar, but not necessarily identical, to an
activity of the TlR-like ligand I protein of the invention as measured in a
particular biological assay. TlR-like ligand I activity can be assayed using
known receptor binding assays (Mitcham, J.L. et al., J. Biol. Chem. 271:5777-
5783 (1996); and Gayle, M.A. et al., J. Biol. Chem. 271 :5784-5789 (1996)).
These assays include an NF-KB gel shift assay, an in vitro Thr-669 kinase assay,and an IL-8 promoter activation assay.
To pe.r~ - these assays, it is first necessary to transfect m~mm~ n cells
with an expression vector containing the cDNA for a suitable receptor. ~or
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96/13777
-20-
example, an expression vector c~ the cDNA for the T1/ST2 receptor can
be used. This cDNA can be obtained as described (Klemenz, R. et al., Proc,
Natil. Acad. Sci. U.S.A. 86:5708-5712 (1989); Tomin~g~, S., FEBSLett. 258:301-
304; Bergers, G. et al. EMBO J. 13:1176-1188)). Alternatively, Tl/ST2 cDNA
can be amplified using the polymerase chain reaction. A commercially available
cDNA library, prepared from mRNA from a suita1ole tissue or cell type (such as
NIH-3T3 cells (Klemenz, R. et al., Proc, Natl. Acad. Sci. U.S.A. 86:5708-5712
(1989)), can be used as template. Using any of several transfection methods wellknown to those of ordinary skill in the art, a suitable cell line (e.g., COS 7cells)
can be transfected with the Tl/ST2 expression plasmid. Expression of the
receptor can be verified by radioimmunoassay (see Mitcham, J.L. et al., ~ Biol.
Chem. 271:5777-5783 (1996)). One to three days post-transfection, confluent
transfected COS7 cells are stimulated with 1 - 10 ng of T1 R-like ligand I protein
for 15 minutes to 20 hours. Duration of stim~ tion by T1 R-like ligand I proteinwill vary, depending on which assay is used, and can be determined using only
routine ~ entation.
To perforrn the NF-lcB assay, nuclear extracts from transfected cells are
prepared immediately after stim~ tion (Ostrowski, J. et al., J. Biol. Chem. 266:12,722-12,733 (1991)). A doùble-stranded synthetic oligonucleotide probe (5'
TGACAGAGGGACTTTCCGAGAGGA 3') cont~inin~ the NF-KB enhancer
element from the immunoglobulin lc light chain is 5'-end labeled by
phosphorylation with ~y-32P]ATP. Nuclear extracts (10 ,ug) are incubated with
radiolableed probe for 20 minutes at room ten,l)~.dlulc, and protein-DNA
complexes are resolved by electrophoresis in a 0.5X TBE, 10% polyacrylamide
gel.
To perform the in vitro Thr-669 kinase assay, cytoplasmic extracts of
transfected eells are prepared immediately after stim~ tion (Bird, T.A. et al.,
Cytokine 4:429-440 (1992)). 10 ~1l of cell extract is added to 20 ~ of
reactio~,..ixl.~.e eu~ ing 20 mM HEPES buffer (pH 7.4), 15 mM MgCI2, 15
~M ATP, 7S ,uCi/ml [y-32P]ATP, and 750 ~M substrate peptide (residues 663-
673 of EGFR). Blands are incubated with distilled HsO in place of the peptide.
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
After inr.uh~tion at 30~C for 20 minlltes, the reactions are termin~tecl by addition
of formic acid. Reactions are cleared by centrifugation, and 30 ,ul of supernatant
are spotted on phoshocellulase paper discs. After washing (three times with 75
mM orthophosphoric acid) and drying, peptide-incorporated counts are
determin~d bymonitoring Cerenkov counts. Results are expressed as the ratio of
Thr-669 kinase activity detected in unstimulated cells compared to activity
detected in stimulated cells.
To perform the IL-8 promoter activation assay, COS7 cells (1 x 105 cells
per well in a 12-well tissue culture plate) are cotransfected with the T1/ST2
receptor e~ ession vector and the pIL8p reporter plasmid (Mitcham, J.L. et al.,
J. Biol. Chem. 271:5777-5783 (1996)). One day post-transfection, the medium
is changed and and cells are either stimulated with l ng/ml IL-la or are left
stimulated. 12-16 hours post-stimulation, cells are washed twice with binding
medium co.~ g 5% (wtv) non-fat dry milk (5% MBM) and blocked with 2 ml
of 5% MBM at room temperature for 30 minutes. Cells are then incubated at
room temperture for 60-90 minlltes with 1.5 ml/well of 5% MBM cont~ining 1
llg/ml of an anti-IL-2Ra antibody (R&D Systems, Minneapolis, MN) with gentle
rocking. Cells are washed once with 5% MBM and incubated with 1 jl/well of
5% MBM c~ g 1:100 dilution of l25I-goat anti-moust IgG (Sigma, St. Louis,
MO) for 60 mimltes at room te~llpe~ re. Wells are washed four times with 5%
MBM and twice with phosphate-buffered saline. Wells are stripped by the
addition of 1 ml of 0.5 M NaOH, and total counts are determined. Results are
e~ cssed as total cpm averged over two duplicate or three triplicate wells.
Thus, "a polypeptide having Tl R-like ligand I protein activity" includes
polypeptides that exhibit T1 R-like ligand I protein activity in the above-described
assay.
Of course, due to the degeneracy of the genetic code, one of ordinary skill
in the art will immediately recognize that a large number of the nucleic acid
molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99%
identical to a nucleic acid sequence described above will encode a polypeptide
"having TlR-like ligand I protein activity." In fact, since degenerate variants of
CA 02263830 1999-02-23
WO ~I'C /~81 PCTIUS96113777
these nucleotide sequences all encode the sarne polypeptide, this will be clear to
the skilled artisan even without performing the above described comparison
assay. It will be further recognized in the art that, for such nucleic acid molecules
that are not degenerate variants, a reasonable number will also encode a
S polypeptide having TlR-like ligand I activity. This is because the skilled artisan
is fully aware of amino acid substitutions that are either less likely or not likely
to significantly effect protein function (e.g., replacing one aliphatic amino acid
with a second aliphatic amino acid).
For exarnple, guidance concerning how to make phenotypically silent
amino acid substitutions is provided in Bowie, J.U. et al., Science 247. 1306-1310
(1990), wherein the authors indicate that there are two main approaches for
studying the tolerance of an amino acid sequence to change. The first method
relies on the process of evolution, in which mutations are either accepted or
rejected by natural selection. The second approach uses genetic engineering to
introduce amino acid changes at specific positions of a cloned gene and selections
or screens to identify sequences that m~int:~in functionality. As the authors state,
these studies have revealed that proteins are surprisingly tolerant of amino aeid
substitutions. The authors further indicate which amino acid changes are likely
to be permissive at a certain position of the protein. For exarnple, most buriedarnino acid residues require nonpolar side chains, whereas few features of surface
side ehains are generally eonserved. Other sueh phenotypieally silent
substitutions are deseribed in Bowie, J.U., et al., supra, and the references eited
therein.
Vectors and Host Cells
The present invention also relates to veetors which include the isolated
DNA moleeules of the present invention, host cells whieh are genetically
~nginP.ored with the reeombinant veetors, and the production of Tl R-like ligandI polypeptides or fragments thereof by reeombinant teehniques.
CA 02263830 1999-02-23
W O98/07881 PCT~US96/13777
-23-
Recombinant constructs may be introduced into host cells using well
known techniques such as infection, transduction, transfection, transvection,
electroporation and transformation. The vector may be, for example, a phage,
plasmid, viral or retroviral vector. Rekoviral vectors may be replication
S competent or replication defective. In the latter case, viral propagation generally
will occur only in complementing host cells.
The polynucleotides may be joined to a vector cont~ining a selectable
marker for propagation in a host. Generally, a plasmid vector is introduced in aprecipitate, such as a calcium phosphate precipitate, or in a complex with a
charged lipid. If the vector is a virus, it may be packaged in vitro using an
appropriate p~r~eing cell line and then transduced into host cells.
Preferred are vectors comprising cis-acting control regions to the
polynucleotide of interest. Appropriate trans-acting factors may be supplied by
the host, supplied by a complementing vector or supplied by the vector itself
upon introduction into the host.
In certain preferred embodiments in this regard, the vectors provide for
specific ~ ci,~ion, which may be inducible and/or cell type-specific. Particularly
preferred among such vectors are those inducible by environmental factors that
are easy to manipulate, such as telll~eldlllre and nutrient additives.
Expression vectors useful in the present invention include chromosomal-,
episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids,
bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as
baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox viruses,pseudorabies viruses and retroviruses, and vectors derived from combinations
thereof, such as cosmids and phagemids.
The DNA insert should be operatively linked to an a~lo~iate promoter,
such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the
SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
Other suitable promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation, t.?l~nin~tion and,
in the kanscribed region, a ribosome binding site for kanslation. The coding
_, .,
.. . ... ~ .... ..
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
- 24 -
portion of the mature transcripts expressed by the constructs will include a
translation initiating AUG at the beginnine and a termin~tjon codon a~plu~liately
positioned at the end of the polypeptide to be translated.
As indicated, the expression vectors will preferably include at least one
selectable marker. Such markers include dihydrofolate reductase or neomycin
resistance for eukaryotic cell culture and tetracycline or ampicillin resistancegenes for culturing in E. coli and other bacteria. Representative examples of
appropriate hosts include bacterial cells, such as E. coli, Streptomyces and
Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such
as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and
Bowes melanoma cells; and plant cells. Appropriate culture media and
conditions for the above-described host cells are known in the art.
Among vectors pl~felled for use in bacteria include pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
Among ~)rere.l~d eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI
and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Ph~ Other suitable vectors will be readily a~)palellt to the
skilled artisan.
Among known bacterial promoters suitable for use in the present
invention include the E. coli lacI and lacZ promoters, the T3 and T7 promoters,
the ~pt promoter, the lambda PR and PL promoters and the trp promoter.
Suitable eukaryotic promoters include the CMV immediate early promoter, the
HSV thymidine kinase promoter, the early and late SV40 promoters, the
promoters of retroviral LTRs, such as those of the Rous sarcoma virus (RSV),
and metallothionein promoters, such as the mouse metallothionein-I promoter.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-
m~ tPrl transfection, electroporation, transduction, infection or other methods.
CA 02263830 1999-02-23
WO 98107881 PCT/US96/13777
Such methods are described in many standard laboratory manuals, such as Davis
e~ al., Basic Methods in Molecular Biology (1986).
Transcription of the DNA encoding the polypeptides of the present
invention by higher eukaryotes may be increased by inserting an enhancer
se~uence into the vector. Enhancers are cis-acting elements of DNA, usually
about from 10 to 300 bp that act to increase transcriptional activity of a promoter
in a given host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp 100 to 270, the
cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side
of the replication origin, and adenovirus enhancers.
For secretion of the translated protein into the lumen of the endoplasmic
reticulum, into the periplasmic space or into the extracellular environment,
al)yf~yliate secretion signals may be incoryorated into the e~ylessed polypeptide.
The signals may be endogenous to the polypeptide or they may be heterologous
1 5 signals.
Thus, the polypeptide may be expressed in a modified form, such as a
fusion protein, and may include not only secretion signals but also additional
heterologous functional regions. For instance, a region of additional amino acids,
particularly charged arnino acids, may be added to the N-terrninus of the
polypeptide to improve stability and persistence in the host cell, during
purification or during subsequent h~nt~ling and storage. Also, peptide moieties
may be added to the polypeptide to facilitate purification. Such regions may be
removed prior to final preparation of the polypeptide. The addition of peptide
moieties to polypeptides to engender secretion or excretion, to improve stability
and to facilitate purification, among others, are f~qmili~r and routine techni~ues
in the art. A preferred fusion protein comprises a heterologous region from
imrnunoglobulin that is useful to solubilize proteins. For exarnple, EP-A-O 464
533 (C~n~ n co~lt~lyall 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with another
human protein or part thereof. In many cases, the Fc part in a fusion protein isthoroughly advantageous for use in therapy and diagnosis and thus results, for
. . .
CA 02263830 1999-02-23
W O 98107881 PCTrUSg6/13777
- 26 -
example, in improved ph~ cokinetic properties (EP-A 0232 262). On the other
hand, for some uses it would be desirable to be able to delete the Fc part after the
fusion protein has been expressed, detected and purified in the advantageous
manner described. This is the case when Fc portion proves to be a hindrance to
use in therapy and diagnosis, for example when the fusion protein is to be used
as antigen for immunizations. In drug discovery, for example, human proteins,
such as, hIL5- has been fused with Fc portions for the purpose of high-throughput
screening assays to identify antagonists of hIL-5. See D. Bennett et al., Journal
of Molecular Recognition, Vol. 8 52-58 (1995) and K. Johanson et al., The
Journal of Biological Chemistry, Vol. 270, No. 16, pp 9459-9471 (1995).
The TlR-like ligand I can be recovered and purified from recombinant
cell cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and lectin
chromatography. Most preferably, high performance liquid chromatography
("HPLC") is employed for purification.
Polypeptides of the present invention include naturally purified products,
products of chemical synthetic procedures, and products produced by
recombinant techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, higher plant, insect and m~mm~ n cells. Depending
upon the host employed in a recombinant production procedure, the polypeptides
of the present invention may be glycosylated or may be non-glycosylated. In
addition, polypeptides of the invention may also include an initial modified
methionine residue, in some cases as a result of host-mediated processes.
Polypepfides and Peptides of f/le TlR-like ligand I
The invention further provides an isolated Tl R-like ligand I polypeptide
having the amino acid sequence encoded by the deposited cDNA, or the amino
acid sequence in FIG. I (SEQ ID NO:2), or a peptide or polypeptide comprising
CA 02263830 1999-02-23
W O 98107881 PCT~US96/13777
-27-
a portion of the above polypeptides. The terms "peptide" and "oligopeptide" are
considered synonymous (as is commonly recognized) and each term can be used
interchangeably as the context requires to indicate a chain of at least two arnino
acids coupled by peptidyl linkages. The word "polypeptide" is used herein for
chains containing more than ten amino acid residues. All oligopeptide and
polypeptide formulas or sequences herein are written from left to right and in the
direction from amino terminus to carboxy terminus.
By '~isolated" polypeptide or protein is intended a polypeptide or protein
removed from its native environment. For example, recombinantly produced
polypeptides and proteins expressed in host cells are considered isolated for
purposes of the invention as are native or recombinant polypeptides and proteinswhich have been substantially purified by any suitable technique such as, for
example, the one-step method described in Smith and Johnson, Gene 67:31-40
(1 988).
It will be recognized in the art that some amino acid sequence ofthe TlR-
like ligand I can be varied without significant effect on the structure or function
of the protein. If such differences in sequence are contemplated, it should be
remembered that there will be critical areas on the protein which detçrmine
activity. In general, it is possible to replace residues which form the tertiarystructure, provided that residues performing a similar function are used. In other
instances, the type of residue may be completely unimportant if the alteration
occurs at a non-critical region of the protein.
Thus, the invention further includes variations of the TlR-like ligand I
which show substantial TlR-like ligand I activity or which include regions of
TlR-like ligand I such as the protein portions discussed below. Such m~lt~nt~
include deletions, insertions, inversions, repeats, and type substitutions (for
example, subslilulillg one hydrophilic residue for another, but not strongly
hydrophilic for strongly hydrophobic as a rule). Small changes or such "neutral"amino acid substitutions will generally have little effect on activity.
Typically seen as conservative substitutions are the replacements, one for
another, among the aliphatic amino acids ~la, Val, Leu and Ile; interchange of the
CA 02263830 1999-02-23
W 03~ 1 PCTrUS96/13777
- 28 -
hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu,
substitution between the amide residues Asn and Gln, exchange of the basic
residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
As indicated in detail above, further guidance concerning which amino
acid changes are likely to be phenotypically silent (i.e., are not likely to have a
significant deleterious effect on a function) can be found in Bowie, J.U., et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino Acid
Substitutions," Science 247:1306-1310 (1990).
The polypeptides ofthe present invention include the polypeptide encoded
by the deposited cDNA including the leader sequence, the polypeptide encoded
by the deposited the cDNA minus the leader (i.e., the mature protein), the
polypeptide of FIG. 1 (SEQ ID NO:2) including the leader, the polypeptide of
FIG. 1 (SEQ ID NO:2) minus the leader, the TlR-like ligand I extracellular
domain, the TlR-like ligand I transmembrane domain, and the TlR-like ligand
I intr~cell~ r domain as well as polypeptides which have at least 90% similarity,
more preferably at least 95% similarity, and still more preferably at least 96%,97%, 98%, or 99% similarity to those described above. Further polypeptides of
the present invention include polypeptides at least 80% identical, more preferably
at least 90% or 95% identical, still more preferably at least 96%, 97%, 98%, or
99% identical to a polypeptide described herein, and and also include portions of
such polypeptides with at least 30 arnino acids and more preferably at least 50
amino acids.
By "% similarity" for two polypeptides is intçnded a similarity score
produced by c~ g the amino acid sequences of the two polypeptides using
the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
Madison, WI 53711) and the default settings for det~rmining similarity.
BESTFIT uses the local homology algorithm of Smith and W:~t~ n, Adv. Appl.
Math. 2:482-489 (1981), to find the best segment of similarity between two
sequences.
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96/13777
- 29 -
By a polypeptide having an amino acid sequence at least, for exatnple~
95% "identical" to a reference amino acid sequence of a TlR-like ligand I
polypeptide is intended that the amino acid sequence of the polypeptide is
identical to the reference sequence except that the polypeptide sequence may
include up to five amino acid alterations per each 100 amino acids of the
reference arnino acid sequence of the TlR-like ligand I polypeptide. In other
words, to obtain a polypeptide having an amino acid sequence at least 95%
identical to a reference amino acid sequence, up to 5% of the arnino acid residues
in the reference sequence may be deleted or substituted with another arnino acid,
or a number of amino acids up to 5% of the total amino acid residues in the
reference sequence may be inserted into the reference sequence. These alterations
of the reference sequence may occur at the amino or carboxy termin~l positions
of the reference amino acid sequence or anywhere between those terminal
positions, intclspGl~ed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence
shown in FIG. l (SEQ ID NO:2) or to the amino acid sequence encoded by
deposited cDNA clone can be dettqrmined conventionally using known computer
programs such the Bestfit program (Wisconsin Sequence Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research Park, 575
Science Drive, Madison, WI 53711. When using Bestfit or any other sequence
aligntnent program to detçrmine whether a particular sequence is, for instance,
95% identical to a reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity is calculated
over the full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of arnino acid residues in the rer~lence
sequence are allowed.
As described in detail below, the polypeptides ofthe present invention can
be used to raise polyclonal and monoclonal antibodies, which are useiùl in
gnostic ~says for detecting TlR-like ligand I expression as described below
.. . . ..
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
- 30 -
or as agonists and antagonists capable of enhancing or inhibiting T1 R-like ligand
I protein function. Further, such polypeptides can be used in the yeast t~vo-hybrid
system to "capture" TlR-like ligand I binding proteins which are also candidate
agonist and antagonist according to the present invention. The yeast two hybrid
system is described in Fields and Song, Nature 340:245-246 (1989).
In another aspect, the invention provides a peptide or polypeptide
comprising an epitope-bearing portion of a polypeptide of the invention. The
epitope of this polypeptide portion is an immunogenic or antigenic epitope of a
polypeptide of the invention. An "immunogenic epitope" is defined as a part of
a protein that elicits an antibody response when the whole protein is the
imrnunogen. These immunogenic epitopes are believed to be confined to a few
loci on the molecule. On the other hand, a region of a protein molecule to whichan antibody can bind is defined as an "antigenic epitope." The number of
imrnunogenic epitopes of a protein generally is less than the nurnber of antigenic
epitopes. See, for instance, Geysen, H.M. et al., Proc. Natl. Acad. Sci. USA
81:3998-4002 (1984).
As to the selection of peptides or polypeptides bearing an antigenic
epitope (i.e., that contain a region of a protein molecule to which an antibody can
bind), it is well known in that art that relatively short synthetic peptides that
mimic part of a protein sequence are routinely capable of eliciting an antiserumthat reacts ~,vith the partially mimicked protein. See, for instance, Sutcliffe, J.G.
et al., Science 219:660-666 (1983). Peptides capable of eliciting protein-reactive
sera are frequently represented in the primary sequence of a protein, can be
characterized by a set of simple chemical rules, and are confined neither to
immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to
the amino or carboxyl termin~l~ Peptides that are extremely hydrophobic and
those of six or fewer residues generally are ineffective at inducing antibodies that
bind to the mimicked protein; longer, soluble peptides, especially those
col-tiqi.,i~-g proline residues, usually are effective. Sutcliffe et al., supra, at 661.
For inct~n~e 18 of 20 peptides designed according to these guidelines, Cont~ining
8-39 residues covering 75% of the sequence of the influenza virus h~ glutinin
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
HAl polypeptide chain, in~ ced antibodies that reacted with the HAI protein or
intact virus; and 12/12 peptides from the MuLV polymerase and 1 8tl 8 from the
rabies glycoprotein induced antibodies that precipitated the respective proteins.
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore useful to raise antibodies, including monoclonal antibodies, that bindspecifically to a polypeptide of the invention. Thus, a high proportion of
hybridomas obtained by fusion of spleen cells from donors immunized with an
antigen epitope-bearing peptide generally secrete antibody reactive with the
native protein. Sutcliffe et al., supra, at 663. The antibodies raised by antigenic
epitope-bearing peptides or polypeptides are useful to detect the mimicked
protein, and antibodies to different peptides may be used for tracking the fate of
various regions of a protein precursor which undergoes posttranslation
proces.cing The peptides and anti-peptide antibodies may be used in a variety ofqualitative or quantitative assays for the mimicked protein, for in~t~nce in
competition assays since it has been shown that even short peptides (e.g., about9 amino acids) can bind and displace the larger peptides in immunoprecipitation
assays. See, for in.~t~nce, Wilson, I.A. et al., Cell 37:767-778 (1984) at 777. The
anti-peptide antibodies of the invention also are useful for purification of themimicked protein, for instance, by adsorption chromatography using methods
well known in the art.
Antigenic epitope-bearing peptides and polypeptides of the invention
designed according to the above guidelines preferably contain a sequence of at
least seven, more preferably at least nine and most preferably between about 15
to about 30 arnino acids contained within the amino acid sequence of a
polypeptide of the invention. However, peptides or polypeptides comprising a
larger portion of an amino acid sequence of a polypeptide of the invention,
cont~ining about 30 to about 50 amino acids, or any length up to and including
the entire amino acid sequence of a polypeptide of the invention, also are
considered epitope-bearing peptides or polypeptides of the invention and also are
useful for in~ .in~ antibodies that react with the mimicked protein. Preferably,the amino acid sequence of the epitope-bearing peptide is selected to provide
. _ . ,,
CA 02263830 1999-02-23
WO 98107881 PCT/US96/13777
substantial solubility in aqueous solvents (i.e., the sequence includes relatively
hydrophilic residues and highly hydrophobic sequences are preferably avoided);
and sequences cont~ining proline residues are particularly preferred.
Non-limiting examples of antigenic polypeptides that can be used to
generate TlR-like ligand I specific antibodies include: a polypeptide comprisingamino acid residues from about 20 to about 53 in Figure 1 (SEQ ID NO:2); a
polypeptide comprising amino acid residues from about 82 to about 98 in Figure
l (SEQ ID NO:2); a polypeptide comprising arnino acid residues from about 106
to about 134 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino
acid residues from about 155 to about 184.
The epitope-bearing peptides and polypeptides of the invention may be
produced by any conventional means for making peptides or polypeptides
including recombinant means using nucleic acid molecules of the invention. For
instance, a short epitope-bearing amino acid sequence may be fused to a larger
polypeptide which acts as a carrier during recombinant production and
purification, as well as during immunization to produce anti-peptide antibodies.Epitope-bearing peptides also may be syntheci7~d using known methods of
chemical synthesis. For instance, Houghten has described a simple method for
synthesis of large numbers of peptides, such as 10-20 mg of 248 dirr~relll 13
residue peptides re~ sellling single amino acid variants of a segment of the HAlpolypeptide which were prepared and characterized (by ELISA-type binding
studies) in less than four weeks. Houghten, R.A., Proc. Natl. Acad. Sci. USA
82:5131-5135 (1985). This "Siml-lt~neous Multiple Peptide Synthesis (SMPS)"
process is further described in U.S. Patent No. 4,631,211 to Houghten et al.
(1986). In this procedure the individual resins for the solid-phase synthesis ofvarious peptides are contained in separate solvent-permeable packets, enabling
the optimal use of the many identical ~elili~e steps involved in solid-phase
methods. A completely manual procedure allows 500-1000 or more syntheses to
be conducted simultaneously. Houghten et al., supra, at 5134.
Epitope-bearing peptides and polypeptides of the invention are used to
induce antibodies according to methods well known in the art. See, for instance,
CA 02263830 1999-02-23
WO 98/07881 PCT/US96113777
- 33 -
Sutcliffe et al., supra; Wilson et al., supra; Chow, M. et al., Proc. Natl. ,4cad.
Sci. USA 82:910-914; and Bittle, F.J. et al., ~ Gen. Virol. 66:2347-2354 (1985).Generally, animals may be immllni7P~l with free peptide; however, anti-peptide
antibody titer may be boosted by coupling of the peptide to a macromolecular
carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid. For
instance, peptides cont~ining cysteine may be coupled to carrier using a linker
such as m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides may be coupled to carrier using a more general linking agent such as
glutaraldehyde. Animals such as rabbits, rats and mice are irnmunized with either
free or carrier-coupled peptides, for instance, by intraperitoneal and/or
intr~(lerm~l injection of emulsions cont~ining about 100 ~lg peptide or carrier
protein and Freund's adjuvant. Several booster injections may be needed, for
inct~nre at intervals of about two weeks, to provide a useful titer of anti-peptide
antibody which can be detecte~l for exarnple, by ELISA assay using free peptide
adsorbed to a solid surface. T~e titer of anti-peptide antibodies in serum from an
immuni~d animal may be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and elution of the
selected antibodies according to methods well known in the art.
Tmmllnogenic epitope-bearing peptides of the invention, i.e., those parts
of a protein that elicit an antibody response when the whole protein is the
immllnogen, are identified according to methods known in the art. Por instance,
Geysen et al. (1984), supra, discloses a procedure for rapid concurrent synthesis
on solid supports of hundreds of peptides of sufficient purity to react in an
enzyme-linked immunosorbent assay. Interaction of synthesized peptides with
antibodies is then easily detected without removing them from the support. In
this manner a peptide bearing an immunogenic epitope of a desired protein may
be identified routinely by one of ordinary skill in the art. For instance, the
immlmologically illlpOl ~ll epitope in the coat protein of foot-and-mouth disease
virus was located by Geysen et al. with a resolution of seven amino acids by
synthesis of an overlapping set of all 208 possible hexapeptides covering the
entire 213 amino acid sequence of the protein. Then, a conl,~,lcte repl~rernent set
.. .. . . .
CA 02263830 1999-02-23
WO 98tO7881 PCTrUS96/13777
- 34 -
of peptides in which all 20 amino acids were substituted in turn at every position
within the epitope were synthesized, and the particular amino acids conferring
specificity for the reaction with antibody were determined. Thus, peptide
analogs of the epitope-bearing peptides of the invention can be made routinely by
this method. U.S. Patent No. 4,708,781 to Geysen (1987) further describes this
method of identifying a peptide bearing an immunogenic epitope of a desired
protein.
Further still, U.S. Patent No. 5,194,392 to Geysen (1990) describes a
general method of detecting or deterrnining the sequence of monomers (amino
l O acids or other compounds) which is a topological equivalent of the epitope (i.e.,
a "mimotope") which is complennent~ry to a particular paratope (antigen binding
site) of an antibody of interest. More generally, U.S. Patent No. 4,433,092 to
Geysen (1989) describes a method of detecting or determining a sequence of
monomers which is a topographical equivalent of a ligand which is
complçnnen1~ry to the ligand binding site of a particular receptor of interest.
Similarly, U.S. Patent No. 5,480,971 to Houghten, R. A. et al. (1996) on
Peralkylated Oligopeptide Mixtures discloses linear Cl-C7-alkyl peralkylated
oligopeptides and sets and libraries of such peptides, as well as methods for using
such oligopeptide sets and libraries for (1et~rmining the sequence of a peralkylated
oligopeptide that preferentially binds to an acceptor molecule of interest. Thus,
non-peptide analogs of the epitope-bearing peptides of the invention also can bemade routinely by these methods.
The entire disclosure of each document cited in this section on
"Polypeptides and Peptides" is hereby incorporated herein by reference.
As one of skill in the art will appreciate, TlR-like ligand I polypeptides
of the present invention and the epitope-bearing fragments thereof described
above can be combined with parts of the constant domain of immllnoglobulins
(IgG), resulting in chimeric polypeptides. These fusion proteins facilitate
purification and show an increased half-life in vivo. This has been shown, e.g.,for chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the heavy or
CA 02263830 1999-02-23
W O 98/07881 PCTAUS96/13777
light chains of m~mmz~ n immunoglobulins (EPA 394,827; Traunecker et al.,
Nature 331:84- 86 (1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding and
neutralizing other molecules than the monomeric TlR-like ligand I protein or
protein fragment alone (Fountoulakis et al., JBiochem. 270:3958-3964 (1995)).
TlR-like Ligand I Related Disorder Diagnosis
For TlR-like ligand I related disorders, it is believed that substantially
altered (increased or decreased) levels of TlR-like ligand I gene expression canbe detected in tissue or other cells or bodily fluids (e.g., sera, plasma, urine,
synovial fluid or spinal fluid) taken from an individual having such a disorder,relative to a "standard" TlR-like ligand I gene ~ ssion level, that is, the TlR-like ligand I gene ~ s~ion level in tissue or bodily fluids from an individual
not having the disorder. Thus, the invention provides a diagnostic method usefulduring diagnosis of an TlR-like ligand I-related disorder, which involves
measuring the ~ e;,sion level of the gene encoding the TlR-like ligand I in
tissue or other cells or body fluid from an individual and comparing the measured
gene expression level with a standard TlR-like ligand I gene ~ur~ssion level,
whereby an increase or decrease in the gene ~xp~s~ion level compared to the
standard is indicative of an Tl R-like ligand I related disorder.
TlR-like ligand I-related disorders are believed to include, but are not
limited to, lellk~?mi~ Iymphoma, arteriosclerosis, autoimmune ~liee~ee,
infl~mm~tory disease, Alzheimer's ~liee~ee~ ophth~lmic disease, apoptosis,
hll~aul.,line growth retardation, preeclampsia, pemphigus and psoriasis.
By individual is int~n-lçd m~mms~ n individuals, preferably hllm~n.e. By
"me~e~lring the expression level of the gene encoding the TlR-like ligand I" is
interlded qualitatively or qual~ ely measuring or estim~ting the level of the
T1 R-like ligand I protein or the level of the mRNA encoding the T1 R-like ligand
I protein in a first biological sample either directly (e.g., by detçrmining or
estim~ting absolute protein level or mRNA level) or relatively (e.g., by
CA 02263830 1999-02-23
WO 98/07881 PCT/US96113777
- 36 -
comparing to the TlR-like ligand I protein level or mRNA level in a second
biological sample). Preferably, the TlR-like ligand I protein level or mRNA
level in the first biological sample is measured or estim~ted and compared to a
standard Tl R-like ligand I protein level or mRNA level, the standard being taken
S from a second biological sample obtained from an individual not having the
disorder or being determin~.d by averaging levels from a population of individuals
not having the disorder. As will be appreciated in the art, once a standard T1 R-
like ligand I protein level or mRNA level is known, it can be used repeatedly asa standard for comparison.
By "biological sample" is intended any biological sample obtained from
an individual, body fluid, cell line, tissue culture, or other source which contains
TlR-like ligand I protein or mRNA. As indicated, biological samples include
body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) whichcontain secreted mature TlR-like ligand I, or tissue sources found to express
TlR-like ligand I protein. Methods for obtaining tissue biopsies and body fluidsfrom m~mm~l~ are well known in the art. Where the biological sarnple is to
include mRNA, a tissue biopsy is the preferred source.
Total cellular RNA can be isolated from a biological sample using any
suitable technique such as the single-step guanidinium-thiocyanate-phenol-
chloroform method described in Chomczynski and Sacchi, Anal. Biochem.
162:156-159 (1987). Levels of mRNA encoding an TlR-like ligand I are then
assayed using any app,~,~,;ate method. These include Northern blot analysis, S In~lcle~e mapping, the polymerase chain reaction (PCR), reverse transcription in
combination with the polymerase chain reaction (RT-PCR), and reverse
transcription in combination with the ligase chain reaction (RT-LCR).
Northern blot analysis can be p~lrolllled as described in Harada et al., Cell
63:303-312 (1990). Briefly, total RNA is prepared from a biological sample as
described above. For the Northern blot, the RNA is denatured in an applup,iate
buffer (such as glyoxal/dimethyl sulfoxide/sodium phosphate buffer), subjected
to agarose gel electrophoresis, and transferred onto a nitrocellulose filter. After
the RNAs have been linked to the filter by a W linker, the filter is prehybridized
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96/13777
-37-
in a solution cont~ining formamide, SSC, Denhardt's solution, denatured salmon
sperm, SDS, and sodium phosphate buffer. TlR-like ligand I cDNA labeled
according to any ~pplol,l;ate method (such as the 32P-multiprimed DNA labeling
system (Amersham)) is used as probe. After hybridization overnight, the filter
is washed and exposed to x-ray film. cDNA for use as probe according to the
present invention is described in the sections above and will preferably at least
15 bp in length.
S l mapping can be performed as described in Fujita et al., Cell 49:357-
367 (1987). To prepare probe DNA for use in Sl mapping, the sense strand of
above-described cDNA is used as a template to synthesize labeled antisense
DNA. The antisense DNA can then be digested using an appropriate restriction
endonuclease to generate further DNA probes of a desired length. Such antisense
probes are useful for visu~li7ing protected bands corresponding to the target
mRNA (i.e., mRNA encoding the TlR-like ligand I). Northern blot analysis can
be performed as described above.
Preferably, levels of mRNA encoding the TlR-like ligand I are assayed
using the RT-PCR method described in Makino et al., Technique 2:295-301
(1990). By this method, the radioactivities of the '~amplicons" in the
polyacrylamide gel bands are linearly related to the initial concentration of the
target mRNA. Briefly, this method involves adding total RNA isolated from a
biological sarnple in a reaction mixture cont~inin~. a RT primer and appropriatebuffer. After incubating for primer ~nne~ling, the mixture can be supplemented
~vith a RT buffer, dNTPs, DTT, RNase inhibitor and reverse transcriptase. After
incubation to achieve reverse transcription of the RNA, the RT products are thensubject to PCR using labeled primers. Alternatively, rather than labeling the
primers, a labeled dNTP can be included in the PCR reaction mixture. PCR
amplification can be performed in a DNA therrnal cycler according to
conventional techniques. After a suitable number of rounds to achieve
amplification, the PCR reaction mixture is electrophoresed on a polyacrylamide
gel. After drying the gel, the radioactivity of the ~pl(3pfiate bands
(corresponding to the mRNA encoding the TlR-like ligand I) is quantified using
~ . .
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
- 38 -
an im~ging analyzer. RT and PCR reaction ingredients and conditions, reagent
and gel concentrations, and labeling methods are well known in the art.
Variations on the RT-PCR method will be appalcnt to the skilled artisan.
Any set of oligonucleotide primers which will amplify reverse transcribed
S target mRNA can be used and can be de~ign~cl as described in the sections above.
Assaying TlR-like ligand I levels in a biological sample can occur using
any art-known method. Preferred for assaying TlR-like ligand I levels in a
biological sample are antibody-based techniques. For example, TlR-like ligand
I expression in tissues can be studied with classical immunohistological methods.
In these, the specific recognition is provided by the primary antibody (polyclonal
or monoclonal) but the secondary detection system can utilize fluorescent,
enzyme, or other conjugated secondary antibodies. As a result, an
immunohistological staining of tissue section for pathological e~c~min~tion is
obtained. Tissues can also be extracted, e.g., with urea and neutral detergent, for
the liberation of T1 R-like ligand I for Western-blot or dotlslot assay (J~lk~nen,
M., et al., J. Cell. Biol.101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol.
105:3087-3096 (1987)). In this technique, which is based on the use of cationic
solid phases, quantitation of T1 R-like ligand I can be accomplished using isolated
TlR-like ligand I as a standard. This technique can also be applied to body
fluids. With these samples, a molar concentration of T1 R-like ligand I will aidto set standard values of TlR-like ligand I content for different body fluids, like
serum, plasma, urine, synovial fluid, spinal fluid, etc. The normal appearance of
TlR-like ligand I amounts can then be set using values from healthy individuals,which can be compared to those obtained from a test subject.
Other antibody-based methods useful for detecting TlR-like ligand I
levels include immunoassays, such as the enzyme linked immunosorbent assay
(ELISA) and the radioimmunoassay (RIA). For example, TlR-like ligand I-
specific monoclonal antibodies can be used both as an immunoadsorbent and as
an enzyme-labeled probe to detect and quantify the TlR-like ligand I. The
amount of TlR-like ligand I present in the sample can be calculated by referenceto the amount present in a standard p~ aldtion using a linear regression computer
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
-39-
algorithrn. Such an ELISA for detecting a tumor antigen is described in Iacobelli
et al., Breast Cancer Research and Treatment 11:19-30 (1988). In another
ELISA assay, two distinct specific monoclonal antibodies can be used to detect
TlR-like ligand I in a body fluid. In this assay, one of the antibodies is used as
the irnmunoadsorbent and the other as the enzyme-labeled probe.
The above techniques may be conducted es.eenti~lly as a "one-step" or
"t~o-step" assay. The "one-step" assay involves contacting TlR-like ligand I
witl1 immobilized antibody and, without washing, contacting the mixture with thelabeled antibody. The "two-step" assay involves washing before contacting the
mixture with the labeled antibody. Other conventional methods may also be
employed as suitable. It is usually desirable to imrnobilize one component of the
assay system on a support, thereby allowing other components of the system to
be brought into contact with the component and readily removed from the
sample.
Suitable enzyme labels include, for example, those from the oxidase
group, which catalyze the production of hydrogen peroxide by reacting with
substrate. Glucose oxidase is particularly preferred as it has good stability and
its substrate (glucose) is readily available. Activity of an oxidase label may be
assayed by measuring the concentration of hydrogen peroxide forrned by the
enzyme-labeled antibody/substrate reaction. Besides enzymes, other suitable
labels include radioisotopes, such as iodine (125I, '2'I), carbon (14C), sulfur (35S),
tritiurn (3H), indium ("2In), and technetiurn (99mTc), and fluorescent labels, such
as fluorescein and rhodamine, and biotin.
In addition to assaying TlR-like ligand I levels in a biological sample
obtained from an individual, TlR-like ligand I can also be detected in vivo by
im~ging. Antibody labels or markers for in vivo im~ing of TlR-like ligand I
include those detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium, which emit
detectable radiation but are not overtly harmful to the subject. Suitable markers
for NMR and ESR include those with a detect~hle characteristic spin, such as
CA 02263830 l999-02-23
W O98/07881 PCTrUS96/13777
-40-
\deuterium, which may be incorporated into the antibody by labeling of nutrientsfor the relevant hybridoma.
A TlR-like ligand I-specific antibody or antibody fragment which has
been labeled with an appropliate detectable im~in~ moiety, such as a
radioisotope (for example, '3'I, "2In, 99mTc), a radio-opaque substance, or a
material detectable by nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the m~mm~l to be
examined for a disorder. It will be understood in the art that the size of the
subject and the im~ging system used will determine the quantity of im~ging
moieties needed to produce diagnostic images. In the case of a radioisotope
moiety, for a human subject, the quantity of radioactivity injected will normally
range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody
fragment will then pre~relltially accumulate at the location of cells which contain
TlR-like ligand I. In vivo tumor im~ging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments"
(Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer,
Burchiel, S.W. and Rhodes, B.A. eds., Masson Publishing Inc., (1982)).
TlR-like ligand I specific antibodies for use in the present invention can
be raised against the intact Tl R-like ligand I or an antigenic polypeptide fragment
thereof, which may presented together with a carrier protein, such as an albumin,
to an animal system (such as rabbit or mouse) or, if it is long enough (at leastabout 25 amino acids), without a carrier.
As used herein, the term "antibody" (Ab) or "monoclonal antibody" (Mab)
is meant to include intact molecules as well as antibody fragments (such as, forexample, Fab and F(ab')2 fr~gment~) which are capable of specifically binding toTlR-like ligand I. Fab and F(ab')2 fragments lack the Fc portion of intact
antibody, clear more rapidly from the circulation, and may have less non-specific
tissue binding of an intact antibody (Wahl et al., J: Nucl. Med. 24:316-325
(1983)). Thus, these fragments are preferred.
The antibodies of the present invention may be prepared by any of a
variety of methods. For example, cells expressing the TlR-like ligand I or an
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96/13777
-41-
antigenic fragment thereof can be ~-lmini.ctered to an animal in order to induce the
production of sera cont~ining polyclonal antibodies. In a preferred method, a
preparation of TlR-like ligand I protein is l)lcl~a~,d and purified as describedabove to render it substantially free of natural cont~min~nt~. Such a pre,uaralion
is then introduced into an animal in order to produce polyclonal antisera of
greater specific activity.
In the most preferred method, the antibodies of the present invention are
monoclonal antibodies (or TlR-like ligand I binding fragments thereof). Such
monoclonal antibodies can be prepared using hybridoma technology (Colligan,
Current Protocols in Immunolo~y, Wiley Interscience, New York ( 1990-1996);
Harlow & Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press,
Cold Spring Harbor, N.Y. (19B8), Chapters 6-9, Current Protocols in Molecular
Biology, Ausubel, infra, Chapter 11, entirely incorporated herein by reference).In general, such procedures involve immunizing an animal (preferably a mouse)
lS with an TlR-like ligand I antigen or, more preferably, with an TlR-like ligand
I-~x,ures~ing cell. Suitable cells can be recognized by their capacity to bind anti-
TlR-like ligand I antibody. Such cells may be cultured in any suitable tissue
culture medium; however, it is preferable to culture cells in Earle's modified
Eagle's medium supplemented with 10% fetal bovine serurn (inactivated at about
56~C), and suppleJnente~l with about 10 ~g/l of nonessential amino acids, about
1,000 U/ml of penicillin, and about l 00 ~lg/ml of streptomycin. The splenocytesof such mice are extracted and fused with a suitable myeloma cell line. Any
suitable myeloma cell line may be employed in accordance with the present
invention; however, it is preferable to employ the parent myeloma cell line
(SP2O), available from the American Type Culture Collection (ATCC)
(Rockville, Maryland, USA). After fusion, the resulting hybridoma cells are
selectively m~int~ined in HAT medium, and then cloned by limiting dilution as
described by Wands et al., Gastroenterology 80:225-232 ( l 98 l ); Harlow & Lane,
inSra, Chapter 7. The hybridoma cells obtained through such a selection are thenassayed to identify clones which secrete antibodies capable of binding the Tl R-like ligand I antigen.
.,
CA 02263830 1999-02-23
W O98107881 PCTrUS96113777
-42-
Alternatively, additional antibodies capable of binding to the TlR-like
ligand I antigen may be produced in a two-step procedure through the use of anti-
idiotypic antibodies. Such a method makes use of the fact that antibodies are
themselves antigens, and therefore it is possible to obtain an antibody which
binds to a second antibody. In accordance with this method, TlR-like ligand I
specific antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of such an animal are then used to produce hybridoma cells, and the
hybridoma cells are screened to identify clones which produce an antibody whose
ability to bind to the TlR-like ligand I-specific antibody can be blocked by theTlR-like ligand I antigen. Such antibodies comprise anti-idiotypic antibodies tothe TlR-like ligand I-specific antibody and can be used to immunize an animal
to induce forrnation of further T1 R-like ligand I-specific antibodies.
It will be appreciated that Fab and F(ab')2 and other fragments of the
antibodies of the present invention may be used according to the methods
disclosed herein. Such fr~gment~ are typically produced by proteolytic cleavage,using enzymes such as papain (to produce Fab fragments) or pepsin (to produce
F(ab')2 fragments). Alternatively, TlR-like ligand I-binding fragments can be
produced through the application of recombinant DNA technology or through
synthetic chemistry.
Where in vivo im~ging is used to detect enhanced levels of TlR-like
ligand I for diagnosis in humans, it may be preferable to use "hl~m~ni7ed"
chimeric monoclonal antibodies. Such antibodies can be produced using genetic
constructs derived from hybridoma cells producing the monoclonal antibodies
described above. Methods for producing chimeric antibodies are known in the
art. See, for review, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques
4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567; Taniguchi et al., EP
171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson
et al., WO 8702671; Boulianne et al., Nature 312:643 (1984); Neuberger et al.,
Nature 314:268 (1985).
Further suitable labels for the T1 R-like ligand I-specific antibodies of the
present invention are provided below. Examples of suitable enzyme labels
CA 02263830 1999-02-23
W O 98/07881 PCT~US96113777
-43-
include malate dehydrogenase, staphylococcal nuclease, delta-5-steroid
isomerase, yeast-alcohol dehydrogenase, alpha-glycerol phosphate
dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase,
aspar~in~e, glucose oxidase, beta-galactosidase, ribonuclease, urease, c~t~l~se,glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholine esterase.
Examples of suitable radioisotopic labels include 3H, "'In, '25I, '3'I, 32p,
35S, 14C, 5~Cr, 57To, 58Co, 59Fe, 75Se, ~52Eu, 90Y, 67Cu 2l7c; 2~At 2~2pb 47Sc ~ospd
etc. " 'In is a preferred isotope where in vivo im:~gin~ is used since its avoids the
problem of dehalogenation of the '25I or ~3~I-labeled monoclonal antibody by theliver. In addition, this radionucleotide has a more favorable gamnla emission
energy for im~in~ (Perkins et al., Eur. J. Nucl. Med. 10:296-301 (1985);
Carasquillo et al., J. Nucl. Med. 28:281-287 (1987)). ~or example, "'In coupled
to monoclonal antibodies with l-(P-isothiocyanatobenzyl)-DPTA has shown little
uptake in non-tumorous tissues, particularly the liver, and therefore enhances
IS specificity of tumor localization (Esteban et al., J. Nucl. Med. 2~:861-870
(1 987)).
Examples of suitable non-radioactive isotopic labels include '57Gd, 55Mn,
s2Tr~ and 56Fe.
Examples of suitable fluorescent labels include an '52Eu label, a
fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin
label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label,
and a fluolesc~ ine label.
Examples of suitable toxin labels include diphtheria toxin, ricin, and
cholera toxin.
Examples of chemilurninescent labels include a luminal label, an
isoluminal label, an aromatic acridinium ester label, an imidazole label, an
acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label,
and an aequorin label.
Fx~mrles of nuclear magnetic resonance contrasting agents include heavy
metal nuclei such as Gd, Mn, and Fe.
.. . . , , . . , . . . ~ .
CA 02263830 l999-02-23
W O 98/07881 PCTrUS96/13777
-44-
Typical techniques for binding the above-described labels to antibodies
are provided by Kennedy et al. (Clin. Chim. Acta 70:1-31 (1976)), and Schurs et
al. (Clin. Chim. Acta 81:1-40 (1977)). Coupling techniques mentioned in the
latter are the glutaraldehyde method, the periodate method, the dimaleimide
method, the m-maleimidobenzyl-N-hydroxy-succinimide ester method, all of
which methods are incorporated by reference herein.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to and can
hybridize with a particular location on an individual human chromosome.
Moreover, there is a current need for identifying particular sites on the
chromosome. Few chromosome m~rking reagents based on actual sequence data
(repeat polymorphisms) are presently available for m~rking chromosomal
location. The mapping of DNAs to chromosomes according to the present
invention is an important first step in correlating those sequences with genes
associated with disease.
In certain plef~lled embodiments in this regard, the cDNA herein
disclosed is used to clone genomic DNA of an TlR-like ligand I gene. This can
be accomplished using a variety of well known techniques and libraries, which
generally are available col~ lcl~;ially. The genomic DNA then is used for in situ
chromosome mapping using well known techniques for this purpose. Typically,
in accordance with routine procedures for chromosome mapping, some trial and
error may be nt cess~ry to identify a genomic probe that gives a good in situ
hybridization signal.
In some cases, in addition, sequences can be mapped to chromosomes by
pl~p~;ng PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untr~n~!~ted region of the gene is used to rapidly select primers that do
not span more than one exon in the genomic DNA, thus complicating the
amplification process. These primers are then used for PCR screening of somatic
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
- 45 -
cell hybrids cont~ining individual human chromosomes. Only those hybrids
cont~ining the human gene corresponding to the primer will yield an amplified
portion.
PCR mapping of somatic cell hybrids is a rapid procedure for ~igning
a particular DNA to a particular chromosome. Using the present invention with
the same oligonucleotide primers, sublocalization can be achieved with panels ofportions from specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be used to map
to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome
specific-cDNA libraries.
Fluorescence in si~u hybridization ("FISH") of a cDNA clone to a
metaphase chromosomal spread can be used to provide a precise chromosomal
location in one step. This technique can be used with probes from the cDNA as
short as 50 or 60 bp. For a review of this technique, see Verma et al., Human
Chromosomes: ~ Manual of Basic Techniques, Pergamon Press, New York
(1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the sequence on the chromosome can be correlated with
genetic map data. Such data are found, for example, in V. McKusick, Mendelian
Inheritance in Man, available on-line through Johns Hopkins University, Welch
Medical Library. The relationship between genes and diseases that have been
mapped to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is n~cecs~ry to detPrmine the differences in the cDNA or genomic
sequence between affected and unaffected individuals. If a mutation is observed
in some or all of the affected individuals but not in any normal individuals, then
the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping
techniques, a cDNA precisely localized to a chromosomal region associated with
, , .
CA 02263830 1999-02-23
wo 3n,~ lo~l PCTrUS96/13777
- 46 -
the disease could be one of between 50 and 500 potential causative genes. (This
assumes I meg~b~e mapping resolution and one gene per 20 kb).
Treatment of TlR-like Ligand I Disorders
It is believed by the present inventors that TlR-like ligand I polypeptides
S ofthe present invention share biological activities with interleukin-l ~IL-1) and
the TlR ligand. Thus, the TlR-like ligand I (particularly the mature form) can be
exogenously added to cells, tissues, or the body of an individual to produce a
therapeutic effect. In particular, disorders caused by a decrease in the standard
level of TlR-like ligand I protein activity can be treated by ~mini.stering an
effective amount of a TlR-like ligand I polypeptide of the invention. Preferably,
a ph~rnl~ceutical composition is ~lmini~tered comprising an amount of an
isolated T1 R-like ligand I polypeptide of the invention effective to increase the
TlR-like ligand I protein activity. Disorders where such a therapy would likely
be effective are discussed above and below.
One of ordinary skill will appreciate that effective arnounts of a TlR-like
ligand I polypeptide can be determined empirically for each condition where
~lmini~tration of a such a polypeptide is indicated. The polypeptide having T1 R-
like ligand 1 activity can be ~-lmini~tered in pharmaceutical compositions in
combination with one or more pharmaceutically acceptable carriers, diluents
and/or excipients. It will be understood that, when ~lmini~t~red to a human
patient, the total daily usage of the pharmaceutical compositions of the presentinvention will be decided by the attending physician within the scope of sound
medical judgment. ~he specific therapeutically effective dose level for any
particular patient will depend upon a variety of factors including the type and
degree of the response to be achieved; the specific composition an other agent,
if any, employed; the age, body weight, general health, sex and diet of the patient;
the time of ~lmini~tration, route of ~-lmini.~tration, and rate of excretion of the
composition; the duration of the treatment; drugs (such as a chemotherapeutic
CA 02263830 1999-02-23
W O98107881 PCTAUS96/13777
-47-
agent) used in combination or coincidental with the specific composition; and like
factors well known in the medical arts.
The TlR-like ligand I composition to be used in the therapy will also be
formulated and dosed in a fashion consistent with good medical practice, taking
into account the clinical condition of the individual patient (especially the side
effects of tre:~tment ~vith T1 R-like ligand I alone), the site of delivery of the T1 R-
like ligand I composition, the method of a-lmini~tration, the scheduling of
7~1minictration, and other factors known to practitioners. An "effective amount"of a TlR-like ligand I polypeptide for purposes herein is thus (let~rmine-l by such
1 0 considerations.
As a general proposition, the total ph~ ceutically effective amount of
a TlR-like ligand I polypeptide ~ inictered parenterally per dose will be in therange of about 0.01 ng/kg/day to 10 ~g/kg/day of patient body weight, although,
as noted above, this will be subject to the~ ,culic discretion. More preferably,this dose is at least 1.0 ng/kg/day, and most preferably for hllm~n.~ between about
1.0 to 100 ng/kg/day for the hormone. If given continuously, the T1 R-like ligand
I is typically ~riminictered at a dose rate of about 0.01 ng/kg/hour to about 100
ng/kg/hour, either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag solution may
also be employed.
A course of TlR-like ligand I polypeptide trc~tment to affect the immllne
system appears to be optimal if continued longer than a certain minimum number
of days, 7 days in the case of the mice. The length of tre~tmtont needed to observe
changes and the interval following tre~tm~nt for responses to occur a~pe~ to
vary depending on the desired effect.
The TlR-like ligand I polypeptide is also suitably ~ministered by
sllcl~ined-release systems. Suitable examples of sustained-release compositions
include semi-permeable polymer matrices in the form of shaped articles, e.g.,
films, or microcapsules. Sl.ct~ined-release matrices include polylactides (U.S.
Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-
ethyl-L-glllt~mzlte (U. Sidman et al., Biopolymers 22:547-556 (1983)), poly (2-
CA 02263830 1999-02-23
PCT~US96113777
WO ~ ,,Oal
-48-
hydroxyethyl methacrylate) (R. Langer et al., J: Biomed. Mater. Res. 15:167-277
(1981), and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (R.Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988). Sustained-
release TlR-like ligand I compositions also include a liposomally elltrd~l)ed
TlR-like ligand I polypeptide. Liposomes cont~ining a TlR-like ligand I
polypeptidearepl~cdbymethodsknownperse: DE3,218,121;Epstein,etal.,
Proc. Natl. Acad. Sci. USA 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad
Sci. USA 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949;
EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and
4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about
200-800 Angstroms) unilamellar type in which the lipid content is greater than
about 30 mol. percent cholesterol, the selected proportion being adjusted for the
optimal TlR-like ligand I therapy.
For parenteral ~-1ministration, in one embodiment, the TlR-like ligand
I polypeptide is formulated generally by mixing it at the desired degree of purity,
in a unit dosage injectable form (solution, suspension, or emulsion), with a
ph~ eutically acceptable carrier, i.e., one that is non-toxic to recipients at the
dosages and concentrations employed and is compatible with other ingredients
of the formulation. For example, the formulation preferably does not include
oxidizing agents and other compounds that are known to be deleterious to
polypeptides.
Generally, the formulations are prepared by contacting the TlR-like
ligand I polypeptide uniformly and intim~tely with liquid carriers or finely
divided solid carriers or both. Then, if necessary, the product is shaped into the
desired fo~ ti- n. Preferably the carrier is a parenteral carrier, more preferably
a solution that is isotonic with the blood of the recipient. Examples of such
carrier vehicles include water, saline, Ringer's solution, and dextrose solution.
Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein,as well as liposomes.
The carrier suitably contains minor amounts of additives such as
substances that enhance isotonicity and chemical stability. Such materials are
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
-49-
non-toxic to recipients at the dosages and concentrations employed, and include
buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids
or their salts; antioxidants such as ascorbic acid; low molecular weight (less than
about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such
as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid,
or arginine; monosacch~rides, disaccharides, and other carbohydrates including
cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such
as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as
sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.
The TlR-like ligand I is typically formulated in such vehicles at a
concentration of about 0.001 ng/ml to 500 ng/ml, preferably 0.1-10 ng/ml, at a pH
of about 3 to 8. It will be understood that the use of certain of the foregoing
excipients, carriers, or stabilizers will result in the forrnation of TlR-like ligand
I salts.
TlR-like ligand I to be used for therapeutic a~1mini~tration must be
sterile. Sterility is readily accomplished by filtration through sterile filtration
membranes (e.g., 0.2 micron membranes). Therapeutic TlR-like ligand I
compositions generally are placed into a container having a sterile access port, for
example, an intravenous solution bag or vial having a stopper pierceable by a
hypodermic injection needle.
TlR-like ligand I ol.lhl~;ly will be stored in unit or multi-dose
conlainers, for example, sealed ampoules or vials, as an aqueous solution or as a
Iyophilized formulation for reconstitution. As an example of a Iyophilized
formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous
TlR-like ligand I solution, and the resulting mixture is Iyophili7.~?~1 The infusion
solution is prepared by reconstituting the lyophilized TlR-like ligand I using
bacteriostatic Water-for-Injection.
For example, sati~f~ctQry results are obtained by oral ~(1mini~tration of a
polypeptide having TlR-like ligand I activity in dosages on the order of from
0.05 to 5000 ng/kg/day, preferably 0.1 to 1000 ng/lcg/day, more preferably 10
.. , . .. " .
. .... , . . . . --
CA 02263830 1999-02-23
WO ~8~ DI~1 PCT/USg6/13777
--50--
tolO0 nglkg/day, ~-lmini.~t~red once or, in divided doses, 1 to 4 times per day. On
~lmini~tration parenterally, for example by i.v. drip or infusion, dosages on the
orderoffrom 0.01 to 500 ngAcg/day, preferably 0.05 to 100 ng/kg/day and more
preferably 0.1 to 50 ng/kg/day can be used. Suitable daily dosages for patients
S are thus on the order of from 2.5 ng to 250 ~g p.o., preferably 5 ng to 50 llg p.o.,
more preferably 50 ng to 12.5 llg p.o., or on the order of from 0.5 ng to 25 ,ug i.v.,
preferably 2.5 ng to 500 llg i.v. and more preferably 5 ng to 2.5 ~g i.v.
TlR~ e Ligand I An~ibody T/terapy
By the invention, disorders caused by enhanced levels of TlR-like ligand
I protein activity can be treated by ~-lmini~tering an effective amount of an
antagonist of a TlR-like ligand I polypeptide of the invention. Therefore,
antibodies (preferably monoclonal) or antibody fragments that bind a Tl R-like
ligand I polypeptide ofthe present invention are useful in treating TlR-like ligand
I-related disorders as are soluble TlR-like ligand I proteins, such as the
extracellular domain, which competes with the intact protein for binding to the
TlR-like ligand I receptor. Such antibodies and/or soluble TlR-like ligand I
proteins are preferably provided in pharmaceutically acceptable compositions.
The pharmaceutical compositions of the present invention may be
~imini~tered, for example, by the parenteral, subcutaneous, intravenous,
intramuscular, inLld~eliloneal, tr~n~-lçrm:~l, or buccal routes. Alternatively, or
concurrently, ~1mini~tration may be oral. The dosage ~lmini.~tered will be
dependent upon the age, health, and weight of the recipient, kind of concurrent
treatment, if any, frequency of treatment, and the nature of the effect desired.Compositions within the scope of this invention include all compositions
wherein the antibody, fragment or derivative is contained in an amount effectiveto achieve its intended purpose. While individual needs vary, determination of
optimal ranges of effective amounts of each component is within the skill of theart. The effective dose is a function of the individual chimeric or monoclonal
antibody, the presence and nature of a conjugated therapeutic agent (see below),
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96113M7
-51-
the patient and his clinical status, and can vary from about 10 ng/kg body weight
to about 100 mg/kg body weight. The preferred dosages comprise 0.1 to 10
mg/lcg body wt.
Pl~aldlions of an TlR-like li~and I antibody or fragment for parenteral
~ministration, such as in detectably labeled forrn for im~ing or in a free or
conjugated form for therapy, include sterile aqueous or non-aqueous solutions,
suspensions, and emulsions. Examples of non-aqueous solvents are
propyleneglycol, polyethyleneglycol, vegetable oil such as olive oil, and
injectable organic esters such as ethyloleate. Aqueous carriers include water,
alcoholic/a~ueous solutions, emulsions or suspensions, including saline and
buffered media, parenteral vehicles including sodium chloride solution, Ringer'sdextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
Intravenous vehicles include fluid and nutrient replenishers, such as those based
on Ringer's dextrose, and the like. Preservatives and other additives may also be
present, such as, for example, antimicrobials, anti-oxidants, chelating agents, and
inert gases and the like. See, generally, Remington's Pharmaceutical Science,
16th ed., Mack Publishing Co., Easton, PA, 1980.
The antibodies described herein may be advantageously utilized in
combination with other monoclonal or chimeric antibodies, or with Iymphokines
or hemopoietic growth factors, etc., which serve to increase the number or
activity of effector cells which interact with the antibodies.
~re~t~d Pleiotropic biologic effec~s of TlR-like ligand I
The T1 R-like ligand I polypeptides of the present invention are expected
to have pleiotropic biological effects including many of those shown in Table 1
below. Similar biological effects have been shown for IL- I, particularly those
associated with pancreatic endocrine tissue (Mandrup-Poulsen, T., et al., Cytohne
5:185 (1993)), thyroid glands (Rasmussen, A.K., Autoimmunity 16:141 (1993)),
hypothalamic-pituitary-adrenal axis (Fantuzzi, G., & Ghezzi, P., Mediator
Inflamm. 2:263 (1993); Rivier, C.,Ann. NYAcad. Sci. 697:97 (1993); Rivier, C.,
.. , . . . . . ~
CA 02263830 1999-02-23
PCT~US96/13777
W O 98/07881
-52-
& RiVCSt, S., Ciba. Found. Symp. 172:204 (1993)), fever (Coceani, F., "Fcver:
Basic Me~h~ni~m~ and MarlagemeIlt", New York, NY, Raven (1991) p. S9), bone
metabolism (Tatalcis, D.N., ~ Peridontol 64:416 (1993)), deStrllCtiOII of cartilage
in the pathogenesis of rh~um~toid arthlitiS (AIend, W.P., & Dayer, J.M., Arthritis
Rh~um 33:305 (1990); Krane, S.M., et al., Ann. NYAcad. Sci. 580:340 (1990)),
uterinc implalltation (LeWtS, M.P., et al., Placenta 15: 13 (1994)), and IOSS of leatl
bodymass(Roubenoff,R., etal., J. Clin. Invest. 93:2379(1994)).
TABLE 1. POSSIBLE BIOLOGIC EFFECTS OF T1R_LIKE LIGAND I
Effects of sys~emicaily injected Tl R-like ligand I
Fever; increased slow wave sleep; sociai d~ ;on; anorexia
Hypotension; myocardial suppression; tachycardia; lactic acidosis
Increased circulating nitric oxide; hypn~ ninn~idPn i~
Hyperinc~linPmi~ hyperglycemia; hypoglycemia
Si Istinn of hypothalamic-pituitary-adrenal axis
Release of hypothalamic l~ n~ ,5 and r u~ ides
Neutrophilia; increased marrow cellularity; increased platelets
Increased hepatic acute phase protein synthesis
Hypoferremia; hyl,o,; .- ~ increased sodium excretion
Hyperlipid~P~ increased muscle protein breakdown
Hypo~ a; decreased drug mPt~ oli~m
Increased ~
Increased non~e~ irlc resistance to infection (pl~ allll~lll)
Learning defects in offspring after maternal IL- I treatment
Effects of locally injected TlR-like ligand I
Infiltration of m ~ ul lic into rabbits knee joint
Increasedprot~ Iy . 1,. Làki~ inrabbitkneejoint
Induction of uveitis following intravitreal injection
Ar.6iot,cll~ s;s in anterior chamber of eye
Cellular infiltrate and cytokine induction in cerebral ventricles
Neutrophil and albumin influx into lungs aRer hl~dtla~ hedl ll ~~inn
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96/13777
Changes in immunologic responses
Increased antibody production (adjuvant ef~ect)
Increased Iymphokine synthesis (IL-2, -3, -4, -5, -6, -7, - 10 and - 12)
Increased IL-2 (,B) receptor
~ De.~lLr of ~pe 2 human T-cell clones
Inhibition of tolerance to protein antigens
.-- ~.1 of spleen cell mitogenic response to LPS
Ef~ects of Tl R-like ligand I on cultured cells or tissues
Increased expression of ELAM- I, VCAM- I, ICAM- I
Cytotoxicity (apoptosis) of insulin-~,.u~ue,-,~ islet ,B cells
Inhibition of thyroglobulin synthesis in thyrocytes
Canilage l,.~kd~)...., release of calcium from bone
Increased release of arachidonic acid, prostanoids, and eicos~ c
Increased mucus 1,.- '~. ~;c l and chloride flux in intestinal cells
Fn~ 1 in chloride nux (GABAA receptor) in brain Syn~rto~o~c
Proliferation of fibroblasts, smooth muscle cells, m,~c~ igJ cells
Growth inhibition of hair follicles
Increased corticosterone synthesis by adrenals
Increased HIV-I e"~ ,-ul.
Assays used: pancreatic endocrine tissue (Iv' ' .1~, Poulsen, T., e~ aL, Cytokine 5:185 (1993)), thyroic
gland (~ r~ cil~n, A.K., ~ 16: 141 (1993)), h~ul~ -pituitary-adrenal axis (Fantuzzi,
G., & Ghe~zi, P., Mediator Inflamm. 2:263 (1993); Rivier, C., Ann. NYAcad. Sci. 697:97 (1993); Rivier,
C., & Rivest, S., Ciba. Found Symp. 1 72:204 (1993)), fever (Coceani, F., "Fever: Bscic Me,l.~ ...c
and Md~ ", New York, NY, Raven (1991) p. 59), bone ~ ' (Tatalcis, D.N., J. Peridon~ol
64:416 (1993)), destruction of cartilage in the pathogenesis of rll~Jllldtu:d arthritis (Arend, W.P., &
Dayer, J.M., Arthritis Rheum 33:305 (1990); Krane, S.M., et al., Ann. NYAcad. Sci. 580:340 (1990)),
uterine irnrlqrt~ion (Lewis, M.P., e~ al., Placenta 15:13 (I994)), and loss of lean body mass
(Roubenoff, R., et al., J. Clin. Invest. 93:2379 (1994).
Having generally described the invention, the same will be more readily
understood by reference to the following exarnples, which are provided by way
of illustration and are not int~n~ecl as limiting.
Examples
Example 1: Expression and Purif cation oSTIR-like ligand I in E. coli
The DNA sequence encoding the mature T1R-like ligand I in the
deposited cDNA clone is amplified using PCR oligonucleotide primers specific
to the arnino tennin~l sequences of the TlR-like ligand I and to vector sequences
CA 02263830 1999-02-23
W 03~ 1 PCT~US96/13777
-54-
3' to the gene. Additional nucleotides cont~ining restriction sites to facilitate
cloning are added to the 5' and 3' sequences respectively.
One of ordinary skill in the art will understand that the full-length, mature
TlR-like ligand I protein (amino acid about 28 to about 217) can be expressed inE.coli using suitable 5' and 3' oligonucleotide primers.
The cDNA sequence encoding the extracellular domain of the full length
TlR-like ligand I in the deposited clone is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene. The 5'
oligonucleotide primer has the sequence 5' CGC CCA TGG AGC TCA CCT
TCG AGC TG 3' (SEQ ID NO:4) containing the underlined Nco I restriction site
followed by 17 nucleotides (nucleotides 170 to 186) of the TlR-like ligand I
protein coding sequence in FIG. 1 (SEQ ID NO: 1 ) beginning immediately after
the signal peptide.
The 3' primer has the sequence 5' CGC AAG CTT TCA TCG GCT ATT
AAG GTC TTC 3' (SEQ ID NO:5) cont~inine a Hind III reskiction site followed
by a stop codon and 18 nucleotides complementary and reverse to nucleotides
604-621 ofthe TlR-like ligand I coding sequence in FIG. 1 (SEQ ID NO:1).
The restriction sites are convenient to restriction enzyme sites in the
bacterial expression vector pQE60, which are used for bacterial expression in
M15/rep4 host cells in these examples. (Qiagen, Inc., Chatsworth, CA, 9131 1).
pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterialorigin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), a 6-His tag and reskiction enzyme sites.
The amplified TlR-like ligand I DNA and the vector pQE60 both are
digested with NcoI and HindIII and the digested DNAs are then ligated together.
Insertion of the T1 R-like ligand I DNA into the restricted pQE60 vector places
the TlR-like ligand I coding region downstream of and operably linked to the
vector's IPTG-inducible promoter and in-frame with an initiating AUG
appropriately positioned for translation of TlR-like ligand I.
The ligation mixture is transformed into competent E. coli cells using
standard procedures. Such procedures are described in Sambrook et al.,
CA 02263830 1999-02-23
WO 98/07881 PCT/US96/13777
_55_
Molecular Cloning: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989). E. coli strain M15/rep4,
containing multiple copies of the plasmid pREP4, which expresses lac repressor
and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative
example described here. This strain, which is only one of many that are suitablefor expressing TlR-like ligand I, is available commercially from Qiagen.
Transformants are identified by their ability to grow on LB plates in the
presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant
colonies and the identity of the cloned DNA was confirmed by restriction
analysis.
Clones cont~ining the desired constructs are grown overnight ("O/N") in
liquid culture in LB media supplemented with both ampicillin (100 llg/ml) and
kanamycin (25 llg/ml).
The O/N culture is used to inoculate a large culture, at a dilution of
approximately 1:100 to 1:250. The cells are grown to an optical density at 600nm("OD600") of between 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside
("IPTG") is then added to a final concentration of 1 mM to induce transcription
from lac repressor sensitive promoters, by inactivating the lacl repressor. Cells
subsequently are incubated further for 3 to 4 hours. Cells then are harvested bycentrifugation and disrupted, by standard methods. Inclusion bodies are purifiedfrom the disrupted cells using routine collection techniques, and protein is
solubilized from the inclusion bodies into 8M urea. The 8M urea solution
containing the solubilized protein is passed over a PD-10 column in 2X
phosphate-buffered saline ("PBS"), thereby removing the urea, exch~n~ing the
buffer and refolding the protein. The protein is purified by a further step of
chromatography to remove endotoxin. Then, it is sterile filtered. The sterile
filtered protein preparation is stored in 2X PBS at a concentration of 95 ~l/ml.Analysis of the pltpaldlion by standard methods of polyacrylamide gel
electrophoresis reveals that the ple~aldlion contains about 95% monomer TlR-
like ligand I having the expected molecular weight of approximately 18 kDa.
.
CA 02263830 1999-02-23
PCTrUS96tl3777
W O 98/07881
-56-
Example 2: ~loning and Expression of TlR-like ligand I in a Baculovirus
Expression System
The cDNA sequence encoding the full length TlR-like ligand I in the
deposited clone is amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC
AGC ACT GTC CCG 3' (SEQ ID NO:6) containing the underlined BamHI
restriction enzyme site followed by 18 nucleotides (nucleotides 88-105) ofthe
TlR-like ligand I coding sequence in FIG. 1 (SEQ ID NO:1). Inserted into an
expression vector, as described below, the 5' end of the amplified fragment
encoding TlR-like ligand I provides an efficient signal peptide. An e~ficient
signal for initiation of translation in eukaryotic cells, as described by Kozak, M.,
Mol. Biol. 196: 947-950 (1987) is a~pro~liately located in the vector portion
of the construct.
The 3' primer has the sequence 5' CGC GGT ACC TCA CTG CTC CAG
CCT GGG GC 3' (SEQ ID NO:7) cont~ining the underlined Asp 718 restriction
site followed by a stop codon and 17 nucleotides complementary and reverse to
nucleotides 771-787 of the TlR-like ligand I coding sequence set out in FIG. 1
(SEQ ID NO:1).
The cDNA sequence encoding the extracellular domain of the full length
TlR-like ligand I in the deposited clone is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC
AGC ACT GTC CCG 3' (SEQ ID NO:6) con~inin~ the underlined BarnHI
restriction enzyme site followed by 18 nucleotides (nucleotides 88-105) of the
TlR-like ligand I coding sequence in FIG. 1 (SEQ ID NO:1). Inserted into an
c~p,cs~ion vector, as described below, the 5' end of the arnplified fragment
encoding TlR-like ligand I provides an efficient signal peptide. An efficient
signal for initiation of translation in eukaryotic cells, as described by Kozak, M.,
CA 02263830 1999-02-23
PCTAUS96/13777
W O 98107881
--57--
J. Mol. Biol. 196: 947-950 (1987) is apl)lopliately located in the vector portion
of the construct.
The 3' primer has the sequence 5' CGC GGT ACC TCA TCG GCT ATT
AAG GTC TTC 3' (SEQ ID NO:8) co~ g the underlined Asp 718 restriction
site followed by a stop codon and 18 nucleotides complementary and reverse to
nucleotides 604-621 of the Tl R-like ligand I coding sequence set out in FIG. I
(SEQ ID NO:l).
The amplified fragments are isolated from a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
fragment then is digested with BarnH I and Asp 7 18 and again is purified on a 1 %
agarose gel. This fragment is ~lecign~te~l herein F2.
The vector pA2 is used to express the TlR-like ligand I full length and
extracellular domains of an TlR-like ligand I in the baculovirus expression
system, using standard methods, as described in Summers et al., A Manual of
Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987).
The vector pA2 is used to express the TlR-like ligand I full length and
extracellular domains of an TlR-like ligand I in the baculovirus ~x~le~sion
system, using standard methods, as described in Summers et al., A Manual o~
Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987). The pA2 vector
does not contain a signal peptide coding region. Thus, the TlR-like ligand I
signal peptide is relied upon (nucleotides 88 to 168 in Figure 1 (SEQ ID NO: 1 );
arnino acids 1-27 in Figure 1 (SEQ ID NO:2)).
If the TlR-like ligand I signal peptide does not result in efficient
expression of the TlR-like ligand I protein, the pA2-GP vector may be used
instead of the pA2 vector. The signal peptide of AcMNPV gp67, including the
N-tt?rrnin~l methionine, is located just ~ of a BamHI site. One of ordinary
skill in the art will understand that if the pA2-GP expression vector is used, the
5' oligonucleotide used should not contain sequence coding for the TlR-like
., .. , . _ ....
CA 02263830 1999-02-23
W O 98/07881 rCT~US96113777
-58-
ligand I signal peptide. Instead, the S' oligonucleotide should begin at nucleotide
169.
Both the pA2 and pA2-GP expression vectors contain the strong
polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus
(AcMNPV) followed by convenient restriction sites. The signal peptide of
AcMNPV gp67, including the N-terminal methionine, is located just upstream of
a BamHI site. The polyadenylation site of the simian virus 40 ("SV40") is used
for efficient polyadenylation. For an easy selection of recombinant virus the beta-
galactosidase gene from ~. coli is inserted in the same orientation as the
polyhedrin promoter and is followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral
sequences for cell-mediated homologous recombination with wild-type viral
DNA to generate viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of pA2 or pA2-GP,
such as pAc373, pVL941 and pAcIMI provided, as those of skill readily will
appreciate, that construction provides appropriately located signals for
lr~lscl;~,lion, translation, trafficking and the like, such as an in-frame AUG and
a signal peptide, as required. Such vectors are described in Luckow et al.,
Virology 170:31-39, among others.
The plasmid is digested with the restriction enzyme XbaI and then is
dephosphorylated using calf intestinal phosphatase, using routine procedures
known in the art. The DNA is then isolated from a 1% agarose gel using a
commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This
vector DNA is tlesi~n~ted herein "V2".
Fragment F2 and the dephosphorylated plasmid V2 are ligated together
with T4 DNA ligase. E. coli HB 101 cells are transformed with ligation mix and
spread on culture plates Bacteria are identified that contain the plasmid with the
human TlR-like ligand I gene by digesting DNA from individual colonies using
XbaI and then analyzing the digestion product by gel electrophoresis. The
sequence of the cloned fragment is confirmed by DNA seqllenrin~ This plasmid
is design~tecl herein pBacTlR-like ligand I.
CA 02263830 l999-02-23
W O 98/07881 PCTrUS96/13777
_59_
5 ~g ofthe plasmid pBacTlR-like ligand I is co-transfected with 1.0 ~lg
of a commercially available linearized baculovirus DNA ("BaculoGoldTM
baculovirus DNA", Ph~nin~en, San Diego, CA.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. US~l 84: 7413-7417 (1987).
1 llg of BaculoGoldTM virus DNA and 5 ~,lg of the plasmid pBacT1 R-like ligand
I are mixed in a sterile well of a microtiter plate cont~inin~;50~1l of serum-free
Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~1
Lipofectin plus 90 Ill Grace's medium are added, mixed and incubated for 15
minutes at room le"~l)cldlule. Then the transfection mixture is added drop-wise
to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with
1 ml Grace's medium without serum. The plate is rocked back and forth to mix
the newly added solution. The plate is then incubated for 5 hours at 27~C. After5 hours the transfection solution is removed from the plate and 1 ml of Grace's
insect mediurn supplemented with 10% fetal calf serum is added. The plate is putback into an incubator and cultivation is continued at 27~C for four days.
After four days the supern~t~nt is collected and a plaque assay is
perforrned, as described by Surnmers and Smith, cited above. An agarose gel
with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy
identification and isolation of gal-e,~ es~ g clones, which produce blue-stainedpla~ues. (A detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and baculovirology distributed by
Life Technologies Inc., Gaithersburg, page 9-10).
Four days after serial dilution, the virus is added to the cells. After
apL)lopliate incubation, blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar cont~ining the recombinant viruses is then
resuspended in an Eppendorf tube cont~inin~ 200 ~1 of Gracels medium. The agar
is removed by a brief centrifugation and the supernatant containing the
recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Fourdays later the sUpprn~t~nt~ of these culture dishes are harvested and then they are
stored at 4~C. Clones cont~ining properly inserted hESSB I, II and III are
.
CA 02263830 1999-02-23
W 03~ 7O81 PCTrUS96/13777
--60--
identified by DNA analysis including restriction mapping and sequencing. This
is flesign~ted herein as V-TlR-like ligand I.
Sfg cells are grown in Grace's medium supplemented with 10% heat-
inactivated FBS. The cells are infected with the recombinant baculovirus V-TlR-
like ligand I at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3).
Six hours later the medium is removed and is replaced with SF900 II medium
minus methionine and cysteine (available from Life Technologies Inc.,
Gaithersburg). 42 hours later, 5 ~Ci of 35S-methionine and 5 ,uCi 35S-cysteine
(available from Amersham) are added. The cells are further incubated for 16
hours and then they are harvested by centrifugation, Iysed and the labeled proteins
are vicl-~li7~d by SDS-PAGE and autoradiography.
Example 3: Cloning and Expression in Mn~nntn~ Cells
Most of the vectors used for the transient expression of the TlR-like
ligand I protein gene sequence in m~mm~ n cells should carry the SV40 origin
of replication. This allows the replication of the vector to high copy numbers in
cells (e.g. COS cells) which express the T antigen required for the initiation of
viral DNA synthesis. Any other m~mm~ n cell line can also be utilized for this
purpose.
A typical m~n~m~ n expression vector contains the promoter element,
which mediates the initiation of transcription of mRNA, the protein coding
sequence, and signals required for the termination of trancription and
polyadenylation of the transcript. Additional elements include enhancers, Kozak
sequences and intervening sequences flanked by donor and acceptor sites for
RNA splicing. Highly efficient transcription can be achieved with the early and
late promoters from SV40, the long t~rrnin~l repeats (LTRs) from Retroviruses,
e.g. RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
However, cellular signals can also be used (e.g. hurnan actin promoter). Suitable
expression vectors for use in practicing the present invention include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden),
CA 02263830 1999-02-23
W O 98/07881 PCTr~S96/13777
-61-
pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC
67109). ~mm~ n host cells that could be used include, human Hela, 283, H9
and Jurkart cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV 1, African
green monkey cells, quail QCl-3 cells, mouse L cells and Chinese hamster ovary
cells.
Alternatively, the gene can be expressed in stable cell lines that contain
the gene integrated into a chromosome. The co-transfection with a selectable
marker such as dhfr, gpt, neomycin, hygromycin allows the identification and
isolation of the transfected cells.
The transfected gene can also be amplified to express large amounts ofthe
encoded protein. The DHFR (dihydrofolate reductase) is a useful marker to
develop cell lines that carry several hundred or even several thousand copies ofthe gene of interest. Another useful selection marker is the enzyme glutamine
synthase (GS) (Murphy et al., Biochem ~ 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10: 169-175 (1992)). Using these markers, the m~tnm~ qn cells
are grown in selective medium and the cells with the highest resistance are
selected. These cell lines contain the arnplified gene(s) integrated into a
chromosome. Chinese h~m.~ter ovary (CHO) cells are often used for the
production of proteins.
The t;~ es~ion vectors pC l and pC4 contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Brology,
438-4470 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al.,
Cell 41:521-530 (1985)). Multiple cloning sites, e.g. with the restriction enzyme
cleavage sites BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest The vectors contain in addition the 3' intron, the polyadenylation and
termination signal of the rat preproinsulin gene.
,
CA 02263830 l999-02-23
W O 98/07881 PCTrUS96/13777
-62-
F.~rntr/e 3(a): Cloning and Expression in COS Cells
An ~A~lession plasmid is made by cloning a cDNA encoding TlR-like
ligand I into the expression vector pcDNAI/Amp (which can be obtained from
Invitrogen, Inc.).
The expression vector pcDNAI/amp contains: (Dower, Colotta, F., ef al.,
Immunol Today 15:562 (1994)) an E.coli origin of replication effective for
propagation in E. coli and other prokaryotic cells; (Greenfeder, S.A., et al., J.
Biol. Chem. 270:13757 (1995)) an ampicillin resistance gene for selection of
plasmid-cont~ining prokaryotic cells; (Polan, M.L., et al., Am. J: Obstet. Gynecol.
170:1000 (1994)) an SV40 origin of replication for propagation in eukaryotic
cells; (Carinci, Mora, M., et al., Prog. Clin. Biol. Res. 349:205(1990)) a CMV
promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged sothat a cDNA conveniently can be placed under expression control of the CMV
promoter and operably linked to the SV40 intron and the polyadenylation signal
by means of restriction sites in the polylinker.
A DNA fragment encoding the entire TlR-like ligand I precursor and an
HA tag fused in frame to its 3' end is cloned into the polylinker region of the
vector so that recombinant protein expression is directed by the CMV promoter.
The HA tag corresponds to an epitope derived from the influenza hemagglutinin
protein described by Wilson et al., Cell 37: 767 (1984). The fusion ofthe HA tagto the target protein allows easy detection of the recombinant protein with an
antibody that recognizes the HA epitope.
The plasmid construction strategy is as follows.
The TlR-like ligand I cDNA of the deposited clone is amplified using
primers that contain convenient restriction sites, much as described above
regarding the construction of ~ s~ion vectors for ~xl"ession of T1 R-like ligandI in E. coli. To facilitate detection, purification and characterization of the
expressed TlR-like ligand I, one of the primers contains a hemagglutinin tag
("HA tag") as described above.
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
-63-
One of ordinary skill in the art will understand that the full-length TlR-
like ligand I protein (amino acid about I to about 217) can be expressed in COS
cells using suitable 5' and 3' oligonucleotide primers.
The cDNA sequence encoding the extracellular domain of the full length
TlR-like ligand I in the deposited clone is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene.
The 5' primer has the sequence: 5' CGC GGA TCC GCC ATC ATG GGC
AGC ACT GTC CCG 3' (SEQ ID NO:6) having the underlined BamH1 site plus
18 nucleotides corresponding to nucleotides 88-105 in SEQ ID NO:l.
The 3' primer, cont~ining the underlined Xba I site, a stop codon, 9
codons thereafter forrning the hemagglutinin HA tag, and 18 bp of 3' coding
sequence, has the following sequence:
S' CGC TCT AGA TCA AGC GTA GTC TGG GAC GTC GTA TGG
GTA TCG GCT ATT AAG GTC TTC 3' (SEQ ID NO:9) as 604-621 of the
reverse complement of SEQ ID NO: 1.
The PCR arnplified DNA fragment and the vector, pcDNAI/Arnp, are
digested with BamH I and Xba I and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene Cloning
Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed
culture is plated on ampicillin media plates which then are incubated to allow
growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant
colonies and e~mine~l by restriction analysis and gel sizing for the presence ofthe TlR-like ligand I encoding fragment.
For expression of recombinant TlR-like ligand I, COS cells are
transfected with an expression vector, as described above, using DEAE-
DEXTRAN, as described, for instance, in Sambrook et al., Molecular Cloning:
A Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New
York (1989). Cells are incubated under conditions for expression of Tl R-like
ligand I by the vector.
Expression of the TlR-like ligand I HA fusion protein is detected by
radiolabelling and immunoprecipitation, using methods described in, for exarnple
CA 02263830 1999-02-23
W O 98/07881 PCTAUS96/13777
-64-
Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York (1988). To this end, two days
after transfection, the cells are labeled by incubation in media cont~ining 35S-cysteine for 8 hours. The cells and the media are collected, and the cells are
washed and the lysed with d~elge,lL-co~ ,g RIPA buffer: 150 mM NaCl, 1%
NP-40,0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by
Wilson et al. cited above. Proteins are ,~)leci~ d from the cell lysate and fromthe culture media using an HA-specific monoclonal antibody. The precipitated
proteins then are analyzed by SDS-PAGE gels and autoradiography. An
expression product of the expected size is seen in the cell Iysate, which is not seen
in negative controls.
Example 3(b): Cloning and Expression in CHO Cells
The vector pC4 is used for the e~ cssion of Tl R-like ligand protein.
Plasmid pC4 is a derivative of the plasmid pSV2-dhfr [ATCC Accession No.
37146]. Both plasmids contain the mouse DHFR gene under control of the SV40
early promoter. Chinese h~m~ter ovary- or other cells lacking dihydrofolate
activity that are transfected with these plasmids can be selected by growing thecells in a selective mediurn (alpha minus MEM, Life Technologies) supplemented
~vith the chemotherapeutic agent methotrexate. The amplification of the DHFR
genes in cells resistant to methotrexate (MTX) has been well docl-mente(l (see,
e.g., Alt, F.W., Kellems, R.M., Bertino, J.R., and Schimke, R.T., 1978, J. Biol.Chem. 253:1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M.J. and Sycl~nh~m, M.A. 1991, Biotechnology Vol.
9:64-68). Cells grown in increasing concentrations of MTX develop resi.ct~nGe
to the drug by overproducing the target enzyme, DHFR, as a result of
arnplification of the DHFR gene. If a second gene is linked to the DHFR gene
it is usually co-amplified and over-~r~ssed. It is state of the art to develop cell
lines carrying more than 1,000 copies of the genes. Subsequently, when the
CA 02263830 1999-02-23
W O 98/07881 PCTrUS96/13777
-65-
methotrexate is withdra~vn, cell lines contain the arnplified gene integrated into
the chromosome(s).
Plasmid pC4 contains for the expression of the gene of interest a strong
promoter of the long te~ninAl repeat (LTR) of the Rouse Sarcoma Virus (Cullen,
et al., Molecular and Cellular biology, March 1985, 438-4470) plus a fragment
isolated from the enhancer of the irnmediate early gene of human
cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530, 1985). Downstream
of the promoter are the following single restriction enzyme cleavage sites that
allow the integration of the genes: BarnHI, Pvull, and Nrul. Behind these cloning
sites the plasmid contains translational stop codons in all three reading frarnes
followed by the 3' intron and the polyadenylation site of the rat preproinsulin
gene. Other highly efficient promoters can also be used for the exples~ion, e.g.,
the human ~-actin promoter, the SV40 early or late promoters or the long
terminal repeats from other retroviruses, e.g., HIV and HTLVI. For the
polyadenylation of the mRNA other signals, e.g., from the human growth
hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated into the
chromosomes can also be selected upon co-transfection with a selectable marker
such as gpt, G418 or hygromycin. It is advantageous to use more than one
selectable marker in the beginning, e.g. G418 plus methotrexate.
The plasmid pC4 is digested with the restriction enzyme BarnHI and then
dephosphorylated using calf intPstinAl phosphates by procedures known in the artThe vector is then isolated from a 1 % agarose gel.
The DNA sequence encoding TlR like ligand I protein is arnplified using
PCR oligonucleotide primers specific to the arnino t~.nnin:~l sequence of the T1 R
like ligand I protein and to vector sequences 3' to the gene. Additional
nucleotides contAining restriction sites to fAcilit~te cloning are added to the 5' and
3 ' sequences respectively.
The cDNA sequence encoding the full length TlR-like ligand I in the
deposited clone is amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences of the gene. The 5' primer has the sequence 5' CGC
, .... . .
CA 02263830 1999-02-23
wo ~ ,8l PCT/US96/13777
--66--
GGA TCC GCC ATC ATG GGC AGC ACT GTC CCG 3' (SEQ ID NO: 6),
cont~ining the underlined BamH I restriction enzyme site followed by 18
nucleotides (nucleotides 88-105) of the sequence of TlR-like ligand I in FIG. 1
(SEQ ID NO:l). Inserted into an expression vector, as described below, the S'
end ofthe amplified fragment encoding TlR-like ligand I provides an efficient
signal peptide. An efficient signal for initiation of translation in eukaryotic cells,
as described by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is ap~lo~l;ately
located in the vector portion of the construct.
The 3 ' primer has the sequence 5 ' GCG GGT ACC TCA CTG CTC CAG
CCT GGG GC 3 ' (SEQ ID NO: 9), cont~ining the underlined Asp 718 restriction
site followed by a stop codon and 17 nucleotides reverse and complementary to
nucleotides 771-787 ofthe TlR-like ligand coding sequence in FIG. 1 (SEQ ID
NO: 1). The restriction sites are convenient to restriction enzyme sites in the CHO
expression vector PC4.
The cDNA sequence encoding the extracellular domain of the full length
TlR-like ligand I in the deposited clone is amplified using PCR oligonucleotide
primers corresponding to the S' and 3' sequences of the gene.
The 5' primer has the sequence 5' CGC GGA TCC GCC ATC ATG GGC
AGC ACT GTC CCG 3' (SEQ ID NO:6) cont~ining the llnclerlined BamHI
restriction enzyme site and 18 nucleotides (nucleotides 88-105) ofthe TlR-like
ligand I coding sequence in FIG. I (SEQ ID NO:l). Inserted into an ~ ession
vector, as described below, the 5' end ofthe amplified fragment encoding TlR-
like ligand I provides an efficient signal peptide. An efficient signal for initiation
of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:
947-950 (1987) is appl~p.iately located in the vector portion ofthe construct.
The 3' primer has the sequence 5' CGC GGT ACC TCA TCG GCT ATT
AAG GTC TTC 3' (SEQ ID NO:8)co~ g the underlined Asp 718 restriction
site followed by a stop codon and 18 nucleotides reverse and complement~ry to
nucleotides 604-621 ofthe TlR-like ligand I coding sequence set out in FIG. 1
(SEQ ID NO:l).
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
-67-
The amplified TlR-like ligand I DNA are digested with BarnH I and Asp
718. The vector pC4 is digested with BamHI and the digested DNAs are then
ligated together. The isolated fragment and the dephosphorylated vector are thenligated with T4 DNA ligase. Insertion of the TlR like ligand I protein DNA into
the BamH I restricted vector places the TlR like ligand I protein coding region
downstream of and operably linked to the vector's promoter. E.coli HB101 cells
are then transformed and bacteria identified that contained the plasmid pC4
inserted in the correct orientation using the restriction enzyme BamHI. The
ligation mixture is transformed into competent E. coli cells using standard
procedures as described, for example, in Sambrook et al., MOLECULAR
CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989). The transformed culture is
plated on ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies
and ex~mined by restriction analysis and gel sizing for the presence of the Tl R-
like ligand I-encoding fragment. The sequence of the inserted gene is confirmed
by DNA sequencing.
Transfection oSCHO-DHFR-cells
Chinese h~ ovary cells lacking an active DHFR enzyme are used for
transfection. S llg of the expression plasmid C4 are cotransfected with 0.5 ~g of
the plasmid pSVneo using the lipofectin method (Felgner et al., supra). The
plasmid pSV2-neo contains a dominant selectable marker, the gene neo from TnS
encoding an enzyme that confers resi~t~n~e to a group of antibiotics including
G418. The cells are seeded in alpha minus MEM supplem~nted with 1 mg/ml
G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning
plates (Greiner, Germany) and cultivated from 10-14 days. After this period,
single clones are trypsinized and then seeded in 6-well petri dishes using different
concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM).
. ~
CA 02263830 1999-02-23
W O~t~7~1 PCTrUS96tl3777
--68--
Clones growing at the highest concentrations of methotrexate are then transferred
to new 6-well plates cont~ining even higher concentrations of methotrexate (500
nM, 1 ~lM, 2 ~lM, ~ IlM). The same procedure is repeated until clones grow at
a concentration of 100 IlM.
The ~ression of the desired gene product is analyzed by Western blot
analysis and SDS-PAGE. Expression ofthe TlR-like ligand I fusion protein is
~letect~(1 by radiolabelling and immnnnprecipitation, using methods described in,
for example Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988). To this
end, two days after transfection, the cells are labeled by incubation in media
cont~ining 35S-cysteine for 8 hours. The cells and the media are collected, and the
cells are washed and the lysed with detergent-cont~ining RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated from the cell
lysate and from the culture media using an HA-specific monoclonal antibody.
The precipitated proteins then are analyzed by SDS-PAGE gels and
autoradiography. An ex~lession product of the expected size is seen in the cell
lys~te, which is not seen in negative controls.
Example 4: Tiss~e distribution of TlR-like Ligand I gene expression
Northern blot analysis was carried out to examine ex~lession levels ofthe
TlR-like ligand I gene in human tissues, using methods described by, among
others, Sambrook et al., cited above. A cDNA probe cont~ining the entire TlR-
like ligand r nucleotide sequence (SEQ ID NO:1) was labeled with 32p using the
rediprimeT~ DNA labelling system (Amersham Life Science), according to
manufacturer's instructions. After labelling, the probe was purified using a
CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to
m~nl~f~rlllrer's protocol number PT1200-1. The purified labelled probe was then
CA 02263830 1999-02-23
W O 98/07881 PCT~US96/13777
-69-
used to e~zlmine various human tissues for ~ cs~ion of the TlR-like ligand I
gene.
Multiple Tissue Northern (MTN) blots cont~inin~ various human tissues
(H) and human immune system tissues (IM) were obtained from Clontech and
are examined with labelled probe using ExpressHybTM Hybridization Solution
(Clontech) according to manufacturerls protocol number PT1190-1. Following
hybridization and washing, the blots were mounted and exposed to film at -70~C
overnight, and films developed according to standard procedures. An approxi-
mately 2.0 kb TlR-like ligand I signal was detected in lanes cont~ining mRNA
from spleen, Iymphnode, thymus, appendix, bone marrow, fetal liver and
peripheral blood leukocytes. No signal was detected lanes cont~ining mRNA
from non-immune tissues.
An approximately 2.0 kb TlR-like ligand I signal was detected in lanes
containing mRNA from spleen, Iymphnode, thymus, appendix, bone marrow,
fetal liver and peripheral blood leukocytes. No signal was detected lanes
cont~2ining mRNA from non-imml-ne tissues.
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are
possible in light of the above te~ching~ and, therefore, are within the scope of the
appended claims.
The disclosures of all patents, patent applications, and publications
referred to herein are hereby entirely incorporated by reference.
CA 02263830 l999-02-23
WO 98/07881 PCT/US96/13777
-70-
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Human Genome Sciences, Inc.
9410 Key West Avenue
Rockville, MD 20850
United States of America
APPLICANT/INVENTORS: NI, JIAN
GENTZ, REINER L.
ROSEN, CRAIG A.
(ii) TITLE OF INVENTION: Tl RECEPTOR-LIKE LIGAND I
(iii) NUMBER OF SEQUENCES: 9
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: STERNE, KESSLER, GOLDSTEIN h FOX, P.L.L.C.
(B) STREET: 1100 NEW YORK AVENUE, SUITE 600
(C) CITY: WASHINGTON
(D) STATE: D.C.
(E) COUNTRY: USA
(F) ZIP: 20005-3934
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: To be assigned
(B) FILING DATE: 23-AUG-1996
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME:Goldstein, Jorge A.
(B) REGISTRATION NUMBER:29,021
(C) REFERENCE/DOCKET NUMBER: 1488.040PC00
(ix) TELECOMMnNICATION INFORMATION:
(A) TELEPHONE: 202-371-2600
(B) TELEFAX: 202-371-2540
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1401 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS:both
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
CA 02263830 1999-02-23
W O ~ Al PCTAUS96/13777
-7l-
(A) NAME/KEY: CDS
(B) LOCATION: 88..738
(ix) FEATURE:
(A) NAME/KEY: sig_peptide
~B) LOCATION: 88..166
(ix) FEATURE:
(A) NAME/KEY: mat_peptide
(B) LOCATION: 169..738
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GGCACGAGCC CGGTCGGTAG TCGTCGCCCC AGCCCGCCGG GGGCGCACGC CCGCAGCCGC 60
GGCCCTCGAG ACGGGACCGA GAGCATC ATG GGC AGC ACT GTC CCG CGC TCC 111
Met Gly Ser Thr Val Pro Arg Ser
-27 -25 -20
GCC TCC GTG CTG CTT CTG CTG CTG CTC CTG CGC CGG GCC GAG CAG CCC 159
Ala Ser Val Leu Leu Leu Leu Leu Leu Leu Arg Arg Ala Glu Gln Pro
-15 -10 -5
TGC GGG GCC GAG CTC ACC TTC GAG CTG CCG GAC AAC GCC AAG CAG TGC 207
Cys Gly Ala Glu Leu Thr Phe Glu Leu Pro Asp Asn Ala Lys Gln Cys
1 5 10
TTC CAC GAG GAG GTG GAG CAG GGC GTG AAG TTC TCC CTG GAT TAC CAG 255
Phe His Glu Glu Val Glu Gln Gly Val Lys Phe Ser Leu Asp Tyr Gln
15 20 25
GTC ATC ACT GGA GGC CAC TAC GAT GTT GAC TGC TAT GTA GAG GAC CCC 303
Val Ile Thr Gly Gly His Tyr Asp Val Asp Cys Tyr Val Glu Asp Pro
30 35 40 45
CAG GGG AAC ACC ATC TAC AGA GAA ACG AAG AAG CAG TAC GAC AGC TTC 351
Gln Gly Asn Thr Ile Tyr Arg Glu Thr Lys Lys Gln Tyr Asp Ser Phe
50 55 60
ACG TAC CGG GCT GAA GTC AAG GGC GTT TAT CAG TTT TGC TTC AGT AAT 399
Thr Tyr Arg Ala Glu Val Lys Gly Val Tyr Gln Phe Cys Phe Ser Asn
65 70 75
GAG TTT TCC ACC TTC TCT CAC AAG ACC GTC TAC TTT GAC TTT CAA GTG 447
Glu Phe Ser Thr Phe Ser His Lys Thr Val Tyr Phe Asp Phe Gln Val
80 85 90
GGC GAT GAG CCT CCC ATT CTC CCA GAC ATG GGG AAC AGG GTC ACA GCT 495
Gly Asp Glu Pro Pro Ile Leu Pro Asp Met Gly Asn Arg Val Thr Ala
95 100 105
CTC ACC CAG ATG GAG TCC GCC TGC GTG ACC ATC CAT GAG GCT CTG AAA 543
Leu Thr Gln Met Glu Ser Ala Cys Val Thr Ile His Glu Ala Leu Lys
110 115 120 125
., . ~ _ .. . . . . ... .. . .
CA 02263830 l999-02-23
W O 98/07881 PCT~US96/13777
-72-
ACG GTG ATT GAC TCC CAG ACG CAT TAC CGG CTG CGG GAG GTC CAG GAC 591
Thr Val Ile Asp Ser Gln Thr His Tyr Arg Leu Arg Glu Val Gln Asp
130 135 140
CGG GCC CGA GCG GAA GAC CTT AAT AGC CGA GTC TCT TAC TGG TCT GTT 639
Arg Ala Arg Ala Glu Asp Leu Asn Ser Arg Val Ser Tyr Trp Ser Val
145 150 155
GGC GAG ACG ATT GCC CTG TTC GTG GTC AGC TTC AGT CAG GTG CTA CTG 687
Gly Glu Thr Ile Ala Leu Phe Val Val Ser Phe Ser Gln Val Leu Leu
160 165 170
TTG AAA AGC TTC TTC ACA GAA AAA CGA CCC ATC AGC AGG GCA GTC CAC 735
Leu Lys Ser Phe Phe Thr Glu Lys Arg Pro Ile Ser Arg Ala Val His
175 180 185
TCC TAGCCCCGGC ATCCTGCTCT AGGGCCCCTC ATGCCCCAGG CTGGAGCAGC 788
Ser
190
TCTCCTAGGT CACAGCCTGC TGGGCTGGGT CGCGTAGCCC AGGGTGGAGG CAGAACGATG 848
CTGCTGTGGT AGCCCTTTGC CTTTCATGCC CATGCTTGAT TCTTGCACCT CAGCAGCTGA 908
AGGTCTCAGA GCCCAGTAAT CAGAAGGCAT CCGACTGCAT TAAGTGTGCA GCGCTGAAAA 968
GACATTTACA ACTAGGCCAG GGATTAGCCA CTGTGGGAGG GTGGACAGGC AATGGTTCAG 1028
TGGCCTGGCT GTTGGCAGGA ACTCCAAGTG CCCAGGCCTC TTGGGCAGCT TAGGGCCCTG 1088
C~ lC ATGATGCATG GGTCATTTGT CTTGGGTGTC CTATCCCATA TGGAGAAGAA 1148
AGGGGCTCTA AGTTCTGGCT ~ CTT TGGGGTTCTC TGTACCTGAG GAAACCAGGC 1208
CCTGGGTGAC TTTGCAGATC TGCTCACCCT CGGTGAGCAA CAGTGTCAGC CATGCAAGCA 1268
GGACAGAATG GTGACTGGGT GCCCTTGGTG AG~ ~lAT TTCCTAGGAG GTAGAAAACT 1328
GTGGGAAACT GTGGCTAATA AAAACTAAGT GTGAGCGTCC TGGAAAAAAA PAAVU~LAAA 1388
PAU~UUUAAAA AAA 1401
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 217 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) ~Q~N~ DESCRIPTION: SEQ ID NO:2:
CA 02263830 1999-02-23
WO 98107881 PCTIUS96/13777
-73-
Met Gly Ser Thr Val Pro Arg Ser Ala Ser Val Leu Leu Leu Leu Leu
-27 -25 -20 -15
Leu Leu Arg Arg Ala Glu Gln Pro Cys Gly Ala Glu Leu Thr Phe Glu
-10 -5 1 5
~eu Pro Asp Asn Ala Lys Gln Cys Phe His Glu Glu Val Glu Gln Gly
~al Lys Phe Ser Leu Asp Tyr Gln Val Ile Thr Gly Gly His Tyr Asp
Val Asp Cys Tyr Val Glu Asp Pro Gln Gly Asn Thr Ile Tyr Arg Glu
Thr Lys Lys Gln Tyr Asp Ser Phe Thr Tyr Arg Ala Glu Val Lys Gly
Val Tyr Gln Phe Cys Phe Ser Asn Glu Phe Ser Thr Phe Ser His Lys
~hr Val Tyr Phe Asp Phe Gln Val Gly Asp Glu Pro Pro Ile Leu Pro
100
~sp Met Gly Asn Arg Val Thr Ala Leu Thr Gln Met Glu Ser Ala Cys
105 110 115
Val Thr Ile His Glu Ala Leu Lys Thr Val Ile Asp Ser Gln Thr His
120 125 130
Tyr Arg Leu Arg Glu Val Gln Asp Arg Ala Arg Ala Glu Asp Leu Asn
135 140 145
Ser Arg Val Ser Tyr Trp Ser Val Gly Glu Thr Ile Ala Leu Phe Val
150 155 160 165
Val Ser Phe Ser Gln Val Leu Leu Leu Lys Ser Phe Phe Thr Glu Lys
170 175 180
~rg Pro Ile Ser Arg Ala Val His Ser
185 190
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 227 amino acids
(B) TYPE: amino acid
~C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
CA 02263830 l999-02-23
W O 98/07881 PCTrUS96l13M7
-74-
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Met Met Ala Ala Gly Ala Ala Leu Ala Leu Ala Leu Trp Leu Leu Met
1 5 10 15
Pro Pro Val Glu Val Gly Gly Ala Gly Pro Pro Pro Ile Gln Asp Gly
Glu Phe Thr Phe Leu Leu Pro Ala Gly Arg Lys Gln Cys Phe Tyr Gln
Ser Ala Pro Ala Asn Ala Ser Leu Glu Thr Glu Tyr Gln Val Ile Gly
Gly Ala Gly Leu Asp Val Asp Phe Thr Leu Glu Ser Pro Gln Gly Val
Leu Leu Val Ser Glu Ser Arg Lys Ala Asp Gly Val His Thr Val Glu
Pro Thr Glu Ala Gly Asp Tyr Lys Leu Cys Phe Asp Asn Ser Phe Ser
100 105 110
Thr Ile Ser Glu Lys Leu Val Phe Phe Glu Leu Ile Phe Asp Ser Leu
115 120 125
Gln Asp Asp Glu Glu Val Glu Gly Trp Ala Glu Ala Val Glu Pro Glu
130 135 140
Glu Met Leu Asp Val Lys Met Glu Asp Ile Lys Glu Ser Ile Glu Thr
145 150 155 160
Met Arg Thr Arg Leu Glu Arg Ser Ile Gln Met Leu Thr Leu Leu Arg
165 170 175
Ala Phe Glu Ala Arg Asp Arg Asn Leu Gln Glu Gly Asn Leu Glu Arg
180 185 190
Val Asn Phe Trp Ser Ala Val Asn Val Ala Val Leu Leu Leu Val Ala
195 200 205
Val Leu Gln Val Cys Thr Leu Lys Arg Phe Phe Gln Asp Lys Arg Pro
210 215 220
Val Pro Thr
225
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
CA 02263830 1999-02-23
W O 98/07881 PCTAUS96113777
-75-
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
CGCCCATGGA GCTCACCTTC GAGCTG 26
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
CGCAAGCTTT CATCGGCTAT TAAGGTCTTC 30
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CGCGGATCCG CCATCATGGG CAGCACTGTC CCG 33
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRAMDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
CA 02263830 1999-02-23
W 0~8~'~7~1 PCTrUS96/13777
-76-
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CGCGGTACCT CACTGCTCGA CCCTGGGGC 29
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) S~QU~:N~ DESCRIPTION: SEQ ID NO:8:
CGCGGTACCT CATCGGCTAT TAAGGTCTTC 30
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CGCTCTAGAT CAAGCGTAGT CTGGGACGTC GTATGGGTAT CGGCTATTAA GGTCTTC 57
