Note: Descriptions are shown in the official language in which they were submitted.
?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/19575- 1 _NUCLEIC ACID AND AMINO ACID SEQUENCES RELATING TOHELICOBACTER PYLORI AND VACCINE COMPOSITIONS THEREOFBackground of the InventionHelicabacter pylori is a gram-negative. S-shaped, microaerophilic bacterium thatwas discovered and cultured from a human gastric biopsy specimen. (Warren. J .R. andB. Marshall. (1983) Lancet 1: 1273-1275; and Marshall et al., (1984) Micrabias Lett. ;5_:83-88). H pylori has been strongly linked to chronic gastritis and duodenal ulcerdisease. (Rathbone et. al., (1986) Gut 27: 635-641). Moreover, evidence isaccumulating for an etiologic role of H. pylori in nonulcer dyspepsia, gastric ulcerdisease, and gastric adenocarcinoma. (Blaser M. J., (1993) Trends Microbial. 1: 255-260). Transmission of the bacteria occurs via the oral route, and the risk of infectionincreases with age. (Taylor. D.N. and M. J. Blaser, (1991) Epidemial. Rev 13: 42-50).H. pylori colonizes the human gastric mucosa. establishing an infection that usuallypersists for decades. Infection by H. pylori is prevalent worldwide. Developedcountries have infection rates over 50% of the adult population, while developingcountries have infection rates reaching 90% of the adults over the age of 20. (HopkinsR. J. and J. G. Morris (1994) Am. J. Med. 2]: 265-277).The bacterial factors necessary for colonization of the gastric environment, andfor virulence of this pathogen. are poorly understood. Examples of the putativevirulence factors include the following: urease, an enzyme that may play a role inneutralizing gastric acid pH (Eaton et al., (1991) Infect. Immunal. 52: 2470-2475;Ferrero, R.L. and A. Lee (1991) Micrab. Ecal. Hlth. Dis. 4: 121-134; Labigne et al.,(1991) J. Bacterial. l?: 1920-1931); the bacterial flagellar proteins responsible formotility across the mucous layer. (Hazell et al., (1986) J. Inf." Dis. _l_5_3_: 658-663; Leyinget al., (1992) M01. Microbial. Q: 2863-2874; and Haas et al., (1993) M01. Microbial. 8:753-760); Vac A, a bacterial toxin that induces the formation of intracellular vacuoles inepithelial cells (Schmitt, W. and R. Haas, (1994) Molecular Microbial. 12(2): 307-319);and several gastric tissue-speci?c adhesins. (Boren et al., (1993) Science E2: 1892-1895; Evans et al.. (1993) J. Bacterial. 115: 674-683; and Falk et al., (1993) Prac. Natl.Acad. Sci. USA m 2035-203). 9Numerous therapeutic agents are currently available that eradicate H. pyloriinfections in vitra. (Huesca et. al.. (1993) Zbl. Bakt. 280: 244-252; Hopkins, R. J. and J.G. Morris, supra). However. many of these treatments are suboptimally effective in vivabecause of bacterial resistance. altered drug distribution, patient nonâcompliance or poordrug availabilty. (Hopkins. R. J. and J. G. Morris. supra). Treatment with antibioticscombined with bismuth are part of the standard regime used to treat H. pylori infection.?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-2-(Malfertheiner. P. and J. E. Dominguez-Munoz (1993) Clinical Therapeutics Q Supp.B: 37-48). Recently, combinations of a proton pump inhibitors and a single antibiotichave been shown to ameliorate duodenal ulcer disease. (Malfertheiner. P. and J. E.Dominguez-Munoz supra). However, methods employing antibiotic agents can have theproblem of the emergence of bacterial strains which are resistant to these agents.(Hopkins, R. J. and J. G. Morris. supra). These limitations demonstrate that new moreeffective methods are needed to combat H. pylori infections in vivo. In particular, thedesign of new vaccines that may prevent infection by this bacterium is highly desirable.Summary of the InventionThis invention relates to novel genes. e.g., genes encoding polypeptides such asbacterial surface proteins. from the organism Helicobacter pylori (H. pylori), and otherrelated genes. their products. and uses thereof. The nucleic acids and peptides of thepresent invention have utility for diagnostic and therapeutics for H. pylori and otherHelicobacter species. They can also be used to detect the presence of H. pylori andother Helicobacter species in a sample; and for use in screening compounds for theability to interfere with the H. pylori life cycle or to inhibit H. pylori infection. Morespecifically, this invention features compositions of nucleic acids corresponding toentire coding sequences of H. pylori proteins. including surface or secreted proteins orparts thereof, nucleic acids capable of binding mRNA from 1-1. pylori proteins to blockprotein translation. and methods for producing H. pylori proteins or parts thereof usingpeptide synthesis and recombinant DNA techniques. This invention also featuresantibodies and nucleic acids useful as probes to detect H. pylori infection. In addition.vaccine compositions and methods for the protection or treatment of infection by H.pylori are within the scope of this invention.Detailed Description of the DrawingsFigure 1 is a bar graph that depicts the antibody titer in serum of mice followingimmunization with specific H. pylori antigens.Figure 2 is a bar graph that depicts the antibody titer in mucous of micefollowing immunization with speci?c H. pylori antigens.Figure 3 is a bar graph that depicts therapeutic immunization of H. pyloriinfected mice with specific antigens dissolved in HEPES buffer.Figure 4 is a bar graph that depicts therapeutic immunization of H. pyloriinfected mice with specific antigens dissolved in buffer containing DOC.?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/19575Figure 5 depicts the amino acid sequence alignment in a portion of the sequenceof five H. pylori proteins (depicted in the single letter amino acid code; shown N-terminal to C-terminal, left to right).Figure 6 depicts the amino acid sequence alignment in a portion of the sequenceof four H. pylori proteins (depicted in the single letter amino acid code; shown N-terminal to C-terminal. left to right).Figure 7 depicts the amino acid sequence alignment in a portion of the sequenceof two H. pylori proteins (depicted in the single letter amino acid code; shown N-terminal to C-terminal, left to right).Figure 8 depicts the amino acid sequence alignment in a portion of the sequenceof two H. pylori proteins (depicted in the single letter amino acid code; shown N-terminal to C-terminal, left to right).Detailed Description of the InventionIn one aspect. the invention features a recombinant or substantially purepreparation of H. pylori polypeptide of SEQ ID NO: 74. The invention also includessubstantially pure nucleic acid encoding an H. pylori polypeptide of SEQ ID NO: 74,such nucleic acid is contained in SEQ ID NO: I. The H. pylori polypeptide sequencesof the invention described herein are contained in the Sequence Listing, and the nucleicacids encoding H. pylori polypeptides of the invention are contained in the SequenceListing.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 75,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 2.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 76,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 3.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 77,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 4.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 78,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 5.In another aspect, the invention features a substantially pure nucleic acidencoding an H pylori polypeptide having an amino acid sequence of SEQ ID NO: 79,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 6.?10I520253035W0 98/18323CA 02265523 l999-03- 16-4-In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 7.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 8.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 9.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 10.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1 1.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 12.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 13.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 14.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 15.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 16.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 17.In another aspect, the invention features a substantially pure nucleic acidencoding an H pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 18.PCT/US97/1957580,81,82,83,84,85,86,87,88,89,90,91,?101520253035WO 98118323CA 02265523 l999-03- 16-5-In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 19.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 20.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 21.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 22.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 23.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 24.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 25.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 26.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 27.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 28.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 29.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 30.PCT/US97/1957592,93,94,95,96,97,98,99.100,101,102,103,?101520253035W0 98/18323CA 02265523 l999-03- 16-5-In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 31.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 32.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 33.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 34.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 35.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 36.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 37.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 38.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 39.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 40.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 41.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 42.PCT/US97/19575104,105,106,107,108,109,110,111,112,113,114,115.?101520253035W0 98/ 18323CA 02265523 l999-03- 16-7-In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO:43.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 44.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 45.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 46.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 47.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 48.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 49.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 50.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 51.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 52.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 53.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 54.PCT/U S97/ 19575116,I17,118,119,I20,121,122,123,124,125,126,127,?10I520253035W0 98/ 18323CA 02265523 l999-03- 16-3-In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 55.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 56.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 57.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 58.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 59.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 60.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 61.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 62.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 63.In another aspect. the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 64.In another aspect. the invention features a substantially pure nucleic acidencoding an H pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 65.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO:such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 66.PCT/US97/19575I28,129,130,131,132,133,134,135,I36,137,I38,139,?101520253035W0 98/ 18323CA 02265523 1999-03-16PCT/US97/19575_ 9 _In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 140,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 67.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 141,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 68.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 142,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 69.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 143,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 70.In another aspect. the invention features a substantially pure nucleic acidencoding an H pylori polypeptide having an amino acid sequence of SEQ ID NO: 144,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 71.In another aspect, the invention features a substantially pure nucleic acidencoding an H. pylori polypeptide having an amino acid sequence of SEQ ID NO: 145,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 72.In another aspect, the invention features a substantially pure nucleic acidencoding an H pylori polypeptide having an amino acid sequence of SEQ ID NO: 146,such as a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 73.Particularly perferred is an isolated nucleic acid comprising a nucleotidesequence encoding an H. pylori cell envelope polypeptide or a fragment thereof. Suchnucleic acid is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 25,SEQ ID NO: 48, SEQ ID NO: 16, SEQ ID NO: 10, SEQ ID NO: 45, SEQ ID NO: 35,SEQ ID NO: 37, SEQ ID NO: 7, SEQ ID NO: 39, SEQ ID NO: 55, SEQ ID NO: 18,SEQ ID NO: 19, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 52, SEQ ID NO: 54,SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 1, SEQ ID NO: 42, SEQ ID NO: 14,SEQ ID NO: 43, SEQ ID NO: 11, SEQ ID NO: 71, SEQ ID NO: 17, SEQ ID NO: 57,SEQ ID NO: 5, SEQ ID NO: 6. SEQ ID NO: 8. and SEQ ID NO: 21.In another embodiment. the H. pylori cell envelope polypeptide or a fragmentthereof is an H. pylori inner membrane polypeptide or a fragment thereof encoded by thenucleic acid selected from the group consisting of SEQ ID âNO: 3, SEQ ID NO: 25, andSEQ ID NO: 48.In another embodiment. the H. pylori cell envelope polypeptide or a fragmentthereof is an H. pylori outer membrane polypeptide or a fragment thereof encoded by thenucleic acid selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 10,,.i,.,................u......l..............................,....._,.... ..?101520253035W0 98/ 18323CA 02265523 l999-03- 16PCT/U S97/ 19575- 10 -SEQ ID NO: 45, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 7, SEQ ID NO: 39,SEQ ID NO: 55, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 28, SEQ ID NO: 30,SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 1,SEQ ID NO: 42, SEQ ID NO: 14, SEQ ID NO: 43, SEQ ID NO: 11, and SEQ ID NO:71.In another embodiment, the H. pylori outer membrane polypeptide or a fragmentthereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof encoded by the nucleic acid selected fromthe group consisting of SEQ ID NO: 1, SEQ ID NO: 42, SEQ ID NO: 14, SEQ ID NO:43, SEQ ID NO: 1 1, and SEQ ID NO:71.In yet another embodiment, the H. pylori outer membrane polypeptide or afragment thereof is an H. pylori polypeptide having a terminal phenylalanine residue ora fragment thereof encoded by the nucleic acid selected from the group consisting ofSEQ ID NO: 16, SEQ ID NO: 45, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 7,SEQ ID NO: 39, SEQ ID NO: 55, SEQ ID NO: 18. SEQ ID NO: 19, SEQ ID NO: 28,SEQ ID NO: 30, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO:58.Particularly preferred is an isolated nucleic acid comprising a nucleotidesequence encoding an H. pylori secreted polypeptide or a fragment thereof. Suchnucleic acid is selected from the group consisting of SEQ ID NO: 72, SEQ ID NO: 32,SEQ ID NO: 51, SEQ ID N022, SEQ ID NO: 4, SEQ ID NO: 9, SEQ ID NO: 13, SEQID NO: 22, SEQ ID NO: 29, SEQ ID NO: 31. SEQ ID NO: 33, SEQ ID NO: 34. SEQID NO: 36. SEQ ID NO: 38, SEQ ID NO: 40. SEQ ID NO: 41, SEQ ID NO: 44, SEQID NO: 46, SEQ ID NO: 49, SEQ ID NO: 53. SEQ ID NO: 59, SEQ ID NO: 61, SEQID NO: 62, SEQ ID NO: 63. SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, andSEQ ID NO: 68.Particularly preferred is an isolated nucleic acid comprising a nucleotidesequence encoding an H. pylori cellular polypeptide or a fragment thereof. Such nucleicacid is selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 15, SEQ IDNO: 20. SEQ ID NO: 23. SEQ IDVNO: 24, SEQ ID NO: 26, SEQ ID NO: 27, SEQ IDNO: 47, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 69, SEQ IDNO: 70, and SEQ ID NO: 73.Particularly preferred is a purified or isolated H. pylori cell envelope polypeptideor a fragment thereof, wherein the polypeptide is selected from the group consisting ofSEQ ID NO: 76, SEQ ID NO: 98, SEQ ID NO: 121. SEQ ID NO: 89, SEQ ID NO: 83,SEQ ID NO: 118, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 80, SEQ ID NO:112, SEQ ID NO: 128, SEQ ID NO: 91. SEQ ID NO: 92, SEQ ID NO: 101, SEQ ID?1520253035WO 98/18323CA 02265523 1999-03-16PCT/US97/19575- 1 1 _NO: 103, SEQ ID NO: 125, SEQ ID NO: 127. SEQ ID NO: 129, SEQ ID NO: 131, SEQID NO: 74, SEQ ID NO: 115, SEQ ID NO: 87, SEQ ID NO: 116, SEQ ID NO: 84, SEQID NO: 144, SEQ ID NO: 90, SEQ ID NO: 130. SEQ ID NO: 78. SEQ ID NO: 79, SEQID NO: 81, and SEQ ID NO: 94.In another embodiment. the H. pylori cell envelope polypeptide or a fragmentthereof is an H. pylori inner membrane polypeptide or a fragment thereof selected fromthe group consisting of SEQ ID NO: 76, SEQ ID NO: 98, and SEQ ID NO: 121.In another embodiment. the H. pylori cell envelope polypeptide or a fragmentthereof is an H pylori outer membrane polypeptide or a fragment thereof selected fromthe group consisting of SEQ ID NO: 89, SEQ ID NO: 83, SEQ ID NO: 118, SEQ IDNO: 108, SEQ ID NO: 110, SEQ ID NO: 80. SEQ ID NO: 112, SEQ ID NO: 128, SEQID NO: 91, SEQ ID NO: 92, SEQ ID NO: 101, SEQ ID NO: 103. SEQ ID NO: 125,SEQ ID NO: 127, SEQ ID NO: 129. SEQ ID NO: 131. SEQ ID NO: 74, SEQ ID NO:115, SEQ ID NO: 87, SEQ ID NO: 116, SEQ ID NO: 84, SEQ ID NO: 144, SEQ IDNO: 90, and SEQ ID NO: 130.In another embodiment, the H. pylori outer membrane polypeptide or a fragmentthereof is an H. pylori polypeptide having a terminal phenylalanine residue and a C-terminal tyrosine cluster or a fragment thereof selected from the group consisting ofSEQ ID NO: 74, SEQ ID NO: 115, SEQ ID NO: 87, SEQ ID NO: 116. SEQ ID NO: 84,and SEQ ID NO:144.In another embodiment. the H. pylori outer membrane polypeptide or a fragmentthereof is an H. pylori polypeptide having a terminal phenylalanine residue or afragment thereof selected from the group consisting of SEQ ID NO: 89. SEQ ID NO:118, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 80, SEQ ID NO: 112, SEQ IDNO: 128, SEQ ID NO: 91. SEQ ID NO: 92, SEQ ID NO: 101, SEQ ID NO: 103, SEQID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131.Particularly preferred is a purified or isolated H. pylori secreted polypeptide or afragment thereof, wherein the polypeptide is selected from the group consisting of SEQID NO: 145, SEQ ID NO: 105. SEQ ID NO: 124, SEQ ID NO: 75, SEQ ID NO: 77,SEQ ID NO: 82, SEQ ID NO: 86,vSEQ ID NO: 95, SEQ ID NO: 102. SEQ ID NO: 104,SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO:113, SEQ ID NO: 114, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 122, SEQ IDNO: 126, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, and SEQ ID NO: 141.Particularly preferred is a purified or isolated H. pylori cellular polypeptide or afragment thereof, wherein the polypeptide is selected from the group consisting of SEQID NO: 85, SEQ ID NO: 88, SEQ ID NO: 93, SEQ ID NO: 96, SEQ ID NO: 97, SEQ?101520253035CA 02265523 l999-03- 16W0 93/ 18323 PCT/US97/19575-12-ID NO: 99, SEQ ID NO: 100. SEQ ID NO: 120. SEQ ID NO: 123, SEQ ID NO: 133,SEQ ID NO: 137, SEQ ID NO: 142, SEQ ID NO: 143, and SEQ ID NO: 146.In another aspect, the invention pertains to any individual H. pylori polypeptidemember or nucleic acid encoding such a member from the above-identified groups of H.pylori polypeptides.In another aspect, the invention features nucleic acids capable of binding mRNAof H. pylori. Such nucleic acid is capable of acting as antisense nucleic acid to controlthe translation of mRNA of H. pylori. A further aspect features a nucleic acid which iscapable of binding speci?cally to an H. pylori nucleic acid. These nucleic acids are alsoreferred to herein as complements and have utility as probes and as capture reagents.In another aspect, the invention features an expression system comprising anopen reading frame corresponding to H. pylori nucleic acid. The nucleic acid furthercomprises a control sequence compatible with an intended host. The expression systemis useful for making polypeptides corresponding to H pylori nucleic acid.In another aspect, the invention features a cell transformed with the expressionsystem to produce H. pylori polypeptides.In another aspect, the invention features a method of generating antibodiesagainst H. pylori polypeptides which are capable of binding specifically to H. pyloripolypeptides. Such antibodies have utility as reagents for immunoassays to evaluate theabundance and distribution of H pyloriâspecific antigens.In another aspect, the invention features a method of generating vaccines forimmunizing an individual against H. pylori. The vaccination method includes:immunizing a subject with at least one H. pylori polypeptide according to the presentinvention, e.g., a surface or secreted polypeptide. or active portion thereof, and apharmaceutically acceptable carrier. Such vaccines have therapeutic and/or prophylacticutilities.In another aspect, the invention provides a method for generating a vaccinecomprising a modified immunogenic H pylori polypeptide, e.g., a surface or secretedpolypeptide, or active portion thereof, and a pharmacologically acceptable carrier.In another aspect, the invention features a method of evaluating a compound, e.g.a polypeptide, e.g., a fragment of a host cell polypeptide, for the ability to bind an H.pylori polypeptide. The method includes: contacting the candidate compound with anH pylori polypeptide and determining if the compound binds or otherwise interacts withan H. pylori polypeptide. Compounds which bind H. pylori are candidates as activatorsor inhibitors of the bacterial life cycle. These assays can be performed in vitro or invivo.?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/19575-13-In another aspect, the invention features a method of evaluating a compound, e.g.a polypeptide. e.g., a fragment of a host cell polypeptide. for the ability to bind an H.pylori nucleic acid, e.g., DNA or RNA. The method includes: contacting the candidatecompound with an H. pylori nucleic acid and determining if the compound binds orotherwise interacts with an H. pylori polypeptide. Compounds which bind H. pylori arecandidates as activators or inhibitors of the bacterial life cycle. These assays can beperformed in vitro or in vivo.The invention features H. pylori polypeptides. preferably a substantially purepreparation of an H. pylori polypeptide, or a recombinant H. pylori polypeptide. Inpreferred embodiments: the polypeptide has biological activity; the polypeptide has anamino acid sequence at least 60%, 70%, 80%. 90%, 95%, 98%, or 99% identical orhomologous to an amino acid sequence of the invention contained in the SequenceListing, preferably it has about 65% sequence identity with an amino acid sequence ofthe invention contained in the Sequence Listing, and most preferably it has about 92% toabout 99% sequence identity with an amino acid sequence of the invention contained inthe Sequence Listing; the polypeptide has an amino acid sequence essentially the sameas an amino acid sequence of the invention contained in the Sequence Listing; thepolypeptide is at least 5, 10, 20, 50, 100, or 150 amino acid residues in length; thepolypeptide includes at least 5, preferably at least 10. more preferably at least 20, morepreferably at least 50, 100, or 150 contiguous amino acid residues of the inventioncontained in the Sequence Listing. In yet another preferred embodiment, the amino acidsequence which differs in sequence identity by about 7% to about 8% from the H. pyloriamino acid sequences of the invention contained in the Sequence Listing is alsoencompassed by the invention.In preferred embodiments: the H. pylori polypeptide is encoded by a nucleicacid of the invention contained in the Sequence Listing, or by a nucleic acid having atleast 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with a nucleic acid of theinvention contained in the Sequence Listing.In a preferred embodiment, the subject H. pylori polypeptide differs in aminoacid sequence at 1, 2, 3, 5, 10 or more residues from a sequence of the inventioncontained in the Sequence Listing.â The differences, however. are such that the H. pyloripolypeptide exhibits an H. pylori biological activity, e.g., the H. pylori polypeptideretains a biological activity of a naturally occurring H. pylori polypeptide.In preferred embodiments, the polypeptide includes all or a fragment of an aminoacid sequence of the invention contained in the Sequence Listing; fused, in readingframe, to additional amino acid residues, preferably to residues encoded by genomic?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/ 19575- 14 -DNA 5' or 3' to the genomic DNA which encodes a sequence of the invention containedin the Sequence Listing.In yet other preferred embodiments, the H. pylori polypeptide is a recombinantfusion protein having a first H. pylori polypeptide portion and a second polypeptideportion, eg, a second polypeptide portion having an amino acid sequence unrelated toH. pylori. The second polypeptide portion can be, e.g., any of glutathione-S-transferase,a DNA binding domain. or a polymerase activating domain. In preferred embodimentthe fusion protein can be used in a two-hybrid assay.Polypeptides of the invention include those which arise as a result of alternativetranscription events, alternative RNA splicing events, and alternative translational andpostranslational events.The invention also encompasses an immunogenic component which includes atleast one H. pylori polypeptide in an immunogenic preparation; the immunogeniccomponent being capable of eliciting an immune response specific for the H. pyloripolypeptide, e. g., a humoral response, an antibody response, or a cellular response. Inpreferred embodiments, the immunogenic component comprises at least one antigenicdeterminant from a polypeptide of the invention contained in the Sequence Listing.In another aspect, the invention provides a substantially pure nucleic acid havinga nucleotide sequence which encodes an H. pylori polypeptide. In preferredembodiments: the encoded polypeptide has biological activity; the encoded polypeptidehas an amino acid sequence at least 60%. 70%, 80%, 90%. 95%, 98%, or 99%homologous to an amino acid sequence of the invention contained in the SequenceListing; the encoded polypeptide has an amino acid sequence essentially the same as anamino acid sequence of the invention contained in the Sequence Listing; the encodedpolypeptide is at least 5, 10, 20, 50, 100, or 150 amino acids in length; the encodedpolypeptide comprises at least 5, preferably at least 10, more preferably at least 20, morepreferably at least 50, 100, or 150 contiguous amino acids of the invention contained inthe Sequence Listing.In preferred embodiments: the nucleic acid of the invention is that contained inthe Sequence Listing; the nucleic acid is at least 60%, 70%. 80%, 90%, 95%, 98%, or99% homologous with a nucleic acid sequence of the invention contained in theSequence Listing.In a preferred embodiment. the encoded H. pylori polypeptide differs (e.g., byamino acid substitution, addition or deletion of at least one amino acid residue) in aminoacid sequence at 1, 2, 3, 5, 10 or more residues, from a sequence of the inventioncontained in the Sequence Listing. The differences, however, are such that: the H.?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/19575- 1 5 _pylori encoded polypeptide exhibits a H. pylori biological activity, e.g., the encoded H.pylori enzyme retains a biological activity of a naturally occurring H. pylori.In preferred embodiments, the encoded polypeptide includes all or a fragment ofan amino acid sequence of the invention contained in the Sequence Listing; fused, inreading frame, to additional amino acid residues, preferably to residues encoded bygenomic DNA 5' or 3' to the genomic DNA which encodes a sequence of the inventioncontained in the Sequence Listing.In preferred embodiments, the subject H. pylori nucleic acid will include atranscriptional regulatory sequence. e.g. at least one of a transcriptional promoter ortranscriptional enhancer sequence, operably linked to the H. pylori gene sequence, e.g.,to render the H. pylori gene sequence suitable for expression in a recombinant host cell.In yet a further preferred embodiment. the nucleic acid which encodes an H.pylori polypeptide of the invention, hybridizes under stringent conditions to a nucleicacid probe corresponding to at least 8 consecutive nucleotides of the invention containedin the Sequence Listing; more preferably to at least 12 consecutive nucleotides of theinvention contained in the Sequence Listing; more preferably to at least 20 consecutivenucleotides of the invention contained in the Sequence Listing; more preferably to atleast 40 consecutive nucleotides of the invention contained in the Sequence Listing.In a preferred embodiment, the nucleic acid encodes a peptide which differs by atleast one amino acid residue from the sequences of the invention contained in theSequence Listing.In a preferred embodiment, the nucleic acid differs by at least one nucleotidefrom a nucleotide sequence of the invention contained in the Sequence Listing whichencodes amino acids of the invention contained in the Sequence Listing.In another aspect, the invention encompasses: a vector including a nucleic acidwhich encodes an H. pylori polypeptide or an H. pylori polypeptide variant as describedherein; a host cell transfected with the vector; and a method of producing a recombinantH. pylori polypeptide or H. pylori polypeptide variant; including culturing the cell, e.g.,in a cell culture medium, and isolating the H. pylori or H. pylori polypeptide variant,e.g., from the cell or from the cell culture medium.In another aspect, the invention features, a purified recombinant nucleic acidhaving at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology with asequence of the invention contained in the Sequence Listing.The invention also provides a probe or primer which includes a substantiallypuri?ed oligonucleotide. The oligonucleotide includes a region of nucleotide sequencewhich hybridizes under stringent conditions to at least 8 consecutive nucleotides ofsense or antisense sequence of the invention contained in the Sequence Listing, or?101520253035CA 02265523 l999-03- 16WO 98/18323 PCT/US97/ 19575-16-naturally occurring mutants thereof. In preferred embodiments, the probe or primerfurther includes a label group attached thereto. The label group can be, e.g., aradioisotope, a ?uorescent compound, an enzyme, and/or an enzyme co-factor.Preferably the oligonucleotide is at least 8 and less than 10, 20, 30, 50, 100, or 150nucleotides in length.The invention also provides an isolated H. pylori polypeptide which is encodedby a nucleic acid which hybridizes under stringent hybridization conditions to a nucleicacid contained in the Sequence Listing.The invention further provides nucleic acids. e.g., RNA or DNA, encoding apolypeptide of the invention. This includes double stranded nucleic acids as well ascoding and antisense single strands.The H. pylori strain, from which genomic sequences have been sequenced, hasbeen deposited in the American Type Culture Collection (ATCC # 55679; deposited byGenome Therapeutics Corporation, 100 Beaver Street. Waltham, MA 02154) as strainHP-J99.Included in the invention are: allelic variations; natural mutants; inducedmutants; proteins encoded by DNA that hybridizes under high or low stringencyconditions to a nucleic acid which encodes a polypeptide of the invention contained inthe Sequence Listing (for de?nitions of high and low stringency see Current Protocols inMolecular Biology, John Wiley & Sons, New York, 1989. 6.3.1 - 6.3.6 and 6.4.1-6.4.10,hereby incorporated by reference); and. polypeptides specifically bound by antisera to H.pylori polypeptides, especially by antisera to an active site or binding domain of H.pylori polypeptide. The invention also includes fragments. preferably biologicallyactive fragments. These and other polypeptides are also referred to herein as H. pyloripolypeptide analogs or variants.Putative functions have been determined for several of the H. pylori polypeptidesof the invention, as shown in Table 1.Accordingly, uses of the claimed H. pylori polypeptides based on these identi?edfunctions, as well as other functions as described herein. are also within the scope of theinvention.In addition, the present invention encompasses H pylori polypeptidescharacterized as shown in Table 1 below, including: H pylori cell envelope proteins, H.pylori secreted proteins, and H. pylori cellular proteins. Members of these groups wereidentified by BLAST homology searches and by searches for secretion signal ortransmembrane protein motifs. Polypeptides related by significant homology to thepolypeptides of Table 1 are also considered to be classi?ed in the manner of thehomologs shown in Table 1.?WO 98/18323CA02265523 1999-03-16PCT/US97/19575- 17 -TABLE 1ORF_Name and Group nt SeqiD aa SeqlDA. CELL ENVELOPEA.1 inner membrane proteinsO2ge1 1622_23494043_f1_6 3 76hp5p15212_13095752_c3_36 25 9806ep30223_20173437_f1_37 48 121A.2 Outer membrane proteins05ee10816_14495437_f2_13 10 83A.2.1 Termina| phe residue06ep11509_35954752_f2__1 16 89O6ep10615_14495437_f3_47 45 11803ae10804_14495437__c2_38 35 10805ae30220__917200_c3_172 37 11004cp1 1202_23646885_f2_26 7 8005ep10815_16131925_c2_97 39 11209cp61003_5860877__f2_23 55 128O9ae10512_48768_c3_67 18 9109cp11003_5860877_f3_7 19 92hp6e12267_30478562_f3_33 28 10106cp30603_34174212_c3_71 30 103O9cp10224_1 962590_f3_31 52 12509cp61003_30478562_c3_106 54 12711ae80818_10553192_f2_16 56 12911ee11408_10584582_c3_51 58 131A.2.2 Termina| phe residue and C-terminal tyrosine clusterO1ae12001_116018_c2__40 1 74O6ap10609__116018_c3_50 42 11506cp30603_4687507_f1_9 14 8706cp30603_4687507_f1_7 43 11605ee10816_36126938_f3_16 11 8401cp20708_4960952_c1_43 71 144A3 Via homoigyO7ap80601__5083193_f3_8 17 9011ap20714_4797137_f3_45 57 130A.4 Other cell envelope proteins04ap12016_25501501_f1_1 5 7804cp1 1202_20415937_f2_25 6 7904ee11108_3906963_f1_7 8 8129ep10720_25501501_c2_33 21 94B. SECRETED PROTEINShp3e10342_22448587_c2_15 72 145hp5p15212_24276587__f1__2 32 105O9ce10413_35336707_f2_9 51 124?CA 02265523 l999-03- 16wo 98/18323 PCTIUS97/19575- 13 -01ae12001_32462543_c2_43 2 7503ee11215_1416312_c3_35 4 77O5ae30220_14570443_c2_94 9 8206cp30603_2772578_c1_46 13 8629ep10720_289077__f2_12 22 95O3ee11215_22542803_f1_7 29 10209ae10512_3155040_c1_4o 31 104O1ce11104_10742963_c2_12 33 10602ge101 16_36335436_f3_66 34 10704ep41903_11876461_f1_4 36 10905ce10208_23631292_f1_6 38 11105ep10815_22447252_c3_110 40 11305ep10815_30283516_c3_109 41 11406ee30709_33851038_c3__30 44 11706ep1 1202_21667842_c3_35 46 11906ep30223_2774062_f1_33 49 12209cp10713__23912707_c1_26 53 12611ee1 1408_4882318_f3_24 59 132hp4e13394__5908553_f1_1 61 134hp4e53394_1416312_c3_119 62 135hp5e15211_24328910_c3_38 63 136hp6p10606_23493756_c1_21 65 138hp6p22217_23564012_f1_5 66 139np6p22217_272056_f1_2 67 140hp6p22217_2922143_f2_9 68 1410. OTHER CELLULAR PROTEINS06ap111 19_14726542_f3_21 12 8506ee10709_6136430_c1_11 15 8812ap10605_14094816_c1_5 20 93hp2p10272_34042518_f1_2 23 96hp5e15211_2541âl557_c1_22 24 97hp5p15641_3907968_f1_3 26 99hp6e10967_657638_f3_9 27 10006ep11202_4569693_c2_28 47 12006ep30223_3930466_c1_110 50 123hp2e10911_960952_c2_86 60 133hp6p10509_14642217_c2_17 64 137hp6p80503_20964382_f2_11 69 142hp7e10192_59â|7593_f1_2 70 143hp6p10509_14642217_c3_25 73 146[In Table 1, "111" represents nucleotide Seq. ID number and "aa" represents amino acidSeq. ID number]De?nitionsThe terms "purified polypeptide" and "isolated polypeptide" and "a substantiallypure preparation of a polypeptide" are used interchangeably herein and. as used herein,?101520253035W0 98/18323CA 02265523 l999-03- 16PCT/U S97/ 19575_ 19 -from other proteins, lipids, and nucleic acids with which it naturally occurs. Preferably,the polypeptide is also separated from substances, e.g._. antibodies or gel matrix, e.g.,polyacrylamide, which are used to purify it. Preferably, the polypeptide constitutes atleast 10, 20, 50 70, 80 or 95% dry weight of the purified preparation. Preferably, thepreparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10,or 100 pg of the polypeptide; at least 1, 10, or 100 mg of the polypeptide. Furthermore,the terms "puri?ed polypeptide" and "isolated polypeptide" and "a substantially purepreparation of a polypeptide," as used herein. refer to both a polypeptide obtained fromnature or produced by recombinant DNA techniques as described herein.For example, an "isolated" or "puri?ed" protein or biologically active portionthereof is substantially free of cellular material or other contaminating proteins from thecell or tissue source from which the H. pylori protein is derived, or substantially freefrom chemical precursors or other chemicals when chemically synthesized. Thelanguage "substantially free of cellular material" includes preparations of H. pyloriprotein in which the protein is separated from cellular components of the cells fromwhich it is isolated or recombinantly produced. In one embodiment, the language"substantially free of cellular material" includes preparations of H. pylori protein havingless than about 30% (by dry weight) of non-H. pylori protein (also referred to herein as a"contaminating protein"), more preferably less than about 20% of non-H. pylori protein,still more preferably less than about 10% of non-H. pylori protein, and most preferablyless than about 5% non-H. pylori protein. When the H. pylori protein or biologicallyactive portion thereof is recombinantly produced. it is also preferably substantially freeof culture medium, i.e., culture medium represents less than about 20%, more preferablyless than about 10%, and most preferably less than about 5% of the volume of theprotein preparation.The language "substantially free of chemical precursors or other chemicals"includes preparations of H. pylori protein in which the protein is separated fromchemical precusors or other chemicals which are involved in the synthesis of the protein.In one embodiment, the language "substantially free of chemical precursors or otherchemicals" includes preparations of H. pylori protein having less than about 30% (by dryweight) of chemical precursors or non~H. pylori chemicals. more preferably less thanabout 20% chemical precursors or non-H. pylori chemicals, still more preferably lessthan about 10% chemical precursors or non-H. pylori chemicals, and most preferablyless than about 5% chemical precursors or non-H. pylori chemicals.A purified preparation of cells refers to, in the case of plant or animal cells, an invitro preparation of cells and not an entire intact plant or animal. In the case of cultured?101520253035CA 02265523 l999-03- 16WO 98118323 PCT/US97/19575-20-cells or microbial cells, it consists of a preparation of at least 10% and more preferably50% of the subject cells.A purified or isolated or a substantially pure nucleic acid, e.g., a substantiallypure DNA, (are terms used interchangeably herein) is a nucleic acid which is one or bothof the following: not immediately contiguous with both of the coding sequences withwhich it is immediately contiguous (i.e.. one at the 5' end and one at the 3â end) in thenaturally-occurring genome of the organism from which the nucleic acid is derived; orwhich is substantially free of a nucleic acid with which it occurs in the organism fromwhich the nucleic acid is derived. The term includes, for example, a recombinant DNAwhich is incorporated into a vector, e.g., into an autonomously replicating plasmid orvirus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as aseparate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR orrestriction endonuclease treatment) independent of other DNA sequences. Substantiallypure DNA also includes a recombinant DNA which is part of a hybrid gene encodingadditional H. pylori DNA sequence.A "contig" as used herein is a nucleic acid representing a continuous stretch ofgenomic sequence of an organism.An "open reading frame". also referred to herein as ORF, is a region of nucleicacid which encodes a polypeptide. This region may represent a portion of a codingsequence or a total sequence and can be determined from a stop to stop codon or from astart to stop codon.As used herein, a "coding sequence" is a nucleic acid which is transcribed intomessenger RNA and/or translated into a polypeptide when placed under the control ofappropriate regulatory sequences. The boundaries of the coding sequence aredetermined by a translation start codon at the five prime terminus and a translation stopcode at the three prime terminus. A coding sequence can include but is not limited tomessenger RNA, synthetic DNA, and recombinant nucleic acid sequences.A "complement" of a nucleic acid as used herein referes to an anti-parallel orantisense sequence that participates in Watson-Crick base-pairing with the originalsequence.A "gene product" is a protein or structural RNA which is specifically encoded bya gene.As used herein, the term "probe" refers to a nucleic acid, peptide or otherchemical entity which specifically binds to a molecule of interest. Probes are oftenassociated with or capable of associating with a label. A label is a chemical moietycapable of detection. Typical labels comprise dyes, radioisotopes, luminescent andchemiluminescent moieties, fluorophores. enzymes. precipitating agents, ampli?cation?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/19575- 3 1 -sequences, and the like. Similarly, a nucleic acid, peptide or other chemical entity whichspeci?cally binds to a molecule of interest and immobilizes such molecule is referredherein as a "capture ligand". Capture ligands are typically associated with or capable ofassociating with a support such as nitro-cellulose, glass. nylon membranes, beads,particles and the like. The speci?city of hybridization is dependent on conditions suchas the base pair composition of the nucleotides. and the temperature and saltconcentration of the reaction. These conditions are readily discemable to one ofordinary skill in the art using routine experimentation.Homologous refers to the sequence similarity or sequence identity between twopolypeptides or between two nucleic acid molecules. When a position in both of the twocompared sequences is occupied by the same base or amino acid monomer subunit, e.g.,if a position in each of two DNA molecules is occupied by adenine. then the moleculesare homologous at that position. The percent of homology between two sequences is afunction of the number of matching or homologous positions shared by the twosequences divided by the number of positions compared x l()0. For example, if 6 of 10of the positions in two sequences are matched or homologous then the two sequences are60% homologous. By way of example, the DNA sequences ATTGCC and TATGGCshare 50% homology. Generally, a comparison is made when two sequences are alignedto give maximum homology.Nucleic acids are hybridizable to each other when at least one strand of a nucleicacid can anneal to the other nucleic acid under defined stringency conditions.Stringency of hybridization is determined by: (a) the temperature at which hybridizationand/or washing is performed; and (b) the ionic strength and polarity of the hybridizationand washing solutions. Hybridization requires that the two nucleic acids containcomplementary sequences; depending on the stringency of hybridization, however,mismatches may be tolerated. Typically, hybridization of two sequences at highstingency (such as, for example, in a solution of 0.5X SSC, at 65° C) requires that thesequences be essentially completely homologous. Conditions of intermediate stringency(such as, for example, 2X SSC at 65 ° C) and low stringency (such as, for example 2XSSC at 55° C), require correspondingly less overall complementarity between thehybridizing sequences. (lX SSC is 0.15 M NaCl, 0.015 M Na citrate). A preferred,non-limiting example of stringent hybridization conditions are hybridization in 6Xsodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in0.2 X SSC, 0.1% SDS at 50-65°C.The terms peptides. proteins, and polypeptides are used interchangeably herein.?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/ 19575-22-As used herein. the term "surface protein" refers to all surface accessibleproteins, e.g. inner and outer membrane proteins, proteins adhering to the cell wall, andsecreted proteins.A polypeptide has H. pylori biological activity if it has one, two and preferablymore of the following properties: (1) if when expressed in the course of an H. pyloriinfection, it can promote, or mediate the attachment of H. pylori to a cell; (2) it has anenzymatic activity, structural or regulatory function characteristic of an H. pyloriprotein; (3) the gene which encodes it can rescue a lethal mutation in an H. pylori gene;(4) or it is immunogenic in a subject. A polypeptide has biological activity if it is anantagonist, agonist, or super-agonist of a polypeptide having one of the aboveâlistedproperties.A biologically active fragment or analog is one having an in vivo or in vitroactivity which is characteristic of the H pylori polypeptides of the invention containedin the Sequence Listing, or of other naturally occurring H. pylori polypeptides, e.g., oneor more of the biological activities described herein. Especially preferred are fragmentswhich exist in vivo, e.g., fragments which arise from post transcriptional processing orwhich arise from translation of alternatively spliced RNA's. Fragments include thoseexpressed in native or endogenous cells as well as those made in expression systems,e.g., in CHO cells. Because peptides such as H. pylori polypeptides often exhibit arange of physiological properties and because such properties may be attributable todifferent portions of the molecule. a useful H. pylori fragment or H. pylori analog is onewhich exhibits a biological activity in any biological assay for H. pylori activity. Mostpreferably the fragment or analog possesses 10%, preferably 40%. more preferably 60%,70%, 80% or 90% or greater of the activity of H. pylori, in any in vivo or in vitro assay.Analogs can differ from naturally occurring H. pylori polypeptides in amino acidsequence or in ways that do not involve sequence, or both. Non-sequence modi?cationsinclude changes in acetylation. methylation. phosphorylation, carboxylation, orglycosylation. Preferred analogs include H. pylori polypeptides (or biologically activefragments thereof) whose sequences differ from the wildâtype sequence by one or moreconservative amino acid substitutions or by one or more nonâconservative amino acidsubstitutions, deletions, or insertions which do not substantially diminish the biologicalactivity of the H. pylori polypeptide. Conservative substitutions typically include thesubstitution of one amino acid for another with similar characteristics, e.g., substitutionswithin the following groups: valine, glycine; glycine. alanine; valine, isoleucine,leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine,arginine; and phenylalanine, tyrosine. Other conservative substitutions can be made inview of the table below.?02265523 l999-03- 16WO 98/18323 PCT/US97/ 19575- 2 3 -TABLE 2CONSERVATIVE AMINO ACID REPLACEMENTSFor Amino Acid Code Replace with any ofAlanine A D-Ala, Gly, beta-Ala. L-Cys, D-CysArginine D-Arg, Lys, D-Lys, homo-Arg, D-homoâArg, Met, Ile,D-Met. D-Ile. Orn, D-OmAsparagine N D-Asn, Asp, DâAsp, Glu, D-Glu, Gln, D-GlnAspartic Acid D DâAsp, D-Asn, Asn, Glu, D-Glu, Gln, D-GlnCysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-ThrGlutamine Q D-Gln. Asn, D-Asn, Glu, D-Glu, Asp, D-AspGlutamic Acid E D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-GlnGlycine G Ala, D-Ala. Pro, D-Pro, B-Ala, AcpIsoleucine I D-Ile. Val, D-Val, Leu, DâLeu, Met, D-MetLeucine L DâLeu, Val, D-Val, Leu, D-Leu, Met, D-MetLysine K D-Lys, Arg, DâArg, homoâArg, D-homoâArg, Met, D-Met. Ile, D-Ile, Om, D-OmMethionine M D-Met, S-Me-Cys, Ile, D-Ile. Leu, DâLeu, Val. D-ValPhenylalanine F D-Phe, Tyr, D-Thr. L-Dopa, His. D-His, Trp, D-Trp,Trans-3,4, or 5-phenylproline, cis-3,4,or 5âpheny1prolineProline P D-Pro, L-I-thioazolidine-4-carboxylic acid, D-or L-1-oxazolidine-4âcarboxylic acidSerine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, Met(O),D-Met(O). L-Cys, D-CysThreonine T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, Met(O).D-Met(O), Val, D-ValTyrosine D-Tyr, Phe, D-Phe, L-Dopa, His, D-HisValine D-Val, Leu, DâLeu, Ile, D-Ile, Met, D-Met?101520253035CA 02265523 l999-03- 16WO 98/18323 PCT/US97/19575-24-Other analogs within the invention are those with modi?cations which increasepeptide stability; such analogs may contain. for example, one or more non-peptide bonds(which replace the peptide bonds) in the peptide sequence. Also included are: analogsthat include residues other than naturally occurring L-amino acids, e.g., D-amino acidsor nonânaturally occurring or synthetic amino acids. e.g., [3 or y amino acids; and cyclicanalogs.As used herein. the term "fragment", as applied to an H. pylori analog, willordinarily be at least about 20 residues, more typically at least about 40 residues,preferably at least about 60 residues in length. Fragments of H pylori polypeptides canbe generated by methods known to those skilled in the art. The ability of a candidatefragment to exhibit a biological activity of H. pylori polypeptide can be assessed bymethods known to those skilled in the an as described herein. Also included are H.pylori polypeptides containing residues that are not required for biological activity of thepeptide or that result from alternative mRNA splicing or alternative protein processingevents.An "immunogenic component" as used herein is a moiety, such as an H. pyloripolypeptide. analog or fragment thereof, that is capable of eliciting a humoral and/orcellular immune response in a host animal alone or in combination with an adjuvant.An "antigenic component" as used herein is a moiety, such as an H. pyloripolypeptide, analog or fragment thereof, that is capable of binding to a specific antibodywith sufficiently high affinity to form a detectable antigen-antibody complex.As used herein, the term "transgene" means a nucleic acid (encoding, e.g., one ormore polypeptides), which is partly or entirely heterologous. i.e., foreign, to thetransgenic animal or cell into which it is introduced. or. is homologous to an endogenousgene of the transgenic animal or cell into which it is introduced, but which is designed tobe inserted. or is inserted. into the cell's genome in such a way as to alter the genome ofthe cell into which it is inserted (e.g., it is inserted at a location which differs from thatof the natural gene or its insertion results in a knockout). A transgene can include one ormore transcriptional regulatory sequences and any other nucleic acid, such as introns,that may be necessary for optimal expression of the selected nucleic acid, all operablylinked to the selected nucleic acid. and may include an enhancer sequence.As used herein, the term "transgenic cell" refers to a cell containing a transgene.As used herein, a "transgenic animal" is any animal in which one or more, andpreferably essentially all, of the cells of the animal includes a transgene. The transgenecan be introduced into the cell, directly or indirectly by introduction into a precursor ofthe cell, by way of deliberate genetic manipulation. such as by a process oftransformation of competent cells or by microinjection or by infection with a?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-25-recombinant virus. This molecule may be integrated within a chromosome, or it may beextrachromosomally replicating DNA.The term "antibody" as used herein is intended to include fragments thereofwhich are speci?cally reactive with H. pylori polypeptides.As used herein, the term "cell-specific promoter" means a DNA sequence thatserves as a promoter, i.e., regulates expression of a selected DNA sequence operablylinked to the promoter, and which effects expression of the selected DNA sequence inspeci?c cells of a tissue. The term also covers soâcalled "leaky" promoters, whichregulate expression of a selected DNA primarily in one tissue, but cause expression inother tissues as well.Misexpression, as used herein, refers to a non-wild type pattern of geneexpression. It includes: expression at non-wild type levels, i.e., over or underexpression; a pattern of expression that differs from wild type in terms of the time orstage at which the gene is expressed. e.g., increased or decreased expression (ascompared with wild type) at a predetermined developmental period or stage; a pattern ofexpression that differs from wild type in terms of decreased expression (as comparedwith wild type) in a predetermined cell type or tissue type; a pattern of expression thatdiffers from wild type in terms of the splicing size. amino acid sequence, post-transitional modi?cation, or biological activity of the expressed polypeptide; a pattern ofexpression that differs from wild type in terms of the effect of an environmental stimulusor extracellular stimulus on expression of the gene, e.g., a pattern of increased ordecreased expression (as compared with wild type) in the presence of an increase ordecrease in the strength of the stimulus.As used herein. "host cells" and other such terms denoting microorganisms orhigher eukaryotic cell lines cultured as unicellular entities refers to cells which canbecome or have been used as recipients for a recombinant vector or other transfer DNA,and include the progeny of the original cell which has been transfected. It is understoodby individuals skilled in the art that the progeny of a single parental cell may notnecessarily be completely identical in genomic or total DNA compliment to the originalparent, due to accident or deliberate mutation.As used herein. the term "control sequence" refers to a nucleic acid having a basesequence which is recognized by the host organism to effect the expression of encodedsequences to which they are ligated. The nature of such control sequences differsdepending upon the host organism; in prokaryotes, such control sequences generallyinclude a promoter. ribosomal binding site, terminators, and in some cases operators; ineukaryotes, generally such control sequences include promoters, tenninators and insome instances. enhancers. The term control sequence is intended to include at a?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-26-minimum, all components whose presence is necessary for expression. and may alsoinclude additional components whose presence is advantageous, for example, leadersequences.As used herein, the term "operably linked" refers to sequences joined or ligatedto function in their intended manner. For example, a control sequence is operably linkedto coding sequence by ligation in such a way that expression of the coding sequence isachieved under conditions compatible with the control sequence and host cell.The metabolism of a substance, as used herein, means any aspect of the,expression, function, action, or regulation of the substance. The metabolism of asubstance includes modifications, e.g., covalent or non-covalent modifications of thesubstance. The metabolism of a substance includes modi?cations, e.g., covalent or non-covalent modification. the substance induces in other substances. The metabolism of asubstance also includes changes in the distribution of the substance. The metabolism ofa substance includes changes the substance induces in the distribution of othersubstances.A "sample" as used herein refers to a biological sample, such as, for example,tissue or ?uid isloated from an individual (including without limitation plasma, serum,cerebrospinal ?uid, lymph, tears, saliva and tissue sections) or from in vitro cell cultureconstituents, as well as samples from the environment.The practice of the invention will employ, unless otherwise indicated,conventional techniques of chemistry, molecular biology, microbiology, recombinantDNA, and immunology, which are within the skill of the art. Such techniques areexplained fully in the literature. See e. g. , Sambrook. Fritsch, and Maniatis, MolecularCloning; Laboratory Manual 2nd ed. (1989); DNA Cloning, Volumes I and II (D.NGlover ed. 1985); Oligonucleotide Synthesis (MJ. Gait ed. 1984); Nucleic AcidHybridization (B.D. Hames & S.J. Higgins eds. 1984); the series, Methods inEnzymoloqy (Academic Press, Inc.), particularly Vol. 154 and Vol. 155 (Wu andGrossman, eds.) and PCR-A Practical Approach (McPherson, Quirke, and Taylor, eds.,1991).I. Isolation of Nucleic Acids ofH. pylori and Uses ThereforH. pylori Genomic SequenceThis invention provides nucleotide sequences of the genome of H. pylori whichthus comprises a DNA sequence library of H. pylori genomic DNA. The detaileddescription that follows provides nucleotide sequences of H. pylori, and also describeshow the sequences were obtained and how ORFS and protein~coding sequences were?101520253035W0 98/18323CA 02265523 l999-03- 16PCT/US97/19575-27-identi?ed. Also described are methods of using the disclosed H. pylori sequences inmethods including diagnostic and therapeutic applications. Furthermore. the library canbe used as a database for identification and comparison of medically importantsequences in this and other strains of H. pylori.To determine the genomic sequence of H. pylori, DNA was isolated from a strainof H. pylori (ATCC # 55679; deposited by Genome Therapeutics Corporation, 100Beaver Street, Waltham, MA 02154) and mechanically sheared by nebulization to amedian size of 2 kb. Following size fractionation by gel electrophoresis. the fragmentswere blunt-ended, ligated to adapter oligonucleotides, and cloned into each of 20different pMPX vectors (Rice et al., abstracts of Meeting of Genome Mapping andSequencing, Cold Spring Harbor, NY, 5/ l 1-5/15, 1994, p. 225) to construct a series of"shotgun" subclone libraries.DNA sequencing was achieved using multiplex sequencing proceduresessentially as disclosed in Church et al., 1988, Science 2_4Q:185; U.S. Patents No.4,942,124 and 5,149,625). DNA was extracted from pooled cultures and subjected tochemical or enzymatic sequencing. Sequencing reactions were resolved byelectrophoresis, and the products were transferred and covalently bound to nylonmembranes. Finally, the membranes were sequentially hybridized with a series oflabelled oligonucleotides complimentary to "tag" sequences present in the differentshotgun cloning vectors. In this manner, a large number of sequences could be obtainedfrom a single set of sequencing reactions. The cloning and sequencing procedures aredescribed in more detail in the Exemplification.Individual sequence reads obtained in this manner were assembled using theFALCONTM program (Church et al. , 1994, Automated DNA Sequencing and Analysis,J .C. Venter, ed., Academic Press) and PHRAP (P. Green, Abstracts of DOE HumanGenome Program Contractor-Grantee Workshop V, Jan. 1996, p.157). The averagecontig length was about 3-4 kb.A variety of approaches are used to order the contigs so as to obtain a continuoussequence representing the entire H. pylori genome. Synthetic oligonucleotides aredesigned that are complementary to sequences at the end of each contig. Theseoligonucleotides may be hybridized to libaries of H. pylori genomic DNA in, forexample, lambda phage vectors or plasmid vectors to identify clones that containsequences corresponding to the junctional regions between individual contigs. Suchclones are then used to isolate template DNA and the same oligonucleotides are used asprimers in polymerase chain reaction (PCR) to amplify junctional fragments, thenucleotide sequence of which is then determined.-._..........a...._..........t..........»...,M_..... .. . ......................................a_.- . ,..w............r............_..m...a.......,,......?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97l19575-23-The H. pylori sequences were analyzed for the presence of open reading frames(ORFS) comprising at least 180 nucleotides. As a result of the analysis of ORFs basedon stop-to-stop codon reads, it should be understood that these ORFs may notcorrespond to the ORF of a naturally-occurring H. pylori polypeptide. These ORFS maycontain start codons which indicate the initiation of protein synthesis of a naturally-occurring H. pylori polypeptide. Such start codons within the ORFs provided herein canbe identi?ed by those of ordinary skill in the relevant art, and the resulting ORF and theencoded H. pylori polypeptide is within the scope of this invention. For example, withinthe ORFS at codon such as AUG or GUG (encoding methionine or valine) which is partof the initiation signal for protein synthesis can be identi?ed and the ORF modi?ed tocorrespond to a naturally-occurring H. pylori polypeptide. The predicted coding regionswere defined by evaluating the coding potential of such sequences with the programGENEMARKTM (Borodovsky and Mclninch. 1993. Camp. Chem. ?:l23).Other H. pylori Nucleic AcidsThe nucleic acids of this invention may be obtained directly from the DNA of theabove referenced H. pylori strain by using the polymerase chain reaction (PCR). See"PCR, A Practical Approach" (McPherson, Quirke, and Taylor, eds., IRL Press, Oxford,UK, 1991) for details about the PCR. High ?delity PCR can be used to ensure a faithfulDNA copy prior to expression. In addition, the authenticity of amplified products can bechecked by conventional sequencing methods. Clones carrying the desired sequencesdescribed in this invention may also be obtained by screening the libraries by means ofthe PCR or by hybridization of synthetic oligonucleotide probes to ?lter lifts of thelibrary colonies or plaques as known in the art (see, eg, Sambrook et al., MolecularCloning, A Laboratory Manual 2nd edition, 1989, Cold Spring Harbor Press, NY).It is also possible to obtain nucleic acids encoding H. pylori polypeptides from acDNA library in accordance with protocols herein described. A cDNA encoding an H.pylori polypeptide can be obtained by isolating total mRNA from an appropriate strain.Double stranded cDNAs can then be prepared from the total mRNA. Subsequently, thecDNAs can be inserted into a suitable plasmid or viral (e.g., bacteriophage) vector usingany one of a number of known techniques. Genes encoding H. pylori polypeptides canalso be cloned using established polymerase chain reaction techniques in accordancewith the nucleotide sequence information provided by the invention. The nucleic acidsof the invention can be DNA or RNA. Preferred nucleic acids of the invention arecontained in the Sequence Listing.The nucleic acids of the invention can also be chemically synthesized usingstandard techniques. Various methods of chemically synthesizing polydeoxynucleotides?101520253035W0 98/ 18323CA 02265523 1999-03-16PCT/U S97/ 19575-29-are known, including solid-phase synthesis which, like peptide synthesis, has been fullyautomated in commercially available DNA synthesizers (See e.g., Itakura e_t gL U.S.Patent No. 4,598,049; Caruthers gt aL U.S. Patent No. 4,458,066; and Itakura U.S.Patent Nos. 4,401,796 and 4,3 73,071 , incorporated by reference herein).Nucleic acids isolated or synthesized in accordance with features of the presentinvention are useful, by way of example, without limitation, as probes. primers, captureligands. antisense genes and for developing expression systems for the synthesis ofproteins and peptides corresponding to such sequences. As probes, primers, captureligands and antisense agents. the nucleic acid normally consists of all or part(approximately twenty or more nucleotides for speci?city as well as the ability to formstable hybridization products) of the nucleic acids of the invention contained in theSequence Listing. These uses are described in further detail below.$988.A nucleic acid isolated or synthesized in accordance with the sequence of theinvention contained in the Sequence Listing can be used as a probe to specifically detectH. pylori. With the sequence information set forth in the present application, sequencesof twenty or more nucleotides are identi?ed which provide the desired inclusivity andexclusivity with respect to H. pylori, and extraneous nucleic acids likely to beencountered during hybridization conditions. More preferably, the sequence willcomprise at least twenty to thirty nucleotides to convey stability to the hybridizationproduct formed between the probe and the intended target molecules.Sequences larger than 1000 nucleotides in length are difficult to synthesize butcan be generated by recombinant DNA techniques. Individuals skilled in the art willreadily recognize that the nucleic acids, for use as probes, can be provided with a label tofacilitate detection of a hybridization product.Nucleic acid isolated and synthesized in accordance with the sequence of theinvention contained in the Sequence Listing can also be useful as probes to detecthomologous regions (especially homologous genes) of other Helicobacter species usingappropriate stringency hybridization conditions as described herein.Capture Ligand >For use as a capture ligand. the nucleic acid selected in the manner describedabove with respect to probes, can be readily associated with a support. The manner inwhich nucleic acid is associated with supports is well known. Nucleic acid havingtwenty or more nucleotides in a sequence of the invention contained in the SequenceListing have utility to separate H. pylori nucleic acid from the nucleic acid of each otherand other organisms. Nucleic acid having twenty or more nucleotides in a sequence ofthe invention contained in the Sequence Listing can also have utility to separate other?101520253035CA 02265523 l999-03- 16WO 98118323 PCT/US97/19575-30-Helicobacter species from each other and from other organisms. Preferably, thesequence will comprise at least twenty nucleotides to convey stability to thehybridization product formed between the probe and the intended target molecules.Sequences larger than 1000 nucleotides in length are dif?cult to synthesize but can begenerated by recombinant DNA techniques.PrimersNucleic acid isolated or synthesized in accordance with the sequences describedherein have utility as primers for the ampli?cation of H. pylori nucleic acid. Thesenucleic acids may also have utility as primers for the ampli?cation of nucleic acids inother Helicobacter species. With respect to polymerase chain reaction (PCR)techniques. nucleic acid sequences of 3 10-15 nucleotides of the invention contained inthe Sequence Listing have utility in conjunction with suitable enzymes and reagents tocreate copies of H. pylori nucleic acid. More preferably, the sequence will comprisetwenty or more nucleotides to convey stability to the hybridization product formedbetween the primer and the intended target molecules. Binding conditions of primersgreater than 100 nucleotides are more difficult to control to obtain speci?city. High?delity PCR can be used to ensure a faithful DNA copy prior to expression. In addition,ampli?ed products can be checked by conventional sequencing methods.The copies can be used in diagnostic assays to detect speci?c sequences,including genes from H. pylori and/or other Helicobacter species. The copies can alsobe incorporated into cloning and expression vectors to generate polypeptidescorresponding to the nucleic acid synthesized by PCR. as is described in greater detailherein.AntisenseNucleic acid or nucleic acid-hybridizing derivatives isolated or synthesized inaccordance with the sequences described herein have utility as antisense agents toprevent the expression of H. pylori genes. These sequences also have utility as antisenseagents to prevent expression of genes of other Helicobacter species.In one embodiment, nucleic acid or derivatives corresponding to H. pylorinucleic acids is loaded into a suitable carrier such as a liposome or bacteriophage forintroduction into bacterial cells. For example, a nucleic acid having twenty or morenucleotides is capable of binding to bacteria nucleic acid or bacteria messenger RNA.Preferably, the antisense nucleic acid is comprised of 20 or more nucleotides to providenecessary stability of a hybridization product of non-naturally occurring nucleic acid andbacterial nucleic acid and/or bacterial messenger RNA. Nucleic acid having a sequencegreater than 1000 nucleotides in length is dif?cult to synthesize but can be generated byrecombinant DNA techniques. Methods for loading antisense nucleic acid in liposomes?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/U S97/ 19575- 31 -is known in the art as exempli?ed by U.S. Patent 4,241,046 issued December 23, 1980to Papahadjopoulos et al.11. Expression of H. pylori Nucleic AcidsNucleic acid isolated or synthesized in accordance with the sequences describedherein have utility to generate polypeptides. The nucleic acid of the inventionexempli?ed in the Sequence Listing or fragments of said nucleic acid encoding activeportions of H. pylori polypeptides can be cloned into suitable vectors or used to isolatenucleic acid. The isolated nucleic acid is combined with suitable DNA linkers andcloned into a suitable vector.The function of a speci?c gene or operon can be ascertained by expression in abacterial strain under conditions where the activity of the gene product(s) speci?ed bythe gene or operon in question can be speci?cally measured. Alternatively, a geneproduct may be produced in large quantities in an expressing strain for use as an antigen,an industrial reagent, for structural studies, etc. This expression can be accomplished ina mutant strain which lacks the activity of the gene to be tested, or in a strain that doesnot produce the same gene product(s). This includes, but is not limited to otherHelicobacter strains, or other bacterial strains such as E. coli, Norcardia,Corynebacterium, Campylobacter, and Streptomyccs species. In some cases theexpression host will utilize the natural Helicobacter promoter whereas in others, it willbe necessary to drive the gene with a promoter sequence derived from the expressingorganism (e.g., an E. coli beta-galactosidase promoter for expression in E. coli).To express a gene product using the natural H. pylori promoter, a procedure suchas the following can be used. A restriction fragment containing the gene of interest,together with its associated natural promoter element and regulatory sequences(identi?ed using the DNA sequence data) is cloned into an appropriate recombinantplasmid containing an origin of replication that functions in the host organism and anappropriate selectable marker. This can be accomplished by a number of proceduresknown to those skilled in the art. It is most preferably done by cutting the plasmid andthe fragment to be cloned with the same restriction enzyme to produce compatible endsthat can be ligated to join the two pieces together. The recombinant plasmid isintroduced into the host organism by, for example, electroporation and cells containingthe recombinant plasmid are identi?ed by selection for the marker on the plasmid.Expression of the desired gene product is detected using an assay speci?c for that geneproduct.In the case of a gene that requires a different promoter, the body of the gene(coding sequence) is speci?cally excised and cloned into an appropriate expression?101520253035CA 02265523 l999-03- 16W0 98/18323 PCT/US97/19575-32-plasmid. This subcloning can be done by several methods, but is most easilyaccomplished by PCR ampli?cation of a speci?c fragment and ligation into anexpression plasmid after treating the PCR product with a restriction enzyme orexonuclease to create suitable ends for cloning.A suitable host cell for expression of a gene can be any procaryotic or eucaryoticcell. For example, an H. pylori polypeptide can be expressed in bacterial cells such as E.coli, insect cells (baculovirus), yeast, or mammalian cells such as Chinese hamster ovarycell (CHO). Other suitable host cells are known to those skilled in the art.Expression in eucaryotic cells such as mammalian, yeast, or insect cells can leadto partial or complete glycosylation and/or formation of relevant inter- or intra-chaindisul?de bonds of a recombinant peptide product. Examples of vectors for expression inyeast S. cerivisae include pYepSecl (Baldari. et al., (1987) Embo J. §:229-234), pMFa(Kurjan and Herskowitz. (1982) Cell 392933-943), pJRY88 (Schultz et al., (1987) Gene_5?:1 13-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Baculovirus vectorsavailable for expression of proteins in cultured insect cells (SF 9 cells) include the pAcseries (Smith et al., (1983) Mol. Cell Biol. 32156-2165) and the pVL series (Lucklow,V.A., and Summers. M.D., (1989) Virology _W_0:31-39). Generally, COS cells(Gluzman, Y., (1981) Cell Q2175-182) are used in conjunction with such vectors aspCDM 8 (Aruffo, A. and Seed, B., (1987) Proc. Natl. Acad. Sci. USA &;:8573-8577) fortransient ampli?cation/expression in mammalian cells, while CHO (dhfr' Qhinese?amster Qvary) cells are used with vectors such as pMT2PC (Kaufman et al. (1987),EMBO J. _6_:187-195) for stable ampli?cation/expression in mammalian cells. VectorDNA can be introduced into mammalian cells via conventional techniques such ascalcium phosphate or calcium chloride co-precipitation. DEAE-dextran-mediatedtransfection, or electroporation. Suitable methods for transforming host cells can befound in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, ColdSpring Harbor Laboratory press (1989)), and other laboratory textbooks.Expression in procaryotes is most often carried out in E. coli with either fusionor non-fusion inducible expression vectors. Fusion vectors usually add a number ofNH2 terminal amino acids to the expressed target gene. These NH2 terminal aminoacids often are referred to as a reporter group. Such reporter groups usually serve twopurposes: 1) to increase the solubility of the target recombinant protein; and 2) to aid inthe puri?cation of the target recombinant protein by acting as a ligand in af?nitypuri?cation. Often, in fusion expression vectors, a proteolytic cleavage site isintroduced at the junction of the reporter group and the target recombinant protein toenable separation of the target recombinant protein from the reporter group subsequentto puri?cation of the fusion protein. Such enzymes. and their cognate recognition?101520253035WO 98/18323CA 02265523 1999-03-16PCT/U S9 7/ 19575-33-sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expressionvectors include pGEX (Amrad Corp., Melbourne, Australia), PMAL (New EnglandBiolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathioneSâtransferase, maltose E binding protein. or protein A. respectively, to the targetrecombinant protein. A preferred reporter group is poly(His), which may be fused to theamino or carboxy terminus of the protein and which renders the recombinant fusionprotein easily puri?able by metal chelate chromatography.Inducible non-fusion expression vectors include pTrc (Amann et al., (1988) Gene§2:30l-315) and pETl ld (Studier et a1.. Gene Expression Technology: Methods inEnzymology _1_8_§, Academic Press, San Diego, California (1990) 60-89). While targetgene expression relies on host RNA polymerase transcription from the hybrid trp-lacfusion promoter in pTrc, expression of target genes inserted into pETl ld relies ontranscription from the T7 gn10-lac 0 fusion promoter mediated by coexpressed viralRNA polymerase (T7 gnl ). This viral polymerase is supplied by host strainsBL2l(DE3) or l-IMS174(DE3) from a resident K prophage harboring a T7 gnl under thetranscriptional control of the lacUV 5 promoter.For example, a host cell transfected with a nucleic acid vector directingexpression of a nucleotide sequence encoding an H. pylori polypeptide can be culturedunder appropriate conditions to allow expression of the polypeptide to occur. Thepolypeptide may be secreted and isolated from a mixture of cells and medium containingthe peptide. Alternatively, the polypeptide may be retained cytoplasmically and the cellsharvested, lysed and the protein isolated. A cell culture includes host cells, media andother byproducts. Suitable media for cell culture are well known in the art.Polypeptides of the invention can be isolated from cell culture medium, host cells, orboth using techniques known in the art for purifying proteins including ion-exchangechromatography, gel filtration chromatography, ultrafiltration, electrophoresis, andimmunoaf?nity puri?cation with antibodies speci?c for such polypeptides.Additionally, in many situations. polypeptides can be produced by chemical cleavage ofa native protein (e.g., tryptic digestion) and the cleavage products can then be purifiedby standard techniques. _In the case of membrane bound proteins, these can be isolated from a host cell bycontacting a membrane-associated protein fraction with a detergent forming asolubilized complex, where the membrane-associated protein is no longer entirelyembedded in the membrane fraction and is solubilized at least to an extent which allowsit to be chromatographically isolated from the membrane fraction. Several differentcriteria are used for choosing a detergent suitable for solubilizing these complexes. Forexample. one property considered is the ability of the detergent to solubilize the I-1.?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/ 19575-34-pylori protein within the membrane fraction at minimal denaturation of the membrane-associated protein allowing for the activity or functionality of the membraneâassociatedprotein to return upon reconstitution of the protein. Another property considered whenselecting the detergent is the critical micelle concentration (CMC) of the detergent inthat the detergent of choice preferably has a high CMC value allowing for ease ofremoval after reconstitution. A third property considered when selecting a detergent isthe hydrophobicity of the detergent. Typically, membrane-associated proteins are veryhydrophobic and therefore detergents which are also hydrophobic, e.g., the triton series,would be useful for solubilizing the hydrophobic proteins. Another property importantto a detergent can be the capability of the detergent to remove the H. pylori protein withminimal protein-protein interaction facilitating further puri?cation. A ?fth property ofthe detergent which should be considered is the charge of the detergent. For example, ifit is desired to use ion exchange resins in the purification process then preferablydetergent should be an uncharged detergent. Chromatographic techniques which can beused in the final puri?cation step are known in the art and include hydrophobicinteraction, lectin af?nity, ion exchange, dye affinity and immunoaffinity.One strategy to maximize recombinant H. pylori peptide expression in E. coli isto express the protein in a host bacteria with an impaired capacity to proteolyticallycleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methodsin Enzymology ?, Academic Press, San Diego, California (1990) 119-128). Anotherstrategy would be to alter the nucleic acid encoding an H. pylori peptide to be insertedinto an expression vector so that the individual codons for each amino acid would bethose preferentially utilized in highly expressed E. coli proteins (Wada et al., (1992)Nuc. Acids Res. @211 1-2118). Such alteration of nucleic acids of the invention can becarried out by standard DNA synthesis techniques.The nucleic acids of the invention can also be chemically synthesized usingstandard techniques. Various methods of chemically synthesizing polydeoxynucleotidesare known, including solidâphase synthesis which. like peptide synthesis, has been fullyautomated in commercially available DNA synthesizers (See, e.g., Itakura et al. U.S.Patent No. 4,598,049; Caruthers et al. U.S. Patent No. 4,458,066; and Itakura U.S.Patent Nos. 4,401,796 and 4,373,071, incorporated by reference herein).III. H. pylori PolypeptidesThis invention encompasses isolated H. pylori polypeptides encoded by thedisclosed H pylori genomic sequences. including the polypeptides of the inventioncontained in the Sequence Listing. Polypeptides of the invention are preferably at least5 amino acid residues in length. Using the DNA sequence information provided herein,?101520253035W0 98/ 18323CA 02265523 l999-03- 16PCT/US97/19575_ 35 -the amino acid sequences of the polypeptides encompassed by the invention can bededuced using methods wellâknown in the art. It will be understood that the sequence ofan entire nucleic acid encoding an H. pylori polypeptide can be isolated and identi?edbased on an ORF that encodes only a fragment of the cognate protein-coding region.This can be acheived, for example, by using the isolated nucleic acid encoding the ORF,or fragments thereof, to prime a polymerase chain reaction with genomic H. pylori DNAas template; this is followed by sequencing the amplified product.The polypeptides of the invention can be isolated from wild-type or mutant H.pylori cells or from heterologous organisms or cells (including, but not limited to,bacteria, yeast, insect, plant and mammalian cells) into which an H. pylori nucleic acidhas been introduced and expressed. In addition, the polypeptides can be part ofrecombinant fusion proteins.H. pylori polypeptides of the invention can be chemically synthesized usingcommercially automated procedures such as those referenced herein.IV. Identi?cation of Nucleic Acids Encoding Vaccine Components and Targets forAgents Effective Against H. nvloriThe disclosed H. pylori genome sequence includes segments that direct thesynthesis of ribonucleic acids and polypeptides, as well as origins of replication,promoters, other types of regulatory sequences, and intergenic nucleic acids. Theinvention encompasses nucleic acids encoding immunogenic components of vaccinesand targets for agents effective against H pylori. Identification of said immunogeniccomponents involved in the determination of the function of the disclosed sequences canbe achieved using a variety of approaches. Non-limiting examples of these approachesare described brie?y below.Homology to known seguences: Computer-assisted comparison of the disclosedH. pylori sequences with previously reported sequences present in publicly availabledatabases is useful for identifying functional H pylori nucleic acid and polypeptidesequences. It will be understood that protein-coding sequences, for example, may becompared as a whole, and that a high degree of sequence homology between twoproteins (such as, for example, >80-90%) at the amino acid level indicates that the twoproteins also possess some degree of functional homology, such as, for example. amongenzymes involved in metabolism. DNA synthesis. or cell wall synthesis. and proteinsinvolved in transport, cell division, etc. In addition, many structural features ofparticular protein classes have been identified and correlate with specific consensussequences, such as, for example, binding domains for nucleotides, DNA, metal ions, andother small molecules; sites for covalent modifications such as phosphorylation,?101520253035W0 98/ 18323CA 02265523 1999-03-16PCT/US97/ 19575-36-acylation, and the like; sites of proteinzprotein interactions, etc. These consensussequences may be quite short and thus may represent only a fraction of the entireproteinâcoding sequence. Identi?cation of such a feature in an H. pylori sequence istherefore useful in determining the function of the encoded protein and identifyinguseful targets of antibacterial drugs.Of particular relevance to the present invention are structural features that arecommon to secretory, transmembrane. and surface proteins, including secretion signalpeptides and hydrophobic transmembrane domains. H. pylori proteins identi?ed ascontaining putative signal sequences and/or transmembrane domains are useful asimmunogenic components of vaccines.Identi?cation of essential genes: Nucleic acids that encode proteins essential forgrowth or viability of H. pylori are preferred drug targets. H. pylori genes can be testedfor their biological relevance to the organism by examining the effect of deleting and/ordisrupting the genes. i.e., by so-called gene "knockout", using techniques known tothose skilled in the relevant art. In this manner. essential genes may be identi?ed.Strain-speci?c seguences: Because of the evolutionary relationship betweendifferent H. pylori strains. it is believed that the presently disclosed H. pylori sequencesare useful for identifying, and/or discriminating between, previously known and new H.pylori strains. It is believed that other H. pylori strains will exhibit at least 70%sequence homology with the presently disclosed sequence. Systematic and routineanalyses of DNA sequences derived from samples containing H. pylori strains, andcomparison with the present sequence allows for the identification of sequences that canbe used to discriminate between strains. as well as those that are common to all H. pyloristrains. In one embodiment. the invention provides nucleic acids, including probes, andpeptide and polypeptide sequences that discriminate between different strains of H.pylori. Strain-speci?c components can also be identi?ed functionally by their ability toelicit or react with antibodies that selectively recognize one or more H. pylori strains.In another embodiment. the invention provides nucleic acids, including probes.and peptide and polypeptide sequences that are common to all H pylori strains but arenot found in other bacterial species.Speci?c Example: Determination Of Candidate Protein Antigens For Antibody AndVaccine DevelopmentThe selection of candidate protein antigens for vaccine development can bederived from the nucleic acids encoding H. pylori polypeptides. First, the ORFâs can beanalyzed for homology to other known exported or membrane proteins and analyzedusing the discriminant analysis described by Klein. et al. (Klein. P., Kanehsia. M., and?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/ 19575- 37 -DeLisi, C. (1985) Biochimica et Biophysica Acta 815, 468-476) for predicting exportedand membrane proteins.Homology searches can be performed using the BLAST algorithm contained inthe Wisconsin Sequence Analysis Package (Genetics Computer Group, UniversityResearch Park, 575 Science Drive, Madison. WI 53711) to compare each predicted ORFamino acid sequence with all sequences found in the current GenBank, SWISS-PROTand PIR databases. BLAST searches for local alignments between the ORF and thedatabank sequences and reports a probability score which indicates the probability of?nding this sequence by chance in the database. ORF's with signi?cant homology (e.g.probabilities lower than 1x10'6 that the homology is only due to random chance) tomembrane or exported proteins represent protein antigens for vaccine development.Possible functions can be provided to H. pylori genes based on sequence homology togenes cloned in other organisms.Discriminant analysis (Klein, et al. supra) can be used to examine the ORFamino acid sequences. This algorithm uses the intrinsic information contained in theORF amino acid sequence and compares it to information derived from the properties ofknown membrane and exported proteins. This comparison predicts which proteins willbe exported, membrane associated or cytoplasmic. ORF amino acid sequencesidenti?ed as exported or membrane associated by this algorithm are likely proteinantigens for vaccine development.Surface exposed outer membrane proteins are likely to represent the bestantigens to provide a protective immune response against H pylori. Among thealgorithms that can be used to aid in prediction of these outer membrane proteins includethe presence of an amphipathic beta-sheet region at their C~terminus. This region whichhas been detected in a large number of outer membrane proteins in Gram negativebacteria is often characterized by hydrophobic residues (Phe or Tyr) clustered atalternating positions from the C-terrninus (e.g., see Figure 5, block F; Figure 7, block E).importantly, these sequences have not been detected at the C-terrnini of periplasmicproteins. thus allowing preliminary distinction between these classes of proteins basedon primary sequence data. This phenomenon has been reported previously by Struyve etal. (J. Mol. Biol. 221_8:14l-148, 1991).Also illustrated in Figure 5 are additional amino acid sequence motifs found inmany outer membrane proteins of H. pylori. The amino acid sequence alignment inFigure 5 depicts portions of the sequence of ?ve H. pylori proteins (depicted in thesingle letter amino acid code) labeled with their amino acid Sequence ID Numbers andshown N-terrninal to C-terrninal. left to right. Five or six distinct blocks (labeled Athrough E or F) of similar amino acid residues are found including the distinctive...-........l....................................... . ..?101520CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/19575-33-hydrophobic residues (Phe or Tyr; F or Y according to the single letter code for aminoacid residues) frequently found at positions near the C-terminus of outer membraneproteins. The presence of several shared motifs clearly establishes the similaritybetween members of this group of proteins.Additional amino acid alignments for four outer membrane proteins isolatedfrom H. pylori are depicted in Figure 6.Outer membrane proteins isolated from H. pylori frequently share additionalmotifs as depicted for two proteins in Figure 7 which also share the C-terminalhydrophobic residues. and as depicted for two proteins in Figure 8 which do not sharethe Câtermina1 hydrophobic residue motif but share a different C-terrninal motif.One skilled in the art would know that these shared sequence motifs are highlysignificant and establish a similarity among this group of proteins.Infrequently it is not possible to distinguish between multiple possiblenucleotides at a given position in the nucleic acid sequence. In those cases theambiguities are denoted by an extended alphabet as follows:These are the official IUPACâIUB single-letter base codesCode Base DescriptionG GuanineA AdenineT ThymineC CytosineR Purine (A or G)Y Pyrimidine (C or T or U)M Amino (A or C)K Ketone (G or T)S Strong interaction (C or G)W Weak interaction (A or T)H NotâG (A or C or T)B Not-A (C or G or T)V Not-T (notâU) (A or C or G)D Not-C (A or G or T)N Any (A or C or G or T)The amino acid translations of this invention account for the ambiguity in thenucleic acid sequence by translating the ambiguous codon as the letter "X". In all cases,?101520253035W0 98/ 18323CA 02265523 1999-03-16PCT/US97/19575_ 39 -the permissible amino acid residues at a position are clear from an examination of thenucleic acid sequence based on the standard genetic code.V. Production of Fragments and Analogs of H. pylori Nucleic Acids and PolypeptidesBased on the discovery of the H. pylori gene products of the invention providedin the Sequence Lsiting, one skilled in the art can alter the disclosed structure (of H.pylori genes), e.g., by producing fragments or analogs, and test the newly producedstructures for activity. Examples of techniques known to those skilled in the relevant artwhich allow the production and testing of fragments and analogs are discussed below.These, or analogous methods can be used to make and screen libraries of polypeptides,e.g., libraries of random peptides or libraries of fragments or analogs of cellular proteinsfor the ability to bind H. pylori polypeptides. Such screens are useful for theidenti?cation of inhibitors of H. pylori.Generation of FragmentsFragments of a protein can be produced in several ways, e.g., recombinantly, byproteolytic digestion, or by chemical synthesis. lntemal or terminal fragments of apolypeptide can be generated by removing one or more nucleotides from one end (for aterminal fragment) or both ends (for an internal fragment) of a nucleic acid whichencodes the polypeptide. Expression of the mutagenized DNA produces polypeptidefragments. Digestion with "end-nibbling" endonucleases can thus generate DNA'swhich encode an array of fragments. DNA's which encode fragments of a protein canalso be generated by random shearing, restriction digestion or a combination of theabove~discussed methods.Fragments can also be chemically synthesized using techniques known in the artsuch as conventional Merrifreld solid phase f-Moc or t-Boc chemistry. For example,peptides of the present invention may be arbitrarily divided into fragments of desiredlength with no overlap of the fragments, or divided into overlapping fragments of adesired length.Alteration of Nucleic Acids and Polypeptides: Random MethodsAmino acid sequence variants of a protein can be prepared by randommutagenesis of DNA which encodes a protein or a particular domain or region of aprotein. Useful methods include PCR mutagenesis and saturation mutagenesis. Alibrary of random amino acid sequence variants can also be generated by the synthesis ofa set of degenerate oligonucleotide sequences. (Methods for screening proteins in alibrary of variants are elsewhere herein).?101520253035W0 98/ 18323CA 02265523 l999-03- 16PCT/US97/19575-40-(A) PCR MutagenesisIn PCR mutagenesis. reduced Taq polymerase ?delity is used to introducerandom mutations into a cloned fragment of DNA (Leung et al., 1989. Technique 1:11-15). The DNA region to be mutagenized is amplified using the polymerase chainreaction (PCR) under conditions that reduce the ?delity of DNA synthesis by Taq DNApolymerase. e.g., by using a dGTP/dATP ratio of five and adding Mn2+ to the PCRreaction. The pool of amplified DNA fragments are inserted into appropriate cloningvectors to provide random mutant libraries.(B) Saturation MutagenesisSaturation mutagenesis allows for the rapid introduction of a large number ofsingle base substitutions into cloned DNA fragments (Mayers et a1.. 1985, Science2292242). This technique includes generation of mutations, e.g., by chemical treatmentor irradiation of single-stranded DNA in vitro. and synthesis of a complimentary DNAstrand. The mutation frequency can be modulated by modulating the severity of thetreatment, and essentially all possible base substitutions can be obtained. Because thisprocedure does not involve a genetic selection for mutant fragments both neutralsubstitutions, as well as those that alter function, are obtained. The distribution of pointmutations is not biased toward conserved sequence elements.(C) Degenerate OligonucleotidesA library of homologs can also be generated from a set of degenerateoligonucleotide sequences. Chemical synthesis of a degenerate sequences can be carriedout in an automatic DNA synthesizer, and the synthetic genes then ligated into anappropriate expression vector. The synthesis of degenerate oligonucleotides is known inthe art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981)Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton,Amsterdam: Elsevier pp273-289; Itakura et al. (1984) Annu. Rev. Biochem. 53:323;Itakura et al. (1984) Science 198:1_056; Ike et al. (1983) Nucleic Acid Res. 11:477. Suchtechniques have been employed in the directed evolution of other proteins (see, forexample, Scott et al. (1990) Science 249:386-390; Roberts et al. (1992) PNAS 8922429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et al. (1990) PNAS 87: 6378-6382; as well as U.S. Patents Nos. 5,223,409, 5,198,346, and 5,096.815).?101520253035WO 98/18323CA 02265523 l999-03- 16PCTIUS97/19575- 41 -Alteration of Nucleic Acids and Polypeptides: Methods for Directed MutagenesisNon-random or directed. mutagenesis techniques can be used to provide specificsequences or mutations in speci?c regions. These techniques can be used to createvariants which include, e. g., deletions, insertions, or substitutions, of residues of theknown amino acid sequence of a protein. The sites for mutation can be modifiedindividually or in series, e.g., by (1) substituting first with conserved amino acids andthen with more radical choices depending upon results achieved, (2) deleting the targetresidue, or (3) inserting residues of the same or a different class adjacent to the locatedsite, or combinations of options l-3.gA) Alanine Scanning MutagenesisAlanine scanning mutagenesis is a useful method for identification of certainresidues or regions of the desired protein that are preferred locations or domains formutagenesis. Cunningham and Wells (Science 24421081-1085, 1989). In alaninescanning, a residue or group of target residues are identified (e.g., charged residues suchas Arg, Asp, His, Lys, and Glu) and replaced by a neutral or negatively charged aminoacid (most preferably alanine or polyalanine). Replacement of an amino acid can affectthe interaction of the amino acids with the surrounding aqueous environment in oroutside the cell. Those domains demonstrating functional sensitivity to the substitutionsare then refined by introducing further or other variants at or for the sites of substitution.Thus, while the site for introducing an amino acid sequence variation is predetermined,the nature of the mutation per se need not be predetermined. For example, to optimizethe performance of a mutation at a given site, alanine scanning or random mutagenesismay be conducted at the target codon or region and the expressed desired protein subunitvariants are screened for the optimal combination of desired activity.(B) Oligonucleotide-Mediated MutagenesisOligonucleotide-mediated mutagenesis is a useful method for preparingsubstitution, deletion, and insertion variants of DNA, see, e. g., Adelman et al., (DNA2:183, 1983). Brie?y, the desiredVDNA is altered by hybridizing an oligonucleotideencoding a mutation to a DNA template, where the template is the single-stranded formof a plasmid or bacteriophage containing the unaltered or native DNA sequence of thedesired protein. After hybridization, a DNA polymerase is used to synthesize an entiresecond complementary strand of the template that will thus incorporate theoligonucleotide primer, and will code for the selected alteration in the desired proteinDNA. Generally, oligonucleotides of at least 25 nucleotides in length are used. Anoptimal oligonucleotide will have 12 to 15 nucleotides that are completely?101520253035CA 02265523 l999-03- 16W0 98/18323 PCT/U S97/ 19575-42-complementary to the template on either side of the nucleotide(s) coding for themutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule. The oligonucleotides are readily synthesized usingtechniques known in the art such as that described by Crea et al. (Proc. Natl. Acaaâ. Sci.USA, 75: 5765[1978]).(C) Cassette MutagenesisAnother method for preparing variants, cassette mutagenesis, is based on thetechnique described by Wells et al. (Gene, 34:315[l 985]). The starting material is aplasmid (or other vector) which includes the protein subunit DNA to be mutated. Thecodon(s) in the protein subunit DNA to be mutated are identified. There must be aunique restriction endonuclease site on each side of the identi?ed mutation site(s). If nosuch restriction sites exist. they may be generated using the above-describedoligonucleotide-mediated mutagenesis method to introduce them at appropriate locationsin the desired protein subunit DNA. After the restriction sites have been introduced intothe plasmid, the plasmid is cut at these sites to linearize it. A double-strandedoligonucleotide encoding the sequence of the DNA between the restriction sites butcontaining the desired mutation(s) is synthesized using standard procedures. The twostrands are synthesized separately and then hybridized together using standardtechniques. This double-stranded oligonucleotide is referred to as the cassette. Thiscassette is designed to have 3' and 5' ends that are comparable with the ends of thelinearized plasmid, such that it can be directly ligated to the plasmid. This plasmid nowcontains the mutated desired protein subunit DNA sequence.(D) Combinatorial MutagenesisCombinatorial mutagenesis can also be used to generate mutants (Ladner et al.,WO 88/06630). In this method, the amino acid sequences for a group of homologs orother related proteins are aligned, preferably to promote the highest homology possible.All of the amino acids which appear at a given position of the aligned sequences can beselected to create a degenerate set of combinatorial sequences. The variegated library ofvariants is generated by combinatorial mutagenesis at the nucleic acid level, and isencoded by a variegated gene library. For example, a mixture of syntheticoligonucleotides can be enzymatically ligated into gene sequences such that thedegenerate set of potential sequences are expressible as individual peptides, oralternatively, as a set of larger fusion proteins containing the set of degeneratesequences.?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/19575_ 43 _Other Modi?cations of H pylori Nucleic Acids and PolvpeptidesIt is possible to modify the structure of an H. pylori polypeptide for suchpurposes as increasing solubility, enhancing stability (e.g., shelf life ex vivo andresistance to proteolytic degradation in vivo). A modi?ed H. pylori protein or peptidecan be produced in which the amino acid sequence has been altered. such as by aminoacid substitution, deletion, or addition as described herein.An H. pylori peptide can also be modi?ed by substitution of cysteine residuespreferably with alanine, serine, threonine, leucine or glutamic acid residues to minimizedimerization via disul?de linkages. In addition, amino acid side chains of fragments ofthe protein of the invention can be chemically modi?ed. Another modi?cation iscyclization of the peptide.In order to enhance stability and/or reactivity. an H. pylori polypeptide can bemodi?ed to incorporate one or more polymorphisms in the amino acid sequence of theprotein resulting from any natural allelic variation. Additionally, D-amino acids, non-natural amino acids, or non-amino acid analogs can be substituted or added to produce amodi?ed protein within the scope of this invention. Furthermore, an H. pyloripolypeptide can be modi?ed using polyethylene glycol (PEG) according to the methodof A. Sehon and co-workers (Wie et al., supra) to produce a protein conjugated withPEG. In addition, PEG can be added during chemical synthesis of the protein. Othermodi?cations of H. pylori proteins include reduction/alkylation (Tarr. Methods ofProtein Microcharacterization, J. E. Silver ed., Humana Press. Clifton NJ 155-194(1986)); acylation (Tarr, supra); chemical coupling to an appropriate carrier (Mishell andShiigi, eds, Selected Methods in Cellular Immunology, WH Freeman. San Francisco. CA(1980), U.S. Patent 4,939,239; or mild formalin treatment (Marsh, (1971) Int. Arch. ofAllergy andAppl. 1mmunoI., g1__1_: 199 â 215).To facilitate puri?cation and potentially increase solubility of an H. pyloriprotein or peptide, it is possible to add an amino acid fusion moiety to the peptidebackbone. For example. hexaâhistidine can be added to the protein for puri?cation byimmobilized metal ion af?nity chromatography (Hochuli, E. et al., (1988)Bio/Technology, §: 1321 - 1325). In addition, to facilitate isolation of peptides free ofirrelevant sequences, speci?c endoprotease cleavage sites can be introduced between thesequences of the fusion moiety and the peptide.To potentially aid proper antigen processing of epitopes within an H. pyloripolypeptide, canonical protease sensitive sites can be engineered between regions, eachcomprising at least one epitope via recombinant or synthetic methods. For example,charged amino acid pairs, such as KK or R, can be introduced between regions withina protein or fragment during recombinant construction thereof. The resulting peptide?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S9'I/ 19575-44-can be rendered sensitive to cleavage by cathepsin and/or other trypsin-like enzymeswhich would generate portions of the protein containing one or more epitopes. Inaddition, such charged amino acid residues can result in an increase in the solubility ofthe peptide.Primary Methods for Screening Polypeptides and AnalogsVarious techniques are known in the art for screening generated mutant geneproducts. Techniques for screening large gene libraries often include cloning the genelibrary into replicable expression vectors. transforming appropriate cells with theresulting library of vectors, and expressing the genes under conditions in whichdetection of a desired activity, e.g., in this case, binding to H. pylori polypeptide or aninteracting protein. facilitates relatively easy isolation of the vector encoding the genewhose product was detected. Each of the techniques described below is amenable tohigh through-put analysis for screening large numbers of sequences created, e.g., byrandom mutagenesis techniques.(A) Two Hybrid SystemsTwo hybrid assays such as the system described above (as with the otherscreening methods described herein), can be used to identify polypeptides, e.g.,fragments or analogs of a naturally-occurring H. pylori polypeptide, e.g., of cellularproteins, or of randomly generated polypeptides which bind to an H. pylori protein.(The H. pylori domain is used as the bait protein and the library of variants are expressedas fish fusion proteins.) In an analogous fashion, a two hybrid assay (as with the otherscreening methods described herein), can be used to find polypeptides which bind a H.pylori polypeptide.(B) Display LibrariesIn one approach to screening assays. the candidate peptides are displayed on thesurface of a cell or viral particle. and the ability of particular cells or viral particles tobind an appropriate receptor protein via the displayed product is detected in a "panningassay". For example, the gene library can be cloned into the gene for a surfacemembrane protein of a bacterial cell, and the resulting fusion protein detected bypanning (Ladner et al., W0 88/06630; Fuchs et al. (1991) Bio/Technology 921370-1371;and Goward et al. (1992) T./BS l8:l36-140). In a similar fashion, a detectably labeledligand can be used to score for potentially functional peptide homologs. Fluorescentlylabeled ligands. e.g., receptors. can be used to detect homologs which retain ligand-binding activity. The use of ?uorescently labeled ligands, allows cells to be visually?101520253035W0 . 98/ 18323CA 02265523 l999-03- 16PCT/U S97/ 19575- 45 _inspected and separated under a ?uorescence microscope, or, where the morphology ofthe cell permits. to be separated by a ?uorescence-activated cell sorter.A gene library can be expressed as a fusion protein on the surface of a viralparticle. For instance, in the filamentous phage system. foreign peptide sequences canbe expressed on the surface of infectious phage, thereby conferring two signi?cantbene?ts. First, since these phage can be applied to af?nity matrices at concentrationswell over 1013 phage per milliliter, a large number of phage can be screened at one time.Second. since each infectious phage displays a gene product on its surface, if a particularphage is recovered from an affinity matrix in low yield. the phage can be amplified byanother round of infection. The group of almost identical E. coli filamentous phagesM13, fd., and fl are most often used in phage display libraries. Either of the phage gIIIor gVIlI coat proteins can be used to generate fusion proteins without disrupting theultimate packaging of the viral particle. Foreign epitopes can be expressed at the NH2-terrninal end of p111 and phage bearing such epitopes recovered from a large excess ofphage lacking this epitope (Ladner et al. PCT publication WO 90/02909; Garrard et al.,PCT publication WO 92/09690; Marks et al. (1992) J. Biol. Chem. 267216007-16010;Griffiths et al. (1993) EMBO J 122725-734; Clackson et al. (1991) Nature 352:624-628;and Barbas et al. (1992) PNAS 89:4457â446l).A common approach uses the maltose receptor of E. coli (the outer membraneprotein, LamB) as a peptide fusion partner (Charbit et al. (1986) EMBO 5, 3029-3037).Oligonucleotides have been inserted into plasmids encoding the LamB gene to producepeptides fused into one of the extracellular loops of the protein. These peptides areavailable for binding to ligands. e.g., to antibodies. and can elicit an immune responsewhen the cells are administered to animals. Other cell surface proteins, e.g., OmpA(Schorr et al. (1991) Vaccines 91, pp. 387-392), PhoE (Agterberg, et al. (1990) Gene 88,37-45), and PAL (Fuchs et al. (1991) Bio/Tech 9, 1369-1372), as well as large bacterialsurface structures have served as vehicles for peptide display. Peptides can be fused topilin, a protein which polymerizes to form the pilus-a conduit for interbacterial exchangeof genetic information (Thiry et al. (1989) Appl. Environ. Microbiol. 55, 984-993).Because of its role in interacting with other cells, the pilus provides a useful support forthe presentation of peptides to the extracellular environment. Another large surfacestructure used for peptide display is the bacterial motive organ, the ?agellum. Fusion ofpeptides to the subunit protein ?agellin offers a dense array of many peptide copies onthe host cells (Kuwajima et al. (1988) Bio/Tech. 6, 1080-1083). Surface proteins ofother bacterial species have also served as peptide fusion partners. Examples include theStaphylococcus protein A and the outer membrane IgA protease of Neisseria (Hansson?101520253035CA 02265523 l999-03- 16W0 98/18323 PCT/US97/19575-45-et al. (1992) J. Bacteriol. 174, 4239-4245 and Klauser et al. (1990) EMBOJ. 9, 1991-1999).In the ?lamentous phage systems and the LamB system described above, thephysical link between the peptide and its encoding DNA occurs by the containment ofthe DNA within a particle (cell or phage) that carries the peptide on its surface.Capturing the peptide captures the particle and the DNA within. An alternative schemeuses the DNA-binding protein Lacl to form a link between peptide and DNA (Cull et al.(1992) PNAS USA 89:1865â1869). This system uses a plasmid containing the Lacl genewith an oligonucleotide cloning site at its 3'-end. Under the controlled induction byarabinose, a Lacl-peptide fusion protein is produced. This fusion retains the naturalability of Lacl to bind to a short DNA sequence known as LacO operator (LacO). Byinstalling two copies of LacO on the expression plasmid. the Lacl-peptide fusion bindstightly to the plasmid that encoded it. Because the plasmids in each cell contain only asingle oligonucleotide sequence and each cell expresses only a single peptide sequence,the peptides become speci?cally and stably associated with the DNA sequence thatdirected its synthesis. The cells of the library are gently lysed and the peptide-DNAcomplexes are exposed to a matrix of immobilized receptor to recover the complexescontaining active peptides. The associated plasmid DNA is then reintroduced into cellsfor ampli?cation and DNA sequencing to determine the identity of the peptide ligands.As a demonstration of the practical utility of the method. a large random library ofdodecapeptides was made and selected on a monoclonal antibody raised against theopioid peptide dynorphin B. A cohort of peptides was recovered, all related by aconsensus sequence corresponding to a six-residue portion of dynorphin B. (Cull et al.(1992) Proc. Natl. Acad. Sci. U.S.A. 89-1869)This scheme, sometimes referred to as peptidesâon~plasmids, differs in twoimportant ways from the phage display methods. First, the peptides are attached to theC-terrninus of the fusion protein, resulting in the display of the library members aspeptides having free carboxy termini. Both of the ?lamentous phage coat proteins, p111and pVIll, are anchored to the phage through their C-termini, and the guest peptides areplaced into the outward-extending N-terrninal domains. In some designs, the phage-displayed peptides are presented right at the amino terminus of the fusion protein.(Cwirla, et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 6378-6382) A second differenceis the set of biological biases affecting the population of peptides actually present in thelibraries. The Lacl fusion molecules are con?ned to the cytoplasm of the host cells.The phage coat fusions are exposed brie?y to the cytoplasm during translation but arerapidly secreted through the inner membrane into the periplasmic compartment,remaining anchored in the membrane by their C-terminal hydrophobic domains. with the?101520253035CA 02265523 l999-03- 16W0 98/18323 PCT/US97/19575-47-N-tennini, containing the peptides, protruding into the periplasm while awaitingassembly into phage particles. The peptides in the Lacl and phage libraries may differsigni?cantly as a result of their exposure to different proteolytic activities. The phagecoat proteins require transport across the inner membrane and signal peptidaseprocessing as a prelude to incorporation into phage. Certain peptides exert a deleteriouseffect on these processes and are underrepresented in the libraries (Gallop et al. ( 1994) J.Med. Chem. 37(9):l233-1251). These particular biases are not a factor in the Lacldisplay system.The number of small peptides available in recombinant random libraries isenormous. Libraries of 107-109 independent clones are routinely prepared. Libraries aslarge as 101 1 recombinants have been created, but this size approaches the practicallimit for clone libraries. This limitation in library size occurs at the step of transformingthe DNA containing randomized segments into the host bacterial cells. To circumventthis limitation, an in vitro system based on the display of nascent peptides in polysomecomplexes has recently been developed. This display library method has the potential ofproducing libraries 3-6 orders of magnitude larger than the currently availablephage/phagemid or plasmid libraries. Furthermore, the construction of the libraries,expression of the peptides, and screening, is done in an entirely cell-free format.In one application of this method (Gallop et al. (1994) J. Med. Chem.37(9):l233-1251), a molecular DNA library encoding 1012 decapeptides wasconstructed and the library expressed in an E. coli S30 in vitro coupledtranscription/translation system. Conditions were chosen to stall the ribosomes on themRNA. causing the accumulation of a substantial proportion of the RNA in polysomesand yielding complexes containing nascent peptides still linked to their encoding RNA.The polysomes are sufficiently robust to be affinity purified on immobilized receptors inmuch the same way as the more conventional recombinant peptide display libraries arescreened. RNA from the bound complexes is recovered, converted to cDNA, andamplified by PCR to produce a template for the next round of synthesis and screening.The polysome display method can be coupled to the phage display system. Followingseveral rounds of screening, cDNA from the enriched pool of polysomes was cloned intoa phagemid vector. This vector serves as both a peptide expression vector, displayingpeptides fused to the coat proteins, and as a DNA sequencing vector for peptideidenti?cation. By expressing the polysome-derived peptides on phage, one can eithercontinue the affinity selection procedure in this format or assay the peptides onindividual clones for binding activity in a phage ELISA, or for binding specificity in acompletion phage ELISA (Barret. et al. (1992) Anal. Biochem 204,357-364). To?101520253035CA 02265523 l999-03- 16WO 98/18323 PCT/US97/19575-48-identify the sequences of the active peptides one sequences the DNA produced by thephagemid host.Secondag Screening of Polypeptides and AnalogsThe high through-put assays described above can be followed by secondaryscreens in order to identify further biological activities which will, e.g., allow one skilledin the art to differentiate agonists from antagonists. The type of a secondary screen usedwill depend on the desired activity that needs to be tested. For example, an assay can bedeveloped in which the ability to inhibit an interaction between a protein of interest andits respective ligand can be used to identify antagonists from a group of peptidefragments isolated though one of the primary screens described above.Therefore. methods for generating fragments and analogs and testing them foractivity are known in the art. Once the core sequence of interest is identi?ed, it isroutine for one skilled in the art to obtain analogs and fragments.Peptide Mimetics of H. pylori PolypeptidesThe invention also provides for reduction of the protein binding domains of thesubject H. pylori polypeptides to generate mimetics, e.g. peptide or nonâpeptide agents.The peptide mimetics are able to disrupt binding of a polypeptide to its counter ligand,e.g., in the case of an H. pylori polypeptide binding to a naturally occurring ligand. Thecritical residues of a subject H. pylori polypeptide which are involved in molecularrecognition of a polypeptide can be determined and used to generate H. pylori-derivedpeptidomimetics which competitively or noncompetitively inhibit binding of the H.pylori polypeptide with an interacting polypeptide (see. for example, European patentapplications EP-4l2,762A and EP-B3l,080A).For example, scanning mutagenesis can be used to map the amino acid residuesof a particular H. pylori polypeptide involved in binding an interacting polypeptide,peptidomimetic compounds (e.g. diazepine or isoquinoline derivatives) can be generatedwhich mimic those residues in binding to an interacting polypeptide, and whichtherefore can inhibit binding of an pylori polypeptide to an interacting polypeptideand thereby interfere with the function of H. pylori polypeptide. For instance, non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine(e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed.,ESCOM Publisher: Leiden, Netherlands. 1988), azepine (e.g., see Huffman et al. inPeptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden,Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides.â Chemistryand Biology, G.R. Marshall ed.. ESCOM Publisher: Leiden, Netherlands, 1988), keto-?101520253035WO 98/18323CA 02265523 1999-03-16PCT/US97/ 19575-49-methylene pseudopeptides (Ewenson et al. (1986) J Med Chem 292295; and Ewenson etal. in Peptides: Structure and Function (Proceedings of the 9th American PeptideSymposium) Pierce Chemical Co. Rockland, IL, 1985), B-tum dipeptide cores (Nagai etal. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin Trans1:1231), and B~aminoalcohols (Gordon et al. (1985) Biochem Biophys ResCommunl26:419; and Dam et al. (1986) Biochem Biophys Res Commun 134271).VI. Vaccine Formulations for H. pvlori Nucleic Acids and PolvneptidesThis invention also features vaccine compositions or formulations (usedinterchangeably herein) for protection against infection by H. pylori or for treatment ofH. pylori infection. As used herein, the term "treatment of H. pylori infection" refers totherapeutic treatment of an existing or established H. pylori infection. The terms"protection against H. pylori infection" or "prophylactic treatment" refer to the use of H.pylori vaccine formulation for reducing the risk of or preventing an infection in a subjectat risk for H. pylori infection. In one embodiment, the vaccine compositions contain oneor more immunogenic components, such as a surface protein, from H. pylori, or portionthereof, and a pharmaceutically acceptable carrier. For example, in one embodiment, thevaccine formulations of the invention contain at least one or combination of H. pyloripolypeptides or fragments thereof, from same or different H pylori antigens. Nucleicacids and H. pylori polypeptides for use in the vaccine formulations of the inventioninclude the nucleic acids and polypeptides set forth in the Sequence Listing, preferablythose H pylori nucleic acids that encode surface proteins and surface proteins orfragments thereof. For example. a preferred nucleic acid and H. pylori polypeptide foruse in a vaccine composition of the invention is selected from the group of nucleic acidswhich encode cell envelope proteins and H. pylori cell envelope proteins as set forth inTable 1. However, any nucleic acid encoding an immunogenic H pylori protein and H.pylori polypetide, or portion thereof, can be used in the present invention. Thesevaccines have therapeutic and/or prophylactic utilities.One aspect of the invention provides a vaccine composition for protectionagainst infection by H. pylori which contains at least one immunogenic fragment of anH. pylori protein and a pharmaceutically acceptable carrier. Preferred fragments includepeptides of at least about 10 amino acid residues in length, preferably about 10-20 aminoacid residues in length, and more preferably about 12-16 amino acid residues in length.Immunogenic components of the invention can be obtained, for example, byscreening polypeptides recombinantly produced from the corresponding fragment of thenucleic acid encoding the fullâlength H. pylori protein. In addition, fragments can be. .m......................._....................._....,.......... _.._ .... .?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/19575-50-chemically synthesized using techniques known in the art such as conventionalMerri?eld solid phase f-Moc or t-Boc chemistry.In one embodiment, immunogenic components are identi?ed by the ability of thepeptide to stimulate T cells. Peptides which stimulate T cells, as determined by, forexample, T cell proliferation or cytokine secretion are defined herein as comprising atleast one T cell epitope. T cell epitopes are believed to be involved in initiation andperpetuation of the immune response to the protein allergen which is responsible for theclinical symptoms of allergy. These T cell epitopes are thought to trigger early events atthe level of the T helper cell by binding to an appropriate HLA molecule on the surfaceof an antigen presenting cell, thereby stimulating the T cell subpopulation with therelevant T cell receptor for the epitope. These events lead to T cell proliferation,lymphokine secretion. local in?ammatory reactions. recruitment of additional immunecells to the site of antigen/T cell interaction. and activation of the B cell cascade. leadingto the production of antibodies. A T cell epitope is the basic element, or smallest unit ofrecognition by a T cell receptor, where the epitope comprises amino acids essential toreceptor recognition (e.g., approximately 6 or 7 amino acid residues). Amino acidsequences which mimic those of the T cell epitopes are within the scope of thisinvention.In another embodiment, immunogenic components of the invention are identi?edthrough genomic vaccination. The basic protocol is based on the idea that expressionlibraries consisting of all or parts of a pathogen genome, e.g., an H. pylori genome, canconfer protection when used to genetically immunize a host. This expression libraryimmunization (ELI) is analogous to expression cloning and involves reducing a genomicexpression library of a pathogen. e.g., H. pylori. into plasmids that can act as geneticvaccines. The plasmids can also be designed to encode genetic adjuvants which candramatically stimulate the humoral response. These genetic adjuvants can be introducedat remote sites and act as well extracelluraly as intracellularly.This is a new approach to vaccine production that has many of the advantages oflive/attenuated pathogens but no risk of infection. An expression library of pathogenDNA is used to immunize a host thereby producing the effects of antigen presentation ofa live vaccine without the risk. For example, in the present invention, random fragmentsfrom the H. pylori genome or from cosmid or plasmid clones, as well as PCR productsfrom genes identified by genomic sequencing, can be used to immunize a host. Thefeasibility of this approach has been demonstrated with A/Iycoplasma pulmonis (Barry etal., Nature _3:?:632-635, 1995), where even partial expression libraries of Mycoplasmapulmonis. a natural pathogen in rodents. provided protection against challenge from thepathogen.?l01520253035W0 98/18323CA 02265523 1999-03-16PCT/US97/19575_ 51 -ELI is a technique that allows for production of a non-infectious multipartitevaccine, even when little is known about pathogen's biology, because ELI uses theimmune system to screen candidate genes. Once isolated, these genes can be used asgenetic vaccines or for development of recombinant protein vaccines. Thus, ELI allowsfor production of vaccines in a systematic, largely mechanized fashion.Screening immunogenic components can be accomplished using one or more ofseveral different assays. For example, in vitro. peptide T cell stimulatory activity isassayed by contacting a peptide known or suspected of being immunogenic with anantigen presenting cell which presents appropriate MHC molecules in a T cell culture.Presentation of an immunogenic H. pylori peptide in association with appropriate MHCmolecules to T cells in conjunction with the necessary costimulation has the effect oftransmitting a signal to the T cell that induces the production of increased levels ofcytokines, particularly of interleukin-2 and interleukin-4. The culture supernatant can beobtained and assayed for interleukin-2 or other known cytokines. For example, any oneof several conventional assays for interleukin-2 can be employed, such as the assaydescribed in Proc. Natl. Acad. Sci USA, &: 1333 (1989) the pertinent portions of whichare incorporated herein by reference. A kit for an assay for the production of interferonis also available from Genzyme Corporation (Cambridge, MA).Alternatively, a common assay for T cell proliferation entails measuring tritiatedthymidine incorporation. The proliferation of T cells can be measured in vitro bydetermining the amount of 3H-labeled thymidine incorporated into the replicating DNAof cultured cells. Therefore, the rate of DNA synthesis and. in turn, the rate of celldivision can be quantified.Vaccine compositions or formulations of the invention containing one or moreimmunogenic components (e.g., H. pylori polypeptide or fragment thereof or nucleicacid encoding an H. pylori polypeptide or fragment thereof) preferably include apharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" isintended to include any and all solvents, dispersion media. coatings, antibacterial andantifungal agents, isotonic and absorption delaying agents. and the like, compatible withpharmaceutical administration. Suitable pharmaceutically acceptable carriers include,for example, one or more of waterâ, saline, phosphate buffered saline, dextrose, glycerol,ethanol and the like, as well as combinations thereof. Pharmaceutically acceptablecarriers may further comprise minor amounts of auxiliary substances such as wetting oremulsifying agents, preservatives or buffers. which enhance the shelf life oreffectiveness of the H. pylori nucleic acid or polypeptide. For vaccine formulations ofthe invention containing H. pylori polypeptides, the polypeptide is preferablycoadministered with a suitable adj uvant and/or a delivery system described herein.?101520253035WO 98/18323CA 02265523 1999-03-16PCT/US97/19575-52-It will be apparent to those of skill in the art that the therapeutically effectiveamount of DNA or protein of this invention will depend, inter alia, upon theadministration schedule. the unit dose of an H. pylori nucleic acid or polypeptideadministered, whether the protein or nucleic acid is administered in combination withother therapeutic agents. the immune status and health of the patient, and the therapeuticactivity of the particular protein or nucleic acid.Vaccine formulations are conventionally administered parenterally, e.g., byinjection, either subcutaneously or intramuscularly. Methods for intramuscularimmunization are described by Wolff et al. (1990) Science ;4_7_: l465-1468 and bySedegah et al. (1994) Immunology _9_1: 9866-9870. Other modes of administrationinclude oral and pulmonary formulations. suppositories, and transderrnal applications.Oral immunization is preferred over parenteral methods for inducing protection againstinfection by H. pylori. Czinn et. al. (1993) Vaccine _l_1: 637-642. Oral formulationsinclude such normally employed excipients as, for example, pharmaceutical grades ofmarmitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesiumcarbonate. and the like.In one embodiment, the vaccine formulation includes, as a pharrnaceuticallyacceptable carrier, an adjuvant. Examples of the suitable adj uvants for use in thevaccine formulations of the invention include, but are not limited, to aluminumhydroxide; N-acetyl-muramyl--L-threonyI-D-isoglutamine (thr-MDP); N-acetyl-nor-muramyl-Lâalanyl-D-isoglutamine (CGP 1 1637, referred to as nor-MDP); N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoylâsn-glycero-3-hydroxyphos-phoryloxy)-ethylamine (CGP 1983 5A. referred to a MTPâPE); RIBI,which contains three components from bacteria; monophosphoryl lipid A; trehalosedimycoloate; cell wall skeleton (MPL + TDM + CWS) in a 2% squalene/Tween 80emulsion; and cholera toxin. Others which may be used are non-toxic derivatives ofcholera toxin, including its B subunit, and/or conjugates or genetically engineeredfusions of the H pylori polypeptide with cholera toxin or its B subunit,procholeragenoid, fungal polysaccharides, including schizophyllan, muramyl dipeptide,muramyl dipeptide derivatives, phorbol esters, labile toxin of E. coli, non-H. pyloribacterial lysates. block polymers or saponins.In another embodiment. the vaccine formulation includes, as a pharrnaceuticallyacceptable carrier, a delivery system. Suitable delivery systems for use in the vaccineformulations of the invention include biodegradable microcapsules or immuno-stimulating complexes (ISCOMS), cochleates. or liposomes, genetically engineeredattenuated live vectors such as viruses or bacteria, and recombinant (chimeric) virus-like?101520253035W0 98/18323CA 02265523 1999-03-16PCT/US97/19575_ 53 -particles, e.g., bluetongue. In another embodiment of the invention, the vaccineformulation includes both a delivery system and an adj uvant.Delivery systems in humans may include enteric release capsules protecting theantigen from the acidic environment of the stomach, and including H. pylori polypeptidein an insoluble form as fusion proteins. Suitable carriers for the vaccines of theinvention are enteric coated capsules and polylactide-glycolide microspheres. Suitablediluents are 0.2 N NaHCO3 and/or saline.Vaccines of the invention can be administered as a primary prophylactic agent inadults or in children, as a secondary prevention, after successful eradication of H. pyloriin an infected host, or as a therapeutic agent in the aim to induce an immune response ina susceptible host to prevent infection by H. pylori. The vaccines of the invention areadministered in amounts readily determined by persons of ordinary skill in the art.Thus. for adults a suitable dosage will be in the range of 10 pg to 10 g, preferably 10 pgto 100 mg, for example 50 pg to 50 mg. A suitable dosage for adults will also be in therange of 5 pg to 500 mg. Similar dosage ranges will be applicable for children.The amount of adjuvant employed will depend on the type of adjuvant used. Forexample, when the mucosal adjuvant is cholera toxin. it is suitably used in an amount of5 pg to 50 pg, for example 10 pg to 35 pg. When used in the form of microcapsules, theamount used will depend on the amount employed in the matrix of the microcapsule toachieve the desired dosage. The determination of this amount is within the skill of aperson of ordinary skill in the art.Those skilled in the art will recognize that the optimal dose may be more or lessdepending upon the patient's body weight, disease. the route of administration. and otherfactors. Those skilled in the art will also recognize that appropriate dosage levels can beobtained based on results with known oral vaccines such as, for example, a vaccinebased on an E. coli lysate (6 mg dose daily up to total of 540 mg) and with anenterotoxigenic E. coli puri?ed antigen (4 doses of 1 mg) (Schulman et al., J. Urol._1_;5Q:917-921 (1993)); Boedecker et al., American Gastroenterological Assoc. 29_9:A-222(1993)). The number of doses will depend upon the disease, the formulation, andefficacy data from clinical trials. Without intending any limitation as to the course oftreatment. the treatment can be administered over 3 to 8 doses for a primaryimmunization schedule over 1 month (Boedeker, American Gastroenterological Assoc.§§&:A-222 (1993)).In a preferred embodiment, a vaccine composition of the invention can be basedon a killed whole E. coli preparation with an immunogenic fragment of an H. pyloriprotein of the invention expressed on its surface or it can be based on an E. coli lysate,wherein the killed E. coli acts as a carrier or an adjuvant.?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-54-It will be apparent to those skilled in the art that some of the vaccinecompositions of the invention are useful only for preventing H. pylori infection, someare useful only for treating H. pylori infection, and some are useful for both preventingand treating H. pylori infection. In a preferred embodiment, the vaccine composition ofthe invention provides protection against H. pylori infection by stimulating humoraland/or cell-mediated immunity against H. pylori. It should be understood thatamelioration of any of the symptoms of H. pylori infection is a desirable clinical goal,including a lessening of the dosage of medication used to treat H. pylori-caused disease,or an increase in the production of antibodies in the serum or mucous of patients.VII. Antibodies Reactive With H. pylori PolypeptidesThe invention also includes antibodies speci?cally reactive with the subject H.pylori polypeptide. Anti-protein/anti-peptide antisera or monoclonal antibodies can bemade by standard protocols (See. for example, Antibodies.â A Laboratory Manual ed. byHarlow and Lane (Cold Spring Harbor Press: 1988)). A mammal such as a mouse, ahamster or rabbit can be immunized with an immunogenic form of the peptide.Techniques for conferring immunogenicity on a protein or peptide include conjugationto carriers or other techniques well known in the art. An immunogenic portion of thesubject H. pylori polypeptide can be administered in the presence of adj uvant. Theprogress of immunization can be monitored by detection of antibody titers in plasma orserum. Standard ELISA or other immunoassays can be used with the immunogen asantigen to assess the levels of antibodies.In a preferred embodiment. the subject antibodies are immunospecific forantigenic determinants of the H. pylori polypeptides of the invention, e.g. antigenicdeterminants of a polypeptide of the invention contained in the Sequence Listing, or aclosely related human or non-human mammalian homolog (e.g., 90% homologous, morepreferably at least 95% homologous). In yet a further preferred embodiment of theinvention, the anti-H pylori antibodies do not substantially cross react (i.e., reactspecifically) with a protein which is for example, less than 80% percent homologous to asequence of the invention contained in the Sequence Listing. By "not substantially crossreact", it is meant that the antibody has a binding affinity for a non-homologous proteinwhich is less than 10 percent, more preferably less than 5 percent, and even morepreferably less than 1 percent, of the binding affinity for a protein of the inventioncontained in the Sequence Listing. In a most preferred embodiment, there is nocrossreactivity between bacterial and mammalian antigens.The term antibody as used herein is intended to include fragments thereof whichare also speci?cally reactive with H. pylori" polypeptides. Antibodies can be fragmented?101520253035WO 98118323CA 02265523 l999-03- 16PCT/US97/19575_ 5 5 -using conventional techniques and the fragments screened for utility in the same manneras described above for whole antibodies. For example, F (abâ)2 fragments can begenerated by treating antibody with pepsin. The resulting F(ab')2 fragment can betreated to reduce disulfide bridges to produce F abâ fragments. The antibody of theinvention is further intended to include bispeci?c and chimeric molecules having ananti-H. pylori portion.Both monoclonal and polyclonal antibodies (Ab) directed against H. pyloripolypeptides or H. pylori polypeptide variants, and antibody fragments such as Fabâ andF(abâ)2, can be used to block the action of H. pylori polypeptide and allow the study ofthe role of a particular H. pylori polypeptide of the invention in aberrant or unwantedintracellular signaling, as well as the normal cellular function of the H. pylori and bymicroinjection of anti-H. pylori polypeptide antibodies of the present invention.Antibodies which speci?cally bind H. pylori epitopes can also be used inimmunohistochemical staining of tissue samples in order to evaluate the abundance andpattern of expression of H. pylori antigens. Anti H. pylori polypeptide antibodies can beused diagnostically in immunoâprecipitation and immuno-blotting to detect and evaluateH. pylori levels in tissue or bodily ?uid as part of a clinical testing procedure. Likewise,the ability to monitor H. pylori polypeptide levels in an individual can allowdetermination of the efficacy of a given treatment regimen for an individual af?ictedwith such a disorder. The level of an H. pylori polypeptide can be measured in cellsfound in bodily ?uid, such as in urine samples or can be measured in tissue, such asproduced by gastric biopsy. Diagnostic assays using anti-H. pylori antibodies caninclude, for example. immunoassays designed to aid in early diagnosis of H. pyloriinfections. The present invention can also be used as a method of detecting antibodiescontained in samples from individuals infected by this bacterium using specific H. pyloriantigens.Another application of anti-H. pylori polypeptide antibodies of the invention isin the immunological screening of CDNA libraries constructed in expression vectorssuch as kgtl 1, kgtl 8-23, KZAP. and KORF8. Messenger libraries of this type. havingcoding sequences inserted in the correct reading frame and orientation. can producefusion proteins. For instance, Agtl-1 will produce fusion proteins whose amino terminiconsist of B-galactosidase amino acid sequences and whose carboxy termini consist of aforeign polypeptide. Antigenic epitopes of a subject H. pylori polypeptide can then bedetected with antibodies, as, for example, reacting nitrocellulose filters lifted frominfected plates with anti-H. pylori polypeptide antibodies. Phage, scored by this assay,can then be isolated from the infected plate. Thus, the presence of H. pylori gene?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/ 19575-56-homologs can be detected and cloned from other species. and alternate isoforms(including splicing variants) can be detected and cloned.VIII. Kits Containing Nucleic Acids, Polypeptides or Antibodies of the InventionThe nucleic acid, polypeptides and antibodies of the invention can be combinedwith other reagents and articles to form kits. Kits for diagnostic purposes typicallycomprise the nucleic acid, polypeptides or antibodies in vials or other suitable vessels.Kits typically comprise other reagents for performing hybridization reactions,polymerase chain reactions (PCR), or for reconstitution of lyophilized components, suchas aqueous media, salts, buffers, and the like. Kits may also comprise reagents forsample processing such as detergents, chaotropic salts and the like. Kits may alsocomprise immobilization means such as particles. supports. wells, dipsticks and the like.Kits may also comprise labeling means such as dyes. developing reagents. radioisotopes,?uorescent agents, luminescent or chemiluminescent agents, enzymes, intercalatingagents and the like. With the nucleic acid and amino acid sequence information providedherein, individuals skilled in art can readily assemble kits to serve their particularpurpose. Kits further can include instructions for use.IX. Drug Screening Assays Using H. pylori PolypeptidesBy making available purified and recombinant H. pylori polypeptides, thepresent invention provides assays which can be used to screen for drugs which are eitheragonists or antagonists of the normal cellular function, in this case, of the subject H.pylori polypeptides, or of their role in intracellular signaling. Such inhibitors orpotentiators may be useful as new therapeutic agents to combat H. pylori infections inhumans. A variety of assay formats will suffice and. in light of the present inventions,will be comprehended by the skilled artisan.In many drug screening programs which test libraries of compounds and naturalextracts, high throughput assays are desirable in order to maximize the number ofcompounds surveyed in a given period of time. Assays which are performed in cell-freesystems, such as may be derived with purified or semi-puri?ed proteins, are oftenpreferred as "primary" screens in that they can be generated to permit rapid developmentand relatively easy detection of an alteration in a molecular target which is mediated bya test compound. Moreover. the effects of cellular toxicity and/or bioavailability of thetest compound can be generally ignored in the in vitro system, the assay instead beingfocused primarily on the effect of the drug on the molecular target as may be manifest inan alteration of binding affinity with other proteins or change in enzymatic properties ofthe molecular target. Accordingly, in an exemplary screening assay of the present?101520253035W0 98/ 18323CA 02265523 1999-03-16PCT/US97/19575-57-invention, the compound of interest is contacted with an isolated and puri?ed H. pyloripolypeptide.Screening assays can be constructed in vitro with a puri?ed H. pyloripolypeptide or fragment thereof. such as an H. pylori polypeptide having enzymaticactivity, such that the activity of the polypeptide produces a detectable reaction product.The ef?cacy of the compound can be assessed by generating dose response curves fromdata obtained using various concentrations of the test compound. Moreover, a controlassay can also be performed to provide a baseline for comparison. Suitable productsinclude those with distinctive absorption, ?uorescence. or chemi-luminescenceproperties, for example, because detection may be easily automated. A variety ofsynthetic or naturally occurring compounds can be tested in the assay to identify thosewhich inhibit or potentiate the activity of the H. pylori polypeptide. Some of theseactive compounds may directly, or with chemical alterations to promote membranepermeability or solubility, also inhibit or potentiate the same activity (e. g., enzymaticactivity) in whole, live H. pylori cells.This invention is further illustrated by the following examples which should notbe construed as limiting. The contents of all references and published patentapplications cited throughout this application are hereby incorporated by reference.EXEMPLIFICATION1. Cloning and Sequencing of H. pylori DNAH. pylori chromosomal DNA was isolated according to a basic DNA protocoloutlined in Sch1eifR.F. and Wensink P.C., Practical Methods in Molecular Biology,p.98, Springer-Verlag, NY., 1981, with minor modi?cations. Brie?y, cells werepelleted, resuspended in TE (10 mM Tris, 1 mM EDTA, pH 7.6) and GES lysis buffer(5.1 M guanidium thiocyanate. 0.1 M EDTA, pH 8.0, 0.5% N-laurylsarcosine) wasadded. Suspension was chilled and ammonium acetate (NH4Ac) was added to ?nalconcentration of 2.0 M. DNA was extracted, ?rst with chloroform. then with phenol-chloroform, and reextracted with chloroform. DNA was precipitated with isopropanol.washed twice with 70% EtOH. dried and resuspended in TE.Following isolation whole genomic H. pylori DNA was nebulized (Bodenteich etal., Automated DNA Sequencing and Analysis (J.C. Venter, ed.), Academic Press. 1994)to a median size of 2000 bp. After nebulization, the DNA was concentrated andseparated on a standard 1% agarose gel. Several fractions. corresponding to?101520253035W0 98/18323CA 02265523 l999-03- 16PCT/US97/ 19575- 5 8 -approximate sizes 900-1300 bp. 1300-1700 bp, 1700-2200 bp, 2200-2700 bp, wereexcised from the gel and puri?ed by the GeneClean procedure (Bio101, lnc.).The puri?ed DNA fragments were then blunt-ended using T4 DNA polymerase.The healed DNA was then ligated to unique BstXI-linker adapters in 100-1000 foldmolar excess. These linkers are complimentary to the BstXI-cut pMPX vectors. whilethe overhang is not selfâcomplimentary. Therefore, the linkers will not concatemerizenor will the cut-vector religate itself easily. The linker-adopted inserts were separatedfrom the unincorporated linkers on a 1% agarose gel and puri?ed using GeneClean. Thelinker-adopted inserts were then ligated to each of the 20 pMPX vectors to construct aseries of "shotgun" subclone libraries. The vectors contain an out-of-frame lacZ gene atthe cloning site which becomes in-frame in the event that an adapter-dimer is cloned,allowing these to be avoided by their blue-color.All subsequent steps were based on the multiplex DNA sequencing protocolsoutlined in Church G.M. and Kieffer-Higgins S., Science 2402185-188, 1988. Onlymajor modi?cations to the protocols are highlighted. Brie?y, each of the 20 vectors wasthen transformed into DH5ot competent cells (Gibco/BRL, DH5oc transformationprotocol). The libraries were assessed by plating onto antibiotic plates containingampicillin, methicillin and IPTG/Xgal. The plates were incubated overnight at 37°C.Successful transformants were then used for plating of clones and pooling into themultiplex pools. The clones were picked and pooled into 40 ml growth mediumcultures. The cultures were grown overnight at 37°C. DNA was puri?ed using theQiagen Midi-prep kits and Tip-100 columns (Qiagen, Inc.). In this manner, 100 ug ofDNA was obtained per pool. Fifteen 96-well plates of DNA were generated to obtain a5-10 fold sequence redundancy assuming 250-300 base average read-lengths.These puri?ed DNA samples were then sequenced using the multiplex DNAsequencing based on chemical degradation methods (Church G.M. and Kieffer-HigginsS., Science 240: 1 85-1 88, 1988) or by Sequithrem (Epicenter Technologies) dideoxysequencing protocols. The sequencing reactions were electrophoresed and transferredonto nylon membranes by direct transfer electrophoresis from 40 cm gels (Richterich P.and Church G.M., Methods in Enzymology 218: 1 87-222, 1993) or by electroblotting(Church, supra). 24 samples were run per gel. 45 successful membranes were producedby chemical sequencing and 8 were produced by dideoxy sequencing. The DNA wascovalently bound to the membranes by exposure to ultraviolet light, and hybridized withlabeled oligonucleotides complimentary to tag sequences on the vectors (Church, supra).The membranes were washed to rinse off non-speci?cally bound probe. and exposed toX-ray ?lm to visualize individual sequence ladders. After autoradiography, thehybridized probe was removed by incubation at 65° C, and the hybridization cycle?101520253035WO 98/18323CA 02265523 l999-03- 16PCT/US97/ 19575- 59 _repeated with another tag sequence until the membrane had been probed 38 times forchemical sequencing membranes and 10 times for the dideoxy sequencing membranes.Thus, each gel produced a large number of ?lms, each containing new sequencinginformation. Whenever a new blot was processed, it was initially probed for an internalstandard sequence added to each of the pools.Digital images of the ?lms were generated using a laser-scanning densitometer(Molecular Dynamics, Sunnyvale, CA). The digitized images were processed oncomputer workstations (VaxStation 4000's) using the program REPLICATM (Church etal., Automated DNA Sequencing and Analysis (J.C. Venter, ed.), Academic Press, 1994).Image processing included lane straightening, contrast adjustment to smooth outintensity differences, and resolution enhancement by iterative gaussian deconvolution.The sequences were then automatically picked in REPLICAâ and displayed forinteractive proofreading before being stored in a project database. The proofreading wasaccomplished by a quick visual scan of the ?lm image followed by mouse clicks on thebands of the displayed image to modify the base calls. Many of the sequence errorscould be detected and corrected because multiple sequence reads covering the sameportion of the genomic DNA provide adequate sequence redundancy for editing. Eachsequence automatically received an identi?cation number (corresponding to microtiterplate, probe information, and lane set number). This number serves as a permanentidenti?er of the sequence so it is always possible to identify the original of anyparticular sequence without recourse to a specialized database.Routine assembly of H. pylori sequences was done using the program FALCON(Church, Church et al., Automated DNA Sequenicng and Analysis (J .C. Venter, ed.),Academic Press, 1994). This program has proven to be fast and reliable for mostsequences. The assembled contigs were displayed using a modi?ed version ofGelAssembIe, developed by the Genetics Computer Group (GCG) (Devereux et al.,Nucleic Acid Res. 12:387-95, 1984) that interacts with REPLICATM. This provided foran integrated editor that allows multiple sequence gel images to be instantaneouslycalled up from the REPLICATM database and displayed to allow rapid scanning ofcontigs and proofreading of gel traces where discrepancies occurred between differentsequence reads in the assembly.ll. Identi?cation, cloning and expression of recombinant H. pylori DNA sequencesTo facilitate the cloning, expression and puri?cation of membrane and secretedproteins from H. pylori a powerful gene expression system, the pET System (Novagen),for cloning and expression of recombinant proteins in E. coli, was selected. Also, aDNA sequence encoding a peptide tag, the His-Tag, was fused to the 3â end of DNA. ,,..............-....................-..._.............._.,...u .,..........,..............l._.... ......_............,.. .. ..?1015202530W0 98/18323CA 02265523 l999-03- 16PCT/US97/1 9575-60-sequences of interest in order to facilitate puri?cation of the recombinant proteinproducts. The 3â end was selected for fusion in order to avoid alteration of any 5âterminal signal sequence. The exception to the above was ppiB, a gene cloned for use asa control in the expression studies. In this study, the sequence for H. pylori ppiBcontains a DNA sequence encoding a His-Tag fused to the 5â end of the full length gene,because the protein product of this gene does not contain a signal sequence and isexpressed as a cytosolic protein.PCR Ampli?cation and cloning of DNA sequences containing ORF âsf0r membrane andsecreted proteins from the J99 Strain of Helicobacter pylori.Sequences chosen (from the list of the DNA sequences of the invention) forcloning from the J99 strain of H. pylori were prepared for amplification cloning bypolymerase chain reaction (PCR). Synthetic oligonucleotide primers (Table 3) specificfor the 5â and 3â ends of open reading frames (ORFS) were designed and purchased(GibcoBRL Life Technologies, Gaithersburg, MD. USA). All forward primers (specificfor the 5â end of the sequence) were designed to include an l_\l_CQl cloning site at theextreme 5â terminus, except for HpSeq. 4821082 where Ngg was used. These primerswere designed to permit initiation of protein translation at a methionine residue followedby a valine residue and the coding sequence for the remainder of the native H. pyloriDNA sequence. An exception is H. pylori sequence 4821082 where the initiatormethionine is immediately followed by the remainder of the native H. pylori DNAsequence. All reverse primers (specific for the 3â end of any H. pylori ORF) included aEcg? site at the extreme 5â terminus to permit cloning of each H pylori sequence intothe reading frame of the pET-28b. The pETâ28b vector provides sequence encoding anadditional 20 carboxy-terrninal amino acids (only 19 amino acids in HpSeq. 263 80318and HpSeq. 14640637) including six histidine residues (at the extreme C-terminus),which comprise the His-Tag. An exception to the above, as noted earlier, is the vectorconstruction for the ppiB gene. A synthetic oligonucleotide primer speci?c for the 5âend of ppiB gene encoded a BamHI site at its extreme 5â terminus and the primer for the3â end of the ppiB gene encoded a Xhol site at its extreme 5â terminus.?W0 98/18323CA 02265523 l999-03- 16-61-TABLE 3PCT/US9i7/19575Oligonucleotide primers used for PCR ampli?cation of H. pylori DNA sequencesOuter membraneProteinsForward primer 5â to 3âReverse Primer 5â to 3âProtein 16225006 5'âTATACCATGGTGGG 5'-CGCTAA-3â (SEQ ID ATGAATTCGAGTAAGNO:147) GATTTTTG-3â (SEQ IDNO: 148)Protein 26054702 5'- 5'-TTAACCATGGTGAAA TAGAATTCGCATAACAGCGATA-3â (SEQ ID GATCAATC-3' (SEQ IDNO:149) NO:150)Protein 7116626 5'- 5'-ATATCCATGGTGAGT ATGAATTCAATTTTTTTGATGA-3' (SEQ ID TATTTTGCCA-3' (SEQNO:151) ID NO:152)Protein 29479681 5'- 5'-AATTCCATGGTGGGG ATGAATTCTCGATAGGCTATG-3' (SEQ ID CCAAAATC-3' (SEQ IDNO:153) NO:154)Protein 14640637 5'- 5'-AATTCCATGGTGCAT AAGAATTCTCTAGCAAACTTCCATT-3' (SEQID NO:155)TCCAAATGGA-3' (SEQID NO:156)Periplasmicl SecretedProteinsProtein 30100332 5'-ATTTCCATGGTCATG 5'-TCTCATATT-3â (SEQ ID ATGAATTCCATCTTTNO:157) TATTCCAC-3' (SEQ IDNO:158)Protein 4721061 5'-AACCATGGTGATTT 5'-TAAGCATTGAAAG-3â AAGAATTCCACTCA(SEQ ID NO:159)AAATTTTTTAACAG-3'(SEQ ID NO:160)Other Surface ProteinsProtein 48210825'-GATCATCCATATGTTATCTTCTAAT-3' (SEQID N011 61)5'-TGAATTCAACCATTTTAACCCTG-3' (SEQ IDNO:162)?101520CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/19575_ -Protein 978477 5'-TATACCATGGTGAA 5'-ATTTTTTCTTTTAâ3' AGAATTCAATTGCG(SEQ ID NO: 163) TCTTGTAAAAG-3'(SEQ ID NO:164)Inner MembraneProteinProtein 26380318 5'-TATACCATGGTGATGGACAAACTC-3' (SEQID NO:l65)5'-ATGAATTCCCACTTGGGGCGATAâ3' (SEQID NO:166)Cytoplasmic Protein5'-TTATGGATCCAAACCAATTAAAACT-3' (SEQID NO: 167)5'-TATCTCGAGTTATAGAGAAGGGC-3' (SEQID NO:168)ppiGenomic DNA prepared from the J99 strain of H. pylori (ATCC #55679;deposited by Genome Therapeutics Corporation, 100 Beaver Street, Waltham, MA02154) was used as the source of template DNA for PCR ampli?cation reactions(Current Protocols in Molecular Biology, John Wiley and Sons, Inc., F. Ausubel et al.,eds., 1994). To amplify a DNA sequence containing an H. pylori ORF, genomic DNA(50 nanograms) was introduced into a reaction vial containing 2 mM MgCl2, 1micromolar synthetic oligonucleotide primers (forward and reverse primers)complementary to and ?anking a defined H. pylori ORF, 0.2 mM of eachdeoxynucleotide triphosphate: dATP. dGTP. dCTP. dTTP and 2.5 units of heat stableDNA polymerase (Amplitaq, Roche Molecular Systems. Inc., Branchburg, NJ. USA) ina ?nal volume of 100 microliters. The following thermal cycling conditions were usedto obtain amplified DNA products for each OR.F using a Perkin Elmer Cetus/ GeneAmpPCR System 9600 thermal cycler:Protein 26054702, Protein 7116626, Protein 29479681, Protein 30100332, andProtein 4821082;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec, 30°C for 15 sec and 72°C for 1.5 min23 cycles at 94°C for 15 sec, 55°C for 15 sec and 72°C for 1.5 minReactions were concluded at 72°C for 6 minutes.Protein 16225006;Denaturation at 94°C for 2 min.?CA 02265523 l999-03- 16W0 98/ 18323- 53 _25 cycles at 95°C for 15 sec, 55°C for 15 sec and 72°C for 1.5 minReaction was concluded at 72°C for 6 minutes.Protein 4721061;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec, 36°C for 15 sec and 72°C for 1.5 min23 cycles at 94°C for 15 sec, 60°C for 15 sec and 72°C for 1.5 minReactions were concluded at 72°C for 6 minutes.Protein 26380318;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec. 38°C for 15 sec and 72°C for 1.5 min23 cycles at 94°C for 15 sec. 62°C for 15 sec and 72°C for 1.5 minReactions were concluded at 72°C for 6 minutes.Protein 14640637;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec, 33°C for 15 sec and 72°C for 1.5 min30 cycles at 94°C for 15 sec, 55°C for 15 sec and 72°C for 1.5 minReactions were concluded at 72°C for 6 minutes.Conditions for ampli?cation of H. pylori ppiB;Denaturation at 94°C for 2 min.2 cycles at 94°C for 15 sec, 32°C for 15 sec and 72°C for 1.5 min25 cycles at 94°C for 15 sec, 56°C for 15 sec and 72°C for 1.5 minReactions were concluded at 72°C for 6 minutesPCT/US97/19575Upon completion of thermal cycling reactions, each sample of ampli?ed DNAwas washed and puri?ed using the Qiaquick Spin PCR puri?cation kit (Qiagen,Gaithersburg, MD, USA). All ampli?ed DNA samples were subjected to digestion withthe restriction endonucleases, l_\I_c_gI and ?9_R_l_ (New England BioLabs, Beverly, MA,USA), or in the case of HpSeq. 4821082 (SEQ ID NO: 1309), with lg and l_3ggjR_l(Current Protocols in Molecular Biology, John Wiley and Sons, lnc., F. Ausubel et al.,eds., 1994). DNA samples were then subjected to electrophoresis on 1.0 % NuSeive(FMC BioProducts, Rockland. ME USA) agarose gels. DNA was visualized byexposure to ethidium bromide and long wave uv irradiation. DNA contained in slices?CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-54-isolated from the agarose gel was puri?ed using the Bio 101 GeneClean Kit protocol(Bio 101 Vista. CA, USA).Cloning of H. pylori DNA sequences into the pETâ28b prokaryotic expression vector.The pET-28b vector was prepared for cloning by digestion with l1c_ol and EQLI,or in the case of H. pylori protein 4821082 with Edi] and?cp?l (Current Protocols inMolecular Biology, John Wiley and Sons. lnc., F. Ausubel et al., eds.. 1994). In the caseof cloning ppiB. the pET-28a vector, which encodes a His-Tag that can be fused to the5â end of an inserted gene, was used and the cloning site prepared for cloning with theppiB gene by digestion with BamHI and )_(_l_i_o_I restriction endonucleases.Following digestion, DNA inserts were cloned (Current Protocols in MolecularBiology, John Wiley and Sons, lnc., F. Ausubel et al., eds., 1994) into the previouslydigested pETâ28b expression vector. except for the ampli?ed insert for ppiB, which wascloned into the pET-28a expression vector. Products of the ligation reaction were thenused to transform the BL21 strain of E. coli (Current Protocols in Molecular Biology,John Wiley and Sons, lnc., F. Ausubel et al., eds., 1994) as described below.Transformation ofcompetent bacteria with recombinant plasmidsCompetent bacteria, E coli strain BL21 or E. coli strain BL21 (DE3), weretransformed with recombinant pET expression plasmids carrying the cloned H. pylorisequences according to standard methods (Current Protocols in Molecular, John Wileyand Sons, lnc., F. Ausubel et al.. eds., 1994). Brie?y, 1 microliter of ligation reactionwas mixed with 50 microliters of electrocompetent cells and subjected to a high voltagepulse, after which, samples were incubated in 0.45 milliliters SOC medium (0.5% yeastextract, 2.0 % tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4 and20, mM glucose) at 37°C with shaking for 1 hour. Samples were then spread on LBagar plates containing 25 micrograrn/ml kanamycin sulfate for growth overnight.Transformed colonies of BL21 were then picked and analyzed to evaluate cloned insertsas described below.Identification of recombinant pE T expression plasmids carrying H. pylori sequencesIndividual BL21 clones transformed with recombinant pET-28b-H.pylori ORFswere analyzed by PCR ampli?cation of the cloned inserts using the same forward andreverse primers, speci?c for each H. pylori sequence, that were used in the original PCRampli?cation cloning reactions. Successful ampli?cation verified the integration of theH. pylori sequences in the expression vector (Current Protocols in Molecular Biology,John Wiley and Sons, lnc., F. Ausubel et al.. eds., 1994).?CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-55-Isolation and Preparation ofplasmid DNA from BL21 transformantsIndividual clones of recombinant pET-28b vectors carrying properly cloned H.pylori ORFs were picked and incubated in 5 mls of LB broth plus 25 microgram/mlkanamycin sulfate overnight. The following day plasmid DNA was isolated andpuri?ed using the Qiagen plasmid puri?cation protocol (Qiagen Inc., Chatsworth, CA,USA).Expression of recombinant H. pylori sequences in E. coliThe pET vector can be propagated in any E. coli K-12 strain e.g. HMS174,HBl01, JM109, DH5, etc. for the purpose of cloning or plasmid preparation. Hosts forexpression include E. coli strains containing a chromosomal copy of the gene for T7RNA polymerase. These hosts are lysogens of bacteriophage DE3, a lambda derivativethat carries the lacl gene, the lacUV5 promoter and the gene for T7 RNA polymerase.T7 RNA polymerase is induced by addition of isopropyl-B-D-thiogalactoside (IPTG),and the T7 RNA polymerase transcribes any target plasmid, such as pET-28b, carrying aT7 promoter and a gene of interest. Strains used include: BL2l(DE3) (Studier, F.W.,Rosenberg, A.H., Dunn, J .J ., and Dubendorff, J .W. (1990) Meth. Enzymol. 185, 60-89).To express recombinant H. pylori sequences, 50 nanograms of plasmid DNAisolated as described above was used to transform competent BL2l(DE3) bacteria asdescribed above (provided by Novagen as part of the pET expression system kit). ThelacZ gene (beta-galactosidase) was expressed in the pET-System as described for the H.pylori recombinant constructions. Transformed cells were cultured in SOC medium for1 hour, and the culture was then plated on LB plates containing 25 micrograms/mlkanamycin sulfate. The following day, bacterial colonies were pooled and grown in LBmedium containing kanamycin sulfate (25 micrograms/ml) to an optical density at 600nM of 0.5 to 1.0 O.D. units, at which point, 1 millimolar IPTG was added to the culturefor 3 hours to induce gene expression of the H. pylori recombinant DNA constructions.After induction of gene expression with IPTG. bacteria were pelleted bycentrifugation in a Sorvall RCâ3B centrifuge at 3500 x g for 15 minutes at 4°C. Pelletswere resuspended in 50 milliliters of cold 10 mM Tris-HCl, pH 8.0, 0.1 M NaCl and 0.1mM EDTA (STE buffer). Cells were then centrifuged at 2000 x g for 20 min at 4°C.Wet pellets were weighed and frozen at -80°C until ready for protein puri?cation.III. Purification of recombinant proteins from E. coliAnalytical MethodsThe concentrations of puri?ed protein preparations were quanti?edspectrophotometrically using absorbance coefficients calculated from amino acid?CA 02265523 l999-03- 16W0 98/18323 PCT/US97/19575- 65 _content (Perkins, SJ. 1986 Eur. J. Biochem. 157, 169-180). Protein concentrations werealso measured by the method of Bradford, M.M. (1976) Anal. Biochem. 72, 248-254,and Lowry, O.H.. Rosebrough, N., Farr. A.L. & Randall, R.J. (1951) J. Biol. Chem. 193,pages 265-275, using bovine serum albumin as a standard.SDS-polyacrylamide gels (12% or 4.0 to 25 % acrylamide gradient gels) werepurchased from BioRad (Hercules, CA, USA), and stained with Coomassie blue.Molecular weight markers included rabbit skeletal muscle myosin (200 kDa), E. coli (-galactosidase (1 16 kDa), rabbit muscle phosphorylase B (97.4 kDa), bovine serumalbumin (66.2 kDa), ovalbumin (45 kDa), bovine carbonic anhydrase (31 kDa), soybeantrypsin inhibitor (21.5 kDa), egg white lysozyme (14.4 kDa) and bovine aprotinin (6.5kDa).1. Purification of soluble proteinsAll steps were carried out at 4°C. Frozen cells were thawed, resuspended in 5volumes of lysis buffer (20 mM Tris, pH 7.9, 0.5 M NaCl, 5 mM imidazole with 10%glycerol. 0.1 % 2-mercaptoethanol, 200 ug/ ml lysozyme, 1 mM phenylmethylsulfonyl?uoride (PMSF), and 10 ug/ml each of leupeptin, aprotinin, pepstatin, L-1âchloro-3-[4-tosylamido]-7-aminoâ2âheptanone (TLCK), L-1-chloroâ3-[4-tosylamido]-4-phenylâ2-butanone (TPCK), and soybean trypsin inhibitor, and ruptured by several passagesthrough a small volume micro?uidizer (Model M-I 10S, Micro?uidics lntemationalCorporation, Newton, MA). The resultant homogenate was made 0.1 % Brij 35, andcentrifuged at 100,000 x g for 1 hour to yield a clear supernatant (crude extract).Following ?ltration through a 0.8 pm Supor ?lter (Gelman Sciences. F RG) thecrude extract was loaded directly onto a Ni-2+â nitrilotriacetate-agarose (NTA) with a 5milliliter bed volume (Hochuli, E., Dbeli, I-1., and Schacheer, A. (1987) J.Chromatography 41 1, 177-184) pre-equilibrated in lysis buffer containing 10 %glycerol, 0.1 % Brij 35 and 1 mM PMSF. The column was washed with 250 ml (50 bedvolumes) of lysis buffer containing 10 % glycerol, 0.1 % Brij 35, and was eluted withsequential steps of lysis buffer containing 10 % glycerol, 0.05 % Brij 35, 1 mM PMSF,and 20, 100, 200, and 500 mM imidazole in succession. Fractions were monitored byabsorbance at OD280 nm, and peak fractions were analyzed by SDS-PAGE. Fractionscontaining the recombinant protein eluted at 100 mM imidazole.Recombinant protein 1464063 7 and proteins, beta-galactosidase (lacZ) and peptidyl-prolyl cis-trans isomerase (ppiB)Fractions containing the recombinant proteins from the Ni2+-NTA-agarosecolumns were pooled and then concentrated to approximately 5 ml by centrifugal?CA 02265523 1999-03-16WO 98118323 PCT/US97/19575- 57 -?ltration (Centriprep-10, Amicon, MA), and loaded directly onto a 180~ml column (1.6X 91 cm) of Sephacryl S-100 HR gel ?ltration medium equilibrated in Buffer A (10 mMHepes, pH 7.5, 150 mM NaCl, 0.1 mM EGTA) and run in Buffer A at 18 ml/h.Fractions containing the recombinant protein were identi?ed by absorbance at 280 nmand analyzed by SDSâPAGE. Fractions were pooled and concentrated by centrifugal?ltration.Recombinant protein 7116626Fractions containing the recombinant protein from the Ni2+ -NTA-agarosecolumn were pooled and dialyzed overnight against 1 liter of dialysis buffer (10 mMMOPS, pH 6.5, 50 mM NaCl, 0.1 mM EGTA, 0.02% Brij 35 and 1 mM PMSF). In themorning, a ?ne white precipitate was removed by centrifugation and the resultingsupernatant was loaded onto an 8 ml (8 x 75 mm) MonoS high performance liquidchromatography column (Pharmacia Biotechnology, Inc.. Piscataway, NJ, USA)equilibrated in buffer B (10 mM MOPS, pH 6.5, 0.1 mM EGTA) containing 50 mMNaCl. The column was washed with 10 bed volumes of buffer B containing 50 mMNaCl, and developed with a 50âml linear gradient of increasing NaCl (50 to 500 mM).Recombinant protein 71 16626 eluted as a sharp peak at 300 mM NaCl.2. Purification of insoluble proteins ?om inclusion bodiesThe following steps were carried out at 4°C. Cell pellets were resuspended inlysis buffer with 10% glycerol 200 p.g/ ml lysozyme. 5 mM EDTA, 1mM PMSF and 0.1% -mercaptoethanol. After passage through the cell disrupter. the resulting homogenatewas made 0.2 % deoxycholate. stirred 10 minutes, then centrifuged at 20,000 x g, for 30min. The pellets were washed with lysis buffer containing 10 % glycerol, 10 mMEDTA, 1% Triton X-100, 1 mM PMSF and 0.1% -mercaptoethanol, followed by severalwashes with lysis buffer containing 1 M urea, 1 mM PMSF and 0.1 % 2-mercaptoethanol. The resulting white pellet was composed primarily of inclusionbodies, free of unbroken cells and membranous materials.Recombinant proteins 26054 702, 16225006, 3 01 003 3 2. 4 721 061The following steps were carried out at room temperature. Puri?ed inclusionbodies were dissolved in 20 ml 8.0 M urea in lysis buffer with 1 mM PMSF and 0.1 %2-mercaptoethanol, and incubated at room temperature for 1 hour. Materials that did notdissolve were removed by centrifugation. The clear supernatant was ?ltered, thenloaded onto a Ni2+Buffer. The column was washed with 250 ml (50 bed volumes) of lysis buffer-NTA agarose column pre-equilibrated in 8.0 M urea in Lysis?1015202530WO 98/18323CA 02265523 l999-03- 16PCT/US97/ 19575- _containing 8 M urea, 1.0 mM PMSF and 0.1 % 2-mercaptoethanol, and developed withsequential steps of lysis buffer containing 8M urea. 1 mM PMSF, 0.1 % 2-mercaptoethanol and 20. 100. 200. and 500 mM imidazole in succession. F ractionswere monitored by absorbance at OD230 nm. and peak fractions were analyzed by SDS-PAGE. Fractions containing the recombinant protein eluted at 100 mM imidazole.Recombinant proteins 294 79681, 26380318The pellet containing the inclusion bodies was solubilized in buffer B containing8 M urea, 1 mM PMSF and 0.1 % 2-mercaptoethanol. and incubated for 1 hour at roomtemperature. Insoluble materials were removed by centrifugation at 20,000 x g for 30min, and the cleared supernatant was loaded onto a 15 ml ( 1.6 x 7.5 cm ) SP-Sepharosecolumn pre-equilibrated in buffer B, 6 M urea, 1 mM PMSF, 0.1 % 2âmercaptoethanol.After washing the column with 10 bed volumes. the column was developed with a lineargradient from 0 to 500 mM NaCl.Dialysis and concentration of protein samplesUrea was removed slowly from the protein samples by dialysis against Tris-buffered saline (TBS; 10 mM Tris pH 8.0, 150 mM NaCl) containing 0.5 %deoxycholate (DOC) with sequential reduction in urea concentration as follows; 6M,4M, 3M, 2M, 1M. 0.5 M and ?nally TBS without any urea. Each dialysis step wasconducted for a minimum of 4 hours at room temperature.After dialysis, samples were concentrated by pressure ?ltration using Amiconstirred-cells. Protein concentrations were measured using the methods of Perkins (1986Eur. J. Biochem. 157, 169-180). Bradford ((1976) Anal. Biochem. 72, 248-254) andLowry ((1951) J. Biol. Chem. 193, pages 265-275).The recombinant proteins puri?ed by the methods described above aresummarized in Table 4 below.TABLE 4J99 Homolog Gene Bacterial cell Method of Relative Final CompositSequence identi?ed symbol fraction used to purification MW on concentratio ionofIdenti?er by Blast of purify SDS- n of purified bufferHomolog recombinant PAGE gel proteinproteinsOuter Membrane Proteins16225006 P28635 YEAC Inclusion bodies His-Tag 18 kDa 5 mg/ml B26054702 P1592â) flgH inclusion bodies His-Tag 37 kDa 1.18 mg/ml B?CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/ 19575-59-llet71 16626 P26093 e(P4) Soluble fraction His-T 29 kDa 0.8 m ml A1.85 m 1 C29479681 P13036 lnclusions 23 kDa 2.36 mg/ml Bbodies0.5 m ml B---â as dryllet14640637 Soluble fraction HisâT 17 kDa 2.4 m l Ael ?ltration S100 HR Periplasmic/Secreted Protein3010032 P23847 dppA Inclusion bodies His-Tag llkDa 2.88 mg/ml B4721061 P36175 GCP Inclusion bodies His-Tag 38 kDa 2.8 mg/ml BOther Surface Proteins4821082 P08089 M inclusion bodies His-Tag 20 kDa 1.16 mg/ml Bprotein978477 L289l9 FBP54 Inclusion bodies SP- 44 kDa 2.56 mg/ml BSepharose0.3 mg/ml BInner Membrane Proteins26380318 P1 5933 fliG Inclusion bodies SP- 22 mg/ml Control Proteins with His-TagP00722 lacZ Soluble fraction His-Tag l 16 kDa 10 mg/ml Agel ?ltration S200 HR IppiB Soluble fraction His-Tag 21 kDa 4.4 mg/ml Agel ?ltration S100 HR |Buffercomposition5:A=|O mM Hepes pH 7.5, 150 mM NaCl, 0.1 mM EGTAB= 10 mM Tris pH 8Ø 150 mM NaCl. 0.5 % DOCC= 10 mM MOPS pH 6.5, 300 mM NaCl. 0.1 EGTA1 I I 1 l?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-70-IV. Analysis of H. pylori proteins as Vaccine candidatesTo investigate the immunomodulatory effect of H. pylori proteins, a mouse/H.pylori model was used. This model mimics the human H. pylori infection in manyrespects. The focus is on the effect of oral immunization in H. pylori infected animalsin order to test the concept of therapeutic oral immunotherapy.AnimalsFemale SPF BALB/c mice were purchased from Bomholt Breeding center(Denmark). They were kept in ordinary makrolon cages with free supply of water andfood. The animals were 4-6 weeks old at arrival.InfectionAfter a minimum of one week of acclimatization. the animals were infected witha type 2 strain (VacA negative) of H. pylori (strain 244. originally isolated from an ulcerpatient). In our hands, this strain has earlier proven to be a good colonizer of the mousestomach. The bacteria were grown overnight in Brucella broth supplemented with 10 %fetal calf serum, at 37°C in a microaerophilic atmosphere (10% CO2, 5%O2). Theanimals were given an oral dose of omeprazole (400 umol/kg) and 3-5 h after this anoral inoculation of H. pylori in broth (approximately 103 cfu/animal). Positive take ofthe infection was checked in some animals 2-3 weeks after the inoculation.AntigensRecombinant H. pylori antigens were chosen based on their association withexternally exposed H. pylori cell membrane. These antigens were selected from thefollowing groups: (1.) Outer Membrane Proteins; (2.) Periplastic/Secreted proteins; (3.)Outer Surface proteins; and (4.) Inner Membrane proteins. All recombinant proteinswere constructed with a hexa-HIS tag for purification reasons and the nonâHelicobacterpylori control protein (b-galactosidase from E. coli; LacZ), was constructed in the sameway.All antigens were given in a soluble fonn, i.e. dissolved in either a HEPES bufferor in a buffer containing 0.5% Deoxycholate (DOC).The antigens are listed in Table 5 below.Table 5Helicobacter pvlori proteinsOuter membrane ProteinsProtein 71 16626Protein 4721061?10152025303540CA 02265523 l999-03- 16WO 98/18323_ 71 -Protein 16225006Protein 29479681Protein 14640637Periplasmic/Secreted ProteinsProtein 30100332Other cell envelope proteinsProtein 4821082Flagella-associated proteinsProtein 26380318Control proteinsb-galactosidase (LacZ)ImmunizationsTen animals in each group were immunized 4 times over a 34 day period (day 1,PCT/U S97/ 1957515, 25 and 35). Puri?ed antigens in solution or suspension were given at a dose of 100mg/mouse. As an adjuvant, the animals were also given 10 pg/mouse of Cholera toxin(CT) with each immunization. Omeprazole (400 mmol/kg) was given orally to theanimals 3-5 h prior to immunization as a way of protecting the antigens from aciddegradation. Infected control animals received HEPES buffer + CT or DOC buffer +CT. Animals were sacrificed 2-4 weeks after ?nal immunization. A general outline ofthe study is shown in Table 6 below.Table 6Study outline, therapeutic immunization:Mice were all infected with H. pylori strain Ah244 at day 30.Substance Mouse strainn_= 101. Controls, PBS Balb/c2. Cholera toxin, 10 pg Balb/c3. Protein 16225006, 100 pg + CT 10 pg Balb/c4. Protein 26054702, 100 pg + CT 10 pg Balb/cDose/mouse0.3 ml0.3 ml0.3 ml().3 mlDates fordosing0, 14, 24, 340, 14, 24, 340, 14, 24, 340, 14, 24, 34?101520253035CA 02265523 l999-03- 16W0 98/18323 PCT/US97/19575_ 72 _5. Protein 26380318, 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24, 346. Protein 29479681, 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24, 347. Protein 30100332, 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24, 348. Protein 4721061. 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24, 349. Protein 4821082. 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24,3410. Protein 7116626. 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24, 34l1.Protein 14640637, 100 pg + CT 10 pg Balb/c 0.3 ml 0, 14, 24, 34Analysis of infectionMucosal infection: The mice were sacrificed by C02 and cervical dislocation.The abdomen was opened and the stomach removed. After cutting the stomach alongthe greater curvature, it was rinsed in saline. The mucosa from the antrum and corpus ofan area of 25mm2 was scraped separately with a surgical scalpel. The mucosa scrapingwas suspended in Brucella broth and plated onto Blood Skirrow selective plates. Theplates were incubated under microaerophilic conditions for 3-5 days and the number ofcolonies was counted. The identity of H. pylori was ascertained by urease and catalasetest and by direct microscopy or Gram staining.The urease test was performed essentially as follows. The reagent, Urea AgarBase Concentrate. was purchased from DIFCO Laboratories. Detroit, MI (Catalog #0284-61-3). Urea agar base concentrate was diluted 1:10 with water. 1 ml of if thediluted concentrate was mixed with 100-200 ml of actively growing H. pylori cells.Color change to magenta indicated that cells were urease positive.The catalase test was performed essentially as follows. The reagent, N,N,N',N'-Tetramethyl-p-Phenylenediamine, was purchased from Sigma, St. Louis. MO (Catalog #T3134). A solution of the regent (1% w/v in water) was prepared. H. pylori cells wereswabbed onto Whatman ?lter paper and overlaid with the 1% solution. Color change todark blue indicated that the cells were catalase positive.Serum antibodies: From all mice serum was prepared from blood drawn by heartpuncture. Serum antibodies were identified by regular ELISA techniques, where thespeci?c antigens of Helicobacter pylori were plated.Mucosal antibodies: Gentle scrapings of a defined part of the corpus and of 4 cmof duodenum were performed in 50% of the mice in order to detect the presence of?101520253035WO 98/18323CA 02265523 1999-03-16PCT/US97/19575_ 73 _antibodies in the mucous. The antibody titers were determined by regular ELISAtechnique as for serum antibodies.Statistical analysis: Wilcoxon-MannâWhitney sign rank test was used fordetermination of signi?cant effects of the antigens on Helicobacter pylori colonization.P<0.05 was considered signi?cant. Because the antrum is the major colonization site forHelicobacter most emphasis was put upon changes in the antral colonization.ResultsAntibodies in sera: All antigens tested given together with CT gave rise to ameasurable speci?c titer in serum. The highest responses were seen with Protein7116626, Protein 4721061, Protein 26380318, Protein 14640637 and Protein 4821082(see Figure 1).Antibodies in mucus: In the mucus scrapings, specific antibodies against allantigens tested were seen. By far the strongest response was seen with Protein30100332, followed by Protein 14640637, and Protein 26380318 (see Figure 2).Therapeutic immunization effects:All control animals (BALB/c mice) were well colonized with H. pylori (strainAH244) in both antrum and corpus of the stomach. Of the antigens tested 3 proteins(Protein 4721061 , Protein 4821082, and Protein 14640637) gave a good and signi?cantreduction and/or eradication of the H. pylori infection. The degree of colonization of theantrum was lower following immunization with Protein 7116626 and Protein 26380318compared to control. The effect of Proteins 16225006, 29479681, and 30100332 did notdiffer from control. The control protein lacZ, i.e. the non-H. pylori protein, had noeradication effect and in fact had higher Helicobacter colonization compared to theHEPES + CT control. All data are shown in Figures 3 and 4 for proteins dissolved inHEPES and DOC respectively. Data is shown as geometric mean values. n=8-10WilcoxonâMann-Whitney sign rank test * = p<0.05; x/10 = number of mice showingeradication of H. pylori over the total number of mice examined.The data presented indicate that all of the H. pylori associated proteins includedin this study, when used as oral immunogens in conjunction with the oral adjuvant CT,resulted in stimulation of an immune response as measured by specific serum andmucosal antibodies. A majority of the proteins led to a reduction, and in some casescomplete clearance of the colonization of H. pylori in this animal model. It should benoted that the reduction or clearance was due to heterologous protection rather thanhomologous protection (the polypeptides were based on the H. pylori J99 strain?101520253035CA 02265523 l999-03- 16WO 98/18323 PCT/US97/19575-74-sequence and used in the therapeutic immunization studies against a different (AH244)challenge strain. indicating the vaccine potential against a wide variety of H. pyloristrains.The highest colonization in the antrum was seen in animals treated with the non-Helicobacter protein LacZ, indicating that the effects seen with the Helicobacter pyloriantigens were speci?c.Taken together these data strongly support the use of these H. pylori proteins in apharmaceutical formulation for the use in humans to treat and/or prevent H. pyloriinfections.V. Sequence Variance Analysis of genes in Helicobacter pylori strainsFour genes were cloned and sequenced from several strains of H. pylori tocompare the DNA and deduced amino acid sequences. This information was used todetermine the sequence variation between the H. pylori strain, J99, and other H. pyloristrains isolated from human patients.Preparation of Chromosomal DNA.Cultures of H. pylori strains (as listed in Table 9) were grown in BLBB (1%Tryptone, 1% Peptamin 0.1% Glucose, 0.2% Yeast Extract 0.5% Sodium Chloride, 5%Fetal Bovine Serum) to an OD6o0 of 0.2. Cells were centrifuged in a Sorvall RC-3B at3500 x g at 4°C for 15 minutes and the pellet resuspended in 0.95 mls of 10 mM Tris-HCl, 0.1 mM EDTA (TE). Lysozyme was added to a ?nal concentration of lmg/mlalong with, SDS to 1% and RNAse A + T1 to 0.5mg/ml and 5 units/ml respectively, andincubated at 37°C for one hour. Proteinase K was then added to a final concentration of0.4mg/ml and the sample was incubated at 55 C for more than one hour. NaCl wasadded to the sample to a concentration of 0.65 M, mixed carefully, and 0.15 ml of 10%CTAB in 0.7M NaCL (?nal is 1% CTAB/70mM NaCL) was added followed byincubation at 65°C for 20 minutes. At this point, the samples were extracted withchloroform:isoamyl alcohol. extracted with phenol, and extracted again withchloroformtisoamyl alcohol. DNA was precipitated with either EtOH (1.5 x volumes) orisopropanol (0.6 x volumes) at -70i"C for 10minutes, washed in 70% EtOH andresuspended in TE.PCR Ampli?cation and cloning.Genomic DNA prepared from twelve strains of Helicobacter pylori was used asthe source of template DNA for PCR ampli?cation reactions (Current Protocols inMolecular Biology, John Wiley and Sons, Inc.. F. Ausubel et al., editors, 1994). To?1015CA 02265523 l999-03- 16WO 98118323 PCT/U S97/ 19575-75-amplify a DNA sequence containing an H. pylori ORF, genomic DNA (10 nanograms)was introduced into a reaction vial containing 2 mM MgCl2, l micromolar syntheticoligonucleotide primers (forward and reverse primers. see Table 7) complementary toand ?anking a de?ned H. pylori ORF, 0.2 mM of each deoxynucleotide triphosphate;dATP, dGTP, dCTP, dTTP and 0.5 units of heat stable DNA polymerase (Amplitaq,Roche Molecular Systems, Inc., Branchburg, NJ, USA) in a ?nal Volume of 20microliters in duplicate reactions.Table 7Oligonucleotide primers used for PCR ampli?cation of H. pylori DNA sequences.The following thermal cycling conditions were used to obtain amplified DNAproducts for each ORF using a Perkin Elmer Cetus/ GeneAmp PCR System 9600thermal cycler:Outer membrane Forward primer 5â to 3â Reverse Primer 5â to 3âProteinsProtein 26054702 (for 5'- 5'-strains AH4, AH15, TTAACCATGGTGAAA TAGAATTCGCCTCTAAH6l, 5294, 5640, AGCGATAâ3â (SEQ ID AAACTTTAG-3' (SEQAH18, and AH244) NO:169) ID NO:170)Protein 26054702 5'- 5'-(for strains AH5, 5155, TTAACCATGGTGAAA TAGAATTCGCATAAC7958, AH24,and J99) AGCGATA-3' (SEQ ID GATCAATC-3' (SEQ IDNO:l7l) NO:l72)Protein 7116626 5'- 5'-ATATCCATGGTGAGT ATGAATTCAATTTTTTTGATGA-3' (SEQ ID TATTTTGCCA-3' (SEQNO:173) ID NO:l74)Protein 29479681 5'- 5'-AATTCCATGGCTATC ATGAATTCGCCAAAACAAATCCG-3' (SEQ ID TCGTAGTATT-3' (SEQNO:l75) ID NO:176)Protein 346 5'- 5'-GATACCATGGAATTT TGAATTCGAAAAAGTATGAAAAAG-3' (SEQ GTAGTTATAC-3' (SEQID NO:177) ID NO:178)?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/ 19575-76-Protein 7116626 and Protein 346;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec, 30°C for 15 sec and 72°C for 1.5 min23 cycles at 94°C for 15 sec, 55°C for 15 sec and 72°C for 1.5 minReactions were concluded at 72°C for 6 minutes.Protein 26054702 for strains AH5. 5155, 7958, AH24,and J99;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec, 30°C for 15 sec and 72°C for 1.5 min25 cycles at 94°C for 15 sec, 55°C for 15 sec and 72°C for 1.5 minReaction was concluded at 72°C for 6 minutes.Protein 26054702 and Protein 294796813 for strains AH4, AH15, AH61, 5294, 5640,AH18, and Hp244 ;Denaturation at 94°C for 2 min,2 cycles at 94°C for 15 sec, 30°C for 20 sec and 72°C for 2 min25 cycles at 94°C for 15 sec, 55°C for 20 sec and 72°C for 2 minReactions were concluded at 72°C for 8 minutes.Upon completion of thermal cycling reactions, each pair of samples werecombined and used directly for cloning into the pCR cloning vector as described below.Cloning of H. pylori DNA sequences into the pCR TA cloning vector.All amplified inserts were cloned into the pCR 2.1 vector by the methoddescribed in the Original TA cloning kit (Invitrogen, San Diego, CA). Products of theligation reaction were then used to transform the TOPIOFâ (INVaFâ in the case of H.pylori sequence 350) strain of E. coli as described below.Transformation of competent bacteria with recombinant plasmidsCompetent bacteria, E coli strain TOPIOFâ or E. coli strain INVaFâ weretransformed with recombinant pCR expression plasmids carrying the cloned H. pylorisequences according to standard methods (Current Protocols in Molecular Biology, JohnWiley and Sons, lnc., F. Ausubel et al., editors, 1994). Brie?y, 2 microliters of 0.5micromolar BME was added to each vial of 50 microliters of competent cells.Subsequently, 2 microliters of ligation reaction was mixed with the competent cells andincubated on ice for 30 minutes. The cells and ligation mixture were then subjected to a?101520 98/18323CA 02265523 l999-03- 16PCT/US97/19575-77-âheat shockâ at 42°C for 30 seconds, and were subsequently placed on ice for anadditional 2 minutes, after which, samples were incubated in 0.45 milliliters SOCmedium (0.5% yeast extract, 2.0 % tryptone. 10 mM NaCl, 2.5 mM KC], 10 mMMgCl2, 10 mM MgSO4 and 20, mM glucose) at 37°C with shaking for 1 hour. Sampleswere then spread on LB agar plates containing 25 microgram/ml kanamycin sulfate or100 micrograms/ml ampicillan for growth overnight. Transformed colonies of TOPIOFâor INVaFâ were then picked and analyzed to evaluate cloned inserts as described below.Identi?cation of recombinant PCR plasmids carrying H. pylori sequencesIndividual TOPl0Fâ or INVaFâ clones transformed with recombinant pCR-H.py1ori ORFS were analyzed by PCR ampli?cation of the cloned inserts using the sameforward and reverse primers, specific for each H. pylori sequence, that were used in theoriginal PCR amplification cloning reactions. Successful ampli?cation verified theintegration of the H. pylori sequences in the cloning vector (Current Protocols inMolecular Biology, John Wiley and Sons, Inc.. F. Ausubel et al., editors, 1994).Individual clones of recombinant pCR vectors carrying properly cloned H. pyloriORFS were picked for sequence analysis. Sequence analysis was performed on ABISequencers using standard protocols (Perkin Elmer) using vector-speci?c primers (asfound in PCRII or pCR2. l , lnvitrogen, San Diego, CA) and sequencing primers specificto the ORF as listed in Table 8 below.?CA 02265523 l999-03- 16WO 98/18323 PCT/US97/19575- 73 _Table 8Oligonucleotide primers used for sequencing of H. pylori DNA sequences.Outer membrane Forward primers 5â to 3â Reverse Primers 5â to 3âProteinsProtein 26054702 5'- 5'-CCCTTCATTTTAGAAATC CTTTGGGTAAAAACGCAG-3' (sEQ ID NO:179) TC-3' (sEQ ID NO:186)5'- 5'-ATTTCAACCAATTCAAT CGATCTTTGATCCTAATTGCG-3' (sEQ ID NO: 1 so) CA-3' (SEQ ID NO: 1 37)5'- 5'-GCCCCTTTTGATTTGAAG ATCAAGTTGCCTATGCTCT-3' (SEQ ID NO: I 81) GA-3' (SEQ ID NQ:188)5'-TCGCTCCAAGATACCAAGAAGTâ3' (SEQ IDNO: 1 82)5'-CTTGAATTAGGGGCAAAGATCGâ3' (SEQ IDNO: I 83)5'-ATGCGTTTTTACCCAAAGAAGTâ3' (SEQ IDNO: 184)5'-ATAACGCCACTTCCTTATTGGT-3' (SEQ ID NO:I85)Protein 7116626 5'- S'-TTGAACACTTTTGATTAT GTCI I IAGCAAAAATGGGCGG-3' (SEQ ID NO: I 89) CGTC-3â (SEQ ID NO: I 91)5'- 5'-GGATTATGCGATTGTTTT AATGAGCGTAAGAGAGCACAAG-3' (SEQ ID CTTC-3' (SEQ ID NO: 192)NO: I 90)Protein 5'- 5'-29479531 CTTATGGGGGTATTGTC AGGTTGTTGCCTAAAGAA-3' (SEQ ID NOZI93) CT-3' (SEQ ID NO:195)5'- 5'-AGCATGTGGGTATCCAG CTGCCTCCACCTTTGATCC-3' (SEQ ID NO:l94) -3' (SEQ ID NOZI96)?101520W0 98/18323CA 02265523 l999-03- 16-79-PCT/U S97/ 19575Protein 3465'-ACCAATATCAATTGGCACT-3' (SEQ ID NO:197)5'-ACTTGGAAAAGCTCTGCA-3â (SEQ ID NO:198)5'-CTTGCTTGTCATATCTAGc-3' (SEQ ID NO: 199)5'-GTTGAAGTGTTGGTGCTA-3' (SEQ ID NO:200)5'-CAAGCAAGTGGTTTGGTTTTAGâ3' (SEQ ID NO:20l)5'-TGGAAAGAGCAAATCATTGAAG-3' (SEQ IDNO:202)5'-GCCCATAATCAAAAAGCCCAT-3' (SEQ ID NO:203)5'-CTAAAACCAAACCACTTocrTGTCâ3' (SEQ ID NO:204)Vector Primers5'-GTAAAACGACGGCCAGâ3' (SEQ ID NO:205)5'-CAGGAAACAGCTATGAC-3' (SEQ ID NO:206)ResultsTo establish the PCR error rate in these experiments, ?ve individual clones ofProtein 26054702, prepared from ?ve separate PCR reaction mixtures from H. pyloristrain J99, were sequenced over a total length of 897 nucleotides for a cumulative totalof 4485 bases of DNA sequence. DNA sequence for the ?ve clones was compared to aDNA sequence obtained previously by a different method, i.e., random shotgun cloningand sequencing. The PCR error rate for the experiments described herein wasdetermined to be 2 base changes out of 4485 bases, which is equivalent to an estimatederror rate of less than or equal to 0.04%.DNA sequence analysis was performed on four different open reading framesidenti?ed as genes and ampli?ed by PCR methods from a dozen different strains of thebacterium Helicobacter pylori. The deduced amino acid sequences of three of the fouropen reading frames that were selected for this study showed statistically signi?cantBLAST homology to de?ned proteins present in other bacterial species. Those ORF Sincluded: Protein 26054702, homologous to the val A & B genes encoding an ABCtransporter in F. novicida; Protein 71 16626, homologous to lipoprotein e (P4) present inthe outer membrane of H. in?uenzae; Protein 29479681, homologous to fecA, an outermembrane receptor in iron (III) dicitrate transport in E. coli. Protein 346 was identifiedas an unknown open reading frame, because it showed low homology with sequences inthe public databases.To assess the extent of conservation or variance in the ORFS across variousstrains of H. pylori. changes in DNA sequence and the deduced protein sequence werecompared to the DNA and deduced protein sequences found in the J99 strain of H.?101520CA 02265523 l999-03- 16WO 98/18323 PCT/US97/19575-80-pylori (see Table 9 below). Results are presented as percent identity to the J99 strain ofH. pylori sequenced by random shotgun cloning. To control for any variations in theJ99 sequence each of the four open reading frames were cloned and sequenced againfrom the J 99 bacterial strain and that sequence information was compared to thesequence information that had been collected from inserts cloned by random shotgunsequencing of the J99 strain. The data demonstrate that there is variation in the DNAsequence ranging from as little as 0.12 % difference (Protein 346, J99 strain) toapproximately 7% change (Protein 26054702. strain AH5). The deduced proteinsequences show either no variation ( Protein 346, strains AH18 and AH24) or up to asmuch as 7.66% amino acid changes (Protein 26054702. Strain AH5).Table 9Multiple Strain DNA Sequence analysis of H. pylori Vaccine CandidatesJ99 Protein #2 26054702 2054702 71 16626 7116626 2947968129479681 346 346Length of RegionSequenced: 248 a.a. 746 nt. 232 a.a. 96 nt. 182 a.a. 548 nt. 273 a.a. 819 nt.Strain TestedAA Nuc. AA Nuc. AA Nuc. AA Nuc.identity identity identity identity identity identity identity identityJ99 100.00% 100.00% 100.00% 100.00% 100.00% 100.00% 99.63% 99.88%AH244 95.16% 95.04% n.d. n.d. 99.09% 96.71% 98.90% 96.45%Al-14 95.97% 95.98% 97.84% 95.83% n.d. n.d. 97.80% 95.73%AH5 92.34% 93.03% 98.28% 96.12% 98.91% 96.90% 98.53% 95.73%AH 15 95.16% 94.91% 97.41% 95.98% 99.82% 97.99% 99.63% 96.09%AH61 n.d. n.d. 97.84% 95.98% 99.27% 97.44% n.d. n.d.5155 n.d. n.d. n.d. n.d. 99.4 % 97.08% 98.53% 95.60%5294 94.35% 94.37% 98.28% 95.40% 99.64% 97.26% 97.07% 95.48%7958 ?4.35% 94.10% 97.84% 95.40% n.d. n.d. 99.63% 96.46%5640 95.16% 94.37% 97.41% 95.69% 99.09% 97.63% 98.53% 95.48%AH 1 8 n.d. n.d. 98.71% 95.69% 99.64% 97.44% 100.00% 95.97%AH24 94.75% 95.04% 97.84% 95.40% 99.27% 96.71% 100.00% 96.46%n.d.= not done.?101520253035CA 02265523 l999-03- 16WO 98/18323 PCTIU S97/ 19575-31-VI. Experimental Knock-Out Protocol for the Determination of Essential H. QyloriGenes as Potential Therapeutic TargetsTherapeutic targets are chosen from genes whose protein products appear to playkey roles in essential cell pathways such as cell envelope synthesis, DNA synthesis,transcription, translation, regulation and colonization/virulence.The protocol for the deletion of portions of H. pylori genes/ORFS and theinsertional mutagenesis of a kanamycin-resistance cassette in order to identify geneswhich are essential to the cell is modified from previously published methods (Labigne-Roussel et al., 1988, J. Bacteriology I70, pp. 1704-1708; Cover et a1.,1994, J. BiologicalChemistry 269, pp. 10566-10573; Reyrat et al., 1995, Proc. Natl. Acad. Sci. 92, pp8768-8772). The result is a gene "knock-out."Identi?cation and Cloning of H. pylori Gene SequencesThe sequences of the genes or ORFs (open reading frames) selected as knock-outtargets are identi?ed from the H. pylori genomic sequence and used to design primers tospeci?cally amplify the genes/ORFS. All synthetic oligonucleotide primers are designedwith the aid of the OLIGO program (National Biosciences, Inc, Plymouth, MN 55447,USA), and can be purchased from Gibco/BRL Life Technologies (Gaithersburg, MD,USA). If the ORF is smaller than 800 to 1000 base pairs, ?anking primers are chosenoutside of the open reading frame.Genomic DNA prepared from the Helicobacter pylori HpJ99 strain (ATCC5&2; deposited by Genome Therapeutics Corporation. 100 Beaver Street, Waltham,MA 02154) is used as the source of template DNA for amplification of the ORFS byPCR (polymerase chain reaction) (Current Protocols in Molecular Biology, John Wileyand Sons, Inc., F. Ausubel et al.. editors, 1994). For the preparation of genomic DNAfrom H. pylori, see Example 1. PCR amplification is carried out by introducing 10nanograms of genomic HpJ99 DNA into a reaction vial containing 10 mM Tris pH 8.3,50 mM KCl, 2 mM MgCl2, 2 microMolar synthetic oligonucleotide primers(forward=Fl and reverse=Rl), 0.2 mM of each deoxynucleotide triphosphate(dATP,dGTP, dCTP. dTTP), and 1.25 units of heat stable DNA polymerase (Amplitaq,Roche Molecular Systems, lnc.. Branchburg, NJ. USA) in a ?nal volume of 40microliters. The PCR is carried out with Perkin Elmer Cetus/GeneAmp PCR System9600 thermal cyclers.Upon completion of thermal cycling reactions, each sample of ampli?ed DNA isvisualized on a 2% TAE agarose gel stained with Ethidium Bromide (Current Protocolsin Molecular Biology, John Wiley and Sons, Inc.. F. Ausubel et al., editors, 1994) to?101520253035CA 02265523 l999-03- 16W0 98/18323 PCT/U S97/ 19575-32-determine that a single product of the expected size had resulted from the reaction.Ampli?ed DNA is then washed and puri?ed using the Qiaquick Spin PCR puri?cationkit (Qiagen, Gaithersburg, MD, USA).PCR products are cloned into the pT7Blue T-Vector(catalog#69820-1, NovagenInc., Madison, WI. USA) using the TA cloning strategy (Current Protocols in MolecularBiology, John Wiley and Sons. lnc., F. Ausubel et al., editors, 1994). The ligation ofthePCR product into the vector is accomplished by mixing a 6 fold molar excess of thePCR product, 10 ng of pT7Blue-T vector (Novagen), l microliter of T4 DNA LigaseBuffer (New England Biolabs, Beverly, MA. USA), and 200 units of T4 DNA Ligase(New England Biolabs) into a ?nal reaction volume of 10 microliters. Ligation is5allowed to proceed for 16 hours at 16°C.Ligation products are electroporated (Current Protocols in Molecular Biology,John Wiley and Sons, lnc.. F. Ausubel et al.. editors, 1994) into electroporation-competent XL-1 Blue or DH5âa E. coli cells (Clontech Lab., Inc. Palo Alto, CA, USA).Brie?y, 1 microliter of ligation reaction is mixed with 40 microliters ofelectrocompetent cells and subjected to a high voltage pulse (25 microFarads, 2.5 kV,200 ohms) after which the samples are incubated in 0.45 ml SOC medium (0.5% yeastextract, 2% tryptone, 10 mM NaCl. 2.5 mM KCl. 10 mM MgCl2, 10 mM MgSO4 and 20mM glucose) at 37°C with shaking for 1 hour. Samples are then spread onto LB (10 g/lbacto tryptone, 5 g/l bacto yeast extract, 10 g/l sodium chloride) plates containing 100microgram/ml of Ampicillin. 0.3% X-gal, and 100 microgram/ml IPTG. These platesare incubated overnight at 37°C. Ampicillin-resistant colonies with white color areselected, grown in 5 ml of liquid LB containing 100 microgram/ml of Ampicillin. andplasmid DNA is isolated using the Qiagen miniprep protocol (Qiagen, Gaithersburg,MD, USA).To verify that the correct H. pylori DNA inserts had been cloned, these pT7Blueplasmid DNAs are used as templates for PCR ampli?cation of the cloned inserts, usingthe same forward and reverse primers used for the initial ampli?cation of the J99H. pylori sequence. Recognition of the primers and a PCR product of the correct size asvisualized on a 2% TAE, ethidium bromide stained agarose gel are con?rmation that thecorrect inserts had been cloned. Two to six such veri?ed clones are obtained for eachknock-out target, and frozen at -70°C for storage. To minimize errors due to PCR,plasmid DNA from these veri?ed clones are pooled, and used in subsequent cloningsteps.The sequences of the genes/ORFS are again used to design a second pair ofprimers which ?ank the region of H. pylori DNA to be either interrupted or deleted (upto 250 basepairs) within the ORFS but are oriented away from each other. The pool of?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCTIU S97/ 19575-83-circular plasmid DNAs of the previously isolated clones are used as templates for thisround of PCR. Since the orientation of ampli?cation of this pair of deletion primers isaway from each other, the portion of the ORF between the primers is not included in theresultant PCR product. The PCR product is a linear piece of DNA with H. pylori DNAat each end and the pT7Blue vector backbone between them which, in essence, resultesin the deletion of a portion of the ORF s. The PCR product is visualized on a 1% TAE,ethidium bromide stained agarose gel to con?rm that only a single product of the correctsize has been ampli?ed.A Kanamycin-resistance cassette (Labigne-Roussel et al., 1988 J. Bacteriology170, 1704-1708) is ligated to this PCR product by the TA cloning method usedpreviously (Current Protocols in Molecular Biology, John Wiley and Sons, lnc., F.Ausubel et al.. editors, 1994). The Kanamycin cassette containing a Campylobacterkanamycin resistance gene is obtained by carrying out an EcoRI digestion of therecombinant plasmid pCTB8:kan (Cover et al.,l994, J . Biological Chemistry 269, pp.10566-10573). The proper fragment (1.4 kb) is isolated on a 1% TAE gel, and isolatedusing the QIAquick gel extraction kit (Qiagen, Gaithersburg, MD. USA). The fragmentis end repaired using the Klenow ?ll-in protocol, which involved mixing 4ug of theDNA fragment, 1 microliter of dATP,dGTP, dCTP, dTTP at 0.5 mM_, 2 microliter ofKlenow Buffer (New England Biolabs) and 5 units of Klenow DNA Polymerase 1 Large(Klenow) Fragment (New England Biolabs) into a 20 microliter reaction. incubating at30°C for 15 min, and inactivating the enzyme by heating to 75°C for 10 minutes. Thisblunt-ended Kanamycin cassette is then puri?ed through a Qiaquick column (Qiagen,Gaithersburg, MD, USA) to eliminate nucleotides. The "T" overhang is then generatedby mixing 5 micrograms of the blunt-ended kanamycin cassette. 10 mM Tris pH 8.3. 50mM KCl, 2 mM MgCl2, 5 units of DNA Polymerase (Amplitaq, Roche MolecularSystems, lnc., Branchburg, NJ, USA), 20 microliters of 5 mM dTTP, in a 100 microliterreaction and incubating the reaction for 2 hours at 37°C. The "KanâT" cassette ispuri?ed using a QIAquick column (Qiagen. Gaithersburg, MD. USA). The PCRproduct of the deletion primers (F2 and R2) is ligated to the KanâT cassette by mixing10 to 25 ng of deletion primer PCR product. 50 - 75 ng KanâT cassette DNA, 1microliter 10x T4 DNA Ligase reaction mixture, 0.5 microliter T4 DNA Ligase (NewEngland Biolabs, Beverly, MA, USA) in a 10 microliter reaction and incubating for 16hours at 16°C.The ligation products are transfomied into XL-1 Blue or DH5-a E. coli cells byelectroporation as described previously. After recovery in SOC, cells are plated onto LBplates containing 100 microgram/ml Ampicillin and grown overnight at 37°C. Theseplates are then replica plated onto plates containing 25 microgram/ml Kanamycin and?1015203035CA 02265523 l999-03- 16W0 98/ 18323 PCT/U S97/ 19575-84-allowed to grow overnight. Resultant colonies have both the Ampicillin resistance genepresent in the pT7Blue vector, and the newly introduced Kanamycin resistance gene.Colonies are picked into LB containing 25 microgram/ml Kanamycin and plasmid DNAis isolated from the cultured cells using the Qiagen miniprep protocol (Qiagen,Gaithersburg, MD. USA).Several tests by PCR ampli?cation are conducted on these plasmids to verify thatthe Kanamycin is inserted in the H. pylori gene/ORF, and to determine the orientation ofthe insertion of the Kanamycin-resistance gene relative to the H. pylori gene/ORF. Toverify that the Kanamycin cassette is inserted into the H. pylori sequence. the plasmidDNAs are used as templates for PCR amplification with the set of primers originallyused to clone the H. pylori gene/ORFs. The correct PCR product is the size of thedeleted gene/ORF but increased in size by the addition of a 1.4 kilobase Kanamycincassette. To avoid potential polar effects of the kanamycin resistance cassette on H.pylori gene expression, the orientation of the Kanamycin resistance gene with respect tothe knock-out gene/ORF is detennined and both orientations are eventually used in H.pylori transformations (see below). To determine the orientation of insertion of thekanamycin resistance gene, primers are designed from the ends of the kanamycinresistance gene ("Kan-1" 5'-ATCTTACCTATCACCTCAAAT-3' (SEQ ID NO:207)),and "Kan-2" 5'-AGACAGCAACATCTTTGTGAA-3' (SEQ ID NO:208)). By usingeach of the cloning primers in conjunction with each of the Kan primers (4 combinationsof primers), the orientation of the Kanamycin cassette relative to the H. pylori sequenceis determined. Positive clones are classi?ed as either in the "A" orientation (the samedirection of transcription is present for both the H. pylori gene and the Kanamycinresistance gene), or in the "B" orientation (the direction of transcription for the H. pylorigene is opposite to that of the Kanamycin resistance gene). Clones which share thesame orientation (A or B) are pooled for subsequent experiments and independentlytransformed into H. pylori.Transformation of Plasmid DNA into H. pylori cellsTwo strains of H. pylori are used for transfonnation: ATCC L51, the clinicalisolate which provided the DNA from which the H pylori sequence database isobtained. and AH244, an isolate which had been passaged in. and has the ability tocolonize the mouse stomach. Cells for transformation are grown at 37°C, 10% C02,100% humidity, either on Sheep-Blood agar plates or in Brucella Broth liquid. Cells aregrown to exponential phase, and examined microscopically to determine that the cellsare "healthy" (actively moving cells) and not contaminated. If grown on plates, cells areharvested by scraping cells from the plate with a sterile loop, suspended in 1 ml of?101520253035CA 02265523 l999-03- 16WO 98/18323 PCT/US97/19575-85-Brucella Broth, spun down (1 minute, top speed in eppendorf microfuge) andresuspended in 200 microliters Brucella Broth. If grown in Brucella Broth liquid, cellsare centrifuged (15 minutes at 3000 rpm in a Beckman T] 6 centrifuge) and the cell pelletresuspended in 200 microliters of Brucella broth. An aliquot of cells is taken todetermine the optical density at 600 nm, in order to calculate the concentration of cells.An aliquot (1 to 5 OD600 units/25 microliter) of the resuspended cells is placed onto aprewarmed Sheep-Blood agar plate. and the plate is further incubated at 37°C, 6% C02,100% humidity for 4 hours. After this incubation, 10 microliters of plasmid DNA (100micrograms per microliter) is spotted onto these cells. A positive control (plasmid DNAwith the ribonuclease H gene disrupted by kanamycin resistance gene) and a negativecontrol (no plasmid DNA) are done in parallel. The plates are returned to 37°C, 6% CO2for an additional 4 hours of incubation. Cells are then spread onto that plate using aswab wetted in Brucella broth, and grown for 20 hours at 37°C. 6% CO2. Cells are thentransferred to a Sheep-Blood agar plate containing 25 micrograms/ml Kanamycin, andallowed to grow for 3 to 5 days at 37°C, 6% C02, 100% humidity. If colonies appear,they are picked and regrown as patches on a fresh Sheep-Blood agar plate containing 25micrograms/ml Kanamycin.Three sets of PCR tests are done to verify that the colonies of transforrnants havearisen from homologous recombination at the proper chromosomal location. Thetemplate for PCR (DNA from the colony) is obtained by a rapid boiling DNApreparation method as follows. An aliquot of the colony (stab of the colony with atoothpick) is introduced into 100 microliters of 1% Triton X-100. 20 mM Tris, pH 8.5,and boiled for 6 minutes. An equal volume of phenol 2 chloroform (1:1) is added andvortexed. The mixture is microfuged for 5 minutes and the supernatant is used as DNAtemplate for PCR with combinations of the following primers to verify homologousrecombination at the proper chromosomal location.TEST 1. PCR with cloning primers originally used to amplify the gene/ORF. Apositive result of homologous recombination at the correct chromosomal location shouldshow a single PCR product whose size is expected to be the size of the deletedgene/ORF but increased in size by the addition ofa 1.4 kilobase Kanamycin cassette. APCR product of just the size of the gene/ORF is proof that the gene had not beenknocked out and that the transformant is not the result of homologous recombination atthe correct chromosome location.TEST 2. PCR with F3 (primer designed from sequences upstream of thegene/ORF and not present on the plasmid), and either primer Kan-1 or Kan-2 (primersdesigned from the ends of the kanamycin resistance gene). depending on whether theplasmid DNA used was of "A" or "B" orientation. Homologous recombination at the?101520253035CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/ 19575-85-correct chromosomal location will result in a single PCR product of the expected size(i.e., from the location of F3 to the insertion site of kanamycin resistance gene). NoPCR product or PCR product(s) of incorrect size(s) will prove that the plasmid had notintegrated at the correct site and that the gene had not been knocked out.TEST 3. PCR with R3 (primer designed from sequences downstream of thegene/ORF and not present on the plasmid) and either primer Kan-1 or Kan-2, dependingon whether the plasmid DNA used was of "A" or "B" orientation. Homologousrecombination at the correct chromosomal location will result in a single PCR product ofthe expected size (i.e., from the insertion site of kanamycin resistance gene to thedownstream location of R3). Again, no PCR product or PCR product(s) of incorrectsize(s) will prove that the plasmid had not integrated at the correct site and that the genehad not been knocked out.Transformants showing positive results for all three tests above indicate that thegene is not essential for survival in vitro.A negative result in any of the three above tests for each transformant indicatesthat the gene had not been disrupted. and that the gene is essential for survival in vitro.In the event that no colonies result from two independent transformations whilethe positive control with the disrupted ribonuclease H plasmid DNA producestransformants, the plasmid DNA is further analyzed by PCR on DNA from transformantpopulations prior to plating for colony formation. This will verify that the plasmid canenter the cells and undergo homologous recombination at the correct site. Brie?y,plasmid DNA is incubated according to the transformation protocol described above.DNA is extracted from the H. pylori cells immediately after incubation with the plasmidDNAs and the DNA is used as template for the above TEST 2 and TEST 3. Positiveresults in TEST 2 and TEST 3 would verify that the plasmid DNA could enter the cellsand undergo homologous recombination at the correct chromosomal location. If TEST2 and TEST 3 are positive, then failure to obtain viable transfonnants indicates that thegene is essential, and cells suffering a disruption in that gene are incapable of colonyformationVII. High-throughput drug screen assayCloning, expression and protein puri?cationCloning, transformation, expression and puri?cation of the H. pylori target geneand its protein product,e.g., an H. pylori enzyme, to be used in a high-throughput drugscreen assay, is carried out essentially as described in Examples 11 and III above.Development and application of a screening assay for a particular H pylori geneproduct, peptidylâpropyl cisâtrans isomerase. is described below as a specific example.?1015202530CA 02265523 l999-03- 16W0 98/ 18323 PCT/US97/19575-37-Enzymatic AssayThe assay is essentially as described by Fisher (Fischer, G., et.al. (1984) Biomed.Biochim. Acta 43:1 101-1 1 1 1). The assay measures the cis-trans isomerization of theAla-Pro bond in the test peptide N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (Sigma # S-73 88, lot # 84H5805). The assay is coupled with ot-chymotrypsin, where the ability ofthe protease to cleave the test peptide occurs only when the Ala-Pro bond is in trans.The conversion of the test peptide to the trans isomer in the assay is followed at 390 nmon a Beckman Model DU-650 spectophotometer. The data are collected every secondwith an average scanning of time of 0.5 second. Assays are carried out in 35 mMHepes, pH 8.0, in a ?nal volume of 400 ul, with 10 uM oi-chymotrypsin (type 1-5 frombovine Pancreas, Sigma # C-7762, lot 23H7020) and 10 nM PPlase. To initiate thereaction. 10 pl of the substrate ( 2 mM N-Succinyl-A1aâAla-Pro-Phe-p-nitroanilide inDMSO) is added to 390 pl of reaction mixture at room temperature.Enzymatic assay in crude bacterial extract.A 50 ml culture of Helicobacter pylori (strain J99) in Brucella broth is harvestedat mid-log phase (OD 600 nm ~ 1) and resuspended in lysis buffer with the followingprotease inhibitors: 1 mM PMSF. and 10 pg/ml of each of aprotinin, leupeptin,pepstatine. TLCK, TPCK, and soybean trypsin inhibitor. The suspension is subjected to3 cycles of freezeâthaw (15 minutes at -70 0 C, then 30 minutes at room temperature),followed by sonication (three 20 second bursts). The lysate is centrifuged (12,000 g x30 minutes) and the supernatant is assayed for enzymatic activity as described above.Many H. pylori enzymes can be expressed at high levels and in an active form inE. coli. Such high yields of purified proteins provide for the design of various highthroughput drug screening assays.EQUIVALENTSThose skilled in the art will recognize. or be able to ascertain using no more thanroutine experimentation, many equivalents to the specific embodiments and methodsdescribed herein. Such equivalents are intended to be encompassed by the scope of thefollowing claims. 8?10152025303540455055CA 02265523 1999-03-16W0 98/ 18323 PCT/US97/19575-33-SEQUENCE LISTING1) GENERAL INFORMATION:(i) APPLICANT:(A) NAME: Astra Aktiebolag(B) STREET: S~15l 85(C) CITY: Sodertalje(D) STATE:(E) COUNTRY: Sweden(F) POSTAL CODE (ZIP)(ii) TITLE OF INVENTION: NUCLEIC ACID AND AMINO ACID SEQUENCESRELATING TO HELICOBACTER PYLORI ANDVACCINE COMPOSITIONS THEREOF(iii) NUMBER OF SEQUENCES: 208(iv) COMPUTER READABLE FORM:(A) MEDIUM TYPE:(B) COMPUTER:(C) OPERATING SYSTEM:(D) SOFTWARE:(V) CURRENT APPLICATION DATA:(A) APPLICATION NUMBER(B) FILING DATE:(Vi) PRIOR APPLICATION DATA:(A) APPLICATION NUMBER:US O8/739,150(B) FILING DATE: 28-OCT-1996(Vii) PRIOR APPLICATION DATA:(A) APPLICATION NUMBER: US 08/759,739(B) FILING DATE: O6âDEC-1996(viii) PRIOR APPLICATION DATA:(A) APPLICATION NUMBER: US 08/891,928(B) FILING DATE: 14-JULYâl997(ix) CORRESPONDENCE ADDRESS:(A) ADDRESSEE: LAHIVE & COCKFIELD(B) STREET: 28 State Street(C) CITY: Boston(D) STATE: Massachusetts(E) COUNTRY: USA(F) ZIP: 02109-1875(x) ATTORNEY/AGENT INFORMATION:(A) NAME: Mandragouras, Amy E.(B) REGISTRATION NUMBER: 36,207(C) REFERENCE/DOCKET NUMBER: GTNâOOlCPl0PC?101525303540455055W0 98/18323(xi)(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGATTAAAAGTGAATGGGTAATTACTCTGGTAGGCTTTGACTTCAGGGAATTGTCAATCGCCGGAAACAAATTTAGGCGCCTATGGTTAGATTATGTCT(2)(i)(ii)(iii)(iv)(vi)(A)(B)TELEPHONE:TELEFAX:CA-89-TELECOMMUNICATION INFORMATION:(617)227-7400(617)742-4214INFORMATION FOR SEQ ID NO:l:SEQUENCE CHARACTERISTICS:(A) LENGTH: 561 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(A)FEATURE:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B) LOCATION l...56lSEQUENCE DESCRIPTION:GAATTGCTTGTTTTCATGGGATTGGCGTCACCAATAAATGCTGAACACACTCATTCCTTTCTTGGATGTTGAAGAATGCGATCAGGGTAGTCACTTTCTA(A) LENGTH:(B) TYPE:(C) STRANDEDNESS:(D)(A)TATTTTAAGCTGCGGGTTATTGGCAATGACGTTTGGGGCTCAAAACCAATGGATAAATTCCCCTTATGATTGTTGGGGATCAAAGATGTAGINFORMATION FOR SEQ ID NO:2:SEQ ID NO:l:TTGAGCGCGACAACAAGGTCCTTTATGGTTAGGGTGTATGTTGCTCACCTGCTCTAGGTCGTCAATCAAACGCAGTGCGTGGGCTTATCCSEQUENCE CHARACTERISTICS:351 base pairsnucleic aciddoubleTOPOLOGY: circularHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriMOLECULE TYPE: DNA (genomic)02265523 1999-03-16GTTTAGCGTTGTTATGGCCCTGAATTTCAAGCTTTTTAGAATGGCGGCGGTCATTGGTGGCCAGATTCCATTGAAGCGGGGCTACTATTCPCT/US97/ 19575AGCTGGCGAA 60TTATAACAGC 120ATTAGGTTTT 180TTGGTTTAAC 240TGGCGATTTG 300CGTTCAATTA 360GTTCTTATGG 420CGTGAAATTC 480TTGGTATGTG 540561?10152025303540455055W0 98/ 18323(ix)(xi)TTGATGCGCACTCGCTTCTTGCTATAGGGAGACCCAGAAAATCTTACAAGGAGAGCAGGC(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGGTTAAACCTGTTTTTTAAAAGTGAGCTTTTATTTTGCGACCATGAATTTTGTGCCTTCCCACTTCTAAACATCAGAGACTGAAAACAAGCTTTATTTTTGTATAACGGAATTGCATTGGCACGGATTAAACGCCGTTATCCCCTTATCTTGGAGCGGATGACCTTTTATTTTAAAGCFEATURE:CA-90-(A) NAME/KEY: misc_feature(B) LOCATION l...35lSEQUENCE DESCRIPTION:TTATCATAAGTGATGGGGGGTTTTTGTGTTAACGAGAAGAACAAGCAAAAAAAAACAAGA(A)FEATURE:GTTACTTTCAGCTTTGGTATGATCTTGTTTATACATAGAAAGAAGAGCAACCTTAAAGAAINFORMATION FOR SEQ ID NO:3:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriSEQ ID N022:TTTAAAATGAGCTTTCAATGGTTTTTTTTACGGCTTAAAAATGCGCCTCTCAAATGAAAASEQUENCE CHARACTERISTICS:(A) LENGTH: 1038 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION:ACTATCTTTTTCTCTTCCATTTTTGGATCTCGATCACTTTTGTTAGTGTTTAAGTTTGTTAGAGCGCTTACGGGTGAATTATTCCTATGATGGCTCAAAAGGCATGCGTATGCGCAACAAATTTGGGTTATTTCTCAAGCTTGGCATCGCTTGGGGTTTATCTTCCCCTTGTTATTAALOCATION l...l038CATGGCGGTTTGTGTTATTAGGTGCAACTCTTTTGCGGCTTTTCTCTTTAAGTGAGCGCGTTACGGGTTTCGGGCAAAAATAATTTGGTGAGGCAATATCTTTCACTCAAGCTCAAGTCTTTGGAAAAAAGATCTTAGTTCAACCCGCGATTTTTTAATGTATTTGGGCGSEQ ID NO:3:TCGCAGGTCTATCAGTATTGTTTTTGTATTTGCGCTTTGGGGGGTTTCGCATTTTATTAGTTGCGTCAAATTAGGCGATTCTTTTTTCTAAACAATCAAAGGCGATAAAATTCAATTCTAGCCTTTGGTATCCTTGTTCCTTCAAAACGAGTGCATGTGATTTATTTCTT02265523 1999-03-16ACGCTTTTTTGCGAAGGCTCTCCGCCCTGTAAAACCATGAATCAAGCCAAAATACTCATATTTTCTCCTTCAAGCGTAACCCTTGCCAGGGGCTTTCAAGCTAAAAAAATCGTTTTCGCTAAAAAGACAAGGCTCGTGTAATAAAAGTCTACGGCGTGTTTGCGTAAGGTATGATGCGGCAAAACGCTAACTTTAGCGAGATTGGAGTTATTTCTACGGAATTTATTGTTPCT/US97/19575AAAACTCGCG 60TGAGATTGTC 120GAGTTTCCAA 180GAGGAAAATG 240AAAAGAGCGA 300A 351CTTTTTAGTG 60GCTCGTGATT 120AACCATTTTT l80GCTTAGCTAT 240GACTAAAGCG 300CATCTTAATC 360GATTGACATT 420TGTGGATAAG 480CTCTCAAGAA 540TGAATTGAAT 600TGATTTTGAA 660TTATTTGCAA 720TAAAAATCAA 780CGTGTTTTTA 840TTTCTATGTC 900TTTGTTTTTG 960TAGAAAATTC 10201038?10152025303540455055W0 98/ 18323(2)(i)CA 02265523 1999-03-16INFORMATION FOR SEQ ID NO:4:-91-SEQUENCE CHARACTERISTICS:(A) LENGTH: 83]. base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(iii)(iv)(vi)(ix)(xi)ATGAAGAAAAGCGGTCTTTTAAACAAAACCATAACCGCCTGTGCGTTATGGGCGAGGGCTATCATTTTCCGCTAGCGGGAGACAACCCCATTGTCAATGTATTTTCATGTTCCAACTTAGGATATGACCTCGCTACATCA(2)(A)(B)FEATURE:(A) NAME/KEY: misc_featureLOCATION l...83lAAGCAAAAGTTTTTGTTGAGATAAGATTTTCAGGGAATGCACACCAAGACTGCTCGTTAACCTTTTATGTAGGATCAAAATTTGGCATGTGGAATCCTAACCACGAGCAAACGGCTTTATTTACCCCACAACTCTAAGACHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriCTTTTGGTGTCGTATCAGACTGAAATCCTTGATCCTATTGTAAAGAAGCGAACCGATTATCCAAGACAGCATATAAGATTCAATGCGACTGATTTATGTCTAAAAGAACTTTATTTGCAAAATCCGTTACGCAGGTTTTTINFORMATION FOR SEQ ID NO:5:SEQUENCE DESCRIPTION: SEQ ID N024:TGTTTTAAAAGCTAAAGAAAGCGGATAAAGAATTATGACGTTATTAGAAGGTGAAATTGAGTGAGCGGGAAAAAACATGATCAGGCTCATGGCGATATTCACCGGGTTTTCCCTTTTATTAAAAGGGGTTATTCAATGCG(i) SEQUENCE CHARACTERISTICS:TGATTCGTTGTCGCTATGCATGAGCGCCAATGTATATTCTGCAATATTAAGTTTGAACGATTTGGGTGAGGCGCTTCAGGTTAACATGCACTGTATTGTATATACCCTGATAGCCCCCAATTGGCTTGAACGCTATTTTA(ii)(iii)(iv)(vi)(A) LENGTH: 675 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D)TOPOLOGY: c ircularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriPCT/U S97/ 19575GTTGTATTTG 60ACGATTTGAC 120AGACAATGTG 180AGCGGATAAG 240GGTTTATAGG 300AAAATATGAG 360CGCGGATATT 420GTGCAGCATT 480AAAATCGCAT 540TTTGCCCTAT 600GTTTGGCACT 660AAACTCATGG 720TTTTGAAGCG 780G 831?I0152025V303540455055WO 98/18323(ix)(xi)ATGATTAGATCTAGGTGCTACGAGTAAAACGGCTCTCAATGAAAAGATTTAAAGAAGACAGCTAAAGTTTCCAAATAAAATTTATTGATGCTTGGCATTATTAGACAATACTATGGCTAG(2)(i)(ii)(iii)(iv)(ix)(xi)ATGCCATACGTGTATGATAACAAATCATTACAAATCTTTTTATTACAAGGAAAGAAAGCTCGTTATGCGATTCAATATCCAAAGAAATTGGAAAATTTGCACGCAATTAGGATTATAAAGGAATACGATGFEATURE:CA-92-(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION:TAAAAGGTTTCTGCTCCCTTTACACAATATACTTGAATAGTTGAATGCGTCTAAAGATAATAAGGCAAAAAGCAACTTCAATTGGCACGAAAGAATATAGTAAAAAAGATTATGALOCATION l...675GAATAAAACTAATGGCAAAGCAAAGAAGATTGGTTGGAATAGAAGAAGAAAGAAGAACTTATTTATGGCTAACCATGCTTACGCTTTGGGTGATGAAGGATTTGAAGAAAINFORMATION FOR SEQ ID NO:6:SEQ ID NO:5:âTTAAAAACAACCTTTATTAAACGCTGACTATTATCTAAAGAAACATAAACGCAAAAAAAATTTGAAATGAGAGAACGCTTGGTATAAGTAAAGATATTGCGCACTTATGASEQUENCE CHARACTERISTICS:(A) LENGTH: 1290 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(A)FEATURE:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc_feature(B)CCTTAAGAAAATTTGCATGCAGACAGAGCCCTTTTGTATCACATCTTAAAATGAGCCTAATTTTAGTGATAAGTCTTTGAAAAAAGAAAATCCAAAATACAAAATCATACAGCAATTAGGATGATGGCCTLOCATION l...l29OAAGATTTTTCCAAAAGCTATTTGCTCTTTGCCAATACGATCAAACTCAACGATTGAATTAGAACACCCTTCAGCGATGAAATTCCCTTTTGACTATCAATCGAGCTTTCTCATGCTCGCAGATAGGTGAASEQUENCE DESCRIPTION: SEQ ID NO:6:AAACGCCTTTCTGTTTTCTCGAGTGCTTGAGATAACAACCCCCGTATTCAGCGATTTTACTTAGCGTATTGAAAGCCCTGATCATCGCTTACCCCTACTTTTAAGCGAGCACTTTCATTACGCTTGAGGC02265523 1999-03-16GCTTATTAGCGCGATGAAGAGCTGTAATGCAATTTCCGCAAAGCCCTTAATCAAAGAAATAAGAACACTCTTGATAATGGGAGAGAATACCTTTGGCGAATACTAGACAATATTGTTTTTCTTTGCCCCCAAGACTTGATAAGATGAGAGTCGCTTCTCATGCCTAAAAATGAACACCAGAAAAATTAGATATTGACTAAATGTGCCTACGCTTGTATTTGCCCTAATTCAAATCACGGAPCT/U S97/ 19575TGGGGTTTTA 60CTTATTGAAA l2OTAAGGTGGAC 180AGAATATAGA 240TTTAATCAAT 300TAAAGAAAAA 360TAAAGAATTC 420AGCTGAAAGT 480TTATAAAGCA 540AGAAGTTATA 600CCCTTATCTG 660675TTTAATTGTT 60AGCGCACCAG 120GCTGCAAAAT 180CCTTAAAACT 240AACTCCAGCT 300GGTGGTGGGC 360AAACAACGAT 420AGAAACCTAT 480AGAGGGCGTG 540GGTGAATAAA 600TGGGGGGATT 660GCCCGTGATT 720GTCTTTAAAC 780?10152025303540455055W0 98/ 18323GTTGAAGTCATTTAGAAAACAAAAGCGGTCTCCACACAAAAATTTATTCATTATTAGAGAATGTTTTTAAAATCAAGTCCAAAAACGAAA(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)GTGTTAAAATTTATTGGCTTAACCATTCCAACGATCAAGCAAAATAGGCGGACCAAGCCAGGGTTTTTAGAATTATGTGCTTAGGGCGTTGATTATAAAAGCTTTTGGGCGAAGTTTATGATGCCTTTTGGATAGCAACCTTCCCTGTTTTGGGGCGCATGGTTATTACCCCTTTTAATTGACGCCGTTTTTAGGCAGATTATAAATGGGCACAACGGCTAACACCAAGAATGATGCGTTTGATCCTTTCTCAATTTCAATTGTCAATGCGCGATTTAAGACACGCTAGAGTTACCACAAGCGAAACAAACAAAACATTTCTTTTTAAAAATTCAAATAGGGCCCCTCTTTACTTGCAAAACGCATGATTGGTCCGCATTTTTCAAATTTATAAAAGAATAAINFORMATION FOR SEQ ID NO:7:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:-93-TACAAACAAGTCTACCTTAACTTTTAGAGTCTCTTGCTCAAGCGATGAAAGTGAATTATTAAAAAGTCTTCAGGCTTTAGSEQUENCE CHARACTERISTICS:(A) LENGTH: 1368 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...1368TTCAAAAATTTTGATTATAAAACTCAATTCTTCAAGTGGATTGGGGGGATCGCATCAAATGCAACGCTCCTGTATAATTCATCTCTCTAATCAATTCTAAAATGGATACGATGGCATCCACTTATTTTTCCGAAATTCAAATGCTAAAGACGCTTTTGATAAAATTTTGGATAGAAATAACTGGGTATGTACACTTATGCGTTCTTTTGCATAGATTAGAACCCTTATTGGTTTAGTGGGCAAAGAAGGGTTCCAATCTGTTTAGGAGCGCTATGGCTCATTGGAAAGACCTATCTGTTTCATGGATTTTAATAGCGTTAGGATTGGTATTGCCGCGCAAGCCTAAGATTAGGCTTAGGGTTTATACGATCCACCAACGCCAACGCTAACCAGCGTTTATCTTTGGTGGGCACTAGAGCGTAGAGTTGATCTATCTCACCSEQUENCE DESCRIPTION: SEQ ID NO:7:TTTGTTTCCAGTAGCGGAATATTTTCCCTACTCCCTAAAACTCGCTTACGGAACTTTTTTTCCCTCATAGTATTCTTATGATGAGTTCCTAAATGGTTTAGCCCCTATTGCTCTATTTTTTACGGAGCGCTTAAGGGCTCGTGTATTGGCTTTGACTACAGCAAGGATTGGGTGGGGTCTGGGGTGTATAAGCGAAAGATGTGAATTTAGGGCCCTTTCA ,......__...............m........m .,. 1.... ., ... ,. 02265523 1999-03-16CGACCAGTTTTTTTGAACACATAAGCCTCTCCCAGCCTAACGCTGATAGACCAGCGCGATTTCAAGAGAGGGTATTCTTTTTCTTTATAACTGTTTCTAACAGCCACCTTACATTGAAAAATTCCACCAAACCTCATAGGAATCTGACGCGCGATAAATTACACACAGGGGCTCTTTTGGTAACTGAAGACTAGCAAGCACCGGTGTTAAAAACCACTATGTAACTCTAAACGAATTTAAGCTGGTATGGTCAGTAACGCGAGGGTTTTTCCATCAACTTAATACTATGTACAAAGCCTT PCT/US97/19575TTCTAAAAAT 840CCCTACCACT 900TAAAATCCTT 960AGACAGGAAA 1020ATACGCTTCC 1080AGGGCTAGAG 1140TTTGGAAGAC 1200TGAGCCGATA 12601290TCAAAGCCCT 60AGTGGGGTTT 120TGTAACCGCC 180ACACAGCTTA 240AACGCTCATA 300GCGTTGGTGG 360TCACACCCGT 420CCACCTAAAA 480TTTTGAACTG 540GAGGGCGTTG 600TGGCAGAAAA 660TGTTCAAGTC 720AATCCATATT 780TAATGTGATT 840GATTGGCGAG 900CTTTGGCTTT 960TAACCCCATC 1020TATTACCGCA 1080ATGGGGTATT 1140GAACTTGGGC 1200GGTCAGCATG 1260TAAGGCTGAC 1320?10152025303540455055W0 98/ 18323CA-94-02265523 1999-03-16GCACAAGATA GGAGTAACCT TATGGTTAGC ATGAAATTCT TTTTTTAA(2)(i)INFORMATION FOR SEQ ID NO:8:SEQUENCE CHARACTERISTICS:(A) LENGTH: 849 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(ii)(iii)(iv)(vi)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix)FEATURE:(A) NAME/KEY: misc__feat:ure(B) LOCATION 1...849(xi)ATGGGGTGTTGGGCTTTCAAAATGACGCCACATGTTACGCCATGTTGTAGGATAAGTTTCCAAGTGTTGCTCCGTTTTGGGATCCCAATAAATTTTTATGTTTCAGGCAATCAAAAAGCGTTAAACAGAAATCGCCAAATAAAAAGTAG(2)(i)SEQUENCE DESCRIPTION:CGTTTATCTTGCGTGTTGATAAAACCAACACACTAGATTTGTATTTTAATAAGACGCTTTGTTTTCAAGAATTTGAAAGGGTCCCAATTTAACCAGAAAGTAACATACACTTATCCATGATGTATGCGGTACAGAGACGCTAAAAAAGTTCGGTTGCGCGACCAGTTCAATAATTACCCGGCCACGCATTAATTAATCAATGAAAAAGCTGTGGGTAGGAAGACACGCTACAATCGTGTCATACACCTCTAAATTTGGATTGTCATGAAATATTGATAGAINFORMATION FOR SEQ ID NO:9:SEQ ID NO:8:AGGGTTTATTATGAATCCAAACTCATGAAAGTGCATATTGCAAGTGAGCGATCCAAACTATTGAATGTGCATCTTAGAAGGTGGATCAAAGTCCATGATTACTAATAACGAAGAATAGAGAAAGCTGTAAATGAAAGGCTSEQUENCE CHARACTERISTICS:(A) LENGTH: 843 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv)ANTI-SENSE: NOCTAAAATGTTGCGCTGAGACGAATGACAACTTCAAGCCCCATAATCTAAATTTTTGAAAAAAGATAAGAAATTTGAAAATGCTCAGGCTCTTGCTGTAGACTTCAGGAGGAAGACGCGATCAGAACTTACTTAAAAGTTCPCT/US97/195751368GGTTGCTTTG 60AAAAAAACCA 120AAGTTCTGAA 180ACAAAACCAT 240ACCCTATATT 300AAGAGGCTAT 360AAAGATTTTT 420GAATTTAAAA 480TGTATGGTTT 540AGTAGGAACT 600GTTTAATTCT 660ACACAAGATT 720AAAAGAAAAT 780TATGCCTCAA 840849?10152025303540455055WO 98/18323CA(Vi) ORIGINAL SOURCE:(ix)(xi)ATGAAACTGATGCAGTAACTAATGAACTGATTCATGGTGCGTACTAACTTAAGATCCTCCTACTTGCAACAATCCCAACACTAGGAGCTAGTGATCAATGACTCTCTTGCTTAGAAACATATTTTTAAGACAAGAAGAAATGA(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAGAAAACGGCTTTTTCAAAAAGACACAATTTTAAAAATCATCTTTATTTCTTGCCTTATCGATCTAG(A)FEATURE:-95-ORGANISM: Helicobacter pylori(A) NAME/KEY: misc_feature(B)GAGCAAGTGTATGCGAAAAATAGAGAAGTAAAGTGAAGTTTCAAACTTGTAATACAAGAACCACTTTGAAACAAAGAAAAACACAAAAAAAAGTGGCAAGAAGACAAGGATGAGTAATCGATGGCAACTTGAGAGAATGALOCATION 1...843TTTAATCGGTAGTGGTGAAATAGTGAGATCGCCAAATTACTCACCATTCTTTACTTCCAATCAAAAGGGTACCACAGACCCTTGCATGGCAGAAAAAGCTACAAGAATATTGCAGGTTATGAACATGCAAATACTTGCGCINFORMATION FOR SEQ ID NO:lO:SEQUENCE DESCRIPTION: SEQ ID NO:9:GTGGCAATTCCAAAAGAACCCCCTTAAATGAAGGACTATTAAAAAGATTAGCTAACGGGGGTGGTGATGATTTGATGTGTTATGATGTGACAGCTAGAAAACCACTAGGACAAATGAGGCGCCAAAGAAGAATCAAATCASEQUENCE CHARACTERISTICS:(A) LENGTH: 1179 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:MOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .1179SEQUENCE DESCRIPTION:TATTCATCCCTAGAAGCCGGCCACCACAAAGAGCGGCTAACCCCTGTTAGATAATTTAAAGCGTGATAGAACTTTTATTACTTTGAAACTAAACACTTACTTTATTCACCAGTGTTGTATTAATGTTAAGGACTATCCCCSEQ ID NO:lO:TTCAGCGCTTGGGCTATTAGGCAACTTACAAATGCCGAAGATGTATAATGCTTAGTTTTAAAACACTCTA02265523 1999-03-16TGTGCTTAATATGTTTATACACAAACTCAATGTTGGATAACGCTCATAGGCAAGATCTGATAGCGAGTAATGCAAGGAAGGTGGAGCAAAAAATCAATCAAAAATAACCAAGAATGTGATAAGAAGTTAGGAAGTTTGCTTAGAAGCGAAAAGGCACACAATTATTTACCCGATTTCAAAGTCAATTAACCAGACGCTCAAGATTGTTTTPCT7US97H9575TTTAAGTGCG 60GCCTGTGTAT 120AGACACACCA 180TAAACAAGTT 240CGATGCCAAT 300CATTGATTTT 360CTACAATGAT 420TCAGCCAATG 480CAACAAGCAA 540GTATTACAAG 600ACGAGAAATT 660TAGTTCTGAG 720GGAGAAGCTA 780CAGTGGTAAG 840843CGAGAAAAAC 60AACGCAAGAA 120CACAGACACG 180ATTAAAATTC 240TATAGAAAAC 300AGGCAATGTG 360GCCCGGAGAG 420?10152025303540455055W0 98/ 18323GCATTTGATAAGCACTTCTAACAAATTTGGGAAGCCTTTAGTTTTAGACTAGCCCAACAGGTCAATTCTAAAAAACAAAGAGTGATATTAGCTTCTGCTTGATTTAAGAAATGACCTATCAAGCCAAAAG(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)ATGAAAAAGTGAAGGTGATGAATATTTATAGCTAATAAGCGCTTTGAATGGATATGACAAGATTTAGGTAGTGGGGAGCGGGTGGGGTCGCAAATCATTGCCTTATAGCAGCCAATATCTAAATTTTTGATCGCTTTATT(2)(i)GTCTAAAAATTTTCTGACGCTCGTAAATTACCCCACAAACCCCAATCTTGATTGCGATAAAAGTCGATCACGGATCTTGACCCCTAGCAATAGATCCTAACCATCTTGCAAAAGAGTGCCATTCTGATGGCATGACCCCTATTAACACGCAGTAGGAATGAACGCAGAAGAAGGGCGATGCGTGATCCTTCAAAAATATGTGTGTAATTGTTCAATGATGATAAAACTCTTTTGAATTCAGCGGTAACGAAACCTCCCCTATINFORMATION FOR SEQ ID NO:ll:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:-96-ACTTTATTTCAGGGTGTTTGAACAAATTTATTCACTAATTATCTTAAACGAAATGCGTAATTAAACAAACTTAAAGGATTGGCAAGCATTGGCGATAACCCACACTAAAGGATGGTCAAGAATGTGTGTSEQUENCE CHARACTERISTICS:(A) LENGTH: 813 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feat:ure(B)TTGTAGCTTTGTGTTTATATATACAGGGGAATAATCCAGGGTTTTGGGTTGCAAGTGGTTAACAAGTTTAATTTGTTAGCCTATCGGCGGAAGCCAAAGGCCAACACTTCACAAGCATAAGCGCGGGTCCTGGGGTATAALOCATION l...8l3AGGGCTTCTAAGGGACTAATTTGCACAGGGAGGCACCAATGAATGTGGGTTGGTTTTAGATGCACCTAATTGATATTATTTAACACTTGGTCCTGATGTTAACCGTCGCTTGGCGTGGAATAACGCTACTCTACACTTTTINFORMATION FOR SEQ ID NO:l2:SEQUENCE DESCRIPTION: SEQ ID NO:ll:TCCGCGGTTTTATCAGCTTGAGTGTTGTAGATCAATTGGCTATAAGAAATGTGTATGGGCAAAATCCAGTGATAAAGACAAAAAGCTCTGTGTACCCCTATTTCAAGTGTTTTGGCGTGAAACCTTTATTTAASEQUENCE CHARACTERISTICS:02265523 1999-03-16TTCCAAAAATAAACGCTCAAAAGATCACGATAATGTTGAACTCCTTTTGAATCCTGGGACAAGACATTGTCAGGGGTTGTATGGCCAGTTTTAAGACTATGCTATGGGCATGGAAAAGGATAAGCTCTTCGACAAGCCCGGTTGCCCCCCACTCCAAATATCTTCCAATTTTTTTGATTATGGATATGGTACGCTTCTTTCAGCAAACTACTTATTGTAAGGTTGAATTTGAGTGCCGCTACCATTTGAAPCT/US97/19575TGAAGCCACT 480TAAGATTAAG 540AAATCATTGG 600CATGATCGCT 660GTTCACTAAC 720AAACGGGCTT 780CAATAAATTT 840AGGGCTTGGG 900AGGGGTAGTA 960CAATTTAGAG 1020TAACGGGAAT 1080TAGTAATGGC 11401179GTTGTTAGCC 60TTTGAATAGC 120AGGTCTTACC I80CGCTAATGGG 240CAAGTCGCTA 300CGGGCATGCC 360CTCTTGGGGT 420TGGTATTTTT 480TTGGAAAGAG 540CCCTAATGCC 600TGGGGTGAGA 660ACTCATCAAT 720ACGGGATTAT 780813?10152025303540455055W0 98/ 18323(ii)(iii)(iv)(vi)(ix)(xi)ATGCATCCTAGGAACACTTTGCAAAGAGTTGAATTAATAGGACATGAGAGGAAATTGATTATAGAAAAATTAA(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)CA-97-(A) LENGTH: 423 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(A)FEATURE:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B)TAATGTTTGCGCATGGCGTTTGATAGGCAAAATGTGGCGTCCAGACAAGTTAAAAAAGATCCTCAATGATLOCATION l...423CTATATCGCTTCAAAAAATACCTTTCTCAACCCATTAAGCGCTAGTAAAATTGCAAGAACCTTAAAAAAGINFORMATION FOR SEQ ID NO:l3:SEQUENCE DESCRIPTION: SEQ ID NO:12:AACGCGCTCGTCTCAAGTCAGTGATTATCTGATAGTGAAAAATATCGTTATACTTTATATCAAACCAAGASEQUENCE CHARACTERISTICS:(A) LENGTH: 771 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:MOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feat:ure(B)SEQUENCE DESCRIPTION:LOCATION l...77lSEQ ID NO:l3:ATGTTGGGGA GCGTCAAAAA AGCGGTTTTT AGGGTTTTGTTGCGGGGGGT TAATGGCAGA GCAAGATCCT AAAGAGCTTATACACGGATA AAAATTTCAC TAGAGCTAAG AAATATTTTG02265523 1999-03-16CTCAAGCTAGAAGAATTAGGACCCCACAAATCAATTTCTTCAAACGCTTCTCTTGATAGCAACTTATAAGGTTTGGGGGCTATTTTCAGGAAAAAGCTTGPCT/US97/19575AAAGATCAAC 60CATTGATAAA 120AGATACTGAT 180ACACAACACG 240AGCTTTTATT 300AATGCTGGTA 360GAAGAGTATT 420423GTTGTGTTTA 60TATAACTATT 120CAAATCAAAC 180?10152025303540455055W0 98/ 18323GATGCTGATGGAAAACGCAAAAATTAAACGCTTAAAAATGATGCTGTCAGCTAGAATATTGGGGATTATTGCCAAAGCTTGAGGGTAAAGAAGCTAGGAT(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAAAAAATGGCATGGATGCATGCGGATACTCTTGGGGTGACTACGCTCCAAGTGGCTACCCAGAACTTGTCATCAATATCATGGCTTAAAGAAAGCCACATTCTAGCAGCAAAAAATTACTTTCTAG(2)(i)GCTGTGCAATGAGAGAGCATATGCTGAAAACTTTAGAATACAACTTTTTAATTCTAAAGCTTTTTGGTGAGTGAGTTGAAGCGTGGCAAATAAAAGAAGCCACTTAAGAGAGTGAAAAAGCTATGCAAGGACTTACTCTAAATAACGATATGTTGCGAGTTAAGGCGTAACACGATGCTAAAGGATGAAAAGATGCGATATTINFORMATION FOR SEQ ID NO:l4:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:-98-GTTTATTCTACTTGAACACATTAGCAGAGTTCTTGTAAGTATAAAGGGTTAATAACGGTGAAAGATTTCAGGGTGTTACGCAAACGACAGCTCAAAGAACSEQUENCE CHARACTERISTICS:(A) LENGTH: 729 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feat:ure(B) LOCATION 1.. .729TTTTTTCTCAGTAATGGCGTTTAATTCTCAATCAATTTTTATGCCAATTCGTCAAATTCTTTGAGCCGAAACGGCATCATTGGCGACACCCTTCTTTCCATTGAAGCGGGTGGATATAGGATCTTTGTTATTTTTTAGGGAAAACAAGCCCTTTGAAAAATATTAAGCTTTGGGAAACAACATGCTCACTGAGTTTGGGGGAGCTTTGAGATTTTTATTCCGTGAAATTCGTTTAGGCGCINFORMATION FOR SEQ ID NO:l5:SEQUENCE DESCRIPTION: SEQ ID NO:l4:GCTCTTATTAGCGGGTTATTACCAACGCTACACTTTGGCTAAAAACCCTAGAAATCAATCTATGGGGGGGGCTTTTGGCGGGCATTTTAGAATGTGGGGGCCCATGCTAAGTGTATTCGTSEQUENCE CHARACTERISTICS:(A) LENGTH: 804 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular02265523 1999-03-16GTGGTAAAGCCCGCTACTGCTTTATTTTAATAAATAATGTTGAAAAAAGAGAGGGTGTTCAAAAAGCTTTCTCTAGCAGCAAAACCTTGAAAAAACAATATCTCTATGAATGCAAGGACACGATCAAAGGTACGCCTTTAACTATAATAGGTTTAACAAACTATGGACGTGGATACAATTTGGAACAAGCCTCGCTTAAGAGAAAAACCCGGTATGTGAAPCT/US97/ 19575CATAGCGAGA 240TAAAGTTTGT 300TGTAAACGAT 360TGAAGGGTGT 420TAAAAAAGAT 480TAAATTAGGA S40TGAATATTCT 600GTTTTATAAT 660AAAGAGTTGC 720A 771TGCGGTATCT 60GGCGCAAATG 120CTTTGACGCG 180TGGGTTTTTT 240CGAAGCGGCG 300CATTGCCGAT 360GATGGTTAAT 420GGCCGGCAAT 480CCTTGTGAGC 540GATCTTAAAA 600CTACATCACT 660TTACGTGTTC 720729?10152025303540455055WO 98/18323(xi)ATGAACTACCGAAATCACTAAGCGAGCAAGTTGGATTTTTCTGACTAACGGAGTTTAATAGCCGAGAACAAGACTTTTAAATCACAAAAAAATGAAATAAGCTAATAATGGAAAGCGCTAGAAAAAACCCATTGATTTTT(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)(A)FEATURE:CAHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori-99-MOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B) LOCATION 1...9o4CTAATCTACCACGAGCTTTTTGGAATTAAGTTAAGAATGCCCGGCGAGAGCGAGCATGCATTAAAAGCGACGAGCTATCAACAAAACCCAGCAACAATCAAAATAAGCAACAACGCAAATAAGCCACAAGTTGAGTTTGATAACAGCGCTAAAGCAATTACCTTAAATGCGAATGAGATTCTTGAAATTATGCCAACGAGAATTAAAAAGAATCTTTTTAAAGCCTTGAAAACGCAAGCGCAATCAAACGAAACGCCAATCGAGATCACCATAAINFORMATION FOR SEQ ID NO:l6:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: HelicobaFEATURE:SEQUENCE DESCRIPTION: SEQ ID NO:15:TTAGAGATAACAAAACGCTTATCGTTAGGAGATAGCAGTTAAAATGAAAGCAGGAAGTAACTAGAAAATCAACCAAGCCAGCGATTACACATAACTAATACAAGCGATAAAAGCAAGAAGGAAGCGAAAASEQUENCE CHARACTERISTICS:(A) LENGTH: 1632 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)cter pylori(A) NAME/KEY: misc_feature(B)LOCATION 1...l632SEQUENCE DESCRIPTION: SEQ ID NO:l6:02265523 1999-03-16GCGAACAGCCTAAGGAGCAATTTTAGAAGTTAAGAAATTCAATACGAGCGCCAATACCTTAATTGATAGAGAGATAACGCAAGCTAAAAATCACCGAAGCCTAACATTAACAATAAATAAAGACCGATCAPCT/U S97/ 19575AGAAGTGAAA 60CGCGCATTTT 120GCTTTTGAGT 180CATTGAGTGG 240CTTTTTTAGC 300AAACGCTAAC 360AACCACGACA 420TAACAACCAA 480CAACGCTAAT 540GAAAACGAAC 600CGAAGCCAAA 660CATCACGCAA 720TTATCAAAAC 780804GTGATAGAGA CCATCCCCAA ACACTCTAAG ATTGTTTTAC CCGGGGAGGC GTTTGATAGT 60?10152025303540455055W0 98/18323TTAAAAGAGGACTAGCACTTAAAACAAATCTACAATAATAGAAGAATTCAGATGCGATCTCCTTCAAAATTATATACTCAGTTGTTTTAATATGGCACATCTTAAGACTAGGCTATGGGCGTGGAAAAGGTCGCTTTATGCACAATTGTGCTCATCAATCAACCTAAACGAAAACCTTTGAGAAGCCCTAATAGGGTTGGGTCCAGCAATTCCAATAAAAATCTTTGGGGAGCGGCAATTGTAGGGATTATATACGAACTGGTGGGTGTTCGTTTGATAACTATTTCTGATTATAATGAAATGGTAATACCCAATTTAATTAAACGCTCCGCGTAAATCCACAAACAAGGAAAATTCAGGTAGGGGTAGATCAATTTAGAATAACGGGAAATAGTAATGGGGGGATCCAACGGATGTCCCAAAACGCCTTCTAGTTTAAATAACTTCTAGTTTTAGGGGTCTTATTATGGTGAGCTATGGATAGCCCTACGGTTAAGGGGTAGATGTGGCGCATCCCTTTCTTTTGTTTTTTCA 02265523 1999-03-16AATTGACCCCTACTAACACGATATAGTAATAAAAAATGATGTTGAACATGTTTTGAATTCCGGAGTAAATTATTATTAATGGTTGTAGGGAGCCTATGCTAGATTTAAGATATGACCTATCAAGCCAAAATCAGCCCGCTGGCTGGCTTTGCCGATCAACCACGCAAGATCGTTACCAACTAACGCTAAACATCATCAAATGGGGGGATAAGGCATTCAACTTGTATAACTACCGGGTTGAATCCAAAGACAATGAAGGG-100-TATACTTTCTCAGAGGGTGTGAAAATCCAATGTTGGCAAAATCGCTGTCTACTAACAGCTGGGCGTGTTGAATTTTAGAATTAGCCAATGTTAGATCCTAACCATCTTGCCAAAGAGTGCGATTCTGATGTTCCCTAGCATTAGGGGTAATACGCTAACTTTAGCCAATTCACCATTTTTATAGGCTATCTACAATTACGGATTTGTTATACCAAAAGGAAGCTATTATGAACTACCGCTAAAGCTAGCGGCTAGCCACT(2) INFORMATION FOR SEQ ID NO:l7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1071 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(Vi)FEATURE:(A) NAME/KEY: misc__feature(B) LOCATION 1...1071(ix)(xi)TTGATGAAAA GCATTTTGCT CTTTATGATT TTTGTAGTTTTTTTCACAAG ATAATTTTAA GGTGGATTAT AACTACTATTATCATTAAAA CGCAAAACGA TTTGTCCAAT GCCTGGTATCAAAGAACATT CTTGGGTGGA TTTTGCTAAA AAATATTTAASEQUENCE DESCRIPTION: SEQ ID NO:l7:TTTTTCCAAATTGAAACGCTACAATTTCAAATTTCACCCCTAGACTCCCACAACAGATTGATACTAAAGTAAAAAATAGAGATATGGCAAAAAAACTCTTATGAATTCAGCGGTAACGAAGCCTCCCCTAACTACCCTAACAGCAGCGGTTGGGGAGTCACCATGCTCAGCAAACGCATCAAAACTACTTCTAAAGCTGTTGGATTTCATATTTTTCTTCTGTTGAACAAATAAGCATTCTCGTTTCTAGTTAAGGTGTTGTCAGTTAGATGCGCAAACATCCCTCCACAACATGATGGAPCT/US97/ 19575ATTTGAAGCC 120CAATAACATT 180CACTTGTCCT 240ACAAACCGCA 300ATCTTGGGGC 360CGATAGCGAT 420CGATCAACAA 480AATTGATGCG 540TGATGGTGAA 600TGGCAACGAC 660CCACACTAAA 720AGATGGTCAA 780TAATGTGTGT 840TTCCATCTAT 900TTGGCAGCAG 960AACAAACTAC 1020CACCATCCAA 1080GCAAAGTTTT 1140TAATGATTTC 1200TAATCAAAAA 1260CACCACTTAC 1320ATCTTTTGGT 1380AGTCAAAGGA 1440TAAATATTCT 1500CGGTGGCGAT 1560TTTCAATTAC 16201632AGGCAAAAAA 60GGATTTGCAC 120AAAAGCCCCC 180TTATCTAGGC 240 ?10152025303540455055W0 98/18323ACTTATTTTTATCAACCCCTAGGCATATTCCAAATTTATAATCTATGTTTATTTGGATAGTTTAATAAAGTATAACGGGCCTGTGTTTCGTATGTCCCTTAAAATTGATTCAATACTGGCAACCCTTTTGTACGATGTTT(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)TTGTCTAAAGGTGTGCGTGAAGCGCTCTGCTTGGAAAACAAGAGAAATCAGTGAGCATGTACGATCAAGTAAAAATAAAGGTTTATGGCGGTTCTGATGAGATTTATTTTGACAAATCCAATTTTAGAAAAATTTTTTAGAATTGGATGACGTTTTGTGGCTTTTAATGCTGCCTTTTTAACCAACGCAATTTGGACTAAATGACCCTCAATCCTATTAAGTTGGCAGCAAAGGTAATCCAAAAAGATGTTTTTGGTGTGATGATCAATCACAGGAGAGGGTTATGATCGTGGGGATTTATTTCCAATCG(A) LENGTH:(B) TYPE:(C)STRANDEDNESS:(D) TOPOLOGY:CATCATAGTTTCTGAGTTTAAGAGGCACGCTTATCCGCCCCCTTTTAAACCTCATTTCTAATTGAAAACCAGGCGCTGGGGGGGAAAAGGGACAACCCTCAAGCGCCACCATCTGGCATGGATGCGCAGTGGTATAGGGGTAINFORMATION FOR SEQ ID NO:l8:-101-ACCCCCATTTTTCCAAATCATATCTGGCTTATGCGAATGATTTGGGGGTAGGTGTGGGGGTTTCCAGGACGGGTGTCKTTGGCCTAAAAATTGATTGATTTTTGAATTGCGCTTTCCGCTTTTAACGGCTGGAATACGCTSEQUENCE CHARACTERISTICS:2028 base pairsnucleic aciddoublecircularHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:MOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B)GTTTGAGTATGCATTTTAGGATTCAATGCACTTATACGAGAAATCCAGTTTTTTTAAAGATGATGGAAAAAAATTTCTAATGGATATTCTTTTTCTTTTCTAATTGGCGTTCACCGAAATATGGCTCTAACCGTTGAAACTCGCTTTGATTGGTTGCAGCGAGCGATCGTLOCATION l...2028CGGTAATAAAGGTGTCCTTAAGATAGTTTGCATGGGCATTGTTAAAAAACCAGAGAGGATCCCGTCATTAAAGCTTGCCTTTTACCACTACATTGACAGCTAAAGGTAAATTATAAAAGCAGCGACTTTACTTTAAAATGCATTGAAAAAGAGTGCTATCGAGCAATCGTSEQUENCE DESCRIPTION: SEQ ID NO:18:ATCATATTGTAACAGCAGGGCATTTCAAGGGTCAAAGAAATTCATTTTAGTTGAGATTGAGGGAGTAACCTATTACAGGATTCAAGGAAATTCAGTAATGGTGCTTTTGAGTGCCTAAAGGAATACTTGGCTAGGCAAAAGACAAGGTCTATGGTGTTAGTTGGAAGTCG02265523 1999-03-16TTCAATGGTAGTTTTAGAGTATACCCAAACTCAATTTCATAAATAGGGAAGTGCGCAATGAACCTGTAATCGGTGARCSCTCATGGTCGCACATGGGGTAAACTTTATGATAGGCTATACATGGCGATGGTGAACCCTTAGCGTGGCGTTTGAAAGAGATTTAAGGAAGTTGCTCCCTGACCAATTCGCACGCTTTTACGCTTTAGCGCAAAATGCCTAAACACGCAAGAAAATCACTAAGCGCGAATAACCACTAATGAATCCCTTTAGCAGAAAGTAAATGAGCAAGTCCTTAATCATTTTCTAGCACPCT/U S97/ 19575CCACCCTAAT 300GCCTGTATTT 360TAACTGGTTT 420GCCTGAACTC 480TTTTTCTGAA 540TTACCAGCCT 600CGTTAAAGAT 660GGGCAACSCC 720TTATTGGCCC 780TGGTAACGCT 840TATTTTCACG 900CTACCGCATT 960CTTGTATGAA 1020A 1071GATTGTGATC 60TTTAAAAGAA 120GCAAAGTGTT 180AGACACCAAA 240TGTCGCTGGG 300AGATAACGAT 360AAAAGCGATG 420CGGGGCGGAA 480AGTGGTGGGG 540AAACAGGAGC 600AAGCTTGCAA 660AGTGATGGCT 720CCATAAGGAG 780AGACAATCTT B40GGGATCGGTG 900AGCGATCACT 960CTTGTCTCAT 1020?10152025303540455055W0 98/ 18323TTCTTTAAATTCTAATGACGAAAACCATGCAAAGCGGGGATTGAGAGACGCCAAGCATTTAACGCTTCGGCTAGAAACTTTGCGTGCAAAAAAACGATAGATTGAACAAGACGAATCTATGGCTTTGCGGAGTGAGATTGATTAAAAACCGTTACTGAGGAAAGTCTCTA(2)TATTGAACAAAATTAGGGCGAAGAAGACAGATTTTGCGGTCGCTAAATGGTCAAAATCTTGTAGGGTGGACGTCTAATTTATTTAGAAAAAAAATATCACGGAAAGACATTAGCCCTAAATGGTGGCTGAAAGCCAATATAGGTTAAAGAGCAATCTAAAACGATATTTTCATCAAGCCCATCATGCAAACAGCAAGCCGTCGCGCATCACGGATCATGGATTGAAAGCTATATTGGTTACTTGCCAAAGATGGCTTCAAACCACTTCCATTTAAAAGCATTCGCTGCTATTTGAGGTGAGGTAATATTCTCAGTAGAAGAGAATCGCTAGCAGAAGATGTGINFORMATION FOR SEQ ID NO:l9:-102-TCTAGCGACAGCGATCAATACAAGACACCAGCTGAACCCGTATTTGCAAGTCTGGCTTGGAACGCTTTAGCTAGCGAACGTCCCAACACACAAGGCGTGAGTAGAAATCAGAAGCCGCACAAGCTCGCTGGTTCAAAGCAATCAACGCTTGATTCTTTAGAATAAAAAGC(i) SEQUENCE CHARACTERISTICS:816 base pairs(ii)(iii)(iv)(vi)(ix)(xi)ATGAACATATTTAGACGCCAGTGGGCGCTAGAGAAAGGGACTCAATGACGAATTTGGACATTTTATTCTCCCAAATGATCGCTCTCAAAGAACATCAAAAGGGGCTATCAGAAGATAAGGGAAGCGATAAGATACCTATA (((((LENGTH:TYPE:A)B)C)D)A)FEATURE:STRANDEDNESS:TOPOLOGY:nucleic aciddoublecircularHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION:TCAAGCGTATAACACCACAAACCCTGTGCCTCAAATTAGTGCTCTTTAGAGAAAAATGCAAAAAAATCACCGGCCAATCAACCCAAGCAATCAAACCCCTTAACAGGGAAACTCGCCTTAAAGCGTTGATAGGGGGCGATLOCATION l...8l6TATTTGCGTAAGAAAAAAAAGCATGCGCAAGATCGTGTCTCGCGAATTACCCTTGTTGGTAGACATTAAAAGGCAGGGCGTCTATACGCTAGAAGCTGCGTTATGCCTTGTGCTAATCTTTGAAGCCTTATATCCCGGCTSEQ ID NO:l9:ACCGCTATTGGAAGACCACAATCTTGCAATTTTACGGATTTTCCAGCACCTTGGCCAATAAACCTTAAAATTGATTTTACACGGAGTTTGTTATTGCCTACAAGCAAAACGTAGCCTCTCCAGAGCGAAATTTTAA02265523 1999-03-16TTAAATTGGTAAAATATCTTTTAAAGTGGTCAAGCCCTGAAAAGCGTAGGATTTTAGAGGGGCAAGAAATATAGCGCGAAAAAGCCTGATGCTCTCAAAGTTAGAGATATGAGCCGGCGAAAAGGACGCATTTCAGACACCTATTGAAGCAAATCAGTCAAGTTTTAATTTTAGGTTTAAATCACTCGCAGTTGTGGAATGTGTTGCCGCCCTTATTTTCCATGTGGAAAGGCTCAGTTCCATAAACAATATTGTCAAAGGTTTTAGGTCACCGGAGCGTGAGGATAAAGACCAGGAAPC17US97U9575TGAAGCGCGA 1080GCAAACCCAA ll4OTTCAGACGTG 1200TTTGAAAGAA 1260GACTCACATG 1320GCGGATCCAA 1380CCAAAAAATG 1440TTTAAAAGAA 1500GGAAACTTCC 1560TGAAGCCATG 1620TGCCGATCAA 1680GCATGGCAGA 1740AAAATCCCTC 1800GAGCGAAAGC 1860CTTAAGATCG 1920AGAAATTGAC 19802028TTTTAACCTT 60TGAGCTTAAA 120TGATTTGAAA 180TAATTTAGCG 240GGATCGGTTT 300GCCTTTAAGA 360GATTGCTGTG 420AGGCCTTATC 480AAATCCTTAC 540GGATGTGGAT 600CTTATTTTCA 660TGCGCAAGAT 720ATTCATTTTG 780816?10152025303540455055WO 98/18323(2)(i)(A) LENGTH: 486 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...486(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:ATGTTTTTTA AAACTTATCA AAAATTACTG GGCGCGAGCTGGCTGTGGGA ATGGTGGTGG CGGTGAATCG CCGGTTGAGAACGTTTCAAA TCGACTCCAA AGCAGATAGC ATTACTATTCGGTAATTGTG CTGTCAATTT TGTTCCAGTA AGTGAGACGTCAAGTTACTC CAATCTCTAT ACAGGATTTT AAAGATATGGGATCAAAAGA AAGGGTTGGC AAACATAGCA AATAAAATTTGTGATGATGG AACCTCAAAC CCTTAATTTT GGAGAAAGTTTGCAATATTA TAGAGGCAGA AATACAAACC GACAAAGGCGAAATAA(2)(i)(ii)CAINFORMATION FOR SEQ ID NO:20:INFORMATION FOR SEQ ID NO:2l:(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A)(ix) FEATURE:-103-SEQUENCE CHARACTERISTICS:SEQUENCE CHARACTERISTICS:(A) LENGTH: 1014 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)ORGANISM: Hel icobacter pylori(A) NAME/KEY: misc_feature(B) LOCATION 1...lOl402265523 1999-03-16GTTTGGCGCTTGATTGCAAAAAGGCGTGAATTCAAATGGGCAAGCACTTACTCAATTAGATAAAAGGCATCTTGGACTTTPCT/US97/1 9575GTATTTAGTG 60TAGCGAGGGT 120GCTTAATAGA 180TGTTTTAAGT 240TAAGATATTT 300GCAAAAGGGT 360TTCTCAAGGG 420TAACTTTGAT 480486?10152025303540455055W0 98/18323(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:2l:ATGATTAGATCTAGGTGCTACGAGTAAAACGGCTCTCAATGAAAAGATTTAAAGAAGACAGCTAAAGTTTCCAAATAAAATTTATTGATGCTTGGCATTAATTAGACAATGCTATGGCTACAGCTCCATAATAGAGCTAATCTAAATATCTGGAGAAATAGCTGAAATAG(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAAAAAATACTCCTTTGAATGGTAGATACAGTTACAAAATCACTTTAGAGATACAACTAGAAACAAATAAGATTGTCAACCGCAAGAGCAATCACTTGAACGATAGTACAAAAACGAA(A)(B)TAAAAGGTTTCTGCTCCCTTTACACAATATACTTGAATAGTTGAATGCGTCTGAAGATAATAAGGCAAAAAGCAACTTCAATTGGCACGAAAGAATATAGATAAAAAAGAATATGAGTGGGTTCAAATAACCAATATCAACCATTCATAAAGATTTGGGAGAATAGTTTGMOLECULE TYPE: DNAFEATURE:(A) NAME/KEY: misc_featureLOCATION l...l25lSEQUENCE DESCRIPTION:TAGTTTTTAGTTGTCAATGAGTATCAAAAGAAGTCAATAACCAATCCTATATGAGAATTTACTTACAGCAATCTTAAAGAATGTGCAAAACTGGGGAATTATTATGAAAGGATTTTTGCTCAGAATAAAACTAATGGCAAAGCAAAGAAGATTGGTTGGAATAGAAGAAGAAAGAAGAACTTATTTATGGCTAACCATGCTTACGCTTTGGGTGATGAAGGATTTTGAAGAACGAAAACGATTATTAAACCCAAAAGAATATAGATTGGGGAATGTATTAAGGAAAAAAAATINFORMATION FOR SEQ ID NO:22:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriCATGCTTTTACCCAGAAACCATACGAAGAGCATGATAAATGCAAGTTTTAAAAGCAAAGCACAATGCCCTTCTCAATAACTCTCATTCAGGAGTGGTAGACGAGCAAGCTTAGAGTAAAG-104-TTAAAAACAACCTTTATTAAACGCTGACTATTATCTAAAGAAACATAAACGCAAAAAAAATTTGAAATGAGAGAACGCTTGGTATAAGTAAAGATATTAGAGCACTTATGTATAAAATTATTAATGTCAAGTTATGGGCTTTTTTTGGTAAATAAAGTAAACTTATTCTASEQUENCE CHARACTERISTICS:(A) LENGTH: 1251 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(genomic)SEQ ID NO:22:TGTTGTAAAACATGTAAGTCATTATTTCTAACGACTAATTCAAAACGCTCATAGAAAATTTGGCTTAATGCTAATCACCATCCATTAGTGGCGTGGGGGGCTTTTAGCAAAAAAAGGTTA02265523 1999-03-16GCTTATTAGCGCGATGAAGAGCTGTAATGCAATTTCCGCAAAGCCCTTAATCAAAGAAATAAGAACACTCTTGATAATGGGAGAGAATACCCTTTGGCGAATACTAGACACTTGGTTAAAACACAGAGTTGTAATATGGAAGGCAAAAGTAGTCCTATGATCTCTCATCAGCGTGTTTGCAAGCCACTATAGGCTCAAGCCTTTGATTAGAGTATCAAATGGAACGCACATCAATGCTCTAAAATGGCGAGCAGTGGCTAAAATGTTGTGCAGGCAATAAATGATAATAAPCT/U S97/ 19575TGGGGTTTTA 60CTTATTGAAA 120TAAGGTGGAC 180AGAATATAGA 240TTTAATCAAT 300TAAAGAAAAA 360TAAAGAATTC 420AGCTGAAAGT 480TTATAAAGCA 540AAGAAGTTAT 600AACCTTATCT 660ACCCAAATAT 720GTTAAATATG 780AATAGATGGT 840CCCAGAAACT 900CAACACTACC 960CTAA 1014AGAGGGGGAA 60CATAGGCAAA 120TCAAGTCAAT 180TAGTAGTGCT 240AGAGAGCATT 300AAATTTGTTA 360TACTAACAAT 420ACAAACCCAA 480TGGAAACATG 540TAAAATGGTA 600CCCAGAAGAG 660GCAGTTAAAA 720?CA02265523 1999-03-16WO 98/18323 PCTIUS97/19575-105-GATAAACTTG ACCCATTTCT AAAAAGACTT GATGTCCTAC AAACTGAGTT TGGTGTAACT 780GACCCTACAG CTAACCATAA TAAGCAAGGG ATACATTATT GCACAGAAAA TAAAGAGACA 840GGTAAATGCG ACCCTATTAA AAATGTATTT AGGACAACTC GCTTAGATAA CGAATTAGAA 900CAAGAAATCC AAACGCTCAC ACTTGATTTA ATCAAAGCCT CCAATAAAGA CGCTCAAAGC 9605 CAAGCCTACG CAAATTTCAA TCAAAGGATT AAATTACTTA CTCTAAAATA TTTAAAAGAA 1020ATTACCAATC AAATGCTCTT TTTAAATCAA ACAATGGCAA TGCAAAGCGA GATTATGACA 1080GATGATTATT TTAGGCAAAA TAATGATGGC TTTGGGGAAA AAGAAAACCA TATAGACAAA 1140CAATTAACGC AAAAAAGAAT AAACGAAAGA GAAAGAGCTA GAATATACTT TCAAAACCCT 1200AATGTTAAAT TTGACCAATT TGGCTTTCCC ATTTTTAGTA TATGGGATTA A 125110(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1131 base pairs15 (B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)20(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO25 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc__feature30 (B) LOCATION 1...1131(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:GTGAATAAGT GGATTAAAGG GGCGGTTGTT TTTGTAGGGG GTTTTGCAAC GATTACAACC 6035 TTTTCTTTAA TCTACCACCA AAAGCCAAAA GCCCCCCTAA ATAACCAGCC TAGCCTTTTG 120AATGACGATG AGGTGAAATA CCCCTTACAA GACTACACTT TCACTCAAAA CCCACAGCCA 180ACTAACACGG AAAGCTCCAA AGACGCTACC ATCAAAGCCT TACAAGAACA GCTCAAAGCC 240GCTTTAAAAG CCCTAAACTC CAAAGAAATG AATTATTCCA AAGAAGAGAC TTTTACTAGC 300CCTCCCATGG ATCCAAAAAC AACCCCCCCT AAAAAAGACT TTTCTCCAAA ACAATTAGAT 36040 TTACTGGCCT CTCGCATCAC CCCTTTCAAG CAAAGCCCTA AAAATTACGA AGAAAACCTG 420ATTTTCCCTG TGGATAACCC TAATGGCATT GATAGTTTCA CTAACCTTAA AGAAAAAGAC 430ATCGCCACTA ATGAAAACAA GCTTTTACGC ACCATTACAG CTGACAAAAT GATACCCGCT 540TTTTTGATTA CGCCCATTTC TAGCCAGATC GCTGGTAAAG TGATTGCGCA AGTGGAGAGC 600GATATTTTTG CAAGCATGGG CAAAGCCGTC TTAATCCCCA AAGGCTCTAA AGTCATAGGC 66045 TATTACAGCA ACAATAACAA AATGGGCGAA TACCGCTTGG ATATTGTATG GAGTCGAATC 720ATCACTCCCC ATGGCATTAA TATCATGCTC ACTAACGCTA AAGGGGCGGA CATTAAAGGC 780TATAACGGCT TAGTGGGGGA ATTGATTGAA AGGAATTTCC AACGCTATGG CGTGCCGTTA 840CTGCTTTCTA CGCTCACTAA CGGCCTATTG ATTGGGATCA CTTCGGCTTT AAACAACAGA 900GGCAATAAAG AAGAGGTGAC TAATTTCTTT GGGGATTATC TTTTATTGCA ATTGATGAGG 96050 CAAAGCGGCA TGGGGATCAA TCAAGTGGTC AATCAAATTT TAAGAGACAA GAGCAAGATC 1020GCCCCCATTG TGGTGATTAG AGAGGGGAGT AGGGTCTTCA TTTCGCCCAA TACTGACATC 1080TTCTTCCCTA TACCCAGAGA GAATGAAGTC ATCGCTGAGT TTTTGAAGTG A 113155(2)INFORMATION FOR SEQ ID NO:24: ?10152025303540455055W0 98/ 18323(i)(ii)(iii)(iv)(vi)(ix)(xi)GTGGATTTGACTAATCAGCTGTTTCTATTCATAAATCTTATTAAAATTGAAAATTAATCAAGAGAAATTAATAGGGAAAGGCAAGTGAAAAAAATTTTTAATTAAAGAAATTTGAATCAATCGCTGATCCGAGTATAAGAAGTCATGCCGAAACAGATAGGAACCAATACTATTTGTTCCTTCAAACAAAACAGCGTTTAGTGCCAATCATCAACCAAAGTTATTTAATAAGATCAAAAAAATATCTCTATCAAAAGATTCAACTTGAATATTTTAGAATCTTTTAGCGACATAACAATAGATTGCAGAATTCCAATGGGTTTAACCATAAGAAAGGAGT(A)(B)MOLECULE TYPE:FEATURE:(A) NAME/KEY: misc_feat:ureLOCATION l...2751SEQUENCE DESCRIPTION:GGATCCAATCATCCTTTTGACCATTAACAATAGCTTCTTAGCGAGCTTGTAACATTTAAGTAAAATACAAGCAAACAAAATTAAACCACAAAACTACCGATAGACGAAAAATATTGAAAAGAGAAATTGATTAATGATCTTTAATGATGTATTTATTAGTAAAGATCTTTCTAAAAATATGCAAAAATGTACTTTCATCTTGAAAGAATAAGACTGGTCTAAACAAACTTTAAAGTTTGAAAAAATACTTTTTTTTCAATTTTTTGAGAAACAACATGCATCGTTCAAGAAGCTTCCTAGAATCCCACGACGTTTAATTTATATTATCTATTAGGAAATTCAHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriTAAAGAAGTCAAAACATGTATGACGACTATCAATTTATTAAACTGAATATCGGCAACAATCGCCCCTAATACAATTAGCAAGATATGGAACTTTACAAAAATACCCTATCACATGATGAAAAATCACTGCGCTCAAAAATGTCTAAAGATCAATTCAGAAATGGGAGAGTTGGTGAAATCTTCTGAGTTCAAATATAAATCAAAGAGCCATGCTAGCCAATAATCCTAATTAAAGATTTAGCAAGAAATATCAAAAAATATGATACAAGTATTAAAAATATAGTCCCCAAAGAGAAATATTCACAATGAGCATGTTTGGCTGTCATGGACTTTAAAAGAA-106-SEQUENCE CHARACTERISTICS:(A) LENGTH: 2751 base pairsB) TYPE: nucleic acidC) STRANDEDNESS: doubleD) TOPOLOGY: circularDNA (genomic)SEQ ID NO:24:AGTCATAATTGAAGCTTTAGTCAAATATTTGAATCATTTTGCCAACGTAACAATTGGTTAAAAGAATACAAAAATTTATTGACATCTTAATTCACACCAAAATGAAAATTATAAAAAAGGAAAAATGAATATCCAACAAAATTAAATCCAATTGTGCGATATAAAAATTTAAGGATAAATGCAGAATATTAATGGTTTATAAAATCACAGTTATCTGGGCAAAATTTGGAGAAATCTATTGATCAAGAATGAGAGTAAGCTTTCTTTTTGGATTCTTTAAGATAGTTACCACGGAACATGCCAATCATCTTTTCTTTATAGAGCCAGCCATACGCTCATA02265523 1999-03-16TAAAGGAATTGGGAACAATGGCACTTTTGTTAGATTTTTACCAATAATCTAAAATTTTTAAACCCAATCACTCATTTAAAAAAAGCTAGAAAACTGAAATTTAAACGGCAATTTTGAGCGGCAATAGCGATATGCAAAAATGATGTGTCAACAGATACAGTAGATAATGATTGAAGCAAAGCCGAGAGTGCTCATCAATTATAATGACCTACTGGTTTTTTTCCTTTAGATTGATAGTCACACTAAAAAAATGATAATAACTAAAGGAAGTTACAAAAGAAATTAAAAATAAATAAAACTTAAGCCAGCAATGTGGGATCCTCATTTGAGAAAATCATGTPCT/US97/19575ATCAAAAACG 60CAGTAACTTC 120GAGTGATTTT 180TAAAGATAAA 240GCTTTTCAAA 300TCAGTGTATA 360ATTTTTTATA 420AGAACTTAGT 480GGAATTAGAT 540TAAGGATATT 600ATTTAATGAG 660AAACAAAGAG 720AGAAGAGCCG 780TTATATAGAA 840GTTTTATTTG 900CAATCTTTTT 960AAGTGGCATT 1020CAAGGAAAAA 1080TAACCCCTAT 1140TGAAAAATTC 1200TGAAGCCATA 1260TCAGCTTTCG 1320GTTCAATAAA 1380TGAATCGTTC 1440GATCAAACAA I500CGATATACTG 1560TTTTGCAGAA 1620ATTTAATAAG 1680TCGTGTCCGA I740TGAAGTTTAT 1800AAGCACCGGC 1860ACATTTTAGT 1920CGTGCCAGCC 1980TACTTTTGTT 2040 ?10152025303540455055W098/18323TTAGCCACCCGAAAAGGAAAAGCAAAGACTTTTCATAACCTTGAGCGCTTACTTTCTTACAAACTTTGCGTTTAACCAACATCACCATCCAGCGCAAACGAAAACAAGGCTTAAAATTAT(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGACTGCAACTTCTTTTTGAAGATCAAAGAAAGGCTTTAAGGGGAGCGTCAAACGAAAAGCTAAGGTGGTTTTACTTGAGTTTTAATAG(2)(i)(ii)ATGACCCCTTCAGAAGGCTCCCGACGCTTTCCCAAAAACATTAAATTGTACCATTTCAGGAGTTAGACAAAAGCAACGAGTACAACTCTCATAGAAACAATTTTGTATGGTCAAATGGATCATTTAGTGGATTGTAATTAAGGGACAAAATCCCGAATCATTTTTGCGTTACGCTTAAAAACTCACCCTATTCGAACGATTTAGACTGCGATATACGCTAAACGGAGAAGATTGCATGGGCT-107-ACGGATCATTAATCACTTTAAAACGCTCTTTTTGTAGAAGAAAGAATACAGATTCAAACGGTTTTGACAGAAAAGAGCTAAGGCATTTCAAATAAGCAAAGCGATAGAAAACAAACTTGAINFORMATION FOR SEQ ID NO:25:SEQUENCE CHARACTERISTICS:(A) LENGTH: 531 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(A)FEATURE:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION:TGATGCGTTACGGTTAGTGGAATGGGTTTTTAAAAGAAAATAGTCATTGGTCAAGACCATGCATCGTGTTGCGCGTTTTTGGAGCGTGGTLOCATION 1...53lTTTTCACATCGCTTTCATTGAGAAAAATCCCCATATCGCTCACGCCTTTGTGAAAGGGGCTCAGGCGCTTAATGGTGGCTGTTCTTTGGASEQ ID NO:25:TATGCGACCACTCTTTAAAGTTAAAAAAAGATGCCTAAAATATGAAATCATTTTTAGGCGTTAGGGATTTTTTAAAGACAGCGATCTATTINFORMATION FOR SEQ ID NO:26:SEQUENCE CHARACTERISTICS:(A) LENGTH: 669 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(genomic)02265523 1999-03-16TAGATGAAATACTATCCCCTTAGGAGTGGGGCATCACGGAAGGACAACCCATATGAAAGAACGATGACAGATGAAGAAATAACAAATTGATGGAATTGAGAACAAACAAATCAAAAACTACTTTTTTCTTCGCGCCAAGAAAGAACGATTAGATAGAGCCACCTTGAAACCGCTCATCATTTTGCGTGTTCTAAACGCATGGTCTTTGTAPCT/US97/19575AAGGATTGTG 2100AAATAATGCA 2160CCAGCATGTT 2220TTATTGTTAT 2280CATTCCTTTC 2340AACCATTGAA 2400AAAATGCGTT 2460GCATGATCCC 2520AGATTGTTTC 2580CATGGCTTTT 2640AAGAAATTTT 2700A 2751CCCTTTGGCG 60CACTGGCGCT 120GGACTTTTTA 180TAGAGAGTAT 240TAAAGGCACT 300GCTGCATAAG 360TTTATTGTTG 420GTTTATAAGC 480G 531?10152025303540455055CAW0 98/ 18323-108-(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...669(xi) SEQUENCE DESCRIPTION:ATGTTTAAAA ACGCTTTAAA TATACAAGAT TTTTCATTTASEQ ID NO:26:ATTATTGGCATCAGACTATACAACGCAAGCAACGACCTTTAAAAATCTTTATTGACTTAGTTAGAGCAAACTTACAAGTACTCCTTAAGAGCTAAAACTTGATATTTAA(2)CAAATGGTGCATTTTAAAGCAATTGGGAGTTTAAATTCTATAAATAAAACCTCTTAGCCAACGCTCTTATTCATCGCCACATGGCAACATTTAACTTTAATGGAAAATCAACAAAACAATTGTCTCTAACTCAATTTTTTCTACGAACACTCACCCACAAAAGACTATCATCATGATCCTTGCTCAATACAGAAAAACCAINFORMATION FOR SEQ ID NO:27:ACGCTTATCAAATATTCCATCTATTCAACTCACAAAAACTCTAAGCGACGTTAGTTATTAAATCTCATAAATTGTCTTAGAAACCTTTAAACCACAAAAG(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1221 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(ii) (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE; NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l22l(ix)(Xi) SEQUENCE DESCRIPTION:SEQ ID NO:27:ATGTATGCGGAGGCGTGTGTTTTGTGGAATTTAAAAGATATTTTTGGAGCCTCATCCTATTTGTGGGCGCTAGACAAGCAGGGGTAAAGAGCTTGGTTTTTAAACCCATAGTCCATTAGGAGCCCATAAATTTAGATTTAAACCGATATTAAAGCCCCTACGCTGGAATGGCGATGATTGGATCTTTTAAAAACCCCCTA02265523 1999-03-16AAAATCATACACACTATTCTACCACGACAAACCCACCTGGGCACTCTAGAGACAAAAACATGGATGAACCGCTTGCGCAAATAGTTGCGAATTCTATATTACTTATTAGCAACTCAAATCACCAAGCATGCGTATCTGCTTCAAATATTTTTTTTTACGCPCT/US97/ 19575TAGTACAGCC 60AGGCATTAGA 120TGTTATACCA 180ATTAAACGCA 240TTTGTTTGAA 300GCGCTTAAAA 360AGAAACCAGT 420CACCCAACAA 480ATGGGTATTG 540AAAATCTGTA 600GTTACTAAAG 660669TCAATTTTTA 60CCCTTTGGAA 120CGCTAAAGAT 180TTGCTTTGAG 240CCTCCAACAA 300?10152025303540455055WO 98/18323ACGCATAGTATATTTTTCTTCAAATTTTAGTTTAACCCCAAATAACGATCAGCATGTTTGACCAGTGTTCTTGAAAGCTTCCCGAAATTTCATTGCATTATTGGGCGTTCGACAAGTCTCAGCGATGAATTTTTTAGAAGGCTAAAAACCTTGTTTAGAG(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)GTGTTGTGGGTCTAAAAAATAGAACCCCACGAACCTTTTGTTGAGCGGTTCAAGCTGTAGCCCCTTTTTAATCAGTAACGATCGCGCTTTATGGTGCTTGGGGGCGTATTAAAATCAGCGAGTATCCTTACACACCCTTTGCGTTTATCCAAGAGTTAGCTAGAGGAACTAGAGCGCGCAACATGTATGGATTTGTTTGAGGCAGTTGCGTAGGGCATACGTAAAAGCATTAACCCGAGAAAGAGATTGAAAGAAGATTTATCAAATCGTATCTTGGGGTCCCAAATCTCTTTTAGAATTATTTTAAGTA(A)(B)(C)(D)LENGTH:CATTCCTATGTTCAAAGAGTATTTTTTATGCGCGTGAAAGAGAGGGCTTTTTTTTCCAAAAGTTTATGCGTGGCGGATCAATCATTATCACGAAAAAAGGAAGAAATATTTCTTTCACTAAATTGCGGGGAGTCTTTCTCATGCGATCCCAAAINFORMATION FOR SEQ ID NO:28:-109-GCGCAAAGTTTTAAGCCACATCTAAGTGGGATTAAAGATAGGGGAAAAAGCGCTGGAGCCGCGATTATGGCATTTTTTGGCCCATCAAACATGCAAAACAACCGAAAACGGACGCTGAAGCTTTTGAAGGGGCATTTCTAACGGAACTGCSEQUENCE CHARACTERISTICS:1008 base pairsTYPE: nucleic acidSTRANDEDNESS:TOPOLOGY:circularHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:doubleMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B)TGCTATATTTCCATGCTCTTGAGCCGGGGGAGATGCCTTTTTTTAGAAGAGGGTCGTTTGGCTTGCCTTACTATTAATATTAGTCATTCAGGTTTATGGTTTTTGGGTTTTGTTTTTTGGGGCGCAAAATTATTTAAATTTTATTCTATGLOCATION l...1008TTTAACCAGTTGTGGATAACGCTTGGGATCTAAGGGGCCTCATTAACCTTCATCATTTCATTTCATCGCTCATTGACGGGTTATATAGACGTTAAATTTCGGTGTGCGGGGCTCAATTTAAAAACGCCAGCTTGCAACAACAACCTGCCTSEQUENCE DESCRIPTION: SEQ ID NO:28:TTATTTATTTGCTAATAAAATTTCTTTCTTTTTGTTTTCTTCATTAAGCCTCAACGCCTTTTTTTATTCGTTTAACGGGCCCTAGCAGTTCCTTCAGGAAATTTCTCTCTATGCTTTATCAAAGCCACCACGCTCTTTCATTTATTTTAA02265523 1999-03-16TGCAAGATGAGGCCTCAAATAGTTTGATATAAATTGACAAAAGATTTGAAAAACCCCAAGGGTATTTATTGCGGGCTTTTAAAGCGTTGCAAGTCTATTCAGTTTAAAAAAATTATTCACTGTGCGATCAGCTACGATTTTTGATTTGGAGCTCTTTGATTCCAAGGCTTTTGCGTTGGCTAGGGCTATCCCAAAATACGTAGTGGTGAGCTATTTTTATTTGCATCTGGTGTCTTGTTTAGATTTTTTTTGCATTTGAGCGGTCATAGATGCCGGATAAATTACCCTAATAAGCGTTTTPCT/US97/19575AATCAGTGCG 360TTTAGAAACT 420TATCTATCAT 480GCAACTCCAC 540AAAATTGGTG 600AGTGCCACAA 660GAGTTTTGAC 720CCATGATTTA 780AGGGCTTGAT 840CTTTGTGTCT 900CCGCTACAAA 960GCTTTATAAT 1020TTTGAGCGCG 1080AATCCAAGGA 1140TTTAGGGAAA 12001221TGTTTTGTGG 60CCATCATGCA 120TTGTTATCTT 180GCTAGTGTTT 240CCTTATTTTG 300CGATTTTTCG 360GCTGGTGGGT 420GATTTGCGCG 480GCTCGCTTAC 540AGGCGATGGG 600TTTGGAGCAA 660GGTGCTTTTT 720TTTGCATTTG 780CCCTTTATGC 840GTTTCGCTTG 900?CA 02265523 1999-03-1610152025303540455055W0 98/ 18323 PCT/US97/19575-110-GACGCTTATG CGCTCATTGT GATTAGCCTA GTCTTTATCG CATGCTATTT AATAGGCTAT 960GCTTATTTGA ATAGGCAAGT TTGCGCTTTA GAAAAGCGGG CGTTTTAA 1008(2) INFORMATION FOR SEQ ID NO:29:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 291 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...291(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:ATGAAAAAGG TTATTGTGGC TTTAGGCGTT TTGGCGTTCG CAAATGTTTT AATGGCAACC 60GATGTTAAGG CTCTTGTAAA AGGTTGTGCC GCTTGCCATG GGGTTAAGTT TGAAAAGAAA 120GCTTTAGGTA AAAGCAAAAT CGTTAACATG ATGAGCGAAA AAGAGATTGA AGAGGATCTT 180ATGGCTTTTA AAAGCGGTGC CAACAAGAAT CCTGTCATGA CCGCGCAAGC TAAAAAATTA 240AGCGATGAAG ACATCAAAGC TTTAGCCAAA TACATCCCCA CTCTCAAATA A 291(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)INFORMATION FOR SEQ ID NO:30:SEQUENCE CHARACTERISTICS:(A)(B)(C)(D)LENGTH:TYPE:TOPOLOGY:circular471 base pairsnucleic acidSTRANDEDNESS: doubleMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(A)FEATURE:(A) NAME/KEY: misc_featureLOCATION l...47l(B)SEQUENCE DESCRIPTION: SEQ ID NO:30:?101525303540455055W0 98/ 18323ATGCGAGATTGAAAAACTGGGGGAAAAGCGTCAAACATTGAGAGAAGATGTTTTTAAACCAAACGCTTATTTATTAGATG(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)GTGATGCTAAATGAGTTTATTTAAATGATTAGCAGAAAGGAAAGAACAAGAAAAAATTTG(2)(i)(ii)(iii)(iv)(vi)TCAATAACATATCTGGAGTTTCCTTATTGCAAGTGGAATTAGCATGAACCAAACAAGCCTCTAACGACAGGCTATATCCA(A)FEATURE:CATCAAATCACATAAAGATGGCGAGCCTTTTAGATCGCGCCTCTTAGTTATTATCTAAAAACATTCAGCCAGAAATAAAAATINFORMATION FOR SEQ ID NO:31:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori-111-CGCTTAAAAGTTGAGCGCGAGGGGCGTTTGTTTTTAGACAAGCGTGATTAACGCTCAAAGAATGAACTCAAGGCGTTTAGSEQUENCE CHARACTERISTICS:(A) LENGTH: 357 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B)TGGCAATTTTTCGCCAATATTTGTTTTTGGCTATGGAAAATAGATATTAGATTTTGTTATLOCATION 1...357TACCCCTTATGGGGTTGGAGTATAGAAGTGTCATCTTATCAGAATTTGAGTTTTAGCAAAINFORMATION FOR SEQ ID NO:32:SEQUENCE DESCRIPTION: SEQ ID NO:31:ATTCTTATTTCAAATTTTTTGGGCTTGATAGGTCTTTTTGGATTTACGCCGAGAAAACTTSEQUENCE CHARACTERISTICS:(A) LENGTH: 1068 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(A)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriMOLECULE TYPE: DNA (genomic)02265523 1999-03-16TGCGTCAAAATTAGTGGGGCGGCTTAAAGACGGAAGAATAAAAAAGAAAACGTTATTAAAACGATATTTTCCCCCTTTTATGAAAATGATGCAACAGAGAGCAATGCGAGTCCAAGCTCAAGGCTTTTGGATTTTCATAGPCT/US97/ 19575TGCCGTTTTT 60TAGTGGGGTG 120GAGCAACGCT 180CGGCATTTTT 240AACACGCTAT 300GGGGCTTATT 360AATGCTCTCC 420G 471GAAAAAGTCT 60CATTAAAGAT 120AAAAAATCGT 180ATTAAATTTT 240AAATGATACT 300AAGCTAA 357?10152025303540455055W0 98/18323(ix)(xi) SEQUENCE DESCRIPTION:ATGAATATCACATTTATGGGGGGAATTATTGGCTGCACGCAAAGCCCTAGTTAGGGGGGCGCTTACGCTATATGATAGAAAATTTTGATAGAAGTCAAACGAGGGGCAGGGAAGATTTTGGGTTGCGCGAAAGGCTTTTAATGGGCTTTAAATTATGAAATATTACAACAGGCATGAAAC(2)(i)(ii)FEATURE:CA-112-(A) NAME/KEY: misc_feature(B)AAATTTTAAAGGAAACAAGACTAAAGCGGCAATTAGGAATAATATTATAATTTATGATGAAGGCATGCGTAAATCAAAGGTGGCTAAGGGAGAGCAACCACTTGCCGAGCAAGTGGCGTTGTTTAGGCTCACTATTTCAATGTATTCGCAGAGGTTGCGATGAAAGATAAAGGCATGCGALOCATION l...lO68AATATTAGTTCAATAGCTTTGTCTTATTTTCATTTATGAAAACCGCATGCGGGTTTAGGCTTTAAAACACCAATGCCGCTGTGTTATATTTAAAGCCGTTGTTAGGGAGTTGATTATTTGTATGTATATGGCAAGCATGCAGGGGACACTTATGGGCGATAGAAAACGCCAAATCTCACCINFORMATION FOR SEQ ID NO:33:SEQ ID NO:32:GGAGGGTTATTTAGGGATTGAAAAAAGCATAACGGGCAAGCAGGCTGATGACGGCTCAAACCTGAGAGTTCAAGCGGTTATTAGGCACTGATCTATTATTTTGTTTGAAACAAAAAGCTTTTGGGCAGGTGATATGGGGAGTTTCAAAAGGAAGTGGGTTATAATGATTTAAACTCAGGGSEQUENCE CHARACTERISTICS:(A) LENGTH: 582 base pairs(8) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)SEQ ID NO:33:ATCATGAGCGAAAAATTCGCTTTAACGCCATTAAAGCCTCCATGGGGATA(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(8) LOCATION l...582(Xi) SEQUENCE DESCRIPTION:ATGAAAGAAA AAAACTTTTG GCCTTTAGGAATCGTGGTGT TTTTAGTGGT GTTTGCCCTATTCAAGGGTC ATAACGAAGT GGATTTAAACTTTAAATCCA ATTATCGTTT TTCAGTGGGTCCCATTTTGC CCTATTTTTC TAAAGGCACGTTAAACAACG CTTTGATTTT AGAAAAGTCCAACACGCTTT02265523 1999-03-16TTTTTTTGAGGTGAAAGAGCGCAACGATGGGCACTAGAATATAGGGAAGGATTATCAAGAGCTACAATTTCTTACTATCACCTATGAAAATGAAAGCGTGATGGCGATGCGCGCTTTAAAATGTTAAAAAGCGCGGTGAGACTTGAGGAAGCTTCGCTCTATGACAAGGGGGTATTAGTGCTTATTTTCTAAAAATGATGCTTAAAACTTACCGAAAGAAAAAATCCAATGCACAATTPC T/U S97/ 19575CTTGAACGCC 60CTATAAAAGC 120GGTGAGTGAA 180AGATTATAAA 240GTGTTTTGGC 300AGCCATTGAC 360AGGCATCATT 420AAAAAGCTGT 480AGGCTTTTTA S40CCGATTGAAT 600AGGGCTTGAT 660CAATTCTGGT 720AGACCCCCAA 780TTGCTCTAGG 840AGCCCTTGAT 900AGCGGGCATG 960CTGTAAATTG 10201068TGGGCTTGGG 60TTTAGTGTAT 120TTATGAAAAC 180CCCTAAAACC 240AGAAAACCTT 300GCAACCGCTC 360?10152025303540455055WO 98/18323CAAAACCCGCTT TAGATTCGCC AAATATTCAACAGCCCAGAT TATTAGGAAC GCTTGATTGTTTGTTAGAGG GCGATAAAGT GGGGCGCTATAAAGAAGAAT TGATTTTGGA GCAACTGGCT(2)(i)INFORMATION FOR SEQ ID NO:34:-113-02265523 1999-03-16PCT/US97/ 19575GTGTATTTAG CGTTCTATCC CAGCCAATCCAAAAACGCAT GCGAACCTTT AAAATTTGATAAGATCCTTT TTAAATTTGT TTTTAAAAATTTTTTTAAGTSEQUENCE CHARACTERISTICS:(A) LENGTH: 870 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(ii)(iii)(iv)(vi)(ix)(xi) SEQUENCE DESCRIPTION:TTGGGTATCATTAAGCTTGTGAAGAAAACAGAGCTTAAAGATCCATAAGATCCATCTTATGGCGATATAGGCTTCTCCCTAGCGCCTTACTCTTTAGCTTGACAAAGAAAATGTATCAAATTAAATTTAGATGCCTCCCTTATTATATTA(2) INFORMATION FOR SEQ ID NO:3S:(i)(A)(B)FEATURE:(A) NAME/KEY: misc_featureLOCATION l...870ATATGTGTTCGCGCTGAAGACCCCTAAAGAAAGAAAATGAAAAAACGCCATCCAACAAATGGATTAACGCTGCTGTATGGGCTTTTATGGCTTATCAAACAAAGGTTTGCATTTAAAAGAGGGTGAGCATTAAAAGAAACGTTACAACTAHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriTAAAAAAATAAAATATCACCCGCTCCCATTAGTGGCAAAAGCTTTACATGGGCTAAAAATTAATCCTTATTTTAAGGAGCGGAATATTTACGCAAGCTTGGTTAGGGATAGATTAGAGGGGACGCTCAACTTCGCAAACCTTTATTGTAASEQ ID NO:34:AGAAATCTCAAAAGAAAACACTTTTGGAAGAAGATTGATGCTCAAAGGGGAAGAGCGGCTGAGAAGTTTGGGGTATCAAAGGGGGGGCGAAATATTGATCTTTGGAGGCGTATTCACAGCCTCAAACACCTTTTTATATTSEQUENCE CHARACTERISTICS:(A) LENGTH: 2007 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NOAGTTTTATGCTTTGACTGAAACAAAAACGCGCAAAAAAGCCTAATTGCATGATTTTTATAGGAACTTTTAAGAGTATTTCGCTGAAAGGGTTTGTTGATGGATTGGAGTGGGCTAACGCCTTGCTTTGAATTATTTTAAAAGTGGTTTTATTGAACACGACTCCAAACTCTAGCTTGAAGAAAAAGAATGAACGTGATCCTTCAATATTCAATAACGGGATTTAAAAGCGATTAAGCCTATTGTGGAATGGGTGGGTTGGTGAGCCCTAAAACACTAATATT................ ............«...,..................................4.....,, . ,. .420480540S8260120180240300360420480540600660720780840870?10152025303540455055W0 98/ 18323(iv)(vi)(ix)(xi)ATGAGAAAACGGCTTTTTCAAAAAGACACAATTTTAAAAATCATCTTTATTTCTTGCCTTATTGATCTAGGCGTTTGATAAAATTTGAAGCTCAATAACAAACACTTGTCCCACAAACCGCAATCTTGGGTGCGATAGCGGTCGATCAACGAAATTGATGAATGATGGTGTTTGGCAACGAGCCACACTAAAAGATGGTCTATAATGTGTAATTCCATCTGTTTGGCAGCCAAACAAACTAGCACCATCCTCGCAAAGTTTTTAATGATTGTTAATCAAAATCACCACTTTCATCTTTTGAAAGTCAAAGTCTAAATATTAGCGGTGGCGTTTTTCAATT(2)(i)(A)FEATURE:CAANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Hel icobacter pylori-114-(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION:TATTCATCCCTAGAAGCCGGCCACCACAAAGAGCGGCTAACCCCTGTTAGATAATTTAAAGCGTGATAGAGTTTAAAAGACCACTAGCACTTAAAACAAACTTACAATAACAGAAGAATTGCGATGCGATATCCTTCAAAAATATATACTCGGTTGTTTTAATATGGCACACCTTAAGACAAGGCTATGGAAGTGGAAAAGTTCGCTTTAATCACAATTGAGCTCATCAAACAACCTAAAAAAAAACCTTTTAGAAGCCCTCATAGGGTTAAGTCCAGCAACTCCAATAAGTATCTTTGGGAAGCGGCAACTGTAGGGATATTATACGAAACGGGTGGGTLOCATION 1...2007ACTTTTATTACTTTGAAACTAAACACTTACTTTATTCACCAGTGTTGTATTAATGTTAAGGACCATCCCCGGCGTTTGATTTCTATTTCTTCTTATAATGTAATGGTAATCACCAATTTACTTAAACGCTATGCGTAAATCAACAAACAAAAAAAATTCAATTAGGGGTATATCAATTTAGCATAACGGGGGATAGTAATTGGGGGATCCTGCGGATGTCTCAAAACGCCCGCTAGTTTATGTAACTTCTTATTTTAGGGGGCTTATTATATTGAGCTATAAATAGCCCTGGGGTTAAGGTTTAGATGTGTAGCATCCCTCTCTTTTGTTGTTTTAGINFORMATION FOR SEQ ID NO:36:SEQ ID NO:3S:TTCAGCGCTTGGGCTATTAGGCAACTTACAAATGCCGAAGATGTATAATGCTTAGTTTTAAAACACTCTAAAAATTGACCGATACTAACAAAATATAGTAACAAAAAATGATGTTGAACACCTTTTGAATCCCGGAGTAAGGTATTATTAGGGGTTGTAGGAAGCCTATGGAAGATTTAAAATATGACCTGGCAAGCCAAAATCAGCCCGCCGGCTGGCTTTGCCGATCAAACACGCAAGAGCGTTACCAGTTAACGCTAGGCATCATCAGGTGGGGGGAACAGGCATTCGGCTTGTATAGCTACCGGGTTTAATCCAAATTCAATGAAGSEQUENCE CHARACTERISTICS:(A) LENGTH: 192 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular02265523 1999-03-16TAGAAGCGAAAAGGCACACAATTATTTACCCGATTTCAAAGTCAATTAACCAGACGCTCAAGATTGTTTTCCTATACTTTCGCAGAGGGTATGAAAATCCATTGTTGGCATGATCGCTGTTCACTAACAGATGGGCGTGTATAATTTTAGGGTTAGCCAACTTTAGATCCGAACCATCTTATCAAAGAGTAAGATTCTGACTTTCCCTAGTTTTAGGGGTACTACGCTAAATTTAGCCAAACCACCATTTAAATAGGCTAAATACAATTATAGATTTGTTAAACCAAAAGACAGCTATTATGAACTACCGGAAAAGCTAGGGGCTAGCCAPCT/US97/19575CGAGAAAAAC 60AACGCAAGAA 120CACAGACACG 180ATTAAAATTC 240TATAGAAAAC 300AGGCAACACG 360ACCCGGGGAG 420ATTTCTTCCA 480GTTTGAAACG 540AAACAATTTC 600AAATTTCACC 660CTTAGACTCC 720CTCAACAGAT 780TGATACTAAA 840AAAAAAAATA 900TGGATATGGC 960TAAAAAACTC 1020GCATGAATTC 1080GCCGGTAACG 1140TGGCCTCCCC 1200CAACTACCCT 1260AACAGCAGCG 1320CTTGGGGAGT 1380TTCCATGCTC 1440TTCAAACGCA 1500TCAAAACTAC 1560CGCTAAAGCT 1620ATTGGATTTC 1680GAATTTTTCT 1740TGTGTTGAAC 1800CTATAAGCAT 1860CGTCGTTTCT 1920CTTTAAGGTG 19802007?10152025303540455055CAW0 98/ 18323-115-(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...l92(ix)(xi)ATGAATACAG AAATTTTAAC CATCATGTTA GTTGTCTCCGTTAATAGCGT TTTTATGGGG GGTTAAAAGC GGTCAGTTTGGAAAGCGTGT TGTATGACAG CGCGAGCGAC TTGAACGAAGCAAAAGAATT AA(2) INFORMATION FOR SEQ ID NO:37:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1221 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l22l(ix)(xi)02265523 1999-03-SEQUENCE DESCRIPTION: SEQ ID NO:36:SEQUENCE DESCRIPTION: SEQ ID NO:37:ATGGTATTTTTTATTCCATTCTTTTAGTGGAACCATATCCGAAATCCAAAGCCCTTATCCTTTTTAGACTCAAACTTCGCTTGATGAACGGCTATCGTTTATGGCGATGGTATTACGATTTTCATAAGAATATCCTATGGGTGAAAGGCTCCCAAAAACTGCAATGTTACCTATTAGCCATTATCCCCATCCTATCAAGACGTATAAAAAATACAAGGGATTAGCTCTCGCAAAAGCGCAAATTATTTTAGGTTCTTTTATGTGTGGGATCTACTACAATCTACTACACTGGATTTGCAATGTTTTCACTTATTGTCAAAAAGCGTGCCTTTATCGTGTGTTTGCACCAAAGAAGTGGCAAATTTTATCTAAAGCCGATGAAGCTCACGCTTGAGCTCTCTTAAGAGATGATCCATATTTCGTAAAGAAAGCCACCAATGTTTAAACGCCGGGCAAGCGTTACTATCTTTGGGTTTTTAC16TGCTTATGGGACGATGAAAACGATTTTACAATTCTTTAATGAATGGCTAATGTTAGGGTTAAGATAAAGACAAATAACACACAAAAAAGGGAACCCTCCTACCCCCTTTTTAGTGAAAAATTGGCCAGCCTTTCCCATTCTAGAAACCCCPCT/US97/19575ATTGGTAGGC 60ACGCATGCTT 120AGAAAAACGC 180192GGTTGCTTTT 60AAAGCAAACT 120TTTAGAAAAA 180ATTGAGTGCT 240GCTCATTCAA 300AGAGGATTAT 360TCTTTCCTTA 420AGCCAACCAA 480CGATAAAATC 540GACCATCAAA 600AAACGGGCGT 660GGTGAAATAC 720?101525303540455055WO 98/18323ACCCGCATTTCCTCATTACGGGCCGTGTGGAATGAATTGCTCGTTCGTTACCGCATTTGCCGCACCGCTATATTCTAAGCTATCTTTTAG(2)CTTCGCCTTTGCGTGGATTAGTTTTATAGGGCTTGGTGTAAAAAAGGGCAATTTTGGCGTAAAGCAAGCTAAAAATTAGAAGGGTTTTTACATTCGTATGGGTGCGGCTAAAGGTTAAGGCGTGCTCACATGAATCATAGGAGTATAAAAACGCATGGCAAAAGAACTTTTTAINFORMATION FOR SEQ ID NO:38:-116-AGGTTCCATCCATGGCAGTTGGTTATGGGAAGCGCGTTCGAGAGTGGGAATCCCGCCCCACAAAGAGAGGAAAACCCATT(i) SEQUENCE CHARACTERISTICS:891 base pairs(xi)TTGTTTTTAGTCGCAAGAGAAAACGCCCCAAACATGGTGTGACAATTCTTGAAAAAAACCAGTCAAAAAAGAATATTCCCGGGGATCAATAACGATAAAGCAAATTAAGGAGGCCTTTTTAATAAGGCTTACCGATAAATCGCTTTAAGA(2)(i)(((((LENGTH:TYPE:A)B)CD)MOLECULE TYPE: DNAA)FEATURE:) STRANDEDNESS:TOPOLOGY:nucleic aciddoublecircularHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc_feature((((B)TCAAAAAAATGCTTTATCAAGCTATGTGGAATCAGCCTATTTAACCCTGATACTCTCATAATCCGTTCCTAACAAGATTTGGTTGATAGAATCGCCAGATGCAAAATTTCATGAATCGTTTAGATACTATTAGACAGCCAGCGATACGGALENGTH:TYPE:A)B)C)STRANDEDNESS:LOCATION l...89lAGGCGTGGTAAATGCAAAAATTCGGATTATAGAGGAAAGAAAATTCCGTGCCCAAACGATTTACAAGCCCCTACCCCCTAAATCCAATCCCCAAACTTTCTTCGTATGTTTTTGTTAGAAGGAGATTTCAGCATAAAGCCACTCTTTTTAINFORMATION FOR SEQ ID NO:39:SEQUENCE DESCRIPTION: SEQ ID NO:38:ATAATGATTTAAAGCCCAAGGAAGTCTTTAAACGCTTTTTATTTTACTGACCCAATAACAAAAAGAAAAAAAAAATGGGGAAAGCCTTGAACTTTTAATGTATACCACCAAAAAAGAGCGAAGTGTCAAAATCAGTATTGGAATGTCTTASEQUENCE CHARACTERISTICS:747 base pairsnucleic aciddouble02265523 1999-03-16CTGTTTTAAATGATCCATTCAGGTGGTTGACTAACGGATTGCACGGGTTTTTAATCCTTTTTTTTTTAGACTTTTGAAAATAGTCTGCTTAGCAAGAAAAGCGAAACGATTCCAACTGACATGAGCCAAGATGAAGACAACAAAAAACCCATATTATCATAGCGTTTTTTACACTAAAACATAACGGTAGATAATGTTTATGGTGTTAAAATTTGGATTTAGGAAAGTTAPCT/US97/19575AGTTAAACGG 780TGCTTCAGAC 840AATCCATTTG 900AAAAAAAGGC 960AAGCACCGGG 1020AGGCTATATC 1080AAAAGCTCAG 1140AAATTCATTT 12001221TTTAGCTTGC 60TGACGGCTCT 120TTTTTTACAA 180TAAAGATGAA 240CGATAATAGT 300CGCTAATAAT 360AAAACTCATT 420GAGTAAAGAA 480AAAAGATCAA 540GCAAATCGCG 600CTTGAGTTTA 660TACGATAGAG 720AAAGCATTCA 780TAAAAAAGAG 840G 891?101525303540455055CA 02265523 1999-03-W0â 98/ 18323-117-(D) TOPOLOGY: c ircular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...747(ix)(xi)GTGAGCTATGTATGCGACAAGGGAATGTCCTATTTATTGAAACACCGATGAGAGGCTTTAGATGGGATTTCGTTTAGCGTTTCTTCTATAGGGTTTGAAAATGGGGCCTTGGCAAAAAATGAATTTTCTASEQUENCE DESCRIPTION:ACAACACCGATGTCTGGTTTGTAACACCAATAGATTTGATATTACTTGCCGGAACGGCTCTTACCGCTTCGGTTTTTTGAACGCTCCCACGGGCGACTTGTGGTGTTGATGTAAAGGGCTTGGGAACAAGTGATTATTATGCCAAGCTCTAGTTTATGGTCGCTCGTTTTCTTAAACTCCAATCACACCTTACTGAATTGCTTTGGTTTCCACGACGGCGGAGGGCTTCTTTTCCCTATAGTGCTTTAACGTTTTAASEQ ID NO:39:TTCCCTAGAAGGCACGCTCAAAATTCGCCGAAAACGCAAGACTTTCTACAAAAGATGAGTAGCTATGGGGTTAACCTTTAAATTTTAAAGACAGGCTTACGCGTTTTTCACCTAACATGA(2) INFORMATION FOR SEQ ID NO:40:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1008 base pairs(B) TYPE: nucleic acid(c) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...lOO8(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:16ATGGGGTTATATTCTTGGAACTTACCACCAGGGGCTATATTGGGGGGCGTTTGGCTTGTGTGTTAAAAGCAAACCCCAACATTATGGCGTAGATTGAATGACCAATGGGGACGATTACACPCT/US97/1 9575CTTTAGTTCC 60CGGGTTAGGC 120TTTGCAAAAA 180CTTTAGGTAT 240AACCACGGTG 300GCTTGGAGGC 360GGCTAAAATG 420TAGGGGGAGT 480TGTAGGGGCT 540GATTTCGCCC 600CGATGGCAAT 660GCAACATTTT 720747GTGCAACACT TCAATTTCCT CTATAAAGAT TCTTTATTTT CTATCGCTTT ATTCACTTTC . .................W..I....â........m-.-.-.m.â.....(............,.~. F!4>1r .,.(. .60?10152025303540455055WO 98/18323ATTATCGCTCAAAAAATTTTGACGAGCTTTAAAGCGGATGGATGAAGAAATTGCAGAAAAGCGTTGTTGAACTTTGGAATTATTTAATGCGCGTCGTTAGTTTTGGCAAGATGAATATCCCAAGGGTTGCCTATTGCATACAAATCTTTCATGGTGCTTA(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAGGAAAAGAGCCTGATTAAAATCCGCCTTGAAAAATACATCATGGGGAGTAAGGGCGACAACCCCTCATTTTTGGTAATTTCATTGCAAATCTAAAGCAAGAAATTGATGATGGCGCGGGCATTATACGTAATATTTAACAAACACATTGTGATTTTTGCAAAAATTTAAAGCATGCTGGAAATGAGAAATCGCTGTCAAAAGACACAGCTTTTGCAGTTTGGAAGAATTTAATAGAATTTGAAAAAAAATTGATACCTGCTTTTATTTTTGGATCAGCCCTATAAACTTTTGAAAGAAATCTCTAACAATTAGAACAGCGCCCAAAATTAAAATTTCCCATTGAAATCTTTAGATTTACGTGAAAGAATGCGTATGAAATTAGAGGTGGAATAAGGAAAATCGCTCTGAACCGAACGGTTTAGAAAAACAAACCTTGCAGCGAGTCTGCCATAGGTGTAAAAACGCATINFORMATION FOR SEQ ID NO:4l:-118-GCTAGAGCGTCAAAACGCCTAGTTTGATGTTTAAAAGGGCTTGGCTAAAAATTTTGCGCTTTAGAAAAAGCCTAAAATTGGATGCGGCTAAATCACTTAACTAGAAAATGCATGCCCTTTCAAATTTTTGACTTTTGAATCCTGTGTGTTGCTATGGGAGSEQUENCE CHARACTERISTICS:(A) LENGTH: 1242 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(A)FEATURE:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc__feature(B)SEQUENCE DESCRIPTION:TTTTTTCTTACTAAAGTGGAAAGAATTGAAAAGAAGAAAAACGCCAAAAATTCAAAATCAAAGCTACTGAATCCTAATAATTGTTAATGGTGAGTAAGGCAGCGCTTAAAAACAACAAGGAACTCTATAGTGCTCACGAAAGGAGCAATTLOCATION l...l242TATTTCTAAGAGCCTTAGAAGAGTAAGGAAGAAAGAAACATCCCACTCCAAGGCGTTCAAAAAAAATAAGCGCTACCAACTTCGCCTATCTCAAGCTAGGAATCCATGTACATGGATTTAAGATCAACTTTGTGGATACCCAGTATCCCCSEQ ID NO:41:GTTCTATTATGGGAGGAAGCTTGAAGAATAAAAGCCAAGAAAGATCACGCAACAACGCGCGAAACAAGCCAACACCCTTGACGCTGTATCGATCGTTTGAGATGATGACAGACCATTTCAAAAGAGCATTAGCTCTGAAAACAGAAATAG02265523 1999-03-16ATTTCACCCGATGCGAGCAGTTTTAGCTAGTTTTGAATCGATTATTTTAGTTTCCCCAAGATTATTCAAAAAACGATTAAAAATCTTGCAAATCGCATGATGATCGATCTTGCAGGACATAATTAGAGGTACCGCTGCAAACCAGTTAGCTGGATTAATTATTGGGGTAAGAGTCTTCAGGAATTAAAGAAAACCCAGCTCCTAAAATCAAAACCTGACTAGCTCTCAAAGATAAGGTAAATCCAAGATCGCTGAACGAGCTAGACCAAACAGATGCTTAGAAATGCACCAAAATGCGAAACCGTGCGPCT/US97/ 19575AAAGAGAAAC 120CGAGAATTTA 180GGCGTATTCT 240CCCCTTAAAA 300CGTGGGGTAT 360GAATGTGGAA 420GGCTTTAGAA 480AAATTACCTC 540TGTTTCAAAA 600TGAAAATCTT 660TTTATGGGAT 720CGCGCGATCT 780TTTACGCGCT 840GCATTGCAAA 900GTTTATGGAT 9601008GGTTTATGCA 60TTTGGATAAA 120GAATAAGGAT 180AGCAGAAGTC 240CAAAGGGAGT 300AGAAAAAGAT 360ATTCAATTCC 420CGTAGGGGGC 480AGAGCAAGAA 540CATTAAAAAC 600AGAAATGGCG 660TATGGCTGAG 720AGAATTGTTG 780CGAATATTAC 840CTACACTTCC 900?101525303540455055W0 98/ 18323ACCAATCAAGAGTAAGGCCAATTTCGCATGACCTTTTATATTCATCGCCCAAATTGCGCG(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)ATGATTAAAAGTGAATGGGTAATTACTCTGGTAGGCTTTGACTTCAGGGAATTGTCAATCGCCGGAAACAAATTTAGGCGCCTATGGTTAGATTATGTCT(2)(i)(ii)(iii)(iv)AGGATTTAGAATGAAAAAATAGCAAGGCTCTCAAGGAAAAAAAAATTAGTTTAAGTCTAGCAAAGGGCTATGAGAGATGAAATTTCACGCCCAAGGGGTAAAGGAAGAATCTGATTGTGATGINFORMATION FOR SEQ ID NO:42:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:-119-GCAGACCCTAACCCTAAACCGTTATGAATGAATGAAGTGAAAGGATAAGAATCAGAGAGTSEQUENCE CHARACTERISTICS:(A) LENGTH: 561 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B)GAATTGCTTGTTTTCATGGGATTGGCGTCACCAATAAATGCTGAACACACTCATTCCTTTCTTGGATGTTGAAGAATGCGATCAGGGTAGTCACTTTCTALOCATION l...S6lTATTTTAAGCTGCGGGTTATTGGCAATGACGTTTGGGGCTCAAAACCAATGGATAAATTCCCCTTATGATTGTTGGGGATCAAAGATGTAGINFORMATION FOR SEQ ID NO:43:HYPOTHETICAL: NOANTI-SENSE: NOSEQUENCE DESCRIPTION: SEQ ID NO:42:TTGAGCGCGACAACAAGGTCCTTTATGGTTAGGGTGTATGTTGCTCACCTGCTCTAGGTCGTCAATCAAACGCAGTGCGTGGGCTTATCCSEQUENCE CHARACTERISTICS:(A) LENGTH: 729 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic) 02265523 1999-03-16ATTTGGAAGTCTCAAATCGCGGGGTGGGGGGCTTCAGTCATTTTAGAAGAGAGTTTAGCGTTGTTATGGCCCTGAATTTCAAGCTTTTTAGAATGGCGGCGGTCATTGGTGGCCAGATTCCATTGAAGCGGGGCTACTATTCPCT/US97/ 19575CCCAGGGGTG 960CCAAGTCTTT 1020GCAGTTCATC 1080GGCCAAGCAA 1140GCATTTTGAA 12001242AGCTGGCGAA 60TTATAACAGC 120ATTAGGTTTT 180TTGGTTTAAC 240TGGCGATTTG 300CGTTCAATTA 360GTTCTTATGG 420CGTGAAATTC 480TTGGTATGTG 540561, ..........._......â.,.. .,.., .. _,?10152025303540455055W0 98/18323(vi)CAORIGINAL SOURCE:-120-(A) ORGANISM: Helicobacter pylori(ix)FEATURE:(A) NAME/KEY: misc_featureB) LOCATION l...729((xi)ATGAAAAAATGGCATGGATGCATGCGGATACTCTTGGGGTGACTACGCTCCAAGTGGCTACCCAGAACTTGTCATCAATATCATGGCTTAAAGAAAGCCACATTCTAGCAGCAAAAAATTACTTTCTAG(2)(i)TTTTTTCTCAGTAATGGCGTTTAATTCTCAATCAATTTTTATGCCAATTCGTCAAATTCTTTGAGCCGAAACGGCATCATTGGCGACACCCTTCTTTCCATTGAAGCGGGTGGATATAGGATCTTTGTTATTTTTTAGGGAAAACAAGCCCTTTGAAAAATATTAAGCTTTGGGAAACAACATGCTCACTGAGTTTGGGGGAGCTTTGAGATTTTTATTCCGTGAAATTCGTTTAGGCGCINFORMATION FOR SEQ ID NO:44:SEQUENCE DESCRIPTION: SEQ ID NO:43:GCTCTTATTAGCGGGTTATTACCAACGCTACACTTTGGCTAAAAACCCTAGAAATCAATCTATGGGGGGGGCTTTTGGCGGGCATTTTAGAATGTGGGGGCCCATGCTAAGTGTATTCGTSEQUENCE CHARACTERISTICS:(A) LENGTH: 771 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(ii)(iii)(iv)(vi)((ix)A)FEATURE:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM : Helicobacter pylori(A) NAME/KEY: misc_feature((xi)ATGGGATACGACCCTTGGTGTATAATAATAGAGTCGCTTGGATTACAAGATATAACAATTGCGGTGGAATGGCATCATGTTTTAGAAAAGB)SEQUENCE DESCRIPTION:CAAGCAAATTCAGAACACCTAGGAATATGACTTATATTCTAAGCGGTTGATGGGCGTGATATTTTAGAATATATGGAGGGCGATGCATAALOCATION l...77lAGCTTTAAAGTGAGCAAAAAGCGAGCGGCTTTTAGGGATCATATTTCCAAGTATAAAGAGAGCTACAGAGCAGGGGAGTTGGGCAATGTGSEQ ID NO:44:ATTTGTTTGGGGGAATTATATCTTTTTATAATGTATGAAAAAAGCTGTTGGGTAAGGGAGAAAGGTTATACCAAGTAACTGAAGCTTATA02265523 1999-03-16TCTCTATGAATGCAAGGACACGATCAAAGGTACGCCTTTAACTATAATAGGTTTAACAAACTATGGACGTGGATACAATTTGGAACAAGCCTCGCTTAAGAGAAAAACCCGGTATGTGAATAGGTTTATGTTTATAAGGGAGAGCGCTATATGGTAGGGGATAACGATATTTCCTAAAGACTAACGCTTAATGCGAAAGCTTCTCCTAGGPCT/U S97/ 19575TGCGGTATCT 60GGCGCAAATG 120CTTTGACGCG 180TGGGTTTTTT 240CGAAGCGGCG 300CATTGCCGAT 360GATGGTTAAT 420GGCCGGCAAT 480CCTTGTGAGC 540GATCTTAAAA 600CTACATCACT 660TTACGTGTTC 720729TTTATTTAGC 60AGAGGAGGCT 120TAAAAATGGT 180TGTACCTAAA 240ACCTAGAGGG 300TGAAAAGAAA 360TATCAACTTA 420GACAGAATGT 480GGATATTTAT S40?10152025303540455055WO 98/18323CATATAGCGGGA ATGATCAATT GGGTATTGAGAAAATGGCGG CTGATGTGAG TTCTTCTAGATATGGGTTAG GCGTGGAAAA AGATAAAAAAGATTTTGACA TTGATAAAAA TTGTAAGAAA(2)INFORMATION FOR SEQ ID NO:4S:-121-02265523 1999-03-16PCT/US97/19575CCGGACAAAG ATAAGGCTGT TGTCTATTATGCTTATGAAG GGTTGTCAGA GTCTTATCGGAAGGCTGAAG AATACATGCA AAAAGCATGCAAGAACACTT CAAGCCGATA A(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(iv)(Vi)(ix)(xi)ATGAGAAAACGGCTTTTTCAAAAAGACACAATTTTAAAAATCATCTTTATTTCTTGCCTTATCGATCTAGGCATTTGATAAGCACTTCTAACAAATTTGGGAAGCCTTTAGTTTTAGACTAGCCCAACAGGTCAATTCTAAAAAACAAAGAGTGATATTAGCTTCTGCTTGATTTAAGAAATGACCTATCAAGCCAAAAGCAGCCCGCTTGCTGGCTTTTCCGATCAACTACGCAAGATTGTTACCAACCAACGCTAAAAATCATCAAATHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) LENGTH: 1974 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B)TATTCATCCCTAGAAGCCGGCCACCACAAAGAGCGGCTAACCCCTGTTAGATAATTTAAAGCGTGATAGAGTCTAAAAATTTTCTGACGCTCGTAAATTACCCCACAAACCCCAATCTTGATTGCGATAAAAGTCGATCACGGATCTTGACCCCTAGCAATAGATCCTAACCATCTTGCAAAAGAGTGCCATTCTGATGGTCCCTAGCAATAGGGGTAACACGCTAACTTTAGCCAATTCACCATTTTTCTAGGCTATCAACAATTACGCLOCATION l...1974ACTTTTATTACTTTGAAACTAAACACTTACTTTATTCACCAGTGTTGTATTAATGTTAAGGACTATCCCCTGACCCCTATTAACACGCAGTAGGAATGAACGCAGAAGAAGGGCGATGCGTGATCCTTCAAAAATATGTGTGTAATTGTTCAATGATGATAAAACTCTTTTGAATTCAGCGGTAACGAAACCTCCCCTATCTACCCTAATAGCAGCGGTTGGGGAGTCAACATGCTCAGCAAACGCATCGAAACTACTTTTAAAGCTGTTSEQUENCE DESCRIPTION: SEQ ID NO:45:TTCAGCGCTTGGGCTATTAGGCAACTTACAAATGCCGAAGATGTATAATGCTTAGTTTTAAAACACTCTAACTTTATTTCAGGGTGTTTGAACAAATTTATTCACTAATTATCTTAAACGAAATGCGTAATTAAACAAACTTAAAGGATTGGCAAGCATTGGCGATAACCCACACTAAAGGATGGTCAAGAATGTGTGTTTCCATCTATCTGGCAGCAGCACAAACTACAACCATCCAAACAAAGTTTTAAATGATTTCAAATCAAAAAGTAGAAGCGAAAAGGCACACAATTATTTACCCGATTTCAAAGTCAATTAACCAGACGCTCAAGATTGTTTTTTCCAAAAATAAACGCTCAAAAGATCACGATAATGTTGAACTCCTTTTGAATCCTGGGACAAGACATTGTCAGGGGTTGTATGGCCAGTTTTAAGACTATGCTATGGGCATGGAAAAGGACGCTTTATGGACAATTGTGCTCATCAATCAACCTAAACGCAAACCTTTGTGAAGCCCTATTAGGGTTGGCTCCAGCAATTCGAGAAAAACAACGCAAGAACACAGACACGATTAAAATTCTATAGAAAACAGGCAATGTGGCCCGGAGAGTGAAGCCACTTAAGATTAAGAAATCATTGGCATGATCGCTGTTCACTAACAAACGGGCTTCAATAAATTTAGGGCTTGGGAGGGGTAGTACAATTTAGAGTAACGGGAATTAGTAATGGCGGGATCCAATGGATGTCCCGAAACGCCTTGTAGTTTAAACAACTTCTAGCTTTAGGGGTTTTATTATGGCGAGCTATGGT6006607207716012018024030036042048054060066072078084090096010201080114012001260132013801440150015601620?10152025303540455055W0 98/ 18323GGGGGGATAGGGCATTCAAATTGTATAACAACCGGGTTGAATCCAAAGAAAATGAAGGGG(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAAATTGGTTGCCTGGAGTTTGAGCATAAAAAAAGACATTTTTAAGCGTTTTATGACGTTCACTTCAAAGCGATGAAGACCCTCAAAG(2)(i)(ii)(iii)(iv)(Vi)((((MOLECULE(ATTTGTTATTCCAAAAGGAAGCTATTATGTACTACCGCTAAAGCTAGCGTCTAGCCACTTA)B)C)D)LENGTH:TYPE:A)FEATURE:STRANDEDNESS:TOPOLOGY:TYPE: DNACAGGATTTCATCTTTTTCTTCAGTTGAACAAATAAGCATTCTCGTTTCTAGCTAAGGTGTTTINFORMATION FOR SEQ ID NO:46:-122-ACCACTTACTTCTTTTGGTAGTCAAAGGAAAAATATTCTGGGTGGCGATTTTCAATTACGSEQUENCE CHARACTERISTICS:504 base pairsnucleic aciddoublecircularHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc_feature(B)TGAGTCTTATTTTATCAAACACGGGAAGTTAACTCAATCCATTTGATTAAGCAAGACCTAGCTATGACAAAAATCAAAAAATAGCCCTATLOCATION l...504TGTAGCGTTATCAAGAATTTCTATGCCTATTAACCCAAAGGGTTGGGGAACCATGTGAGAATGGGGGTATTCTAAAGCTCTTAAINFORMATION FOR SEQ ID NO:47:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:SEQUENCE DESCRIPTION: SEQ ID NO:46:GTTTTTTGTTTTATACATGAGGTATTTCTGCTAAGGAATCCAATCTTATAGTCACTCAAAGTGGGCAAAAAAGCGTTTTASEQUENCE CHARACTERISTICS:(A) LENGTH: 885 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)02265523 1999-03-16CCAATAAAAATCTTTGGGGGGCGGCAATTTTAGGGATTAGATACGAACTCGGTGGGTGTTGTTTTTTAGGAAAGCTCTTTATGTGGATGGGCAGCGATAAAAGGCGGTAAATTCAAACGGCCTTCACCTGACTTGGACGAPCT7US97?9575TAGCCCTACA 1680GTTAAGGGGC 1740AGATGTGGCT 1800CATCCCTTTA I860TTTTGTTTTC 1920TTAG 1974GGCTGTAGAG 60TGTGGAGTTT 120CTCTAAAGCC 180AGGCGTGGTG 240GGCGTATAAT 300GGATTTGGAA 360GAAACGCCTG 420AGTCCTTAAA 480504?10152025303540455055W0 98/18323(ix)(xi) SEQUENCE DESCRIPTION:ATGAGTAATCTTTGATAATAAAATCCAACAGTATTTGATGAAAAATATCTGAACCCGGGCGGCGCGGAAGATTGTGATTGGATTGCGTGGATTAAAATCACCTAAAGAAGTCATTAGAATAGGGAGCGAACAGATAGCGAGGTTTAAAAA(2)(i)(ii)(iii)(iv)(vi)(ix)(Xi)TTGGAACCTTTTGTTTTTAACTTGTCACTCTTAAGCGCGCTTTAGCGGCAAAGACTAATCTCGCATGAATTTGTTGTTTGCA-123-(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc__feat:ure(B) LOCATION l...885AAGCGAGCCAAGGGGAATACTTAGCGCTAACGGATATTGGTGCATGCCTTTTTGCTTAATCTTTGGATCGATACGGGTGCTGATTGTTACACTCCAAGAAGCAGGGCGACTGCACTATTTAGATTTTGAGGCCTTTTAGTGCTTTTTTAA(A)FEATURE:TTTGGATAATCAAATTCATCTTTAGCTTACTTTAGCGAATAAAAGGCGAACCCTGGGGATATTCGTAGATTGGGATTGGGCACACCCGATTAAAGATGAATTATGAAAGGAGGGGCGATTGAAAATAGCCTTCTAAACTAAAGGCTTTTGINFORMATION FOR SEQ ID NO:48:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriSEQ ID NO:47:TTTATGAACGGCTATCACAATCTTTATACATTAGATGTCAGCCAAATTGCAGCGGCGAAGGAAGAGGGGGGCCACTACGCCCTTCAGCGATTGTTCCTTACTATTCAAGGGAAAACAGCTCCTAACGATTGAAACCGGCAAAGTATTTGGSEQUENCE CHARACTERISTICS:(A) LENGTH: 1119 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feat:ure(B)SEQUENCE DESCRIPTION:CAAGAAATCGTTATAATGAAAAACCCCCCCATGCGAGCTCCTAAAGAAGGGCTGGAGCGAACATCAAAAATCGTAGGGGTLOCATION l...l119CCTAAAACATGCACCAAACCCTATTTCACGTTTAATCAGCGGCAAGGGATAGCCTTCATTATTAGGTAACGAGCATGGGC SEQ ID NO:48:GCCGCCTTTTTCCCCCTATGCAACTCACTATTGCCTAACGGTGAAAATCACTTTTAACCACCCTTGCTTTGGGTGGGCCA02265523 1999-03-16CTAAAAATCCGCGGTAAGGGAGAAAGGTTATTTTTGGGGTAAGAAATCATAAATTTTAAATTTTAAGCTCAAGCGTTTTTTTACCGATGCTCGCTAACATTGGCTAAAAACCTTATTGAATGTTTTCGCACTTTAGAAATGGTAGTTGTGGGGCTCTTTCACGCATCCCTAAACCACAATCTTTTGCGCGAATCTAAGAAGAGCTTTTTGCATGACTTCTAAAATPCT/US97/19575CAAAAGTTTT 60GGGCGTGGGG 120TAAGGTAGGG 180GAAAACCCAT 240TTGCGAGATT 300ATACATCAGC 360TTTAGATTAT 420GAATGCGAGC 480GTATGCATGC 540GGTAGCCCAA 600CAATATCGCT 660ACGCTATGTG 720ATCCATTGAC 780ACCAAAAGAA 840885TTTTATCGTT 60TAATCAAGCC 120AAATGACGCT 180GAGCGCTTAT 240TTTTGACAGC 300TTCTCATCAT 360TAATAAAATT 420CTATCAATTT 480?10152025303540455055W0 98/18323GAAAGCGCTTTTAAATTTGACTACCACTCTAATAACCCAAACCCCCTTTAATGCTAGAAAAACTTAGATGCCTAGCGATTTCGTTTAAAACTTAATCCGCCGTTTCAATA(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAAGAAAAGTATTCACTCTTAAAAATTGTTGGAAGTTGTTAGAAGTTTGAAAAACTTAGATGGGAATAGATAAAAATAGATGGCAACGCCCTTAGTTGGAATTAAAAACGCCAATCGCAAGATTGATATTGGAAAATTTTATCGCCCACAGCCCCAAAAATTTGTTAGGATAGCATTAATGCCATCTATTTAGCGTTCTAGAGCCGATGCCATTTAGTATCACGAATTGAGAGCTTTTAAGACTGCGCCCTGTAAAACATTCTTTAAATATCACTGCGCCTTAAAAGTATTTTATAGATGGCTTATTT(A)FEATURE:CATCATTTTAAGAAGGAATAAGAGCCACCCAAAAGGCCTAATTGTCATGGCGCCCCACTGATTTTACTCAATTCGTAAAGAATTTGGATAAATATTGTCTATAAATTCCCTTINFORMATION FOR SEQ ID NO:49:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori-124-TTTGCGCGAACCTTTAAACATACCCCTTGTACCTTAAACCTTTAGAAACCTGGCAAAAACTTAAATGGAACTTTGGCTTTGCGAATGAAGACTTACAACCCTCAAGTGASEQUENCE CHARACTERISTICS:(A) LENGTH: 2937 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_featu:r:e(B)GAAAACATGTTTTTAGTCGTGAAAACTTGGAGCGGGTTGACTGATTTGATAAGTCAAAGAAATACGAGTTTCAAGCTTAACCCACTATTCAACCCAGCGCTTAACACTTCAAAAAAATTTACGCTTTAATCTGTAGTTAATTAAAATGGAAAATCACTTAAAGCCCCTAAAGGATTTATTGCGCGGATTTAAGGCAGCGTLOCATION 1...2937ATCCAAGAAACATTCACAAACATTTCTGAATCTCTCTTCTTAAAAATATCAATCATTTTAAGAATTTCCAAATCATCAATACCCAAAGCCTGCAATTTATTCCAATGAAAAAAAACGTGGCAAGGCTAATAGCCACTTTGTAAAACCGAATGAAACCATGGTTGGAGGTTGAGCGCTTATGAAGCTCACTTAATTTGCAASEQUENCE DESCRIPTION: SEQ ID NO:49:GTGTTTAATGACCCTTTCAATTATACTTAATTCTTCCATCCGTTATGGCAGACGATAAAAGGAATCAAAGTTGCTTTTTAAGGAAAATGGTTGCAAGGGCAGCCTAGCGTATTTTTGACATTCACTCCTAATTAAGCCTTTTGATTTTCAGAATTAACCGTTTTTAAAAAAAAGTCGTTTTTGCAATTCTGAAGGCACTT02265523 1999-03-16AACTCTCTTTCCACTGATGGTGTTGAAATTACCAGCTCCAATTCTTTTAACCATTTCTACTATTGTATTTCTAAATTAGATGAGTTACCCGCTCTCATATTCATTATCTTACGGCATTCAAACTCAATAAAAAAACCCACTTTGGGCGGTATAAAGCCAAGGGAATTTTCAAGATGTTAACGTTCAATTTTAACCGATTTTTTTAAAGCCAGATCCAATTGCGAGTTTATCAGTCGTTTTAAAACAAACAGCTCTTACGCCGACCCCTAATACCTTTGGATAAAAAACACTCTCGCTCTAPCT/US97/ 19575AAGCCCTTTT 540CGGGTTTATG 600TGACCAACAA 660ACCAAGCTTA 720AGATAGCCTC 780AAATCTTAAA 840GATCCACAAC 900AAACTCCAAC 960AAGCTATAGC 1020CAAACACATC 10801119GTTTGTGGCA 60CATACAAAAT 120CAAGCTTTCT 180TAAAAAGCGT 240GTCTTATTTT 300TATCTTTTTT 360CCTAGAAGAC 420AGTCCAAGTG 480GATTGTCAAG 540AAAAACCATA 600TCTTTTCCAA 660TGCCAGCTTT 720CCCATCGCTT 780TAATGATGGC 840GCTCCTCATA 900CACTTTTTCC 960TTATTATGGC 1020TAAAATCAGC 1080CGCCCCCTTA 1140TAATATCCCC 1200?10152025303540455055WO 98/18323CTTTACACGCATAGACACGAGATTTAGGTCAATAACAATAAACTTTACTTGTTTTTAGAAGATGTTTTTTAACCCCGATCAACGCCTATAGACTATATTGGATTTTTTTGTTTGATTCTTAGCAAAAGCAGATTTGAGTAAAAGAACGAAGCCAAACAACAAAGATGTCGGCTCAAGACGTTAGTGCATGATTCTTCAAACAGGTTTTCACAAAACATGGTTAGGGGCTATATTTAGGGTATCATTGAATTTGAGTAATGAAAATCACCATTAGCGTCAGGACATCATCG(2)AAAGCGCTCATCCACACGCGAAAAAAACCTTCAACATGCGTGGATCTAAAGAAAAATCATACGCCACAGGACATACAATGCTTTTAAGATCCCTAAAAGACTAAAGATTTTTTCTTTATTTATCCATAAATTGATGATTTAAGAAAAGCCGCTATGAAAATGCTGATCTAATAGGGTGAAGGGCTTTGTAAAGATTTCGTATGGCGAATTTCAATCTCATATGGCTATCATAGAAAAAATTAGACAAAAATCTTAAATAACTAACGTGAAATATTATCCATGGATGAAGTCAAATCAATTTGCTATGCAAACTTCTTTGGATCTCTTATGATAAGCTTGCATAGACACCATTAGACACTCTCGAGCGTGCCACAAAGATTTGCGGCTCTTTAGAAAATCAACTGGCTCTATCAGTTAAGGGGCTTGGATAGTTAGCTCTAAAAGCCCACAAATAAAAAAATGAATTGATGGCTCTTAAGGCTAGAAGGAGGCGAAATTCCAACAACACCATTAATCAAAACCTGATCTTGTCCAAATTAGATAATCCCTATCTGTCAAAGGCAGCGCCTTTTCAAGAAAAACINFORMATION FOR SEQ ID NO:S0:-125-GACATCGCCCATGCTGGATTTCTTTAGTCCCCCAATAACATCTATCATTCAAAGCCCAAAAAAAGCCTGTCAACTCTTATAAAAAGATCAGAGGTTTCTACTCCCCATTTAATAAAGATGGATCAAAAGGAAAATGCCAGGAAATCCAAGATTATCCCCACCTTTTCCTTAATTATAAAACATAATTTTATTATTCACGCAACACAAGCTCCCTCCCTCAGGCTCCGTTGGGCAAAACGCTTAAACTTAGGTGGGCTATCACGTTGGATAAAAATCTTACATTGATTCAA02265523 1999-03-16AAGAATACCATAGACGCTAAATAAAATCCACTCAAGAAGAAAGAGGGTGAGCGAAGATAACGTTGAGTTTTAGAAGGCGAAGCCCTATTCCGAGCGATTTATAGGAGCGAAAATTTCTGTATATTACCCTCTATTGCGGGATGAAGATGTTCTCTACACGTAGAAAATCTACGCCATGATGCGGGGATTATTATTGGGGCTAAAGAATTTTTGTCTTTAGTGTTTGGGATTTGATATTGCAAGTTTCCACTCGTTTTAGGAGCCTAAAACGCCGTATTTTAAAGGAAATTPCT/US97/19575ATACATCTAC 1260AATCGCTTTA 1320AGTCAATACC 1380TCCGCAAACT 1440AAATTCAGAA 1500ATTCACTAAA 1560TGATTTTTCC 1620ATTTAAAGAT 1680CCCCATTATG 1740TGTCAATATT 1800TGGATCGCAT 1860CTATACTCCA 1920TAATAACATT 1980ATTATTCTCA 2040TTTCATTAGC 2100CATCCATGCT 2160TGATATTGTC 2220CATGGCGGAT 2280TATCAACACC 2340TCTTGAAGAT 2400CGCCCTCATG 2460AAACCCTCAT 2520CACTAAAGAA 2580TGGCAATGGA 2640TATCAAGGCT 2700AAAAGGAGGT 2760CCAAGTAACT 2820CACGCCTATT 2880AAAATGA 2937(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1434 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...1434(ix)SEQUENCE DESCRIPTION: SEQ ID NO:50:(xi)ATGAATACTA TTATAAGATA TGCGAGTTTA TGGGGCTTGT GTATTACTCT AACTCTAGCGCAAACCCCCT CTAAAACCCC TGATGAAATC AAGCAAATCC TTAACAATTA TAGCCATAAG60120 ?10152025303540455055W0 98/ 18323AATTTAAAGCTCGCCTAAAGGATAAAGCCGCAAGCGCAAGTTTTTGCCTATATAAGCATTTTTAGCAATGTTAGAATATAAACAATCTCGAAAAGGGTTAAAAGCGCAAGAACCGCTTGAATTGATGCGCATTTCTGCACGACTCATGGCTACCCAGGTCGGGTTGAGCTGCGTATAAAAGCCAGAGCTAAATATTAAAAACCACGCGCTAAAGCCAATT(2)(i)(ii)(iii)(iv)(vi)(ix)(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:5l:ATGCTATCTTTTGTTACTGCAAATACCTTTTCTCAAGAAAGCTAACGTGATTGTCTCAAAGAAAAACAAAATGATAAACGATTAAAAATTTCATTGATCCAAACAGCGACCTTTGGGGCTAACTCAGTGTCTTTGAACGCATAACACCCATGAATAATGTGCCGCCAAAGCTCGCATGATCTAAGCTCTAGGAATTTGAGCTTTAGAATACTAATTTGCATCAGATACCATTTTTTGGATAGCAAAATACTGCAAAAACAAATTGGAGCAAGATTGAATCGGAAATACGATTGATGCAGAACATTTTTAACAGCCGACAAGTCACGATCAATTTATGAATTGCAAGCAAGCGGAGTTATAATACAACTCCAACAAAGAAAAGCGTGTATTTGCGCTTTGCAATGACAAAGGGCGAATACGATCCTCACTAACATTAAGAGAAAAACAAGCAACCAAAAACCCGGCTGGGGTTATCCATCATGAGAAAAAGACTTCAAAGGCTCGCTAATTTAAGTGGCTTACCAGCGGGCATINFORMATION FOR SEQ ID NO:5l:-126-TCTTTAGAAGCAAGAGATCGCTAAAGGGGGATGAAGAACCTTTAAAAATGGCTCAAGTCATCTGCGACTTCAAGTGGTGCAAGAAATTAGCTGACCACGAATTTTGGACACTCAGTGTGAAGGCAGGATTCTCAATTATTGCTTATGCCAACTGCGACTTCTAGGCCAATGAACAGCTTTAGTTTGGATGGTGGATTTCAAATTTAGCGCAAAATAGACGSEQUENCE CHARACTERISTICS:(A) LENGTH: 1239 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(A)FEATURE:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc_feature(B) LOCATION l...l239TTATAAGCGCTTTTTAGTTTCTAAAAATCAAAGTCGTTAGGCGATTTTTTAAGTGGATTTAAAAAATATTGCATTGAAAATAGAAAACACGTTTGATAAAGGGTTTGGCTAAAAATACAACAAATGGGATCAGGCTGGATAAATGGTAAAAGAGCTTAAACTATAAAAACCCTCTATCAAAGGGGCGTTTAAAGATTTAGGCCCTACAGGAACCCTATTTAGCACCTTAAAAACTCACGCAAAACCAAGCCAACAAGAAAGCCAACCATT02265523 1999-03-16CGACACCGGGCTAAATACCACTACCACCAAACACCATCGCAAGCTAGGGACATTGAATGTACCGATCCACAACAATACTAAGCAAATCCATTGATGATTTTGCAATTTGCAAAATTTGAATGGTTTCTTTACCCCAAGATCAGGGCGTTTTGAATATTTTTAGCGAATGAACAGAAAGTCCGGCCAATCTCTACCTATTTTCAACAATTAACTATGTGCACAATACGCCTAAATCCAAACAGCAAATTGATGTATTTAGGTGCAAAACATAGTCTAAAATAGCAATTGGTTAGAGCTTTTCCAGTTCGCCPCT/US97/19575TTTTTTACCC 180TGAAAAAAGC 240TCTCAGTTTG 300CAAAGCGATG 360TACTCCAGAA 420GTTTAATGGC 480TGTGGCTAAT 540CGAGTATTTT 600AACGGACATT 660ACAAAGCTTA 720TTTGGAGCAA 780AAAGACCACG 840AAGGGAGCAG 900AGATGTGTTT 960TGGGAATTTC 1020TGATGATATA 1080AAAGAATTTA 1140GCTTGATATT 1200TTCTTTTGCC 1260AAGGGGCTTA 1320CGAAGTGCAA 1380TTAA 1434TCTAACAGCC 60TTTTGTGGCT 120CGCTTTAGAT 180CTATAACAAC 240GAGCTTGGGT 300GATCAATTTA 360GATTAATTTA 420AAACACAGCG 480CGATTTAATA 540?10152025303540455055WO 98/18323GCGATCGCCAGTAGCGCTCTTTAAGCATTGGCCACTAATTACTCTGGCTATCCAAACAATTATGGCAAGCGAAGTGGAAAGAAACCTTGCGCGCAAATTTTTGAATGACAGCTTATTTGT(2)AGTTAGAAATCTAGCAGCCACCCCTAAAAAACGATATTGCAAAAAAGCTTACTATAACTAAGGCTAAATTACGCCAAAAAAAAAAAACCTATGCGCTTGAAAATCACTATCCTTACAAAACATTTAAAATCGTTATTCCATGTTTTGAATTCGATCGCCAGGTTTAGAAGACCGACATGTTTAGTGGAGCAACAAAACGCGCGGAATCGATCTTTGAAAACTTCAAATCACCTCTCAAAGGAINFORMATION FOR SEQ ID NO:52:-127-CTATTAGAAAGGCGAATTGAAATAACGAGCCTTGATGAAGATAAACGTTAAGCGTCGCTTAAGAAAAAAGCACCTGGCCCAATAAAATCAAATGGCGATTCAGCTTGAAATTAGAATGA(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(iv)(vi)(ix)(xi)ATGCGTATAGGCGGATTTAGCATAAAAACCAAAAATAGCGAAAAGCGATAATGCCGATTGAGCAAAAAAA(2) INFORMATION FOR SEQ ID NO:53:(i)(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...4l4SEQUENCE DESCRIPTION:TTAGAAATTTAAACCGGAACATGGCTCAGAGATTAGAAGGAAAAGTTTTATGAATTTCAACCCAATACATHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriATTTCTTGTACAAAAACGACAACCGAGACTCGTGGATTTATAAACAACTCTAAAGCCCTAGGACGGCGGG(A) LENGTH: 414 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)SEQ ID NO:52:TCGTTTGTGGAAAAAGAGCGAAAAACGATAGAAAAAAGCCGCTAAAAACATCTTTTGGGCTTGATGATGCSEQUENCE CHARACTERISTICS:(A) LENGTH: 930 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO02265523 1999-03-16TCCAAAAAAACTTTTAAAGAAAGAGCTGCAAAAAAGCACACCGGGGTGTATGTCTATCCCAAAGCTTGGCTAAAACTCCTTCAAACAGAAACAACGCTTACCTTAAGCGCCGTATAGTAGGTAAAAAATTAAAAGCTTTACTAACCTTAAATATCGCTGACTTATTTTGAACATCCGTTTPCT/US97/19575CGATTTAGAA 600AAACGAGATT 660TAACATTAGC 720AAAAGACATC 780TTATTTCCGC 840TTTACCTCTT 900GTTTAAAAGC 960TAAAAAATTA 1020TGAAAAAATC 1080TTACAACGCC 1140TCTAAATAGT 12001239TGCGTTCGCA 60TTACAAACTC 120TGATTTCACT 180AAGCCATAAA 240AGGGGTGAGC 300AAGGACTAAA 360TTAA 414?10152025303540455055WO 98/18323(iv)(Vi)(ix)(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:TTGATGCCACAAATTTTCTAGTGGGGCTTGGAGAGGAATGAAAGAGATTAGAATCCTTGAGATTTAGAAAATGCCCCTAAAAGATTAAGGGCGAGCGCTGTTGGTGCGCAAATGTGCAGCGGTAATAGCGGCAGAAAAATTTTATTGAATGTGGATAAAG(2)(i)(B)FEATURE:(A) NAME/KEY: misc_featureLOCATION l...930AAAACCAGCTAAAATTTAAAGCGTGGGGTTCGGTTTTAAGAAAACAAGCGTTGAAATCAAATTTGAGCTTAAACTTATAGGCGTTGAATCATGGGATTGTTTGAACATGCCTAAAAGCTTGCGGCGAAAATCCTAGCATGGGAAGAATCTACACCTTAAACAANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriTGTGATCACCACGCAACCTCTTTAAAATTTGGATTTTAGGAGAAGAGCTTAAAGGGGGCTAAATCAAAAACGCTATCAAACGGGATCGATGGATTTTGTGGTTTGGTTTCCATCCAAAAAATTGCATTATGGATTTGGATGTTTTGGGTTAGGTCAGTAGINFORMATION FOR SEQ ID NO:54:02265523 1999-03-16ATCATTGATGATCATTTCTGTTAATCGCTAGGTTTGTATCTTTATTGTGGAATGGGGGAGCATTTAGCACCCCACTAAAGTTTATCGCGCAAGACTCGTTAGCTCCATTTGGGCAGTTGAGAAGTGCGGTCATTTTCAAATTAGAAGACASEQUENCE CHARACTERISTICS:(A) LENGTH: 999 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(ii)(iii)(iv)(vi)(ix)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:(B)FEATURE:(A) NAME/KEY: misc__feat:ureLOCATION l...999HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriAATCAGGCTCTTGTCATTCTAAATGGATACAAAAAAATTAGGCAAAAGATGGCATCTCTATCATGCTCATAAAGGAACCACATTGAACACCTAATGCGGGATACGCACTTTTGGCTATAGTTTTGGGTAAGCGCTTTAGATCGTCCAGCTPCT/US97/19575TAAGCAACTC 60TTTATTGATC 120GATGACAAGC 180CGCCCTAGCG 240CCGTGGGCTA 300TGATGAAGTG 360TCCTAATGGC 420CCCCATTAAA 480GCCTGTGTAT 540GTATGGGAAC 600AGATCATGTC 660CGGGAAGAGC 720AATTTTAGAC 780AGAAAATAAA 840CCAAGAGCAT 900930GTGCTATATT TTTTAACCAG TTTATTTATT TGCTCTTTGA TTGTTTTGTG GTCTAAAAAATCCATGCTCT TTGTGGATAA CGCTAATAAA ATCCAAGGCTCGAGCCGGGG GGCTTGGGAT CTTTCTTTCT TTTGCGTTGGTCCATCATGCCTTGTTATCTAAGAACCCCATGAACCTTTT60120180?10152025303540455055WO 98/18323GAGATGCCTTTTTTTAGAAGGGGGTCGTTTAGCTTGCCTTGCTATTAATATTAGTCATTCGGGTTTATGGTTTTTGGGTTGTGTTTTTTGAGGCGCAAAATTATTTAAATCTTATTCTATGCGCTCATTGAATAGGCAAG(2)TTAAGGGGCCACATTAACCTGCATCATTTCATTTCATCGCTCATTGACGGATTATATAGATGTTAAATTTTGGTGTGCGGGGCTCAATTTTAAAACGCCATCTTGCAACAGCAACCTGCCTGATTAGCCTTTTGCGCTTTCATTTTGTTTTCTTCATTAAGCATCAACGCCTTTTTTTATTCGTTTAACGGGCCCTAGCAGTCCCTTCAGGAGATTTCTCTCAATGCTTTATGAAAGCCACCACGCTCTTTCTTTTATTTTAAGTCTTTATCAGAAAAGCGGINFORMATION FOR SEQ ID NO:55:-129-TTAGGGCTATCCCAAAATACTTAGTGGTGAGCTATTTTTACTTGCATCTGTTGTCTTGTTAAGATTTTTTTTGCATTTGACCGGTCATAGATGCCGGATAAATTACCCTAATAAGCGTTTGCATGCTATTGCGTTTTAA(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(iv)(vi)(ix)(xi)ATGAACATATTTAGACGCCAGTGGGCGCTAGAGAAAGGGACTCAATGACGAATTTGGACATTTTATTCTCCCAAATGATCGCTCTCAAAGAACATCAAAAGGGGCTATCAGAAGATAAGGGAAGCGATAAGATACCTATA(2)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) LENGTH: 816 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...816TCAAGCGTATAACACCACAAACCCTGTGCCTCAAATTAGTGCTCTTTAGAGAAAAATGCAAAAAAATCACCGGCCAATCAACCCAAGCAATCAAACCCCTTAACAGGGAAACTCGCCTTAAAGCGTTGATAGGGGGCGATTATTTGCGTAAGAAAAAAAAGCATGCGCAAGATCGTGTCTCGCGAATTACCCTTGTTGGTAGACATTAAAAGGCAGGGCGTCTATACGCTAGAAGCTGCGTTATGCCTTGTGCTAATCTTTGAAGCCTTATATCCCGGCTINFORMATION FOR SEQ ID NO:56:SEQUENCE DESCRIPTION: SEQ ID NO:5S:ACCGCTATTGGAAGACCACAATCTTGCAATTTTACGGATTTTCCAGCACCTTGGCCAATAAACCTTAAAATTGATTTTACACGGAGTTTGTTATTGCCTACAAGCAAAACGTAGCCTCTCCAGAGCGAAATTTTAA02265523 1999-03-16CGCTAGTGTTGCCTTATTTTGCGATTTTTCTGCTGGTGGGGGATTTGCGCTGCTCGCTTATAGGCGATGGGTTTGGAGCAAGGTGCTTTTATTTGCATTTACCCTTTATGTGTTTCGCTTTAATAGGCTATTTTAGGTTTAAATCACTCGCAGTTGTGGAATGTGTTGCCGCCCTTATTTTCCATGTGGAAAGGCTCAGTTCCATAAACAATATTGTCAAAGGTTTTAGGTCACCGGAGCGTGAGGATAAAGACCAGGAAPCT/US97/1 9575TTTGAGCGGT 240GCAAGCTGTA 300GCCCCTTTTT 360TATCAGTAAC 420GATCGCGCTT 480CATGGTGCTT 540GGGGGCGTAT 600AAAAATCAGC 660TAGTATCCTT 720GCACACCCTT 780CGCGTTTATC 840GGACGCTTAT 900TGCTTATTTG 960999TTTTAACCTT 60TGAGCTTAAA 120TGATTTGAAA 180TAATTTAGCG 240GGATCGGTTT 300GCCTTTAAGA 360GATTGCTGTG 420AGGCCTTATC 480AAATCCTTAC 540GGATGTGGAT 600CTTATTTTCA 660TGCGCAAGAT 720ATTCATTTTG 780816 ?10152025303540455055WO 98/18323(ii)(iii)(iv)(vi)(ix)(xi)ATGCAAGAATTTAAAGCTCAGAAGCGATCAGCTAAAGAAAATGCCTTTGTTTAGAAGACGCGCCCCAATGCTGGCTCAAGGAAATCGCTCTCACGATTTGATCATGAACGACCCTTTTTGGCGCTGTGTTCTTGACCCAAAAAGAATTAAGGCTTGATAG(2)(i)(ii)(iii)(iv)(vi)(A)(A)FEATURE:CAHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori-130-SEQUENCE CHARACTERISTICS:(A) LENGTH: 951 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B)TCAGTTTGTGTCAATAAGGGCAAAAAGCGCTTTATGAAACATGAAAAAGAATGCGATTAATGATGATTAACCTCTATCCCAAATCTTAGCACAAAGAAATCTACCGAGTGCATCCACCGGTTAAAAACTCACACCGAGTGAAACGCACAACGTTCAAACA(A) LENGTH:(B) TYPE:(C) STRANDEDNESS:(D)MOLECULE TYPE: DNALOCATION l...95lGTGCGATTTTGGCTATTTGCGTTTTATCAATCTGGCACTACCCTAACAACAAGCATTGATAGTCCCGGCGCATTAATGTACAAAGAAGCAAGACCCACTATTATTATCAACGTTAAATCTTATCAACACATCAAACCCCTTATTGATTTAATCCTTTGAAINFORMATION FOR SEQ ID NO:57:SEQUENCE DESCRIPTION: SEQ ID NO:56:ATAGAAAGGGGGGGCGACGAGATGAAATCGAAGGATATTTGGCTACATCAGAAGCCAAGCAGTGAAAGCGACTTTAGTCTCGAAAAAGAGGTGCCACAAAATCAACCAGCAATTCTTTAGGCCCCCCTAGTTAAAAATCAGAAAACACCGAAGCTTTTAASEQUENCE CHARACTERISTICS:783 base pairsnucleic aciddoubleTOPOLOGY: circularHYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)02265523 1999-03-16ATTTTTTAGAGTAACCCTAGCTAAACTCAATACAAGCCTCGCCTAGAAATGGTTATTCAACTTTTGAAGTTTTCGCCTAACGGTCATTAGATTTGCAAGCATGCTAATAACTAAAGATTAACGCCCTAAACAGAAATTGACCCAAAAACTGCAGTTTTTGPCT/US97/19575AAACGATTTT 60TTTGTTTTGC 120AGGCAAAAAA 180TAGCGCGTTA 240TGACCCCTTT 300AACATTAAAC 360CATTAGCGCT 420AATTGCCGGT 480CGTGTTTGTC 540TCAAAGTGGG 600GCTAATAAGC 660CTACATTAAA 720CGCTTATTTG 780AGCGTTCAAA 840CCTTAAAGAA 900A 951?10152025303540455055WO 98/18323(ix)(xi)ATGAAAACAAGTGGTGGCTTAAATTGAATTTTAAGGCCAGAATCAAACCAGTGGATAGCAGTCGCTATGATCAGAACCCGGCTGGGTTTGACGATGGATTCATAGCGGAGAAGAGCGCTTCAAAGGAATTTAA(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)TTGAATTTTATTAACTAAGGAATTTATCTGAACGCTCAAATATGGCATGATTTATAAACCACCATAGAAGGAGCTTTATAGACAATCAAGGGCTCTCAAATTGAATATCTFEATURE:CA-131-(A) NAME/KEY: misc_feat:ure(B)ATGGTCATTTTATTAGTGGGACCATCCAGCCTTTCCAATACGCTTAAAGTGCGATAAAGAATGGCGAAATGGTTATTATTTCAAGGTTACTGAGCGAGTTGGTTAGTTAGTGAATAAGATTAGAATCTTALOCATION l...783TAAGGATTTTGTGTAGCCCGTAGCGAGAAACAGCGATAATTGAAGAGATCCGATTTTTCTTGTTTTACGCCTCCACTGGTCATACTAGAGGGACATCCAACACTATGGTTTTTTGCAAGTTCAAAAAGACINFORMATION FOR SEQ ID NO:58:SEQUENCE DESCRIPTION: SEQ ID NO:57:GCATGGAAAACATATTATTGGTTCAAGCGTATTGCTAAAGTTGCAAAATCTTTGCGCAAACCCGATCCTATTGGATAAAACCTATGAGTGGAAAAATTCTAAGGGGACGGATCATGCAAGGCCAAGGAATSEQUENCE CHARACTERISTICS:(A) LENGTH: 4149 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(A)FEATURE:NAME /KEY: misc_f eatureLOCATION l...4149(A)(B)ATAACCTTACCTTTAATGAAACATCAATATAAGGGATTACAAATCCAAAACTCTCAATTCTTTTAAATAAATTACCAAGACAGGCACTTACGCCTCAAACACAATAAGGGHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriGGCTAATGGGTGTCAGCGGGCTTTGACAACTGGCATTAGTCGCTACCTATTTCTCAAATCCCCTAACTCGTTCTAAGCAATTACTTGACACCCAGGCACTTTTTTCTAGCMOLECULE TYPE: DNA (genomic)SEQUENCE DESCRIPTION: SEQ ID NO:58:GCGTTAAATTCAGTTTGTTTATCACAAAATGGGGCTAATGAGCGATAATAATTCAAGAGAGCTTCCAACAAATCCTACCGAGCAACATTATATAGCCCATGAGAATTTAA02265523 1999-03-16AATGCTTTTTAAACCAATGATAGATGAAAAAGTATGAAAAAGGGCTATAAAAAAAGAAGGAAAGGACCATTGGAAAGGGTGGGAATCTTTTAAAAACCACATAATTCTAAAAATGGATAATAAAAAACAATTAATGGTTATAGGGAATAACTGTAACTTAGCTATGAAAAACAACATCCAGCATTAAAAACTATTTTTAAGCTATAGCTAAAGGTCTTTTTTAACCAGCCAAACGCTTTT PCT/US97/ 19575AGGCGCGAGC 60AGTTGCTTTG 120GATTTTACTT 180CAAATTCAAG 240GGTTATTAAT 300GTATTTGGCT 360ACAGAAAAAA 420TTTAATCCCG 480GGATTCTTTT 540CCATTCAAGC 600TGACGCAATT 660GAAACTCACT 720GAGAAACCGA 780783TGCGCCCTCT 60TGGGGATATT 120CAACATCTTA 180AATCCTTTTT 240AACTTGGTCG 300TGGGGATCTA 360TATCGCTCCT 420TGATTATAGC 480CACCCCTAAA 540TTTGAATAGT 600AGGGATCCTT 660 ?10152025303540455055W0 98/ 18323TCTCAAAATTAACATTAATGGCGCTCCTAGAATCTCGTTAGGGGGCAATGAACACTTACTGATTTTAAAGAGCGGAGGGAAACATAGAAGAAAATCTTTAAAGCAAGCCGTTACCCGCTAGATTTATTGAAGCATTTTTGTTAAAAAGCATCTGAATTAACTGCAAAAAGGTTGTCAAAACAAGGCGGGTCAAAACGCGCTTTTGGCAAATCTTTTAGTAAATGGCGATAGGTGTTTCTAGGTTTGAATAACAACCAAAAGTGCACGCTATCTCAAGTAACAAGCTAATAATTGATGGTAAATGTCATGGAGTCATGCTAATCCAATTCAGCCATTTATTAAGCTTTATGACCTATAACGTCTCAAAATCAATGATCCTAGGCGTTCAAAAATAAAATCTTCCACAAAAGAACCCTAATTATGAGTCGTTCGCTTAGAAGATTTTAAAATGGGGCTAGTTAGGTTTATTAGCAAACATCAATCAAAAGAAATCAACTCCTACGACTGACGTTTAAACCCCATGGATGATCCTAACGATCAGTGATTGCGGCCGCCACCTTAAGTGTTGCAAAACGATCAATAGGCGCTACGCTATAGCAGTGGGGCAATTCTAAAAGCATGCGCGGATGTCTCAAGCCACATCAGGGGAAGCGGTTTAGGGCTTGCAAGAATAATAGTGGGCAATTTTGTTGCTAGACGAGCTCTATTTTACATTGGTGTAGCTAGAAAGTGAGCGGCGTTCAAAGAAAAAAGGGTATTTACGCTACTGGATACGATTGAATATCAATATATGTGAGCGTACAGCTCTCCATAATTTCACCAAATAATAGATTTAACGATATTTCACCTTGGAATTTTAATTATCAATACACGCTTCTTCACGGGTATAACGCTCATTGAGGCAAGCCGTAATACATTTATCAATAACCCGCGTGGATAGTTGAAACTAAATTTAACCACTTAAAAATGATAGCCAAGCTCCCTTAAAAAACTCTCAAAGTCATTAGTGGAGGGCGTGATCTCAATCAGGGCGAGCTAACATGACCCCCTCTAAAATCAAAAGTAGGCTTCTATTTACAAATTTTGCCCTATGTGGGCAGCAAAAAGAAATGACTCTTAGATCCATTTGACTCCAAGATAATCCCTTGCGCGATTAGGCTCATTATATTACCAACCTTTCAAAGACAATATCTTTAGCGAATGAACTTTATATGAAACCTTAAGTCATGAATTACCCCATCCTAAAGGGCTTAGGCGTGATTGGTAGCGAACTCAAGGCTTGTTATAATCAACGATTTAGGCTAACTTTTTAGGGTAGTTTGCTTTAGCAAGCACCACCCTATCAAAAAGGATGCAAACTCTTTTCTTAGGCCGTTATAGGCCACCAACGCTAAACCAACAATAGCTATGGCTCAAGGCACAAAAAGAAGTGCAACCAAATCTATTAATGGCGAGCGTTAAACACTTCCATTACAAGCCCCCCATCGATCAAAGGAAGCCCTGATCGCTGGACGCCACTAATCTCTGACACTCAAGCGATTCGAATAGAGTTAGGTACTGGATGTGGGAGGTCTCTAGCAATCATGAGCTTGACTCTCAATCTTATGGCTATAAGCTATTATCCAATTCAGAAGAAAGTCGGAGACTTATTC-132-ATTGAATCCAAAGATTAAAAGACAACATCAGTTACAAACTCTAGATAGCGACTTCCCCTTGGGACAATTGAGCGCTAATATTTAATCTTTGTTCTTAGTCGAAAACGCTCGGCCAACTTAGAAATCCAAAATCATAGAAATTGAATTTTATTAAAGGATAGACTTGTTGAGTGAGTAATAGGTTTAGGGAACTCTTTTATAGCAATGGCTAATTTTGTCGTATCAAGGCGAACGCCACTAGAAATTTGTAAGCGTAACCCACAATCATCTACGCTCAATCTTTAACAACGGCGACTTTAAGATTTGGTGTGCGACGATCAGGTACTTACAACAGGAGGCAAAGCACATGGGATGGCGGTTCTTTATAATAACTTTAAAACGCTGGGGGAATTATTCGCTCGATATTGCTAATTTTACAGATCAACTTTCGGCTGATGCGAAAAAATAATGACTTTATATGTATGCCGCTTGTCAATGTGGAATGAGACTTATCAATCAGTGATTTCATGTTACATTGGTTGCCAATGCTGCATTATTTCAATTAATTCTA02265523 1999-03-16ACCAACTAGATCACCCAAGCATCAAACCTTCTACTAGCTCCCACTTGTTCATTTAGGCTAGAAGTAGTAAACTTAGTGTTTGGGTCAAGAAAATGGCTATTAAGCCCTTTTAGGTCAAAAACATTATCAGACTACCTTGCTCGGTGGGTATTACTAACCCACGAGTTTTTTCATCAATAAGCGTGTTGCCCGCCTAGAGGATGTTTTTGTCCAACAAGTCCATTGATTTTATGGCTTAAGTCAATTTAGCCCACTAATGACTAATGGGGCTCAATGAAAACCTCTAACTCGCACTAACGCTTAACCTCAGTGGCCAATAACGCTGATTGAGTAGCCTGGATGATGACTGATAGTTGTAGGAAGTGAAAATAATATATCGCATCAAGCGATCCTATTATCTACACTTTAGATCAACACCTACCCGTTCTGATCCCTAACGCTGTGGGCGACGTATCAATGTATGGGTATAGGCGTTTATAGGGGGATACAACTTACAGATATTAAAGATAATGTCTGGTTTACCCTAATAAATAAAAACTCTGGGGGATAAPC T/U S97/ 1 9575CAATATCACT 720GCAAAAGCAA 780TAATAACGGG 840TATATGGTTT 900TTCTTTTAGA 960CATTAACGCT 1020CGCTTTTGAA 1080GAATAAAGCT 1140AGGGATTGAT 1200GGAAAAAATC 1260GAGTAAGGAA 1320TAACTTAGAT 1380TCAAAAACTA 1440TAAGCAGTCT 1500TATAGACGCT 1560CCCTACAAGC 1620AGGACAAGAT 1680TGTTATTTCT 1740GCCCTCTTTA 1800CTTGCATGAT 1860CAATAACAGC 1920TATTATCTTT 1980TGCTTCTAAT 2040CCTTAATGCG 2100CAATTGCCCT 2160GTCTTTAAGC 2220TATTGATTTG 2280TGCGACCTTG 2340TACGGCTAAT 2400TAGTGGTTTG 2460TCATTCAGTT 2520TAACCCTTTG 2580TAGCGCTAAA 2640TAATTACCTT 2700CAACGGCTTA 2760CTTTAAGGAC 2820CGCTGTTTCT 2880TCAAATTCAG 2940TAATTGGCTC 3000AGAGAGCCAC 3060AGTCATCGCT 3120CACGCAGCAA 3180TTTCTTAGAA 3240TATGGATGTG 3300AGGAGTTGGA 3360AGGGTATGAT 3420CGGGTTCCAT 3480CCGAGCGTTT 3540TAAAACTTTC 3600CGACACTTGG 3660AAGCGTTATT 3720AAGGGGCATT 3780AAAATCCGTT 3840TTATTATTTT 3900AATGGTGCGT 3960?10152025303540455055WO 98/18323TTCATCGGTA ATAACACCCT AAGCTATAGAATTATCACAG GCGGGGAGAT AAGATTGTTCGCTAGGTTTG GGCTTGATTA TAAAGATATTGCTTTTTAA(2)CA-133-INFORMATION FOR SEQ ID NO:59:(i)(A)(B)(C)(D)(ii)(iii)(iv)(vi)SEQUENCE CHARACTERISTICS:LENGTH: 789 base pairsTYPE: nucleic acidSTRANDEDNESS: doubleTOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...78902265523 1999-03-(xi)ATGAAAAAAAGAAGTGAGCGATGAAAATCAGCAAGAGAGGTATTCTTTAGCTAGAAAATCAAAAACCCTGGATGAAGCAATATATGAAAAGCGTTCAAGTAAAGAGGGCGCTCTCTTCATTTTGCGAATCAATTATTAG(2)SEQUENCE DESCRIPTION: SEQ ID NO:59:TTGb111GAGCTGAAGAGATACCACACGAAATTTAGAGGTGGGGCGTGGCAAAACGCTAGAAGAATTCGCGAATCAAAAACGATAGGGATTTAAAGATAATTAAATACTTTCCAACAACAAAAATGATGCLl lblbll LGTGCGGATATTGGGGTTTTGCGCCACTACTCGATGGACGATTTGGACAATGCCAATTTTTTGCTTTACGAATAGCTCAAGCGAAAGAAAAAAAATCCTCAACCTTAAAAATCACCAACGACINFORMATION FOR SEQ ID NO:60:L11 1 1 IGAGTTTTCTACAAACGCTAAAGGCGAATGAAAAAGAAAAGCAAGGGTGATGCTCAGAAATGAGACGAAGTCCCCTGTGGCTAATATTATTGCCTGGAATTAAAGCAAACCCATAGACGACCGCGC(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 741 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO16TGGGTTTTTTTCAACGCCAATGTTCCTCCCAAATCCCTGCTTAGGGGAATATACAGAAATTTCCTAAAAACTTATAGGAACGCCTTATTACGAGGTGGAAAAAAAGATTCAATACCAAATTTTGGAAAGGPCT/U S97/ 19575GATGGTGGCA GATACAACAC TTTTGCTAGCAAAACCTTTT ATGTGAATGC GGGCATAGGGAATATTACCG GAAATATTGG TATGCGCTATAAAAGCCCATAGAGCCTAAATAACCCGCAAGTCTGTAAGGGGCGTTAAAACAATTTTGCCTGGCAAGGTATTTTGCCGCCTAGCGTGCATATTTGTGCCTAAATTATCTGGTATTTGGTGCAGCATAAGG402040804140414960120180240300360420480540600660720780789?10152025303540455055WO 98/18323CA(iv) ANTI-SENSE: NO(vi)(A)(ix)ORIGINAL SOURCE:-134-ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_featureLOCATION 1...741(B)(xi)ATGAAACAATATCTTAAAGCTATGCGGATGGTGCATCGTCTTTACAGGAACACTCTCAAATTAAGCGGTCTTAGGCAGTATATCCTAATGGTAGAAGTGGAACTTGAACGGTGAATGTAGTACTTGCAGT(2) INFORMATION FOR SEQ ID NO:61:(i)TTAAAAAGAAGTCCTTTATGGAACAGACATCATGGTATGCACCAACTCATACAACCAAGATGTATAACTAACGCTACTTTGGCATACTGAGCAATCGTGTCTAATAAGGTGCAATGCTAATCTTTAGCTAACCAAAAAAGGCTTATGCCTTTTGGGGCTTTATATGGAGTCACAAAAACTCATCACAGCCCACCGGAGGGTAATCTAGGTTGTTACTTTTGGGATCGGGATACTATCAATCAGCGTTATTGSEQUENCE DESCRIPTION: SEQ ID NO:60:ATAAAACGATTTACTGATTGAGTTGGGGGGTGCGATAAATTGGGCAGGGGAATTTAAAAAGAATATAATGGCGAGTAGTGAGCGCTGGGAGCTGGCACGCTCCAATATCAACCATTAATTSEQUENCE CHARACTERISTICS:(A) LENGTH: 738 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii)(iv)(vi)(A)(ix)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_featureLOCATION 1...738(B)(Xi) SEQUENCE DESCRIPTION:ATGATAAAAAGCCAAAGAATATCAGAGCCTAAGCTCGTTAACTTTTGATTGATAAATTTGTACGCTAATTAGACCCTTGCGCGTTTCGCCTGCAATTACAAAGACAAAAAATGCGGGCTAAAAAAGAAGGCTAAGGGCGTATCGGTTTTACATAACAAGAAAGTTACAAAGCCAGCCGTCTTTAGTCAAACTCTCTTACGTAAGATTTTTSEQ ID NO:61:TTAGGATTGAAGCGTTAAGTATGGCGAAAAATCTTGGATTAACTGCATTACTCATTCCTGTACATTTCTA02265523 1999-03-16CGCATCAAAAGCGGGTTTGCAAAAAAGCCAGGGAGGAAAAGTAATGCGGCATGATAACGGGGGGGAATTTGGAATAGCTTCTATCAATGTACACCGGCACGCGCGTATAACGGTTTCTTTGTTTGATGAGATCATCAGCATGGCGCTAGATAGATGAAACAATACACCCCGAGCGCTAGAACCGCACCCAPC17US97H9575TCAAAAAACA 60TAGTGGGGTG 120AAAGGTATGC 180AACACAACAA 240TAACTACTAC 300CACTTATTTT 360AGACATTGAA 420CACTTCTTGG 480GAATAACAGC 540AGCCACTTTA 600AACTTCGCAA 660AAATGGGGAA 720741TGTGTTAAAT 60AAGTGCTGAG 120CAATAACCTT 180CGTTTTGAAC 240AGAAACTTGG 300CTTTTTAGAA 360AAAAAATAAG 420?10152025303540455055WO 98/18323GCATTCACTTTTGTTAAAGGGCGATTGTTTGCTAAAAACAGAATGGATCATGGCAAAATA(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)TTGTGGTGTTTGGTGTTGTTTCAGACGCTAATCCTTGCGGCTATTGAATTGAAGCGTTATGATTATGTGAGACAGCGTGAAAGATTAAAAGCGACTTCAGTATGTCGGCGAGAACTACCGTTGCAACCCTCGTTACAAAAGTTTTTATTC(2)(i)(ii) MOLECULE TYPE: DNATAAAAACGCTAAAAAGGCAATACAAGTGGGGCCAAGAACATTTTACCCAAAAAAATAA(A) LENGTH:(B) TYPE:(C)(D) TOPOLOGY:MOLECULE TYPE: DNA(A)FEATURE:CACAAAAGCTTTGCCTAAAGCCCGACACTTTGACAAGCCAAACTCTCTTTATINFORMATION FOR SEQ ID NO:62:-135-02265523 1999-03-16PCT/US97/1 9575AAGCTCCCCC AAGTGAGTGA AGAATCCGTTGTTAGGCGGG AGTTAGTCGC TAAGGATTATCATGATTTTG ACGCCATTTT TGCTAAAGACGTCTTGCAAA ACGCTCAAAA ATTCGGCACAGGCACATGGG AAGATGGGCC TATAAAAGCASEQUENCE CHARACTERISTICS:867 base pairsnucleic acidSTRANDEDNESS: doublecircularHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori(genomic)(A) NAME/KEY: misc_feature(B) LOCATION l...867SEQUENCE DESCRIPTION:TAAAAACCCCTTAAAATGATAAGAAATCGCATAAAGTGAGATGACGTGTATAGAAGGCAAAATTGAGTTTGCGGGATTTGACATGAGCGCGCTCATTTAAATATTCCTGTGGTTTTTATATTTATTTAGCGGGGTTTTGGAATGCGCGCTTATCATAGGGTCGTTGGTTGTATGCAACGACGCCAAAGACTATTCTAGCGTATTAAGGTTGAACGAAAAAGGTGAGCGCGTTCAGGGTGCCATGCAAAAAATTGTATTTGCCCTGAGTTTCCCCAAAAACCTTGAATTTTATTTTAGINFORMATION FOR SEQ ID NO:63:SEQ ID NO:62:CATGGCATGATATTTGGCGGTTTGACAAACAATGTGATAAGATAAGGTGCTATAGGGGCGTATGAGATCAGATATTGCTAAGCATTGACATCGCATTTGTCCCTATATTTGGCACTTCCATCATGGGATAGAAGCGCGCTSEQUENCE CHARACTERISTICS:(A) LENGTH: 387 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular (genomic)AGAAAAAAGCTCTTTTTTTTAAAACCATAACCGCCTCAGGGTTATGACACAGGGCTTGCTTTTTCCCCTTGCGGGAAGGAACCCCATTTGCAATGTGGAATCATGTCCACACTTAGACGGTGACCTTTACACATCAACTC....,..u................................w..M . ,. . . ._.(,.W . ..AAAAGTCTTTGTTGAGCGTAGATTTTTGAAGAATGCGATCCAAGACTAAACGTTAAAACCTTATGTCCAATCAAAAATATGCATGTCAATTCCTAAGATTGAGCAATAAACTTTATTTATCCCACAAATCTAAGACGCAG 48054060066072073860120180240300360420480540600660'72O780840867?10152025303540455055W0 98/ 18323(iii)(iv)(xi)TTGATGTTTAAAGGATTTGGACGGACTCTACTTATTGTCAGATAAGTTTATACCGCCTGGGAATATTACC(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGCAAGCGTTTGATGCATATACGAAGCTGAAATTTGAAAGAAATGCAAGTATTTAGTGGGGGCTTTGGAACCACCCTATGCTTTCTGGG(A)FEATURE:CAHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pylori-136-(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION:AAAAAATGTGATTTCAAGCTGTCTTTTAAGATAGGGGAAAAAAAAGAAAAATTGCAAGCCATAAATTTTC(A)FEATURE:LOCATION l...387TTTGAGCCTGGGATTATCGCTATCACTTCTTTCATGCGAAACTCTTTGATTAACCAATTGCAAATAGINFORMATION FOR SEQ ID NO:64:HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:ORGANISM: Helicobacter pyloriSEQ ID NO:63:CTAATGATAAGCGACTGGGGATGAACGATGGCGACTAAAACATGAATTAATTAGAAGTTASEQUENCE CHARACTERISTICS:(A) LENGTH: 510 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)(A) NAME/KEY: misc_feature(B)TAAAATCATTTAGCTATTTTAAGGGATCGCAACCTGCATAATAACCCTAACTGAAGGTTTTGCCTTTAATTCTTTTTTATGCTGGAAGGCLOCATION l...S1OGCTTGAAGTGCATCATTTTTCCCTTTTGTGCAAACAACACAATCGTTGAAAGGGATTACGGGGCGTAGTTTCACAACGCCTAGTGGTTAASEQUENCE DESCRIPTION: SEQ ID NO:64:ATTACAAAACATTTGGATTGGCCAACTCCCAAAATGTCTGAACAAAGAATATCATGATCCGGGGGCTTGCAGAAGTGTTT02265523 1999-03-16GCGGTGTTTGGGAAATTCATAACCGGTGGTAAGTAGAACCAATACTCGCAAAATCATCACTCCAGAATCTGAGGGCTTAACTTTCTTTTCAATCCCAATCGGCATAAAGATAGGCATTTTTTGTCGCTGGGTCAATCAGCPCTIUS97/19575TGTGGGGGCA 60GGGGAAAATG 120GATTAAAAAC 180CAAATTTGGC 240ACAGATATTT 300GGACAAGGGC 360387AGGCGGCTAT 60GTTTGTGCCT 120TTTCATGTAT 180CATGCAAGAA 240AAACCGCACT 300GGTGCTTTTG 360AATGACGATC 420ATTTCCCATG 480510?10152025303540455055W0 98/ 18323(2)(i)(ii)CAINFORMATION FOR SEQ ID NO:65:-137-SEQUENCE CHARACTERISTICS:(A) LENGTH: 1464 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A)(ix) FEATURE:MOLECULE TYPE: DNA (genomic)ORGANISM: Helicobacter pylori(A) NAME/KEY: misc_feature(B) LOCATION 1...146402265523 1999-03-16(xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:ATGATTGAATATCGCTTTTAGATAGCGCTGCGCCGCCTTACAAATCAAAGTTGAGGAATTATCAGAAAAAATCTTAAAACATCCTTCAAACTATCGCTTTGTTAAAATCTTTTAAAAAGCACTGATTTGAGAGGGGAAATCAAAAGGCGAAACTACACCAAAACTCACCGATCGTGGTGCAGCGCTCTTAAAAGAAAAGCGGCACTATCACGCCAGGAAAGAGCAAAATTAATAACACTAAAGATAGTCA(2)(i)GGATGCAAAATTGCCGCCGGCCAAAGTGGGAAGACGCCTACCATGCATTTTCGCTTTAGACGAACGTTTTAAAGCCATTAAAATCAGCGCGGGCAAAATTCTCTCAATGACCACAAGCTTAAGAGTTGGATACAGGATTTATGAAAAAGCCGCAAGATTTCTCTCAAGCCAGCTTGTCTCAAACCCGTCTTTAAGGATTTGTGAACTTAAAAAAAGGGTTTCAATCACCCAAACGGATTTAATACATTCA(A) LENGTH:(B) TYPE:(C)TCATAGAAAGAATGATAGGTACAGATTAAGTGCTGAGTCTAGAAAAAAGCTTTAGGGCTTTCAAAAAGATCCGCCCCAAGTCTATTCCCCGCAAGACAAAAGAAGAGATGTAAAACACGCGGAATACTACTAAAAGCGTTCTTAAGGAGCTGAAAAAAACCCTTGAAGTCTCAAATTAAAGACTCAAGAATAAAGGGAAACCAAGAAGAGTGTAACCATACTTTAGTGCATTTTGATAAAATAAINFORMATION FOR SEQ ID NO:66:TATTTAGTGGTGGGGGCAATATTTCTCAAGATCCCTGATTGCGCTAGATTGGTGCTACCAGGCGTTTTTGCATTTTGAAGAAAACCACCATTAGACATTCAAAAAATATTTCTTTATATTCATAAAAACACAAGAGCAAGTATATCGCTCAACTCCCCCTCTAAAACCAGGACGAATTGCAAAACCCTTAAGCGTGGGTTAGCGCGAAGTGGTAATAAAGGAAGAAAACCGCGTTGATAGSEQUENCE CHARACTERISTICS:42 9 base pairsnucleic acidSTRANDEDNESS: doubleTTACGATATGACAGCTTTTCAAGAATTAGCTTAAAGAACTCGCTCATCAAAGCAAGAAGTATGAAGAATTAAAGCGTTGACCCCTTTGGATTATCCTAAAATGAAAACCATTGACGCTAGAGGTGTCTTATCAAGCATGATAAAAAAGGGATACTGCTGAAGCCTTTTAAAAAATTTTGATGGCGTTGCAATGTAAGCCCTTATCAACACTGGTGCTTTAAATACATGCAAAGAATTGAAPCT/US97/ 19575GATAAGCACG 60TTTAGATAGC 120CCAAGAATAC 180CACCGAAGAT 240TCAAGCTTTA 300GGCCAAAGAG 360GTATAAAAAT 420AAGGCTTTTA 480GCAATCCAGT 540TCCTAATGAT 600TAGAAAGGAT 660TTTAGAAAAA 720TTTGGACAAA 780TTTAAACATG 840GAACGCACAA 900AATCACGCAA 960AGATGGTTTT 1020TGAAGCCAAA 1080AACTTTAGCT 1140TAATTTTGGA 1200CCTTTTTAAC 1260TCAAATCACA 1320GCGTTTAGTC 1380AAAACGCTAT 14401464?10152025303540455055WO 98/18323(ii)(iii)(iv)(Vi)(ix)(Xi)ATGAAAACGATTTAACGCTCATGGCGCTAAGAAACCCTAGAAGTTTGACGATGTGGGGCATCTTTCATGTGGGTATTAA(2)(D)(B)MOLECULE TYPE:FEATURE:(A) NAME/KEY: misc_featureLOCATION l...429ACTTTTATAACGCTTAACGCATAGCGTGGGAGCAAAAAGTACATAAGTTTTTCAAAATCTATGGCTATGCTOPOLOGY:CAcircularDNAHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriAATTAAATTATGACCAAAACGCTTGTTTCTGGCCATACTCAGGGAGTTTCTCTCATGAGCGCCAACATACINFORMATION FOR SEQ ID NO:67:-138-(genomic)SEQUENCE DESCRIPTION: SEQ ID NO:66:CTATTTGCTTACGGATATAAAGAGATCAGCAATGACTATACAACCTAATGCAAATGATGATCAGATTCAT02265523 1999-03-16GGTGTCTTATAAGATATTAGTAAAAATAGAATGATAAGAAATAATCTAGGGCAATTACGGCGTTTTTACC(i)SEQUENCE CHARACTERISTICS:(A) LENGTH: 627 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii)(iii)(iv)(vi)(ix)(xi)TTGATCAACAAGTCTCGTTGGCGCTAGAAAAGTTTTAAAGCCCGATATTAATAAAGGATT(B)FEATURE:(A) NAME/KEY: misc_featureLOCATION 1...627ATAATAATAATTTTCAGTTCAAGAAAAAAACGACTATCAATCAAAGATGATGAAGCATTAHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriCAATAAAAAAGTATGGGTCACACTCCCAATAAATTTGAAAAGTTTTTGACCGATCCAGTTMOLECULE TYPE: DNA (genomic)SEQUENCE DESCRIPTION: SEQ ID NO:67:CTGAGAGGCTGCAAATGACGGGGCTTGTTTGACAAGAAAGTTCGTGATTGATTGAAAAAATTTTTTTGAAATAAAGAAGCATACGAATTTTAACTTTCAATCAATAGAGTTCTTTGATGAPCT7US97?9575CATTGGCATG 60TCCTGAAGAT 120GATCCCTAAA 180TGTTAATATC 240TATCAATGCG 300TCCAAACAAT 360ACCGATCTTA 420429AGTTCTCTTA 60CAAAAAAGAA 120AGATTTTGAT 180AGAAGTCAAT 240CCTTAAAAAA 300AAAGGGTAAA 360?10152025303540455055CAWO 98/18323-139-TGAATGTAGA ATTACAGATCGCACGACCAA CAAACAACGCGCGATGATAA GCTATATAATTTTTGAAACA CATTAGCACCAAGCGGTATA TCTATAAGAAATGGGATAAAAGCATCAGAAATTTTATCCTAATGATCATTACATGTG(2) INFORMATION FOR SEQ ID NO:68:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 738 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...738(ix)02265523 1999-03-(xi) SEQUENCE DESCRIPTION:ATGGCAGGCATCAATCATCTATGACAGCAGATGACCCAATCAACAATACAATCTTAAATACAAATTAGTGAATCCTAGCGACGGTTGAAACTAGCTCTACGATTCCCTTGAGTTGCATGCACCAGCGGTT(2)CACAAGCTATCAAGCACAAGCGATTATTCCACAATCAAAGACCAATTGTATCAGCAAATTCTGTCAATAGCTATTGAAGCTGATGAGCGGAAGAGCAACTATAGCTGTACAAATTTCTATGCCACTAAATATGAATCATGGTGTCGCATATTGTTGTGCATCGCTGAATCAAGGTTTTAACAGGGGAATCAGATTGCATTATGCGACGTATATTAGGCGCGTTCTCAACGCTTTAGGCGACTCCTATGINFORMATION FOR SEQ ID NO:69:SEQ ID NO:68:TCTTCTGCAGGGGCCATTTGGGATTTACTAGCTGTAAGCGAACGATCAAATTTAACGCGCAGCATTTTAGAATCAAATCGAATATTACAAGCAAGCAACAGCACTTGTTGAGTGTTTCTA(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1104 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO16GATTCTTATCCAGGAATAGTATCCGCAAATTGCCTATGAAGCATGGCTGTAAGGCAACACCGAGTAACACCTGTTCCTAGGCGCAGCACCGCTCAATGAAGCTCATCAAATGCCCACTGTPCT/US97l19575AATCCTGAAG TGAAAGACTT TTTTACTTTCTGCTTTCTAT CATTGCACGG AGAAACAAGAGTTTTATTGG CCGTATTCAA TTCTTATGATATAGAGTCTC TCAAAAAAAT CTTTTATACGGCAAGTCTCCAGCGGGCGCTGACCGCTATCAGCCGCTAACGGGGAACAATGCAAAGCGCGTACCCCTAAACGTGCCAACAAAAATACGCCTGATACAGCCAGTGTTTTTCTATGCCAAAT.M.....................-....... ...»...u .u......_..m...\..,...W....:...(. ,42048054060062760120180240300360420480540600660720738?101520303540455055WO 98/18323CA(iv) ANTI-SENSE: NO(vi)(ix)(xi)ATGATTAAAATTTAAACTCAGCTCTTTATAGAACATGCCGACCTTTTTTTGCTACTATCCTTGAATAGCGCTCCAATTTTCAAAACCTAGGCGATGTTTACAATTAGCAATTAAATGCTACTAGAAGAAAATTATGGTGAAGCGGTTTGCAAATTACAGAAACACGATATAAAGAAAGCGAGGGGTATGG(2)(i)(ii)(iii)(iv)(vi)(ix)(Xi)(A)(B)(A)(B)FEATURE:(A) NAME/KEY: misc_featureLOCATION l...llO4GCGTAGAGATTCAACTTTTTCCAACACAGGTGAATATTAGATCAAGGAAACTCTTACTATATGATGCTCACCTACAATCCGTTTAATCCATTCCTATAGAGCAAAGAAAAATACAATAAGGTCCCAAAAGGCATTCTTATACCATACAAATTCAAATTTTCCGATAATGACTTCTGGCTTAGGTTAGAGGMOLECULE TYPE: DNAFEATURE:(A) NAME/KEY: mi.-sc_featureLOCATION l...l23OSEQUENCE DESCRIPTION:ORIGINAL SOURCE:ORGANISM: Helicobacter pyloriTGAAAATTACTACCGGTCAACCTTTGTGATTGAATTCAGACACCGCTAATCCAATACCCCTATGACAAACATCCCTTTCCTTCTAATTTAATTATCTATTAGAATTGATTAAAGTCTGTCGCTTTTAAATAGACAATCGTAATGCAAGAGTGCCACCACGAACGGGAGTTTATCAGACACCTGAINFORMATION FOR SEQ ID NO:70:HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:ORGANISM: Hel icobacter pylori-140-SEQUENCE DESCRIPTION: SEQ ID NO:69:AAAAATTTTGAACGATGCGGCCTACTGCCAAAAATCAAACCCCATTAGTAACACAAACCACTTATAAACACCCATGACAAGATAAAATCGGTTAATTCTCGAAATCCTACTATATCCAAATTGTTTGGTTGTCAAGTATCTTTTTAAAAGCACAATAAGGTTTAAAGACAAGCTATTCTASEQUENCE CHARACTERISTICS:(A) LENGTH: 1230 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(genomic)SEQ ID NO:70:02265523 1999-03-16AGCACCTTAAGTAAAACCAAATCAAGTCAGTCGATGCCGATCCGCACTGAGTTACAGCAACAACAATAACTGACTTATGACTCAAACCTATTAAAGCATTAATGTTTCAATCAAAGATGAGGGGTTTTATTTTTTATTGACTCTGTTTAAAATTTTTATTTAGCCTTGTTTGCTAGAAAAPCT/US97/ 19575AATGGAAAAT 60TCTTTTAGAA 120TCTTCCTCCT 180CAACCTAAAA 240ATTTGAACAT 300AGACATCAAT 360GAAGCCACAG 420ATTTGAAAGG 480TAAAGAAAAT S40GGAAAATTTA 600CCCTAATATT 660AAACACACCG 720CAAATTCTTT 780TGAAATAGAA 840GTTAGCTCAA 900AAACGCCATC 960TGAGCTTGAA 1020AGCGCTTTAT 10801104ATGTCCTTGA TTAGAGTGAA TGGGGAAGCT TTTAAACTCT CTTTGGAAAG TTTAGAAGAA60?10152025303540455055WO 98/18323GATCCTTTTGGTTGTTTTATCTACGCTCTCGACTTTAAGGTACCCCAAAATTGAAAGTAAATGGAAGCGCCCTTACTTGCATCAAACTCACAAGGGGGTTTATATTGAAGACGCCTTTTTTTCATTAAAGAAGGCTCATAATTAAAGGGGTCTTCTAAAGCTTGAAATGGATTTTAGAGAACTACAATGGGTGAGCATGC(2)(i)(ii)(iii)(iv)(vi)(ix)(xi)ATGAAAAAGTGAAGGTGATGAATATTTATAGCTAATAAGCGCTTTGAATGGATATGACAAGATTTAGGTAGTGGGGAGCGGGTGGGGTCGCAAATCATTGCCTTATAGCA(B)AAACTAAAGATGGCCGCTGGACCACACCCCAAGTCATTCTTCAAGCTTGTTTGATAGCACTTAAAAGCTTCTTGCTATGATTCAAACCCCTTAAAGATGAGCAGTAAGGATTAACCCAGCATAAGCCTATGCGATGGCGAGGGATATTGGAGCTTTTAAAGAGCGACCATATTTGAGCCAAAAAAATGGGGTTATAAACA(A) LENGTH:(B) TYPE:(C)(D) TOPOLOGY:FEATURE:(A) NAME/KEY: misc_featureLOCATION l...813TTGTAGCTTTGTGTTTATATATACAGGGGAATAATCCAGGGTTTTGGGTTGCAAGTGGTTAACAAGTTTAATTTGTTAGCCTATCGGCGGAAGCCAAAGGCCAACACTTCCAAACGCTAGAAGGAGTCTAAGCTTATGGCTCAGTTGTAAGCAAAAGGCGGGTTACACGATCGTTTTTAACCCACAGCGATCGCAATTAAGCAAGCAGCGCGTTTGCACAAAAAAGGACACTGGTTTTAGGGTGCTTTATTGCGAATGGTTCAATCGTGTTGCTTTAGCGAAACTTTTGGGTGTTCATTGGCAAAACTTTAAINFORMATION FOR SEQ ID NO:7l:-141-ACGCTAGAAACGTTTTTCTCAGCGTGTATGGAATTGGATTGCATCAAGGCACCAGCGATGCTCCAACAAATATTATAACGCACACCAAAAATTTTACAAGCTCACCACAATTTATAGGCAGGGGTTGTTTCATGCGGTTACCTGATAATGGATTTTTCTCATCCCTAAAATTAGAAAAATAAACAAGAAGSEQUENCE CHARACTERISTICS:813 base pairsnucleic acidSTRANDEDNESS: doublecircularHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriAGGGCTTCTAAGGGACTAATTTGCACAGGGAGGCACCAATGAATGTGGGTTGGTTTTAGATGCACCTAATTGATATTATTTAACACTTGGTCCTGATGTTAACCGTCGCTMOLECULE TYPE: DNA (genomic)SEQUENCE DESCRIPTION: SEQ ID NO:7l:TCCGCGGTTTTATCAGCTTGAGTGTTGTAGATCAATTGGCTATAAGAAATGTGTATGGGCAAAATCCAGTGATAAAGACAAAAAGCTCTGTGTACCCCTATTTCAAGTGT02265523 1999-03-16CGCTTATCAAGTGCGATTAAAAAGCTTTAAATGTTTATATAAGAATCCGTTGGCTAGGGGCGAGCCATTAAGGCTTTAGACGCTCCAATCCTTTCCCTAAGCGGCGATTTTGGGTTTTGATGGATTGCGATTGATGCGATACCCCAAATAAAAGCATTGGTCACTCCTTACTCAAATCAGGGCTGTTAGTTAAGCTCTTCGACAAGCCCGGTTGCCCCCCACTCCAAATATCTTCCAATTTTTTTGATTATGGATATGGTACGCTTCTTTCAGCAAACTACTTATTGTAAGGTTGAATTTPCT/U S97/ 19575ACAAACGAGC 120AAAGCAGTGG 180AGAAGCCCTA 240CCAACGCCAT 300GCGTAACGCT 360TTTAGCGAAT 420TTGCATCGCC 480TAGAGAAGCG 540AGCCCTAAAC 600CTCTGTGAGC 660AAAGTTTTTT 720TACGCATGCG 780GTTTGGGTTA 840TTTAGGAGCG 900CAAAAACGCC 960GTTTGAATTG 1020CAAACCGGCG 1080CTTGAAAGCC 1140CCAAGCGCAT 12001230GTTGTTAGCC 60TTTGAATAGC 120AGGTCTTACC 180CGCTAATGGG 240CAAGTCGCTA 300CGGGCATGCC 360CTCTTGGGGT 420TGGTATTTTT 480TTGGAAAGAG 540CCCTAATGCC 600TGGGGTGAGA 660?101525303540455055W0 98/ 18323CAGCCAATATCT ACAAGCATAA TGGCGTGGAAAAATTTTTGA GCGCGGGTCC TAACGCTACTTCGCTTTATT TGGGGTATAA CTACACTTTT(2)(i)(ii)(iii)(iv)(Vi)(ix)(xi)ATGGCTTACAAGCATCTTAGAATAAAATACATTTCTAGAGGATAATAGTAGTTTATGAAGGATAGAAATAACAAACAGCTGAAACGCATAAAAGATATTTCCCAGTATTTAACAATGAAAGAATTAGCTATATTATTCTTATCAATGAAACAATTTTTCTCAAGAAAACAGCAAAAATTGAGAGAAATCAAAGGAGCGTTGGTAATGAGCACTAATACTT(2)(i)INFORMATION FOR SEQ ID NO:72:-142-TTTGGCGTGA GAGTGCCGCT ACTCATCAATAACCTTTATT ACCATTTGAA ACGGGATTATTAASEQUENCE CHARACTERISTICS:(A) LENGTH: 1317 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularHYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:MOLECULE TYPE: DNA (genomic)(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc__feature(B) LOCATION l...l3l7SEQUENCE DESCRIPTION:AACCTAACAAATAAGGGCGAAAGAGCCACTATCCTATTGAAAGAAGATGTCGAATAAAGATTGATAGAAATAAAAGAATTAGAAAGCCTTACCAAGAAGTCTAGCGCTGAATACCAAACTAAGAAGTGCAGGATAGATAAATAAACTCAATTAATAATGGGAGATTATTCAATTGCAAAAAGCCTTTTAAATGACAAATTGACCAAATTCCTAACAATAT(A) LENGTH:(B) TYPE:AAAGAAGTTATGTTGCAACACCCTTATGTCATGGGCAAAGCAATTTCTTTAGGGTTTGAATAGAGAATTTGAAAGAGCAAAGAAAATGGCAGAAAGAACAGTATTTCAAGGAATACTAACTATTTTAATCAGATGATAATAGAAAACCATTTCTATTTTATTTAAGAAGCATACTATGAAAGAAATTTTAGGTAAGCTTGTAGTGCAAATTATTCAAAATINFORMATION FOR SEQ ID NO:73:SEQ ID NO:72:AAAGAATTAAAACAATCCTGGTGAAAACGCTATTTAAGCTGCCAATGGTGAGGCGCATCATTTATAAAAGGGGTTAGAAAAATGAAATCGAAAGATGGTGCTTTACAACAGACAATGAAGCTAGAGCAACGCGAATTTTGCTCAGCGCCAGGCTGGACTAGCTCTTTTAAAGCGTTTATGAGAGACACCAAGTGCAGCAAAACAATAACCAATGATAATASEQUENCE CHARACTERISTICS:648 base pairsnucleic acid02265523 1999-03-16GAGAGCAACCTTGAAGAGTCAAATCAATAATTGAAAAACGAGATAAAAGACTAAAAGATAAAATTGAAATTCCAATTGACTTAAAGAATAGATTGGTAAGAACTGCCTTTAAGTTAAAAAAATTGCTTTCCTTGGAAAATATAACGCTAAAAGAAGAACAGTTTAGAAGATTAATGGTGAACAATTTTGATCATTCAAGCCTATTAAAAATAATCATCCAPCT/US97/19575GAATTTATTTAGACAAGGCCAGCAAGCATGAGTCTATAAGAAGTTCTCGTCGATCTGATTTCTAACCCACCCACCATAATCGACCATCTTAGAAATAATCTGAATCAATAACTAGAATTTAGCAACAAATGCATAGGCTTTAAGATTAAGAAGCGCTATAAATCGCTCAATGGGAATAAAAAAAGCTTATTAAAGAGGGTTACAATAGAGAATTTAA72078081360120180240300360420480540600660720780840900960102010801140120012601317?10152025303540455055CAW0 98/18323-143-(C) STRANDEDNESS:(D) TOPOLOGY:doublecircular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...648(ix)(xi)02265523 1999-03-SEQUENCE DESCRIPTION: SEQ ID NO:73:ATGCAAGCGTTTGATGCATATACGAAGCTGAAATTTGAAAGAAATGCAAGTATTTAGTGGGGGCTTTGGAACCACCCTATCTTTCTGGGGGTGGCCGGATTCATCGGTAG(2)(i)(ii)(iii)(vi)(ix)(A)(B) TYPE:(A)TAAAATCATTTAGCTATTTTAAGGGATCGCAACCTGCATAATAACCCTAACTGAAGGTTTTGCCTTTAATCTTTTTTATTCTGGAAGGCTTTGATGCGAAGGATTAAAACLENGTH:FEATURE:GCTTGAAGTGCATCATTTTTCCCTTTTGTGCAAACAACACAATCGTTGAAAGGGATTACGGGGCGTAGTTCACAACGCCAAGTGGTTAAAACGCTATTTGTAAATGCTCTINFORMATION FOR SEQ ID NO:74:ATTACAAAACATTTGGATTGGCCAACTCCCAAAATGTCTGAACAAAGAATATCATGATCCGGGGGCTTGCGAAGTGTTTGGACTTGGCGTGAGGGTAAAGAGCGGGTGTTSEQUENCE CHARACTERISTICS:186 amino acidsamino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:ORGANISM: Helicobacter pylori(A) NAME/KEY: misc4feature(B) LOCATION l...l85(xi)Met Ile Lys Arg Ile Ala Cys Ile Leu Ser Leu1 S 10Leu Ala Gly Glu Val Asn Gly Phe Phe Met Gly20 25Gly Arg Tyr Gly Pro Tyr Asn Ser Asn Tyr SerSEQUENCE DESCRIPTION: SEQ ID NO:74:16TCCAGAATCTGAGGGCTTAACTTTCTTTTCAATCCCAATCGGCATAAAGATAGGCATTTTTTGTCGCTGGTCAATCAGCATATTTGCTGGGGTTTTGCTTGCTCTTAAPC1VUS97H9575AGGCGGCTAT 60GTTTGTGCCT 120TTTCATGTAT 180CATGCAAGAA 240AAACCGCACT 300GGTGCTTTTG 360AATGACGATC 420TTTCCCATGG 480AGGCTTGTTT S40GATGGACCGC 600648Ser Ala Ser Leu Ala15Ala Gly Tyr Gln Gln30Asp Trp Arg His Gly?W0 98/ 1832310152025303540455055AsnAsn65ThrGlyGlyTyrArg145ProSer(2)LeuLeuAsnLeuArg65IleLysLysAsp50LysSerGlyLeuAsp130MetMetTrp35LeuTrpGlyAspIle115ValArgValTyrTyrPheThrLeu100GlyAsnValAsnVal180CAGly LeuAla70HisGlyGlu85Ile ValGly ValGln ThrGly Asp150Gln Gly165Asp TyrAsn55ArgThrAsnGlnArg135ArgSerVal40PheValLysLeuLeu120PheSerLysPhe-144-LysTyrThrIle105AlaGlnAlaAspThr185INFORMATION EOR SEQ ID NO:75:(i)(ii)(iii)(vi)(ix)(xi)MetLysGlyPhe50GluLeuLysLysSEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYRE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l16SEQUENCE DESCRIPTION: SEQ ID NO:75:ArgLeuGlu35ValGluGlnGluTyrIleAla20GlyPheTyrAspArg100SerIle Ile5Leu AlaSer GluPhe IleGlu70GlnIleLys85Glu SerArgSerIleArg55ArgLysArgLeuLeuVal40ProLeuGluGlnLeuMet25AlaValLysGluLys105LeuGlyAsn90ProGlyPhePheVal170Phe116 amino acidsSer10GlyIleSerLysGln90Gln02265523 1999-03-16GlyPhe75LeuLeuAsnLeuGlu155GlyPheGlyGlyPheAsn75MetAspPhe60LeuLeuAspThrTrp140AlaLeuLysLeuIleGln60HisArgLeu45ValAspThrLysTrp125AsnGlyIleMetTrpPhe45AspGluLeuLysPCT7US97?9575GlyTrpTyrPhe110MetLeuValArgAsnTyr30ValProArgTyrGluI10PhePheGly95AlaPheGlyLysTyr175Ala15AlaLeuGluLysGln95GlnAlaAsn80GlyLeuProGlyPhe160TyrPhePheIleLysMet80AlaMet?W0 98/ 1832310152025303540455055(2)MetPheIleGlnIle65AspMetLeuGlyGly145ThrLeuGlnThrArg225GlyAsn115CA02265523 1999-03-16-145-INFORMATION FOR SEQ ID NO:76:(i)(ii)(iii)(vi)(ix)(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:(D) TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...345Val Lys HisPheAlaLeu50ThrHisThrAlaPhe130GluGluSerAsnGln210AsnThrLysLeuSer35PhePheGluLysPhe115LeuPheAsnGlnGly195GlyLysAspAsnVal20ValLeuPheLeuAla100SerArgGlyAsnGlu180ValAspLeuTyrGlnTyr Leu Phe Met Ala5LeuThrTyrAlaLeu85PheLeuGlnGlnSer165SerPheLysLysLeu245Lys PheLeuSerAla70ValValIleLysLys150TyrPheGluMetSer230GlyArgPheValLeu55CysPheProLeuLys135LeuAspIleLeuArg215PheTyrArgIleIle40ProAlaPheLeuIle120AspGlyAsnLeuAsn200LysAsnTrpPheSer25LysGlyLeuSerSer105ProLysAspLeuAla185LeuValSerLysSer345 amino acidsVal10SerValThrGlyLeu90LeuThrIleTrpVal170GlnTyrAspAsnLys250GlnSerIleSerIleLeu75GlyLeuSerAspLeu155LeuLysAsnPheAsp235AlaAlaGlnValPhePhe60SerValValLysIle140ValPheGlyGlyGlu220AlaPheIleValLeuLeu45PheArgSerSerSer125AsnTyrSerAsnHis205GluAlaGlyLeuPCTIUS97/19575PheLeu30AspIleLeuProAla110AlaIleValAsnIle190AlaLeuTyrLysVal Phe15IleLeuLeuSerLys95IleTyrArgAspLys175AsnTyrHisLeuAsn255SerSerSerValProTyr80LysLeuTyrAlaLys160SerAsnPheLeuGln240AlaLeu?WO 98/18323101525303540455055PheProGly305MetPhe(2)MetTrpGluIleGly65ValLysLeuAspAsp145AspGlnProArg290ValThrArgINFORMATION(i)(ii)(iii)(vi)(ix)(xi)LysLeuIleLeu50AsnArgValSerSer130GlnAsnLysCA 02265523 1999-03-16-146-260Ala265Val Phe Leu Ile280SerLeu Ser275PheProLys Thr Asn Trp295ValTyr Phe TyrPhe Met His Val Ile310ProLeu Ser315PheTyrPhe Phe325IlePhe Phe Ile Trp Ala330Phe340Lys Leu Lys Arg Tyr345FOR SEQ ID NO:77:SEQUENCE CHARACTERISTICS:(A) LENGTH: 276 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...276SEQUENCE DESCRIPTION: SEQ ID NO:77:Lys Lys Ala Lys Val Phe Trp Cys5 10Ala Val Phe Phe Leu Leu25LysCysLeu20MetTyr SerAla Gln Phe35AlaArg Asp Gln40AlaAsnVal Ser55AsnAsp Lys Lys Asp AsnAla Ile Leu Val70LysLeu Tyr Asp Tyr75Thr Leu85GlyThr Glu Ala90ValTyr Asp LysGlu Leul05IleArg Leu100AST1Tyr Gly LysGlu Glu Ile120ValLeu Phe115ValLys TyrSer Gly Ile Trp Ser Ala135LysAspIle150HisAsn Met Ala155SerLys Tyr Lys SerVal Ala Thr170ProPro Ile Trp Asn165Ser His Leu Ser Met Trp Asn LysVal Leu300ThrIlePheValHisVal60IleLeuThrProIle140SerGlyIle285AspSerLysSerLys45IleLeuGluAspPhe125AlaGlySerTyrPCT/U S97/ 19575270Gly AlaLeu PheLeu Phe Gly Ile Ala AsnValLeu320Tyr Leu LeuMetAsp30IleThrAlaGlyTyr110TyrSerCysPheVal335Ile15AlaPheAlaAspAsn95ValValGlySerAsn175GlyArgLysGluSerLys80IleLysGlnLysIle160MetAsp?W0 98/ 1832310152025303540455055IleArgGly225AspASI1Cys(2)MetAlaLeuGluLeu65GluAsnLysMetGln145PheProThr2 1 0PheMetPheAlaVal195ThrIleThrGluLeu275180LeuGlyTyrPheAla260PheI NFORMAT I ON(i)(ii)(iii)(vi)(ix)(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:TyrPheLeuThr245ArgFORCALeuLeuGln230ProTyrSEQProTyr215ProGlnIleTyr2 00ProPheIleAsn-147-185IleGluTyrArgSer265ID NO:78:SEQUENCE CHARACTERISTICS :(A)LENGTH :(B) TYPE:(D)amino acidlinearTOPOLOGY :MOLECULE TYPE : proteinI-IYPOTHETICAL : YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE :(A) NAME/KEY: misc_feat:ure(B) LOCATION 1. . .224Ile Arg LeuGlySerAsp50AsnLysLeuIleAla130LeuIleValAsp35ThrSerIleIleLys115PheGlnAspLeu2 0GluLeuGlyPheAsn100GluGluThrAspLys5LeuAspThrTrpGlu8 5LysIleMetMetTrpGlyGlyLeuSerAsn70CysGluLysLysLeu150HisLeu Asn LysAlaLeuCys55Leu.ValAspGluGlu135GluGluThrLys4 0AsnSerGluThrLys120HisASHArgAla25ArgAlaLysGluLys105AlaSerAlaPhePhePheLeuTyr250Lys224 amino acidsThr10ProValLysGluGlu90AspLysLysPheGly02265523 l999-03- 16MetGlyAla235LysThrLeuLeuLysValPhe7 5LysLysValGluAsp155GlySerThr220ProArgGlnLysMetLeuAsp6 0ProHisGluLeuPhe14 0ASDIleThr205SerLysGlyValThrAlaHis45GlyGlnLysGluArg125ProGlySerPCT/U S97/ 19575190SerAsnAsnPhePhe270SerLys30AsnSerGluGlnLeu110GlnAsnAlaArgAsnLeuSerGly255IleLeu15ProIleGlnTyrAla95AlaLysLysGluGluLysAspTrp24 0LeuGlnLeuLeuLysTyrArg8 0LeuLysPheLysSer160Asn?W0 98/ 1832310152025303540455055CA 02265523 1999-03-16-148-l65 170PCT/US97/19575175Thr Tyr Lys Ala Leu Gly Ile Lys Glu Tyr Ser Asp Glu Gly LysLeuLys(2)MetPheSerSerPhe65TyrGlnLeuThrVal145LysLysThrLeuProLys210INFORMATION FOR(i)(ii)(iii)(vi)(ix)(xi)ProLeuProLeu50ValTyrThrLeuLeu130PheGluGluTyrSer180Leu Ala Lys195Ala Leu Met185Glu Val Ile Leu200Ile Leu Asp Asn215Asp AsnSEQ ID NO:79:SEQUENCE CHARACTERISTICS:(A) LENGTH: 429 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...429SEQUENCE DESCRIPTION: SEQ ID NO:79:Tyr Ala Leu Arg Lys Arg Phe Phe Lys5 10Cys Met Ile Asn Leu His25GlnVal20ProIle AlaGln40LeuLeu Pro Ala His Ile Ile35Glu Cys Leu Lys Asp Met Leu Gln55Ser Gln Tyr Asp Asp Asn Asn Gln70LeuAsp75Ile Pro85LysAsn Leu Asn90ProLys Asp LysAla100LysGlu Glu105ArgPro Ser Tyr LysPro Val Val Ala115LeuLys Gly120ThrTyrAla Asn135GluTyr Leu Arg Asn AsnGlu150GluAsp Ser Asp Ser Pro Glu Lys155Ile Glu Phe Pro Phe Ile170AsnLys165GluLysVal180ProGln185ThrGly Asn Leu Leu ThrVal195LeuThr Val Asn Lys Gln200TyrLeuSer Glu Arg Leu Phe Gly GlyIle220ArgLysLysAsn60GluValIleIleAsp140LeuIleThrGluIle190Lys Lys Ile205LeuSerThr45GlnSerPheGluLeu125PheGluAlaIleAsn205AspLeuTyr30GluIleLeuIleLeu110ValAsnGluLeuAsn190HisTyrPro Tyr Leu Leu Trp LeuLeu15LeuProPheLysAla95AlaMetIleThrLeu175ThrThrLysIleLeuValPhePheCysSerThr80SerIleAsnGlnTyr160ThrProGluGlu?CA 02265523 1999-03-16W0 98/18323 PCT/U S97/ 19575-149-210 215 220Gln Leu Gly Met Leu Ala Thr Phe Ile Ser Pro Asn Ser Pro Val Ile225 230 235 240Glu Tyr Asp Asp Asp Gly Leu Ile Gly Glu Arg Leu Arg Gln Ile Thr5 245 250 255Glu Ser Leu Asn Val Glu Val Lys His Gln Glu Asn Ile Ser Tyr Lys260 265 270Gln Ala Thr Ser Phe Ser Lys Asn Phe Arg Lys His Asp Ala Phe Phe275 280 28510 Lys Asn Ser Thr Leu Ile Leu Asn Thr Pro Thr Thr Lys Ser Gly Leu290 295 300Ile Leu Ser Gln Ile Gly Leu Leu Glu Tyr Lys Pro Leu Lys Ile Leu305 310 315 320Ser Thr Gln Ile Asn Phe Asn Pro Ser Leu Leu Leu Leu Thr Gln Pro15 325 330 335Lys Asp Arg Lys Asn Leu Phe Ile Val Asn Ala Leu Gln Asn Ser Asp340 345 350Glu Thr Leu Ile Glu Tyr Ala Ser Leu Leu Glu Ser Asp Leu Arg His355 360 36520 Asp Trp Val Asn Tyr Ser Ser Ala Ile Gly Leu Glu Met Phe Leu Asn370 375 380Thr Leu Asp Pro His Phe Lys Lys Ser Phe Gln Glu Ser Leu Glu Asp385 390 395 400Asn Gln Val Arg Tyr His Asn Gln Ile Tyr Gln Ala Leu Gly Tyr Ser25 405 410 415Phe Glu Pro Ile Lys Asn Glu Ser Glu Thr Lys Lys Glu420 425(2) INFORMATION FOR SEQ ID NO:80:30(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 455 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear35(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES40 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature45 (B) LOCATION i...455(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:Val Leu Lys Phe Gln Lys Leu Pro Leu Leu Phe Val Ser Ile Leu Tyr50 1 5 10 15Asn Gln Ser Pro Leu Leu Ala Phe Asp Tyr Lys Phe Ser Gly Val Ala20 25 30Glu Ser Val Ser Lys Val Gly Phe Asn His Ser Lys Leu Asn Ser Lys35 40 4555 Glu Gly Ile Phe Pro Thr Ala Thr Phe Val Thr Ala Thr Ile Lys Leu ?W0 98/1832?)10152025303540455055Gln65LysLysPheLysTyr145LeuGlyPheTrpGly225MetLysAlaTyrLeu305GlyGlyValGlyThr385TyrValPheVal(2)50ValIleThrTyrAsp13 OAsnGlyPheSerTyr210IleProIleGlnAsp2 90LeuTyrAsnPheGly3 70TyrLysValAsnSer450AspGlyLeuLeu115SerSerArgGluSer195AlaHisPheHisThr275ValIleTyrProSer355GlyAlaTrpSerLys435MetSerValIle100IleLeuTyrTyrLeu180PheProAlaAlaIle260ThrTyrHisGlnIle340AsnValThrGlyMet420AlaLysAsnGly85AspGlyIleLeuLeu165AspGlyIleAlaTyr245AspIleTrpGlnAsn325ProAlaTyrArgSer405HisPhePheINFORMAT I ON FOR(i)CALeu70GlyGlnArgGluPhe150SerTyrArgValGln23 OPheSerAsnArgArg3 10PhePheIleArgAla3 9 0PheAsnLysPheSEQS 5LeuIleAlaTrpSer135TyrAsnLysAlaThr215LeuSerAsnValAsn295PheGlyAsnThrGly375SerAlaGlyAlaPhe455ProLeuThrTrp12 OAspSerMet:IleLeu2 O0GluTyrProProIle280SerAspAsnTyrAla360PheGluArgTyrAsp440-150-LysGlyHis1 O 5GlyAlaTyrAspAsn1 8 5AlaAspPheLysLys2 6 5PheLysTyrAl aArg3 4 5AspLeuArgValArg425AlaID NO:8l:SEQUENCE CHARACTERISTICS :AsnAla90GlnPheHisGlyPhe170SerPheGlySerIle250PheProIleAsnAsn33 OAsnAlaTrpSerAsp410LeuGln02265523 l999-03- 16Ile75LeuIleLeuThrAsp155Met:LysGlyArgSer23 5TyrLysValGlyGlu3 15AlaAsnValGlyIle3 95ValAspAsp60GluAlaTyrGlyArg140LysSerIleGlnLys220LysGlyGlyTyrGlu3 00PheArgSerSerIle380AsnAsnTyrArgLysTyrGlyAsn125AsnPheSerAlaTrp205GluHisAlaLeuAla285TrpAsnIleValGly365LeuLeuLeuLeuSer445PCT/US97/ 19575HisAspSer110AlaTyrHisTyrLeu190IleValValProGly2 70LysGlyPheGlyTyr350TyrGlyAsnGluThr430AsnSerSer95GluProValLeuThr175LysArgTyrGlnGly255LeuAspAlaGlyTrp33 5GlyValArgLeuTyr4 15GlyLeuLeu8 OThrLeuTrpLeuLys1 6 0GlnTrpAspAspVal2 4 0ValArgLeuSerPhe3 2 0TyrGlyPheTyrGly4 O 0TyrProMet?WO 98/183235 (ii)(iii)(vi)10(ix)152025303540455055Met1LeuProVa 1Leu65Hi 5LysThrLysLeu145Asp5 erAspThrI l e225LeuThrGly(2)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8l:GlyValSerGln50AspValProIleAla130LysProValPheSer210HisAsnLysPhe(A)LENGTH :(B) TYPE:(D) TOPOLOGY:CAamino acidlinearMOLECULE TYPE: proteinHYPOTHETI CAL : YE SORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc__feature(B) LOCATION l . . .282CysAlaAla3 5ThrPheValTyrPhe1 15LeuGlyAsnTrpAla1 9 5ThrGluArgGluLys275SerLeu2 0GluHisAsnGlyIle100GluAsnTrpSerPhe180ValAsnAsnMetAsn260SerINFORMAT I ONPhe5GlyThrGluTyrI le8 5AspLysValValPro16 5AsnGluAsnLeuTyr2 4 5IleSerFORI 1 eLeuLysArgPro7 0LeuLysArgGlnGly15 0AsnPheValAlaAsp2 3 0AlaAlaMetSEQPheSerLysMet55ValMet:PheGlyAsp13 5IleLeuTyrGlySer215LysValLysProLysSerPro40ThrHisProGlnTyr120LysLeuAspGluThr2 O0GlyAsnValTyrGln280-151-LysVal2 5AsnThrI leArgAsp10 5GlnLysGluThrPro1 8 SPheGlyArgMetArg26 SLysID NO:82:2 82 amino acidsVal10LeuAspSerValIle90AlaValLysAspLeu170GluGlnPheGluLys250AspLys02265523 l999-03- 16ORGANISM: Helicobacter pyloriArgIleSerGln75GlnLeuLeuIleLeu155ValSerAlaAsnAsp23 5LysAlaValGlyLysGlu60AlaValIleArgPhe14 OLysAspAsnIleSer22 0AlaAlaIleTyrCysAsn4 5HisProSerAsnPhe125SerMetGlnArgThr205SerIleValAspPCT/US97/ 19575SerAla30GlnValGlnAspGln110GlnValAsnSerVal190TyrLysHisThrArg270Lys15MetGlnThrAsnAsn95IleAspLeuLeuSer175ValThrSerLysGlu255MetMet:AsnProProHis80LeuGlnGluAspLys16 0GlyHisTyrValIle24 0LeuLys?CA 02265523 1999-03-16W0 98/ 18323 PCT/U S97/ 19575-152-(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 280 amino acids(B) TYPE: amino acid5 (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES10(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:15 (A) NAME/KEY: misc_feature(B) LOCATION 1...2ao(xi) SEQUENCE DESCRIPTION: SEQ ID NO:82:20 Met Lys Leu Arg Ala Ser Val Leu Ile Gly Val Ala Ile Leu Cys Leu1 5 10 15Ile Leu Ser Ala Cys Ser Asn Tyr Ala Lys Lys Val Val Lys Gln Lys20 25 30Asn His Val Tyr Thr Pro Val Tyr Asn Glu Leu Ile Glu Lys Tyr Ser25 35 40 45Glu Ile Pro Leu Asn Asp Lys Leu Lys Asp Thr Pro Phe Met Val Gln50 55 60Val Lys Leu Pro Asn Tyr Lys Asp Tyr Leu Leu Asp Asn Lys Gln Val65 70 75 8030 Val Leu Thr Phe Lys Leu Val His His Ser Lys Lys Ile Thr Leu Ile85 90 95Gly Asp Ala Asn Lys Ile Leu Gln Tyr Lys Asn Tyr Phe Gln Ala Asn100 105 110Gly Ala Arg Ser Asp Ile Asp Phe Tyr Leu Gln Pro Thr Leu Asn Gln35 115 120 125Lys Gly Val Val Met Ile Ala Ser Asn Tyr Asn Asp Asn Pro Asn Asn130 135 140Lys Glu Lys Pro Gln Thr Phe Asp Val Leu Gln Gly Ser Gln Pro Met145 150 155 16040 Leu Gly Ala Asn Thr Lys Asn Leu His Gly Tyr Asp Val Ser Gly Ala165 170 175Asn Asn Lys Gln Val Ile Asn Glu Val Ala Arg Glu Lys Ala Gln Leu180 185 190Glu Lys Ile Asn Gln Tyr Tyr Lys Thr Leu Leu Gln Asp Lys Glu Gln45 195 200 205Glu Tyr Thr Thr Arg Lys Asn Asn Gln Arg Glu Ile Leu Glu Thr Leu210 215 220Ser Asn Arg Ala Gly Tyr Gln Met Arg Gln Asn Val Ile Ser Ser Glu225 230 235 24050 Ile Phe Lys Asn Gly Asn Leu Asn Met Gln Ala Lys Glu Glu Glu Val245 250 255Arg Glu Lys Leu Gln Glu Glu Arg Glu Asn Glu Tyr Leu Arg Asn Gln260 265 270Ile Arg Ser Leu Leu Ser Gly Lys55 275 280?CA 02265523 1999-03-16WO 98/18323 PCT/US97/19575-153-(2) INFORMATION FOR SEQ ID NO:83:(i) SEQUENCE CHARACTERISTICS:5 (A) LENGTH: 393 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein10(iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori15(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...39320 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:Met Arg Lys Leu Phe Ile Pro Leu Leu Leu Phe Ser Ala Leu Glu Ala1 5 10 15Asn Glu Lys Asn Gly Phe Phe Ile Glu Ala Gly Phe Glu Thr Gly Leu25 2o 25 30Leu Glu Gly Thr Gln Thr Gln Glu Lys Arg His Thr Thr Thr Lys Asn35 40 45Thr Tyr Ala Thr Tyr Asn Tyr Leu Pro Thr Asp Thr Ile Leu Lys Arg50 SS 6030 Ala Ala Asn Leu Phe Thr Asn Ala Glu Ala Ile Ser Lys Leu Lys Phe65 70 75 80Ser Ser Leu Ser Pro Val Arg Val Leu Tyr Met Tyr Asn Gly Gln Leu85 90 95Thr Ile Glu Asn Phe Leu Pro Tyr Asn Leu Asn Asn Val Lys Leu Ser35 100 105 110Phe Thr Asp Ala Gln Gly Asn Val Ile Asp Leu Gly Val Ile Glu Thr115 120 125Ile Pro Lys His Ser Lys Ile Val Leu Pro Gly Glu Ala Phe Asp Ser130 135 14040 Leu Lys Ile Asp Pro Tyr Thr Leu Phe Leu Pro Lys Ile Glu Ala Thr145 150 155 160Ser Thr Ser Ile Ser Asp Ala Asn Thr Gln Arg Val Phe Glu Thr Leu165 170 175Asn Lys Ile Lys Thr Asn Leu Val Val Asn Tyr Arg Asn Glu Asn Lys45 180 _ 185 190Phe Lys Asp His Glu Asn His Trp Glu Ala Phe Thr Pro Gln Thr Ala195 200 205Glu Glu Phe Thr Asn Leu Met Leu Asn Met Ile Ala Val Leu Asp Ser210 215 22050 Gln Ser Trp Gly Asp Ala Ile Leu Asn Ala Pro Phe Glu Phe Thr Asn225 230 235 240Ser Pro Thr Asp Cys Asp Asn Asp Pro Ser Lys Cys Val Asn Pro Gly245 250 255Thr Asn Gly Leu Val Asn Ser Lys Val Asp Gln Lys Tyr Val Leu Asn55 260 265 270 ?CA 02265523 1999-03-16WO 98/1832310152025303540455055LysIlePro305AlaIleLysThrSer385(2)MetSerLeuThrAsn65AlaPheGlyPro-154-Ile Val Phe280ValGln Asp Asn Asn275LeuLys Lys LysVal290SerLys Asp Ser Gly Val295GlyGly LeuAsn Asn Asp Asp His310ProLys Tyr Gly315Phe Gly330LeuSer Ala Leu Asp Leu325AspLys LysGlu340GlyThr Ile345MetAsn Leu Leu Arg HisAsn Thr360LysGly Tyr His Asn Gly355AspTyrGln Val Glu375AsnLys Gly Ser Asn370AspAspGly Leu Pro Tyr Val390CysINFORMATION FOR SEQ ID NO:84:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 270 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...27O(ix)(xi)Lys Lys Phe Val Ala Leu Gly Leu Leu5 10Glu Gly Asp Gly Val Tyr25AsnSerAla20AlaLeu Leu IleGln35SerSer Ile40ProGly Arg Leu Asn TyrGly Val Val Pro Leu50ProGly Cys55IleGlyThr Ser75TyrAsn Asn His70GlyGly Gly TrpPhe85AspLeu Asn Gly Leu Asn Val Gly90Leu Met Thr Ser Trp Phe100AspLys Ser Lys105Phe Asp115LysAla120MetLeu Tyr Gly His Leu GlyAsn Ile Gln Leu Val Ser130Asp135TrpSEQUENCE DESCRIPTION: SEQ ID NO:84:AlaGly300GlnAspGluGlnGly380AlaGlyAsnThr60LysLysGlyLysGly140Asp285SerLeuAsnPheArg365LysValThrThr45AlaTyrLysPheGln125ValPCT/US97/19575LeuAspGlyLeuSer350ValProLeuAsn30GlyAsnAlaPheArg110ValGlyAspIleValLys335HisProLysSer15TyrAspLysAsnPhe95ValTyrSerValThrVal320ThrThrValAspSerGlnCysHisGly80GlnTyrAlaAsp?CA 02265523 1999-03-16W0 98/ 1832310152025303540455055Leu145GlyTyrProValLys225LysLys(2)MetArgValSerCys65AspSerIleLys-155-Ile150GlyAla Ile Ala155LysLeu Asp Asp Lys Asp AsnAla Ile165GlnGly Val Gly Asn Thr Trp170Glu Lys180CysIle Ile Ala185ProTrp Lys Glu GlyThr Ala200AsnTyr Asn Pro Asn Ser195PheTyrGln Val Leu215PheAla Phe210HisTrp Gly ValVal Glu230GlyVal Val235AsnAsn Gly Gly ArgPhe Ala245SerSer Pro Asn Ala Thr250TyrLeuArg Asp Tyr Leu Leu Asn260Tyr Gly265INFORMATION FOR SEQ ID NO:85:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 140 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l40(ix)(xi)His Pro Ile Met Phe Ala Tyr Ile Ala5 10Gly Thr Leu Cys Met Ala25AlaASHIle Asn20LeuLys PheGlu Ile35ValLys Gly Asp Lys Ser40ThrLysGln50GlyIle Ile Pro Thr55AspTyr Lys AspVal Ser Ser Glu Ile70GlnPro Leu Asn. 75Lys Asn90LysMet Arg Ala Arg Val Leu Val85Ala Phe Ile Glu100IleIle Asp Leu Lys Ile105Phe Val Ile120IleLeu Ala Met Leu115GlnGlu LysThr Leu135Lys Ser130Lys Lys Arg LysSEQUENCE DESCRIPTION: SEQ ID NO:B5:SerSerProThrArg220ProLeuTyrAlaGlnLeuAsp60PheIleCysSerIle140 PheSerAspAsn205AlaLeuTyrThrLeuLysIle45GluLeuValLysSer125PCT/US97/19575GlyAlaVal190ThrAsnLeuTyrPhe270AlaIle30GlyLeuHisThrAsn110MetIleAla175CysSerIleIleHis255Gln15SerAsnIleAsnAsn95TyrIlePhe160AsnThrThrTyrAsn240LeuAlaGlnLeuGluThr80AlaPheLeu?W0 98/1832310152025303540455055(2)MetAlaLeuAlaCys65GluAlaGluSerThr145LeuSerPheAlaVal225LysCA-156-INFORMATION FOR SEQ ID NO:B6:(i)(ii)(iii)(vi)(ix)(xi)LeuLeuI leLys50AlaAsnLysPheLys130PheGluLysLysLys210AlaLeuSEQUENCE CHARACTERISTICS :(A)(B)LENGTH :TYPE :amino acid(D) TOPOLOGY: linearMOLECULE TYPE : proteinHYPOTHETI CAL : YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE :(A) NAME/KEY: misc_fe.ature(B) LOCATION l. . .256SEQUENCE DESCRIPTION: SEQ ID NO:86:GlyCysPhe35LysIleAlaValTyr115SerTyrTyrLeuLys195GlyLysGlySerLeu2 0SerTyrLeuArgCys1 O 0PheCysAsnTyrGly1 8 0AlaCysAspLeuI NFORMAT I ONVal5CysGlyPheArgGlu8 5LysAsnLysAspSe r1 6 5GlyPheTyrGluLys245FORLysGlyIleGluGlu70SerLeuValLeuMet:150LysAspGluAlaLys230GluSEQLysGlyThrLys55ValIleAsnAsnAsn13 5IleAlaTyrTyrLeu215GlnAlaAlaLeuIle40AlaTyrGluAspAsp120AsnLysCysPheSer200AlaThrCysValMet25TyrCysSerLysAla1 0 5LeuValGlyGluPhe185AlaAlaThrAspID NO:87:256 amino acidsPhe10AlaThrLysSerAla90GluLysGluLeuLeu170GlyLysPheGluIle25002265523 l999-03- 16ArgGluAspSerGly75LeuLysAsnGlyLys155AsnGluAlaTyrAsn235LeuValGlnLysAsn60LysGluCysAlaCys140LysAsnGlyCysAsn2 20LeuLysLeuAspAsn45AspAlaHisLysLeu125MetAspGlyValGlu205GluGluGluPCT /US97/19575CysPro3 0PheAlaIleThrAsp110GluLeuLysGlyThr190LeuGlyLysGlnLeu1 5LysThrAspAlaAla9 5LeuTyrSerLysGly17 5LysAsnLysSerLys255GlyGluArgGlyArg8 OThrAlaTyrAlaAsp16 OCysAspAspGlyCys240Gln?W0 98/ 1832310152025303540455055MetAsnTyrGlnGln65AspSerAsnLeuGly145SerAlaGlyLysAsp225Thr(ii)(iii)(vi)(ix)(xi)LysAlaLeuAla50PheTyrGluArgThr130IleTrpLeuAlaPhe210IlePheINFORMATION(i)CA 02265523 1999-03-16-157-SEQUENCE CHARACTERISTICS:(A) LENGTH: 242 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...242SEQUENCE DESCRIPTION: SEQ ID NO:87:Phe Ser Gln Ser Leu Leu Ala5 10Gly Met Asp Gly Asn Gly25HisLys PheVal Ser Val20Gln Gly35ThrGln Ala Gln Met Ala40LysAspAla Thr Ile55HisAsn Gly Phe AspPhe Phe Glu Lys Phe70AsnGly Leu Arg75Ala Lys85GlnAla His Ser Ile Leu90IleLysAla Ala100ThrVal Ala Gln105ProSer LeuLeu Asn Ile Ala Thr115TyrAsp120AspArgAla Met135AlaGly Gly Val Met ValMet Leu Phe Ile155GlySer Gly150ThrGly GlyAla165LysMet Phe Glu170PheLeu Pro SerVal Ser Ala Thr Gln180LeuSer185HisLysArg Ile Leu Ser Ser195PIOArg Lys200Met Leu Lys Asn Pro Ile215ValLys TyrGly Phe Arg Arg Ser230Tyr Trp Tyr235FOR SEQ ID NO:88:SEQUENCE CHARACTERISTICS:LeuPheIleAla60LeuAsnGlyPheAsn140GlnIlePheIleThr220ValIleLeuAsn45LeuTyrProLysGlu125ValLeuLeuLeuGlu205AlaAsnPCTIUS97/19575IleGly30SerLeuGlyAsnGln110ProIleAlaValPhe190AlaLysTyrSer15AlaGlnGlyPheTyr95GluAsnAsnGlyGlu175AsnGlyAsnValMetGlyLysTyrPhe80AsnIleMetAsnAsn160GlnValValLeuPhe240?W0 98/183235 (ii)(iii)(Vi)10(ix)152025303540455055MetProAlaLysLys65LeuArgValLysSer145IleAsnAsnGlnThr225GluHis(xi) SEQUENCE DESCRIPTION: SEQ ID NO:88:AsnGluLeuCys50AsnThrPheThrLys130TyrThrAsnIleThr210GlnLysTyr(A)(B)LENGTH:TYPE:CAamino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...267TyrValArg35IleAlaAsnPheAsn115LeuGlnLysAlaThr195GlnIleThrGlnProLys20SerValAsnAlaSer100ThrGluIleAsnAsn180GluAlaAsnGlnAsn260INFORMATION(i)Asn5GluAsnArgGluGly85GluLeuAsnPheLys165AsnAlaIleAlaAla245IleFORLeu ProIle ThrAla HisIle Leu55Ile Asp70Glu SerPhe AsnAsn AlaGln Leu135Leu Asn150Thr GlnGlu IleLys ThrThr Asn215Asn Lys230Thr SerAsp PheAsnAsnPhe40GluSerLeuThrAsn120IleGlnSerSerAsn200IleGlnGluPhe-158-SerGlu25SerValSerLysSer105AlaGluAlaLeuAsn185AlaAsnGluIleGlu265SEQ ID NO:89:SEQUENCE CHARACTERISTICS:267 amino acidsAla10LeuGluLeuLeuLeu90MetGluThrArgGlu170AsnAsnGluAlaThr250Phe02265523 1999-03-16ORGANISM: Helicobacter pyloriLeuLeuGlnLeuArg75LysHisAsnThrAsp155AlaGlnAsnAlaIle235GluGluGluLysValSer60AsnMetAlaIleThr140AsnIleThrGluLys220AsnAlaIleGlnGlu45LeuSerLysAsnLys125ArgAlaThrGlnIle205GluAsnLysPCT/US97/19575SerLeu30LeuAspIleGluGlu110SerLeuAsnGlnAla190SerSerIleLysGlu15GlnSerPheGluTyr95GlnGluLeuAsnAla175IleAsnAlaThrThr255GlnAsnLeuPheTrpBOGluGluIleThrGln160LysThrAsnThrGln240Asp?WO 98/183235 (ii)(iii)(vi)10(ix)1 52025303540455055ValAlaPheAsnIle65TyrProValGluVal145TyrGluAsnTyrAsn225GlyLysAspPro(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:IlePhePheThr50MetAsnGlnLeuPhe130AsnIleIleGlyAla210LeuTyrAspGlyAla290(A)(B)LENGTH:TYPE:CAamino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .544GluAspPhe35GlnLysAsnThrAsp115ThrProLeuAspTyr195LeuGluGlyGlyLeu275PheThrSer20ProArgTyrAsnAla100SerAsnGlyAsnAla180GlyAspAspHisGln260ProProIle5LeuLysValSerGly85GluGlnSerValLys165ValAsnProLeuAsn245ValTyrSerProLysPhePheAsn70AsnGluSerSerAsn150GlnValAspLysArg230GlyGluAsnAsnLysGluGluGlu55GluThrPheTrpThr135GlyGlyLeuGlyLys215ThrAsnLysValTyr295HisAlaAla40ThrAsnLysThrGly120AspArgIleLysGlu200LeuIleMetAspCys280Pro-159-SerPhe25ThrLeuProAsnAsn105AspCysValIleAsn185TyrPheLeuThrSer265SerAsn544 amino acidsLys10AspSerAsnAsnAsp90LeuAlaAspAspAsn170SerGlyGlyHisTyr250AsnLeuSer02265523 1999-03-16ORGANISM: Helicobacter pyloriIleLysThrAsnAsn75CysMetIleSerThr155AsnGlyThrAsnGlu235GlnGlyTyrIleValIleSerIle60PheTrpLeuLeuAsp140LysPheValLeuAsp220PheArgLysGlyTyr300LeuAspIle45LysAsnGlnAsnAsn125ProValArgValGly205LeuSerValProGly285HisPCT/US97/ 19575ProPro30SerThrThrAsnMet110AlaSerAspLysGly190ValLysHisProLys270SerAsnGly15TyrAspAsnCysPhe95IleProLysGlnLys175LeuGluThrThrVal255AspAsnCysGluThrThrLeuPro80ThrAlaPheCysGln160IleAlaAlaIleLys240ThrSerGlnAla?W0 98/ 18323101525303540455055Asp305LeuGlnAsnThrLeu385IleValLeuIleLeu465SerSerSerGlu(2)ValIleThrSerAsn370GlyGlyAsnLeuGln450ArgGlyLysValGly530INFORMATION FOR(i)(ii)(iii)(Vi)(ix)(xi)CA 02265523 1999-03-16-160-Ala Phe310AlaVal Thr Ala315TyrPro Gly Leu GlyGln Asn Leu Ile325ASHAsn Asn330LeuProAla Ser Asn345LysAsn Tyr Leu Asn340Met Leu Thr355HisIle Gln Thr360AlaSer PheHis Phe Ser Asn Ser Gln Ser375Val Asn Ala Ile Gln Asn395TyrLys390TyrGly TyrLeu Ala Tyr Ile Ile405ValGly Lys410Gln Gln Gln Ser Tyr425SerLys Leu420PheGlyAsp Ile Thr Thr Asn435ThrTyr440SerLysPhe455SerLys Arg Asn Ser Ser PheAsn Val470ValGly Leu Tyr Leu475AsnTyr TyrAsn Leu Ala Thr Leu490ProAsp485ValGlyIle Ile505TyrSer500SerTyr Gly Ser LeuVal515AlaSer Gly Gly Asp Thr Asn520Ser His Phe Lys Val Phe Phe Asn535SEQ ID NO:90:SEQUENCE CHARACTERISTICS:(A) LENGTH: 356 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .356SEQUENCE DESCRIPTION:Leu Met Lys Ser Ile Leu Leu Phe Met Ile Phel5 10Glu Gly Lys Lys Phe Ser Gln Asp Asn Phe Lys20 25SEQ ID NO:90:AlaAlaThrValPhe380TyrAsnGlyAsnGly460AsnTyrIleSerTyr540ValAsnGlnThr365ArgPheTyrGlySer445IleLysArgGlnPhe525GlyPCT/US97/19575Trp GlnLeu Gly335Asp Leu350Ser SerSer ProAsn AspAla Lys415Ile Asp430Pro ThrPhe GlyVal LysTyr Lys495Arg Lys510Val PheGly CysGln320SerAlaValIlePhe400AlaLeuGlyGlyGly480HisAlaAsnPheVal Val Cys Gln Leu15Val Asp Tyr Asn Tyr30?CA 02265523 1999-03-16W0 98/18323 PCT/US97/19575-161-Tyr Leu Arg Lys Gln Asp Leu His Ile Ile Lys Thr Gln Asn Asp Leu35 40 45Ser Asn Ala Trp Tyr Leu Pro Pro Gln Lys Ala Pro Lys Glu His Ser50 55 605 Trp Val Asp Phe Ala Lys Lys Tyr Leu Asn Met Met Asp Tyr Leu Gly65 70 75 80Thr Tyr Phe Leu Pro Phe Tyr His Ser Phe Thr Pro Ile Phe Gln Trp85 90 95Tyr His Pro Asn Ile Asn Pro Tyr Gln Arg Asn Glu Phe Lys Phe Gln10 100 105 110Ile Ser Phe Arg Val Pro Val Phe Arg His Ile Leu Trp Thr Lys Gly115 120 125Thr Leu Tyr Leu Ala Tyr Thr Gln Thr Asn Trp Phe Gln Ile Tyr Asn130 135 14015 Asp Pro Gln Ser Ala Pro Met Arg Met Ile Asn Phe Met Pro Glu Leu145 150 155 160Ile Tyr Val Tyr Pro Ile Asn Phe Lys Pro Phe Gly Gly Lys Ile Gly165 170 175Asn Phe Ser Glu Ile Trp Ile Gly Trp Gln His Ile Ser Asn Gly Val20 180 185 190Gly Gly Ala Gln Cys Tyr Gln Pro Phe Asn Lys Glu Gly Asn Pro Glu195 200 205Asn Gln Phe Pro Gly Gln Pro Val Ile Val Lys Asp Tyr Asn Gly Gln210 215 22025 Lys Asp Val Arg Trp Gly Gly Cys Xaa Ser Val Xaa Xaa Gly Asn Xaa225 230 235 240Leu Cys Phe Val Leu Val Trp Glu Lys Gly Gly Leu Lys Ile Met Val245 250 255Ala Tyr Trp Pro Tyr Val Pro Tyr Asp Gln Ser Asn Pro Gln Leu Ile30 260 265 270Asp Tyr Met Gly Tyr Gly Asn Ala Lys Ile Asp Tyr Arg Arg Gly Arg275 280 285His His Phe Glu Leu Gln Leu Tyr Asp Ile Phe Thr Gln Tyr Trp Arg290 295 30035 Tyr Asp Arg Trp His Gly Ala Phe Arg Leu Gly Tyr Thr Tyr Arg Ile305 310 315 320Asn Pro Phe Val Gly Ile Tyr Ala Gln Trp Phe Asn Gly Tyr Gly Asp325 330 335Gly Leu Tyr Glu Tyr Asp Val Phe Ser Asn Arg Ile Gly Val Gly Ile40 340 345 350Arg Leu Asn Pro355(2) INFORMATION FOR SEQ ID NO:9l:45(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 675 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear50(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES55 (vi) ORIGINAL SOURCE:?W0 98/18323101525303540455055LeuLeuArgSerTyr65ArgHisLeuSerIle145ValGluAsnGlyThr225IleSerLysGluVal305LeuThrAspGln(ix)(xi)SerIleValLeu50ThrGluValThrLeu13 0SerTyrValGluLys210GluLeuHisThrLys2 90AlaLeuLeuIleThrCA-162-02265523 l999-03- 16(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B)SEQUENCE DESCRIPTION: SEQ ID NO:91:LysValLys35HisSerIleAlaLeu115GlyLysGlyValIle195ValIleGluLysGlu275AspAlaMetSerLys355AlaGlyIle20GluPheMetLysGly100LeuSerSerValGly180ThrLeuTyrAsnGlu260SerLysSerArgHis340LeuIleLeu5ValIleLysGlyIle85ValArgAsnLeuAsp165ValLysLeuLysGly245AsnLysValAlaAla325PheValAsnSerCysLeuValIle70GlnSerAspProPro150IleLeuAsnSerSer230SerPheAspTyrIle310IlePheGluLysIleValLysLys55ValLeuMetAsnLeu13 5TyrLeuMetArgAla215ValLysLeuAsnGlu2 95MetValLysAlaAsnLOCATION 1. . .675GlySerGlu40GluLysLeuPheAsp120AlaTyrLeuIleSer200AsnProAlaAlaLeu280GlnValSerLeuArg360IleAsnIle2 5SerValGluLysPhe105ThrGlnArgProPhe18 5AspLysLysThrVal2 6 5AsnValLeuAsnLeu345SerLeuLys10LeuAlaGlnMetAsn90LysIleLysLysLeu170PheLeuSerAlaLeu2 50GluTrpGlyAlaArg3 3 OAsnAsnGlnIleGlyLeuSerLeu7 5PheAspLysAlaMet155PheSerPheLeuThr23 5GluThrMetSerLeu3 15LeuAsnAspThrIleValHisVal6 0ProIleArgLeuMet140ProLysIleLeuGln22 0AsnTyrPheIleVal3 00IleGluGlnGluGlnLeuSerSer45LeuGluLeuGluMet125LysAsnGluAspIle205AspGluLeuLysAla2 85ArgIleValAlaLeu365LysPCT/US97/19575CysLeu3 0MetGluAspAlaAsp110GluAsnGlyAsnSer190GlyLysValAspMet2'70LeuPheAlaValHis3 50GlyThrVal15AsnGlnAsnThrAsn95LeuAsnLysAlaThr175PheValSerMetPro255LeuIleValIleSer3 3 5SerArgMetAlaSerAspThrLys80SerArgProGluGlu160GlnSerLysIleAla240PheGlyIleValThr320SerSerMetGln?WO 98/1832310152025303540455055Glu385LysAspGlnSerArg465LeuAsnHisSerLys545ThrGluAlaIleVal625ValGlnLys(2)370AspAlaLeuGluTyr4 5 0ValGluLeuLysIle5 3 0AspAsnHisGluLeu6 1 0LysThrGluGlnArgGlyLysGlnAsnGluAlaPhe4 O 5Leu420Ser435SerGluThrLysValGlyLeuSerGluGlyLeuValSer485Cys500Ser515GlnIleLeuGlyLeuGlyLysLeuArgMetValSerAla565Gly580Arg595ValGluGluIleThrGlnValGlyAspGlnSerGluAsn645Lys660Phe675INFORMATION FORCAVal390AlaArgThrAspThr470AsnValGluSerIleS50LeuPheLysIleGlu630LeuVal02265523 l999-03- 16375GlnValAspHisPhe455AsnPheGlnThrSer535ValAsnAlaSerSer615IleLysSerAspArgAlaMet440ArgAlaAlaAsnSer52 OGlnGluAlaValLeu600AspAsnIleAsn-163-ThrIleLeu425ProGlyLeuLysLeu505LysSerIleAlaVal585SerThrAlaAlaAsp665SEQ ID NO:92:(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(vi)(ix)(A)(B)LENGTH 2TYPE :amino acidlinear(D) TOPOLOGY:MOLECULE TYPE : proteinHYPOTHETI CAL : YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE :IleThr410AsnSerArgGlyAsp490GluThrGluIleIle570AlaGluSerSerSer650Ile2 7 1 amino acidsLys395AlaGlyIleIleGln475LeuLysIleAlaArg555GluAspIleGluIle635AspLeu380ValGluIlePheGln460GluAlaAlaGluMet540AspAlaGluGluSer620GluSerGluValProMetLys445AsnIleAsnSerAsn525IleIleAlaValAla605IleAlaLeuAsp........... ...l....................... ....._..â.. .............,.....,.PCT/U S97/ 19575SerAlaAsp430IleAlaGlnAspAsn510IleGluAlaArgArg590AsnLysLeuGluVal670AspSer415TyrPheSerLysSer495SerThrGlnAspAla575LysIleAsnArgIle655ASHVal400ProLeuGluGlyMet480AlaGlnThrGlyGln560GlyLeuAsnGlnSer640SerLys?WO 98/18323101525303540455055MetPheHisAlaLys65LeuLeuAsnIleAla145AlaLysProAlaSer225GluLys(2)(xi)(A) NAME/KEY: misc_featureCA(B) LOCATION l...27lSEQUENCE DESCRIPTION: SEQ ID NO:92:Asn Ile PhePheLysGln50LeuAsnAspIleLys130AsnLeuAsnLysLeu210ProAlaPheAsnIle35IleValAspArgHis115AsnGlnLysProVal195GlnTyrIleIleLeu20ThrLeuIleGlyPhe100ValLeuGlyAspTyr180LeuAlaAlaLysLeu260INFORMATION(i)(ii)(iii)-164-Lys Arg Ile Ile Cys5LeuArgGlnValSer85AsnGluLysArgPro165AsnGlyLysAsnAla245AspFORAspGluSerSer70LeuLeuProLysAla150SerIleAspLeuLeu230LeuThrSEQAlaLeuVal55PheAspAspLeuGly135LeuAsnLysValThr215ValIleTyrLysLys40ValThrAlaArgArg120SerIleLeuIleAsp200GlyAlaGluLysHis25ValAspAspAsnLys105PheValLeuTyrLys185GlyAlaSerAlaGly265ID NO:93:SEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:Val10HisGlyAspTyrTyr90MetTyrIleLeuAla170ProAlaLeuArgLeu250Ala161 amino acids02265523 1999-03-16ThrLysAlaLeuVal75PheHisSerAlaHis155ThrLeuIlePheGlu235GlnIleAlaGluAsnLys60LeuGlnLeuGlnVal140LysGluGluIleSer220AspSerIleIleLysPro45GluProHisValLys125ProGlnPheAlaThr205GluAsnGluProPCT/US97/19575ValLys30ValLysAsnArgGly110IleAsnGlyAspAla190GlyAspAlaLysAla270Leu15GluProGlyLeuPro95LeuThrAspLeuIle175LeuAsnLysGlnThr255PheGlyAspHisIleAla80TyrAlaAspProIle160ValLeuTyrAspAsp240Arg?WO 98/1832310152025303540455055MetLeuGluAspVal65GlnTyrIleAsnGlu145Lys(2)(xi)PheTyrMetSer50AsnValLysSerPhe130Ala(A) NAME/KEY: misc_featureCA(B) LOCATION l...16lSEQUENCE DESCRIPTION: SEQ ID NO:93:02265523 1999-03-16-165-Phe Lys Thr Tyr Gln Lys LeuLeuIle35IlePheThrIleGln115GlyGlu5Val Gly20Ala AsnThr IleVal ProIle85AspPIOPhe100Leu GluGlu SerIle GlnCysSerGlnVal70SerGlnGlnLeuThr150GlyGluGly55SerIleLysLysLys135AspAsnGly40ValGluGlnLysGly120GlyLysGly25ThrLysThrAspGly105ValIleGlyINFORMATION FOR SEQ ID NO:94:(i)(ii)(iii)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A)(B)(D)TYPE:LENGTH:amino acidTOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...337SEQUENCE DESCRIPTION: SEQ ID NO:94:Met Ile Arg1Ala Gly ValLeu Ser Asp35Glu Asp ThrLeu Lys Gly Leu5Leu Leu Gly Ala20Glu Asp Leu LeuLeu Thr Ser CysAsnThrLys40AsnLysAla25ArgAla.\ . .(..............â-..=.......:., ..... (. .,Leu Gly10Gly GlyPhe GlnLeu ASHPhe Gln75Phe Lys90Leu AlaMet MetSer GlnAla Trp155337 amino acidsThr Leu10Pro LeuVal LysLys ValAlaGlyIleArg60MetAspAsnGluGly140ThrLysMetLeuAspSerGluAsp45GlyGlyMetIlePro125CysPheThrAlaHis45GlyPCT/U S97/1 9575CysSer30SerAsnValAlaAla110GlnAsnAsnSerLys30AsnSerLeu15ProLysCysLeuSer95AsnThrIlePheLeu15ProIleGlnAlaValAlaAlaSer80ThrLysLeuIleAsp160LeuLeuLysTyr?WO 98/18323101525303540455055Leu65GluAsnLysMetGln145PheThrLeuGluMet225GlnLeuGlyTrpIle305AlaHis(2)50ASHLysLeuIleAla130LeuIleTyrAlaGlu210SerLeuLeuCysGly290TrpGluSerIleIleLys115PheGlnAspLysPhe195SerGlyHisAsnAsn275PheGluIleGlyPheAsn100GluGluThrAspAla180GlyThrGluSerMet260MetPheCysGlyINFORMAT I ON(i)(ii)(iii)(vi)(ix)TrpGlu85LysIleMetMetTrp165LeuGluTyrAsnSer245IleGluGlyIleIle325FORCAAsn7 OCysGluLysLysLeu150HisGlyArgAspAsp23 0AsnGluIleLysLys310Val55LeuValAspGluGlu135GluGluIleSerThr215TyrAsnLeuAspAla295AsnTrpSerGluThrLys120HisAsnArgLysTyr2 00ArgLysIleThrGly2 B 0LysLysLys-166-LysGluGlu105AlaSerAlaPheGlu185IleGlnIleLysAsn265SerValValLysSEQ ID NO:95:SEQUENCE CHARACTERISTICS:(A)LENGTH :(B) TYPE:(D)amino acidlinearTOPOLOGY :MOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...416GluGlu9 OAspLysLysPheGly1 7 0TyrArgThrThrPro2 5 OI l eLysProLysAsn3304 16 amino acids02265523 l999-03- 16Phe75LysLysValGluAsp155GlySerGlnLeuTrp23 5LeuLysTyrGluSer315Thr6 0ProHisGluLeuPhe14 OAsnIleAspTyrSer22 0LeuMetLysProThr300TyrTyrGlnLysGluArg125ProGlySerGluLys205AlaLysSerGluIle285TrpAspSerPCT/US97/1 9575GluGlnLeu110GlnAsnAlaArgGly190LysMetProAsnTyr270HisArgAsnIleTyrAla9 5AlaLysLysGluGlu1 7 5LysAspAlaLysThr2 5 5ValLysAsnThrSer335Arg8 0LeuLysPheLysSer1 6 OAsnIlePheAsnTyr2 4 OGluMetAspLysThr320His?W0 98/ 1832310152025303540455055MetAlaSerGluVal65I leI leAsnCysLeu145ThrTyrGlyGlnPhe225AspPheTyrValThr305GlnTyrAlaAspLys385Asn(xi)LysGluGlnGlu50AsnThrGluTrpPro130LysAlaGlyGluAla210LeuLysGlyCysPhe290LeuAlaLeuMetGly370ArgValSEQUENCE DESCRIPTION: SEQ ID NO:95:LysGlyAla3 5I leAsnLeuSerAsn11 5TrpAspArgAsnMet1 95LeuLeuLeuValThr2 7 5ArgThrTyrLysGln3 5 5PheIleLysLeuGlu2 0ThrIleMetAlaIle100AlaLeuLeuAspMet180LeuLeuArgAspThr260GluThrLeuAlaGlu34 0SerGlyAsnPheVal5ThrIleSerIleAsn85ArgGlnAsnAsnVal165GlnCysAlaValPro245AspAsnThrAspAsn32 5IleGluGluGluAsp405CAPheProI leLysAsn7 0ProTyrAsnValAsn1 5 OGlnSerLysThrLys2 3 0PheProLysArgLeu3 1 OPheThrI leLysArg390Gln02265523 l999-03- 16SerLeuGlyAla55ThrMetAsnLeuAsn13 5LeuAsnLeuMetGly215LysLeuThrGluLeu295IleAsnâAsnMetGlu375GluPheMetI 1 eLys4 0GlnThrGlnTyrLeu12 0AlaI leLeuAlaVal2 O OAsnLysLysAlaThr2 8 0AspLysGlnGlnThr3 6 0AsnArgGly-167-LeuVal2 5MetAlaAsnValGlu105ArgLeuThrIleGly185AsnAsnValArgAsn26 5GlyAsnAlaArgMet345AspHisAlaPheLeu10AsnValGlnSerLeu90AsnAsnThrLysGln170GluAspProAsnLeu2 50HisLysGluSerIle3 3 0LeuAspIleArgPro410CysAspAspValLeu75GlnLeuLysAsnAsn155SerLeuSerGluAsp23 5AspAsnCysLeuAsn3 15LysPheTyrAspIle395IleCysProSerAsn60IleAsnLysTyrAsn140GlyIleSerAsnGlu22 OAsnValLysAspGlu300LysLeuLeuPheLys380TyrPheLysGluIle45GlnSerAlaGlnLeu125LysGluSerGlyTyr205GlnLysLeuGlnPro285GlnAspLeuAsnArg365GlnPheSerPCT/US97/19575SerThr30LysLeuSerGlnSer110GlnIleGlnGlyArg190GluLysGlnGlnGly270IleGluAlaThrGln350GlnLeuGlnIleVal15HisArgGlnSerTyr95IleGlnValThrSer175AlaSerArgLeuThr255IleLysIleGlnLeu335ThrAsnThrAsnTrp415PheValTyrLysAla8 0GlnGluGlnAsnGln16 0GlyTrpGluArgLys240GluHisAsnGlnSer320LysMetAsnGlnPro400Asp?W0 98/ 1832310152025303540455055(2)ValThrLeuLeuSer65AlaThrAspPheAsp145IleMetLysAlaAsn225IleAspCA-168-INFORMATION FOR SEQ ID NO:96:(i)(ii)(iii)(vi)(ix)(xi)AsnIleAsnGln50SerLeuPhePheLys130AsnAlaIleValVal210AsnThrIleSEQUENCE CHARACTERISTICS:(A)LENGTH:(B) TYPE:(D) TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...376SEQUENCE DESCRIPTION: SEQ ID NO:96:LysThrAsn35AspLysLysThrSer115GlnProThrProIle195LeuLysProLysTrpThr20GlnTyrAspAlaSer100ProSerAsnAsnAla180AlaIleMetHisGly260Ile5PheProThrAlaLeu85ProLysProGlyGlu165PheGlnProGlyGly245TyrLysSerSerPheThr70AsnProGlnLysIle150AsnLeuValLysGlu230IleASHGlyLeuLeuThr55IleSerMetLeuAsn135AspLysIleGluGly215TyrAsnGlyAlaIleLeu40GlnLysLysAspAsp120TyrSerLeuThrSer200SerArgIleLeuValTyr25AsnAsnAlaGluPro105LeuGluPheLeuPro185AspLysLeuMetVal265376 amino acidsVal10HisAspProLeuMet90LysLeuGluThrArg170IleIleValAspLeu250Gly02265523 1999-03-16PheGlnAspGlnGln75AsnThrAlaAsnAsn155ThrSerPheIleIle235ThrGluValLysGluPro60GluTyrThrSerLeu140LeuIleSerAlaGly220ValAsnLeuGlyProVal45ThrGlnSerProArg125IleLysThrGlnSer205TyrTrpAlaIlePCT/US97/19575GlyLys30LysAsnLeuLysPro110IlePheGluAlaIle190MetTyrSerLysGlu270Phe15AlaTyrThrLysGlu95LysThrProLysAsp175AlaGlySerArgGly255ArgAlaProProGluAla80GluLysProValAsp160LysGlyLysAsnIle240AlaAsn?W0 98/ 1832310152025303540455055PheLeuGlu305GlnLysPheGlu(2)ValLeuLeuAspAla65LeuLeuValProLys145GlnLeu290ValSerSerIleVal370Arg275IleThrGlyLysSer355IleTyrGlyAsnMetIle340ProAlaGlyIlePheGly325AlaAsnGluCAValThrPhe310IleProThrPhe02265523ProSer295GlyAsnIleAspLeu375Leu280AlaAspGlnValIle360Lys1999-03-16-169-LeuLeuTyrValval345PheINFORMATION FOR SEQ ID NO:97:(i)(ii)(iii)(vi)(ix)(xi)AspSerGlyTyr50SerLysLeuLysAsn130GlnSEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY;amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...916SEQUENCE DESCRIPTION: SEQ ID NO:97:LeuLysGlu35SerTyrLeuPheAsn115LysLysArgThr20GlnAsnAsnSerLys100PheGluGlnIle5LeuCysIleLeuGlu85LysTyrTyrLeuGln Ser LysIleSerCysLeu70LeuLeuGlnLysAla150SerAsnThr55GluValIleCysPro135LysTyrPhe40PheSerThrLysIle120AsnIleGluPro25ValValPheGluHis105ArgGlnTyr. .. ...._...............4.u......«........m..,...,.11 l.LeuAsnLeuVal330IlePhe916 amino acidsVal10PheSerSerLeuTyr90LeuGluPheSerSerAsnLeu315AsnArgProORGANISM: Helicobacter pyloriSerGluIleAspAsp75AlaSerIlePheHis155 ThrArg300LeuGlnGluIleHisLysProPhe60PheAsnGlyIleIle140LeuLeu285GlyGlnIleGlyPITO365AsnHisIle45IleTyrValAsnLys125IleLysPCT/US97/19575ThrAsnLeuLeuSer350ArgLeuVal30AsnAsnLysThrAsn110TyrGlyGluAsnLysMetArg335ArgGluLys15GluAsnLeuAspAsn95GlnAsnLysLeuGlyGluArg320AspValAsnGluAlaAspIleLys80AsnLeuAlaGlySer160?WO 98/1832310152025303540455055AlaGluProProIle225SerGluGlnLysLeu305GluGluLysGluPhe385ValLeuGlyProLys465AsnLysLysThrAsn545LeuIleHisSerGluLysIle210GluLeuGluIleAsp290LeuProSerPhePhe370HisProGluHisAsn450PheIleIleHisSer530Met:LeuArgGluGluLeuThr195AsnLysIleGluCys275IleValIleGlyGlu355AlaLeuIleAlaTrp435LysAspSerLysAsp515PheGlnAlaValIleIleAsp180GluGluHisArgPro260LysLysAsnGlnIle340AlaGluAsnMetIle420PheIleLysLysGln500AsnLeuLeuIleArg580LysLys165LysIleAsnAspGlu245GluAsnSerSerArg325TyrAsnTyrIleLys405SerPheTrpAspLys485SerAsnPheLysVal565HisLeuCAProIleLysPheGlu230IleTyrTyrMetGlu310SerLeuLysCysAsn390GluThrGlnIleLeu470TyrLysAspAlaIle550GlnAsnGluGlnPheAspLys215IleGluLysIleMet2 95IleLeuPheGluArg3 75AsnTyrLysLeuPro455GluLeuAspIleLys53 5AspAspAsnVal02265523AspLysIle200ArgLysAsnIleGlu280CysValTrpProLys360GluGlyLysGluSer440LeuIleGlnPheLeu520GlySerSerLysTyr1999-03-16-170-MetThr185IleGlnLysHisAsn265SerGlnArgGluLys345PheCysLeuGluThr425LeuGluTyrGluPhe505GlnSerLeuProLeu585AspGlu170ThrLysPheAspCys25 0AspHisPheTyrSer33 OAsnLysAsnSerPro41 0GlyPhePhePheIle4 90SerLeuPheIleGln570ProCysAspAspGluAsnPhe23 5LysLeuAlaTyrArg315IleIleGlnProHis3 95LysLeuAsnAsnAsp475AspIleGluAlaThr555AspArgArgIlePheIleGlu220GluAsnLeuValLeu300TyrLysGlySerTyr380GlnIleAlaLysLys460SerGlnGlnPheGlu540LysSerGluLysLeuThrAsp2 05PheArgGluLysAsn285LysSerIleGluLys365ThrPheThrSerThr44 5ArgHisGluLysPhe525IleGluTyrLysSerPCTIUS97/19575LysLys190GluGluAsnCysAsn270AspGlnAsnLeuIle350AsnAlaGluAspGln430AsnSerGluSerIle510GluLeuPheGlnTyr590HisLys175PheLysSerLysAsn255IleValIleLeuAsp335LysValPheLysAsn4 15LeuPheLysSerLeu4 95GluAsnGluAsnLeu575ThrAspLeuThrTyrAsnGlu240SerGlnSerAspPhe32 0AsnAspSerAsnPhe400AspSerAsnIlePhe480LysSerAspTyrLys56 OLysGluHis?WO 98/18323101525303540455055AsnPhe625PheSerHisValGlu705SerGlyGluArgIle785LysArgAlaCysArg865LysLysLeu(2)Glu610AsnAsnValLysAsp690GlyLysGlnGlyTyr770SerLeuLysAsnAsp850AsnThrArgIle595ProPheHisProAsn675ThrSerAspHisIle755LysGlyCysCysGlu835ArgLysArgASHLys915IleMetAsnAla660HisAspValSerVal740ThrGluLeuGluVal820GluHisTyrLeuPhe900AsnIlePheIle645ArgValHisIleAsp725PheAspTyrLysLeu805PheMetPheAlaLeu885LeuINFORMATION FOR(i)CALeuGly630IleLysThrLeuLys710AlaHisTyrLysAsn790AspAsnHisLysLys870TyrLysSer615PheTyrGluPheAsp695AsnLeuAsnCysAsp775AspAsnGlnAspGln855AsnGlyLeu600GlnLeuValPheVal680GluHisAspProTyr760AsnSerHisGlnPro840IleLysGlyPhe-171-GlnTyrMetArg665LeuIlePheLysGln745LeuProAsnProAla825IleGluGlnGluLys905SEQ ID NO:98:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:(D)amino acidTOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES(vi)ORIGINAL SOURCE:(A)SerAsnAsp650LysAlaArgAsnIle730LysSerIleAspIle810ThrThrAspMetAsp890Trp176 amino acids02265523 1999-03-16ThrVal635GluPheThrIleTyr715LysHisAlaProMet795ValSerIleCysGlu875AlaIleORGANISM: Helicobacter pyloriGly620GlyProLeuHisVal700ProArgArgPhePhe780LysLeuGluLeuPhe860LeuIleAla605PheSerAlaLysAsp685GluLeuSerIleLys765ThrGluThrArgGln845SerSerGluTrpPCT/US97/19575GlnHisThrGlu670ProLysAsnLeuIle750LeuPheThrAspPhe830LeuAlaMetLysAla910TrpPheHis655TyrPheGluAsnGly735PheTyrLeuIleAsp815LysSerAsnAlaGln895ThrAlaâSer640LeuAlaLeuThrAla720ValValLeuProGlu800AspArgAspAspPhe880ThrAsn?CA 02265523 1999-03-16W0 98/ 18323 PCT/U S97/ 19575-172-(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l76(xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:Met Thr Ala Met Met Arg Tyr Phe His Ile Tyr Ala Thr Thr Phe Phe1 5 10 1510 Phe Pro Leu Ala Leu Leu Phe Ala Val Ser Gly Leu Ser Leu Leu Phe20 25 30Lys Ala Arg Gln Asp Thr Gly Ala Lys Ile Lys Glu Trp Val Leu Glu35 40 45Lys Ser Leu Lys Lys Glu Glu Arg Leu Asp Phe Leu Lys Gly Phe Ile15 so 55 soLys Glu Asn His Ile Ala Met Pro Lys Lys Ile Glu Pro Arg Glu Tyr65 70 75 80Arg Gly Ala Leu Val Ile Gly Thr Pro Leu Tyr Glu Ile Asn Leu Glu85 90 9520 Thr Lys Gly Thr Gln Thr Lys Ile Lys Thr Ile Glu Arg Gly Phe Leu100 105 110Gly Ala Leu Ile Met Leu His Lys Ala Lys Val Gly Ile Val Phe Gln115 120 125Ala Leu Leu Gly Ile Phe Cys Val Phe Leu Leu Leu Phe Tyr Leu Ser25 130 135 140Ala Phe Leu Met Val Ala Phe Lys Asp Thr Lys Arg Met Phe Ile Ser145 150 155 160Val Leu Ile Gly Ser Val Val Phe Phe Gly Ala Ile Tyr Trp Ser Leu165 170 17530(2) INFORMATION FOR SEQ ID NO:99:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 222 amino acids35 (B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein40 (iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori45 (ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...222(xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:50Met Phe Lys Asn Ala Leu Asn Ile Gln Asp Phe Ser Phe Lys Asn His1 5 10 15Thr Ser Thr Ala Ile Ile Gly Thr Asn Gly Ala Gly Lys Ser Thr Leu20 25 3055 Ile Asn Thr Ile Leu Gly Ile Arg Ser Asp Tyr Asn Phe Lys Ala Gln?WO 98/1832310152025303540455055AsnLeu65AsnAspAspProAla145LeuGluLeuLys(2)MetSerAsnHisGly65PheAsn50GlyAspLeuGlyGln130LeuThrTrpAsnPro21035ASE.ValLeuPheGln115LeuIleSerValSer195ThrIleValPheGlu100LysValArgIleLeu180IleThrProSerLys85LysGlnIleLeuIle165LeuLeuLysINFORMATION FOR(i)(ii)(iii)(Vi)(ix)(xi)CATyrAsn70PheAsnArgMetSer150AlaLeuLysAspSEQ02265523 1999-03-16His55LeuTyrLeuLeuAsp135AsnThrLysSerLeu21540AspPheGlnLeuLys120GluLeuHisAsnVal200Leu-173-AsnAsnPheAsn105IleProIleAspGly185AlaAlaID N02100:SEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...406ValTyrPhe90LysAspGluSerPro170AsnLysLeu406 amino acidsIlePro75HisThrLeuThrLeu155IleIleThrLeuORGANISM: Helicobacter pyloriPro60ProLysTyrAlaSer140ArgValAlaPheLys220SEQUENCE DESCRIPTION: SEQ ID NO:l0O:Tyr Ala Ala His Pro Ile Lys ProGlnAspLys50LysLeuPheGln35AlaAspGluLeu20AlaMetLeuArg5ArgCysIleAspLeuArgProAlaLeu70ValValLeuTyr55AspLeuPheGlu40LeuLeuThrVal25PheLeuLeuAspIle10GlyValAlaIleIleLysAlaGluLysLys75LysAlaSerLeuAsp60TyrPJCO45GlnGlyAsnGluLeu125LeuAsnLeuGlnAsn205AspProIleAsp45LeuPhePro PCT/U S9 7/ 19575ArgLeuCysHis110SerGluThrAspTyr190PheIleLysArg30LysLysCysIleLysAsnThr95LeuHisGlnGlnSer175LysLysLeu15ArgGlnAspPhePheGlnAla80LeuSerHisAsnGln160CysPICGluLysTrpAlaArgGlu80Tyr?W0 98/ 18323101525303540455055AlaSerGluSer145PheLysLysGlnGly225LeuPheLysLysGlu305AspThrLysSerLeu385LeuLeuLeuTyr130AlaAsnGlnGluLys210HisLysHisGlnGlu290AspLysLeuValHis370GluPheGlnGln8 5Thr100Gln115LeuHisProLeuAspSerPheAsnHisGluHisTyrMet165Asn180Asp195ArgThrAlaAspLeuTrpLeuCysLeuLysSerCysLys245Pro260Ser275MetLeuSerTyrValGlnLysHisAsnAlaAsnTyrGln325Ser340Cys355GlyLeuArgAspIleArgAspHisSerSerPhe405I NFORMATI ON FOR(i)(ii)(iii)(vi)CAHisIleArgAla150TyrAsnLysGlnVal230SerGluGlyLysPhe310IleAspLeuSerGln390LysSEQSerSerPro135SerGlyAspLeuThr215AlaMetIleLeuVal295ThrValGluSerTyr375ThrLysAla12 OGlnLysValHisVal200ProIleArgLeuAsp280TyrGluPheTyrAla36 OAspGlu-174-Glu105TyrIleTrpLysLeu185SerArgMetIleThr265HisSerAsnThrLeu345PheLeuLeuID NO:lOl:SEQUENCE CHARACTERISTICS :(A)(B)(D)LENGTH :TYPE :amino acidlinearTOPOLOGY :MOLECULE TYPE: proteinHYPOTHETICAL : YESORIGINAL SOURCE:ORGANISM: Helicobacter pylori(A)90LeuPheLeuGluGlu170PheMetValGlyAsn250ArgCysPheGluLys330GlyLeuIleLeu3 3 5 amino acids02265523 l999-03- 16AlaSerGluPhe155IleGluPheProTyr235HisAspIleValPhe315AspValGluGlnAsp395SerLeuThr140AspLysGlyGlyGln22 0LeuPheIleLysSer3 00LysAlaCysAlaGly380LeuTyrGlu125GlnIleAspLeuGln2 O5ThrLeuLeuIleGlu285LeuAsnGluGlyGln365AlaAspPCTlUS97/ 19575Val110GluIleIleLysPhe190LeuSerSerGlyThr270IleGlyArgGluGlu350IleLysLeu95AlaLeuLeuTyrIle175GlyArgValPheGly255ProGluValTyrLeu33 5LeuSerAsnGlyGlnLysGluHis16 0AspGluPheLeuAsp240LeuIleLysGlnLys32 OPheLeuLeuLeuLys400?WO 98/1832310152025303540455055ValIleLysGlyMet65LeuArgProIleIle145IleLeuGlyCysPhe225SerAsnPheLeuLeu305Ala(2)(ix)(xi)LeuValIleIle50ProSerLeuLeuAla130AsnAlaLeuLysGly210PheIleLeuAsnPro290IleTyrFEATURE:(A) NAME/KEY: misc_featureCA02265523 1999-03-16(B) LOCATION l...335-175-SEQUENCE DESCRIPTION: SEQ ID NO:lOl:TrpLeuGln35PhePheGlyIleVal115PheIleLeuAlaIle195IleGlyLeuHisTyr275PheValLeuValTrp20GlyLeuLysPheLeu100ValLeuIleLeuTyr180PheSerLeuArgLeu260ProIleIleASI1Leu Tyr Phe Leu Thr5SerPheSerGlyLeu85GlnSerPheAspVal165MetLeuLeuAsnArg245HisAsnLeuSerArg325LysHisPhePro70GluAlaAspAlaGly150IleValGlyLeuLeu230LysThrProIleLeu310GlnLysHisAla55PheAspValPheIle135PheHisLeuAspHis215MetIleLeuLeuSer295ValValSerAla40LeuValIleGlySer120PheAsnTyrGlyGly200LeuLeuLysLeuCys280ValPheCysMet25ArgAlaPheAsnVal105ProMetGlyIlePhe185GlySerTyrArgPhe265AlaLeuIleAlaINFORMATION FOR SEQ ID N02102:(i)SEQUENCE CHARACTERISTICS:(A)LENGTH:(B) TYPE:amino acid96 amino acidsSer Leu Phe10LeuThrCysLeuâLeu90ValLeuLeuLeuAsp170MetAlaLeuProGln250LysPhePheAlaLeu330PheProTyrGly75SerCysPheValAla155ProValTyrGluVal235LysPheIleArgCys315GluIleVal AspAla45GluArgLeu60Leu SerLeu SerIle IleLeu125IleSerGly140Ser GlySer SerLeu AsnPhe Leu205Gln Lys220Ile GluAla ThrLeu GlnIle285AspLeuLeu300Tyr LeuLys ArgPCT/US97l19575CysAsn30GlyProLeuProSer110ProSerIleLeuPhe190GlyIleValMetGln270LeuAlaIleAlaSer15AlaGlyPheValLys95SerTyrAsnCysSer175ProLeuSerLeuPro255ArgCysTyrGlyPhe335LeuAsnLeuGluPhe80IleThrPheAlaAla160CysSerValValPhe240AspSerAsnAlaTyr320?CA02265523 1999-03-16-176-(A) ORGANISM: Helicobacter pylori(A) NAME/KEY: misc_featureAla Leu Gly ValLys AlaLys Lys40Glu Ile55Pro ValAla LeuID NO:lamino acidLeu25AlaGluMetAla03:SEQUENCE DESCRIPTION: SEQ ID NO:lO2:Leu Ala10ValLys GlyLeu Gly LysGlu Leu60GlnAspThr Ala75TyrLys Ile90156 amino acids(A) ORGANISM: Helicobacter pylori(A) NAME/KEY: misc_feature40SEQ ID NO:lO3:Val Phe Glu Lys Leu Asp Leu25Ser Gly Ala Ser Gly Val GlyW098/18323(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein5 (iii) HYPOTHETICAL: YES(Vi) ORIGINAL SOURCE:I0 (ix) FEATURE:(B) LOCATION l...96(xi)15Met Lys Lys Val Ile Vall 5Leu Met Ala Thr Asp Val2020 His Gly Val Lys Phe Glu35Asn Met Met Ser Glu Lys50Ser Gly Ala Asn Lys Asn25 65 7oSer Asp Glu Asp Ile Lys85(2) INFORMATION FOR SEQ30(i) SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:(D) TOPOLOGY: linear35(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES40 (vi) ORIGINAL SOURCE:(ix) FEATURE:45 (B) LOCATION 1 ..lS6(xi) SEQUENCE DESCRIPTION:Met Arg Asp Phe Asn Asn Ile Gln Ile50 1 5Asn Ala20Ala Ile3555 Leu LeuGly Ala Phe Gly Leu Lys GluThr Arg Leu10Glu Phe LysLys Ser ValSer Asn AlaPheCysSer45MetAlaProLysAspLeu45SerPCT/US97/19575Ala Asn Val15Ala Ala30LysCysIle ValAla Phe LysLeu80LysLys LysThr Leu95Val Arg Gln15Gly Leu Ser30Ile Ala SerAsn Ile Glu?LeuAspArgLeu115AsnGlnIleGluTyr100LeuGluAsnAlaHis85PheLysLeuLysCAPro70GluLeuGlyASH.ASH15002265523 1999-03-1655PheProAsnLeuAsp135ArgLeuLeuGlnIle120IleArg-177-AspValThr105LysLeuLeuINFORMATION FOR SEQ ID NO:104:SEQUENCE CHARACTERISTICS:amino acid(A) LENGTH:(B) TYPE:(D) TOPOLOGY:linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...ll8ThrIle90SerArgMetAla118 amino acidsGlu75SerLeuLeuLeuPro15560GluValSerSerSer140PheSEQUENCE DESCRIPTION: SEQ ID N02104:LeuLysAsn35GlyAsnGlnAspPhe115MetSer20ArgLeuHisValThr100HisAla5MetAspAspLeuAsp85LysArgINFORMATION FORWO 98/1832350Val Glu65Arg Glu5Lys ThrLys Ala10 Ser Gln130Tyr Ile14515 (2)(i)20(ii)(iii)25(Vi)(ix)30(xi)35 Val Met1Met LysPhe Cys40Glu Val50Met Glu6545 Lys GluGly AsnThr Tyr50(2)55(i)IleSerIleSerIle70IleLysSerPheLeuLysAsn55GlyArgPheThrPheAsp40AlaLeuGluAspProAla25LeuArgPhePhePhe105SEQ ID NO:lO5:SEQUENCE CHARACTERISTICS:(A)LENGTH:Tyr Ile Leu10AsnAsnLysValGlu90Val355 amino acidsMetAspAsnGln75AspIleGlyPheArg60AlaLeuPheTyrIleLysAsn125LeuIleLeuVal45SerGlnArgSerPCTIUS97/19575GlyLysAsn110AspLeuLeuGlu30PheArgLeuGlnLys110IleLys95ThrArgAspLys15GlnGlyLysAsnAla95GluPhe80GluLeuPheGlyMetIleIleAlaPhe80PheLys?WO 98/1832310152025303540455055MetSerIleTyrLeu65LysGlyGlnLysIle145AsnLysTyrGlyVal225GlyLysGlyAspGly(ii)(iii)(vi)(ix)(xi)(B)(D)TYPE:TOPOLOGY:CAamino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...355-178-02265523 1999-03-16SEQUENCE DESCRIPTION: SEQ ID NO:105:Asn Ile LysLeuGlyPhe50GlyAlaCysAsnHis130LysPheGlyLeuSer210AlaCysAspSerThr290CysAsnGlu35LysIleLeuPheTyr115ProGlyAspPheLys195LeuPheAlaProAla275ValAspAla20ArgLysIleGluGly100GlnGluAsnMetLeu180AlaPheAspSerGln260ValSerMetIle Leu Lys Ile Leu5HisAlaAlaTyrTyr85LeuGluSerAlaAla165GluCysGluTyrLeu245LysSerLysGlyLeuTyrCysGlu70TyrGlyAlaCysAla150LysValArgAsnLeu230GlyAlaCysAspAspTrpLysAsn55AsnLysGlyIleTyr135GlnGlyLysLeuGly215GlnSerPheSerLeu295GluGlySer40AspGlyThrLeuAsp120AsnAlaCysGlnAsn200AspLysMetAsnArg280ArgValLys25GlyGlyGlnAlaTyr105AlaLeuValTyrSer185GluAlaAlaTyrTyr265MetLysGlyVal Gly Gly10GlnAsnValGlyCys90AspTyrGlyThrIle170AsnGlyGlyCysMet250PheGlyAlaCysAspTyrSerThr75GlnGluAlaIleTyr155LeuHisGlnLeuAla235LeuLysPheLeuPheAsnSerGlu60ArgAlaGlyLysIle140TyrGlyLysAlaAsp220LeuGlyGlnMetAsp300AlaLeuSerLys45GlyIleAspLeuAla125TyrGlnThrAlaCys205GluAsnArgAlaTyr285AsnLeuPCTYUS97?9575PhePhe30AlaCysAspAspGly110CysAspLysAlaVal190ArgAspAsnTyrCys270SerTyrAlaPhe15LeuAlaThrTyrArg95ThrValArgSerTyr175IleAlaPheSerVal255AspGlnGluGlyLeuGlySerGlnLys80GluAlaLeuLysCys160GluTyrLeuGluGly240LysMetGlyArgMet?CA 02265523 1999-03-16W0 98/ 18323 PCT/US97/19575-179-305 310 315 320Tyr Tyr Asn Met Lys Asp Lys Glu Asn Ala Ile Met Ile Tyr Asp Lys325 330 335Gly Cys Lys Leu Gly Met Lys Gln Ala Cys Glu Asn Leu Thr Lys Leu5 340 345 350Arg Gly Tyr355(2) INFORMATION FOR SEQ ID NO:lO6:10(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 193 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear15(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES20 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature25 (B) LOCATION 1...193(xi) SEQUENCE DESCRIPTION: SEQ ID NO:106:Met Lys Glu Lys Asn Phe Trp Pro Leu Gly Ile Met Ser Val Leu Ile30 1 5 10 15Phe Gly Leu Gly Ile Val Val Phe Leu Val Val Phe Ala Leu Lys Asn20 25 30Ser Pro Lys Asn Asp Leu Val Tyr Phe Lys Gly His Asn Glu Val Asp35 40 4535 Leu Asn Phe Asn Ala Met Leu Lys Thr Tyr Glu Asn Phe Lys Ser Asn50 55 60Tyr Arg Phe Ser Val Gly Leu Lys Pro Leu Thr Glu Ser Pro Lys Thr65 70 75 80Pro Ile Leu Pro Tyr Phe Ser Lys Gly Thr His Gly Asp Lys Lys Ile40 85 9o 95Gln Glu Asn Leu Leu Asn Asn Ala Leu Ile Leu Glu Lys Ser Asn Thr100 105 110Leu Tyr Ala Gln Leu Gln Pro Leu Lys Pro Ala Leu Asp Ser Pro Asn115 120 12545 Ile Gln Val Tyr Leu Ala Phe Tyr Pro Ser Gln Ser Gln Pro Arg Leu130 135 140Leu Gly Thr Leu Asp Cys Lys Asn Ala Cys Glu Pro Leu Lys Phe Asp145 150 155 160Leu Leu Glu Gly Asp Lys Val Gly Arg Tyr Lys Ile Leu Phe Lys Phe50 155 170 175Val Phe Lys Asn Lys Glu Glu Leu Ile Leu Glu Gln Leu Ala Phe Phe180 185 190Lys55?WO 98/1832310152025303540455055(2)LeuPheAsnProGlu65IleGluGlyProLeu145SerPheAspGlyLeu225LeuLeuTyrCA-180-INFORMATION FOR SEQ ID NO:lO'7:(i)(ii)(iii)(Vi)(ix)(xi)GlyGlyMetI l e50AsnHisLysPheTyr130TyrAlaLysLeuI le210LysAsnAlaTyrSEQUENCE CHARACTERISTICS :(A) LENGTH :TYPE :TOPOLOGY :(B)(D)amino acidlinearMOLECULE TYPE: proteinHYPOTHETI CAL : YESORIGINAL SOURCE:(A)FEATURE :(A) NAME/KEY: misc__feature(B) LOCATION l. . .2892 8 9 amino acids02265523 l999-03- 16ORGANISM: Helicobacter pyloriSEQUENCE DESCRIPTION: SEQ ID NO:107:IlePheThr3 5LeuGluLysAsnPhe115GluGlyLeuSerLeu195PheGluLeuLeuPheAsnIle2 0GluLeuValLysGlu100IleLysLeuArgAsp180MetGlyIleGlyLys260LysMet5LeuThrGluAlaLys85SerGlyPheArgPhe165SerAspGlyArgVal245MetSerCysSerAsnGluLys70ArgIleValGluSer150TyrLeuLysValGly23 0SerProThrSerLeuThrLys55LysGlnLeuIleLeu13 5GlyGlyAlaProGly215TyrMetProAsnLysCysThr40ArgIleLeuPheLeu12 0LeuTyrGluSerIle2 00ValSerThrLeuIleLysAla25GluAlaAspTyrGln105GlySerGlnTyrTyr185AspGlyGlnLeuLys265TyrIle10GluGluGlnGluMet90GlnAspAsnLysLeu1 70GlnLysTrpProAsn25 OGluTyrArgGluAsnThrLys75LeuMetI leIleTyr155GlyThrGluAsnAsn23 5LeuThrIleAsnAsnThrLeu60SerLysAlaGlyGln14 0PheGlyAlaLysGly22 0AlaLysSerSerLeuIlePro4 5GluLeuGlyLysIle125AlaAlaAlaSerArg2 O5MetPheHisGlnTyrPCT/US97/19575I leThr3 OLysLeuLeuGluAsn1 1 0AsnSerAsnMetLeu1 9 OPheTyrGlyArgThr270AsnLeu1 5LysAspLysGluLeu9 5LysAlaProGlyLys1 7 5AsnAlaGlnLeuPhe2 5 5PheTyrCysGluAlaGluGlu80HisSerAsnLeuIle160GlyIleLeuAsnVal240GluLeuLeu?W0 98/18323Leu5 (2)101525303540455055MetAsnLeuThrAla65SerThrPheIleLeu145LysValSerGlyGlu225Gln275CA280-181-INFORMATION FOR SEQ ID NO:108:(i)(ii)(iii)(vi)(ix)(xi)ArgGluGluTyr50AlaSerIleThrPro130LysPhePheAsnAsn210GluSerSEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...668668 amino acids02265523 1999-03-16ORGANISM: Helicobacter pylori285SEQUENCE DESCRIPTION: SEQ ID NO:l08:LysLysGly35AlaAsnLeuGluAsp115LysGluGluGluGlu195ThrPheTrpLeuAsn20ThrThrLeuSerAsn100AlaHisAlaAlaThr180AsnLysThrGlyPhe5GlyGlnTyrPhePro85PheGlnSerPheThr165LeuProAsnASI1AspIle ProPhe PheThr GlnAsn Tyr55Thr Asn70Val ArgLeu ProGly AsnIle135LysLysAsp150Ser ThrAsn AsnAsn AsnAsp Cys215Leu Met230Ala IleLeuIleGlu40LeuAlaValTyrThr120ValIleSerIlePhe200TrpLeuLeuLeuGlu25LysProGluLeuAsn105IleLeuAspIleLys185AsnGlnAsnAsnLeu10AlaArgThrAlaTyr90LeuAspProProSer170ThrThrAsnMetAlaPheGlyHisAspIle75MetAsnLeuGlyTyr155AspAsnCysPheIle235ProSer AlaPhe GluThr Thr45Thr Ile60Ser LysTyr AsnAsn ValVal125AlaGlyGlu140Thr LeuThr AsnLeu IlePro Tyr205Thr Pro220Ala ValPhe GluPC1YUS97?9575LeuThr30ThrLeuLeuGlyLys110IlePhePheThrMet190AsnGlnLeuPheGlu15GlyLysLysLysGln95LeuGluAspLeuGln175LysAsnThrAspThrAlaLeuAsnArgPhe80LeuSerThrSerPro160ArgTyrAsnAlaSer240Asn?WO 98/1832310152025303540455055SerValLysVal305AsnProLeuAsnVal385TyrSerGlyAsnAsn465SerPheAlaTyrVal545I leArgTyrAspVal625SerHisSerAsnGln2 90ValAspLysArgGly370GluAsnAsnPheAla450LeuThrSerLysTyr530GlnThrAsnAsnVal610GlyGlyPheThrGly275GlyLeuGlyLysThr355AsnLysValTyrLeu435LeuAsnIleAsnIle515GlyGlnThrPheSer595AlaIleGlyLysAsp260ArgIleLysGluLeu340IleMetAspCysPro420GlyProAlaGlnAla500GlyIleLeuTyrSer580TyrThrSerAspVal660INFORMATION24 5CysValIleAsnTyr325PheLeuThrSerSer405AsnValIleSerLys485SerTyrIleSerSer565SerTyrGlyIleTyr645PheFORCAAspAspAsnSer310GlyGlyHisTyrAsn390LeuSerThrAsnLeu470ThrGlnGlnLysTyr550AsnSerValLeuPro630ThrPheSEQSerThrAsn295GlyThrAsnGluGln375GlyTyrIleAlaTyr455AsnPheSerAsnTyr535GlyLysPheLeuAsn615LeuAsnAsnAspLys2 8 0PheValLeuAspPhe3 60ArgLysGlyTyrAla440AlaThrValPheTyr52 OAsnGlyAsnGlyAsn6 O0TyrIleSerTyr-182-Pro265ValArgValGlyLeu345SerValProGlyHis425ValAsnGlnThrArg505PheTyrGlySerIle585LysArgGlnPheGly665ID NO:lO9:250SerAspLysGlyVal3 3 0LysHisProLysSer410AsnTrpLeuAspSer490SerAsnAlaIlePro570PheValTyrArgVal650Trp02265523 l999-03- 16LysGlnLysLeu315GluThrThrValAsp3 95AsnCysGlnGlyLeu475SerProAspLysAsp555ThrGlyLysLysLys635PheValCysGlnIle300AlaAlaIleLysThr380SerGlnAlaGlnSer460AlaValIlePheAla540LeuGlyGlyGlyHis620AlaAsnPheValTyr285GluAsnTyrAsnGly3 65LysAspProAspLeu44 5GlnAsnThrLeuIle525ValLeuIleLeuSer605SerSerGluPCT/US97/19575Asn270IleIleGlyAlaLeu350TyrAspGlyAlaVal430IleThrSerAsnGly510GlyAsnLeuGlnArg590GlyLysValGly255ProLeuAspTyrLeu3 3 5GluGlyGlyLeuPhe415ProAsnAsnMetHis495ValLeuGlnAspThr575GlyAsnTyrValAla655GlyAsnAlaGly320AspAspHisGlnPro4 00ProAlaGlnTyrLeu480HisAsnAlaLysPhe56 OLysLeuLeuSerSer640Ser?CA02265523 1999-03-16linear-183-63 amino acids(A) ORGANISM: Helicobacter pylori.63SEQUENCE DESCRIPTION: SEQ ID NO:l09:PC1VUS97?9575Ile Met Leu Val Val Ser Val10Phe Leu Trp Gly Val Lys Ser2530Leu Glu Ser Val Leu Tyr Asp4045Leu Gln Glu Lys Arg Gln LysID NO:ll0:linear60406 amino acids(A) ORGANISM: Helicobacter pyloriWO 98/18323(i) SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE: amino acid5 (D) TOPOLOGY:(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES10(vi) ORIGINAL SOURCE:(ix) FEATURE:15 (A) NAME/KEY: misc_featureA (B) LOCATION 1..(xi)20 Met Asn Thr Glu Ile Leu Thr1 5Gly Leu Val Gly Leu Ile Ala20Phe Asp Asp Glu Lys Arg Met25 35Ser Asp Leu Asn Glu Ala Ile50 55(2) INFORMATION FOR SEQ30(i) SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE: amino acid(D) TOPOLOGY:35(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES40 (vi) ORIGINAL SOURCE:(ix) FEATURE:(A) NAME/KEY: misc_feature45(B) LOCATION l:..406(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:llO:Met Val Phe50 1Met Val AlaAsp Gly Met3555 Trp Asp LysPhePhe20AlaLeuHis5LeuLysThrLysPheLysLeuLysHisGlnLeuIleLeuThr40GlyIleSer25LeuPheLeu Asn Phe Ile10Tyr Gly Val LeuLeu Val Gly Glu45Leu Glu Lys Asn TyrLeu30ArgHisLeu Met15Gly GlnSer AlaASHSer Leu15Lys AlaLeu ValIle Pro?WO 98/1832310152025303540455055Gln65GluThrIlePheTyr145LeuAsnAlaHisLys225ThrLysSerLysLeu305SerLeuProGlyLys385Tyr(2)50LysIleLeuTyrThr130GlnMetAspPheGln210AlaArgValLeuAla290ValPheSerIleLys370LeuLeuLeuGlnIleLys115ArgAspAsnLysGly195TyrGlnIleLysIle275GlyTyrValThrAsn355GlnGluLeuTyrSerGln100LysLysIleAlaIle180GlnTyrGluSerArg260HisTyrAlaLysGly340ProArgGluGluINFORMATION(i)TyrAsn85AlaGlyGluValTyr165AlaProLeuValSer245ProSerGlyHisLys325ProLeuGluLeuGly405FORCAAsn70ValLeuGluArgLys150LysIleThrPheAla230ProHisAlaLysMet310GlyHisGlyValPhe390PheSEQ55LeuThrIleAspThr135AlaLysValIleSer215GlyPheTyrSerVal295SerGlnLeuTyrPhe375LysSerTyrProTyr120LeuThrSerTyrLys200HisPheSerGlyAsp280ValAlaIleHisIle360LeuThr-184-SerTyrIle105PheLeuAsnValThr185MetSerLeuTyrVal265GlyGluPheIlePhe345ArgGluHisID NO:ll1:SEQUENCE CHARACTERISTICS:(A) LENGTH:TYPE:TOPOLOGY:(B)(D)amino acidlinear(ii) MOLECULE TYPE:proteinGlnThr90SerLeuLeuAspPro170ArgAlaAsnLeuGly250AspArgIleAlaGly330GlyThrLysSer296 amino acids02265523 1999-03-16Asp75LeuGlnAspSerPro155PheAspMetGlyGlu235ArgTyrValHisAsn315ArgValAlaAlaPhe39560LysArgAspPheLeu140LeuLysTyrValArg220ThrPheAlaGlyLeu300GlyValTyrLysGln380GluGluAspLeuIle125GlnLeuArgArgSer205TyrProHisAlaPhe285AsnLeuGlyLysSer365TyrLysPCT/US97/ 19575LeuAlaGln110ProThrAlaLeuVal190SerTyrValProLys270IleGluLysSerAsn350LysSerAsnSerAsn95IleIleSerAsnVal175GlyArgAspLysVal255HisGlyLeuLysThr335SerLeuLysSerAla80AsnHisValProGln160LysGlnLeuSerTyr240LeuGlyValArgGly320GlyArgHisGlnPhe400?WO 98/1832310152025303540455055LeuPheGlnAspGln65AspSerAsnLysGln145GlyLeuAsnTyrGlu225AsnLysIlePhe(2)CA02265523 l999-03- 16(iii) HYPOTHETICAL: ms(vi)ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(xi )PheLeuGluTyr5 0ProAsnAspAsnPro13 0AspAspLysAspVal2 1 0SerLysLysAspLeu290(A) NAME/KEY: misc_feat:ure(B) LOCATION l. . .296-185-SEQUENCE DESCRIPTION: SEQ ID NO:lll:LeuAlaGln35GluIleSerAsnGlu115LysPheGlnAspThr195TyrPheAlaHisLeu275GluValCys2 OGluValGluPheSer100AspArgTyrTrpGln18 0LysThrLeuLeuSer260AspCysLys5SerâAsnPheGluAsn8 5GluAsnLysProLeu16 5AsnThrThrLeuAsp2 4 5ThrPheLeuINFORMAT I ON FOR(i)LysGlnAspSerArg7 0ProLysAlaThrLeu150IleAspGlnAsnGlu23 0ThrAspLysLysSEQIleGluGlyGlu5 5AsnGluAsnAsnLys13 5LysGluLysIleAsn215LysMetLysLysGlu295GlySerSer40ThrAlaAsnLeuAsn120AsnAsnIleAspAla200GlyLysGluLeuGlu280SerValPhe25LysIlePheSerLeu105SerProGlyGlnArg185GlnSerSerIleAsp265ArgID NO:ll2:SEQUENCE CI-IARACTERISTI CS :(A)(B)LENGTH :TYPE :amino acid>H>rv ._..m.,.M._...-...».........»...m.aa..~.a..4........3. AVal10IleArgPhePheVal90SerGlnLysAspSer170GlnIleLeuAspSer250SerPhe2 4 8 amino acidsIleLysProLeuGln7 5IleTyrLysLeuIle155LysIleLysSerAsn235LysGlnLysMetMetSerGln60LeuLeuProAsnIle140IleAlaGlnGlyLeu220ValCysHisSerI leGlnTyr4 5AsnThrLeuAsnPro12 5GluMetLeuThrLys2 O 5ArgTyrGlnLysAsp285PCT/U S97/ 19575LeuLys3 0ValMetLysAsnAsp1 1 0PheTyrSerLysPhel 9 OI l (2ProThrMetAla2'70ThrVal15LysAspValAspGlu95ProLeuSerLysArg175ThrSerPheIleVal255IleGluCysAlaSerTyrGlu8 0ProAsnTyrGlnGlu160PhePheSerTyrGlu24 0LeuSerLeu?CA 02265523 1999-03-16W0 98/ 18323 PCT/U S97/ 19575-186-(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein5 (iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori10 (ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .243(xi) SEQUENCE DESCRIPTION: SEQ ID N02112:»15Val Ser Tyr Asp Asn Thr Asp Asp Tyr Tyr Phe Pro Arg Asn Gly Val1 5 10 15Ile Phe Ser ser Tyr Ala Thr Met Ser Gly Leu Pro Ser Ser Gly Thr20 25 3020 Leu Asn Ser Trp Asn Gly Leu Gly Gly Asn Val Arg Asn Thr Lys Val35 40 45Tyr Gly Lys Phe Ala Ala Tyr His His Leu Gln Lys Tyr Leu Leu IleS0 55 60Asp Leu Ile Ala Arg Phe Lys Thr Gln Gly Gly Tyr Ile Phe Arg Tyr25 65 7o 75 80Asn Thr Asp Asp Tyr Leu Pro Leu Asn Ser Thr Phe Tyr Met Gly Gly85 90 95Val Thr Thr Val Arg Gly Phe Arg Asn Gly Ser Ile Thr Pro Lys Asp100 105 11030 Glu Phe Gly Leu Trp Leu Gly Gly Asp Gly Ile Phe Thr Ala Ser Thr115 120 125Glu Leu Ser Tyr Gly Val Leu Lys Ala Ala Lys Met Arg Leu Ala Trp130 135 140Phe Phe Asp Phe Gly Phe Leu Thr Phe Lys Thr Pro Thr Arg Gly Ser35 145 150 155 160Phe Phe Tyr Asn Ala Pro Thr Thr Thr Ala Asn Phe Lys Asp Tyr Gly165 170 175Val Val Gly Ala Gly Phe Glu Arg Ala Thr Trp Arg Ala Ser Thr Gly180 185 19040 Leu Gln Ile Glu Trp Ile Ser Pro Met Gly Pro Leu Val Leu Ile Phe195 200 205Pro Ile Ala Phe Phe Asn Gln Trp Gly Asp Gly Asn Gly Lys Lys Cys210 215 220Lys Gly Leu Cys Phe Asn Pro Asn Met Asn Asp Tyr Thr Gln His Phe45 225 23o_ 235 240Glu Phe Ser Met Gly Thr Arg Phe245(2) INFORMATION FOR SEQ ID N02113:50(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 335 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear55?CA 02265523 1999-03-16wo 93/13323 PCT/US97/19575-187-(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES5 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature10 (B) LOCATION 1...335(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll3:Val Gln His Phe Asn Phe Leu Tyr Lys Asp Ser Leu Phe Ser Ile Ala15 1 5 10 15Leu Phe Thr Phe Ile Ile Ala Leu Val Ile Leu Leu Glu Gln Ala Arg20 25 30Ala Tyr Phe Thr Arg Lys Arg Asn Lys Lys Phe Leu Gln Lys Phe Ala35 40 4520 Gln Asn Gln Asn Ala Tyr Ala Ser Ser Glu Asn Leu Asp Glu Leu Leu50 55 60Lys His Ala Lys Ile Ser Ser Leu Met Phe Leu Ala Arg Ala Tyr Ser65 70 75 80Lys Ala Asp Val Glu Met Ser Ile Glu Ile Leu Lys Gly Leu Leu Asn25 85 9o 95Arg Pro Leu Lys Asp Glu Glu Lys Ile Ala Val Leu Asp Leu Leu Ala100 105 110Lys Asn Tyr Phe Ser Val Gly Tyr Leu Gln Lys Thr Lys Asp Thr Val115 120 12530 Lys Glu Ile Leu Arg Phe Ser Pro Arg Asn Val Glu Ala Leu Leu Lys130 135 140Leu Leu His Ala Tyr Glu Leu Glu Lys Asp Tyr Ser Lys Ala Leu Glu145 150 155 160Thr Leu Glu Cys Leu Glu Glu Leu Glu Val Pro Lys Ile Glu Thr Ile35 165 170 175Lys Asn Tyr Leu Tyr Leu Met His Leu Ile Glu Asn Lys Glu Asp Ala180 185 190Ala Lys Ile Leu His Val Ser Lys Ala Ser Leu Asp Leu Lys Lys Ile195 200 20540 Ala Leu Asn His Leu Lys Ser His Asp Glu Asn Leu Phe Trp Gln Glu210 215 220Ile Asp Thr Thr Glu Arg Leu Glu Asn Val Ile Asp Leu Leu Trp Asp225 230 235 240Met Asn Ile Pro Ala Phe Ile Leu Glu Lys His Ala Leu Leu Gln Asp45 245 , 250 255Ile Ala Arg Ser Gln Gly Leu Leu Leu Asp His Lys Pro Cys Gln Ile260 265 270Phe Glu Leu Glu Val Leu Arg Ala Leu Leu His Ser Pro Ile Lys Ala275 280 28550 Ser Leu Thr Phe Glu Tyr Arg Cys Lys His Cys Lys Gln Ile Phe Proâ 290 295 300Phe Glu Ser His Arg Cys Pro Val Cys Tyr Gln Leu Ala Phe Met Asp305 310 315 320Met Val Leu Lys Ile Ser Lys Lys Thr His Ala Met Gly Val Asp55 325 330 335?WO,98/ 1832310152025303540455055(2)MetValLysLysGlu65HisIleAlaAsnPro145IleGluLeuHisGln225GlyGlnCA-188-INFORMATION FOR SEQ ID NO:ll4:(i)(ii)(iii)(vi)(ix)(xi)ArgValGlnGlu50GluHisLysProLys130AsnSerGluIleVal210GlnHisGluSEQUENCE CHARACTERISTICS:(A) LENGTH:TYPE:TOPOLOGY:(B)(D)amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .413SEQUENCE DESCRIPTION:LysTyrGlu35LeuLysGlyGlyLys115GluAsnLeuGlnAla195AspGlyTyrLeuIleAla20SerLysLysAspSer100ProThrAlaLeuGlu180GluAspMetLysLeu260Phe5GluSerAsnGluAla85SerGluSerThrVal165LysArgAspAspLeu245ArgSerProLeuLysThr70LysLysGluProAsn150AsnSerIleLysLeu230TyrAsnTyrAspAspGlu55LysAsnGlyLysSer135AsnGlyLysEysLeu215AspArgIleIleSerLys40LeuAlaProValAsp120SerThrSerValAsn200AspHisAspLeuSerLys25LysLysLysThrGln105ThrGlnLeuProSer185GlnGlnPheGlnLeu265413 amino acidsLys10ValIleAsnArgPro90AsnThrPheGluIle170LysGluGluLysLeu250Thr02265523 1999-03-16ValGluArgLysLys75LysGlnProAsnAsp155ThrAlaIleMetGln235LysAsnSEQ ID NO:ll4:LeuAlaGlnAsp60ProIleGlyGlnSer140LysLeuGlnGluAla220MetGluValLeuLeuGlu45LeuArgThrValAla125IleValTyrAlaArg205MetLeuHisAspPCT/U S97/ 19575PheGlu30LeuLysAlaProGln110ThrPheValGlnArg190LeuMetMetLeuThr270Ile15GlyLysAsnGluPro95AsnGluGlyGlyIle175AspLysAlaAlaGlu255SerGlyArgSerLysVal80LysAsnLysAsnGly160GlnArgIleGlnGlu240MetSer?W0 98/ 1832310152025303540455055GluIleAsp305SerAlaAsnGlyLys385LysMetLeuGlyAsnAsn65ThrGlyGlyThrPro290LeuLysGlnGlyLys370LeuLeuLys275ThrGluAlaValGly355AsnValArgMetGluArgAsnPhe340GlyGluGluValINFORMATION(1)(ii)(iii)(vi)(ix)ArgIleAlaGlu325IleGlyValGluLys405FORCAGluGluMet310LysSerGlnSerSer390SerSEQ02265523TyrThr295AlaIleHisPhePhe375LysArgTyr280ValAspGluGluIle360SerAspIle1999-03-16-189-AsnArgProMetGln345ThrGlnLysValID NO:l15:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...l86LysTyrAsnLys330GlyPheAlaIleMet410186 amino acidsHisThrLeu315ThrSerTyrLysLeu395IleLysSer300GluLeuPheIleGln380GluArg(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1l5:IleAlaArgAsp50LysSerGlyLeuLysGlyTyr35LeuTrpGlyAspIle115ArgGlu20GlyTyrPheThrLeu100GlyIle5ValProGlyGlyGlu85IleGlyAlaAsnTyrLeuAla70HisValValCysGlyAsnAsn55ArgThrAsnGlnIle Leu Ser Leu SerPheSer40PheValLysLeuLeu120Phe25AsnLysTyrThrIle105Ala10MetTyrLeuGlyAsn90ProGlyGlySerGlyPhe75LeuLeuAsnAlaAspPhe60LeuLeuAspThrGlu285ThrValAsnThrLys365PheGluGluAlaGlyTrp45ValAspThrLysTrp125PCT/US97/ 19575GlnAsnProProPro350GluIleHisSerTyr30ArgGlyTrpTyrPhe110MetPheGlnGlyGln335ValLysAlaPheLeu15GlnHisPhePheGly95AlaPheSerGluVal320IleMetArgGlnGlu400AlaGlnGlyAlaAsn80GlyLeuPro?WO 98/1832310152025303540455055TyrArg145PIOSerMetAsnTyrGlnGln65AspSerAsnLeuGly145SerAlaGlyCAAsp Val Asn Gln Thr130MetMetTrpArgValTyrValAsnVal180INFORMATION(i)(ii)(iii)(vi)(ix)(xi)GlyGln165AspFORAsp150GlyTyrSEQArg Phe135Arg SerSer LysVal Phe02265523 1999-03-16PCTYUS97?9575-190-Gln Phe Leu Trp Asn Leu Gly Gly140Ala Phe Glu Ala155Asp Val Gly Leu170Thr Phe185Gly Val Lys Phe160Ile Arg Tyr Tyr175ID NO:ll6:SEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B)LOCATION l...242242 amino acidsORGANISM: Helicobacter pyloriSEQUENCE DESCRIPTION: SEQ ID NO;ll6:Lys Lys PheAlaLeuAla50PheTyrGluArgThr130IleTrpLeuAlaValGln35ThrPheAlaAlaLeu115TyrMetLeuValArg195Ser20GlyAsnPheHisAla100ThrGlySerMetSer180LeuPhe Ser Gln5GlyGlnAlaGluAla85GlnAsnGlyLeuAla165LysArgMetAlaThrLys70AsnValIleAlaGly150ThrLysIleSerAsp GlyGln Met40Ile Lys55His PheSer IleAla SerAla Asp_ 120Met Asp135Ala PhePro SerAla ThrLeu Lys200Leu Ala Leu Ile10GlySer Met15AlaLeu IleAsn Val Phe Leu25HisGly30SerGlyAla Ile Asn Gln45LeuAsp LysPhe Ala60LeuGly Asp Leu Gly TyrPhe Phe80AsnGly Leu Arg75LysTyr GlyLeu ASH PIO Asn90IleLys Tyr95Gln Glu105ProGln Ile110ProLeu Gly LysThr Phe Glu125ValArg Asn MetVal Met Val Asn Ile Asn Asn140Ile Gln155GlyAla Asn160GlnGly Gly Leu GlyGlu170PhePhe Ile Val Glu175AsnLeuPhe190AlaSer Gln Phe Leu Val185His Glu205Ser Ser Ile Gly Val?WO 98/18323Lys Phe210Asp Ile2255 Thr Phe10152025303540455055(2)MetCysTyrAlaTyr65AspIleGlyThrMet145PheGlyLysSerCA-191-02265523 1999-03-16PCT/US97/19575Pro Met Leu Lys Lys Asn Pro Tyr Ile Thr Ala Lys Asn Leu215220Gly Phe Arg Arg Val Tyr Ser Trp Tyr Val Asn Tyr Val Phe230INFORMATION FOR SEQ ID NO:ll7:(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(vi)(ix)(A) LENGTH:(B) TYPE:amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...256256 amino acids235(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll7:GlyLeuIleAla50IleTyrProValGlu130GluArgAspAspArg210TyrPheTyr35SerLeuLysArgPro115LysGlyLysIleLys195AlaAlaSer20LysPheLeuLysGly100LysGlyArgAlaTyr180AlaTyrSer5ThrGlyTyrGlyAla85TyrAspTyrGlyMet165TyrValGluLysLeuGluLysIle70ValAsnGluThrVal150HisSerValGlyLeuGlyGluSer55MetGluAsnLysAsn135ProLysGlyTyrLeu215AlaAlaAla40AlaTyrTyrLeuLys120AlaSerGlyAsnTyr200SerLeuGlu25TyrIleGluPheGly105AlaTyrAsnAsnAsp185LysGluLys10HisAsnLysAsnGln90ValValIleTyrVal170GlnMetSerIle CysLeu GluAsn LysAsn Gly60Gly Arg75Lys AlaMet TyrGlu TyrAsn Leu140Ala Lys155Glu AlaLeu GlyAla AlaTyr Arg220LeuGlnGlu45GluGlyValLysPhe125GlyAlaTyrIleAsp205TyrValLys30TyrSerValAspGlu110ArgIleThrIleGlu190ValGlyGly15GlyGluLeuProAsn95GlyIleMetGluLeu175ProSerLeu240LeuAsnArgAlaLys80AspLysAlaTyrCys160LeuAspSerGly?WOâ98/ 1832310152025303540455055Val Glu Lys Asp Lys225Asp Phe Asp Ile Asp(2)MetAsnLeuThrAla65SerThrPheIleLeu145SerAsnPheGluGln225245INFORMATION FOR(i)(ii)(iii)(vi)(xi)ArgGluGluTyr50AlaSerIleThrPro130LysThrLysLysGlu210SerCA-192-02265523 1999-03-16PCT/US97/19575Lys Lys Ala Glu Glu Tyr Met Gln Lys Ala Cys230Lys Asn Cys Lys Lys Lys Asn Thr Ser Ser ArgSEQ ID NO:ll8:SEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...657250657 amino acids235ORGANISM: Helicobacter pyloriSEQUENCE DESCRIPTION: SEQ ID NO:118:LysLysGly35AlaAsnLeuGluAsp115LysIleSerIleAsp195PheTrpLeuAsn20ThrThrLeuSerAsn100AlaHisAspIleLys180HisThrGlyPhe5GlyGlnTyrPhePro85PheGlnSerProSer165ThrGluAsnAspIlePheThrAsnThr70ValLeuGlyLysTyr150AspAsnAsnLeuAla230ProPheGlnTyr55AsnArgProAsnIle135ThrAlaLeuHisMet215IleLeuIleGlu40LeuAlaValTyrVal120ValLeuAsnValTrp200LeuLeuLeuGlu25LysProGluLeuAsn105IleLeuPheThrVal185GluAsnAsnLeu10AlaArgThrAlaTyr90LeuAspProLeuGln170AsnAlaMetAlaPheGlyHisAspIle75MetAsnLeuGlyPro155ArgTyrPheIlePro235SerPheThrThr60SerTyrAsnGlyGlu140LysValArgThrAla220PheAlaGluThr45IleLysAsnValVal125AlaIlePheAsnPro205ValGluLeuThr30ThrLeuLeuGlyLys110IlePheGluGluGlu190GlnLeuPhe255Glu15GlyLysLysLysGln95LeuGluAspAlaThr175AsnThrAspThr240AlaLeuAsnArgPhe80LeuSerThrSerThr160LeuLysAlaSerAsn240?WO 98/1832310152025303540455055SerThrLysIlePro305AlaIleLysThrSer385GlnAlaGlnSerAla465ValIlePheAlaLeu545GlyGlyGlyHisAla625AsnPheProAsnGlnVal2 90SerSerAsnGlyLys370AspProAspLeuGln4 50AsnThrLeuIleVal530LeuIleLeuSerSer610SerGluThrGlyAsp275LeuAsnAlaLeuTyr3 55AspGlyAlaValIle435ThrSerAsnGlyGly515AsnLeuGlnArgGly5 95LysValGlyAspLeu260IleLysAsnLeuGlu340GlyGlyLeuPhePro42 0AsnAsnMetHisVal500LeuGlnAspThrGly580AsnTyrValAlaCys2 4 5ValValAspAspAsp3 2 5AspI-Ii sGlnProPro4 O 5AlaGlnTyrLeuHis4 8 5AsnAlaLysPheLys5 6 5LeuLeuSerSerSer645CAAspAsnAsnSerAsp310ProLeuAsnValTyr3 90SerGlyAsnAsnSer470PheAlaTyrValIle550ArgTyrAspValSer630HisAsnSerLysGly2 95GlyLysArgGlyGlu3 75AsnAsnPheAlaLeu455ThrSerLysTyrGln53 5ThrAsnASHâValGly615GlyPheAspLysPhe280ValLysLysThrAsn360LysValTyrLeuLeu440AsnIleAsnIleGly520GlnThrPheSerAla6 00IleGlyLys-193-ProVal265LysValHisLeuIle345MetAspCysProGly425ProAlaGlnAlaGly505IleLeuTyrSerTyr585ThrSerAspValSer250AspAsnGlyTyrPhe330LeuThrSerSerAsn410ValIleSerLysSer490TyrIleSerSerSer570TyrGlyIleTyrPhe65002265523 l999-03- 16LysGlnLysLeuGly3 15GlyHisTyrAsnLeu3 95SerThrAsnLeuThr475GlnGlnLysTyrAsn55 5SerValLeuProThr635PheCysLysAlaGly300GlnAspGluGlnGly380TyrIleAlaTyrAsn460PheSerAsnTyrGly540LysPheLeuAsnLeu62 0AsnAsnValTyrAsp285SerLeuAsnPheArg365LysGlyTyrAlaAla445ThrValPheTyrAsn525GlyAsnGlyAsnTyr605IleSerTyr.. ...»......¢................_.......¢,..~... .s.....W.. . .PCT/U S97/ 19575AsnVal2 7 0LeuAspGlyLeuSer3 50ValProGlyHisVal43 0AsnGlnThrArgPhe510TyrGlySerIleLys5 90ArgGlnPheGlyPro255LeuAspIleValLys33 5HisProLysSerAsn415TrpLeuAspSerSer495AsnAlaIleProPhe575ValTyrArgValTrp655GlyAsnValThrVal3 2 0ThrThrValAspAsn4 O 0CysGlnGlyLeuSer4 8 0ProAspLysAspThr56 0GlyLysLysLysPhe640Val?CA 02265523 1999-03-16W0 98/18323 PCT/US97/19575-194-(2) INFORMATION FOR SEQ ID NO:1l9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 167 amino acids5 (B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein10 (iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori15 (ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1 ..1s7(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll9:Met Lys Leu Val ser Leu Ile Val Ala Leu Val Phe Cys Cys Phe Leu1 5 10 15Gly Ala Val Glu Leu Pro Gly Val Tyr Gln Thr Gln Glu Phe Leu Tyr20 25 3025 Met Lys Ser Ser Phe Val Glu Phe Phe Glu His Asn Gly Lys Phe Tyr35 40 45Ala Tyr Gly Ile ser Asp Val Asp Gly Ser Lys Ala Lys Lys Asp Lys50 55 60Leu Asn Pro Asn Pro Lys Leu Arg Asn Arg Ser Asp Lys Gly Val Val30 65 70 75 80Phe Leu Ser Asp Leu Ile Lys Val Gly Glu Gln Ser Tyr Lys Gly Gly85 90 95Lys Ala Tyr Asn Phe Tyr Asp Gly Lys Thr Tyr His Val Arg Val Thr100 105 11035 Gln Asn Ser Asn Gly Asp Leu Glu Phe Thr Ser Ser Tyr Asp Lys Trp115 120 125Gly Tyr Val Gly Lys Thr Phe Thr Trp Lys Arg Leu Ser Asp Glu Glu130 135 140Ile Lys Asn Leu Lys Leu Lys Arg Phe Asn Leu Asp Glu Val Leu Lys40 145 150 155 160Thr Leu Lys Asp Ser Pro Ile165(2) INFORMATION FOR SEQ ID NO:l20:45 .(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 294 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear50(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES55 (vi) ORIGINAL SOURCE:?WO 98/1832310152025303540455055MetProThrAlaAsp65LysIleGluValThr145AspAlaLeuGluHis225ArgGlnGlyLeu(2)(ix)(xi)SerLysSerTyr50IleAsnCysGluAsp130GlyCysTyrIleArg210TyrGluSerThrLeu290CA-195-02265523 1999-03-16(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...294SEQUENCE DESCRIPTION: SEQ ID NO:l20:AsnSerGly35SerGlyIleGluIle115GluAlaValAlaAla195LeuLeuArgIleLeu275LysGlnPhe20LysLeuLeuLeuIle100LeuGluGlyValCys180AsnPheGlyLysAsp260GluTyrAla5PheGlyTyrAlaHis85GluLysGlyIleIle165IleMetLysAlaIle245GlnIleLeuINFORMATION FOR(i)(ii)Ser His LeuAsp Asn LysGly Val Gly40Lys Lys Gly55Asn Leu70AlaAspLeu LysPro Gly LeuIle Ser120SerTyrVal Leu135Gly Ala150ValThrThr ThrLys Ile AsnVal Ala Gln200Val Ala Lys215Ile Glu230LeuAsnArg LysIle Ala SerGlu280Pro LysGly .AspGly25LysTyrValGlyCys105GlySerThrProSer185ProAsnSerIleLeu265GlySEQ ID NO:121:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:(D) TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinAsn10AsnSerLysIleGlu90LeuAlaLeuGlnAsp170LysLysAsnSerAla250LeuLeu372 amino acidsPheThrAsnValPhe75AlaIleGluAspAla155ProAsnGluIleLeu235ProValLysMetLysIleGly60GlyLysProAlaTyr140PheSerLysGlyAla220LeuAsnSerSerAsnPheSer45ValValLeuGlyLeu125IleLeuAlaAspArg205SerLysAspLysPhe285PCT/US97/1 9575AlaIle30AlaPheLysGlnAsp110AspValAsnIleGlu190AlaLeuArgLeuLeu270PheLys15AlaAsnAspThrGlu95SerArgIleAlaThr175LeuThrGluTyrPhe255GluLysAsnIleLeuAlaHis80IleGlyPheAspSer160AspPheTyrLeuVal240SerThrArg?W0 98/ 18323101525303540455055LeuLeuTyrPheAla65PheLeuThrGlyVal145GluLeuAsnThrGlu22 5ThrLysLysLeuSer3 O5SerPro(iii)(vi)(ix)(xi)GluPheAlaThr50SerSerPheLysAsn130GlySerSerThrGln210LeuProAspProAsn2 90LeuPheSerCAHYPOTHETI CAL : YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE :(A) NAME/KEY: misc_feature(B) LOCATION 1.. .372-196-02265523 l999-03- 16SEQUENCE DESCRIPTION: SEQ ID NO:l2l:ProIlePhe3 5GlnSerGlyAspGlu115ProValAlaProThr195TyrLeuPheSerIle275LeuArgLysTyrSerVal2 OThrLeuLeuThrSer100GluLeuSerLeuPhe180AspProArgLysLeu26 0SerAsnArgThrSerArg5LeuHisThrIleLys85LysLeuLeuMetGlu165LeuGlyLeuProAsp24 5MetThrGlyLysLeu325LeuAsnPheAsnIleSer70GluThrSerPheGly150ProAsnGlyLeuAsn230CysLeuAsnIleGlu310LysAsnArgLeuGlnPro55LeuGlyAsnHisLeu13 5GlyIleLeuPheLeu215ThrAlaGluLeuLeu2 95LeuValProLeuIleAla4 0LysProAlaArgHis12 0HisTrpHisSerMet200LysLeuValThrLys2 80TyrTrpLeuHisLysIle25LeuProAsnArgTrp105SerAspAlaPheHis18 5LeuPheAsnMetCys26 5AsnLeuLeuAspPheHis Ala Ala10MetValAsnAspAsp9 0SerHisAsnThrLys1 7 0LeuProAspHisAla2 5 OLysLeuI leSerLys330IleLysThrAspAsn75ValGluGluLysSer155PheValLeuGlnGln23 5PheThrAspHisLys3 15AlaAspHisGlnAla60LeuLysAlaTyrIle140LysAlaArgTyrGln22 0LeuArgProAspAsn3 O0LeuAsnIlePheGlnThr4 5LeuLeuIlePheIle125LeuIleArgAsnHis205AsnGlnAsnThrSer285ProGluGluValPCT/U S97/ 19575PheThr3 0ProSerSerSerIle110LysLeuTyrLysLys190GluAsnProHisAsp2 70LeuSerAsnValTyrVal15SerProAlaAlaAla95LeuLysPheGlnLeu175ProLeuProSerSer2 55TrpAsnAspSerSer335ThrGlyProTyrHisTyr80AsnLeuLeuValPhe160SerLeuAlaArgLeu24 0PheGlnLeuLeuAsn32 0TyrTyr?WO 98/1832310152025303540455055Asn Arg Ser His Ile Lys His Ile Arg Phe Asn Met Ala Tyr Leu Asn355340Ser Leu Leu Lys(2)MetLeuSerSerArg65LeuValLysPheLys145AspLeuGlyMetLys370CA02265523 1999-03-16360-197-345INFORMATION FOR SEQ ID NO:122:(i)(ii)(iii)(vi)(ix)(xi)LysPheAsnGlu50ValGluSerAsnPro130LeuGlyIleLeuLys210AsnSEQUENCE CHARACTERISTICS:(A) LENGTH:TYPE:TOPOLOGY: linear(B)(D)amino acidMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...978978 amino acidsSEQUENCE DESCRIPTION: SEQ ID NO:122:LysValGly35LeuAspValTyrLys115GlyLysAsnValThr195SerLeuArgAla20IleTyrLeuSerPhe100AlaIleIleAlaLys180AspLeuLysLys5ValHisLeuSerAsp85GluAsnLysIleHis165ProLeuAlaThrHisPheIleLysSer70LeuLysIleGlyAsn150TyrLeuLysPheTrpValThrGlnLeu55PheIleLeuPheGlu135LeuSerValThrLeu215IleSerLeuAsn40AsnPheLysLysPhe120PheLeuProGluIle200LysPheLysLeu25LeuAsnHisAsnVal105AspSerPheLysPro185GluProAspLys10ValLysLysGlnIle90LysGlyLeuLysAla170SerLeuLeuLysValValIleLeuLys75ArgGluAsnGluAsp155ArgAlaLysPheIlePheIleGlySer60ProTyrIleLysAsp140ValLysAlaIleGln220Gln365AsnHisLys45LeuThrGlyIleTyr125AspLysMetIleAsn205ArgPhePCT/US97/19575350ValLys30LeuGluLysIleLeu110GluLysValAlaTyr190ThrGlnAlaIle15ThrGlyValLysTrp95AspLeuAsnGlnPhe175LeuSerSerSerIleLeuIleGluArg80AlaAspGluIleVal160AsnGlnProGlnPhe?WO 98/18323101525303540455055225LysIleProThrIle305AsnAsnValLeuGly385LeuGlnAspLeuAsn465AsnGluGlnThrIle545AsnSerSerIleSer625SerLeuIleProSerGlu2 90ThrLeuTyrLeuThr3 70SerTyrTyrLeuAsp450Met:PheAsnSerLeu53 0GlnAlaProThrAsn610LeuLysAsnAspSerVal2 75LeuTyrLeuTyrPro355LeuValThrIleAsp435SerArgThrSerGlu515LysTrpTyrIleSer595LeuPheSerAsnAsnLeu260ValIleGluGluGly340LeuGlnAsnGlnTyr420AlaLeuSerLeuGlu500AspSerSerThrMet580AspProGlyIleIle660Ala245LeuPhePheThrAla32 5AspAspPheLeuSer405IleLysValTyrAsp4 85ValLysLeuValPhe565AspPheIleSerSer645AspCA230LeuGluAsnLysMet310ProSerLysLeuGln3 90AlaAspIleHisAsp470LeuPhePheSerPro550LysTyrValTyrIle630IleLeuIleAsnAspAsn295GluLysIleIleLys375GluGlnThrAlaLys455ProLysArgThrLeu535GlnIleIleAsnArg615AsnLysSerLysSerGly280LysLeuLeuLysSer360AsnGlyIleIleLeu440IleAsnSerArgLys520SerLeuLysAlaIle600SerLysValIle-198-AlaVal26 5LeuGlnThrGluAsp345MetThrThrAsnHis42 5AspGlnAsnLeuLys505AspPheLeuAspLeu585AspAspAspLysAsp665Asn2 50ValSerLeuGlyVal33 0LeuProAlaPheLeu4 10ThrLeuValThrHis4 90IleValAspLeuLeu570LysPheGlyGluGly650Asp02265523 l999-03- 16235PheLysProLeuSer3 15PheLeuSerProSer3 95AspArgGlyAsnGln475SerIlePhePheGlu555LysAspPheSerIle63 5AspPheThrAlaIleIle300TyrLeuSerSerLeu380LeuIleTyrGlnThr460GluIleAspTyrSer540GlyLysGlyAlaHis620SerGlnLeuProThrLys2 B5GlnAlaLysAlaAla365PheTyrAlaAlaLys44 SAsnAspIleThrAla52 5AsnGluIleSerLys605PheValLysAspPCT/US97/19575SerLeu270MetProThrThrTyr3 50AspSerAsnGlnAsn43 0AsnAsnProGlnIle510ThrProPheLysLeu590AspAspTyrAspSer670Glu255IleAspGlnPheThr335LysLeuValIleGlu415MetLeuAsnGlnGlu495LysGlyAspLysPro575GluLeuSerThrIle655Lys240PheLysLysLysSer32 0ProValLysGlnPro400TyrLeuSerIleThr480GlyAlaAspHisAsp560TyrValLysPhePro64 OThrMet?WO 98/1832310152025303540455055ProSerTyr705LysLeuLysLysAsp785GlnPheLeuLysGlu865IleThrTyrLysIle945AspLeu(2)AlaLys690GluAspAspAsnAla770PheValAlaIleThr850LysIleIleLeuGly930IleIleLysIle675GluLysValIleAla755HisValPheLeuVal835GlyIleGluLysVal915ThrGlnIleAlaIleAlaValVal740MetAsnGluAsnMet820PheSerAspLeuAla900LeuLeuAlaValGlyGlnHisLeu725AlaIlePheGlyGlyB05GlnArgValLeuAsp885LeuGlyAspProAsp965INFORMATION FOR(i)CALeuAspLys710IleGlnMetSerGly790GluAsnAsnValVal870LysSerLysLysPhe950Glu02265523Phe Ser680Glu Asp695Ile IleTyr LysAsp AspAla Asp760Gly Asp775Leu PheLeu LysMet ValHis840GlyPIOPhe855Gly LysAsn LysAsn ValGly Gly920Pro Lys935Lys IleVal Lys1999-03-16-199-LysValProLysArg745LeuTyrThrPheAsn825LeuIleThrLeuLeu905LysThrLeuLysSEQ ID NO:l23:SEQUENCE CHARACTERISTICS:amino acid(A) LENGTH:(B) TYPE:(D) TOPOLOGY:linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A)GluPheIleMet730ValValIleLeuGln810LeuGlyThrLeuAsp890AsnIleGlnArgAsn970477 amino acidsArgIleSer715ProLysHisAsnIle795AsnIleAlaLysAsp875LeuLysThrValArg955IleORGANISM: Helicobacter pylori.......~..u....... .................... .5. LysSer700ThrPheIleGlyThr780GlyThrAsnAsnGlu860IleAsnIleThrThr940IleAspGlu685AlaArgProAspAla765IleAlaSerThrGly845TyrAlaLeuProAsn925LeuPheSerPCT/US97/19575LysLysIleLeuGly750LeuLeuLeuLeuIleB30TyrLeuGlyGluIle910ValAlaThrLysProGlnHisGlu735AsnTyrGlnGluLysâ815ProGlnGlyAsnVal895ValAsnSerPICArg975SerArgAla720AsnTyrLeuLysAsp800AsnSerIleLeuGly880SerGlyValAspIle960Lys?WO 98/1832310152025303540455055MetLeuI l eThrThr65AspAsnAsnTyrAsn145PheThrValLeuLys225LysAlaValArgArg305AspPheThrIleLeu(ix)(xi)AsnThrLeuSer50AlaLysLeuHisAsn13 0ThrSerValGlnGln210LeuAlaLeuLysGlu2 90TyrSerGlyLeuMet370GluFEATURE :(A) NAME/KEY: misc_feature(B) LOCATION l. . .477CA-200-02265523 l999-03- 16SEQUENCE DESCRIPTION: SEQ ID NO:l23:ThrLeuAsn3 5SerThrAlaSerThr115PheGlnAsnAlaGln195LysTyrGlnGluAsn2 75ArgGlnTrpAsnAsn3 55LeuGlnIleAla2 OAsnLeuThrAlaLeu100IleLysGlnValAsn180TyrLysAspGlyGln260LeuGlnAsnLeuPhe34 0IleGlyGluIle5GlnTyrGluIleLeu85GlnAlaAsnLeuAsn165LeuTyrLeuLysAsn245AsnLysAspLysPhe3 2 5TyrPheGlnLysArgThrSerAlaAsn70GlyAlaLysGluGln15 0AsnGluGluGluGly23 0LeuArgLysLeuGln3 10TrpProAspLeuAspTyr Ala SerProHisThr55GlnLeuGlnAlaAla13 5AlaValTyrTyrGln2 15LeuSerLeuThrVal2 95LeuIleGlyAspAla375GluSerLys40ProGluTyrGluMet120ArgGlnLysSerPhe200IleThrGluThrThr280SerAsnGlnGlnIle360A511GlnLys2 5AsnGlyIleGluLeu105PheAspValGluArg185AsnGlnThrTyrLeu265IleLeuTyrLysGln34 5GlyGluLeuLeu Trp Gly1 OThrLeuPheAlaLeu9 0SerLeuThrThrLys1 7 0GlnAsnThrIleAsp2 5 0GluAspArgTyrPro3 3 OAsnLeuLysTyrProLysLeuLys75LeuValProProLeu155SerSerLeuAspAsp23 5IleTyrAlaGluPro315AlaThrSerAsnArgAspLeuPro6 0TyrLysLysThrGlu14 0AsnAlaValAlaI le22 0AspLeuLeuProGln3 O 0LysTyrAlaLeuLeu380LysLeuGluIle45SerHisGlyGlnLeu125TyrValThrTyrArg205LysLeuAspThrAsn285IleIleAlaGlyGln365AlaSerPCT/US97/ 19575CysIle3 0AspProGluAlaAla110AsnLysPheTyrLeu190MetArgGlnMetAsn27 0LeuSerAspThrVal35 0LysTyrLeuIle15LysProLysLysThr95MetAlaHisAsnArg175GlnIleValSerGln255LeuGlnAlaValGly335ThrGlnLysAspThrGlnProGluSer8 0ThrLysSerTyrGly16 0SerValAlaThrLeu24 OPheSerLeuLeuPhe320ArgAlaSerLysIle?W0 98/ 18323385Ala Arg Ala LysLeu Ser Phe Ala5 4 2 0Phe Thr Thr Tyr435Ala Tyr Asn Leu45010 Ile Phe Asn Ser465(2) INFORMATION1525303540455055MetLeuLeuIleVal65AlaMetThrLeuIle145IleProIle405AsnLeuAlaGlyFORCA390GluIleArgLeuHis470SEQ02265523 1999-03-16SerLysGlyAsn455LysSerArgLeu440AsnIle-201-LysLys425ThrTyrAspID NO:l24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:(ii)(iii)(vi)amino acid(D) TOPOLOGY: linearHYPOTHETICAL: YESORIGINAL SOURCE:MOLECULE TYPE: proteinAla410TyrThrGluAsp412 amino acids395SerAspArgValTyr475(A) ORGANISM: Helicobacter pylori(ix)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...4l2(xi)Leu SerLeu ThrGlu Ile35Gln Ala50Val SerAsn ValSer LeuGln Ser115Lys Lys130Glu AsnLys AsnAsp LeuPheAla20GlnLeuLysSerGly100LysThrTyrLeuIleIle5LeuThrGlnTrpAsp85LeuMetLysLysGlu165AlaSerLeuPheGluAsp70PheSerIleGlnAsn150ASHIleAla Phe AspLeuValGln55AsnPheGlnAsnGln135GlnThrAlaLeuAla40IleProArgLysLeu120LeuGlnLeuLysPhe25LysAspIleLeuVal105GluValGluTyrLeuLys10SerTyrAlaLeuAsp90AspLysIleIleGln170GluArgLeuLeuLeuTyr75SerLeuGlnAsnGlu155AlaIleLeuAlaPheGln460ValSEQUENCE DESCRIPTION: SEQ ID NO:l24:GlyGlySerAsp60LeuThrAsnLysLeu140LeuAsnLeuAspAsnAsp445LysHisValLeuLys45SerGlyLeuGlyLys125MetLeuHisLysPCT/US97/19575Ala Ala415Leu Val430Ala GluAla AsnIle15LysSerAla30Asn GlnGln GluTyr AsnGln95LysMetLys110Ile LeuIle AsnAsn ThrSer175LeuSerSer400AsnAspValTyrArgAspLysLysAsn80AsnLeuGluGlyAla160SerLeu?W0 98/ 1832310152025303540455055GluSerPro225AlaGlnValMetAla305GluLeuIleLysIle385Ala(2)IleMet210LysThrLysThrPhe290LysValLysIleThr370ThrTyrGln195GlyAsnAsnAspGly275SerLeuGluLysLys355AsnIleLeu180LysGluPheTyrIle260ValValValAsnLeu340GlnGlyGlnSerINFORMATION(i)(ii)(iii)(vi)(ix)(xi)AsnLeuGluAsp245ThrTyrAlaGluAla325GluAsnAspIleLeu405FORCAAspThrPhe230IleLeuTyrLeuâGln310LysThrGluTyrThr390GlnSEQLeuPhe215AsnAlaAlaPheSer295LysAsnLeuLysAsn375GlnAsnGlu200LysAsnIleLysArg280IleLysLysGlnIle360AlaLeuLeu-202-185ValGluGluAlaLys265SerProLysThrLys345AlaTyrGluLysID NO:125:SEQUENCE CHARACTERISTICS:(A) LENGTH:TYPE:TOPOLOGY:(B)(D)amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE: .(A) NAME/KEY: misc_feature(B)LOCATION l...l37AlaAsnGlnArg250SerLysLeuGluArg330AsnGlnTyrThrGly410137 amino acids02265523 1999-03-16LeuGluGlu235LeuPheGlnProSer315HisLeuIleAsnLeu395LeuORGANISM: Helicobacter pyloriSerIle220LeuAspLeuTyrLeu300LeuLeuGluTyrAla380SerGluSEQUENCE DESCRIPTION: SEQ ID NO:l25:Ser205LeuHisGluGluTyr285TyrAlaAlaSerAla365LeuAlaPCT/U S97/ 19575190SerSerAsnGluAsp270AsnGlyPheLeuIle350LeuAsnLeuHisIleIleLys255IleTyrLysLysLys335AsnAspAspASHTyrAlaSer240AlaAsnAspGlnSer320LeuLysLeuLysSer400Met Arg Ile Val Arg Asn Leu Phe Leu Val Ser Phe Val Ala Tyr Ser151015Ser Ala Phe Ala Ala Asp Leu Glu Thr Gly Thr Lys Asn Asp Lys Lys202530Ser Gly Lys Lys Phe Tyr Lys Leu His Lys Asn His Gly Ser Glu Thr?WO 9811832310152025303540455055GluLeu65LysGluGlyGly(2)LeuSerSerLysVal65LysIleGlyGlnThr145LysThr50GluSerGlyPIOGly13035LysGlyAspValTyr115LeuAsnValLysSer100PheMetAspAspLys85MetGluMetCALysLeu70PheProArgHisINFORMATION FOR SEQ(i)(ii)(iii)(vi)(ix)(xi)MetLysValPhe50LeuGluArgGlyLys130TyrIleLys55GluTyrIleThrIle13540LeuLysLysValLys120Arg-203-02265523 1999-03-16Tyr Asp PheSer Pro Asn75Gln Leu Ala90Asn Phe Asn105Ser Lys LysPheID NO:l26:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...309309 amino acidsThr60LeuLysLysThrSEQUENCE DESCRIPTION: SEQ ID NO:l26:ProGlnVal35LeuArgIleGlyHis115HisSerLysGlnLeu20IleIleAspLysLeu100LeuLeuAlaGlyAsn5LysLeuAlaPheAsn85GluTyrAlaIleValGlnPheLeuLysArg70LysSerAspLeuLys150GluLeuSerLeuMet55GlyArgLeuGluMet135ProSerValLysIle40AspLeuGluIleVal120LeuThrGlyIleAsn25ValThrTyrGluGlu105AspIleLysIleThr10LeuGlyMetGlnLeu90IleLeuProGluAspIleLysLeuThrLys75PheLysGluAsnArg155PheIleArgGlySer60AsnIleLysAsnGly140AsnIle45LysLysAsnAlaGln125AspAsnVal45GluTyrValGlyLeu125MetHisAlaPCT7US97H957SAsnSerAsnLeu110TyrGluLeu30GlyArgAlaGlyAla110SerProProProSerHisIle95SerMetSer15IlePheAsnLeuGln95AsnLeuLeuIleLeuGlyLys80AlaPheAspGlyIleLeuAlaAla80LysGlyAsnLysLys160Asn?W0 98/ 1832310152025303540455055ThrArgGlyLys225GlyLysGlnTrpThr305(2)ValTrpGlyLeuLys65PheLeuValProSerPhe210SerAsnIleSerVal290LeuValAsn195SerPheSerLeuAla275LeuLysTyr180AlaSerIleGlyAsp260LeuGluGly165AlaGlyIleGlnGly245AlaGluAspGlnCASerTyrTyrLys230GluGluGluIleAlaGlyThr215GlyLysLysAsnVal295AspAsn200HisGlnLeuPheLys280Gln-204-Gly185LeuLeuLeuHisLeu265PheLeuINFORMATION FOR SEQ ID NO:l27:(i)(ii)(iii)(vi)(ix)(xi)LeuSerPheSer50GlyLeuGlnSerSEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY: linearamino acidMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...332170IleValAspIleTyr250AlaIleGln332 amino acids02265523 1999-03-16ValArgHisGly235GluTrpGluGluORGANISM: Helicobacter pyloriAspIleVal220TyrValAspTrpHis300SEQUENCE DESCRIPTION: SEQ ID NO:l27:TyrLysHis35PheProGluAlaAspPheLys20HisAlaPheAspVal100PheLeu Thr Ser5SerAlaLeuValIle85GlySerMetArgAlaPhe70AsnValProLeuThrCys55LeuLeuValLeuLeuPhePro40TyrGlySerCysPhePheVal25ArgLeuLeuLeuIle105SerIle10AspAlaGluSerSer90IleLeuCysAsnGlyProLeu75ProSerPIOSerAlaGlyPhe60ValLysSerTyrPheGlu205AsnSerArgLeuLys285ValLeuAsnLeu45GluPheIleThrPhePCT/US97/19575Val190HisValGlyPheAsp270ASHAspIleLys30GlyMetLeuArgPro110Ile175LysAlaGlnLysLeu255HisLeuLysVal15IleIleProSerLeu95LeuAlaThrPheProSer240GlyPhePheAspLeuGlnPhePheGly80IleValPhe?W0 98/1832310152025303540455055LeuIle145LeuTyrPheSerLeu225ArgLeuProIleIle305Asn(2)Met1PheHisAlaPhe130AspValMetLeuLeu210AsnArgHisAsnLeu290SerArg115AlaGlyIleValGly195LeuLeuLysThrPro275IleLeuGlnIlePheHisLeu180AspHisMetIleLeu260LeuSerValValPheAsnTyr165GlyGlyLeuLeuLys245LeuCysValPheCys325INFORMATION FOR(i)(ii)(iii)(vi)(ix)(xi)AsnPheLysGlnCAMetGly150IlePheGlySerTyr230ArgPheAlaLeuIle310Ala02265523 1999-03-16Leu135LeuAspMetAlaLeu215ProGlnLysPhePhe295AlaLeu120ValAlaProValTyr200GluValLysPheIle280ArgCysGlu-205 -GlySerSerLeu185PheGlnIleAlaLeu265LeuLeuTyrLysSEQ ID NO:l28:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1n..271IleGlySer170AsnLeuLysGluThr250GlnIleAspLeuArg330271 amino acidsSerIle155LeuPheGlyIleVal235MetGlnLeuAlaIle315AlaAsn140CysSerProLeuSer220LeuProArgCysTyr300GlyPheSEQUENCE DESCRIPTION: SEQ ID NO:l28:IleAsnIle35IlePhe Lys Arg Ile5Leu Leu Asp Ala20Thr Arg Glu LeuLeu Gln Ser ValIleLysLys40ValCysHis25ValAspVal10HisGlyAspThrLysAlaLeuAlaGluAsnLys125AlaAlaCysSerVal205ValPheAspSerAsn285AlaTyrIleLysPro45GluPCT/US97/ 19575IleIleLeuGly190CysPheSerAsnPhe270LeuLeuAlaValLys30ValLysW, ....,.......~....m.........â............ ...............»..W.»...- .. ..,.AsnAlaLeu175LysGlyPheIleLeu255AsnProIleTyrLeu15GluProGlyIleLeu160AlaIleIleGlyLeu240HisTyrPheValLeu320GlyAspHisIle?WO 98/1832310152025303540455055Lys65LeuLeuAsnIleAla145AlaLysProAlaSer225GluLys(2)50LeuAsnAspIleLys130AsnLeuAsnLysLeu210ProAlaPheValAspArgHis115AsnGlnLysProVal195GlnTyrIleIleIleGlyPhe100ValLeuGlyAspTyr180LeuAlaAlaLysLeu260INFORMATIONValSer85AsnGluLysArgPro165AsnGlyLysAsnAla245AspFORCASer70LeuLeuProLysAla150SerIleAspLeuLeu230LeuThrSEQ55PheAspAspLeuGly135LeuAsnLysValThr215ValIleTyr-206~Thr Asp TyrAla Asn Tyr90Arg Lys Met105Arg Phe120SerTyrVal IleIle Leu LeuAla170PICLeu TyrIle Lys185Asp Gly Ala200Gly Ala LeuAla Ser ArgGlu Ala Leu250AlaLys Gly265ID NO:l29:(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(vi)(ix)(xi)(A) LENGTH:(B) TYPE:(D)316 amino acidsamino acidTOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1,..31602265523 1999-03-16Val75PheHisSerAlaHis155ThrLeuIlePheGlu235GlnIle60LeuGlnLeuGlnVal140LysGluGluIleSer220AspSerIleSEQUENCE DESCRIPTION: SEQ ID NO:l29:ProHisValLys125ProGlnPheAlaThr205GluAsnGluProPCT/US97/19575AsnArgGly110IleAsnGlyAspAla190GlyAspAlaLysAla270LeuPro95LeuThrAspLeuIle175LeuAsnLysGlnThr255PheAla80TyrAlaAspProIle160ValLeuTyrAspAsp240.ArgMet Gln Glu Phe Ser Leu Trp Cys Asp Phe Ile Glu Arg Asp Phe Leu15Glu Asn Asp Phe Leu Lys Leu20Thr Ser Asn Pro Ser Leu Phe35Tyr Gln Asp Glu Ile Ala Lys1015Ile Asn Lys Gly Ala Ile Cys Gly Ala2530Cys Glu Ala Ile Thr Lys Ser Ala Phe40Leu Lys Gly Lys Lys45Ala Lys Glu Ile?W0 98/ 18323101525303540Tyr65MetIleLysProSer145GluSerGlnTyrSer225AlaAsnIleAspPhe30550GluProAspArgAla130IleIleValAsnGln210ThrLeuAlaThrLeu290LysThrLeuProLeu115SerProAlaPheLeu195IleGlyCysTyrGlu275GluGlnLeuTyrPhe100PheGluIleGlnVal180GlnAsnValPheLeu260IleAsnSerAlaGlu85LeuLysSerAsnIle165SerAlaGlnLysLys245LeuGluThrPheCALeu70LysGluThrAlaVal150LeuArgGlnHisSer230AsnAspAlaAlaGlu31002265523 1999-03-1655LysAspAspLeuPhe135ThrAlaPheSerAla215AsnSerProPheGln295LysAspProAspAsn120GluLeuLysAspGly200AsnSerIleAsnLys280LysLeu-207-IleAsnAla105ArgValValGluLys185IleLysLeuAsnThr265LysLeuLeuINFORMATION FOR SEQ ID NO:l30:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 260 amino acidsamino acidlinear(B) TYPE:(D)TOPOLOGY:LeuAsn90IleProIlePheAla170GluMetLeuAlaThr250GluGluL811SerGln75GlyLysAsnSerSer155ArgIleAsnIleLys235AlaCysLeuLysSer31560AlaTyrSerValAla140ProLysAspAlaSer220AspProGlnLysGlu300PheSerIleIleMet125LeuLysArgProThr205ThrTyrLeuThrThr285GlyPCTVUS97M9575SerSerAsp110IleAlaIleAlaLeu190GluLeuTyrAspPro270HisLeuAlaLeu95GluLysGlnAlaVal175ValCysPheIleAla255LeuASHIleLeu80GluAlaValAlaGly160IleProTyrAlaLys240LeuLysIleAla(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES455055ORIGINAL SOURCE}(A) ORGANISM: Helicobacter pylori(vi)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...26O(ix)(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l30:Met Lys Thr Asn Gly His Phe Lys Asp Phe Ala Trp Lys Lys Cys Phe?WO 98/1832310152025303540455055LeuIleGluPhe65AsnLysGlnLeuLeu145AlaLeuPheMetAsn225GlnLys(2)GlyGluLys50GlnGlnValLysArg130LeuGlyAspLeuVal210LysArgArgAlaThr35ValTyrThrIleLys115ProPhePheSerLys195LysIleAsnASI1Ser20AsnGlnSerThrAsn100GluAspSerValPhe180ThrGlyPheL6L1Arg260INFORMATION(i)(ii)(iii)(Vi)(ix)(xi)ValGluAlaAspLeu85ValGlyProThrLys165ThrThrThrAlaGlu245FORCAValValLeuAsn70LysAspTyrLysGly150ValMetHisAspSer230SerAla LeuAla Leu40Asp Glu55Ile AlaVal GluSer SerAla120ThrLeuArg135Leu AspThr IleAsp LeuSer200SerSerAsn215Ile MetTyr Gln-208-Leu25LysLysLysGluAsp105ValIleLysLeuSer185HisAsnGlnLysSEQ ID NO:l3l:SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE:(D) TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l382IOValLeuIleGluIle90LysAlaGlnMetGlu170GluSerAspGluAsp2501382 amino acids02265523 1999-03-16GlyAsnLeuTyr75LeuAspMetLysGlu155ProLeuGlyAlaMet235AlaCysTyrLeu60GluGlnAspAsnLys140ArgMetAspGlyIle220AspLysSEQUENCE DESCRIPTION: SEQ ID NO:l3l:SerHis45LeuAsnAsnPheGly125SerValSerIleLeu205LysLysGluPCT/US97/ 19575Pro30ProArgLysGlnSer110GluGluLeuGlyGln190ValSerLysLeu15His IleAla SerPro AlaPhe Lys80Gly Tyr95Phe AlaIle ValProIle Pro160Glu Ser175Glu LysSer ThrAla LeuThr240Lys Asn255LeuLeu Asn Phe Asn Asn Leu Thr Ala Asn Gly Ala Leu Asn Phe Asn Gly?W0 98/ 1832310152025303540455055TyrValAspGly6 5TyrGlnGluAsnTyr14 5AspPheProSerAla22 SAsnAlaIleAspTyr3 O5AsnTyrI lePheGln3 8 5LysMetAlaAlaLeuAsn50IleGlyThrSerSer130GlnAsnThrPheSer210ThrIleGlnAsnAsn290SerThrIleGlyGln370AlaIleGluLeuProGly3 5IleThrMetTrpIle115AlaAspGlnProAsn195GluLeuAsnLysGln275ValSerTyrAsnSer355SerThrPheLysSer435Ser20AsnThrGlyLysSer100LysSerSerAlaLys180GlnAsnLysGluGln260ThrThrProLeuAla340SerAlaAspAsnIle420ProLeuAsnLysIleIle85PheAsnAsnLysGly165GlyProLeuGluVal245AlaPheAsnCysGly325AspAsnAsnAsnGln405LysLeuCAThrGlySerSer70GlnIleGlyThrGln150ThrSerLeuLysMet:230LeuLeuAsnSerAla310GlnPheAlaAsnIle390GlyGlnSerLysAspVal5 5GlyAsnAsnAspIle13 5AsnTyrGlnAsnThr2 1 5I laGlnLeuAsnThr2 9 5LeuLeuLysPheLeu3 7 SPheAsnAlaLysAlaIle40ThrAlaAlaProLeu12 0PheProTyrThrSer200LeuGluLeuGluGly280SerAspLeuAlaGlu360ValAsnLeuGlyGlu440-209-Leu2 5AsnTyrAsnThrLeu1 O 5ThrAsnThrLeuPro1 8 5LeuLeuSerLeuThr2 6 5AsnSerSerGlyLys3 4 5SerLeuLeuAlaGly425Leu10MetLeuAsnGlyTyr90AsnIleIleGlyThr170GlnAsnGlyAsnAsp250IleLeuIleAlaSer330SerGlyAsnLeuAsn410LeuPITO02265523 l999-03- 16AsnSerIleTyr75SerSerGluAlaTyr155SerThrIleIleGln235LysAsnValTrpThr315ThrIleGlyLysGly395ValGlyAlaValAspLeu60GluAspSerValPro140SerAsnProTyrLeu220LeuIleHisIlePhe3 00CysSerTyrSerAla3 80GlnLeuAsnSerSerIle45AsnLysAsnGlnLeu125GluTyrIleGlyAsn205SerAspLysLeuGly285GlySerProIleAla36 5AsnGluSerPheLeu445PCT/US97/19575Gly30AsnAlaIleAsnIle110AsnLeuAspLysThr190LysGlnAsnIleThr270AlaGlySerTyrThr3 50AspIleGlyGlnIle430Gln15GlnIleGlnLeuAsn95IleAsnTyrTyrGly175TyrGlyAsnIleThr255AspThrAsnPheLeu335GlyValGluIleMet415GluAspPhePheLysPhe8 0IleGlnProAsnSer16 0LeuSerPheSerThr240GlnAsnGlnGlyArg320GlyThrThrAlaAsp400AlaAsnGlu?W0 98/ 1832310152025303540455055ThrAsn465SerAlaPheValIle545ValAsnGlyLeuGly625SerSerGlyThrVal705ThrGluIleIleLeu785IleAlaValGlyAla865AlaLeu450SerIleLysIleIle530GlyValValSerGly610TyrPheIleAlaLeu690SerThrSerSerGly770ThrAspSerPheThr850SerIleGlyGlyPheGlnGly515LeuValLysIleVal5 95ThrPheSerIleLeu675AsnValLysLeuAsn755ThrIleGlyGlyAsn83 5AlaSerTyrGlnValGlySer500GlyLysValLysSer580LeuLeuAsnAsnPhe660IleAlaGlnAsnSer740GlyLeuThrAsnLeu820LeuThrLysTyrLeuMetAsn48 5LeuTyrAspAlaLeu565GlnProLeuPheAla645AsnPheThrLysSer725ValAlaAsnAsnPhe805AsnSerIleGluGlyCAIleAsn470PheLysIleIleAsn550GluGlyProSerLeu630ThrGlyAlaAsnGly710SerHisIleLeuAla790ThrValHisMetVal870TyrGly455GluValSerAspThr535AspSerGlySerPro615SerGlyAspSerGly695GluProAlaAspAsn775PheLeuMetSerAla855GlyAsnGlnIleThrMetAla520AsnLeuGlnLeuLeu600ArgAsnGlyAsnAsn680LeuIleAlaAsnLeu760GluAsnAsnGlyVal84 0AsnThrAsn-210-AsnGlnProLeu505SerProLeuGlySer585GlnGlyGlySerThr665GlySerCysAsnAsn745SerAsnAsnGlnAsn825SerAsnTyrGlnAsnAsnSer4 90AspGluProAsnLeu570GlyAsnLeuTyrLeu650IleValLeuIleSer73 0PheGlnAlaAlaGln810PheHisAsnThrIle02265523 l999-03- 16LeuIle475IleAspLeuThrGlu555ValValAlaHisVal635AsnAspSerAsnAsn715SerThrValThrSer795AlaAsnAlaProLeu875ThrAsp460IleIleLysSerSer540PheSerTyrLeuAsp6 2 0PhePhePheAsnAla7 0 0LeuValPheThrLeu78 0AsnThrSerI l eLeu8 6 0IleGlyAspSerGluGlySer525LeuLeuAsnAsnLys605PheValValSerIle685GlyAlaThrLeuAsn765GlnSerLeuTyrIle845IleAspGlyPCT/US97/19575LeuGlnAsnLeu510IleGlnGlyIleGln590GluTrpAsnAlaLys670AsnLeuAsnProGly750AsnAlaThrSerGly83 0AsnGlnSerSerLeuLysTyr4 95LeuLeuLysGlnI1 e5 7 5GlyAsnGlnAsnAsn6 5 5TyrIleAsnCysThr7 3 5ThrSerAsnAlaThr8 1 5AspThrPheAlaSerAsnLeu48 0LeuAsnGlyAspAsp560AsnLeuAspLysSer640LysGlnThrAsnPro720AsnIleValAsnAsn800AsnLeuGlnAsnLys880Leu?CA 02265523 1999-03-16W0 98/ 18323 PCT/U S97/ 19575-211-885 890 895Asp Asn Tyr Leu Lys Leu Tyr Ala Leu Ile Asp Ile Asn Gly Lys His900 905 910Met Val Met Thr Asp Asn Gly Leu Thr Tyr Asn Gly Gln Ala Val Ser5 915 920 925Val Lys Asp Gly Gly Leu Val Val Gly Phe Lys Asp Ser Gln Asn Gln930 935 940Tyr Ile Tyr Thr Ser Ile Leu Tyr Asn Lys Val Lys Ile Ala Val Ser945 950 955 96010 Asn Asp Pro Ile Asn Asn Pro Gln Ala Pro Thr Leu Lys Gln Tyr Ile965 970 975Ala Gln Ile Gln Gly Val Gln Ser Val Asp Ser Ile Asp Gln Ala Gly980 985 990Gly Asn Gln Ala Ile Asn Trp Leu Asn Lys Ile Phe Glu Thr Lys Gly15 995 1000 1005Ser Pro Leu Phe Ala Pro Tyr Tyr Leu Glu Ser His Ser Thr Lys Asp1010 1015 1020Leu Thr Thr Ile Ala Gly Asp Ile Ala Asn Thr Leu Glu Val Ile Ala1025 1030 1035 104020 Asn Pro Asn Phe Lys Asn Asp Ala Thr Asn Ile Leu Gln Ile Asn Thr1045 1050 1055Tyr Thr Gln Gln Met Ser Arg Leu Ala Lys Leu Ser Asp Thr Ser Thr1060 1065 1070Phe Ala Arg Ser Asp Phe Leu Glu Arg Leu Glu Ala Leu Lys Asn Lys25 1075 1030 1085Arg Phe Ala Asp Ala Ile Pro Asn Ala Met Asp Val Ile Leu Lys Tyr1090 1095 1100Ser Gln Arg Asn Arg Val Lys Asn Asn Val Trp Ala Thr Gly Val Gly1105 1110 1115 112030 Gly Ala Ser Phe Ile Ser Gly Gly Thr Gly Thr Leu Tyr Gly Ile Asn1125 1130 1135Val Gly Tyr Asp Arg Phe Ile Lys Gly Val Ile Val Gly Gly Tyr Ala1140 1145 1150Ala Tyr Gly Tyr Ser Gly Phe His Ala Asn Ile Thr Gln Ser Gly Ser35 1155 1160 1165Ser Asn Val Asn Val Gly Val Tyr Ser Arg Ala Phe Ile Lys Arg Ser1170 1175 1180Glu Leu Thr Met Ser Leu Asn Glu Thr Trp Gly Tyr Asn Lys Thr Phe1185 1190 1195 120040 Ile Asn Ser Tyr Asp Pro Leu Leu Ser Ile Ile Asn Gln Ser Tyr Arg1205 1210 1215Tyr Asp Thr Trp Thr Thr Asp Ala Lys Ile Asn Tyr Gly Tyr Asp Phe1220 1225 1230Met Phe Lys Asp Lys Ser Val Ile Phe Lys Pro Gln Val Gly Leu Ser45 1235 1240 1245Tyr Tyr Tyr Ile Gly Leu Ser Gly Leu Arg Gly Ile Met Asp Asp Pro1250 1255 1260Ile Tyr Asn Gln Phe Arg Ala Asn Ala Asp Pro Asn Lys Lys Ser Val1265 1270 1275 128050 Leu Thr Ile Asn Phe Ala Leu Glu Ser Arg His Tyr Phe Asn Lys Asn1285 1290 1295Ser Tyr Tyr Phe Val Ile Ala Asp Val Gly Arg Asp Leu Phe Ile Asn1300 1305 1310Ser Met Gly Asp Lys Met Val Arg Phe Ile Gly Asn Asn Thr Leu Ser55 1315 1320 1325 ?W0 98/ 1832310152025303540455055CA-212-02265523 1999-03-16PCT/U S97/ 19575Tyr Arg Asp Gly Gly Arg Tyr Asn Thr Phe Ala Ser Ile Ile Thr133013351340Gly Glu Ile Arg Leu Phe Lys Thr Phe Tyr Val Asn Ala Gly Ile1345Ala Arg Phe Gly Leu Asp Tyr Lys Asp Ile Asn Ile Thr Gly Asn13651350Gly Met Arg Tyr Ala Phe(2)Met1LeuLysPheLeu65TyrMetLeuPheIle145TyrTyrPro1380INFORMATION FOR SEQ ID NO:132:(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(vi)(ix)(xi)LysLysLeuCys50GluSerAlaAsnPhe130LysMetSerAlaamino acid(A) LENGTH:(B) TYPE:(D) TOPOLOGY:linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...2621370262 amino acids1355ORGANISM: Helicobacter pyloriSEQUENCE DESCRIPTION: SEQ ID NO:l32:LysAlaAsn35AlaValLeuLeuThr115GluLysLysValArg195Ile Gly5His Glu20Ala LysLys GlyPro LeuGly Gly85Lys Leu100Glu IleMet ArgLeu TyrIle165AlaThrHis180Trp LysLeuValGluValLeu70ValGluAsnLeuGlu150GlyPhePheSerSerProPhe55AsnAlaAsnPhePro135GluIleLysValLeuAlaLys40LeuGluMetGlnAla120LysValSerPhePro200CysGlu25MetProLysAspAsn105LysAsnProSerLys185LysLeu10GluLysAsnGluAsp90AlaAsnGlySerSer170AspGluValIleIleProIle75LysSerProLysTyr155ValLysGlyLeuAlaAsnGln60ProSerTrpGluVal140ArgAlaLysValSer LeuAsp Ile30His Thr45Ala ArgAla SerLys ValThr Met110Glu Phe125Asp GluAsn PheAsn ThrGlu Lys190Lys Tyr2051375Gly15PheLysGluValArg95ValAlaAlaAlaPro175LeuLeuGlyGly1360IlePheTyrGlyAspArg80GlyMetGlnArgAla160TyrLeuAsn?CA02265523 1999-03-16-213-PCT/U S97/ 19575Asp Ser Asn Tyr Leu Leu Ser Ser Phe220Pro Ile Glu Tyr Gln Met Tyr Leu Val235240Thr Asn Asp Thr Thr Ala Leu Trp LysID N01133:linear250246 amino acids(A) ORGANISM: Helicobacter pyloriW0 98l18323Pro Gln Glu Leu Lys Gln Lys210 215Gln Gln His Leu Lys Asn Lys225 2305 Phe Ala Asn Gln Asn Asp Ala245Gly Ser Ile Arg Asn Tyr26010 (2) INFORMATION FOR SEQ(i) SEQUENCE CHARACTERISTICS:(A) LENGTH:(B) TYPE: amino acid15 (D) TOPOLOGY:(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES20(vi) ORIGINAL SOURCE:(ix) FEATURE:25303540455055MetAsnIleGlyTrp65PheAlaLysGlyAla145TyrValThr(A) NAME/KEY: misc_feature(B)LOCATION l...246(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l33:LysGlnGlyLeu50TyrThrAsnAsnGly130ThrProAsnHisGlnLysGly35SerAlaGlyTyrAsp115GluPheAsnAsnThr195PheThr20PheTrpIleAsnTyr100AsnTyrAsnGlySer180GlyLys5IleAlaGlyTrpGln85HisGlyAsnLeuHis165ValThr LysLeuSerGluSer70LeuSerThrGlyGly150ThrGluAlaLysLysGlyLys55CysIleGlnTyrGly135AlaAspValThrProArgVal40SerAspThrAsnPhe120AsnSerValGlyLeu200LysPro25TyrGlnLysLysAsn105LeuLeuSerThrAsn185AsnLys10LeuAlaLysTrpThr90GlnSerAspGlyPhe170ArgLeuIleTrpAspValGlu75TrpAspGlyIleAsn155SerValAsnLysLeuGlyCys60GluAlaIleLeuGlu140SerAlaGlyAlaArgMetThr45ValLysGlyThrTyr125LeuPheGlySerAsn205SerPro30AspHisThrGlyAla110AsnGlyThrThrGly190Lys255His15LeuIleArgGlnAsn95AsnTyrSerSerIle175AlaValGlnLeuLeuProGln80AlaLeuThrAsnTrp160AsnGlyThr?W0 98/ 1832310152025303540455055Ile Asn Ser Asn210Asn Ala Asn Ser225Tyr Leu Gln Phe(2)(i)(ii)(iii)(xi)MetSer ValLys TyrTyr Lys50Asp Lys65Thr PhePro GluPro GlyIle Phe130Lys Thr145Leu LeuAla LysPhe AspAla Lys210INFORMATIONIleValPhe245FORCASer Ala Tyr Lys Thr Ser Gln Val Asn Val GlyIle Thr Ile Asn Ser Val Ser Leu Asn Gly Glu230Ser02265523 1999-03-16215-214-SEQ ID NO:l34:SEQUENCE CHARACTERISTICS:amino acidlinear(A) LENGTH:(B) TYPE:(D) TOPOLOGY:MOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .245SEQUENCE DESCRIPTION:LeuHis35MetLysAspThrAla115TyrLeuLysAspAla195ValIle Lys LysAsn20GlnAlaProTyrTrp100LeuIleLysGluTyr180IleLeu245 amino acids235ORGANISM: Helicobacter pylori220SEQ ID NO:l34:Thr Leu Ala Ser Val5AlaGlnLysAlaAla85AspAspSerSerLys165AlaPheGlnLysSerMetVal70GlyLysPheAsnPhe150GlyIleAlaASHGluAlaAla55IleTyrPheLeuArg135LysLysValLysAla215CysGlu40LeuLeuLeuGluGlu120ThrLeuProLeuAsp200GlnVal25IleAspAspValLys105TyrGlnProLysGln185AlaLysLeu10SerArgAsnLeuLys90GluAlaLysGlnAla170ValLysPheLeuProAlaAsnAsp75AsnGlyAsnAsnVal155ValGlyAsnGlyGlyIleLeuLeu60GluCysSerSerLys140SerArgAspSerThr220LeuThrGln45LysThrIleLeuLys125AlaGluArgThrGln205GluPCT/US97/19575SerArg30LeuLeuValLysThr110GlyPheGluGluLeu190GluTrpLeu15SerGlnValLeuTyr95LeuValThrSerLeu175HisGlnIle240MetValSerLysAsn80ThrIleLysLeuVal160ValAspGlnIle?WO -98/1832310152025303540455055CA 02265523 1999-03-16PCT/US97/19575-215-Leu Pro Asn Ser Leu Tyr Gly Thr Trp Glu Asp Gly Pro Ile Lys Ala225230 235 240Trp Gln Asn Lys Lys(2)LeuAlaAlaGlnLys65LeuThrGlyGluGly145LysTrpLeuTyrPhe225245INFORMATION FOR SEQ ID NO:135:(i)(ii)(iii)(vi)(ix)(xi)TrpLysValArg50ValLeuLysGluLys130IleIleHisSerLeu210Leu SEQUENCE CHARACTERISTICS:(A) LENGTH: 288 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...288SEQUENCE DESCRIPTION: SEQ ID NO:l35:Cys Leu Lys Thr Pro Ile Ile Gly His Met5 10Trp Cys Cys Phe Lys Met25SerGly Lys Lys15TyrLysVal Phe20PheIle Leu Leu30IleArg TrpVal40HisPhe35PheLeu Leu Ser Ala Glu45IleAsp Lys Ala MetGln Asn Ile Ala55ASHPhe Glu60SerAsp Lys Lys Leu AspAla Val Ile Thr Ala75AspAla Ile80AspSer Lys Asp Asn70ValGlyIle Ala90GlyAsn Tyr Asp Leu Val85GluTyr Lys Arg Tyr95Thr Ala Glu Tyr105AspVal110SerLys Leu Leu Asn Ile100LeuLys ArgVal Thr120ProGly115TyrLeu Lys Val Leu Leu Asn125AspTyr LysGlu Ile Ile Phe135AspPhe Val Gln140LysTyr Ser Val SerAla150SerTrp Val Ser Ile Ala Ser Gly Gln155SerAsp Lys Tyr_ 160Met Ala Ile165AlaAsn Ser Ile Pro175SerLys Gly Cys170PheAsp AsnVal Thr Ser His185TyrASH Ser180TrpGly Asn Met Gln Lys190Ile Pro200SerMet195ProAsn Pro Lys Val Gly Ile Val Leu205ArgAspPhe Met215GlyTyr Ile Thr Ser Asn Lys Thr Thr220AspGlyPhe230Glu Thr Asn Leu Phe Ile235Pro SerTyrGly Tyr240?CA 02265523 1999-03-16W0 98/18323 PCT/US97/19575-216-Leu Gln Pro Phe Tyr Leu Ala Pro Lys Asn Ser Trp Asp Met Thr Phe245 250 255Thr Pro Gln Ile Arg Tyr Lys Arg Gly Phe Gly Leu Asn Phe Glu Ala260 265 2705 Arg Tyr Ile Asn Ser Lys Thr Gln Val Phe Ile Gln Cys Ala Leu Phe275 280 285(2) INFORMATION FOR SEQ ID NO:l36:10 (i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 128 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear15 (ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES(Vi) ORIGINAL SOURCE:20 (A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...l2B25(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l36:Leu Met Phe Lys Lys Met Cys Leu Ser Leu Leu Met Ile Ser Gly Vall 5 10 1530 Cys Val Gly Ala Lys Asp Leu Asp Phe Lys Leu Asp Tyr Arg Ala Thr20 25 30Gly Gly Lys Phe Met Gly Lys Met Thr Asp Ser Ser Leu Leu Ser Ile35 40 45Thr Ser Met Asn Asp Glu Pro Val Val Ile Lys Asn Leu Ile Val Asn35 50 55 soArg Gly Asn Ser Cys Glu Ala Thr Lys Lys Val Glu Pro Lys Phe Gly65 70 75 80Asp Lys Phe Lys Lys Glu Lys Leu Phe Asp His Glu Leu Lys Tyr Ser85 90 9540 Gln Gln Ile Phe Tyr Arg Leu Asp Cys Lys Pro Asn Gln Leu Leu Glu100 105 110Val Lys Ile Ile Thr Asp Lys Gly Glu Tyr Tyr His Lys Phe Ser Lys115 120 12545 (2) INFORMATION FOR SEQ in NO:l37:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 169 amino acids(B) TYPE: amino acid50 (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES55?W0 98/1832310152025303540455055MetLeuIlePhePro65GluGluIleValPhe145Ala(2)CA-217-(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l6902265523 1999-03-16(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:137:GlnGlyGlyVal50AlaMetAsnLeuVal130PhePheAlaGlyGly35AlaTyrGlnArgGly115GlyIleTrpLeuTyr20LeuAsnLysAspThr100IleGlyHisGlyINFORMATION(i)(ii)(iii)(Vi)(ix)(xi)Lys5LeuLysSerGlnAsn85TyrLeuLeuASI1Trp165FORSerMetPheProHis70ProLeuValLeuAla150LysSEQLeu Leu Glu Val IleIle Ala25TyrHisVal Pro40Phe Phe55LysSerMet SerLys Ile ValVal Ala Glu105Leu Leu Gly120Val Ala135ArgGlySer ValAla Ser GlyID NO:138:SEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY:amino acidlinearMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...48710IleGluPheGluGlu90GlyLeuMetCys487 amino acidsPheAlaMetSer75AsnLeuTrpThrGln155ThrIleGluTyr60GlnLysGlyMetIle140SerSEQUENCE DESCRIPTION: SEQ ID NO:138:LysIleGly45LysSerGluIlePro125ThrAlaPCT/U S97/ 19575LeuPhe30IlePheMetTrpThr110LeuThrPheGln15IleAlaGluGlnHis95IleMetLeuPICAsnTrpProLysGlu80LysMetGlyPheMet160Met Ile Glu Trp Met Gln Asn His Arg Lys Tyr Leu Val Val Thr Ile151015Trp Ile Ser Thr Ile Ala Phe Ile Ala Ala Gly Met Ile Gly Trp Gly?W0 98/ 1832310152025303540455055GlnIleAsp65GlnAsnThrLysSer145IleGluIleGluThr225ThrTyrGlnArgGln305LysLysLeuGlnLys385GlyThrLysSerTyrLys50AlaIleGlnLysAsp130HisLeuGlnLeuMet210SerAspLeuValSer2 90AspLeuAspGlnGlu370AspThrLeuValAla450Ser3 5IleTyrLysAlaGln115GlyTyrGlnSerIle195LysPheLeuAspLys275TyrPheThrGlyAsn3 5 5LysPheIlePheVal435Glu2 OPheSerAlaAlaLeu100GluValArgLysSer180LeuLys 'LysLysLys260HisIleGluAlaPhe34 0PheThrLysSerAsn42 0LeuGluSerGlnGluMet85LeuValPheProIle16 5LeuAsnTyrThrGlu245GluAspAlaLysLeu32 5IleAspLeuGlyGlu405ArgTyrAsnCALeuGluSer7 0HisArgAlaAspLys150SerSerProTyrArg23 0LeuGlyLeuLeuAsn310LysValGluMetLys3 90LeuGlnGlnGln02265523AspGlu55IleLeuAsnLysGlu135HisAlaLeuAsnGlu215SerGluLysAsnLys295AsnProValAlaAla375SerAsnGluIleTyr455Ser40LeuProGluPheGlu12 0GluPheLeuTrpAsp2 00AsnLeuGluLeuMet2 B 0LysSerLeuGlnLys36 0LeuValGlnLysThr440Met1999-03-16-218-2 5AspAlaAspLysAla105IleLeuGluPheAla18 5ValHisTyrTyrGln265GlnGlyProGluLeu34 5SerGlnGlyGluLys42 5GluGlnSerGlnPheSer9 0LeuArgTyrGluPro1 7 0LysLysArgPheTyr2 5 OAspLysAsnTyrVal3 3 0ValAlaThrTyrGlu4 1 0GlyGlnArgAlaGluLys7 5AlaAspLysLysSer155LysLeuLysAsp2 3 5HisPheAlaAlaThr3 15LeuSerLeuLeuVal3 95SerPheAsnLeuAlaTyr6 OGluLeuLeuThrAsn14 0ValThrGlnSerAsp22 0AlaLysLysAsnGln3 O0AlaLysGlnLysAla3 80SerAlaValPheVal460Lys45ArgLeuAspGlyAsn12 5IleGluThrAspLeu205PheSerAsnSerGlu2 85AsnGluProIleThr36 5LysProLysThrAsn445AsnPCT/US97/1957530ValArgThrSerLeu110ValLeuArgThrLys190AsnLysLeuLysVal2 70LysTyrIleGluLys3 50ArgGluAsnPheIle43 0HisAsnGlyLeuGluLeu95GlyPheLysLeuPro175LeuGluLysGluVal255GlnAlaThrThrPro33 5AspLeuLysPheIle415GlyProThrGlnLysAsp8 OIleAlaGlnGlnLeu160LeuAspGluProLys240SerGluLeuThrGln320PheGluThrLeuGly4 O0AsnAsnPheLys?WO 98/1832310152025303540455055465(2)MetIleIleValGln65LysGlyMetThrCA 02265523 1999-03-16PCT/U S97/ 19575-219-Thr Asp Phe Phe Asp Lys Ala Leu Ile Glu Glu Leu Lys Lys Arg Tyr470 475 480Lys Ile Val Lys Tyr Ile Gln485INFORMATION FOR SEQ ID N02139:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 142 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...142(xi) SEQUENCE DESCRIPTION: SEQ ID NO:139:Lys Thr Asn Phe Tyr Lys Ile Lys Leu Leu Phe Ala Trp Cys Leu5 10 15Ile Gly Met Phe Asn Ala Pro Leu Asn Ala Asp Gln Asn Thr Asp20 25 30Lys Asp Ile Ser Pro Glu Asp Met Ala Leu Asn Ser Val Gly Leu35 40 45Ser Arg Asp Gln Leu Lys Ile Glu Ile Pro Lys Glu Thr Leu Glu50 55 60Lys Val Ala Ile Leu Asn Asp Tyr Asn Asp Lys Asn Val Asn Ile70 75 BOPhe Asp Asp Ile Ser Leu Gly Ser Phe Gln Pro Asn Asp Asn Leu85 90 95Ile Asn Ala Met Trp Gly Ile Gln Asn Leu Leu Met Ser Gln Met100 105 110Ser Asn Tyr Gly Pro Asn Asn Ser Phe Met Tyr Gly Tyr Ala Pro115 120 125Tyr Ser Asp Ser Ser Phe Leu Pro Pro Ile Leu Gly Tyr130 135 140INFORMATION FOR(i)(ii)(iii)SEQ ID NO:l40:SEQUENCE CHARACTERISTICS:(A) LENGTH: 208 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linearMOLECULE TYPE: proteinHYPOTHETICAL: YES ?CA 02265523 1999-03-16W0 98/ 18323 PCT/US97/19575-220-(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:5 (A) NAME/KEY: misc_feature(B) LOCATION l...208(xi) SEQUENCE DESCRIPTION: SEQ ID NO:140:10 Leu Ile Asn Asn Asn Asn Asn Asn Lys Lys Leu Arg Gly Phe Phe Leu1 5 10 15Lys Val Leu Leu Ser Leu Val Val Phe Ser Ser Tyr Gly Ser Ala Asn20 25 30Asp Asp Lys Glu Ala Lys Lys Glu Ala Leu Glu Lys Glu Lys Asn Thr15 35 40 45Pro Asn Gly Leu Val Tyr Thr Asn Leu Asp Phe Asp Ser Phe Lys Ala"50 55 60Thr Ile Lys Asn Leu Lys Asp Lys Lys Val Thr Phe Lys Glu Val Asn65 70 75 8020 Pro Asp Ile Ile Lys Asp Glu Val Phe Asp Phe Val Ile Val Asn Arg85 90 95Val Leu Lys Lys Ile Lys Asp Leu Lys His Tyr Asp Pro Val Ile Glu100 105 110Lys Ile Phe Asp Glu Lys Gly Lys Glu Met Gly Leu Asn Val Glu Leu25 I15 120 125Gln Ile Asn Pro Glu Val Lys Asp Phe Phe Thr Phe Lys Ser Ile Ser130 135 140Thr Thr Asn Lys Gln Arg Cys Phe Leu Ser Leu His Gly Glu Thr Arg145 150 155 16030 Glu Ile Leu Cys Asp Asp Lys Leu Tyr Asn Val Leu Leu Ala Val Phe165 170 175Asn Ser Tyr Asp Pro Asn Asp Leu Leu Lys His Ile Ser Thr Ile Glu180 185 190Ser Leu Lys Lys Ile Phe Tyr Thr Ile Thr Cys Glu Ala Val Tyr Leu35 195 200 205(2) INFORMATION FOR SEQ ID NO:141:(1) SEQUENCE CHARACTERISTICS:40 (A) LENGTH: 245 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein45 .(iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori50(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION I...24555 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14l:?WO 98/1832310152025303540455055MetSerPheValAsn65GlnValAlaIleIle145ThrProAsnLeuIle225Thr(2)AlaGlnAlaVal50GlnGlnGlyGlnAla130GluValLysSerGly210SerSerGlyValGly35GlySerTyrAsnGly115SerAlaGluTyrSer195AlaMetGlyThrSer20IlePheIleAsnAsn100AsnIleTyrMetAla180MetLeuThrCysINFORMATIONGln5SerValThrAlaGln85IleThrLeuAlaMet165LeuAsnValProHis245FORCAAla Ile TyrIle Ile SerAla Ala40GlnGlyPro55AlaAsnGlu70LeuValTyr GlnLeu Asn IleGln Ala120AsnSerAla Ser135Thr Asn150SerGlnGly IleAla Leu GlnThr Ala200SerAspSer215SerGlyMet Val230-221-GluSer25MetMetSerGlySer105GlnThrIleLeuGlu185AspLysSerSEQ ID NO:l42:(i) SEQUENCE CHARACTERISTICS:(ii)(iii)(vi)(ix)(xi)(A) LENGTH:TYPE:TOPOLOGY: linear(B)(D)amino acidMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE;(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B)LOCATION l...367Ser10ThrThrThrValPhe90LysIleThrAlaGly170GlnSerValMet367 amino acids02265523 1999-03-16SerSerAlaAlaPro75AsnLeuSerProVal155AsnLeuLeuPhePro235SerGlyAlaIle60MetAspThrAlaLys140ProIleArgAspPhe220ThrSEQUENCE DESCRIPTION: SEQ ID NO:142:AlaValIle45MetLysGlnGlyVal125AsnSerThrSerSer205SerValPCT/US97/19575GlyAla30IleThrAlaSerGlu110AsnProValSerGln190CysCysMetPhel5GlyProGlnAlaMet95PheSerSerProAla175AlaThrMetPIOLeuProIleTyrAsn80AlaAsnGlnAlaThr160AlaSerAlaGlnAsn240Met Ile Lys Ser Val Glu Ile Glu Asn Tyr Lys Asn Phe Glu His Leu ?W0 98/1832310152025303540455055LysAlaCysAsn65ThrGluThrThrTyr145GlnTyrSerLeuThr225LeuI leTyrGlnGln305AsnPheSerMetGlyAsp50IlePhePheSerAsn13 OAsnAsnLysLeuIle210IleGluLysLeuGlu290IleThrGluMetGluLys3 5ProSerPheGluTyr115LeuProLeuGluLys195GluArgGluPhePhe275PhePheIleLeuLeu355Asn20ThrThrGluTyrHis100SerIleSerGlyAsn180AlaIleLysSerPhe260IleLeuAlaSerGlu340Glu5PheAsnAlaPheGln85AlaLysAsnLeuLeu165AlaLeuLeuSerPro245IleAspLysThrAsp3 2 5LysLysINFORMAT ION FOR(i)CALysLeuAsnArg70GlyThrAspThrSer150IleMetGluGlnVal23 0LysMetGluAlaThr3 10AsnGluAla02265523 l999-03- 16LeuLeuGln55LysAsnIleIleThr13 5ProHisPheAsnCys215TyrArgValIleLeu2 95HisGluSerLeuIleGlu40ValIleThrProAsn120IleMetSerIleLeu200PheIleLeuSerGlu280PheAsnThrAlaTyr360-222-Asn25AlaSerLysAlaLeu105LeuThrThrAsnPro185GlnAsnGlnLeuIle265SerLysLysGlySer345ArgSEQ ID NO:l43:SEQUENCE CHARACTERI STICS:(A)(B)(D)LENGTH :TYPE :TOPOLOGY :amino acidlinear(ii) MOLECULE TYPE: protein1 OPheLeuLeuLeuAsn90ThrAsnLysMetLeu170IleLeuProIleAsn2 50LeuGlyLeuGluVal33 0GlyGly4 09 amino acidsPheTyrProAsp7 5ProIleSerProThr155AspGluAlaAsnLys23 5LeuIleLeuAlaPhe3 15PhePheMetThrThrPro60AlaIleGlnAspGln140TyrLysLeuSerIle220AspPheAspHisGln3 O0LeuLysIleGluGlyAsn45GluAspSerTyrAsp125LeuGluIleSerLys205LeuGluGlyAsnHis28 5LysLeuAspArgVal365PCT/US97/ 19575Gln3 0ThrHisAsnIlePro110AlaGlnPheAlaIle190GluAsnAsnTrpArg270ThrLeuAsnIleHis350Arg15AsnGlyAlaLeuArg95ThrHisPheGluGln175ValLysAlaThrGly255ValLysGlnAlaAla33 5SerGlyAspLeuValLys8 OThrGlnMetSerArg16 0ThrAsnGluAsnPro24 0PheLysMetIleIle320LeuTyr?CA 02265523 1999-03-16W0 98/ 18323 PCT/U S97/ 19575-223-(iii) HYPOTHETICAL: YES(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...40910 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:143:Met Ser Leu Ile Arg Val Asn Gly Glu Ala Phe Lys Leu Ser Leu Glu1 5 10 15Ser Leu Glu Glu Asp Pro Phe Glu Thr Lys Glu Thr Leu Glu Thr Leu15 2o 25 3oGlu Thr Leu Ile Lys Gln Thr Ser Val Val Leu Leu Ala Ala Gly Glu35 40 45Ser Lys Arg Phe Ser Arg Ala Ile Lys Lys Gln Trp Leu Arg Ser His50 55 6020 His Thr Pro Leu Trp Leu Ser Val Tyr Glu Ser Phe Lys Glu Ala Leu65 70 75 80Asp Phe Lys Glu Val Ile Leu Val Val Ser Glu Leu Asp Tyr Val Tyr85 90 95Ile Gln Arg His Tyr Pro Lys Ile Lys Leu Val Lys Gly Gly Ala Ser25 100 105 110Arg Gln Glu Ser Val Arg Asn Ala Leu Lys Val Ile Asp Ser Thr Tyr115 120 125Thr Ile Thr Ser Asp Val Ala Arg Gly Leu Ala Asn Met Glu Ala Leu130 135 14030 Lys Ser Leu Phe Leu Thr Leu Gln Gln Thr Ser His Tyr cys Ile Ala145 150 155 160Pro Tyr Leu Pro Cys Tyr Asp Thr Ala Ile Tyr Tyr Asn Glu Ala Leu165 170 175Asp Arg Glu Ala Ile Lys Leu Ile Gln Thr Pro Gln Leu Ser His Thr35 180 135 190Lys Thr Leu Gln Ser Ala Leu Asn Gln Gly Gly Phe Lys Asp Glu Ser195 200 205Ser Ala Ile Leu Gln Ala Phe Pro Asn Ser Val Ser Tyr Ile Glu Gly210 215 22040 Ser Lys Asp Leu His Lys Leu Thr Thr Ser Gly Asp Leu Lys Phe Phe225 230 235 240Thr Pro Phe Phe Asn Pro Ala Lys Asp Thr Phe Ile Gly Met Gly Phe245 250 255Asp Thr His Ala Phe Ile Lys Asp Lys Pro Met Val Leu Gly Gly Val45 260 - 255 270Val Leu Asp Cys Glu Phe Gly Leu Lys Ala His Ser Asp Gly Asp Ala275 280 285Leu Leu His Ala Val Ile Asp Ala Ile Leu Gly Ala Ile Lys Gly Gly290 295 30050 Asp Ile Gly Glu Trp Phe Pro Asp Asn Asp Pro Lys Tyr Lys Asn Ala305 310 315 320Ser Ser Lys Glu Leu Leu Lys Ile Val Leu Asp Phe Ser Gln Ser Ile325 330 335Gly Phe Glu Leu Leu Glu Met Gly Ala Thr Ile Phe Ser Glu Ile Pro55 340 345 350?WO 98/1832310152025303540455055LysLeuLys385ValMetSerLeuThrAsn65AlaPheGlyProLeu145GlyTyrProThr Pro355Gly Leu Glu370MetIleGly PheSer Met ArgINFORMATION(i)(A) LENGTH:TyrLysIleTyr405FOR(B) TYPE:(D)(ii)(iii)(vi)CALysSerGly390Lys02265523 1999-03-16-224-PCT/US97/19575Pro Ala Ile Leu Glu Asn Leu Ser Gln Leu360Gln Ile Ser Leu Lys375LysGlnGln Glu Gly LeuLysLeuSEQ ID NO:l44:amino acidHYPOTHETICAL: YESORIGINAL SOURCE:TOPOLOGY: linearMOLECULE TYPE: proteinSEQUENCE CHARACTERISTICS:270 amino acids395(A) ORGANISM: Helicobacter pylori(ix)(B)(xi)PheLys LysAla20AlaLeu LeuGln35SerGlyGly Val50ProGly GlyLeu Asn GlySer Leu100AspLysPhe115LysLeuAsn Ile130LeuAla AspGly Val AlaGlu180CysTrp LysThr Tyr195FEATURE:(A) NAME/KEY: misc_featureLOCATION l...270Val5GluArgValThrPhe85AspTyrGlnIleIle165GlnAsnAlaGlyLeuGlyAsn70GlyMetGlyLeuIle150GlyIleProLeuAspAsnCys55IleLeuThrHisAsp135AspGlyIleAsnGlyGlySer40ProAsnAsnSerAla120MetLysAsnGluAla200LeuVal25AsnProTrpValLys105AspValAspThrAla185ProLeu10TyrIleGlyHisGly90TrpLeuSerAsnTrp170LysTyrSerIleTyrLeuSer75TyrPheGlyTrpAla155LysGlySerAla380LeuSEQUENCE DESCRIPTION: SEQ ID NO:l44:AlaGlyAsnThr60LysLysGlyLysGly140SerSerProThr365ThrValValThrThr45AlaTyrLysPheGln125ValPheSerAspAsn205Thr Met GluGln Ala HisLeuAsn30GlyAsnAlaPheArg110ValGlyGlyAlaVal190ThrSer15TyrAspLysAsnPhe95ValTyrSerIleAla175CysSer400SerGlnCysHisGly80GlnTyrAlaAspPhe160AsnThrThr?WO 98/1832310152025303540455055ValLys225LysLysMetProProTyrPro65AspGluIleGluLys145GluTyrGlyAla210HisPheArgPheAsnLeuAspGlnGlySerTyr260INFORMATION(5.)(ii)(iii)(vi)(ix)(xi)ValValAla245SerCATrpGlu230GlyLeuLeu215PheProTyrAsnGlyAsnLeu-225-PheValAlaGly265FOR SEQ ID NO:l45:SEQUENCE CHARACTERISTICS:(A)(B)(D)LENGTH:TYPE:TOPOLOGY: linearamino acidMOLECULE TYPE: proteinHYPOTHETICAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...438GlyArgThr250Tyr438 amino acids02265523 1999-03-16ValVal235AsnAsnORGANISM: Helicobacter pyloriArg220ProLeuTyrSEQUENCE DESCRIPTION: SEQ ID NO:l45:Ala Tyr LysAsnValVal50IleAsnSerThrPhe130GluThrAspGlyLeuGlu35ValGluSerSerLys115PheLeuHisHisLeu195Phe20GluLysTrpLysArg100ArgIleLysLysLeu180ValPro Asn Lys Lys Lys5SerSerThrAlaGlu85ValTyrLysGluLys165LysArgIleAspGlnLys70AspTyrAspGluGln150AlaAspGluLeuLysIle55TyrValGluLeuIle135GlyLeuIleIleAspAla40AsnLeuAsnAlaIle120GluLeuGluTyrIle200Lys25AsnLysSerPheAsn105AspIleGluAsnGln185ProLeu Lys Glu10GlyLysAlaPhePhe90LysArgLeuIleGly170GluSerAspIleSerGlu75AlaGluAsnThrGln155AsnValIleValGlnMet60LysAsnGlyIleHis140LeuGluGluSerAlaLeuTyrThrLeuAlaGlu45IleArgGlyPheAsp125ThrThrIleArgSer205PCT/U S97/ 19575AsnLeuTyrPhe270ArgThr30ProSerValGluGlu110ArgAsnHisValThr190AlaIleIleHis255Glu15AsnLeuArgTyrIle95ArgAsnSerHisLys175LysGluTyrAsn240LeuGlnAsnProAspLys80LysArgArgLeuAsn160GluAspTyr?W0 98/ 183231015303540455055PheThr225GluSerPheAsnAsn305GlnGluTyrIleAsp385GlyAsnAsn(2)Lys2 10LysLeuAlaAlaHis290AsnGluIleValLeu3 70LysAsnThrIleLeuLeuAlaThrTrp275LeuGlyAsnAlaAsn3 55ArgLeuGluIleIle435TyrAsnLysAsn260LysSerSerArgGln34 0GlyAspValArgGlu420IleAsnThrGlu245TyrMet:AlaIleAsp325AlaAspThrSerPro405ThrGlnCALysAsn23 0ValTyrHisAsnLeu3 10TyrLysGlyAsnLeu3 90AsnAsnIleINFORMATION FOR SEQ(i)(ii)(iii)(vi)(ix)(xi)02265523Leu215AspHisSerArgAsn295GlySerIleAsnAsn375SerSerThrProAsnIleTrpLeu2 BOAlaTrpLeuGluLys360PheAlaSerSer1999-03-16-226-PheGluLeuIle265IleAsnThrArgLeu34 5ArgGluAlaAlaAsn425ID NO:146:SEQUENCE CHARACTERISTICS 2(A)(B)(D)LENGTH :TYPE :TOPOLOGY: linearamino acidMOLECULE TYPE: proteinHYPOTHET I CAL: YESORIGINAL SOURCE:(A)FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...215GluGluIle250AspAsnLysLysSer330GlnGluLysIleAsn410Asn2 15 amino acidsSerVal235LeuLysGluIleGlu315AlaLysIleAlaIle395AsnIleORGANISM: Helicobacter pyloriIle22 OLysGluAspAsnLys3 00GluLeuTyrLysTyr380GlnASI1IleSEQUENCE DESCRIPTION: SEQ ID NO:l46:AsnLysGlnAspLys2 8 5GlnGlnLeuTyrPro3 6 5LysAlaAsnGlnPCT/US97/19575AsnLeuGlnAsn270LeuPheSerSerGlu350PheGluLysProAsn430GluGluLeu255AlaLysPheAlaLeu3 35SerLysArgGluIle415AsnAsnPhe240LeuAsnGluPheIle320GluValGluTyrGly400LysAspMet Gln Ala Leu Lys Ser Leu Leu Glu Val Ile Thr Lys Leu Gln Asnl51015Leu Gly Gly Tyr Leu Met His Ile Ala Ile Phe Ile Ile Phe Ile Trp202530 ?CA 02265523 1999-03-16WO 98/1832310152025303540455055-227-Ile Gly Gly Leu Lys Phe Val Pro Glu Ala35 40Val Ala Asn Ser Pro Phe Phe50 55Pro Ala Tyr Lys Gln His Lys Met Ser Glu Ser65 70 75Glu Met Gln Asp Asn Pro Lys Ile Val Glu Asn85 90Tyr Leu Val Ala Glu Gly105GlyTyrPhe Ser Phe MetThr100IleGlu Asn Arg LeuVal Leu120AlaIle Leu Gly Leu Leu115GlyLeu TrpVal135GluVal Val130LeuGly Leu Leu Gly Met ThrPhe Thr Thr Pro Val Phe Val150ArgPhe145LeuASH155Ser Gly Ala Gly Leu Val Asp165ValVal Lys' 170Phe Ala Ala180CysGly Gly Leu Gly Phe Asp185SerLysPhe Leu Met Val195SerLys Gly Asp Arg Ser200Ser215Ser210Cys Gly Cys Cys(2) INFORMATION FOR SEQ ID NO:147:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA(ii) (genomic)GluTyr60GlnLysGlyMetIle140GlnLeuArgGly(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l,..2O(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l47:TATACCATGG TGGGCGCTAA(2) INFORMATION FOR SEQ ID NO:148:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acidGly45LysSerGluIlePro125ThrHisAlaTyrIle205PCT/U S97/ 19575IlePheMetTrpThr110LeuThrPheLeuLeu190LysAlaGluGlnHis95IleMetLeuProPhe175GluThrProLysGlu80LysMetGlySerTrp160AlaGlyLys20 ?WO 98/18323(ii)5(iii)(iv)10 (vi)(ix)15(xi)2025303540455055CA 02265523 1999-03-16PCT/US97/19575-228-(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...23SEQUENCE DESCRIPTION: SEQ ID NO:l48:ATGAATTCGA GTAAGGATTT TTG(2) INFORMATION FOR SEQ ID NO:l49:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...22SEQUENCE DESCRIPTION: SEQ ID NO:l49:TTAACCATGG TGAAAAGCGA TA(2) INFORMATION FOR SEQ ID NO:l50:(i)(ii)SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)2322?CA 02265523 1999-03-16WO 98/1832310152025303540455055 -229-(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1. . .23(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1S0:TAGAATTCGC ATAACGATCA ATC(2) INFORMATION FOR SEQ ID NO:151:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feat:ure(B) LOCATION l...22(xi) SEQUENCE DESCRIPTION: SEQ ID NO:151:ATATCCATGG TGAGTTTGAT GA(2) INFORMATION FOR SEQ ID NO:152:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:PCT/US97/1 95752322?W0 98/ 1832310152025303540455055CA 02265523 1999-03-16PCT/US97/19575~230-(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l52:ATGAATTCAA TTTTTTATTT TGCCA(2) INFORMATION FOR SEQ ID NO:l53:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...2l(xi) SEQUENCE DESCRIPTION: SEQ ID N02153:AATTCCATGG TGGGGGCTAT G(2) INFORMATION FOR SEQ ID NO:l54:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...232521?W0 98/ 1832310152025303540455055(xi)CA 02265523 1999-03-16PCT/US97/ 19575-231-SEQUENCE DESCRIPTION: SEQ ID NO:l54:ATGAATTCTC GATAGCCAAA ATC(2) INFORMATION FOR SEQ ID NO:lS5:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25SEQUENCE DESCRIPTION: SEQ ID NO:l55:AATTCCATGG TGCATAACTT CCATT(2) INFORMATION FOR SEQ ID NO:l56:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25SEQUENCE DESCRIPTION: SEQ ID NO:l56:AAGAATTCTC TAGCATCCAA ATGGA 232525?CA 02265523 1999-03-16W0 98/ 1832310152025303540455055-232-(2) INFORMATION FOR SEQ ID NO:157:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...24(xi) SEQUENCE DESCRIPTION: SEQ ID NO:157:ATTTCCATGG TCATGTCTCA TATT(2) INFORMATION FOR SEQ ID NO:1S8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l,..23(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l58:ATGAATTCCA TCTTTTATTC CAC(2) INFORMATION FOR SEQ ID NO:lS9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 base pairs(B) TYPE: nucleic acidPCT/U S97/ 195752423?CA 02265523 1999-03-16WO 98/18323 PCT/US97/19575-233-(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)5(iii) HYPOTHETICAL: NO(iV) ANTI-SENSE: NO10 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature15 (B) LOCATION 1...27(xi) SEQUENCE DESCRIPTION: SEQ ID NO:159:AACCATGGTG ATTTTAAGCA TTGAAAG 2720(2) INFORMATION FOR SEQ ID NO:160:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 base pairs25 (B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)30(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO35 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feat:ure40 (B) LOCATION 1...2e(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:160:AAGAATTCCA CTCAAAATTT TTTAACAG 2845 7(2) INFORMATION FOR SEQ ID NO:l6l:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs50 (B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)55?CA 02265523 1999-03-16W0 98/ 18323101520253540455055-234-(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(iX) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...2S(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l6l:GATCATCCAT ATGTTATCTT CTAAT(2) INFORMATION FOR SEQ ID NO:162:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...23(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:162:TGAATTCAAC CATTTTAACC CTG(2) INFORMATION FOR SEQ ID N02163:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:PC1VUS97H95752523?CA 02265523 1999-03-16WO 98/1832310152025303540455055-235-(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc__feature(B) LOCATION l...27(xi) SEQUENCE DESCRIPTION: SEQ ID N01163:TATACCATGG TGAAATTTTT TCTTTTA(2) INFORMATION FOR SEQ ID NO:l64:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25(xi) SEQUENCE DESCRIPTION: SEQ ID N02164:AGAATTCAAT TGCGTCTTGT AAAAG(2) INFORMATION FOR SEQ ID NO:165:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...24 PCT/US97/ 195752725?W0 98/ 1832310152025303540455055CA 02265523 1999-03-16PCT/US97/ 19575-236-(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:165:TATACCATGG TGATGGACAA ACTC(2) INFORMATION FOR SEQ ID NO:l66:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...23(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l66:ATGAATTCCC ACTTGGGGCG ATA(2) INFORMATION FOR SEQ ID NO:l67:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NO(iii)(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE;(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l67:TTATGGATCC AAACCAATTA AAACT242325?W0 98/ 1832310152025303540455055CA 02265523 1999-03-16-237-(2) INFORMATION FOR SEQ ID N02168:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...23SEQUENCE DESCRIPTION: SEQ ID NO:l68:TATCTCGAGT TATAGAGAAG GGC(2) INFORMATION FOR SEQ ID NO:169:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1.-.22SEQUENCE DESCRIPTION: SEQ ID NO:169:TTAACCATGG TGAAAAGCGA TA(2) INFORMATION FOR SEQ ID NO:l70:(i)SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acidPC1VUS97?95752322?CA 02265523 1999-03-16W098/18323 PCT/U S97/ 19575â 238 -(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)5 (iii) HYPOTHETICAL: NO10152025303540455055(iv) ANTI~SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...24(xi) SEQUENCE DESCRIPTION: SEQ ID NO:170:TAGAATTCGC CTCTAAAACT TTAG(2) INFORMATION FOR SEQ ID NO:l7l:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NO(iii)(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l71:TTAACCATGG TGAAAAGCGA TA(2) INFORMATION FOR SEQ ID NO:l72:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: Circular(ii) MOLECULE TYPE: DNA (genomic)2422?CA 02265523 1999-03-16WO 98/1832310152025303540455055-239-(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...23(xi) SEQUENCE DESCRIPTION: SEQ ID N02172:TAGAATTCGC ATAACGATCA ATC(2) INFORMATION FOR SEQ ID NO:173:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22(xi) SEQUENCE DESCRIPTION: SEQ ID NO:173:ATATCCATGG TGAGTTTGAT GA(2) INFORMATION FOR SEQ ID NO:174:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:PCTIUS97/195752322?CA 02265523 1999-03-16W0 98/ 1832310152025303540455055-240-(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l74:ATGAATTCAA TTTTTTATTT TGCCA(2) INFORMATION FOR SEQ ID NO:175:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...23(xi) SEQUENCE DESCRIPTION: SEQ ID NO:175:AATTCCATGG CTATCCAAAT CCG(2) INFORMATION FOR SEQ ID NO:176:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25PCTTUS97?95752523?CA 02265523 1999-03-16W0 98/ 18323101520303540455055-241-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l76:ATGAATTCGC CAAAATCGTA GTATT(2) INFORMATION FOR SEQ ID NO:177:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc__feature(B) LOCATION l...24(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:177:GATACCATGG AATTTATGAA AAAG(2) INFORMATION FOR SEQ ID NO:178:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) I-IYPOTHETICAL: NO(iv) ANTIâSENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...25(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:178:TGAATTCGAA AAAGTGTAGT TATACPCT/US97/19575252425?CA 02265523 1999-03-16WO 98/1832310152025303540455055-242-(2) INFORMATION FOR SEQ ID NO:l79:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...19(xi) SEQUENCE DESCRIPTION: SEQ ID NO:179:CCCTTCATTT TAGAAATCG(2) INFORMATION FOR SEQ ID NO:l80:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...20(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l80:ATTTCAACCA ATTCAATGCG(2) INFORMATION FOR SEQ ID NO:l8l:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acidPCT/U S97/ 195751920?W0 98/ 1832310152025303540455055 CA 02265523 1999-03-16PCT/US97/19575-243-(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...2O(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l8l:GCCCCTTTTG ATTTGAAGCT 20(2) INFORMATION FOR SEQ ID NO:182:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22(xi) SEQUENCE DESCRIPTION: SEQ ID NO:182:TCGCTCCAAG ATACCAAGAA GT 22(2) INFORMATION FOR SEQ ID NO:l83:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic) ?WO 98/18323(iii)(iv)5 (vi)(ix)10(xi)152025303540455055CA 02265523 1999-03-16PCT/U S97/ 19575-244-HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22SEQUENCE DESCRIPTION: SEQ ID N02183:CTTGAATTAG GGGCAAAGAT CG(2) INFORMATION FOR SEQ ID NO:184:(i)(ii)(iii)(iv)(Vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22SEQUENCE DESCRIPTION: SEQ ID NO:l84:ATGCGTTTTT ACCCAAAGAA GT(2) INFORMATION FOR SEQ ID NO:185:(i)(ii)(iii)(iv)(vi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: CircularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:2222? CA 02265523 1999-03-16W0 98/ 1832310152025303540455055-245-(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l85:ATAACGCCAC TTCCTTATTG GT(2) INFORMATION FOR SEQ ID N02186:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...l9(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:186:CTTTGGGTAA AAACGCATC(2) INFORMATION FOR SEQ ID NO:l87:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc__feature(B) LOCATION l...2OPCT/US97/195752219?CA 02265523 1999-03-16W0 98/ 1832310152025303540455055-246-(xi) SEQUENCE DESCRIPTION: SEQ ID N02187:CGATCTTTGA TCCTAATTCA(2) INFORMATION FOR SEQ ID NO:188:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l9(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l88:ATCAAGTTGC CTATGCTGA(2) INFORMATION FOR SEQ ID NO:189:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:189:TTGAACACTT TTGATTATGC GGPCTIUS97/19575201922?W0 98/ 1832310152025303540455055CA 02265523 1999-03-16PCT/US97/19575-247-(2) INFORMATION FOR SEQ ID NO:l90:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 23 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...23(xi) SEQUENCE DESCRIPTION: SEQ ID NO:190:GGATTATGCG ATTGTTTTAC AAG 23(2) INFORMATION FOR SEQ ID NO:19l:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: Circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...2l(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19l:GTCTTTAGCA AAAATGGCGT C 21(2) INFORMATION FOR SEQ ID NO:l92:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid ?CA 02265523 1999-03-16W0 98/18323 PCT/US97/19575-248-(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)5(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO10 (vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misC_feature15 (B) LOCATION 1...21(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l92:2025303540455055AATGAGCGTA AGAGAGCCTT C(2) INFORMATION FOR SEQ ID NO:193:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l8(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l93:CTTATGGGGG TATTGTCA(2) INFORMATION FOR SEQ ID NO:l94:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)2118?W0 98/ 18323(iii)(iv)5 (vi)(ix)10(xi)152025303540455055CA 02265523 1999-03-16PC T/U S97/ 19575-249-HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...18SEQUENCE DESCRIPTION: SEQ ID NO:l94:AGCATGTGGG TATCCAGC(2) INFORMATION FOR SEQ ID NO:l95:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...19SEQUENCE DESCRIPTION: SEQ ID NO:l95:AGGTTGTTGC CTAAAGACT(2) INFORMATION FOR SEQ ID NO:l96:(i)(ii)(iii)(iv)(vi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: CircularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:1819?CA 02265523 1999-03-16WO 98/1832310152025303540455055-250-(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l8(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:196:CTGCCTCCAC CTTTGATC(2) INFORMATION FOR SEQ ID NO:197:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(E) LOCATION l...l9(xi) SEQUENCE DESCRIPTION: SEQ ID NO:197:ACCAATATCA ATTGGCACT(2) INFORMATION FOR SEQ ID NO:l98:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l8PCT7US97?95751819?CA 02265523 1999-03-16WO 98/1832310152025303540455055-251-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l98:ACTTGGAAAA GCTCTGCA(2) INFORMATION FOR SEQ ID NO:l99:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 19 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...19(xi) SEQUENCE DESCRIPTION: SEQ ID NO:199:CTTGCTTGTC ATATCTAGC(2) INFORMATION FOR SEQ ID NO:200:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE;(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l8(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:200:GTTGAAGTGT TGGTGCTA PC1VUS97U9575181918?WO 98/1832310152025303540455055(2)CA 02265523 1999-03-16PCTIUS97/19575-252-INFORMATION FOR SEQ ID NO:20l:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI~SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...22SEQUENCE DESCRIPTION: SEQ ID N02201:CAAGCAAGTG GTTTGGTTTT AG(2)INFORMATION FOR SEQ ID NO:202:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l,..22SEQUENCE DESCRIPTION: SEQ ID NO:202:TGGAAAGAGC AAATCATTGA AG(2)INFORMATION FOR SEQ ID NO:203:(i)SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid2222?CA 02265523 1999-03-16WO 98/1832310152025303540455055-253-(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTIâSENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...2l(xi) SEQUENCE DESCRIPTION: SEQ ID NO:203:GCCCATAATC AAAAAGCCCA T(2) INFORMATION FOR SEQ ID NO:204:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pylori(ix) FEATURE :(A) NAME/KEY: misc_feature(B) LOCATION l...24(xi) SEQUENCE DESCRIPTION: SEQ ID NO:204:CTAAAACCAA ACCACTTGCT TGTC(2) INFORMATION FOR SEQ ID NO:205:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 16 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE: DNA (genomic)PC1VUS97?95752124?WO 98/18323(iii)(iv)5 (vi)(ix)10(xi)152025303540455055CA 02265523 1999-03-16PCT/U S97/ 19575-254-HYPOTHETICAL: NOANTIâSENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...16SEQUENCE DESCRIPTION: SEQ ID NO:205:GTAAAACGAC GGCCAG(2) INFORMATION FOR SEQ ID N02206:(i)(ii)(iii)(iv)(vi)(ix)(xi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 17 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION l...l7SEQUENCE DESCRIPTION: SEQ ID NO:206:CAGGAAACAG CTATGAC(2) INFORMATION FOR SEQ ID NO:207:(i)(ii)(iii)(iv)(vi)SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circularMOLECULE TYPE: DNA (genomic)HYPOTHETICAL: NOANTI-SENSE: NOORIGINAL SOURCE:1617?CA 02265523 1999-03-16W0. 93/13323 PCT/U S97/ 19575- 255 -(A) ORGANISM: Helicobacter pylori(ix) FEATURE:(A) NAME/KEY: misc_feature5 (B) LOCATION 1...21(xi) SEQUENCE DESCRIPTION: SEQ ID NO:207:ATCTTACCTA TCACCTCAAA T 211015202530(2) INFORMATION FOR SEQ ID NO:208:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: circular(ii) MOLECULE TYPE : DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(Vi) ORIGINAL SOURCE:(A) ORGANISM: Helicobacter pyloriFEATURE:(A) NAME/KEY: misc_feature(B) LOCATION 1...21(ix)(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:2OB:AGACAGCAAC ATCTTTGTGA A 21
