Note: Descriptions are shown in the official language in which they were submitted.
CA 02268457 1999-04-19
Mammalian RADI .Genes, Polypeptides
And Methods of Use
BACKGROUND OF TFiE INVENTION
Field of the Invention
The present invention is in the fields of molecular biology, medical
diagnostics and therapeutics. In particul~~r, the invention provides isolated
nucleic acid molecules encoding mammalian. homologues ofthe yeast radl + gene
(i.e., mammalian RADl genes), such as human RADI (HRADI), marine RADI
(MRA.Dl ), and mutants, fragments or derivatives thereof. The invention also
relates to polypeptides encoded by such isolated nucleic acid molecules,
antibodies binding to such polypeptides, I;enetic constructs comprising such
nucleic acid molecules, prokaryotic or eukaryotic host cells or whole animals
(including transgenic animals) comprising siuch genetic constructs, and
methods
and compositions for use in diagnosing disorders associated with sensitivity
to
DNA damage (e.g., cancer), and therapeutic methods for treating certain
disorders
(such as cancer) by inducing increased sensitivity to DNA damage in cells.
Related Art
Cell cycle checkpoints are regulatory mechanisms which prevent cell
cycle progression in the presence of DNA damage or incompletely replicated
DNA (Weinert, T.A., and Hartwell, L.H., S~:ience 241:317-22 (1988); Weinert,
T.A., and Hartwell, L.H., Mol. Cell. Biol. 10:6554-64 (1990); al-Khodairy, F.,
and Carr, A.M., EMBO J. 11:1343-SO (1992); Rowley, R., et al., EMBO J.
11:1335-42 (1992)). Even in the absence of exogenous DNA damage, defects in
cell cycle checkpoints lead to genomic instability, as demonstrated in budding
CA 02268457 1999-04-19
-2-
yeast rad9 mutants at the G2-M checkpoint (Weinert, T.A., and Hartwell, L.H.,
Mol. Cell. Biol. 10:6554-64 (1990)), and in mammalian p53 null cell lines at
the
G1-S checkpoint (Livingstone, L.R., et al.,Cell 70:923-35 (1992); Yin, Y., et
al.,
Cell 70:937-48 ( 1992)). The resulting widespread genomic abnormalities are
typical of cancer cells (Howell, P.C., Science' 194:23-28 ( 1976)). A large
body of
evidence implicates defects in cell cycle regulation, including checkpoint
regulation, in the genesis of human cancers (Swift, M., et al., N. Engl. J.
Med.
316:1289-1294 (1987); Malkin, D., et al., Science 250:1233-8 (1990);
Srivastava,
S., et al., Nature 348:747-9 (1990); Kastan, M.B., et al., Cancer Res. 51:6304-
11 ( 1991 ); Motokura, T ., et al., Nature 350: S 12-5 ( 1991 ); Swi ft, M.,
et al., N.
Engl. J. Med. 325:1831-1836 (1991); Donehower, L.A., et al., Nature 356:215-21
(1992); Kastan, M.B., et al., Cell 71:587-97 (1992); Kuerbitz, S.J., et al.,
Proc.
Natl. Acad. Sci. USA 89:7491-5 (1992); Liviingstone, L.R., et al.,Cel170:923-
35
(1992); Xiong, Y., et al., Cell 71:504-14 (15192); Yin, Y., et al., Cell
70:937-48
(1992); O'Connor, P.M., et al., Cancer Res. 53:4776-80 (1993); Serrano, M., et
al., Nature 366:704-7 ( 1993 ); Dulic, V ., et al, Cell 76:1 O 13-23 ( 1994);
Kamb, A.,
et al., Science 264:436-40 (1994); Nelson, ~7V.G., and Kastan, M.B., Mol.
Cell.
Biol. 14:1815-23 (1994); Savitsky, K., et al., Science 268:1749-53 (1995)).
The
increased genomic instability evident in all checkpoint mutants so far tested
is a
likely mechanism for increasing cancer susceptibility.
The fission yeast Schizosaccharomyces pombe undergoes a dose-
dependent G2 delay in response to DNA damage caused by radiation
(al-Khodairy, F., and Carr, A.M., EMBO J. 11:1343-SO (1992); Rowley, R., et
al., EMBO J. 11:1335-42 (1992)). Cells remain arrested at this G2 checkpoint
while DNA damage is repaired, then enter mitosis and resume progression
through the cell cycle. Six "checkpoint ra~fi' genes have been identified in
S.
pombe: radl+, rad3+, rad9+, radl7+, rad26~, and hulsl+ (al-Khodairy , F., and
Carr, A.M., EMBOJ.11:1343-SO (1992); Enoch, T., et al., GenesDev. 6:2035-46
(1992); Rowley, R., et al., EMBO J. 11:1335-42 (1992); al-Khodairy, F., et
al.,
Mol. Biol. Cell 5:147-60 ( 1994)). All six of these genes are required to
arrest the
cell cycle in response to either DNA damage or incomplete DNA replication.
Mutations in any of the checkpoint raf genes result in almost identical
CA 02268457 1999-04-19
-3-
phenotypes; these mutants are all sensitive to treatment with DNA-damaging
agents (e.g. , ultraviolet (UV) or y irradiation ) and/or agents that block
replication
(e.g., hydroxyurea). This sensitivity is dine to loss of the G2 and S phase
checkpoints which normally prevent mitotic entry in the presence of damaged or
incompletely replicated DNA, respectively (al-Khodairy, F., and Carr, A.M.,
EMBO J. 11:1343-50 (1992); Enoch, T. et al., Genes Dev. 6:2035-46 (1992);
Rowley, R., et al., EMBOJ:11:1335-42 (1992); al-Khodairy, F., et al., Mol.
Biol.
Cell. 5:147-60 (1994)). These data suggest that these genes share a common or
overlapping pathway.
While the G2 checkpoint also exists :in human cells, little is known about
the molecular mechanisms involved. Recent identification of human genes
homologous to known G2 checkpoint control genes in yeast suggests that the
regulation of this process has been conserved from yeast to man. For example,
a functional homologue of the rad9+ gene, it~RAD9, and a structural homologue
of the rad3+ gene, ATR, have previously been reported in humans (Bentley,
N.J.,
et al., EMBOJ. 15:6641-6651 (1996); Cimprich, K.A., et al., Proc. Natl. Acad.
Sci. USA 93:2850-2855 (1996); Lieberman, H.B., et al., Proc. Natl. Acad. Sci.
USA 93:13890-13895 (1996); and WO 9T/46661 A2 (U.S. Application No.
08/644,034, filed May 9, 1996)). However, a mammalian structural homologue
of the RAD1 family of checkpoint control genes (e.g., radl+ in fission yeast,
RAD17 in budding yeast and RECI in Ustilago maydis) has not heretofore been
reported.
SUMMARY OF THE INVENTION
The present invention generally :relates to mammalian cell cycle
checkpoint control genes and polypeptides, and methods of diagnosing and
treating certain mammalian disorders using these genes and polypeptides.
Specifically, the invention provides manunalian homologues of the yeast
checkpoint control gene radl +, herein designated "mammalian RADI genes,"
such as isolated human or marine RADl (iYRADl and MRADI, respectively)
nucleic acid molecules.
CA 02268457 1999-04-19
-4-
Isolated HRA.Dl nucleic acid molecules of the invention preferably
comprise a polynucleotide having a nucleotide sequence at least about 65 %
(more
preferably at least about 70%, at least about 75%, at least about 80%, at
least
about 85%, at least about 90%, at least about 95% or at least about 99%)
identical
to a reference sequence selected from the g~~oup consisting of
(a) the nucleotide sequence set i:orth in SEQ iD NO:1;
(b) a nucleotide sequence encodi ng the HRAD 1 p polypeptide having
the complete amino acid sequence set forth in SEQ ID N0:2;
(c) a nucleotide sequence encoding the HRAD lp polypeptide having
the complete amino acid sequence encoded by the cDNA clone having GenBank
Accession Number AF 011905;
(d) a nucleotide sequence of a polynucleotide which hybridizes under
stringent conditions to a polynucleotide haviing the nucleotide sequence set
forth
in SEQ ID NO:1; and
(e) a nucleotide sequence complementary to any one ofthe nucleotide
sequences in (a), (b), (c) and (d),
or a fragment thereof.
Analogously, isolated MRADl nucleic acid molecules of the invention
preferably comprise a polynucleotide having a nucleotide sequence at least
about
65% (more preferably at least about 70%, at least about 75%, at least about
80%,
at least about 85%, at least about 90%, at le~cst about 95% or at least about
99%)
identical to a reference sequence selected from the group consisting of
(a) the nucleotide sequence set i:orth in SEQ ID N0:3;
(b) a nucleotide sequence encoding the MRAD 1 p polypeptide having
the complete amino acid sequence set forth in SEQ ID N0:4;
(c) a nucleotide sequence encoding the MRAD lp polypeptide having
the complete amino acid sequence encoded by the cDNA clone having GenBank
Accession Number AF 038841;
(d) a nucleotide sequence of a polynucleotide which hybridizes under
stringent conditions to a polynucleotide having the nucleotide sequence set
forth
in SEQ ID N0:3; and
CA 02268457 1999-04-19
-5-
(e) a nucleotide sequence complementary to any one of the nucleotide
sequences in (a), (b), (c) and (d),
or a fragment thereof.
The invention is also directed to an isolated nucleic acid molecule
comprising a polynucleotide encoding an ep itope-bearing portion of a HRAD 1 p
or MRADIp polypeptide, wherein the epitope-bearing portion is selected from
the group consisting of a polypeptide having; an amino acid sequence
consisting
essentially of amino acid residues from about 77 to about 86 in SEQ ID N0:2
(for HRADIp) or from about 77 to about 86 in SEQ ID N0:4 (for MRADIp);
a polypeptide having an amino acid sequence: consisting essentially of amino
acid
residues from about 89 to about 97 in SEQ II) N0:2 (for HRAD 1 p) or from
about
89 to about 97 in SEQ ID N0:4 (for MR.AD 1 p); a polypeptide having an amino
acid sequence consisting essentially of amino acid residues from about 112 to
about 128 in SEQ ID N0:2 (for HRADlp) or from about 112 to about 128 in
SEQ ID N0:4 (for MRADIp); a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 159 to about 177 in
SEQ
ID N0:2 (for HRADlp) or from about 159 to about 177 in SEQ ID N0:4 (for
MRADIp); and a polypeptide having are amino acid sequence consisting
essentially of amino acid residues from about 227 to about 257 in SEQ ID N0:2
(for HRAD 1 p) or from about 227 to about 2;5 7 in SEQ ID N0:4 (for MRAD 1 p).
The present invention also relates to vectors, particularly expression
vectors, which comprise the isolated nucleic acid molecules of the present
invention, and to host cells comprising these; vectors. Preferred host cells
of the
invention include, but are not limited to, bacterial cells, yeast cells,
animal cells
(especially mammalian cells or insect cells) and plant cells. The invention
also
relates to methods of making such vectors and host cells, and methods of using
the same for production of HRAD 1 p or MRAD 1 p polypeptides by recombinant
techniques.
The invention also is directed to isolated HRADlp polypeptides and
isolated MRAD lp polypeptides. Isolated HF;AD 1 p polypeptides preferably have
an amino acid sequence at least about 65% (more preferably at least about 70%,
at least about 75%, at least about 80%, at least about 85%, at least about
90%, at
CA 02268457 1999-04-19
-6-
least about 95% or at least about 99%) identiical to a reference sequence
selected
from the group consisting of
(a) the amino acid sequence encoded by an isolated nucleic acid
molecule having a nucleotide sequence as set forth in SEQ ID NO:1;
(b) the complete amino acid sequence of the HRAD lp polypeptide as
set forth in SEQ ID N0:2; and
(c) the complete amino acid sequence of the HRADIp polypeptide
encoded by the cDNA clone having GexiBa~zlc Accession Number AF 011905,
or a fragment thereof.
Analogously, isolated MRAD 1 p polypeptides of the invention preferably
have an amino acid sequence at least about 65% (more preferably at least about
70%, at least about 75%, at least about 80°ro, at least about 85%, at
least about
90%, at least about 95% or at least about 99'%) identical to a reference
sequence
selected from the group consisting of
(a) the amino acid sequence encoded by an isolated nucleic acid
molecule having a nucleotide sequence as set forth in SEQ ID N0:3;
(b) the complete amino acid sequence of the MRADIp polypeptide
as set forth in SEQ ID N0:4; and
(c) the complete amino acid sequence of the MRADlp polypeptide
encoded by the cDNA clone having GenBa~ik Accession Number AF 038841,
or a fragment thereof.
The invention alsa relates to other isolated HRAD 1 p and MR.AD 1 p
polypeptides (as defined below) comprising ane or more epitope-bearing
portions
of the above-described HRADlp and MItADIp polypeptides, wherein the
epitope-bearing portion is selected from thc; group consisting of a
polypeptide
having an amino acid sequence consisting essentially of amino acid residues
from
about 77 to about 86 in SEQ ID N0:2 (for FIRADIp) or from about 77 to about
86 in SEQ ID N0:4 (for MRADIp); a ~polypeptide having an amino acid
sequence consisting essentially of amino acid residues from about 89 to about
97
in SEQ ID N0:2 (for HRADlp) or from about 89 to about 97 in SEQ ID N0:4
(for MRADIp); a polypeptide having an amino acid sequence consisting
essentially of amino acid residues from about 112 to about 128 in SEQ ID N0:2
CA 02268457 1999-04-19
_7_
(for HRA.D lp) or from about 112 to about 1:Z8 in SEQ ID N0:4 (for MRADIp);
a polypeptide having an amino acid sequence; consisting essentially of amino
acid
residues from about 159 to about 177 in SE;Q ID N0:2 (for HRADIp) or from
about 159 to about 177 in SEQ ID N0:4 (for MRADlp); and a polypeptide
having an amino acid sequence consisting essentially of amino acid residues
from
about 227 to about 257 in SEQ ID N0:2 (i:or HRADlp) or from about 227 to
about 257 in SEQ ID N0:4 (for MRADIp).
The invention also relates to methods of producing an isolated HRAD lp-
or MRAD lp-specific antibody comprising innmunizing an animal with the above-
described isolated BRAD l p or MRAD l p polypeptides, and isolating an
HRAD 1 p- or MR.AD 1 p-specific antibody from the animal. The invention is
also
directed to isolated HRAD 1 p- or MRAD 1 p-specific antibodies produced by
these
methods. The antibodies of the invention may be polyclonal or monoclonal
antibodies, and may be detectably labeled or immobilized on a solid support.
The invention also relates to antisense oligonucleotides which are
complementary to an HRADl or a MRADI InRNA sequence corresponding to a
portion of the above-described HRADl or MRADl nucleic acid molecules.
Preferred such antisense oligonucleotides may be 15-mers to 40-mers and may
be DNA molecules or derivatives thereof such as DNA phosphorothioate
molecules. The invention also relates to pharmaceutical compositions
comprising
one or more of these antisense oligonucleotides and a pharmaceutically
acceptable carrier or excipient therefor.
The invention also relates to ribozymes comprising target sequences
which are complementary to an HRADI or a MRADI mRNA sequence
corresponding to a portion of the above-described HRADI or MRADl nucleic
acid molecules. The invention also relates to pharmaceutical compositions
comprising these ribozymes and a pharmaceutically acceptable earner or
excipient therefor.
The invention is also directed to transgenic animals comprising one or
more of the above-described isolated mammalian RADI nucleic acid molecules
or mutants, derivatives or variants thereof. Preferred such transgenic animals
may be mice comprising an altered HRA.DI or MRADI gene that includes
CA 02268457 1999-04-19
_$_
mutations rendering the gene functionally inactive, particularly wherein the
mutations comprise deletion of one or more nucleotides from, or insertion or
substitution of one or more nucleotides into, a wildtype HRADI or MRADI gene
such as that having the nucleotide sequence set forth in SEQ ID NO: l or SEQ
ID
N0:3, respectively.
The invention is also directed to methods for determining the sensitivity
of a first animal (preferably a mammal such as a mouse or human) to a DNA-
damaging agent (such as radiation or a chemical), or for diagnosing a disorder
in
a first animal suffering therefrom or predisposed thereto wherein the disorder
is
characterized by increased sensitivity of the first animal to a DNA-damaging
agent. Preferred such methods of the invention comprise:
(a) obtaining a first biological sample from the first animal and a
second biological sample from a second animal of known sensitivity to the DNA-
damaging agent;
(b) determining the level of expression of a mammalian RADI gene,
such as an HRADI or an MRADl gene, in the first and second biological samples;
and
(c) comparing the level of mamnnalian RADl gene expression in the
first biological sample to the level of mammalian RADI gene expression in the
second biological sample. According to~ the invention, a lower level of
mammalian RADI gene expression in the fimt biological sample relative to that
of the second biological sample indicates a hdgher level of sensitivity to a
DNA-
damaging agent in the first animal relative to that of the second animal. In
the
practice of this aspect of the invention, the determination step (b) may be
accomplished by a technique, such as northern blotting, that measures the
amount
of mammalian RADl mRNA (such as HRAL)1 or MRADl mRNA) present in the
first and second biological samples. Alternatively, the determination step (b)
may be accomplished by a technique that measures the level or activity of
mammalian RADIp polypeptide (such as F(RADlp or MRADlp polypeptide)
present in the first and second biological samples; such a technique may be an
immunological technique which may comprise contacting the first and second
biological samples with one or more antibodies that bind specifically to one
or
-9-
more mammalian RADIp (such as HRADlp or MRADIp) polypeptides present
in the first and second biological samples.
The invention is also directed to methods of treating or preventing a
disorder, such as a cancer, in a first animal suffering therefrom or
predisposed
S thereto, comprising:
(a) obtaining a first biological sample from the first animal and a
second biological sample from a second animal of known sensitivity to a DNA-
damaging agent;
(b) determining the level of mammalian RADI gene expression, such
as that of an HRADl gene or an MRADl gene, in the first biological sample
relative to that of the second biological sample; and
(c) treating the first animal, in which the level of mammalian RADI
gene expression in the first biological sample is different from that of the
second
biological sample, by a technique that cures, delays or prevents the
development
of, or induces remission of, the disorder. One suitable technique that cures,
delays or prevents the development of, or induces remission of, the disorder,
may
be selected from the group consisting of (a) chemotherapy, (b) radiation
therapy,
(c) surgery and (d) a combination of two or more of these techniques in (a),
(b)
and (c). Alternatively, the technique that cures, delays or prevents the
development of, or induces remission of, the disorder may comprise introducing
into the first animal a composition comprising one or more of the above-
described mammalian RADl (e.g., HRADI or MRADI ) antisense
oligonucleotides or one or more of the above-described mammalian RADI (e.g.,
HRADI orMRADI ) ribozymes, wherein the introduction of the composition into
the first animal induces a decrease in the expression of mammalian RAD1 (e.g.,
HRADI or MRADI ) in the animal. Finally, the technique that cures, delays or
prevents the development of, or induces remission of, the disorder may
comprise
introducing into the first animal a composition comprising one or more of the
above-described isolated HRAD1 nucleic acid molecules, wherein the
introduction of said composition into the first animal induces an increase or
a
decrease in the expression of mammalian RADI (e.g., HRADl or MRADI ) in the
animal. In preferred such methods of the invention, the composition introduced
CA 02268457 1999-04-19
-10-
into the animal further comprises a pharmaceutically acceptable carrier or
excipient, or a vector or a virion which may be derived from a retrovirus, an
adenovirus or an adeno-associated virus. According to the invention, any of
the
above methods and compositions may be used in conjunction with one or more
of the above-described conventional therapies, such as chemotherapy or
radiation
therapy. Disorders capable of being treated or prevented by the methods of the
invention include cancers, and animals suitably treated by these methods
include
mammals, preferably humans.
The invention is also directed to methods of identifying and/or isolating
mammalian, particularly human and rodent (particularly mouse), cell cycle
checkpoint control polypeptides, based on the ability of such polypeptides to
interact specifically with HRAD 1 p and/or M:RAD 1 p. Methods according to
this
aspect of the invention may comprise one or more steps, including, for
example:
(a) immobilizing the HR.ADIp or MRADIp on a solid support;
(b) contacting the immobilized FIRAD 1 p or MRAD 1 p with a sample
containing one or more cell cycle checkpoint control polypeptides that
interact
with HR.ADlp and/or MRAD lp, under conditions favoring the interaction of the
one or more polypeptides with the immobiliized HRADlp or MRADIp; and
(c) releasing the one or more cell cycle checkpoint control
polypeptides from the immobilized HRAD 1 p and/or MRAD 1 p, thereby isolating
the one or more cell cycle checkpoint control polypeptides.
In an alternative such method, one or more cell cycle checkpoint control
polypeptides may be identified or isolated using the anti-HRADlp and/or anti-
MRAD 1 p antibodies of the invention, by co-immunoprecipitation of HRAD 1 p
or MRAD 1 p complexed with the one or more cell cycle checkpoint control
polypeptides, as described in more detail in Examples 10-12 herein.
The invention is also directed 1;o cell cycle checkpoint control
polypeptides that are isolated and/or identified according to these methods of
the
invention.
CA 02268457 1999-04-19
-11-
Other preferred embodiments of the present invention will be apparent to
one of ordinary skill in light of the following drawings and description of
the
invention, and of the claims.
BRIEF DESCRIPTION OF' THE DRAWINGS
Figure 1 is a depiction of the complete cDNA nucleotide sequence (SEQ
ID NO:1 ) and deduced complete amino acid (SEQ ID N0:2) sequence of
HRADl.
Figure 2 is a depiction of the complete cDNA nucleotide sequence (SEQ
ID N0:3) and deduced complete amino .acid (SEQ ID N0:4) sequence of
MRADI. Shown is the complete MRAD~! sequence containing a 224 by S'
untranslated region (UTR), an 840 by codling region, and a 328 by 3' UTR,
flanked at the 5' and 3' ends by 6 by EcoRI sites.
Figure 3 is a depiction of the ali~~ed amino acid sequences of the
deduced HRAD1 polypeptide (HRADIp I;SEQ ID N0:2)) and the MRAD1
polypeptide (MRAD 1 p (SEQ ID N0:4)) with other members of the Rad 1 p family
of proteins (U. maydis RECIp (SEQ ID N0:25), S. pombe Radlp (SEQ ID
N0:26), and S. cerevisiae RAD 17p (SEQ ID N0:27), indicating the regions of
amino acid sequence identity between the amino acid sequences of HRAD 1 p and
MRADlp and other members of the Radlp family. Numbers on the right
indicate the numbering of the final amino acid on each line. Identical
residues in
z 80% of the sequences are highlighted in dark grey. Conserved residues
(I/L/V/M, D/E, S/T, A/G, N/Q, R/H/K, and W/F/Y) in z 80% of the sequences are
highlighted in light grey. The proposed e~:onuclease and leucine-rich regions
(Thelen, M.P., et al., J. Biol. Chem. 269:747-54 ( 1994); Onel, K., et al.,
Genetics
143:165-74 (1996)) are indicated.
Figure 4 is a depiction of the aligned amino acid sequences of the
deduced HRADlp polypeptide (SEQ ID N0:2) and the deduced MRADIp
CA 02268457 1999-04-19
-12-
polypeptide (SEQ ID N0:4). Amino acid residues that are conserved between the
two polypeptides are designated with an asterisk; those residues where
conservative differences between the two po~lypeptides exist are designated
with
a dot; and those with non-conservative differences are blank.
Figure 5 is a composite of line graphs of the relative viabilities of radl -1
mutants of S. pombe versus radiation dose. Each data point corresponds to the
average taken over three plates and error bars indicate the standard deviation
of
the three values. O, wild type; 0, HRADl sense in radl-1; O, HRADI antisense
in radl -1. Error bars cannot be seen for data points where they are smaller
than
the data markers. Fig. 5A: cells irradiated with UV light; Fig. 5B: cells
irradiated with y radiation.
Figure 6 is a composite of line graphs demonstrating the ability of
HRADI to rescue the checkpoint defects of radl mutants at varying doses of
LTV-irradiation. Fig. 6A: checkpoint-deficient vector-transformed control
cells;
Fig. 6B: checkpoint-proficient yeast expressing Radlp; Fig. 6C: checkpoint-
proficient yeast expressing HRADlp. O, 0 J/mz; D,10 J/m2; D, 30 J/m2. These
data are representative of three independent experiments.
Figure 7 is a line graph of the ability of HRADl expression to restore
hydroxyurea (HL~ resistance to radl:: ura4-~ yeast.
Figure 8 is a composite demonstrating the interaction between HRAD1
and hHUS 1. Fig. 8A: ,~'. cerevisiae strain HF7c was transformed with the
indicated GAL4 fusion plasmids and plated on media selecting for co-
transformants. Single colonies were subcultured onto selective media in the
presence (lefthand plate) or absence (righthand plate) of histidine. Growth in
the
absence of histidine is indicative of a protein::protein interaction, as
demonstrated
by the p53:SV40 T-Ag positive control (lower left quadrant). When pGBT9-
HRAD9 and pGAD-hHUS 1 were cotransformed separately with the
CA 02268457 1999-04-19
-13-
corresponding empty vector, no growth on h~iple dropout medium (see Materials
and Methods, below) was observed (upper l:wo quadrants). Expression of both
HRAD 1 and hHUS 1 GAL4 fusions were required for viability in the absence of
histidine (bottom right quadrant). Fig. 8B: COS-1 cells were transiently co-
y transfected with constructs expressing FLACi epitope-tagged HRAD 1 (HR.AD 1
fj
and myc epitope-tagged hHUS 1 (hHUS 1 "~ (:lane 1 ), hHUS l m and FLAG epitope-
tagged hepatic leukemia factor (HLFf) (lane 2), or HRAD 1 f and a myc-tagged n-
terminal deletion of the fer oncogene (FerON'm) (lane 3). After harvesting,
lysates
were immunoprecipitated with anti-myc ("cc-myc") 9E 10 monoclonal antibody
(Sigma, and gift of Dr. Peter Greer, Cancer Research Laboratories, Queen's
University, Kingston, Ontario, Canada) or a- FLAG M2 monoclonal antibody
(Sigma). Two aliquots from each sample were subjected to electrophoresis
through two identical polyacrylamide gels, one of which was used for an anti-
FLAG (a-Flag) western blot and the other for an anti-myc (a-Myc) western blot.
Figure 9 is a composite demonstrating the interaction between HRAD9
and HRAD 1. Fig. 9A: Yeast two-hybrid assay, performed as in Figure 8A, using
pGBT9-HRAD9 and pGAD-HRAD 1 GAL4 fusion constructs. Co-expression of
HRAD9 and HR.AD 1 fusions failed to assemble a functional GAL4, and hence
did not produce viable cells in the absence ~of histidine (Figure 9A, lower
right
quadrant). Fig. 9B: Co-immunoprecipitation of HRAD1 and HRAD9. COS-1
cells were transiently co-transfected with constructs expressing FLAG epitope-
tagged HRAD 1 (HRAD 1 f) and myc epitope-tagged HR.AD9 (HR.AD9m) (lane 1 ),
HRAD9m and HLFf (lane 2), or HRAD 1 f and Fer~Nm (lane 3). After harvesting,
lysates were immunoprecipitated with a-myc 9E10 monoclonal antibody or a-
FLAG M2 monoclonal antibody. Two aliquots from each sample were subj ected
to electrophoresis through two identical polyacrylamide gels, one of which was
used for an anti-FLAG (a-Flag) western blot and the other for an anti-myc (a-
Myc) western blot.
Figure 10 is a composite demonstrating the preferential association of
HRAD1 with phosphorylated HRAD9. (:OS-1 cells were transfected with
CA 02268457 1999-04-19
-14-
HRAD9my~ expressing construct, and harvf;sted 48 hours later. Alternatively,
HeLa cells were simply harvested at 50% confluence. Cells were lysed and
immunoprecipitated as in Figure 8 with a-myc or a-HRAD9 antibodies,
respectively. Immunoprecipitates were either untreated, or treated with calf
intestinal phosphatase (CIP) in the presence or absence of the phsophatase
inhibitor sodium orthovanadate (V04). Samples were then subjected to SDS-
PAGE, blotted onto nitrocellulose, and immtaroblotted with a-myc or a-HR.AD9
antibodies. Fig. 10A: banding pattern of HltAD9my~ in immunoblots of COS-1
cells, demonstrating multiple phosphorylation states of HRAD9my~. Fig lOB:
banding pattern of HRAD9my~ in HeLa cells, indicating that endogenous HRAD9
is phosphorylated in HeLa cells. Fig. l OC: co-immunoprecipitations of HRAD 1
and HRAD9 in the presence and absence of CIP and/or V04, indicating that the
most heavily phosphorylated forms of HltAD9 are preferentially bound by
HRAD 1.
DETAILED DESCRIPTION I~F THE INVENTION
Overview
The present invention provides isolated nucleic acid molecules
comprising a polynucleotide encoding mammalian homologues or orthologues
of the yeast radl + polypeptide (i.e., "marrunalian RADlp" polypeptides). In
particular, the invention is directed to isolated nucleic acid molecules
encoding
a human RADlp (HRADIp) polypeptide, and to isolated nucleic acid molecules
encoding a murine RAD 1 p (MRAD 1 p) pol~,~peptide. The HRAD 1 p polypeptide
of the present invention shares about 27% overall amino acid sequence identity
and about 53% amino acid sequence similarity with certain members of the
Radlp family of yeast cell cycle checkpoint control polypeptides (Figure 3),
although the sequence identity and similarity vary within individual domains
of
the polypeptide as described in detail in the Examples below. The nucleotide
sequence of HRADI shown in Figure 1 (SEQ ID NO:1) was obtained by
sequencing a cDNA clone prepared from a human transformed keratinocyte
cDNA library (HaCaT); the sequence was df;posited with GenBank and assigned
CA 02268457 1999-04-19
-15-
GenBank Accession Number AF 011905, and the clone was deposited on
at and assigned accession number Although a mammalian
homologue of the yeast radl + gene was initially isolated from a human cDNA
library and was designated HRADl , the presE;nt invention also provides a
marine
homologue ofHRADl , referred to throughout: this specification as "MRADI ,"
that
is expressed in marine cells and tissues. The nucleotide sequence of MRADI
shown in Figure 2 (SEQ ID N0:3) was deposited with GenBank and assigned
GenBank Accession Number AF 038841, and the clone was deposited on
at and assigned accession numbc;r It will therefore be
understood by one of ordinary skill in the art that the term " mammalian RADl
"
as used herein refers to isolated mammalian RADl nucleic acid molecules or
polynucleotides, or mammalian RADIp polypeptides and antibodies, that may
originate from any mammal, including those of human or marine origin (i. e.,
HRADl and HRADlp, or MRADl and MIRADIp, respectively), and that the
present invention thus encompasses RADI nucleic acid molecules and
polynucleotides, and RAD 1 p polypeptides and antibodies, of mammalian, most
particularly of human and marine, origin.
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using a T7 sequencing kit
containing T7 DNA polymerase (Pharnnacia Biotech) according to the
instructions of the manufacturer, as described in more detail in the Examples
below. It will be understood by one of ordinary skill, however, that the
nucleotide sequences of the nucleic acid molecules of the invention could also
be
determined by manual DNA sequencing such as dideoxy sequencing, according
to methods that are routine in the art (Sanger., F., and Coulson, A.R., J.
Mol. Biol.
94:444-448 (1975); Sanger, F., et al., Proc. Natl. Acad. Sci. USA 74:5463-5467
(1977)), or by automated sequencing such .as by using an Applied Biosystems
Automated Sequenator according to the maJlufacturer's instructions. All amino
acid sequences of polypeptides encoded by DNA molecules determined herein
were predicted by conceptual translation of a DNA sequence determined as
CA 02268457 1999-04-19
-16-
above. Therefore, as is known in the art for any DNA sequence determined by
these approaches, any nucleotide sequence determined herein may contain some
errors. Nucleotide sequences determined by such methods are typically at least
about 90% identical, more typically at least about 95% to at least about 99.9%
identical to the actual nucleotide sequence oiF the sequenced DNA molecule. As
is also known in the art, a single insertion or deletion in a determined
nucleotide
sequence compared to the actual sequence will cause a frame shift in
translation
of the nucleotide sequence such that the predicted amino acid sequence encoded
by a determined nucleotide sequence will be .completely different from the
amino
acid sequence actually encoded by the seqwenced DNA molecule, beginning at
the point of such an insertion or deletion.
Unless otherwise indicated, each "nucleotide sequence" set forth herein
is presented as a sequence of deoxyribonucle;otides (abbreviated A, G , C and
T).
However, by "nucleotide sequence" of a nuclleic acid molecule or
polynucleotide
is intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotidea (A, G, C and U), where each
thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide
sequence
is replaced by the ribonucleotide uridine (I~. For instance, reference to
HRADI
or MRADl RNA molecules having the sequence of SEQ ID NO:I or SEQ ID
N0:3, respectively, set forth using deoxyribonucleotide abbreviations is
intended
to indicate RNAs molecule having a sequence in which each deoxyribonucleotide
A, G or C of SEQ ID NO:1 or SEQ II) N0:3 has been replaced by the
corresponding ribonucleotide A, G or C, and each deoxyribonucleotide T has
been replaced by a ribonucleotide U.
Using the information provided herein; such as the nucleotide sequences
in Figures l and 2, nucleic acid molecules ~of the present invention encoding
a
mammalian RADIp polypeptide, such as; HR.ADlp or M>2ADlp, may be
obtained using standard cloning and screening procedures, such as those for
cloning cDNAs using mRNA as starting material. As used herein, an "HRADIp
polypeptide" means a polypeptide that is encoded by a polynucleotide
comprising
the nucleotide sequence shown in Figure 1 (SEQ ID NO:1 ), or that has an amino
CA 02268457 1999-04-19
-17-
acid sequence as set forth in Figure 1 (SEQ ID N0:2), or a fragment thereof.
Analogously, an "MRADIp polypeptide" as used herein refers to a polypeptide
that is encoded by a polynucleotide comprising the nucleotide sequence set
forth
in SEQ ID N0:3, or that has an amino acid sequence as set forth in SEQ ID
N0:4, or a fragment thereof. Preferred cloning and screening methods used in
the
invention include PCR-based cloning methods, such as reverse transcriptase-PCR
(RT-PCR) using primers such as those described in the Examples below.
Illustrative of the invention, the determined nucleotide sequence of the
coding segment (849 base pairs) of the HRA1)1 cDNA is shown in Figure 1 (SEQ
ID NO:1 ). The predicted 282 amino acid HItAD lp polypeptide encoded by this
coding sequence has an amino acid sequence as set forth in Figure 1 (SEQ ID
N0:2), and a deduced molecular weight of about 32 KDa. Analogously, the
determined nucleotide sequence of the codiing segment (843 base pairs) of the
MRADl cDNA is shown in Figure 2 (SEQ ID N0:3). The predicted 280 amino
acid MRADIp polypeptide encoded by this coding sequence has an amino acid
sequence as set forth in Figure 2 (SEQ II) N0:4), and a deduced molecular
weight of about 32 KDa
Nucleic acid molecules of the present invention may be in the form of
RNA, such as mRNA, or in the form of DNA,, including, for instance, cDNA and
genomic DNA obtained by cloning or produced synthetically. The DNA may be
double-stranded or single-stranded. Single-stranded DNA or RNA may be the
coding strand, also known as the sense strand, or it may be the non-coding
strand,
also referred to as the antisense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid
molecule, DNA or RNA, which has been removed from its native environment.
For example, recombinant DNA molecules .contained in a vector are considered
isolated for the purposes of the present invention. Further examples of
isolated
DNA molecules include recombinant DNA molecules maintained in heterologous
host cells, and those DNA molecules purific;d (partially or substantially)
from a
solution whether produced by recombinant DNA or synthetic chemistry
techniques. Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. However, it is intended that
CA 02268457 1999-04-19
-18-
"isolated" as used herein does not include the mammalian RADI cDNA present
in a mammalian cDNA library or in a preparation of purified or isolated total
genomic DNA containing the mammalian IZ.4D1 gene.
The nucleic acid molecules of the. present invention further include
genetic constructs comprising one or more mammalian RADI DNA sequences
(such as HRADI or MRADI ) operably linked to regulatory DNA sequences
(which may be heterologous regulatory sequences), such as promoters or
enhancers as described below. Upon expression of these DNA sequences in host
cells, preferably in bacterial, fungal (including yeast), plant or animal
(including
insect or mammalian) cells, one or more mammalian RAD lp polypeptides, such
as HRADIp or MRADIp, may be produced. In such constructs, the regulatory
sequences may be operably linked to a mammalian RADI polynucleotide
encoding a mature mammalian RADIp polypeptide or any of its variants,
precursors, fragments or derivatives described herein. For example, an HRADl
variant may include one or more polynucleotides having a nucleic acid sequence
that is similar or complementary to substantially all or a portion of a
nucleic acid
molecule having a nucleic acid sequence as shown in Figure 1 (SEQ ID NO:1 ).
Analogously, an MRADI variant may include one or more polynucleotides
having a nucleic acid sequence that is similar or complementary to
substantially
all or a portion of a nucleic acid molecule having a nucleic acid sequence as
shown in Figure 2 (SEQ ID N0:3). As used herein, the term "substantially all"
of a nucleic acid molecule or a polypeptide means a portion of the nucleic
acid
molecule or polypeptide that contains greatc;r than about 90%, 91 %, 92%, 93%,
94%, 95%, 96%, 97%, 98% or 99%, of a reference nucleotide sequence, for
example the nucleotide sequences shown in SEQ ID NO:1 and SEQ ID N0:3, or
of a reference polypeptide amino acid sequence, for example the polypeptide
amino acid sequences shown in SEQ ID N0:2 and SEQ ID N0:4. As used
herein, the terms "a portion" or "a fragment" of a nucleic acid molecule or a
polypeptide means a segment of a polynucleotide or a polypeptide comprising at
least S,10 or 1 S, and more preferably at least 20, contiguous nucleotides or
amino
acids of a reference polynucleotide one polypeptide (for example, the
CA 02268457 1999-04-19
-19-
polynucleotides and polypeptides shown in Figure 1 (SEQ ID NOs: 1, 2) and
Figure 2 (SEQ ID NOs: 3, 4)), unless otherwise specifically defined below.
Isolated nucleic acid molecules of the present invention include (a) DNA
molecules encoding a mammalian RAD lp p~olypeptide, for example the HRADI
S DNA molecule having a nucleotide sequence corresponding to that depicted in
Figure 1 (SEQ ID NO:1 ) and the MRADl :DNA molecule having a nucleotide
sequence corresponding to that depicted in Figure 2 (SEQ ID NO:3); (b) DNA
molecules comprising the coding sequence fir a mammalian RAD lp polypeptide,
for example the HRADIp polypeptide shown in Figure 1 (SEQ ID N0:2) and the
MRADlp polypeptide shown in Figure 2 (SEQ ID N0:4); and (c) DNA
molecules which comprise a sequence substantially different from those
described above but which, due to the degeneracy ofthe genetic code, still
encode
a mammalian RAD lp polypeptide. Since the genetic code is well known in the
art, it is routine for one of ordinary skill in the art to produce the
degenerate
variants described above without undue experimentation.
In another aspect, the invention provides an isolated HRADl nucleic acid
molecule having a nucleotide sequence as set forth in Figure 1 (SEQ ID NO:1 ),
an isolated MRADl nucleic acid molecule leaving a nucleotide sequence as set
forth in Figure 2 (SEQ ID N0:3), or a nucleic acid molecule having a sequence
similar or complementary to substantially all or a portion of such nucleic
acid
molecules. Such isolated molecules, particularly DNA molecules, are useful as
probes for gene mapping, by in situ hybridization with chromosomes, and for
detecting expression of the mammalian RAL)1 (e.g., HRADl or MRADI ) gene in
animal (especially mammalian, including human and murine) tissues and cells,
for instance by northern blot analysis.
Nucleic acid molecules of the present invention which encode a
mammalian RADIp polypeptide may include, but are not limited to, those
encoding the amino acid sequence of the mal:ure polypeptide by itself; the
coding
sequence for the mature polypeptide and additional coding sequences, such as
those encoding the about 20-amino acid leader or secretory sequence, such as a
pre-, or pro- or prepro- protein sequence; the coding sequence of the mature
polypeptide, with or without the aforementioned additional coding sequences,
CA 02268457 1999-04-19
-20-
together with additional, non-coding sequences, including for example introns
and non-coding 5' and 3' sequences, such as the transcribed, untranslated
regions
(UTRs) or other 5' flanking sequences that nnay play a role in transcription
(e.g.,
via providing ribosome- or transcription factor-binding sites), mIRNA
processing
(e.g. splicing and polyadenylation signals) and stability of mRNA; the coding
sequence for the mature mammalian RADIIp polypeptide operably linked to a
regulatory DNA sequence, particularly a hetcrologous regulatory DNA sequence
such as a promoter or enhancer; and the; coding sequence for the mature
mammalian RADIp polypeptide linked to one or more coding sequences which
code for amino acids that provide additional functionalities. Thus, the
sequence
encoding the polypeptide may be fused to a marker sequence, such as a sequence
encoding a peptide which facilitates purification of the fused polypeptide. In
certain embodiments of this aspect of the invention, the marker amino acid
sequence may be a hexa-histidine peptide, such as the tag provided in a pQE
vector (Qiagen, Inc.), among others, many of which are commercially available.
As described for instance in Gentz et al., Prnc. Natl. Acad. Sci. USA 86:821-
824
( 1989), hexa-histidine provides for convenient purification of the fusion
protein.
The "HA" tag is another peptide useful for purification which corresponds to
an
epitope derived from the influenza hema;gglutinin protein, which has been
described by Wilson et al., Cell 37: 767 ( 1984). Yet another useful marker
peptide for facilitating the purification of a mammalian RAD 1 polypeptide is
glutathione S-transferase (GST) encoded b;r the pGEX fusion vector (see, e.g.,
Winnacker, From Genes to Clones, New Fork: VCH Publishers, pp. 451-481
( 1987)). As discussed below, other such fusion proteins include the mammalian
RAD1 polypeptide fused to immunoglobulin Fc at the N- or C-terminus.
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode portions, analogs or
derivatives
of the mammalian IRADIp polypeptides of'the invention. Variants may occur
naturally, such as a natural allelic variant. By an "allelic variant" is
intended one
of several alternate forms of a gene occupying a given locus on a chromosome
of an organism (see Lewin, B., Ed., Genes 11, John Wiley & Sons, New York
CA 02268457 1999-04-19
-21-
(1985)). Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
Such variants include those produced by nucleotide substitutions,
deletions or insertions. The substitutions, delletions or insertions may
involve one
or more nucleotides. The variants may be altered in coding regions, non-coding
regions, or both. Alterations in the coding regions may produce conservative
or
non-conservative amino acid substitutions, deletions or additions. Especially
preferred among these are substitutions, additions and deletions, which alter
the
properties and activities of the mammalian RAD lp polypeptide protein or
portions thereof; for example, most particul2~rly preferred in this regard are
those
substitutions, deletions and insertions vrhereby the mammalian RAD 1 p
polypeptide is rendered substantially reduced in activity. As used herein, the
term "substantially reduced in activity" means the mammalian RADlp
polypeptide or mutant mammalian RAD 1 p polypeptide demonstrates an activity
level not greater than about SO%, 40%, 30%, 20%,10%, 5%,1 %, 0.1 % or 0.01 %,
of the level demonstrated by a wildtype mammalian RAD 1 polypeptide such as
the wildtypes of HRAD 1 or MR.AD 1. In practice, whether a mammalian RAD lp
polypeptide or a mutant mammalian RAD 1 polypeptide demonstrates an activity
level not greater than about SO%, 40%, 30%, 20%,10%, S%,1 %, 0.1 % or 0.01 %,
of the level demonstrated by a wildtype malrunalian RAD 1 p polypeptide may be
determined by any number of assays measuring the sensitivity of mammalian
cells, expressing the RAD 1 p or mutant RAI~ 1 p polypeptides, to DNA damage.
Such assays will be familiar to one of ordinary skill; analogous assays in
yeast
cells are described in detail in the Example,. below.
Further embodiments of the invention include isolated HRADl nucleic
acid molecules comprising a polynucleotide :having a nucleotide sequence at
least
about 65% identical, and more preferably at least about 70%, at least about
75%,
at least about 80%, at least about 85%, at least about 90%, at least about
95%, at
least about 96%, at least about 97%, at least about 98% or at least about 99%
identical, to:
(a) the nucleotide sequence set forth in SEQ ID NO:1;
CA 02268457 1999-04-19
-22-
(b) a nucleotide sequence encoding the HRAD lp polypeptide having
the complete amino acid sequence set forth in SEQ ID N0:2;
(c) a nucleotide sequence encoding the IiRADIp polypeptide having
the complete amino acid sequence encoded by the cDNA clone having GenBank
Accession Number AF 011905 and which was deposited on at
and has accession number ;
(d) a nucleotide sequence of a po lynucleotide which hybridizes under
stringent conditions to a polynucleotide haviing the nucleotide sequence set
forth
in SEQ ID NO:1; and
(e) a nucleotide sequence complementary to any one of the nucleotide
sequences in (a), (b), (c) and (d),
or a fragment thereof.
Additional embodiments ofthe invention include isolatedMRADl nucleic
acid molecules, comprising a polynucleoti~de having a nucleotide sequence at
least about 65% (more preferably at least about 70%, at least about 75%, at
least
about 80%, at least about 85%, at least about 90%, at least about 95% or at
least
about 99%) identical to a reference sequence selected from the group
consisting
of
(a) the nucleotide sequence set forth in SEQ ID N0:3;
(b) a nucleotide sequence encoding the MRAD lp polypeptide having
the complete amino acid sequence set forth in SEQ ID N0:4;
(c) a nucleotide sequence encoding the MRAD 1 polypeptide having
the complete amino acid sequence encoded by the cDNA clone having GenBank
Accession Number AF 038841 and which was deposited on at
and has accession number ;
(d) a nucleotide sequence of a po lynucleotide which hybridizes under
stringent conditions to a polynucleotide having the nucleotide sequence set
forth
in SEQ ID N0:3; and
(e) a nucleotide sequence complementary to any one of the nucleotide
sequences in (a), (b), (c) and (d),
or a fragment thereof.
CA 02268457 1999-04-19
-23-
By "stringent hybridization conditions" as used herein is meant overnight
incubation at 42 °C in a solution comprising: :50% formamide, Sx SSC
(1X SSC =
150 mM NaCI, lSmM trisodium citrate), 50 mM sodium phosphate (pH 7.6),
Sx Denhardt's solution, 10% dextran sulfate;, and 20 ug/ml denatured, sheared
salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65
°C.
By a polynucleotide having a nucleotide sequence at least, for example,
65% "identical" to a reference nucleotide sequence encoding a mammalian
RADIp polypeptide is intended that the nucleotide sequence of the
polynucleotide is identical to the reference sequence except that the
polynucleotide sequence may include up to 35 point mutations per each 100
nucleotides of the reference nucleotide se-quence encoding the mammalian
RADIp polypeptide. In other words, to obtain a polynucleotide having a
nucleotide sequence at least 65% identical to a reference nucleotide sequence,
up
to 35% of the nucleotides in the reference sequence may be deleted or
substituted
with another nucleotide, ar a number of nucleotides up to 35% of the total
nucleotides in the reference sequence may be inserted into the reference
sequence. These mutations of the reference sequence may occur at the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere between
those terminal positions, interspersed either individually among nucleotides
in the
reference sequence or in one or more contiguous groups within the reference
sequence.
As a practical matter, whether any particular nucleic acid molecule is at
least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%
identical to, for instance, the HRADI nucleotide sequence shown in Figure 1
(SEQ ID NO:1) or the MRADI nucleotide sequence shown in Figure 2 (SEQ ID
N0:3), can be determined conventionally using known computer programs such
as BLAST (Washington, DC) or BEST:EIT (Genetics Computer Group,
University Research Park, Madison, WI). Wlnen using BLAST, BESTFIT or any
other sequence alignment program to determine whether a particular sequence
is,
for instance, 65% identical to a reference sequence according to the present
invention, the parameters are set such that the; percentage of identity is
calculated
over the full length of the reference nucleotide sequence and that gaps in
CA 02268457 1999-04-19
-24-
homology of up to 35% of the total number of nucleotides in the reference
sequence are allowed.
The present invention is directed to nucleic acid molecules at least about
65%, 70%, 75%, 80%, 85%, 90%, 95%, 96°/~, 97%, 98% or 99% identical to
the
HRADI nucleic acid sequence shown in Fig~:~re 1 (SEQ ID NO:1 ) or the MRADl
nucleic acid sequence set forth in SEQ :ID N0:3, and fragments thereof,
irrespective of whether they encode a polypeptide having RAD 1 p activity.
This
is because even where a particular nucleic acid molecule does not encode a
polypeptide having RADIp activity, one of skill in the art would still know
how
to use the nucleic acid molecule, for instance, as a hybridization probe or a
polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of
the present invention that do not encode a p~olypeptide having RADIp activity
include, inter alia, (1 ) isolating the mammalian RADl gene (e.g., the HRADI
or
MRADI gene) or allelic variants thereof in a genomic DNA library; (2) in situ
hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide
precise chromosomal location of the mammalian RADl gene, as described for
human gene localization in Verma et al., Human Chromosomes: A Manual of
Basic Techniques, Pergamon Press, New ~.'ork ( 1988); and (3) northern blot
analysis for detecting RAD 1 mRNA expression in specific mammalian tissues.
Of course, due to the degeneracy of flue genetic code, one of ordinary skill
in the art will immediately recognize that a large number of the nucleic acid
molecules having a sequence at least about 65%, 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, or 99% identical to the HRADI nucleic acid sequence
shown in Figure 1 (SEQ ID NO:1) or the MiQADl nucleic acid sequence shown
in Figure 2 (SEQ ID N0:3), and fragments thereof, will encode a polypeptide
having mammalian RAD 1 p polypeptide structure and/or activity. In fact, since
degenerate variants of these nucleotide sequences all encode the same
polypeptide, this will be clear to the skilled wtisan even without performing
the
above described comparison assay. It will be further recognized by one of
ordinary skill in the art that, for such nucleic acid molecules that are not
degenerate variants, a reasonable number will also encode a polypeptide having
RADlp polypeptide structure and/or activity. This is because the skilled
artisan
CA 02268457 1999-04-19
-25-
is fully aware of amino acid substitutions that are either less likely or
unlikely to
significantly affect protein function (e.g., rep:lacing one aliphatic amino
acid with
a second aliphatic amino acid). For example, guidance concerning how to make
phenotypically silent amino acid substitutions is provided in Bowie, J. U., et
al.,
Science 247:1306-1310 (1990), and the references cited therein.
As noted above, the invention also provides fragments of the above-
described nucleic acid molecules. Preferred nucleic acid fragments of the
present
invention include isolated nucleic acid molecules encoding epitope-bearing
portions of the mammalian RADIp polypeptides of the invention, such as
HRADlp and MRADlp. In particular, such HRADl nucleic acid fragments of
the present invention include nucleic acid molecules encoding: a polypeptide
having an amino acid sequence consisting essentially of amino acid residues
from
about 77 to about 86 in Figure 1 (SEQ ID NC1:2); a polypeptide having an amino
acid sequence consisting essentially of amino acid residues from about 89 to
about 97 in Figure 1 (SEQ ID N0:2); a polypeptide having an amino acid
sequence consisting essentially of amino acid residues from about 112 to about
128 in Figure 1 (SEQ ID N0:2); a polypeptide having an amino acid sequence
consisting essentially of amino acid residuf;s from about 159 to about 177 in
Figure 1 (SEQ ID N0:2); and a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 227 to about 257 in
Figure 1 (SEQ ID N0:2). Analogously, such MRADI nucleic acid fragments
may include nucleic acid molecules encoding: a polypeptide having an amino
acid sequence consisting essentially of amino acid residues from about 77 to
about 86 in Figure 2 (SEQ ID N0:4); a polypeptide having an amino acid
sequence consisting essentially of amino acid residues from about 89 to about
97
in Figure 2 (SEQ ID N0:4); a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 112 to about 128 in
Figure 2 (SEQ ID N0:4); a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 159 to about 177 in
Figure 2 (SEQ ID N0:4); and a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 227 to about 257 in
Figure 2 (SEQ ID N0:4). The inventors contemplate that the above polypeptide
CA 02268457 1999-04-19
-26-
fragments are antigenic regions of the predicted HRAD 1 p and MRAD 1 p
polypeptides. Methods for determining other such epitope-bearing portions of
the mammalian RAD1 polypeptides are described in detail below.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising a polynucleotide which hybridlizes under stringent hybridization
conditions to substantially all or a portion of the polynucleotide in a
nucleic acid
molecule of the invention described above, for instance, an HRADI nucleic acid
molecule having a nucleotide sequence as set forth in Figure 1 (SEQ ID NO:1 )
or an MRADl nucleic acid molecule having a nucleotide sequence as set forth in
Figure 2 (SEQ ID N0:3).
By a polynucleotide which hybridizes to a "portion" of a polynucleotide
is intended a polynucleotide (either DNA or RNA) hybridizing to at least about
30 nucleotides, and more preferably at least about 40 nucleotides, still more
preferably at least about 50 nucleotides, and even more preferably about 50-90
nucleotides of the reference polynucleotide. These hybridizing polynucleotides
are useful as diagnostic probes and primers as discussed above and in more
detail
below.
Of course, polynucleotides hybridizing to a larger portion of the reference
polynucleotide (e.g., a nucleic acid molecule consisting of the HRADI coding
sequence, having the nucleotide sequence se;t forth in Figure 1 (SEQ ID NO:1
),
or a nucleic acid molecule consisting of the ~TRADI coding sequence, having
the
nucleotide sequence set forth in Figure 2 (SEQ ID N0:3)), for instance, a
portion
about 100-800 nucleotides in length, or even to the entire length of the
reference
polynucleotide, are also useful as probes according to the present invention,
as
axe polynucleotides corresponding to most, i f not all, of the nucleotide
sequence
as shown in Figure 1 (SEQ ID NO:1) or Figure 2 (SEQ ID N0:3). By a portion
of a polynucleotide of "at least 30 nucleotides in length," for example, is
intended
or more contiguous nucleotides from the nucleotide sequence of the reference
polynucleotide (e.g., the HRADl nucleotide sequence as shown in Figure 1 (SEQ
30 ID NO:1) or the MRADl nucleotide sequence as shown in Figure 2 (SEQ ID
N0:3)). As indicated, such portions are usf;ful diagnostically either as a
probe
according to conventional DNA hybridization techniques or as primers for
CA 02268457 1999-04-19
-27-
amplification of a target sequence by the polymerase chain reaction (PCR), as
described, for instance, in Molecular Cloning, A Laboratory Manual, 2nd Ed.,
Sambrook, J., et al., eds., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1989), the entire disclosure of'which is hereby incorporated
herein
S by reference.
Since a determined nucleotide sequence encoding an HR.ADlp
polypeptide is provided in Figure 1 (SEQ ID NO:1 ) and a determined nucleotide
sequence encoding an MRADIp polypeptidie is provided in Figure 2 (SEQ ID
N0:3), generating polynucleotides which hybridize to a portion of a mammalian
RADl cDNA molecule, particularly to a portion of an HRADl cDNA molecule
or an MRADl cDNA molecule, would be routine to the skilled artisan. For
example, restriction endonuclease cleavage; or shearing by sonication of the
mammalian RADI cDNA clone could easily be used to generate DNA portions
of various sizes which are polynucleotides that hybridize to a portion of the
mammalian RADl cDNA molecule. Alternatively, the hybridizing
polynucleotides of the present invention could be generated synthetically
according to known techniques. Thus, while the present invention specifically
relates to RADl nucleic acid molecules and polypeptides from human and mouse,
one of ordinary skill could easily generate and/or isolate homologues or
orthologues of the HRADl and MRADl nucleic acid molecules and polypeptides
of the invention from other organisms (parl:icularly other mammals) using the
HRADl nucleotide sequence (SEQ ID NO:1 ) and HRAD 1 p amino acid sequence
(SEQ ID N0:2), and the MRADI nucleotide sequence (SEQ ID N0:3) and
MRADIp amino acid sequence (SEQ ID N0:4), described herein and routine
molecular biology methods, e.g., screening; of cDNA libraries, that are well-
known in the art and described in standard protocols (see, e.g., Molecular
Cloning, A Laboratory Manual, 2nd Ed., Sambrook, J., et al., eds., Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory Press (1989)). Mammalian
tissue cDNA and genomic libraries that may be useful in isolating mammalian
RADI nucleic acid molecules are commercially available, for example from
Clontech (Palo Alto, California).
CA 02268457 1999-04-19
-28-
Vectors and Host Cells
The present invention also relates to genetic constructs comprising the
isolated nucleic acid molecules of the invention, or fragments thereof,
operably
linked to regulatory DNA sequences as described in detail below, vectors which
comprise these genetic constructs or the isolated DNA molecules of the present
invention, and host cells which comprise these vectors. In addition, the
invention
relates to the production of mammalian RAI) 1 p polypeptides (such as HRAD 1 p
or MRAD 1 p polypeptides) or fragments therf;of by recombinant techniques
using
these vectors and host cells.
Vectors comprising the genetic constructs or the isolated DNA molecules
or fragments of the present invention may be introduced into host cells using
well-known techniques such as infecaion, transduction, transfection,
electroporation and transformation. The vector may be, for example, a phage,
plasmid, viral or retroviral vector, and is preferably an expression vector as
described below. Retroviral vectors may be replication-competent or -
defective.
In the latter case, viral propagation generall;r will occur only in
complementing
host cells.
The polynucleotides may be joined to a vector containing a selectable
marker for propagation in a host. Generally, a plasmid vector is introduced
into
mammalian or avian cells in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid (e.g., LIPOFECTAMINETM; Life
Technologies, Inc.; Rockville, Maryland) or in a complex with a virus (such as
an adenovirus; see U.S. Patent Nos. 5,547,932 and 5,521,291) or components of
a virus (such as viral capsid peptides). If the vector is a virus, it may be
packaged
in vitro using an appropriate packaging cell line and then used to infect host
cells.
Preferred are vectors comprising cis-acting control regions to the
polynucleotide of interest. Appropriate traps-acting factors may be supplied
by
the host, by a complementing vector or by thE; vector itself upon introduction
into
the host.
In certain preferred embodiments in this regard, the vectors provide for
specific expression, which may be ind.ucible and/or cell type-specific.
Particularly preferred among such expressiion vectors are those inducible by
CA 02268457 1999-04-19
-29-
environmental factors that are easy to mmipulate, such as temperature and
nutrient additives.
Expression vectors useful in the present invention include chromosomal-,
episomal- and virus-derived vectors, e.g., vectors derived from bacterial
S plasmids, bacteriophages, yeast episomes, yeast chromosomal elements,
viruses
such as baculoviruses, papovaviruses, vaccinia viruses, adenoviruses, fowl pox
viruses, pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as cosmids and phagemids.
In one embodiment, an isolated nucleic acid molecule of the invention or
fragment thereof may be operably linked to am appropriate regulatory sequence,
preferably a promoter such as the phage lambda PL promoter, promoters from
T3, T7 and SP6 phages, the E. coli lac, trp and tac promoters, the SV40 early
and
late promoters and promoters of retroviral LT'Rs and derivatives thereof, to
name
a few. Other suitable promoters will be ls~own to the skilled artisan. The
expression constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site for
translation.
The coding portion of the mature transcripts expressed by the constructs will
preferably include a translation initiation codon (AUG) at the beginning and a
termination codon (LTAA, UGA or UAG) appropriately positioned at the end of
the polypeptide to be translated.
As indicated above, the expression vectors will preferably include at least
one selectable marker. Such markers include dihydrofolate reductase (dhfr) or
neomycin (neo) resistance for eukaryotic cell culture and tetracycline (tet)
or
ampicillin (amp) resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate ho sts include, but are not limited to,
bacterial cells, such as Escherichia spp. cells: (particularly E. coli),
Bacillus spp.
cells (particularly B. cereus, B. subtilis and B. megaterium), Streptomyces
spp.
cells, Salmonella spp. cells (particularly S. typhimurium) andXanthomonas spp.
cells; fungal cells, including yeast cells such as Saccharomyces spp. cells;
insect
cells such as Drosophila S2, Spodoptera Sf~ or Sf21 cells and Trichoplusa High-
Five cells; other animal cells (particularly mammalian cells and most
particularly
human cells) such as CHO, COS,1VIII-3T3, VERO, HeLa, HeCaT, embryonic
CA 02268457 1999-04-19
-30-
stem (ES) cells, Bowes melanoma cells and >:IepG2 and other liver cell lines;
and
higher plant cells. Appropriate culture media and conditions for the
above-described host cells are known in the art.
Among vectors preferred for use in bacteria include pQE70, pQE60 and
pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript
vectors, pNHBA, pNHl6a, pNHl8A and pl'JI-I46A, available from Stratagene;
pcDNA3 available from Invitrogen; and pGE:K, pTrxfus, pTrc99a, pET-S, pET-9,
pKK223-3, pKK233-3, pDR540 and pRITS available from Pharmacia. Among
preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl, pBK and
pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available
from Pharmacia. Other suitable vectors will be readily apparent to the skilled
artisan.
Among known bacterial promoters suitable for use in the present
invention include the E. coli lacI and lacZ promoters, the T3, T7 and SP6
phage
promoters, the gpt promoter, the lambda PR and PL promoters and the trp
promoter. Suitable eukaryotic promoters include the CMV immediate early
promoter, the HSV thymidine kinase promoter, the early and late SV40
promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma
virus (RS V), and metallothionein promoters, such as the mouse metallothionein-
I
promoter.
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAF-dextran mediated transfection, cationic
lipid-mediated transfection, electroporation, transduction, infection, nucleic
acid-
coated microproj ectile bombardment or other methods. Such methods are
described in many standard laboratory manuals, such as Davis et al., Basic
Methods In Molecular Biology (1986).
In some embodiments, the isolated polynucleotides of the present
invention may be operably linked to a regulatory genetic sequence, which may
be a homologous or a heterologous regulatory genetic sequence (such as an
enhancer, promoter or repressor), to form a genetic construct. Genetic
constructs
according to this aspect of the invention are intended to encompass not only
those
comprising a polynucleotide encoding a mature mammalian RAD 1 p polypeptide
CA 02268457 1999-04-19
-31-
(such as an HRADpI or an MRADIp p~olypeptide) operably linked to a
regulatory DNA sequence, but also those constructs comprising one or more
regulatory sequences operably linked to a mammalian RADl polynucleotide
fragment which does not encode a mammalian RADlp polypeptide, but which
contains a sufficient portion of the mammalian RADI nucleotide sequence (a
"targeting fragment") to target the genetic construct to the native mammalian
RADl locus upon introduction into a host cell wherein the mammalian RADl
gene may be inactive due to repression or nnutation. These constructs may be
inserted into a vector as above, and the vectors introduced into a host cell,
the
genome of which comprises the target gene;, by any of the methods described
above. The mammalian RADl polynucleotiide will then integrate into the host
cell genome by homologous recombination. :(n the case of a construct
comprising
a homologous or heterologous regulatory sequence linked to a targeting
mammalian RADI polynucleotide fragment, the regulatory sequence will be
targeted to the native mammalian RADI lochs in the host cell, and will amplify
or de-repress (if the regulatory sequence comprises, for example, a promoter
or
enhancer) or will inhibit or repress (if the regulatory sequence comprises,
for
example, a repressor or otherwise integrates into the native regulatory
sequence
to inhibit or repress (i.e., "knock out")) the expression of the native
mammalian
RAD1 gene in the host cell, thereby increasing or decreasing the level of
mammalian RADI gene expression. Alternatively, such gene targeting may be
carried out using genetic constructs comprising the above-described mammalian
RADl targeting fragment in the absence of a regulatory sequence; such an
approach may be used, for example, to correct or introduce point mutations in
the
mammalian RADI gene, for example for the purposes of enhancing or inhibiting
the activity of the RADI gene in the targeted mammalian cell (see Steeg, C.M.,
et al., Proc. Natl. Acad. Sci. USA 87(12):46'80-4684 (1990) for a description
of
the use of such approaches to correcting point mutations in other mammalian
genes). Such methods of producing genetic constructs, introducing genes of
interest into a host cell via homologous recombination and producing the
encoded
polypeptides are generally described in U.S. fatentNo. 5,578,461; WO 94/12650
(U.S. Application No. 07/985,586); WO 93/09222 (U.S. Application No.
CA 02268457 1999-04-19
-32-
07/911,535); and WO 90/14092 (U.S. Application No. 07/353,909), the
disclosures of which are expressly incorporated herein by reference in their
entireties.
Transcription of the DNA encoding the polypeptides of the present
invention by higher eukaryotes may be increased by inserting an enhancer
sequence into the vector. Enhancers are cis-acting elements of DNA, usually
from about 10 to 300 bp, that act to increase b~anscriptional activity of a
promoter
in a given host cell-type. Examples of enh;ancers include the SV40 enhancer,
which is located on the late side of the repliication origin at by 100 to 270,
the
cytomegalovirus early promoter enhancer, th.e polyoma enhancer on the late
side
of the replication origin, and adenovirus enha~ncers. In an alternative
embodiment
of the invention, transcriptional activation of the mammalian RA.DI gene may
be
enhanced by inserting one or more concat~unerized elements firom the native
human or mammalian RADl promoter into l:he vector.
For secretion of the translated polypeptide into the lumen of the
endoplasmic reticulum, into the periplasmaic space or into the extracellular
environment, appropriate secretion signals may be incorporated into the
expressed polypeptide. The signals may be; endogenous to the polypeptide or
they may be heterologous signals.
Depending upon the host employed in a recombinant production
procedure, the polypeptides of the present invention may be glycosylated or
may
be non-glycosylated. In addition, mammalian RADIp polypeptides of the
invention may also include an initial modified methionine residue, in some
cases
as a result of host-mediated processes.
The mammalian RADIp polypeptide, such as an HRADlp or an
MRADIp polypeptide, may be expressed in a modified form, such as a fusion
protein, and may include not only secrE;tion signals, but also additional
heterologous functional regions. For instance, a region of additional amino
acids,
particularly charged amino acids, may be; added to the N-terminus of the
polypeptide to improve stability and persistence in the host cell, during
purification, or during subsequent handling and storage. Also, peptide
moieties
may be added to the polypeptide to facilitate: purification. Such regions may
be
CA 02268457 1999-04-19
-33-
removed prior to final preparation of the polypeptide. The addition of peptide
moieties to polypeptides to engender secretion or excretion, to improve
stability
and to facilitate purification, among other purposes, is a familiar and
routine
technique in the art. A preferred fusion protean comprises a heterologous
region
from an immunoglobulin that is useful to solubilize proteins. For example,
EP 0 464 533 discloses fusion proteins comprising various portions of constant
(Fc) region of immunoglobulin molecules together with another human protein
or part thereof. In many cases, the Fc portion of a fusion protein is
thoroughly
advantageous for use in therapy and diagnosis and thus results, for example,
in
improved pharmacokinetic properties (EP 0 232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part after the
fusion
protein has been expressed, detected and purified in the advantageous manner
described. This is the case when the Fc portion proves to be a hindrance to
use
in therapy, diagnosis or further manufacturing, for example when the fusion
protein is to be used as an antigen for immunizations for the preparation of
antibodies.
The mammalian ItAD 1 p polype:pt:ide, such as an HRAD 1 p or an
MRADIp polypeptide, may be recovered and purified from recombinant cell
cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
lectin
chromatography, gel filtration, hydrophobic interaction chromatography,
affinity
chromatography and hydroxylapatite chromatography. Most preferably, high
performance liquid chromatography ("HPL(:") is employed for purification.
Mammalian 12AD1 Polypeptides and Fragments
The invention further provides isolatc;d mammalian 1RAD 1 polypeptides.
Polypeptides of the present invention include purified or isolated natural
products, products of chemical synthetic procedures, and products produced by
recombinant techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, insect, mammalian, avian and higher plant cells.
Examples of mammalian ItAD 1 p polypeptides provided by the invention include,
but are not limited to, isolated HRADlp polypeptides and isolated MRADIp
CA 02268457 1999-04-19
-34-
polypeptides. Isolated HRADlp polypeptides of the invention include
those having the amino acid sequence encoded by a polynucleotide having the
nucleotide sequence set forth in Figure 1 (SEQ ID NO:1 ), the complete amino
acid sequence in Figure 1 {SEQ ID N0:2), the complete amino acid sequence
encoded by a polynucleoti.de contained in the cDNA clone having GenBank
Accession Number AF 011905 and which was deposited on at
and has accession number , the amino acid sequence encoded by a
polynucleotide which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence as set forth in Figure 1 (SEQ ID
NO:1), or a peptide or polypeptide comprising a portion or a fragment of the
above polypeptides. Analogously, isolated MRAD lp polypeptides of the
invention include those having the amino acid sequence encoded by a
polynucleotide having the nucleotide sequence set forth in Figure 2 (SEQ ID
N0:4), the complete amino acid sequence in Figure 2 (SEQ ID N0:4), the
complete amino acid sequence encoded by a polynucleotide contained in the
cDNA clone having GenBank Accession Number AF 038841 and which was
deposited on at and has accession number , the amino
acid sequence encoded by a polynucleotide: which hybridizes under stringent
hybridization conditions to a polynucleotide having a nucleotide sequence as
set
forth in Figure 2 (SEQ ID N0:3), or a peptide or polypeptide comprising a
portion or a fragment of the above polypepti.des.
As used herein, the terms "peptide" and "oligopeptide" are considered
synonymous (as is commonly recognized) and each term can be used
interchangeably as the context requires to indicate a chain of at least two
amino
acids coupled by (a) peptidyl linkage(s). The term "polypeptide" is used
herein
to denote chains comprising nine or more amino acid residues, unless otherwise
defined in the specific contexts below. As is commonly recognized in the art,
all
oligopeptide and polypeptide formulas or sequences herein are written from
left
to right and in the direction from amino terminus to carboxy terminus.
It will be recognized by those of ordinary skill in the art that some amino
acid sequences of the mammalian RADlp p~olypeptides of the invention can be
varied without significant effect on the structure or function of the
polypeptides.
CA 02268457 1999-04-19
-35-
If such differences in sequence are contemplated, it should be remembered that
there will be critical areas on the protein which determine structure and
activity.
In general, it is possible to replace residues which form the tertiary
structure,
provided that residues performing a similar function are used. In other
instances,
the type of residue may be completely unimportant if the alteration occurs at
a
non-critical region of the polypeptide.
Thus, the invention further includes variants of the present mammalian
RADIp polypeptides, including allelic variants, which show substantial
mammalian RAD 1 p polypeptide structural homology or activity, or which
include regions of the mammalian RADIp polypeptides such as the portions
discussed below. Such mutants may include deletions, insertions, inversions,
repeats, and type substitutions (for example, substituting one hydrophilic
residue
for another, but not strongly hydrophilic for strongly hydrophobic as a rule).
Small changes or such "neutral" or "conservative" amino acid substitutions
will
generally have little effect on activity.
Typical conservative substitutions are the replacements, one for another,
among the aliphatic amino acids Ala, Val, Leu and Ile; interchange of the
hydroxylated residues Ser and Thr; exchange. of the acidic residues Asp and
Glu;
substitution between the arnidated residues Asn and Gln; exchange of the basic
residues Lys and Arg; and replacements amaong the aromatic residues Phe and
Tyr.
Thus, the fragment, derivative or ~uialog of the mammalian RADIp
polypeptide of the invention, such as the HRADlp polypeptide depicted in
Figure 1 (SEQ ID N0:2) ar that encoded by a polynucleotide having a nucleic
acid sequence as set forth in Figure 1 (SEQ ID NO:1 ), or such as the MRAD 1 p
polypeptide depicted in Figure 2 (SEQ ID N0:3) or that encoded by a
polynucleotide having a nucleic acid sequence as set forth in Figure 2 (SEQ ID
N0:3) may be (i) one in which one or more of the amino acid residues are
substituted with a conservative or non-conservative amino acid residue
(preferably a conservative amino acid residue), and such substituted amino
acid
residue may be encoded by the genetic code or may be an amino acid (e.g.,
desmosine, citrulline, ornithine, etc.) that is not encoded by the genetic
code; (ii)
CA 02268457 1999-04-19
-36-
one in which one or more of the amino acid residues includes a substituent
group
(e.g., a phosphate, hydroxyl, sulfate or other group) in addition to the
normal "R"
group of the amino acid; (iii) one in which the mature polypeptide is fused
with
another compound, such as a compound to increase the half life of the
polypeptide (for example, polyethylene glycol), or (iv) one in which
additional
amino acids are fused to the mature polypeptide, such as an immunoglobulin Fc
region peptide, a leader or secretory sequence:, a sequence which is employed
for
purification of the mature polypeptide (such as GST) or a proprotein sequence.
Such fragments, derivatives and analogs are intended to be encompassed by the
present invention, and are within the scope of those skilled in the art from
the
teachings herein and the state of the art at the time of invention.
The polypeptides of the present invention are preferably provided in an
isolated form, and preferably are substantially purified. Recombinantly
produced versions of the mammalian RAD 1 p polypeptides of the invention can
be substantially purified by the one-step metriod described in Smith and
Johnson,
Gene 67: 31-40 (1988). As used herein, the l:erm "substantially purified"
means
a preparation of an individual mammalian RADIp polypeptide wherein at least
50%, preferably at least 70%, and more preferably at least 80%, 85%, 90%, 91
%,
92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% (by mass) of contaminating
proteins (i. e. , those that are not the individual mammalian R.AD 1 p
polypeptide)
have been removed from the preparation.
The polypeptides of the present invention include those which are at least
about 65% identical, more preferably at least about 70%, at least about 75%,
at
least about 80%, at least about 85%, at least about 90%, at least about 95%,
at
least about 96%, at least about 97%, at least about 98% or at least about 99%
identical, to the above-described polypeptide;s. For example, preferred HRAD 1
p
polypeptides of the invention include those l;hat are at least about 65%
identical,
more preferably at least about 70%, at least about 75%, at least about 80%, at
least about 85%, at least about 90%, at lea~;t about 95%, at least about 96%,
at
least about 97%, at least about 98% or at least about 99% identical, to the
polypeptide encoded by a polynucleotide h~~ving a nucleic acid sequence as set
forth in Figure 1 (SEQ ID NO: l ), to the pol;,rpeptide having the complete
amino
CA 02268457 1999-04-19
-37-
acid sequence shown in Figure 1 (SEQ ID N0:2), to a polypeptide encoded by
a polynucleotide contained in the cDNA clone having GenBank Accession
Number AF 011905 and which was deposited on at and has
accession number , or to a polypeptide encoded by a polynucleotide
hybridizing under stringent conditions to a polynucleotide having the
nucleotide
sequence set forth in Figure 1 (SEQ ID NO:1 ). Analogously, preferred MRAD 1 p
polypeptides of the invention include those that are at least about 65%
identical,
more preferably at least about 70%, at least about 75%, at least about 80%, at
least about 85%, at least about 90%, at least about 95%, at least about 96%,
at
least about 97%, at least about 98% or at least about 99% identical, to the
polypeptide encoded by a polynucleotide having a nucleic acid sequence as set
forth in Figure 2 (SEQ ID N0:3), to the polypeptide having the complete amino
acid sequence shown in Figure 2 (SEQ ID T10:4), to a polypeptide encoded by
a polynucleotide contained in the cDNA clone having GenBank Accession
Number AF 038841 and which was deposited on at and has
accession number , or to a polypeptide encoded by a polynucleotide
hybridizing under stringent conditions to a polynucleotide having the
nucleotide
sequence set forth in Figure 2 (SEQ ID N0:4). The present polypeptides also
include portions or fragments of the above-described polypeptides with at
least
30 amino acids and more preferably at least SO amino acids.
By a polypeptide having an amino acid sequence at least, for example,
65% "identical" to a reference amino acidl sequence of a given mammalian
RADIp polypeptide is intended that the amino acid sequence ofthe polypeptide
is identical to the reference sequence except. that the polypeptide sequence
may
include up to 3 S amino acid alterations per e~ich 100 amino acids of the
reference
amino acid sequence of the mammalian RAIDlp polypeptide. In other words, to
obtain a polypeptide having an amino acid ;sequence at least 65% identical to
a
reference amino acid sequence, up to 35%. of the amino acid residues in the
reference sequence may be deleted or substituted with another amino acid, or a
number of amino acids up to 3 S % of the total amino acid residues in the
reference
sequence may be inserted into the reference: sequence. These alterations of
the
reference sequence may occur at the amino (N-) or carboxy (C-) terminal
CA 02268457 1999-04-19
-38-
positions of the reference amino acid sequence or anywhere between those
terminal positions, interspersed either individually among residues in the
reference sequence or in one or more contiguous groups within the reference
sequence. As a practical matter, whether a ,given amino acid sequence is, for
example, at least 65% identical to the amino acid sequence of a mammalian
RADIp polypeptide of the invention can bE; determined conventionally using
known computer programs such as those described above for nucleic acid
sequence identity determinations, or more yreferably using the CLUSTAL W
program (Thompson, J.D., et al.) Nucleic A~:ids Res. 22:4673-4680 (1994)) as
described in detail below in the Examples.
The polypeptides of the present invention can be used as molecular weight
markers on SDS-PAGE gels or on molecular sieve gel filtration columns using
methods well known to those of skill in the art. In addition, as described in
detail
below, the polypeptides of the present invention can be used to raise
polyclonal
and monoclonal antibodies which are useful in diagnostic assays for detecting
mammalian RADlp protein expression, as antagonists capable of inhibiting
mammalian RAD 1 p protein function or for the isolation of a mammalian RAD 1 p
polypeptide.
In another aspect, the present invention provides a peptide or polypeptide
comprising an epitope-bearing portion of a ~polypeptide of the invention,
which
may be used to raise antibodies, particularly monoclonal antibodies, that bind
specifically to a mammalian RADIp polypeptide of the invention. The epitope
of this polypeptide portion is an immun.ogenic or antigenic epitope of a
polypeptide of the invention. An "immuno~;enic epitope" is defined as a part
of
a protein that elicits an antibody response when the whole protein is the
immunogen. These immunogenic epitopes are believed to be confined to a few
loci on the molecule. On the other hand, a region of a protein molecule to
which
an antibody can bind is defined as an "mtigenic epitope." The number of
immunogenic epitopes of a protein generally is less than the number of
antigenic
epitopes (see, e.g., Geysen et al., Proc. Nztl. Acad. Sci. USA 81:3998- 4002
(1983)).
CA 02268457 1999-04-19
-39-
As to the selection of peptides or polypeptides bearing an antigenic
epitope (i. e., that contain a region of a protein molecule to which an
antibody can
bind), it is well-known in that art that relatively short synthetic peptides
that
mimic part of a protein sequence are routinelly capable of eliciting an
antiserum
S that reacts with the partially mimicked protE;in (see, e.g., Sutcliffe,
J.G., et al.,
Science 219: 660-666 (1983)). Peptides capalble of eliciting protein-reactive
sera
are frequently represented in the primar~r sequence of a protein, can be
characterized by a set of simple chemical rules, and are not confined to the
immunodominant regions of intact proteins (i. e. , immunogenic epitopes) or to
the
amino or carboxy termini. Peptides that are extremely hydrophobic and those of
six or fewer residues generally are ineffective at inducing antibodies that
bind to
the mimicked protein; longer peptides, especially those containing proline
residues, usually are effective (Sutcliffe, ,T.G., et al., Science 219:660-666
(1983)).
Epitope-bearing peptides and polypeptides of the invention designed
according to the above guidelines preferably contain a sequence of at least
seven,
more preferably at least nine and most preferably between about 15 to about 30
amino acids contained within the amino acid sequence of a polypeptide of the
invention. However, peptides or polypeptides comprising a larger portion of an
amino acid sequence of a polypeptide of the invention, containing about 30 to
about 50 amino acids, or any length up to and including the entire amino acid
sequence of a polypeptide of the invention, also are considered epitope-
bearing
peptides or polypeptides of the invention and also are useful for inducing
antibodies that react with the mimicked protein. Preferably, the amino acid
sequence of the epitope-bearing peptide is selected to provide substantial
solubility in aqueous solvents (i.e., the sequence includes relatively
hydrophilic
residues and highly hydrophobic sequences are preferably avoided); sequences
containing proline residues are particularly preferred.
Non-limiting examples of epitope-bearing polypeptides or peptides that
can be used to generate mammalian RADIp-specific antibodies include certain
epitope-bearing regions of the HRADlp polypeptide depicted in Figure 1 (SEQ
ID N0:2) and the MRADIp polypeptide depicted in Figure 2 (SEQ ID N0:4).
CA 02268457 1999-04-19
-40-
Preferred such epitope-bearing regions of HP;ADlp include without limitation a
polypeptide having an amino acid sequence c;onsisting essentially of amino
acid
residues from about 77 to about 86 in Figure 1 (SEQ ID N0:2), a polypeptide
having an amino acid sequence consisting essentially of amino acid residues
from
about 89 to about 97 in Figure 1 (SEQ ID NO:2), a polypeptide having an amino
acid sequence consisting essentially of amino acid residues from about 112 to
about 128 in Figure 1 (SEQ ID N0:2), a polypeptide having an amino acid
sequence consisting essentially of amino acid residues from about 159 to about
177 in Figure 1 (SEQ ID N0:2), and a polypeptide having an amino acid
sequence consisting essentially of amino acid residues from about 227 to about
257 in Figure 1 (SEQ ID N0:2). Analogously, preferred such epitope-bearing
regions of MRADIp include without limitation a polypeptide having an amino
acid sequence consisting essentially of amino acid residues fiom about 77 to
about 86 in Figure 2 (SEQ ID N0:4), a polypeptide having an amino acid
sequence consisting essentially of amino acid residues from about 89 to about
97
in Figure 2 (SEQ ID N0:4), a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 112 to about 128 in
Figure 2 (SEQ ID N0:4), a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 159 to about 177 in
Figure 2 (SEQ ID N0:4), and a polypeptide having an amino acid sequence
consisting essentially of amino acid residues from about 227 to about 257 in
Figure 2 (SEQ ID N0:4). Other epitope-bearing polypeptides or peptides that
may be used to generate mammalian RADlp-specific antibodies will be apparent
to one of ordinary skill in the art based on the primary amino acid sequence
of the
HRADIp and MRADIp polypeptides set forth in SEQ ID N0:2 and SEQ ID
N0:4, respectively, via the construction of Kyte-Doolittle hydrophilicity and
Jameson-Wolf antigenic index plots of the HRADIp and/or MRADIp
polypeptides using, for example, PROTEAN computer software (DNASTAR,
Inc.; Madison, Wisconsin).
The epitope-bearing peptides and polypeptides of the invention may be
produced by any conventional means for making peptides or polypeptides
including recombinant means using nucleic acid molecules of the invention. For
CA 02268457 1999-04-19
-41-
instance, a short epitope-bearing amino acid sequence may be fused to a larger
polypeptide which acts as a carrier during recombinant production and
purification, as well as during immunization to produce anti-peptide
antibodies.
Epitope-bearing peptides also may be synl:hesized using known methods of
chemical synthesis (see, e.g., U.S. Patent No. 4,631,211; Houghten, R. A.,
Proc.
Natl. Acad. Sci. USA 82:5131-5135 (1985)).
As one of skill in the art will appreciate, mammalian RAD 1 p polypeptides
of the present invention and epitope-bearing fragments thereof may be
immobilized onto a solid support, by techniques that are well-known and
routine
in the art. By "solid support" is intended any solid support to which a
peptide can
be immobilized. Such solid supports include, but are not limited to
nitrocellulose, diazocellulose, glass, polystyrene, polyvinylchloride,
polypropylene, polyethylene, dextran, Seph~~rose, agar, starch, nylon, beads
and
microtitre plates. Linkage of the peptide of the invention to a solid support
can
be accomplished by attaching one or both ends of the peptide to the support.
Attachment may also be made at one or more internal sites in the peptide.
Multiple attachments (both internal and at tile ends of the peptide) may also
be
used according to the invention. Attachment can be via an amino acid linkage
group such as a primary amino group, a carboxyl group, or a sulfhydryl (SH)
group or by chemical linkage groups such as with cyanogen bromide (CNBr)
linkage through a spacer. For non-covalent .attachments to the support,
addition
of an affinity tag sequence to the peptide carp be used such as GST (Smith,
D.B.,
and Johnson, K.S., Gene 67:31 (1988)), polyhistidines (Hochuli, E., et al., J.
Chromatog. 411:77 (1987)), or biotin. Such affinity tags may be used for the
reversible attachment of the peptide to the support. Such immobilized
polypeptides or fragments may be useful, for example, in isolating antibodies
directed against a mammalian RADIp polypeptide, such as an HRADlp or an
MRADIp polypeptide, as described below.
As one of skill in the art will also appreciate, mammalian RADIp
polypeptides of the present invention and the epitope-bearing fragments
thereof
described above can be combined with parts of the constant domain of
immunoglobulins (Ig), resulting in chimeric or fusion polypeptides. These
fusion
CA 02268457 1999-04-19
-42-
polypeptides facilitate purification and show an increased half life in vivo
(EP 0 394 827; Traunecker et al., Nature 331:84- 86 (1988)).
Mammalian RAD1 Antibodies
Epitope-bearing peptides and mammalian RADlp polypeptides of the
invention may be used to produce antibodies directed against one or more
mammalian RADlp polypeptides, such as HRADIp and/or MItADlp
polypeptides, according to methods well-laiown in the art. See, for instance,
Sutcliffe, J.G., et al., Science 219:660-666 (1983); Wilson et al., Cell 37:
767
(1984); and Bittle, F.J., et al., J. Gen. Virol, 66:2347-2354 (1985).
Antibodies
specific for a mammalian IRADlp polypeptide can be raised against the intact
mammalian 1RAD 1 p polypeptide or one or more antigenic polypeptide fragments
thereof, such as the epitope-bearing fragments of mammalian IRADIp
polypeptides described above. These polypeptides or fragments may be
presented together with a carrier protein (e.g. , albumin) to an animal system
(such
as rabbit or mouse) or, if they are long enough (at least about 25 amino
acids),
without a Garner.
As used herein, the term "antibody" (Ab) may be used interchangeably
with the terms "polyclonal antibody" or "monoclonal antibody" (mAb), except
in specific contexts as described below. These terms, as used herein, are
meant
to include intact molecules as well as antibody fragments (such as, for
example,
Fab and F(ab')2 fragments) which are capable of specifically binding to a
mammalian IZADIp polypeptide (such as an HRADlp or an MIZADlp
polypeptide) or a portion thereof. Fab and F( ab')2 fragments lack the Fc
fragment
of intact antibody, clear more rapidly from the circulation, and may have less
non-specific tissue binding than an intact antibody (Wahl et al., J. Nucl.
Med.
24:316-325 (1983)).
The antibodies of the present invention may be polyclonal or monoclonal,
and may be prepared by any of a variety of methods. For example, polyclonal
antibodies may be made by immunizing a~n animal with one or more of the
mammalian ltADlp polypeptides or portions thereof (including one or more
epitope-bearing fragments) of the invention according to standard techniques
CA 02268457 1999-04-19
-43-
(see, e.g., Harlow, E., and Lane, D., Antibodies: A Laboratory Manual, Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press (1988); Kaufman,
P.B., et al., In: Handbook of Molecular ana! Cellular Methods in Biology and
Medicine, Boca Raton, Florida: CRC Press, pp. 468-469 (1995)). In the most
preferred method, the antibodies of the yresent invention are monoclonal
antibodies (or mammalian RAD 1 p polypeptide-binding fragments thereof). Such
monoclonal antibodies can be prepared using hybridoma technology that is well-
known in the art (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
Immunol. 6:511 (1976); Kbhler et al., .Eur. J. Immunol. 6:292 (1976);
Hammerling et al., In: Monoclonal Antibodies and T Cell Hybridomas, New
York: Elsevier, pp. 563-681 (1981); Kaufnnan, P.B., et al., In: Handbook of
Molecular and Cellular Methods in Biology ~xnd Medicine, Boca Raton, Florida:
CRC Press, pp. 444-467 (1995)).
Alternatively, antibodies capable of binding to one or more mammalian
RADIp polypeptides or fragments thereof' may be produced in a two-step
procedure through the use of anti-idiotypic antibodies. Such a method makes
use
of the fact that antibodies are themselves antigens, and that, therefore, it
is
possible to obtain an antibody which binds to a second antibody. In accordance
with this method, mammalian RADlp polyheptide-specific antibodies are used
to immunize an animal, preferably a mouse. The splenocytes of such an animal
are then used to produce hybridoma cells, and the hybridoma cells are screened
to identify clones which produce an antibody whose ability to bind to the
polypeptide-specific antibody can be blocked by the mammalian RADIp
polypeptide antigen. Such antibodies comprise anti-idiotypic antibodies to the
mammalian RAD 1 p polypeptide-specific antibody and can be used to immunize
an animal to induce formation of further mammalian RAD 1 p polypeptide-
specific
antibodies.
In another preferred embodiment of the invention, the present antibodies
may be prepared as chimeric antibodies. According to the invention, such
chimeric antibodies may comprise an antigen-binding domain (i.e., the region
of
the antibody binding to a mammalian RADI.p polypeptide, such as an HR.ADlp
or an MRADIp polypeptide) from a first species and one or more constant
CA 02268457 1999-04-19
-44-
regions from a second species. See U.S. Patent No. 4,816,567, which is
directed
to methods for the preparation of chimeric antibodies, the disclosure of which
is
incorporated herein by reference in its entirety.
It will be appreciated that Fab, FI ab')z and other fragments of the
antibodies of the present invention may b~e used according to the methods
disclosed herein. Such fragments are typically produced by proteolytic
cleavage,
using enzymes such as papain (to produce Fab fragments) or pepsin (to produce
F(ab')2 fragments). Alternatively, mamm~~lian RADlp polypeptide-binding
fragments can be produced through the application of recombinant DNA
technology or through synthetic chemistry.
The antibodies of the present invention may be detectably labeled, most
preferably with an enzyme, radioisotopic, non-radioactive isotopic,
fluorescent,
toxin, chemiluminescent or nuclear magnetiic resonance (NMR) contrast agent
label. Suitable examples of each of these types of labels are well-known to
one
of ordinary skill in the art. Typical techniques for binding a label to an
antibody
are provided, for example, by Kennedy et al'. , Cl in. Ch im. Acta 70:1-31 (
1976),
and Schuss et al., Clin. Chim. Acta 81:1-40 (1977), all of which methods are
incorporated by reference herein.
In an additional preferred embodim~snt of the invention, the antibodies
produced as described above may be covalently or non-covalently immobilized
onto a solid support. By "solid support" is intended any solid support to
which
an antibody can be immobilized, including but not limited to nitrocellulose,
diazocellulose, glass, polystyrene, polyvinylchloride, polypropylene,
polyethylene, dextran, Sepharose, agar, staxch, nylon, beads (including glass,
latex, magnetic (including paramagnetic and superparamagnetic) beads) and
microtitre plates. Linkage of the antibodies o~f the invention to a solid
support can
be accomplished by attaching one or more ends of the antibody to the support.
Attachment may also be made at one or snore internal sites in the antibody.
Multiple attachments (both internal and at the ends of the antibody) may also
be
used according to the invention. Attachment can be via an amino acid linkage
group such as a primary amino group, a c~crboxyl group, or a sulfhydryl (SH)
group, by chemical linkage groups such ~~s with cyanogen bromide (CNBr)
CA 02268457 1999-04-19
-45-
linkage through a spacer, or by attachment vi a glycosylations in the Fc
region of
the antibody using hydrazine beads (available; commercially, e.g., from Bio-
Rad,
Hercules, California). For non-covalent attachments to the support, addition
of
an affinity tag sequence to the antibody can be used such as GST (Smith, D.B.,
and Johnson, K.S. Gene 67:31 (1988)); polyhistidines (Hochuli, E. et al., J.
Chromatog. 411:77 ( 1987)); or biotin. Alternatively, an indirect coupling
agent
such as Protein A or Protein G (available; commercially, e.g., from Sigma
Chemical Co., St. Louis, Missouri) which binds to the Fc region of antibodies
may be attached to the solid support and the .antibodies of the invention
attached
thereto by simply incubating the antibodies with the solid support containing
the
immobilized Protein A or Protein G. Such affinity tags may be also used for
the
reversible attachment of the antibodies of th.e present invention to the
support.
Transgenic Animals
The present invention is also directed to transgenic animals comprising
one or more of the above-described mammalian RADI nucleic acid molecules.
Preferred such transgenic animals may be nnice comprising one or more of the
above-described HRADI or~MRADl isolated nucleic acid molecules, or altered
HRADI orMRADl genes that include mutations rendering the genes functionally
inactive. Particularly preferred are those tranagenic animals comprising
mutants,
derivatives or variants of HRADI or MRf(Dl nucleic acid molecules which
comprise deletion of one or more nucleotides from, or insertion or
substitution
of one or more nucleotides into, the corresponding wildtype HRADI or MRADI
gene such as those having the nucleotide sequences set forth in SEQ ID NO:1 or
SEQ ID N0:3, respectively.
Transgenic animals comprising the nucleic acid molecules of the
invention may be produced according to methods that are well-known in the art
and that will be familiar to the skilled artisan (see, e.g., WO 90/05188;
Hammer,
R.E., et al., J. Animal Sci. 63:269-278 (1986); Pursel, V.G., et al., J.
Reprod.
Fert. Suppl. 40:235-245 (1995); Houdebine, L.-M., J. Biotechnol. 34:269-287
(1994); Hammer, R.E., et al., Nature 315:680-683 (1985); Mortensen, R.M., et
al., Mol. Cell. Biol. 13:2391-2395 (1992);. Deng, C., et al. , Cell 82:675-684
CA 02268457 1999-04-19
-46-
(1995); and Murakami, T., et al., Devel. Gen. 10:393-401 (1989), the
disclosures
of all of which are incorporated herein by reference in their entireties). In
particular, transgenic animals and cell lines comprising the nucleic acid
molecules of the invention may be producE;d as described in detail below in
Examples 4 and 5.
Uses
The isolated mammalian RADl nucleic acid molecules, polypeptides and
antibodies of the invention are useful in a variety of methods, for example in
industrial, clinical and research settings. Included among these uses are the
use
of the present nucleic acid molecules or antibodies in the detection of
mammalian
RADl expression or production by isolated calls or tissues, or by cells and
tissues
in an animal, for example for use in certain diagnostic assays as detailed
below.
In addition, the nucleic acid molecules, antisense oligonucleotides and
ribozymes
of the invention may be used in therapeutic methods for treating an individual
that is predisposed to or suffering from a disorder (such as a cancer)
characterized
by increased sensitivity to DNA-damaging agents. Analogously, the present
nucleic acid molecules, antisense oligonuclc;otides and ribozymes may be used
in methods of inducing sensitivity to DNA-damaging agents in cells or tissues
(for example cancer cells or tumors) that are; relatively resistant to such
agents.
Diagnostic and Prognostic Uses
The present invention also provides methods of determining the
sensitivity of a cell, tissue or animal to the effects of DNA-damaging agents.
As
used herein, a "DNA-damaging agent" nneans any physical, biological or
chemical composition or force that acts to alter the structure (reversibly or
irreversibly) of one or more DNA molecules in a cell, tissue or animal upon
which the agent acts. Such DNA-damaging agents may include, for example,
chemicals (including carcinogens, teratogens, mutagens or the like), radiation
(including ionizing radiation (e.g., 'y- or X-radiation) and non-ionizing
radiation
such as photoradiation (e.g., ultraviolet (UV) radiation) or electromagnetic
radiation (e.g., microwave, radio or electromagnetic field radiation)), and
other
CA 02268457 1999-04-19
-47-
agents which cause damage to DNA. Such damage may be in any form which
causes the structure of the DNA molecule to be altered from its normal or
wildtype state in the untreated cell, tissue or animal, including without
limitation
inducing cross-linking of adj acent or juxtaposed nucleotide bases (e.g.,
thymidine
dimerization), inducing breaks in the sugar-phosphate backbone, or inducing
nucleotide tautomerization or isomerization.
It is believed that certain tissues in animals (particularly mammals) that
are sensitive to DNA-damaging agents (e~.g., an animal suffering from or
predisposed to a cancer) express significantly decreased levels of functional
mammalian RADIp protein and/or mRNA encoding a RADIp protein when
compared to a corresponding "standard" animal, i.e., an animal of the same
species that is less sensitive to DNA-damaging agents. Further, it is believed
that
decreased levels of the RAD 1 protein can he detected in certain tissues,
cells
and/or body fluids (e.g., sera, plasma, urine, and spinal fluid) from animals
that
are sensitive to DNA-damaging agents, when compared to samples from animals
of the same species that are less sensitive to such agents. Thus, the
invention
provides methods useful during diagnosis of the sensitivity of an animal to a
DNA-damaging agent, which involve assaying the expression level of the gene
encoding a mammalian RADlp protein in tissues, cells or body fluid from the
animal and comparing this gene expression level with a standard mammalian
RADl gene expression level, whereby a dii~erence (particularly a decrease) in
RADl gene expression level compared to that of the standard is indicative of
increased sensitivity to a DNA-damaging agent. Such methods for diagnosing
the sensitivity of a human preferably involve assaying the level of expression
of
an HRADl gene in the human. Analogously, such methods for diagnosing the
sensitivity of a mouse preferably involve assaying the level of expression of
an
MRADl gene in the mouse.
Methods according to this aspect of the invention may comprise one or
more steps. For example, one such method of the invention may comprise:
(a) obtaining a first biological saanple from a first animal to be tested
for its sensitivity to a DNA-damaging agent and a second biological sample
from
a second animal of known sensitivity to the DNA-damaging agent;
CA 02268457 1999-04-19
-48-
(b) determining the level of expression of a mammalian RADI gene
in the first and second biological samples; and
(c) comparing the level of mammalian RADl gene expression in the
first biological sample to the level of mammalian RADI gene expression in the
second biological sample, wherein a difference, particularly a decrease, in
the
level of mammalian RADI gene expression in the first biological sample
relative
to that of the second biological sample indicsates a higher level of
sensitivity to
a DNA-damaging agent in the first animal rc;lative to that of the second
animal.
Another such method of the invention may comprise:
(a) obtaining a first biological sample from a first animal to be tested
for its sensitivity to a DNA-damaging agent and a second biological sample
from
a second animal of known sensitivity to the DNA-damaging agent;
(b) determining the level or activity of a mammalian RADlp
polypeptide in the first and second biological samples; and
(c) comparing the level or activity of a mammalian RADlp
polypeptide in the first biological sample to the level or activity of a
mammalian
RADIp polypeptide in the second biologiical sample, wherein a difference,
particularly a decrease, in the level or activity of a mammalian RADlp
polypeptide in the first biological sample relative to that of the second
biological
sample indicates a higher level of sensitivity to a DNA-damaging agent in the
first animal relative to that of the second animal.
In practice, since the sensitivity of the first animal to a DNA-damaging
agent may be estimated by determining the level of mammalian RAD1 gene
expression, or the level or activity of mammalian RAD lp polypeptide, in the
first
biological sample relative to that in a second biological sample from a second
animal of known sensitivity, the second biological sample thus serves as a
control
(positive or negative) in the present diagnostic methods. In some assays, it
may
be preferable to use two or more such control samples obtained from animals of
varying sensitivities to a DNA-damaging agent to establish a "standard curve"
of
sensitivity versus mammalian RADI gene expression; this standard curve may
then be used to interpolate or extrapolate thc; sensitivity of the first
animal to the
CA 02268457 1999-04-19
-49-
DNA-damaging agent by plotting the mammalian RADI gene expression level
in the first biological sample on the standard curve.
Where a diagnosis has already been made according to conventional
methods, the present invention is useful ass a prognostic indicator, whereby
animals exhibiting decreased mammalian h'ADI gene expression or decreased
levels or activity of mammalian RADIp polypeptide will experience a worse
clinical outcome relative to animals expressing the gene at a higher level.
By "determining the level of expression of a mammalian RADI gene" is
intended qualitatively or quantitatively measuring or estimating the level of
the
mammalian RADIp polypeptide (such s~s an HRADlp or an MRADlp
polypeptide) or the level of the mRNA encoding the mammalian RADIp
polypeptide in a first biological sample either directly (e.g., by determining
or
estimating absolute protein level or mRNA level) or relatively (e.g., by
comparing to the RAD 1 p polypeptide level o~r mRNA level in a second
biological
sample). Analogously, by "determining the level or activity of a mammalian
RAD 1 p polypeptide" is intended qualitatively or quantitatively measuring or
estimating the amount or biological activity of the mammalian RADlp
polypeptide (such as an HRADlp or an MRADIp polypeptide), in a first
biological sample either directly (e.g., by determining or estimating absolute
protein level or mRNA level) or relatively (e.g. , by comparing to the RAD 1 p
polypeptide level or mRNA level in a second biological sample).
Biological samples assayable accordling to these methods may be derived
from any animal, preferably a mammal such as a human, ape, monkey, rat or
mouse, and most preferably a human, and lnay comprise cells, tissues, organs
or
bodily fluids, or extracts thereof. The first and second biological samples
may,
but need not necessarily, be derived from two individuals of the same species.
In an alternative embodiment of the invention, the first and second biological
samples may be derived from the same individual. Cells that are preferably
used
in these methods include primary cells derived from tissue biopsies or other
means of obtaining primary cells from the animal, particularly epithelial
cells,
connective tissue cells (e.g., fibroblasts or adipose cells), neuronal cells,
endothelial cells, leukocytes, germ cells (oocytes or spermatocytes), bone
cells
CA 02268457 1999-04-19
-50-
(osteocytes, osteoblasts or osteoclasts), .cartilage cells (chondrocytes or
chondroblasts), stromal cells of the bone marrow, and other cell types that
may
express a mammalian RADI gene. Tissues useful in the present methods include,
but are not limited to, ovarian, prostate, heart, placenta, pancreas, liver,
spleen,
lung, breast, neuronal, epithelial, bone marrow and umbilical tissues.
Mammalian body fluids that may be assayed according to the present methods
include sera, plasma, urine, synovial fluid and spinal fluid. Methods for
obtaining tissue biopsies, cell suspensions and body fluids from mammals are
well known in the art. Where the biological sample is to include mRNA, a
tissue
biopsy is the preferred source.
To determine the level of mammalian RADl gene expression in a
biological sample by measuring RADI mRN.A, it is preferable to first isolate
total
RNA from the sample. Total RNA can be isolated from a biological sample
using any suitable technique such as the single-step guanidinium-thiocyanate-
phenol-chloroform method described in Chomczynski and Sacchi, Anal.
Biochem. 162:156-159 (1987). Levels of mRNA encoding the mammalian
RAD 1 protein are then assayed using any appropriate method. These include
northern blot analysis, S 1 nuclease mapping, the polymerase chain reaction
(PCR), reverse transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in comb ination with the ligase chain
reaction
(RT-LCR).
Northern blot analysis can be performed as described in Harada et al.,
Cell 63:303-312 ( 1990). Briefly, total RNA is prepared from a biological
sample
as described above. For the northern blot, the; RNA is denatured in an
appropriate
buffer (such as glyoxaUdimethyl sulfoxide/sodium phosphate buffer), subj ected
to agarose gel electrophoresis, and transferred onto either a nitrocellulose
filter
or a nylon membrane. After the RNAs have been linked to the nitrocellulose
filter by baking the filter in vacuo, or to the nylon membrane using a UV
crosslinker, the filter is prehybridized in a solution containing formamide,
SSC,
Denhardt's solution, denatured salmon sperni, SDS, and sodium phosphate
buffer.
Mammalian RADIp polypeptide-encoding nucleic acid molecules or cDNAs,
such as those of the invention prepared as described above, may be labeled
CA 02268457 1999-04-19
-$1-
according to any appropriate method (such as the 32P-multiprimed DNA labeling
system (Amersham)) and used as hybridization probes. Preferred such probes are
at least 10-1$ basepairs in length. After hybridization overnight, the filter
is
washed and exposed to x-ray film.
$ S1 mapping can be performed as described in Fujita et al., Cell 49:3$7-
367 ( 1987). To prepare probe DNA for use in S 1 mapping, the sense strand of
the above-described mammalian RADl cD:~IA may be used as a template to
synthesize labeled RADI antisense DNA, lby methods known in the art and
described in more detail below. The RADl antisense DNA can then be digested
using an appropriate restriction endonucleasc; to generate further DNA probes
of
a desired length. Such antisense probes are useful for visualizing protected
bands
corresponding to the target mRNA (i. e., mRNA encoding a mammalian RAD 1 p
polypeptide). Northern blot analysis can be performed as described above.
Alternatively, levels of mRNA encoding a mammalian RAD 1 protein may
be assayed using the RT-PCR method described in Makino et al.,
Technique 2:29$-301 (1990). By this method, the radioactivities of the
"amplicons" in the polyacrylamide gel bands are linearly related to the
initial
concentration of the taxget mRNA. Briefly, this method involves adding total
RNA isolated from a biological sample in a reaction mixture containing a RT
primer and appropriate buffer. After incubating for primer annealing, the
mixture
can be supplemented with a RT buffer, dNTP s, DTT, RNa.se inhibitor and
reverse
transcriptase. After incubation to achieve reverse transcription of the RNA,
the
RT products are then subj ect to PCR using labeled primers. Alternatively,
rather
than labeling the primers, a labeled dNTP can be included in the PCR reaction
mixture. PCR amplification can be performed in a DNA thermal cycler
according to conventional techniques. After a suitable number of rounds to
achieve amplification, the PCR reaction mixture is electrophoresed on an
agarose
gel. After drying the gel, the radioactivity of the appropriate bands
(corresponding to the mRNA encoding a mammalian RADlp polypeptide) is
quantified using an imaging analyzer. RT' and PCR reaction ingredients and
conditions, reagent and gel concentrations, and labeling methods are well
known
-52-
in the art. Variations on the RT-PCR method will be apparent to the skilled
artisan.
Any set of oligonucleotide primers which will amplify reverse-transcribed
target mRNA can be used and can be designed as described in the Examples
below.
Assaying mammalian RADIp polypeptide levels in a biological sample
can occur using any art-known method. Preferred for assaying mammalian
RADIp polypeptide levels in a biological sample are antibody-based techniques.
For example, RADIp polypeptide expression in tissues, cells or body fluids can
be studied with classical immunohistological or immunocytological methods. In
these, specific recognition is provided by a primary antibody (polyclonal or
monoclonal) but a secondary detection system can utilize fluorescent, enzyme,
or other conjugated secondary antibodies. As a result, an immunohistological
or
immunocytological staining of the tissue section or cell suspension for
pathological examination is obtained. Tissues and cells can also be extracted,
e.g. , with urea and neutral detergent, for the liberation of mammalian RAD 1
p
polypeptide for western blot or dot/slot assay (Jalkanen, M., et al., J. Cell
Biol.
101:976-985 (1985); Jalkanen, M., et al., J. Cell Biol. 105:3087-3096 (1987)).
In this technique, which is based on the use of cationic or anionic solid
phases,
quantitation of mammalian RAD 1 p polypeptide can be accomplished using
isolated RADlp polypeptide or fragments thereof obtained according to the
present invention as a standard. This technique can also be applied to body
fluids. With these samples, a molar concentration of mammalian RADlp
polypeptide will aid to set standard values of RADIp polypeptide content for
different body fluids, like serum, plasma, urine, spinal fluid, etc. The
normal
appearance of RAD lp polypeptide amounts can be set using values from healthy
individuals (e.g., those individuals that are less sensitive to DNA-damaging
agents), which can then be compared to those obtained from a test subj ect.
Other antibody-based methods useful for detecting mammalian RADI
gene expression include immunoassays, such as ELISA and RIA as will be
familiar to one of ordinary skill. For example, a mammalian RADlp
polypeptide-specific antibody, such as that obtained by the methods of the
present
CA 02268457 1999-04-19
-53-
invention, can be used both as an immunoadsorbent and as an enzyme-labeled
proba to detect and quantify the RADIp polypeptide. The amount of RADIp
polypeptide present in the sample can be calculated by reference to the amount
present in a standard preparation using a linear regression computer
algorithm.
Such an ELISA for detecting a tumor antigen is described in Iacobelli et al.,
Breast Cancer Research and Treatment 11:19-30 (1988). In another ELISA
assay, two distinct specific monoclonal antibodies can be used to detect
mammalian RADlp polypeptide in a tissue, cell, body fluid or extract thereof,
in
a modification of the "sandwich" assay described above. In this assay, one of
the
antibodies is used ass the immunoadsorbent and the other as the enzyme-labeled
probe.
The above techniques may be conducted essentially as "one-step" or
"two-step" assays. A "one-step" assay involves contacting a mammalian RAD 1 p
polypeptide with immobilized antibody and, without washing, contacting the
mixture with the labeled antibody. A "two-step" assay involves washing before
contacting the mixture with the labeled anti body. Other conventional methods
may also be employed as suitable. It is usually desirable to immobilize one
component of the assay system on a support, thereby allowing other components
of the system to be brought into contact with the component and readily
removed
from the sample.
These methods of the invention are pairticularly useful in several
diagnostic applications. For example, such methods may be used to identify an
individual animal, particularly a maunmal such as a human, that is at risk of
or
predisposed to developing a disorder, such as a cancer, that is characterized
by
increased sensitivity of the cells of the inClividual to a DNA-damaging agent
relative to cells of an individual that is not so predisposed to or at risk of
developing the disorder. In addition, the pre;;ent methods may be used to
identify
an individual, particularly a maunmal suclh as a human, that is sensitive to
radiation such ass those ionizing and non-ioni:;ing radiation types described
above.
Use of these methods of the invention to diagnose the sensitivity of such
individuals to DNA-damaging agents or radiation may be useful in the clinical
setting, for example, to identify individuals at a higher risk of developing
cancer
CA 02268457 1999-04-19
-54-
than individuals in the general population. These methods may also dictate the
choice of therapy in such individuals; for example, the use of radiation or
chemotherapy protocols, which would leadl to increased side effects in such
individuals due to their sensitivity to DNA-damaging agents, might be
discouraged in such individuals. The pre.:ent diagnostic methods may also
facilitate therapeutic approaches, such as those described below, to
preventing the
development, or delaying the onset, of the above-described disorders in such
individuals.
Therapeutic Uses
The isolated nucleic acid molecules and polypeptides of the invention
may also be used therapeutically, for example; in treating or preventing a
disorder,
characterized by increased sensitivity to a DANA-damaging agent, in an animal,
particularly a mammal such as a human or mouse, predisposed thereto or
suffering therefrom. In such approaches, the goal of the therapy is to delay
or
prevent the development of the disorder, and/or to cure or induce a remission
of
the disorder, and/or to decrease or minimize the side effects of other
therapeutic
regimens.
Methods according to this aspect of the invention may comprise one or
more steps which allow the clinician to achieve the above-described
therapeutic
goals. A preferred such method may comprise:
(a) obtaining a first biological sample from a first animal and a second
biological sample from a second animal of known sensitivity to a DNA-damaging
agent;
(b) determining the level of mammalian RADI gene expression in the
first biological sample relative to that of the; second biological sample; and
(c) treating a first animal, in which the the level of mammalian RADI
gene expression in the first biological sample is different (i.e., higher or
lower,
particularly lower) than that of the second biological sample, by a technique
that
cures, delays or prevents the development of, or induces remission of, the
disorder.
CA 02268457 1999-04-19
-55-
In the present methods, the determination of the level of mammalian
RADI gene expression in the first biological ;ample relative to that of the
second
biological sample is preferably performed as described above, by measuring the
level or activity of mammalian RAD 1 p polyp~eptide and/or mRNA production in
the samples. In this way, animals that are sensitive to DNA-damaging agents,
or
predisposed to, at risk for, or suffering from a disorder (such as a cancer)
characterized by increased sensitivity to such agents, may be identified and
aggressively and/or proactively treated.
Conventional Therapies. In a first such aspect of the invention, the
technique that cures, delays or prevents the development of, or induces
remission
of, the disorder may be a conventional therapeutic approach commonly used in
treating or preventing such disorders. Such approaches include, without
limitation, aggressive chemotherapy (e.g., wiith one or more approved
chemicals
or other drugs that cure, delay or prevent the development of, or induce
remission
of, the disorder), radiation therapy (including; focal and whole-body
irradiation),
surgery (including focal and radical invasive or non-invasive surgical removal
of
affected tissues and/or cells, with or without removal of surrounding
uninvolved
tissues and/or cells). More preferably, a combination of such approaches is
used,
particularly a combination of chemotherapy and radiation therapy (see Sporn,
M.B., Lancet 347:1377-1381 (1996)). Appropriate chemotherapeutic agents,
radiotherapeutic agents and surgical approaches, and combinations thereof, are
well-known in the art and will be familiar to the skilled clinician.
Of course, one significant advantage of the diagnostic methods of the
present invention is the identification of these individuals in which the
level or
activity of RADI mRNA or RAD 1 p polype:ptide is lower than in a standard or
control biological sample. As noted above, these individuals with lower RADI
expression will be expected to be more sensitive to treatment with DNA-
damaging agents such as radiation and many chemotherapeutic agents. Thus, the
diagnostic methods of the invention may be used to indicate alternative
therapeutic approaches in such individuals, i:or example the use of a
combination
of surgery and chemotherapy with agents that do not induce DNA damage (e.g.,
taxol or taxanes).
CA 02268457 1999-04-19
-56-
Antisense Oligonucleotides. In an alternative therapeutic aspect of the
invention, the technique that cures, delays or prevents the development of, or
induces remission of, the disorder in the animal may comprise introducing into
the animal a composition comprising one or more antisense oligonucleotides
that
are designed to interact with the mammali;m RADI mRNA produced by the
affected cells or tissues, thereby preventing or delaying expression of the
mammalian RAD 1 p polypeptide and thus development and/or progression of the
disorder. The invention thus further provides such mammalian RADI antisense
nucleic acid molecules (such as oligonucleotides), such as HRADl or MRADl
antisense nucleic acid molecules which may interact with HRADI (in the case of
HRADI antisense molecules) or MRADl (in the case of MRADI antisense
molecules). As used herein, the terms "an~~isense nucleic acid molecule" and
"antisense oligonucleotide" (which may be used interchangeably) mean a DNA
or RNA molecule, or a derivative thereof, containing a nucleic sequence which
is complementary to that of a specific mRIVA. An antisense oligonucleotide
binds to the complementary sequence in a specific mRNA and inhibits
translation, and/or negatively affects the stability, of the mRNA.
Alternatively,
an antisense oligonucleotide can bind to t:he complementary sequence on a
specific DNA molecule (such as a mammalian RADl DNA molecule) and inhibit
transcription of that DNA molecule.
There are many known derivatives of such DNA and RNA molecules
(see, e.g., U.S. Patent Nos. 5,602,240, 5,596,091, 5,506,212, 5,521,302,
5,541,307, 5,510,476, 5,514,787, 5,543,50 ~~, 5,512,438, 5,510,239, S,S
14,577,
5,519,134, 5,554,746, 5,276,019, 5,286,717 and 5,264,423; see also WO
96/35706 (IJ.S. Application No. 08/438,97-'i), WO 96/32474 (L1.S. Application
No. 08/420,672), WO 96/29337 (U.S. Application No. 08/409,169) (thiono
triester modified antisense oligodeoxynu~cleotide phosphorothioates), WO
94/17093 (U.S. ApplicationNo. 07/939,262) (oligonucleotide alkylphosphonates
and alkylphosphothioates), WO 94/08004 (U.S. Application No. 07/958,135)
(oligonucleotide phosphothioates, methyl phosphates, phosphoramidates,
dithioates, bridged phosphorothioates, bridge phosphoramidates, sulfones,
sulfates, ketones, phosphate esters and phosphorobutylamines (van der Krol et
CA 02268457 1999-04-19
-57-
al., Biotech. 6:958-976 (1988); Uhlmann et al., Chem. Rev. 90:542-585 (1990)),
WO 94/02499 (U.S. Application No. 07/919,967) (oligonucleotide
alkylphosphonothioates and arylphosphonothioates), and WO 92/20697 (U.S.
Application No. 07/698,568) (3'-end capped oligonucleotides), the disclosures
of
which are incorporated herein by reference in their entireties). Particular
mammalian RADI antisense oligonucleotides of the present invention include
derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-
oligos;
see Cohen, J., Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression,
Boca Raton, Florida: CRC Press (1989)). S-oligos (nucleoside
phosphorothioates) are isoelectronic analogs of an oligonucleotide (O-oligo)
in
which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur
atom. The S-oligos of the present invention may be prepared by treatment of
the
corresponding O-oligos with 3H 1,2-benzodithiol-3-one-1,1-dioxide which is a
sulfur transfer reagent (see Iyer et al., J. Org. Chem. 55:4693-4698 ( 1990);
and
Iyer et al., J. Am. Chem. Soc. 112:1253-1254 (1990)).
Antisense oligonucleotides have been described as naturally occurnng
biological inhibitors of gene expression in both prokaryotes (Mizuno et al.,
Proc.
Natl. Acad. Sci. USA 81:1966-1970 ( 1984)) and eukaryotes (Heywood, Nucl.
Acids Res. 14:6771-6772 (1986)), and these. sequences presumably function by
hybridizing to complementary mRNA sequences, resulting in hybridization arrest
of translation (Paterson, et al., Proc. Natl. Acad. Sci. USA 74:4370-4374
(1987)).
Antisense oligonucleotides are short, usually synthetic, DNA or RNA
polynucleotide molecules formulated to be complementary to a specific gene or
RNA message. Through the binding of these oligomers to a target DNA or
mRNA sequence, transcription or translation, respectively, of the gene can be
selectively blocked and the disease process ,generated by that gene can be
halted
(see, for example, Cohen, J., Oligodeoxynucleotides, Antisenselnhibitors
ofGene
Expression, Boca Raton, Florida: CRC Press (1989)). The cytoplasmic location
of mRNA provides a target considered to~ be readily accessible to antisense
oligodeoxynucleotides entering the cell; hence much of the work in the field
has
focused on RNA as a target. Currently, the use of antisense
oligodeoxynucleotides provides a useful tool for exploring regulation of gene
CA 02268457 1999-04-19
-$ 8-
expression in vitro and in tissue culture (Rotlaenberg, et al., J. Natl.
Cancer Inst.
81:1539-1544 (1989)).
Antisense therapy comprises the administration of exogenous
oligonucleotides which bind to a target polynucleotide located within the
cells,
which may be performed in vitro or in vivo. For example, antisense
oligonucleotides may be administered systemically for anticancer therapy (see
U.S. Patent No. 5,087,617). As described above and in detail in the Examples
below, defects in cell cycle checkpoint control genes (such as mammalian RADl
genes) are thought to be involved in the genesis of certain disorders in
humans,
such as cancers. Thus, HRADI and MRADI antisense oligonucleotides of the
present invention may be active in the therapeutic methods of the present
invention as a technique that cures, delays or prevents the development of
such
a disorder. In particular, such methods function by rendering the affected
cells
or tissues more sensitive to DNA-damaging agents (such as radiation or
chemicals), thereby increasing the efficacy of the conventional therapeutic
approaches described in detail above.
According to this aspect of the invention, the mammalian RADI antisense
oligonucleotides may be used in combination with one or more of the above-
described conventional therapies in at lea;ct two ways. In a first aspect, the
mammalian RADl antisense oligonucleotide s of the invention may be introduced
in a disseminated fashion into the animal to be treated (e.g., by intravenous
or
oral administration, or other systemic means of introduction of therapeutic
agents
that will be familiar to the skilled clinician), and the conventional therapy
may
be localized to one or more particular sites to be treated (e.g., targeted
radiation
exposure of one or more tumor sites). In a related aspect, the mammalian RADI
antisense oligonucleotides of the invention may be introduced in a localized
fashion into the animal to be treated (e.g., by localized injection,
intranasal or
intraocular administration, etc.), and the conventional therapy used may be of
a
more disseminated or generalized type (e.g., conventional chemotherapy).
As discussed above, the invention relates to the amino acid and nucleotide
sequences for mammalian RADI genes such as HRADI and MRADI. Thus, the
antisense oligonucleotides of the invention preferably have a nucleic acid
CA 02268457 1999-04-19
-S 9-
sequence that is complementary to substantially all or a portion of the mRNA
which may be transcribed from SEQ ID NO:1 (in the case of HRADI antisense
molecules) or SEQ ID N0:3 (in the case of MRADl antisense molecules), or to
fragments thereof including those sequence.. encoding epitope-bearing regions
of HRADIp or MRADlp polypeptides as described above. In one preferred
embodiment, the antisense oligonucleotide;s are DNA molecules, or DNA
phosphorothioate molecules, or derivatives thereof. In another preferred
embodiment, the antisense oligonucleotides are 15- to 40-mers, more preferably
15- to 30-mers.
Examples of preferred nucleotide sequences for HRADl antisense
oligonucleotides include, but are not limited to:
CGTCCACTGCGCATTCGGCCCCGAGGGATG (SEQ ID NO:S)
GGGTCAGAAGGGGCAT (SEQ ID N0:6)
GGCTGTACTGATCATCCTCG (SEQ ID ~V0:7)
TAACGTTGTCAAGGCTGGCC (SEQ ID N0:8)
GCCTGAATAAAAGCATTTGCTTGCACACAC (SEQ ID N0:9)
GGCTTGTCAGGAGACATGGT (SEQ ID NO:10)
Examples of preferred nucleotide sequences for MRADl antisense
oligonucleotides include, but are not limited to:
GGATGGTCCACGGTACCGTCGGCTCC;GAGA (SEQ ID NO:11 )
TACTGGGTTAGGAGA (SEQ ID N0:12)
ACTGTTCGTACTCCTCTTCA (SEQ ID N0:13)
AAGGCTGGCCACTAAGCAGT (SEQ ID N0:14)
AACCTTGGTAACACATCCGAAGCGC~~GTCA (SEQ ID NO:15)
ACTGTAAGGAGAGGAAGCCT (SEQ II) N0:16)
Other nucleic acid molecules and nucleotide sequences thereof that may
be useful as HRADl and MRADI antisense oligonucleotides according to the
invention will be apparent to one of ordinary skill, based on the nucleotide
sequences of the HRADl cDNA (SEQ ID 1V0:1) and MRADl cDNA (SEQ ID
N0:3) and the guidance provided herein.
CA 02268457 1999-04-19
-60-
Also provided for use in the pre:>ent methods are pharmaceutical
compositions comprising a therapeutically effective amount of one or more
antisense oligonucleotides and a pharmaceutically acceptable carrier or
excipient
therefor. In one embodiment, a single mammalian RADI antisense
oligonucleotide is utilized. In another embodiment, two or more mammalian
RADl antisense oligonucleotides are utilized which are complementary to
adj acent regions of the mammalian RADl DT(A or the mammalian RADI mRNA
that is transcribed from the mammalian RADA nucleic acid molecules described
above. Administration of two or more mammalian RADI antisense
oligonucleotides which are complementary to adjacent regions of the DNA or
corresponding mRNA may allow for more efficient inhibition of RADI genomic
transcription or RADI mRNA translation, resulting in more effective inhibition
of the expression of mammalian RADI , thereby inducing a prevention or
delaying
of the disorder. In a related aspect of the invention, the mammalian RADI
antisense oligonucleotides or composition;. comprising the mamalian RADI
antisense oligonucleotides of the invention may be used in combination with
one
or more of the above conventional therapies, to provide a more rapid
therapeutic
or preventative course of treatment.
Preferably, the mammalian RAM antisense oligonucleotide is
coadministered in a composition further comprising one or more agents that
enhance the uptake of the antisense moleculf~ by the affected cells. For
example,
the one or more mammalian RADI antisense; oligonucleotides may be combined
with a pharmaceutically acceptable carrier or excipient therefor, as described
below. The present antisense oligonucleotides may also be administered in a
composition with one or more lipophilic cationic compounds or carriers, which
may be in the form of liposomes. The use of liposomes to introduce
polynucleotides into cells is disclosed, i:or example, in U.S. Patent Nos.
4,897,355 and 4,394,448. See also U.S. Patent Nos. 4,235,871, 4,231,877,
4,224,179, 4,753,788, 4,673,567, 4,247,41:1, 4,814,270 for general methods of
preparing liposomes comprising biological materials. In addition, the present
antisense oligonucleotides may be combined with alternative lipophilic
carriers
CA 02268457 1999-04-19
-61-
such as any one of a number of sterols including cholesterol, cholate and
deoxycholic acid. A preferred sterol is cholE;sterol.
The mammalian XADI antisense oligonucleotides of the invention
additionally may be conjugated to a peptide that is ingested by the affected
cells.
Examples of useful peptides include peptide: hormones, antigens or antibodies,
and peptide toxins. By choosing a peptide that is selectively taken up by the
neoplastic cells, specific delivery of the ant:isense agent may be effected.
The
present antisense oligonucleotides may be activated by formation of an
activated
aminoalkyl derivative at the 5'OH group. ':~Che peptide of choice may then be
covalently attached to the activated mammalian RADl antisense oligonucleotide
via an amino- and sulfhydryl-reactive heterobifunctional reagent. The latter
is
bound to a cysteine residue present in the pptide. Upon exposure of cells to
the
mammalian RADl antisense oligonucleotide bound to the peptide, the peptidyl
antisense agent is endocytosed and the anti;sense oligonucleotide binds to the
target mammalian RADl mRNA to inhibit translation (see U.S. Patent No.
5,525,465; see also EP 0 263 740).
Antisense oligonucleotides can be prepared which are designed to
interfere with transcription of the mammalian RADI gene (such as an HRADl or
an MRADI gene) by binding transcribed regions of duplex DNA (including
introns, exons, or both) and forming triple helices (see U. S. Patent Nos.
5,399,676, 5,594,121 and 5,591,607; WO 96/35706 (U.S. Application No.
08/438,975); WO 96/32474 (LJ.S. Application No. 08/420,672); WO 94/17091
(U.S. Application No.07/938,000); WO 94/01550 (U.S. Application No.
07/909,069); and WO 92/10590 (U.S. .Application No. 07/625,680), the
disclosures of which are incorporated herein by reference in their
entireties).
Preferred antisense oligonucleotides :for triple helix formation are
oligonucleotides which have inverted polarities for at least two regions of
the
oligonucleotide (Id.). Such oligonucleotides may comprise tandem sequences of
opposite polarity such as 3'---5'-L-5'---3', or :5'---3'-L-3'---5', wherein L
represents
a 0-10 base oligonucleotide linkage between oligonucleotides. The inverted
polarity form stabilizes single-stranded oligonucleotides to exonuclease
degradation (Id.).
CA 02268457 1999-04-19
-62-
The antisense oligonucleotides of the. present invention may be prepared
according to any of the methods that are well known to those of ordinary skill
in
the art, including methods of solid phase; synthesis and other methods as
disclosed in the publications, patents and patent applications cited herein.
Riborymes. In still another approach to the therapeutic methods of the
invention, the technique that cures, delays or prevents the development of, or
induces remission of, the disorder in the animal may comprise introducing into
the animal a composition comprising one or :more ribozymes that are designed
to
interact with the mammalian RADI mRNA yroduced by the affected cells and/or
tissues, thereby preventing or delaying expression of the RADlp polypeptide.
Thus, the invention is also directed to ribozymes comprising a target sequence
which is complementary to a mammalian RADI DNA sequence, such as an
HRADI or an MRADI DNA sequence, or to a mammalian RADl mRNA
sequence that is transcribed from the above-described nucleic acid molecules
(such as the HRADI nucleotide sequence dpicted in Figure 1 (SEQ ID NO:1) or
the MRADl nucleotide sequence depicted in Figure 2 (SEQ ID N0:3)). The
invention is also directed to pharmaceutical compositions comprising such
ribozymes and a pharmaceutically acceptable earner or excipient therefor.
Ribozymes, which provide an altf;rnative method to inhibit mRNA
function, may be RNA enzymes, self splicing RNAs or self cleaving RNAs
(Cech, T., et al., J. Biol. Chem. 267:17479-17482 (1992)). It is possible to
construct ribozymes de novo which have an endonuclease activity directed in
trans to a certain target sequence. Since these ribozymes can act on various
sequences, ribozymes can be designed for virtually any RNA substrate and thus
are very flexible tools for inhibiting the expression of specific genes. For
example, a ribozyme against chloramphenicol acetyltransferase mRNA has been
successfully constructed (Haseloff et al., Nature 334:585-591 (1988);
Uhlenbeck
et al., Nature 328:596-600 (1987)). This ribozyme contains three structural
domains: 1 ) a highly conserved region of nucleotides which flanks the
cleavage
site in the 5' direction; 2) the highly conserved sequences contained in
naturally
occurring cleavage domains of ribozymes, f arming a base-paired stem; and 3)
the
regions which flank the cleavage site on both sides and ensure the exact
CA 02268457 1999-04-19
-63-
arrangement of the ribozyme in relation to the cleavage site and the cohesion
of
the substrate and enzyme. RNA enzymes constructed according to this model
have already proven suitable in vitro for the ;specific cleaving of RNA
sequences
(Haseloff et al., Nature 334:585-591 (1988)) such as the antisense
oligonucleotides described above.
Alternatively, hairpin ribozymes may be used in which the active site is
derived fiom the minus strand of the satellite RNA of tobacco ring spot virus
(Hamper et al., Biochemistry 28:4929-4933 (1989)). For example, hairpin
ribozyrnes have been designed which cleave human immunodeficiency virus type
1 RNA (Ojwang et al.) Proc. Natl. Acad Sci. I~SA 89:10802-10806 (1992)). Other
self cleaving RNA activities are associated with hepatitis delta virus (Kuo et
al.,
Virol. 62:4429-4444 (1988)). See also U.S. :Patent No. 5,574,143, the
disclosure
of which is incorporated by reference herein) for methods of preparing and
using
ribozymes.
Preferably, the mammalian RADI ,ribozyme molecules of the present
invention are designed based upon the chloramphenicol acetyltransferase
ribozyme or hairpin ribozymes, described above. Alternatively, the present
ribozyme molecules may be designed as described in WO 92/07065, which
discloses catalytically active ribozyme constructions having increased
stability
against chemical and enzymatic degradation that are therefore useful as
therapeutic agents.
Also provided by the present invention are pharmaceutical compositions
comprising an effective amount of at least one ribozyme of the invention in
combination with a pharmaceutically acceptable Garner or excipient therefor.
Preferably, the ribozyme is coadministe:red as a composition that further
comprises one or more agents that enhance the uptake of the ribozyme by the
affected cells. For example, the present ribozyme compositions may comprise
one or more lipophilic Garners (such as cholesterol) or lipophilic cationic
compounds which may be in the foam of liposomes, as described above for
mammalian RADI antisense oligonucleotides.
Ribozyme therapy comprises the administration of exogenous ribozyme
oligonucleotides which bind to a target polynucleotide located within the
cells,
CA 02268457 1999-04-19
-64-
which may be performed in vitro or in vivo. F'or example, as described above
for
antisense therapy, ribozymes may be administered systemically for anticancer
therapy. As described above and in detail in the Examples below, defects in
cell
cycle checkpoint control genes (such as mammalian RADI genes) are thought to
be involved in the genesis of certain disorders in humans, such as cancers.
Thus,
HRADI and MRADl ribozymes of the present invention may be active in the
therapeutic methods of the present invention as a technique that cures, delays
or
prevents the development of such a disorder. In particular, such methods
function by rendering the affected cells o:r tissues more sensitive to DNA-
damaging agents (such as radiation or chemicals), thereby increasing the
efficacy
of the conventional therapeutic approaches ~~s described.
According to this aspect of the invention, the mammalian RADI
ribozymes may be used in combination with one or more of the above-described
conventional therapies in at least two ways. In a first aspect, the mammalian
RADI ribozymes of the invention may be introduced in a disseminated fashion
into the animal to be treated (e.g., by intravenous or oral administration, or
other
systemic means of introduction of therapeutic agents that will be familiar to
the
skilled clinician), and the conventional therapy may be localized to one or
more
particular sites to be treated (e.g., targeted radiation exposure of one or
more
tumor sites). In a related aspect, the m~unmalian RADl ribozymes of the
invention may be introduced in a localized ifashion into the animal to be
treated
(e.g., by localized injection, intranasal or intraocular administration,
etc.), and the
conventional therapy used may be of a more disseminated or generalized type
(e.g., conventional chemotherapy).
The antisense oligonucleotides, ribozymes and pharmaceutical
compositions of the present invention may be administered by any means that
achieve their intended purpose of curing, delaying or preventing the
development
of, or inducing remission of, a disorder in an animal. For example,
administration may be by parenteral, subcutaneous, intravenous, intramuscular,
intra-peritoneal, transdermal, intrathecal or intracranial routes. The dosage
administered will be dependent upon the age, health, and weight of the
recipient,
kind of concurrent treatment, if any, frequency of treatment, and the nature
of the
CA 02268457 1999-04-19
-65-
effect desired. For example, as much as 700 milligrams of antisense
oligodeoxynucleotide has been administered intravenously to a patient over a
course of 10 days (i. e., O.US mg/kg/hour) without signs of toxicity
(Sterling,
"Systemic Antisense Treatment Reported," Gen. EngNews 12(12):1, 28 ( 1992)).
While individual needs may vary, determination of optimal ranges of effective
amounts of each component is within the ability of the clinician of ordinary
skill.
In addition to administering the present antisense oligonucleotides or
ribozymes as raw chemicals in solution, the therapeutic molecules may be
administered as part of a pharmaceutical preparation containing suitable
pharmaceutically acceptable carriers comprising excipients and auxiliaries
which
facilitate processing of the present antisense oligonucleotides or ribozymes.
Suitable formulations for parenteral administration include aqueous solutions
of
the present antisense oligonucleotides or rib~ozymes in water-soluble form,
for
example, as water-soluble salts. In addiition, suspensions of the active
compounds as appropriate oily injection suspensions may be administered.
Suitable lipophilic solvents or vehicles includle fatty oils, for example,
sesame oil,
or synthetic fatty acid esters, for example, ettryl oleate or triglycerides.
Aqueous
inj ection suspensions may contain substances which increase the viscosity of
the
suspension; such substances may include, for example, sodium
carboxymethylcellulose, sorbitol, and/or dextran. Optionally, the suspension
may
also contain stabilizers.
Alternatively, the present antisense o ligonucleotides or ribozymes can be
encoded by DNA constructs which are then administered in compositions
comprising virions or vectors containing these DNA constructs. Preferably, the
vectors or virions comprising the DNA constructs containing the present
antisense oligonucleotides or ribozymes are incapable of replicating in vivo
(see,
e.g., WO 92/06693 (U.S. Application No. 07/602,135)). For example, such DNA
constructs may be administered using hepes-based viruses (U.S. Patent No.
5,082,670). In addition, the antisense olig;onucleotides and ribozyrnes of the
invention may be encoded by RNA constmcts which are then administered in
compositions comprising these constructs in the form of virions or vectors,
such
as retroviruses. The preparation of retroviral vectors is well known in the
art (see,
CA 02268457 1999-04-19
-66-
for example, Brown et al., "Retroviral Vectors," in DNA Cloning: A Practical
Approach, Volume 3, Washington, D.C.: IRL Press (1987)).
Gene Therapy. In amother therapeutic;, aspect of the invention, the animal
may be treated by introducing into the animal one or more of the isolated
nucleic
acid molecules of the invention comprising a polynucleotide encoding a
mammalian RADIp polypeptide or a fragment thereof, particularly a
polynucleotide that is 90% or 95% identical to one or more of the reference
nucleotide sequences (such as that ofHRADl (SEQ ID NO:1) orMRADI (SEQ
ID N0:3) described above. This approach, known generically as "gene therapy,"
is designed to increase the level of maunmaliam RADI gene expression in the
cells
affected by or causing the disorder (such ass camcer or tumor cells) acnd
thereby to
cure, delay or prevent the development of, or induce remission of, the
disorder
by restoring cell cycle checkpoint control to the affected cells. Analogous
gene
therapy approaches have proven effective or to have promise in the treatment
of
certain maunmalian diseases such as cystic fibrosis (Drumm, M.L. et al., Cell
62:1227-1233 (1990); Gregory, R.J. et al., Nature 347:358-363 (1990); Rich,
D.P. et al., Nature 347:358-363 (1990)), Gau~cher's disease (Sorge, J. et al.,
Proc.
Natl. Acad. Sci. USA 84:906-909 (1987); Fi~ilc, J.K. et al., Proc. Natl. Acad.
Sci.
USA 87:2334-2338 (1990)), certain forms ofhemophilia (Bontempo, F.A. et al.,
Blood 69:1721-1724 (1987); Palmer, T.D. et al., Blood 73:438-445 (1989);
Axekod, J.H. et al., Proc. Natl. Acad. Sci. USA 87:5173-5177 (1990);
Armentano, D. et al., Proc. Natl. Acad. Sci. USA 87:6141-6145 (1990)) arnd
muscular dystrophy (Pau~tridge, T.A. et al., Nature 337:176-179 (1989); Law,
P.K. et al., Lancet 336:114-115 (1990); Morgan, J.E. et al., J. Cell Biol.
111:2437-2449 (1990)), as well as in other b~eatments for certain cancers such
as
metastatic melanoma (Rosenberg, S.A. et al., Science 233:1318-1321 (1986);
Rosenberg, S.A. et al., N. Eng. J. Med. 319:1676-1680 (1988); Rosenberg, S.A.
et al., N. Eng. J. Med. 323:570-578 (1990)).
In a preferred such approach, one or more isolated nucleic acid molecules
of the invention, comprising a polynucleotiide having a nucleotide sequence at
least 90% or at least 95% identical to one or more of the above-described
reference nucleotide sequences (such as the ~~RADI nucleotide sequence set
forth
CA 02268457 1999-04-19
-67-
in SEQ ID NO:1 or the MRADI nucleotide sE;quence set forth in SEQ ID N0:3),
is introduced into or administered to the animal that is suffering from or
predisposed to the disorder. Such isolated nucleic acid molecules may be
incorporated into a vector or virion suitable for introducing the nucleic acid
molecules into the cells or tissues of the animal to be treated, to form a
transfection vector. Suitable vectors or viriions for this purpose include
those
derived from retroviruses, adenoviruses and adeno-associated viruses.
Alternatively, the nucleic acid molecules of the invention may be complexed
into
a molecular conjugate with a virus (e.g., an adenovirus or an adeno-associated
virus) or with viral components (e.g., viral capsid proteins).
Techniques for the formation of vectors or virions comprising the
mammalian RADl -encoding nucleic acid molecules are well-known in the art,
and are generally described in "Working Toward Human Gene Therapy," Chapter
28 in RecombinantDNA, 2nd Ed., Watson, J.D. et al., eds., New York: Scientific
American Books, pp. 567-581 (1992). In addition, general methods for
construction of gene therapy vectors and the introduction thereof into
affected
animals for therapeutic purposes may be obtained in the above-referenced
publications, the disclosures of which are specifically incorporated herein by
reference in their entirety. In one such general method, vectors comprising
the
isolated polynucleotides of the present invention are directly introduced into
the
cells or tissues of the affected animal, preferably by inj ection, inhalation,
ingestion or introduction into a mucous membrane via solution; such an
approach
is generally referred to as "in vivo" gene therapy. Alternatively, cells,
tissues or
organs, particularly those containing cancer cells or tumors, may be removed
from the affected animal and placed into culture according to methods that are
well-known to one of ordinary skill in tlae art; the vectors comprising the
mammalian RADI polynucleotides may then be introduced into these cells or
tissues by any of the methods described generally above for introducing
isolated
polynucleotides into a cell or tissue, includin g viral infection or
transfection, and,
after a sufficient amount of time to allow incorporation of the RADI
polynucleotides, the cells or tissues may tlhen be re-inserted into the
affected
animal. Since the introduction of the mammalian RAD1 gene is performed
CA 02268457 1999-04-19
-68-
outside of the body of the affected animal, this approach is generally
referred to
as "ex vivo" gene therapy.
For both in vivo and ex vivo gene therapy, the isolated mammalian RADI
polynucleotides of the invention may alternatively be operatively linked to a
regulatory DNA sequence, which may be a mammalian RADI promoter or an
enhancer, or a heterologous regulatory DN,A sequence such as a promoter or
enhancer derived from a different gene, cell or organism, to form a genetic
construct as described above. This genetic construct may then be inserted into
a vector, which is then directly introduced into the affected animal in an in
vivo
gene therapy approach, e.g. , by intratumoral administration (i. e. ,
introduction of
the nucleic acid molecule or vector directly into a tumor in an animal, for
example by inj ection), or into the cells or tissues of the affected animal in
an ex
vivo approach. In another preferred embodiment, the genetic construct of the
invention may be introduced into the cells or tissues of the animal, either in
vivo
or ex vivo, in a molecular conjugate with a virus (e.g., an adenovirus or an
adeno-
associated virus) or viral components (e.g ., viral capsid proteins; see WO
93/07283). These approaches result in increased production of RADIp
polypeptide by the cells of the treated anirnal via (a) random insertion of
the
RADI gene into the host cell genome; or (b) incorporation of the RADl gene
into
the nucleus of the cells where it may exist as an extrachromosomal genetic
element. General descriptions of such methods and approaches to gene therapy
may be found, for example, in U.S. Patent No. 5,578,461; WO 94/12650; and
WO 93/09222.
Regardless of the approach used, however, use of these methods of the
present invention will result in the increased production of RADlp polypeptide
by the cells and tissues of the treated animal, such that the disorder will be
delayed or inhibited, or such that the disorder will go into remission or be
cured.
Isolationlldentification of Cell Cycle Checkpoint Control Polypeptides
The isolated mammalian RADI nucleic acid molecules, polypeptides and
antibodies of the invention are also useful in methods for isolating
additional cell
cycle checkpoint control genes and polypeptides, particularly those that
interact
CA 02268457 1999-04-19
-69-
with the mammalian RADI nucleic acid molecules and polypeptides of the
invention. Methods according to this aspect of the invention may comprise one
or more steps, including, for example, contacting one or more HRADlp or
MRADIp polypeptides of the invention with a sample (e.g., a cell lysate, a
culture supernatant from cells expressing one. or more recombinant or natural
cell
cycle checkpoint control polypeptides, or the like) containing one or more
cell
cycle checkpoint control polypeptides that interact with HRADIp and/or
MRADIp, under conditions (such as those described in detail in the Examples
herein, and other conditions favoring protein:protein interaction that will be
familiar to the ordinarily skilled artisan) favoring the interaction of the
one or
more cell cycle checkpoint control polypeptides with the HRADIp or MRADIp
polypeptides of the invention. In certain. embodiments in this regard, the
HRAD 1 p and/or MItAD 1 p polypeptides may be immobilized on a solid support
and the sample containing the one or more cell cycle checkpoint control
polypeptides may be passed over the solid phase containing the immobilized
HRAD 1 p and/or MRAD 1 p polypeptides under conditions favoring the
interaction
(e.g., binding or association) of the cell cycle checkpoint control
polypeptides
with the immobilized HRAD lp and/or MRAD lp polypeptides. According to this
embodiment, the desired cell cycle checkpoint control polypeptides may then be
released from the immobilized HRAD 1 p and/or MRAD 1 p polypeptides, using,
for example, elution by change in ionic strength, by competitive release
(using,
e.g. , additional HRAD 1 p or MRAD 1 p pol~,~peptide), by treatment with one
or
more chaeotropic agents (e.g., urea, guanidine salts, etc.), by treatment with
high
magnesium concentrations, etc., according to routine methods ofprotein
isolation
and recovery that are well-known in the art, thereby isolating the one or more
cell
cycle checkpoint control polypeptides. In an alternative such method, one or
more cell cycle checkpoint control polypptides may be identified or isolated
using the anti-HRAD 1 p and/or anti-MRAD'l p antibodies of the invention, by
co-
immunoprecipitation of HRAD 1 p or MRAI~ 1 p complexed with the one or more
cell cycle checkpoint control polypeptides, as described in more detail in
Examples 10-12 herein.
CA 02268457 1999-04-19
-70-
It will be readily apparent to one of ordinary skill in the relevant arts that
other suitable modifications and adaptations to the methods and applications
described herein may be made without departing from the scope of the invention
or any embodiment thereof. Having now described the present invention in
detail, the same will be more clearly understood by reference to the following
examples, which are included herewith for purposes of illustration only and
are
not intended to be limiting of the invention.
Examples
Materials and Methods
The following materials and methods were generally used in the
Examples, unless otherwise indicated.
PCR Amplification
Oligonucleotide primers were synthesized on a Beckman Oligo 1000
DNA Synthesizer against various stretches of the expressed sequence tag (EST)
(GenBank Accession number AA029300). Sequences of the oligonucleotide
primers ("oligos") were as follows:
Oligo A: GGTACATGACCTTGCTCCTA'T (SEQ ID N0:17);
Oligo B: AGTTCCCACCTTGACTATCC (SEQ ID N0:18);
Oligo C: AGCCTCTGTTATCTGTCCGA (SEQ ID N0:19); and
Oligo D: CTTGTAAGGTATCTATTCGG.ACA (SEQ ID N0:20).
Oligos A and C (SEQ ID NOs: 17 arid 19, respectively) were oriented in
the forward direction while oligos B arid D (SEQ ID NOs: 18 and 20,
respectively) were oriented in the reverse direction. These oligonucleotides
were
used to prime PCR reactions using HaCaT cDNA as a template. PCR
amplifications were carried out on an MJ R.esearch, Inc. programmable thermal
cycler (model PTC-100). Reactions were done in a total volume of SO pl with
100
ng HaCaT cDNA; 20 pmol of each oligonucleotide primer; 0.2 mM each dNTPs;
one unit of VENTTM DNA polymerase (New England BioLabs; Beverly,
Massachusetts) in 1X Thermopol buffer (New England Biolabs). PCR was
CA 02268457 1999-04-19
-71-
performed for 40 cycles, each consisting e~f one minute at 94°C and a
final
extension at 72°C, with a five minute pre-incubation at 95°C and
a final
extension at 72°C for five minutes. All possible primer pairs were used
and 20
~1 of the PCR products were resolved on a. 1 % agarose gel containing 40 ~,g
ethidium bromide (EtBr) by electrophoresis for 35 minutes at 120 V, and
visualized under ultraviolet light.
Plasmid Manipulations and Recovery
Subcloning the two largest PCR products into a pBluescript (pBS KS-)
plasmid at the SmaI site involved a two step blunt ligation. In a single 50 wl
reaction of 1X T4 DNA Ligase buffer (Ne:w England Biolabs), 5 ~1 of PCR
product were phosphorylated at the 5' end with T4 polynucleotide kinase and 1
~g
of the vector was linearized with SmaI. This reaction was allowed to proceed
for
one hour at room temperature and the mixture was subsequently incubated
overnight at 16°C with two units of T4 DNA Ligase.
After ligation, the DNA was extracted sequentially with equal volumes
of phenol and 24:1 chloroform/isoamyl alcohol, and precipitated with two
volumes of ethanol. Plasmids were transformed into electrocompetent XL 1-
Blues using a BioRad Gene Pulser set at 25 wF, 2.5 kV and 200 ~2. White
colonies were selected after overnight grovvth on LB agar plates (25 ml/plate)
with ampicillin (Amp) at 0.05 mg/ml, ~S'.-Gal (800 pg/plate) and IPTG (1
~ g/plate). Plasmids were recovered after overnight growth in LB/Amp. Inserts
were sized using the appropriate restriction enzymes and subjected to
electrophoresis on a 1 % agarose gel. Ma~;:i-preps for plasmid purification of
successfully cloned products were performed using a QIAGEN-tip 500 (Qiagen,
Inc.) according to the instructions of the m~mufacturer.
Subcloning of HRADI into pARTI
The HRADl open reading frame (ORF) was amplified with primers
HRAD 1-5 (GGACGGTCGACATGCCCC'TTCTGACCCAA) (SEQ ID N0:21 )
and HRAD1-3 (ACGGATCCTCAAGACT'CAGATTCAGG) (SEQ ID N0:22),
CA 02268457 1999-04-19
-72-
and blunt end ligated into the SmaI site of pART 1, to generate pART 1-HRAD 1.
Orientation of the inserts within pART 1 was determined by restriction
digestion.
Screening of HaCaT cDNA
To isolate a full length human cDNA. clone, a screen of a HaCaT cDNA
~, phage library (obtained from David Beaclh, Cold Spring Harbor Laboratory,
Cold Spring Harbor, New York) was performed. An overnight culture of E. coli
BB4 was grown in NZCYM medium with 0.2% maltose and 1 mM MgS04. The
primary screen involved a 30 minute incubation of 600 wl of this overnight
culture with 106 ~, phage particles at 30°C. This mixture was then
spread evenly
(approximately 100 pl each) over 6 150mm~ NZCYM agar plates with 8 ml of
NZCYM top agar for each plate. Double plaque lifts were performed for each
plate onto nitrocellulose membranes (MicronSeparations, Inc.). Membranes were
floated onto denaturing solution (1.5 M NaCI, 0.5 N NaOH) for four minutes,
treated with neutralizing solution ( 1 M Tris,1.5 M NaCI, pH 7.4) for five
minutes
and then rinsed in 5X SSPE (0.75 M NaCI, 0.05 NaHzP04, 6.3 mM EDTA,
pH 7.4). The membranes were allowed to ai:r dry and were baked under vacuum
for 1.5 hours at 80°C in a National Appliance Company Model 5831 oven.
Membranes were probed with a random-primed probe generated by using the
subcloned PCR product as a template and [a; 'ZP] dGTP as label. Hybridization
was performed overnight at 65°C and the following series of washes
done: 2X
SSPE/0.1 % SDS for five minutes at room temperature (RT); 2X SSPE/0.1 % SDS
for 10 minutes at RT; 1X SSPE/0.1% SDS~ for 15 minutes at 65°C; and
O.1X
SSPE/0.1% SDS for 15 minutes at 65°C. Membranes were then exposed
to
autoradiographic film at -75°C with an intensifying screen.
Plugs in the vicinity of positive plaques were pulled, and each plug was
placed into 1 ml of SM buffer to allow the phage particles to diffuse out.
Secondary and tertiary screens were performed using only single plaque lifts
with
the same protocol but scaled down for 100 mm plates. In further purifying the
plaques, 500 particles were examined per plate in the secondary screen and 50
particles per plate in the tertiary screen.
CA 02268457 1999-04-19
-73-
The cDNA inserts of positive clones after the tertiary screen were
subcloned into a pBS plasmid (ZAP construct) using an in vivo excision
protocol
supplied by the manufacturer (Stratagene). 11~I13K07 helper phage were
utilized
and transformed cells were grown overnight at 42°C on LB/Amp plates to
eliminate the problem of helper phage co-infection. Inserts were sized using a
restriction enzyme double digest using EcoR:I and XhoI.
DNA Sequence Analysis
Preliminary DNA sequences were cabtained manually by the dideoxy
chain termination method for the PCR product subclone and the HRADI cDNA
ZAP construct. This was performed with a TT sequencing kit containing T7 DNA
Polymerase (Pharmacia Biotech) according to the instructions of the
manufacturer. The "read short" protocol was followed and [a 'SS]dATP was used
as label. For the PCR product subclone, sequencing reactions utilized a T7
primer, while for the HRADI cDNA ZAP construct, an SK primer was used.
Samples from the sequencing reactions were resolved on a vertical 8%
acrylamide sequencing gel for two hours a1: 90 W. The gel was fixed in 10%
acetic acid/ 10% methanol for 20 minutes, blotted on 3 mm filter paper and
dried
on a vacuum gel dryer for two hours at 8(1°C. The gel was exposed to
film
(Kodak X-OMAT AR) overnight at RT arid the film developed on a Kodak
M35A X-GMAT developer.
The confirmed HRADI cDNA ZAP construct in the correct orientation
had both strands of the full insert sequenced by the automated sequencing
facility
at Queen's University (Kingston, Ontario, Canada) in the Department of
Biochemistry. This facility utilizes the ABI PRISM Dye Terminator Cycle
Sequencing Ready Reaction Kit with Ampli'Taq DNA Polymerase, FS. Samples
were prepared in deionized distilled w2~ter (dHzO) with DNA (plasmid)
concentrations of 1 ~,g/~l and synthetic oligonucleotides were supplied in
concentrations of 1 pmol/ul. T3 and T7 primers were used in the first rounds
of
sequencing and synthetic oligos were made to sequences further downstream of
these primers in order to obtain the full sequences of the inserts. The
sequences
of the synthetic oligos were as follows: Oligo E:
CA 02268457 1999-04-19
-74-
GTGTGTGCAAGCAAATGCTT (+ strand corresponding to the T3 primer)
(SEQ ID N0:23); and
Oligo F: CAAGGTGGGAACTTCCTGCA (- strand corresponding to the T7
primer) (SEQ ID N0:24).
S. pombe growth and manipulation
S. pombe was cultured by standard tE;chniques (Leupold, U., Meth. Cell
Physiol. 4:169-177 (1970)). To determine whether the isolated human cDNA
clone could rescue the UV sensitivity of an S. pombe rad 1-1 mutant, a radl -1
leu-1 strain, Sp263 (Davey , S., and Beach, D., Mol. Biol. Cell. 6:1411- 1421
( 1995)), was transformed with the full length HRADl construct in the pART 1
expression vector (Bali, G. et al., Gene 123::131-6 (1993)) by the lithium
acetate
method (Okazaki, K., et al., Nucleic Acids I~'es. 18:6485-9 (1990)). These
were
plated on pombe minimal (PM) agar to select for transformants and grown at
30°C for three days. Cultures were then grown in PM broth to
midlogarithmic
("midlog") phase at 25°C.
For radiation sensitivity analyses, cE;lls were plated in triplicate on PM
agar for each dose. Plates were either irradial:ed with a 254 nm UV light at a
dose
rate of 4 J/m2/sec, at doses of 0 to 100 J/m2, or were gamma irradiated in a
Clinac
2100 C/D with a 6-MV beam, at a dose rate of 0.23 Gy/sec, at doses of 0 to
300 Gy. Plates were incubated at 30°C for seven days and the total
number of
yeast colonies on each plate were counted. 'The average of the three plates
were
normalized to the unirradiated control, and the graphed results were used as
an
indicator of viability by comparing them to the values of the wild type strain
subjected to the same treatment and to the wlirradiated plates.
For viability in hydroxyurea (HLI), midlog phase cultures were treated
with 10 or 12 mM HLI, and aliquots were taken at various time points. Aliquots
were diluted appropriately, and plated on minimal selective media to maintain
the
HRADl expression plasmid. Plates were incubated for seven days at
30°C, and
counted. Average surviving fractions were normalized to untreated samples
harvested immediately prior to HTJ addition.
CA 02268457 1999-04-19
-7S-
Yeast Two Hybrid Library Screen
HRAD9 cDNA was subcloned from pBluescript into the Smal and Sall
restriction sites of the GAL4 DNA binding .domain pGBT9 vector (Clontech).
pGBT9-HRAD9 was then transformed into the budding yeast strain HF7c
(Feilotter et al., Nucl. Acids Res. 22:150:2-1503 (1994)) according to the
manufacturer's instructions. Transformants were plated on synthetic dropout
(SD) media minus tryptophan (6.7 g/L DII~ CO Yeast Nitrogen Base without
Amino Acids, 2% glucose, 0.62 g/L Bio 1 X01 Complete Supplement Mixture
minus histidine (-his), leucine (-leu), and tr,~ptophan (-trp), 20 mg/L
histidine,
100 mg/L leucine, and 20 g/L DIFCO Bacto-Agar), also referred to herein as
"triple dropout medium". To ensure that the HRAD9 GAL4 DNA binding
domain hybrid construct alone did not activate the HIS3 and/or lacZ reporter
genes, colonies were streaked onto the S~D agar-trp-his and tested for ~i-
galactosidase activity using a filter assay described in the Clontech Manual.
One
HF7c colony harboring the pGBT9-HRAD9 vector was picked into 150 ml of
SD-trp liquid media and grown to saturation :for two days at 30°C. The
saturated
culture was then diluted by adding 1 L of YTD (10 gA yeast extract, 20 g/1
tryptone, and 20 g/1 dextrose) and grown to an ODD of 0.5. These yeast were
then transformed, as described by the manufacturer, with 0.5 mg of a
directionally cloned HeLa cDNA library vn the pGAD-GH GAL4 activation
domain vector (Clontech). The transformalits were plated on forty-four 15 cm
plates containing SD agar-trp-leu-his and incubated at 30°C. To
determine the
efficiency of the library transformation, serial dilutions of a small aliquot
of the
transformed yeast were plated on SD agar-tr~~-leu. After 10 days,
approximately
500 colonies grew larger than background on the triple dropout plates. These
colonies were subcultured onto SD agar-trp-leu-his + S mM 3-aminotriazole (3-
AT) and incubated at 30°C for 2 days, after which 15 positive
clones were
identified. Plasmid DNA was then prepared from 15 saturated liquid cultures
essentially as described by the manufacturer (Clontech). XL1 -Blue competent
bacteria were then transformed with this DNA and plated on LB agar containing
ampicillin. Inserts in pGAD-GH were sequenced using fluorescently labeled SK
primer and an automated sequencer (AEd). DNA sequence analysis was
CA 02268457 1999-04-19
-76-
performed using the BLAST algorithm (Altschul et al., J. Mol. Biol. 215:403-
410
(1990)).
For analysis of individual interactions between HRAD9, HRAD1, and
hHUS 1, HF7c were simultaneously cotransformed with pGBT9-hHUS 1 and
pGAD-HRAD1, pGBT9-HRAD9and pGAI)hHUSl, and pGBT9-HRAD9 and
pGAD-HRAD1, as described by the manufac;turer(Clontech). Cotransformants;
were plated on SD agar-trp-leu and incubated at 30°C for 2-3 days. As
negative
controls, pGBT9 fusion constructs were co-transformed with empty pGAD-GH
vector and pGAD fusion constructs were c;otransformed with empty pGBT9
vector. As a positive control, a p53-DNA binding domain fusion construct was
co-transformed with a pSV40 T antigen-activation domain fusion construct. A
single isolated colony from each plate was streaked onto both SD agar-trp-leu
and
SD agar-txp-leu-his + SmM 3-AT and grown at 306C for 2-3 days.
HRAD9 Polyclonal Antibody Prepu~ration and Purification
HRAD9 cDNA was PCR cloned into the SmaI and BamHI restriction
sites of the pGEXI bacterial expression vector (Pharmacia). aHRAD9-
Glutathione S-transferase (GST) fusion probein was then expressed in E coli
and
affinity purified on Glutathione Sepharose (Pharmacia) according to previously
described methods (Frangioni et al., Anal. Biochem. 210:179-187 (1993)). a-
HRAD9 polyclonal chicken antibodies were generated against this HRAD9
fusion protein (RCH antibodies).
10 mg of purified GST was batch adsorbed to 2 ml of glutathione
sepharose for 2 hours at 4°C. Sepharose w~~s washed with 40 volumes of
PBS.
2 ml of antibody supernatant was batch adsorbed with the GST bound glutathione
sepharose overnight. Sepharose was subjected to centrifugation and the
supernatant harvested.
pg of purified GST-HRAD9 protein was subjected to electrophoresis
through a 10% acrylamide gel, then elc;ctro-blotted onto a nitrocellulose
membrane. The protein band was visualized by Ponceau S staining and the band
30 excised and cut into small pieces with a scalpel. Membrane pieces were
blocked
overnight in 1 % casein in PBST (PBS + 0. 1 % Tween 20) at 4°C in a
microfuge
CA 02268457 1999-04-19
_77_
tube. The membrane was then washed 3 timc;s for S minutes each in PBST. I ml
of pre-cleared antibody supernatant was added to the membrane pieces and
rocked at 4 ° C for 4 hours. The supernatant was removed and the
membrane was
washed 2 times rapidly and once for 15 minutes with PBST. The tube was
centrifuged briefly and all traces of the wash were removed. The antibody was
eluted from membrane with 300 ~,1 of 0.2 M glycine pH 2.8. A second elution
with 100 ~.1 of glycine was pooled with the first and the antibody supernatant
was
neutralized with 0.2 volumes of 1 M Tris pH 8Ø
Co-immunoprecipitation Experiments
Co-immunoprecipitations utilized the myc and FLAG epitope tags, and
for simplicity, proteins expressed with these tags are denoted by a
subscripted m
or f, respectively. HRAD1 cDNA was amplified by PCR and cloned into the
XbaIlXhoI restriction sites ofthe mammalian. expression vector, pyDF31 (Gift
of
Dr. David LeBrun (Dept. of Pathology, Queen's University, Kingston, Ontario,
Canada), in frame with one copy of the FLAG epitope. HRAD9 cDNA was PCR
cloned into the XbaIlXhoI restriction sites of the pCS2-MT, a mammalian
expression vector with 6 copies of the myc; epitope (Rupp et al., Genes Dev.
8:1311-1323 (1994); Turner et al., Genes Dev. 8:1434-1447 (1994)). A hHUS 1
-myc fusion construct was generated by PCR amplifying hHUS 1 cDNA and
cloning it into the pCS2-MT vector. The constructs used to express the
negative
controls FLAG epitope-tagged hepatic leukemia factor (HLFf) and FerONm.
Constructs were gifts of Dr. David LeBrun arid Dr. Peter Greer (Cancer
Research
Laboratories, Queen's University), respectively.
COS-1 cells that were approximatc;ly SO% confluent in 10 cm tissue
culture plates were transiently co-transfecte;d with 24 ~g each of the
indicated
constructs. using lipofectin reagent (SIGM:A) according to the manufacturers
instructions. Cells were then washed twice with 10 ml of sterile PBS, and 10
ml
of complete DMEM was added (DMEM + 11J% fetal bovine serum). Transfected
cells were cultured at 37 ° C in a 5 % COz al:mosphere for 48 hours.
Cells were
lysed directly on the plate in mammalian cell lysis solution (50 mM Tris-Cl pH
8.0,150 mM NaCI, 0.5% NP40,1 mM Na3VIJ4,1 mM PMSF, 20 wg/ml aprotinin,
CA 02268457 1999-04-19
_7$_
~g/ml leupeptin). Lysates were passed through 18 and then 23 gauge syringes
several times to shear genomic DNA, incubated on ice for 30 minutes, and
centrifuged at 16,000 x g to remove any insoluble material. Each co-
transfected
cell lysate was split into two equal portions. 'Co one set, lysates were pre-
cleared
5 with 3 5 ~,l of a-IgY agarose (Promega) on a :Nutator at 4 ° C for 45
minutes, and
immunoprecipitated with polyclonal chicken anti-HRAD9 antibodies on a
Nutator at 4°C for 1 hour. 'These immune complexes were collected on 35
~,1 of
a-IgY agarose (Promega) at 4 ° C for 1 hour. To the other set, lysates;
were pre--
cleared with 10 wl protein G-sepharose (Pharlacia) and immunoprecipitated with
10 approximately 1 ~g of a-myc 9E10 mouse monoclonal antibody (Sigma, and gift
of Dr. Peter Greer). These immune complexc;s were collected on 10 ~,1 of
protein
G-sepharose at 4°C for 1 hour. Both the a-myc and a-HRAD9
immunoprecipitated complexes were collected by centrifugation at 500 x g,
washed four times with PBS, and incubated at 100°C for 5 minutes in 50
wl of
SDS-PAGE sample buffer (NEB). Following centrifugation at 16,000 x g for 20
minutes, supernatants were electrophoresed through a single 6% acrylamide gel.
Protein was transferred to nitrocellulose (0.2 hum pore size, Xymotech) which
was
blocked in 5% MPBST (PBS + 5% non-fat milk powder + 0. 1 % Tween 20) at
room temperature for 2 hours, and then probed with a-myc 9E 10 mouse
monoclonal antibody. After extensive washing in PBST, HRP-conjugated anti-
mouse secondary antibody was added and the membrane was incubated for 45
minutes at room temperature. Protean antigens were detected by
chemiluminescence using the ECL detection system (Amersham), followed by
exposure to X-ray film (Kodak). Three tines less a-myc immunoprecipitate
sample (12 ~ul) was loaded onto the gel than ix-HRAD9 sample (4 ~1).
Similarly,
the a-myc immunoprecipitate side of the blot was exposed to film for one fifth
the time that the a-HRAD9 immunoprecipitate side.
For the HRAD 1 ~hHLlS 1 and HRAD~~/HRAD 1 co-immunoprecipitations,
the same methods as described for the HRAL>9/hHUS 1 co-immunoprecipitations
were used, with the following exceptions. .All lysates were pre-cleared with
10
~1 protein G-sepharose (Pharmacia) on a Niutator at 4°C for 45 minutes.
Either
a-myc 9E10 monoclonal antibody or a-FLAG M2 monoclonal antibody (Sigma)
CA 02268457 1999-04-19
-79-
was used for immunoprecipitation. Samples were size-fractionated on 10%
polyacrylamide gels. Immunoblotting was cauried out using a-myc 9E 10 mouse
monoclonal or a-FLAG M2 monoclonal antibody, as indicated.
Calf Intestinal Phasphatase Treatments
COS-1 cells were transfected with 24 pg of pCS2-MT-HRAD9 as
described previously. Two days after the transfection, cells were harvested
and
immunoprecipitated with a-myc monoclonal antibody as before. After collecting
the immune complexes on protein G-sepharose, beads were washed four times
with PBS and resuspended in 200 pl of NEB buffer 3 (50 mM Tris-HCI, 10 mM
MgClz,100 mM NaCI, and 1 mM DTT) + 1 '% SDS. Protein was removed from
the sepharose beads by heating at 100 ° C for 5 minutes followed by
centrifugation
at 16,000 x g. 20 pl of the supernatant was then treated with 30 units of calf
intestinal alkaline phosphatase (Promega) in 1 x NEB buffer 3 in the presence
or
absence of 2 M sodium orthovanadate (Na3V04), for 30 minutes at 37°C.
To
sufficiently dilute the SIDS in the sample, the total volume of the reactions
was
200 pl. Both reactions, along with 20u1 of untreated immunoprecipitate, were
made up to 1 ml with PBS, and re-immunoprecipitated with a-myc monoclonal
antibody, electrophoresed through 6% acrylamide, and immunoblotted with a-
myc monoclonal antibody essentially as above.
Endogenous HRAD9 protein was immunoprecipitated from
approximately 9 x 106 HeLa cells with polyc.lonal chicken a-HRAD9 antibodies
essentially as described above. The phosphatase procedure followed was
identical to that for exogenous HRAD9m e~;cept samples were electrophoresed
through 8% acrylamide and immunoprecipitated and immunoblotted with a-
HRAD9 antibodies.
HRAD9 Immunofluorescence
HaCaT or HeLa cells were seeded on coverslips for 1 hour (HeLa) or
overnight (HaCaT) at 37°C in 5% CO2. Cellls were washed twice with PBS
and
fixed with 10% paraformaldehyde for 10 minutes at room temperature. Fixed
cells were washed twice more with PBS, cowered with methanol, and incubated
CA 02268457 1999-04-19
-80-
at -20°C for 20 minutes. Cells were rinsed twice, and then washed for
30 minutes
in PBST. PBST + 1 % normal goat serum (N~GS) was used to block cells at room
temperature for 1 hour. Incubation in polyclonal a-HR.AD9 chicken antibodies
in PBST + 1 % NGS for 1 hour at room temperature was followed by two rinses,
and one 30 minute wash in PBST. Cells were then incubated in Alexa 488 goat
anti-chicken secondary antibody (Molecular Probes) and diluted to 10 pg/ml in
PBST + 1 % NGS for 1 hour at room temperature. After two rinses with PBST,
and two 10 minute washes in PBS, cells were treated with 200 ug/ml RNase A
in 1 % PBS for 1 hour at 37°C. After two vrinses and two 5 minute
washes in
PBST, nuclei were stained with 2 pg/ml pro:pidium iodide in PBS for 5 minutes
at room temperature. Cells were rinsed twice and washed once for 10 minutes
with PBST. Coverslips were mounted on glass slides and visualized using a
Meridian Insight Plus confocal microscope. Images were captured from a cooled
Meridian video with a Matrox 1280 frame gzabber (Matrox Electronic Systems
Ltd.) and pseudocolored and saved using MC;ID M4 software (Imaging Research
Inc.).
Example 1: Isolation of the HRADI and MRADI Genes
HRADI
A search of the dBEST database (National Center for Biotechnology,
National Institutes of Health, Bethesda, Maryland) revealed an EST of interest
(484 nucleotides) obtained from a normalized and directionally cloned human
cDNA library. The complimentary strand of the EST appeared to encode a
predicted polypeptide similar to a portion of the S. pombe radl + gene
product.
This open reading frame predicted a polype:ptide that is 30% identical and 57%
similar over an 80 amino acid stretch, which represents approximately one
quarter ofthe RADlp protein. It is aligned closer to the C-terminal portion of
the
S. pombe protein which is a moderately conserved region shared by the
Schizosaccharomyces pombe radl+, Saccharomyces cerevisiae RAD17, and
Ustilago maydis RECl gene products. The extent of homology in the region that
CA 02268457 1999-04-19
-81-
the EST is aligned with S. pombe radl+ is comparable to that of radl+ and
RADl7 (Lydall, D. and Weinert, T., Science 270:1488-91 (1995)). This same
region contains 9 identical residues between RAD 1 p, RAD 17p, and RECIp, of
which 7 are also present in the human EST. Based on the alignment and extent
of sequence identity, this was evidence for the existence of a possible human
orthologue of S. pombe radl+.
Because a positive orientation clone was not present in the dBEST library,
we chose to search other cDNA libraries for the bona fide human radl
homologue. A HaCaT (spontaneously transi:ormed human keratinocyte) cDNA
library in ~. ZAP II was amplified by PCR using oligonucleotides directed
against
the putative HRADI gene. PCR amplification using HaCaT cDNA resulted in
PCR products generated from the expected primer pairs. The 399 by PCR product
generated using oligonucleotides A and B (SI:Q ID NOs:17 and 18, respectively)
was subcloned into pBS KS-. Sequencing of the subclone revealed an insert of
identical sequence to that of the original EST, confirming that the sequence
of
interest was present in the HaCaT cDNA library.
The screen of 106 phage particles eventually yielded 4 positive clones
after a tertiary screen. In vivo excision converted these ~, cDNA vectors into
pBS
plasmids containing the cDNA insert (ZAf construct). Two of these, clones
HRAD 1-7 and HRAD 1-8, were in the orientation expected for HRAD 1 sense
expression. The other two, clones HRAI)1-9 and HRAD1-10, were in the
opposite orientation. Clone HRAD 1-7 was slightly longer than clone HRAD 1-8,
and so was chosen for further analysis.
MRADI
The full length HRAD 1-7 clone was used to probe a mouse CB7
erythroleukemia cDNA library by low stringency hybridization. Five positives
were identified, four of which were the same length, and one was slightly
shorter than the others. Clone MRAD1-2.1 was chosen for further analysis.
Complete sequencing of both strands of clone MRAD 1-2.1 identified a cDNA
that was 1380 by long with a 218 by 5' U'TR, an 840 by coding region and a
322 by 3' UTR (Figure 2; the additional 12 by shown in this figure are the 6
by
CA 02268457 1999-04-19
-82-
EcoRI sites flanking the 5' and 3' ends of the MRAD1-2.1 cDNA). The 3'
UTR contains a common variant of the consensus polyadenylation signal
sequence (ATTAAA). However, no poly(A) tail is observed in this cDNA
isolate. The ORF of MRADl encodes a 280 amino acid polypeptide that is 90 ~
identical and 96 % similar to HRAD lp. Ami:no acid alignment (Figure 3) shows
that the sequence similarity of HRADlp and MRADlp to the other members
of the Radlp family extends over their entire lengths, suggesting that the
isolated human and mouse cDNAs are full llength.
Example 2: Sequence Analysis of the H.RADl and MRADl Genes
Full DNA sequences of both strands of the insert of clone HRAD1-7
showed that the cDNA was 1300 by long witlh a 214 by 5' untranslated region,
an
846 by coding region and at least a 240 by 3' untranslated region (Figure 1 ).
The
ORF of HRADI encodes a 282 amino acid pc~lypeptide. This is 40 as shorter than
the S. pombe radl+ gene product. An aligxlment of HRADIp to Radlp was
generated using the CLUSTAL W program (Thompson, J.D., et al., Nucleic
Acids Res. 22:4673-4680 ( 1994)). Figure 3 shows that HRAD 1 p and the other
members of the RAD 1 p family share protein sequence similarity over their
entire
lengths, suggesting that the isolated human cDNA is full length. The extent of
the similarity between HRADIp (SEQ ID 110:2) and Radlp (SEQ ID N0:26)
(27% amino acid identity, 53% similarity) is comparable to that between Radlp
(SEQ ID N0:26) and RADl7p (SEQ ID NC1:27) (23% identity, SO% similarity)
over their respective full lengths (Lydall, D. and Weinert, T., Science
270:1488-
91 (1995)). As shown in Figure 4, the similarity between HRADIp (SEQ ID
N0:2) and the corresponding murine radl+ orthologue MRADlp (SEQ ID
N0:4), was significantly greater, exceeding about 90-95% amino acid identity
and similarity.
Example 3: HRADl Partially Rescues the G2 DNA Damage Checkpoint
Defects of radl:: ura4+ Yea;et
The HRADI ORF was subcloned into the S. pombe expression vector
pARTl under control of the strong, constitutive adhl+ promoter. Expression of
CA 02268457 1999-04-19
-83-
HRADI in a radl:: ura4+ strain background increased the viability of these
mutants following UV irradiation, to levels above that of the vector-
transformed
control (Figure SA). However, this increase in viability did not reach the
level of
rescue that was obtained by expression of the wild type radl+ gene (Figure
SA).
Expression of HRADI also restored partial resistance to ionizing radiation
(Figure SB).
In order to more rigorously examine; if HRADI rescues the checkpoint
defects of radl mutants, HRADl was expressed in a radl-1 strain containing the
temperature sensitive cdc25-22 allele. At the restrictive temperature of 36
° C
these yeast arrest at the G2/M transition point:, due to their inability to
activate the
Cdc2 kinase. If cells blocked at the G2/M transition are irradiated just prior
to
being released to the permissive temperature of 25 ° C, checkpoint
proficient cells
will undergo a dose dependent delay in entry into mitosis. Checkpoint
deficient
cells will enter mitosis without a noticeable delay. As shown in Figure 6A,
the
checkpoint-deficient vector transformed controls entered a synchronous mitosis
within 100 minutes of being irradiated, regardless of the dose received.
Checkpoint-proficient yeast expressing Rad lp underwent the characteristic
dose
dependent delay in entry into mitosis (Figure 6B). Yeast expressing HRADlp
also underwent a dose dependent delay in entry into mitosis (Figure 6C). The
dose dependence is not equal to that of cells. expressing Radlp; however, this
is
what one would expect for partial rescue.
Expression of HRADI was found to restore only limited resistance in
rad l: : ura4+ yeast to the DNA synthesis inhi bitor hydroxyurea (HL)).
Expression
of HRADI in Sp337 (Radl null strain) increased the viability of these yeast
after
exposure to HU. As shown in Figure 7, HRADI -expressing cells did not lose
viability to as great a degree as vector-transformed control cells. Cells
expressing
wild type radl + remained viable to a much greater extent than either of the
other
samples.
Example 4: Generation of MRADI'' (l~Iul1 Mutant) Cell Lines
The MRADI cDNA is used as a probe to obtain genomic clones using
standard screening procedures (Sambrooh, J., et al., Molecular Cloning: A
CA 02268457 1999-04-19
-84-
Laboratory Manual, 2nd Ed., Cold Spring H~~rbor Laboratory Press, Cold Spring
Harbor, NY (1989)). Preferably, a positive-negative selection scheme is used
(Mansour, S. L., et al., Nuture 336:348-352 (1988)) to produce "knockout" or
null mutant cell lines. As large a region as possible of the genomic locus
containing coding exons is removed and the positive selection cassette (neo'
gene
under control of the phosphoglycerate kinase [PGK] promoter) inserted in its
place. The PGK-neo cassette is flanked on both sides by 2-5 kb of homology to
the target locus. Outside the region of homology the negative selection
cassette
(HSV thymidine kinase [TK] under control of the PGK promoter) is inserted.
Generation of targeted embryonic stem (ES) cells is performed essentially
as described (Mortensen, R. M., Proc. Natl. Acad. Sci. USA 88:7036-7040
(1991)). Briefly, ES cells grown to 7'_.% confluence are harvested and
trypsinized; 10' cells are suspended in 1 ml of 20 mM HEPES, 145 mM NaCI,
and 0.1 mM 2-mercaptoethanol containing 1 pmol of the targeting construct.
Electroporation is performed in a Bio-Rad Gene Pulser at 450 V and 250 mF.
Cells are then plated at 5 x 106 cells per 1:i0-mm gelatinized Petri dish.
After
2 days, cells are selected with 6418 at 0.15 mg/ml and gancyclovir (GANC) at
2 mM. G418 selects for cells which have integrated the targeting construct.
GANC, which is converted to a cytotoxic compound by HSV TK, selects against
6418-resistant cells which arise by random integration of the targeting
construct.
6418-resistant cells which result from integration due to homologous
recombination at the target locus lose the PGK-HSV TK cassette. Cells are
cultured for an additional 7-10 days with daily medium changes, after which
surviving colonies are counted, isolated, an<t expanded. Single disruptions of
the
target locus are confirmed by genomic Southern blots using both locus-specific
probes that recognize sequences located outside the targeting construct and
the
neo gene as a probe.
At this stage, transgenic cell lines and animals are prepared by any of
several approaches. In a first approach, M~RADI+~- heterozygous ES cell clones
are injected into mouse blastocysts in order to generate chimaeric mice. These
chimaeric mice are then mated to produce ~fRADI-'' nullizygous embryos. From
these embryos mouse embryonic fibroblast~; (MEFs) are produced using standard
CA 02268457 1999-04-19
-8S-
procedures (Deng, C., et al., Cell 82:675-684 (1995)). Day 11.5 to 16.5 post
coitum embryos are dissociated, treated with DNase and trypsin, and plated in
Dulbecco's modified Eagle's medium (DDrIEM) containing 15% fetal bovine
serum (FBS).
In a second approach, provided the mice are viable, the mice are allowed
to mature and primary tissue cultures are prepared from their mammary
epithelium as previously described (Johnson, C. W., et al., CancerRes. 45:3774-
3781 (1985)). Briefly, mammary tissue is removed, minced, and washed in
phosphate-buffered saline (PBS). Tissue is dissociated by sequential digestion
with collagenase III, trypsin, and DNase I in Ca2+/Mgz+-free PBS. Cells are
washed with PBS and plated in DMEM containing 15% FBS.
A third option is the method of Mortensen et al. to generate homozygous
null ES cells (Mortensen, R. M., et al., Mol. Cell. Biol. 12:2391-2395
(1992)).
Singly disrupted ES cells are expanded for 14-28 days, plated, cultured for 24
hours, and then selected at concentrations of 6418 up to 2.0 mg/ml. Doubly
disrupted ES cell clones are confirmed by g~enomic Southern blotting. MRADI'''
nullizygous ES cells are then allowed to dii:~erentiate in vitro, if desired.
Example 5: Generation of Human Cell Lines Deficient in HRADI
Expression
To generate HRADl' human cell lir,~es, the full length HRADI cDNA is
cloned in the reverse orientation in the mammalian expression vector pcDNA3
(Invitrogen). HaCaT cells (spontaneously transformed human keratinocytes) are
transfected with this antisense HRADl expression construct by electroporation
(Bio-Rad Gene Pulser, as above). Stable transfectants are selected and
maintained
in DMEM supplemented with 10% FBS and 6418 at 1 mg/ml. HRADI
expression levels are determined by northern blot analysis and immunoblot
analysis using polyclonal antisera generated as described below in Example 7.
Vector-transfected cells may be used as controls for the experiments described
below in Example 6.
CA 02268457 1999-04-19
-86-
Example 6: Analysis of RADl-deficient Cell Lines
Once mammalian RADl -deficient cells and cell lines have been generated
by the above-described approaches, they are then examined for their biological
characteristics (e.g., cell cycle kinetics and checkpoint control). The
techniques
used to assess cell cycle kinetics and checkpoint characteristics are the same
regardless of the cell type used in the experiments.
A. Cell Cycle Analysis
Cell cycle analysis involves meas~uing the doubling time of RADI-
deficient cell lines, compared to control cells (either normal MEFs or vector-
transfected HaCaT cells). If a change in doubling time is observed,
fluorescence-
activated cell sorting (FACS) analysis (facili.ties available at Queen's
University,
Kingston, Ontario, Canada) is performed to detenmine which phase of the cell
cycle is perturbed. A dual 5-bromo-2'-deoxy~uridine (BrdU)/propidium iodide
(PI)
FACS analysis allows resolution of the Gl, S, and G2+M phases of the cell
cycle.
Cells are incubated for 1-4 hours at 37°C in the presence of BrdU,
harvested,
stained for BrdU incorporation with fluorescein isothiocyanate (FITC)-
conjugated anti-BrdU antibodies and for DNA content with PI, and subjected to
FACS analysis as described (Davey, S., and Beach, D., Mol. Biol. Cell 6: 1411-
1421 (1995)). Analysis of mitotic entry kinetics is performed with cells that
are
pulse-labelled with BrdU and followed through mitosis. BrdU is incorporated
into cells which are in S phase at the time of labelling. Therefore, the time
required for BrdU-labelled cells to complete mitosis represents the amount of
time necessary for these cells to finish replication, transit G2, and complete
mitosis. Completion of mitosis is monitored using FACS analysis, in which case
the end of mitosis is evidenced by a return of BrdU-labelled cells to a G1 DNA
content. Alternatively, mitotic entry is measured by counting mitotic figures
under a fluorescence microscope. This method uses cells that are pulse-
labelled
with BrdU and then grown in the presence of colcemid in order to prevent exit
from mitosis.
B. Response to DNA Synthesis Inhibition andRadiation Treatment
CA 02268457 1999-04-19
These experiments allow determinatiion ofthe cell cycling parameters and
viability of RADI -deficient cells following .exposure to agents such as the
DNA
synthesis inhibitor hydroxyurea (HU), UV radiation, and y radiation. Mitotic
entry and cell cycle kinetics are determined as described above, and viability
is
assessed by plating efficiency.
HU inhibits ribonucleotide reductase, preventing dNTP synthesis and
blocking replication (Elford, H. L. Biochem. Biophys. Res. Comm. 33:129-135
(1968)). Cells are labelled with BrdU, then treated with 0.2 mM HU and
followed
through mitosis using the methods described above. To assess viability, cells
are
exposed to HU for varying lengths of time (0-8 hours for yeast cells; 0-72
hours
for human cells), then released from the HU replication block and plated.
Resulting colonies are fixed, stained, and counted. In response to HU,
checkpoint-proficient control cells will delay mitosis until DNA replication
is
complete. If RAD 1-deficient cells are checkpoint-defective, as expected, they
do
not delay mitosis in response to HU, but rather undergo mitosis with kinetics
similar to untreated cells.
Radiosensitivity of RAD1-deficient cells is determined by plating
efficiency. y radiation is delivered using a. "'Cs source (available at
Queen's
University, Kingston, Ontario, Canada), and 254 nm UV light is delivered using
a calibrated UV light box. Cells are irradiatead with 0-10 Gy of'y radiation
or 0-20
J/mz of UV light and plated. Colonies are fi:ced, stained, and counted. Cell
cycle
kinetics are followed at varying time point:. after irradiation. The dose
used, as
well as the timing, depend on the results obtained above. In response to
radiation,
checkpoint-proficient cells delay mitosis, allowing time for DNA repair to
occur.
RADl -deficient cells, presuming they are ch<;ckpoint-defective, enter mitosis
with
the same kinetics as untreated cells.
C. Determination of Genomic Instability
As described above, checkpoint dE;fects are associated with genomic
instability. Amplification of the CAD gene. is used as an indicator of genomic
instability in RADI -deficient cells. Amplil:ication of the CAD gene results
in
resistance to the drug N-(phosphonacetyl)-L,-aspartate, or PALA (Otto, E., et
al.,
CA 02268457 1999-04-19
_$8-
J. Biol. Chem. 264:3390-3396 (1989); Tlsty, T. D., et al. Proc. Natl. Acad.
Sci.
USA 86:9441-9445 (1989)). PALA resistance occurs very rarely in normal cells,
including human keratinocytes (Wright, J. ~~., et al., Proc. Natl. Acad. Sci.
USA
87:1791-1795 ( 1990)), making the frequency of PALA-resistant colony formation
a good indicator of genomic instability (Otto, E., et al., J. Biol. Chem.
264:3390-
3396 (1989); Tlsty, T. D., et al. Proc. ~fatl. Acad. Sci. USA 86:9441-9445
(1989)). The frequency of PALA-resistant colony formation in RAD1-deficient
cells is determined, as compared to control cells. The assay is performed as
described (Yin, Y., et al., Cell 70:937-948 (:1992); Livingstone, L. R., et
al., Cell
70:923-935 (1992)), including selection in 55-88 mM PALA for 1-4 months,
followed by fixation, staining, and scoring :for colony formation.
Example 7: Generation of anti-HRADIIp Polyclonal Antibodies
The full length HRADI cDNA i s cloned in the vector pGEX2T
(Pharmacia, Piscataway, New Jersey) in frame with the glutathione-S-
transferase
(GST) moiety. Recombinant GST-HRADIp is purified from bacterial lysates by
affinity chromatography, using Glutathione-Sepharose (Pharmacia) as previously
described (Smith, D. B., and Johnson, K. S., Gene 67:31-40 (1988)). Multiple
injections of 50-100 mg ofrecombinant GST-HRADIp are used to immunize a
rabbit. The animal is boosted and bled three 'times, and polyclonal anti-
HR.AI) 1 p
antibodies are affinity purified from the antisera using recombinant GST-
HRAD lp.
Example 8: Interaction of HRADlp with BRCAlp, ATRp or ATMp
To determine if BRCAIp, ATRp, and ATMp proteins interact with
HRAD 1 p, two sets of experiments using anti-HR.AD 1 p antibodies are
conducted.
In a first experiment, anti-HRADIp antibodies are used in co
immunoprecipitation experiments. In an alternative approach, recombinant GST-
HRADIp protein is used in pull-down experiments to determine if HRADlp
interacts with BRCAlp, ATRp, or ATMp proteins.
A. Co-immuhoprecipitations
CA 02268457 1999-04-19
-89-
WI38 normal human fibroblasts or HaCaT cells are lysed in SO mM Tris-
HCl (pH 8.0),150 mM NaCI, 0.5% NP-40 containing phosphatase inhibitors (50
mM NaF, 1 mM Na3V04) and protease inhibitors (aprotinin [20 mg/ml],
leupeptin [ 10 mg/ml], and phenylmethylsulphonylfluoride [ 100 mg/ml]), at 4
°C.
S Lysates are pre-cleared with protein A-Sepharose (Pharmacia) and then
precipitated with antibodies against either HF;AD 1 p, BRCAIp, ATRp, or ATMp,
at 4 ° C. Immunoprecipitates are collected on protein A-Sepharose
beads,
separated by SDS-PAGE, and transferred to nitrocellulose membranes.
Immunoblot analysis is performed as follows. The membranes are blocked with
low-fat milk powder, incubated with primary antibody (either anti-HRADlp,-
BRCAIp, -ATRp, or -ATMp), and then incubated with species-specific,
horseradish peroxidase (HRP)-conjugated secondary antibody. Immunoreactive
proteins are detected by ECL (Amersham).
B. Pull down Experiments
Pull-down experiments can be performed to confirm those of the co-
immunoprecipitation experiments described .above. Recombinant GST-HRAD lp
is bound to Glutathione-Sepharose beads. Lysates (prepared as described above)
of cells expressing BRCAIp, ATRp, and ATMp are incubated with these beads.
Bead-bound protein complexes are washed, separated by SDS-PAGE, and
transferred to nitrocellulose membranes. Imlnunoblot analysis is then
performed
as described above.
Example 9: Co-localization of HRADlp with BRCAIp, ATRp or ATMp
WI38 cells are used for the immunolocalization experiments because this
is one of the cell lines in which co-localization of BRCAlp and HRADS lp has
been shown (Scully, R., et al., Cell 88:265-275 (1997)). Immunostaining of
adherent cells grown on cover slips is performed as described (Eckner, R., et
al.,
Genes Dev. 8:869-884 (1994)). Cells are fixed in 3% paraformaldehyde/2%
sucrose in PBS for 10 min at room temperature, washed twice with PBS, and then
permeabilized in ice-cold Triton X-100 buffer (50 mM NaCI, 3 mM MgCl2,
200 mM sucrose, 10 mM HEPES [pH 7.~1], 0.5% Triton X-100) for 5 min.
CA 02268457 1999-04-19
-90-
Primary antibody incubations are for 30 min at 37 °C, followed by three
washes
for 5 min each with PBS. Species-specific, iluorochrome-conjugated secondary
antibodies are incubated in a similar fashion. Immunofluorescence is recorded
using a Zeiss confocal microscope (available at Queen's University, Cancer
Research Laboratories, Kingston, Ontario, (Janada).
General Discussion for Examples 1-9
We have identified novel human and mouse genes that are structural
homologues of the fission yeast radl+ checkpoint control gene. The sequence
similarity extends over the entire coding regions, indicating that the
isolated
cDNAs are fixll length. Particularly high levels of conservation were seen in
the
putative exonuclease domains, as well as in the leucine-rich region, which
have
been previously defined (Onel, K., et al., Genetics 143:165-174 (1996)). The
extent o f amino acid conservation between BRAD 1 p and rad 1 p, 27% identity
and
53% similarity, is comparable to that observed between Radlp and RADl7p
(23% identity, 50% similarity), which have been shown by independent means
to be involved in checkpoint control in fission and budding yeast,
respectively
(Lydall, D., and Weinert, T., Science 27(7:1488-1491 (1995)). In different
regions, HRADlp (SEQ ID N0:2) and MRADlp (SEQ ID N0:4) appear more
like each of Radlp (SEQ ID N0:26), RADl7p (SEQ ID N0:27), and RECIp
(SEQ ID N0:25).
While it has previously been clearly demonstrated that REClp (SEQ ID
N0:25) is a 3'-5' exonuclease, it has also beE,n demonstrated that this
fiznction is
not required for checkpoint control by this. protein (Onel, K., et al.,
Genetics
143:165-174 (1996)). The sequence similaril:y between HRAD lp, MRAD lp, and
other members of the family over the exo II and exo III domains is high, but
less
high in the exo I domain.
In the present studies, we were able: to show that HRADl can partially
rescue radiation sensitivity in radl: : ura4~~ mutant yeast, but fails to
rescue
hydroxyurea sensitivity. This partial complementation indicates that HRADI is
a likely human homologue of fission yeast radl+. Cross-species complementation
by checkpoint genes has been demonstrated in other cases, but full
CA 02268457 1999-04-19
-91-
complementation of all the defects of an:y particular mutant has not been
observed. For example, the human homologue of S. pombe rad9+ restores
resistance to treatment with hydroxyurea to the rad9 null mutant, but fails to
rescue LTV sensitivity (Lieberman, H.B., eat al., Proc. Natl. Acad. Sci. USA
93:13 890-13 895 ( 1996)). FRPI lATR has al.;o been shown to rescue some of
the
checkpoint defects in MECl mutant S. cerevisiae, but not in rad3- S. pombe
(Bentley, N.J., et al., EMBO J. 15:6641-66~~ 1 (1996)).
In mammalian cells, the G1 checkpoint is regulated in part by the p53 and
ATM genes, and defects in these genes have been associated with a variety of
human cancers (Livingstone, L. R., et al., Cell 70:923-935 ( 1992); Yin, Y.,
et al.,
Cell 70:937-948 (1992); Malkin, D., et al., Science 250:1233-1238 (1990);
Srivastava, S., et al., Nature 348:747-749 (1.990); Swift, M.., et al., N.
Engl. J.
Med. 325:1831-1836 (1991); Savitsky, K., et al., Science 268:1749-1753 (1995);
Dulic, V., et al., Cell 76: 1013-1023 (1994); Kastan, M.B., et al., Cancer
Res.
51:6304-6311 (1991); Kuerbitz, S.J., et al., l°roc. Natl. Acad. Sci.
USA 89:7491-
7495 (1992); O'Connor, P.M., et al., CancerRes. 53:4776-4780 (1993); Kastan,
M.B., et al., Cell 71:587-597 (1992); Swift, M., et al., New Engl. J. Med
216:1289-1294 (1987)). By contrast, very little is known about the molecular
control of the G2 checkpoint in mammalian cells. Like yeast, mammalian cells
will respond to DNA damage or incompletc;ly replicated DNA by arresting the
cell cycle in G2, prior to entry into mitosis. The presence of such a G2
checkpoint has been shown to correlate with viability after exposure to
radiation
(Cheong, N., et al., Mutat. Res. 274:111-122 (1992); Knox, S.J., et al.,
Radiat.
Res.135:24-31 (1993); McKenna, W.G., et al., Radiat. Res.125:283-287 (1991);
Nagasawa, H., et al., Int. J. Radiat. Biol. 66::573-379 (1994); Su, L.N., and
Little,
J.B., Radiat. Res. 133:73-79 (1993)).
As a result of the present invention, there are now three candidates for
human G2 checkpoint control genes: h~RADl , HRAD9, and FRPI lATR,
homologues of the radl+, rad9+, and rad3'+ genes of S. pombe, respectively.
HRAD1, HRAD9 and ATR have been shown to rescue some of the defects in
checkpoint-deficient fission and budding; yeast. Interestingly, BRCAIp
colocalizes with the repair protein RADS l p, and both are found in regions of
CA 02268457 1999-04-19
-92-
meiotic chromosomes similar to where FRF' lp/ATRp is located (Keegan, K.S.,
et al., Genes Dev. 10:2423-2437 (1996); Scully, R., et al., Cell 88:265-275
(1997)). Genetic evidence from yeast indicates that radl+, rad3+ and rad9+ are
part of the same G2 checkpoint control pathway, and may form a physical
complex. This suggests that HRADIp, as the homologue of Radlp, may be part
of a multisubunit complex that includes other checkpoint proteins, including
HRAD9p, FRPlp/ATRp, RADSlp, and BR.CA1.
It has been shown that caffeine treatment partially restores sensitivity to
radiation in cell lines which have lost G1 checkpoint control through the loss
of
p53 (Russell, K.J., et al., Cancer Res. 55:1639-1642 (1995); Yao, S.-L., et
al.,
Nature Med. 2:1140-1143 ( 1996)). Presumalbly, the loss of the ability to
undergo
apoptosis in response to radiation in p53 mutant cells leads to radiation
resistance. Caffeine is presumed to eliminate the G2 checkpoint in these
cells,
leading to radiation-induced death by premature mitosis, typical of checkpoint-
defective cells. Directly targeting HRADI or HRAD 1 p could be an efficient
way
of targeting human G2 checkpoint control. If elimination of G2 checkpoint
function would restore sensitivity to radiation or chemotherapeutic drugs to
cells
which have lost G1 checkpoint function (e.g.,. p53-'- cells), there will be
therapeutic benefits to inhibiting HRADl or other G2 checkpoint control genes
and protein functions, in conjunction with radio- or chemo- therapies.
Introduction for Examples 10-12
As noted above, the eukaryotic cell cycle consists of a number of tightly
regulated events whose precise order ensures that the important tasks of DNA
replication and cell division occur with high fidelity. Cells maintain the
order of
these events by making later events dependent on the successful completion of
earlier events. This dependancy is enfon;ed by cellular mechanisms called
checkpoints (Weinert, T.A., and Hartwell, L.H., Science 241:317-22 (1988);
Weinert, T.A., and Hartwell, L.H., Mol. Cell. Biol. 10:6554-64 (1990)). The
DNA damage (G2) and DNA replication (S-phase) checkpoints arrest eukaryotic
cells at the G2/M transition in the presence of damaged or incompletely
replicated DNA, respectively (Weinert, ~C.A., and Harlwell, L.H., Science
' CA 02268457 1999-04-19
-93-
241:317-22 ( 1988); Weinert, T.A., and Hartwell, L.H., Mol. Cell. Biol.
10:6554-
64 ( 1990); Epoch et al. , Cell 60:665-673 ( 1990); al-Khodairy et al., EMBO
J.
11:1343-1350 (1992); Epoch, T., et al., Genes Dev. 6:2035-46 (1992); Rowley,
R., et al., EMBOJ. 11:1335-42 (1992); al-Klaodairy et al., Mol. Biol. Cell
5:147-
160 ( 1994)). This arrest provides time for tree cell to repair damage or
complete
replication prior to entry into mitosis.
Evidence according to the best current model indicates that in the fission
yeast Schizosaccharomyces pombe, the ultimate target of the G2 checkpoint
signals is the tyrosine 15 residue of the cyclin dependent kinase Cdc2 (Epoch
et
al., Cell 60:665-673 ( 1990); O'Connell et al., EMBO.L 16:545-554 ( 1997);
Rhind
et al., Genes Dev. 11:504-S11 (1997)). '.Phosphorylation of this residue is
regulated primarily by the Cdc25 phosphatase and the Weel protein kinase, and
the activity of these enzymes is regulated in turn by the kinases Chkl and
Cdsl,
respectively (Walworth et al., Nature 363:368-371 (1993); Furnari et al.,
Science
277:1495-1497 (1997)). Chkl is only required for the DNA damage checkpoint
(Walworth et al., Nature 3b3:368-371 (199?) and functions by phosphorylating
and inhibiting Cdc25, thereby preventing Cdc2 dephosphorylation and mitotic
entry (Fumad et al. 1997). When the S-phase checkpoint is triggered,
activation
of Cdsl results in activating phosphorylation of Weel, which then results in
inhibitory phosphorylation of Cdc2 (Boddy et al., Science 280:909-912 (1998)).
While the mechanistic detail involved in the; G2 checkpoints upstream of these
proteins is unclear, it is known that a group of six proteins in fission yeast
are
required for both G2 and S-phase checkpoint control. These proteins are Radl,
Rad3, Rad9, Rad 17, Rad26, and Hus 1, and are collectively termed the
checkpoint
rad proteins (al-Khodairy and Carr, EMBO,1. 11:1343-1350 (1992); Epoch, T.,
et al., Genes Dev. 6:2035-46 (1992); Rowlt;y, R., et al.) EMBO J. 11:1335-42
(1992); al-Khodairy et al., Mol. Biol. Cell .S: 147-160 (1994)). Evidence that
these genes are all critical components of both the damage and replication
checkpoints is based on observations that t:he checkpoint rad mutants, unlike
wild-type cells, do not block mitotic entry in response to DNA-damaging agents
or transient inhibition of DNA synthesis (al-Khodairy and Carr, EMBO J.
11:1343-1350 (1992); Epoch, T., et al., Genes Dev. 6:2035-46 (1992); Rowley,
CA 02268457 1999-04-19
-94-
R., et al., EMBO J. 11:1335-42 (1992); al-Kt~odairy et al., Mol. Biol. Cell
5:147-
160 (1994)). The checkpoint rods are placed upstream of the Cdc2 regulators in
the emerging checkpoint signal transduction pathway because the checkpoint-
induced phosphorylation of the Chkl and Cdsl kinases are dependent on the
presence of all of the checkpoint rod proteins (Walworth et al., Science
271:353-
356 (1996); Lindsay et al., Genes Deu 12:382-395 (1998)). More recently, it
was shown that Rad 1 and Hus 1 form a stable complex that is dependant on
Rad9,
suggesting that these three proteins may exist in a three way.-complex in
fission
yeast (Kostrub et al., EMBO J. 17:2055-2066 (1998)).
Many of the genes involved in the G2 checkpoint pathways are conserved
between humans and yeast. By the present invention and other work, human
homologs of all of the fission yeast checkpoint rods, except Rad26, have been
identified, suggesting that the fission yeast G2 checkpoint signaling
mechanism
may be similar to that of humans (Cimprich et al., Proc. Natl. Acad. Sci. USA
93:2850-2855 (1993); Lieberman, H.B., et al., Proc. Natl. Acad. Sci. USA
93:13890-13895 (1996); Kostrub et al.) EMBOJ. 17:2055-2066 (1998); Parker
et al., J. Biol. Chem. 273:18332-18339 (1f98); Parker et al., J. Biol. Chem.
273:18340-18346 (1998); Udell et al., Nucl. Acids Res. 26:3971-3978 (1998)).
In accordance with this hypothesis, Chk2, the :human equivalent of S. pombe
Cdsl
protein kinase, has recently been shown to block Cdc2-regulated mitotic entry
in
response to G2 checkpoint activation, by phosphorylating Cdc25C (Matsuoka et
al., Science 282:1893-1897 (1998)). Furthermore, this response is dependent on
ATM, a human homolog of fission yeast Rad3 (Savitsky, K., et al., Science
268:1749-53 (1995); Savitsky et al., Hum. Mol. Gen. 4:2025-2032 (1995)).
Therefore, the human equivalents of the checkpoint rods appear to be
functioning
upstream of the Cdc2 regulatory machinery, .as they do in fission yeast.
In the following Examples, we identify further conservation between the
fission yeast and human G2 checkpoints by demonstrating that human homologs
of S. pombe checkpoint rods, HRAD 1, HRAfr~9, and hHUS 1, physically interact
with one another in vivo. We have also previously shown that endogenous
HR.AD9 is phosphorylated and that it localizes primarily to the nucleus in
unperturbed HeLa and HaCaT cells.
CA 02268457 1999-04-19
-95-
Example 10: Interaction Between hHUSl and HFtADl
An interaction between Hus 1 and Ra.dl has been previously described in
S. pombe (Kostrub et al., EMBO J. 17:2055-2066 (1998)). Therefore, we
investigated whether a similar interaction existed between hHUS 1 and HRAD 1.
We co-transformed pGBT9-hHUSI and pGAD-HRAD1 into HF7c and looked
for activation of the HIS3 reporter gene b;y subculturing co-transformants on
triple dropout media (Figure 8a). The same positive and negative controls were
used as before. While neither fusion plasmid on its own was sufficient for
growth
in the absence of histidine, co-transformation of pGBT9-hHUS l and pGAD-
HRAD 1 resulted in viable HIS+ co-transformants. These results suggested that
a specific interaction existed between hHUSI and HRAD1.
To confirm this interaction, exogenously expressed HRAD1 and hHUS 1
were co-immunoprecipitated in COS-1 cells (Figure 8b) using FLAG epitope-
tagged HRAD 1 and myc epitope-tagged hHUS 1. HLFf and FerONm were
included as negative controls to ensure the specificity of the interaction.
Cells
were co-transfected as indicated with HF;AD 1,lhHUS 1 m, HLF,JhHUS 1 m, or
HRAD I,JFerONm. The cells were harvested 48 hours after transfection, lysed,
and immunoprecipitated with either a-FLAG M2 monoclonal anitbody or a-myc
9E10 monoclonal antibody. Two aliquots lFrom each sample were subjected to
electrophoresis through two identical polyacrylamide gels, one of which was
used
for an a-FLAG western blot and the other for an a-myc western blot. Although
exogenous HRAD 1 f protein levels were approximately equivalent in both
pyDF31-HRAD1 transfections (Figure 8b, lanes 1 and 3), HF,AD1 f
immunoprecipitated only with hHUS lm (Fii;ure 8b, lane 1) and not with FerONm
(Figure 8b, lane 3). Similarly, hHUSIm immunoprecipitated with HRADIf
(Figure 8b, lane 1 ), but not with HLFf (Figure 8b, lane 2). Together, these
results
indicate the existence of a specific physical interaction between hHUS 1 and
HRAD 1.
Example 11: Interaction Between HRAlD9 and HF~AD1
Having observed the two interactions described in Example 10, we next
explored the association status of HRAD~> and HR.AD1. Using the pGBT9-
CA 02268457 1999-04-19
-96-
HRAD9 and pGAD-HRAD 1 GAL4 fusion constructs, we repeated the yeast two-
hybrid experiment described above (Figure 9a). Despite growth of the
p53/pSV40 T-Ag positive control (Figure 9a, lower left quadrant), co-
expression
of HRAD9 and HRAD 1 filsions failed to assc;mble a filnctional GAL4, and hence
did not produce viable yeast in the absence of histidine (Figure 9a, lower
right
quadrant). Therefore, while the yeast two-hybrid system demonstrated
interactions between hHUS 1 and HRAD9, and hHUS 1 and HRAD 1, it showed
no interaction between HR.AD9 and HRAD 1.
To confirm this result, we examined the ability of HRAD9 and HRAD 1
to co-immunoprecipitate in COS-1 cells (Figure 9b). HRAD9m and HItAD 1 f
were exogenously expressed either together, or separately with HLFf or Fer~Nm
as described in Example 10. Neither HRAID 1 nor HRAD9 protein expression
levels varied significantly between different transfections. Contrary to the
yeast
two-hyrbrid data, HRAD9m but not Fer~N"" immunoprecipitated with HRAD 1"
and HRAD 1 ~, but not HLF~, immunoprecipitated with HRAD9m. Therefore,
while HItADl and WAD9 show no interaction in the two-hybrid system, they
do specifically co-immunoprecipitate with each other when exogenously
expressed in COS-1 cells.
Example 12: Association of H1RAD1 with Phosphorylated HltAD9
In immunoprecipitations performed using antibodies directed against
either native or epitope tagged HRAD9 (see Example 11, Figure 9), we noted
multiple discrete bands in western analyses. We have gone on to demonstrate
that these bands are the result of phosphorylation, using both epitope tagged
exogenously expressed I~AD9 in COS-1 cells, as well as using endogenous
HRAD9 in HeLa cells (Figure 10). COS-~ 1 cells were transfected with our
HRAD9",y~ expressing construct, and harvested 48 hours later. Alternatively,
HeLa cells were simply harvested at SO% confluency. The cells were lysed and
immunoprecipitated with 9E 10 monoclonal antibody directed against the myc
epitope, or with a-HRAD9 antibodies, respectively. Immunoprecipitates were
either untreated, or treated with calf intestinal phosphatase (CIP) in the
presence
or absence of the phosphatase inhibitor sodium orthovanadate. Samples were
CA 02268457 1999-04-19
-97-
then subjected to SDS polyacrylamide ;gel electrophoresis (SDS-PAGE),
transferred to nitrocellulose, and immunolblotted with a-myc or a-H1RAD9
antibodies. Figure 10a, lane 1, shows the multiple banding pattern of HRAD9my~
in immunoblots, similar to that seen in Figure 9. Treatment with C1P caused
the
slower migrating bands to disappear, leaving only the fastest form. This
effect
was eliminated by the presence of vanadate, confirming that the slower
migrating
bands are the result of multiple phorphoryla~tion states of HRAD9mY~. In HeLa
cells, only a single slower migrating band was observed (Figure 1 Ob, lane 1
). The
HRAD9 can be converted to the faster migxating, de-phosphorylated form by
treament with CIP, and this reaction was also found to be sensitive to sodium
orthovanadate (Figure l Ob, lanes 2 and 3), indicating that endogenous HRAD9
is phosphorylated in HeLa cells.
We have also noted that the most heavily phosphorylated forms of
HRAD9 are preferentially bound by HRAD1 (Figure lOc). An
immunoprecipitation of HRAD9 followed by an a-HRAD9 western shows
approximately equal amounts of each phosphorylated form of H1ZAD9 are
present in cells, while if the same sample is immunoprecipitated with a-Flag
(HRAD1), followed by a HRAD9 western;, the most heavily phosphorylated
forms of H1RAD9 are selectively, thoul;h not exclusively, precipitated.
Confirmatory dephosphorylation experiments on HR.AD9 in HRAD 1
immunoprecipitations are shown on the right hand side of Figure 1 Oc. This is
the
first indication that phosphorylation of HltAD9 influences complex formation
with other members of the G2 checkpoint protein family.
General Discussion for Examples 10-12
We have demonstrated three interactions between three human checkpoint
rad proteins, HRAD1, »tAD9, and hHUS 1. In all cases, these interactions were
substantiated using both the yeast tyro-hybrid system and by co-
immunoprecipitation, except for HRAD 1 and H1RAD9 which did not interact in
the yeast two-hybrid, but did co-immunoprecipitate when exogenously expressed
in COS-1 cells. The original observation that led to this work was that H1RAD9
interacted with hHUS 1 in a two-hybrid screen. Nine of 15 interactions
isolated
CA 02268457 1999-04-19
-98-
in the screen that used HRAD9 as bait were 11HUS 1. It is interesting to note
that
HRAD 1 was not among the remaining isolates; however, the observation that
HRAD 1 and HRAD9 show no interaction in the two-hybrid confirms previous
results (Parker et al., J. Biol. Chem. 273:18332-18339 (1998); Parker et al.,
J.
Biol. Chem. 273:18340-18346 (1998)). It now appears that this interaction may
be dependant on factors that are absent in budding yeast, since HRAD 1 and
HRAD9 specifically co-irnmunoprecipitate in COS-1 cells. Such factors may
include a budding yeast equivalent of hHLJS 1, the existence of which seems
unlikely considering that no homologs have been identified based on sequence.
Alternatively, the N-terminal GAL4 domain of the fusion proteins may result in
a conformational change that prevents association of these two proteins. This
hypothesis is supported by our observation 'that reversing the orientation of
the
HRAD9/ hHUS 1 and HRAD 1 / hHUS 1 C?AL4 fusions, abolishes the HIS3
reporter gene activation (data not shown). Furthermore, an N-terminal myc
tagged version of fission yeast Hus 1 has bec,n shown to function as a
dominant
negative allele (Kostrub et al. , Mol. Gen. Genet. 254:389-399 ( 1997)).
Future use
of dominant negative fusions involving human proteins could prove invaluable
in uncovering the mechanistic details involved in checkpoint signaling.
It has been shown in fission yeast that Husl and Radl interact, and that
this interaction is dependent on the presence of Rad9, as interaction does not
occur in a rad9 null background (Kostrub et czl., EMBO J.17:2055-2066 (
1998)).
Our data presented here offer strong evidence that such a complex also exists
in
humans, although it may be assembled differently. While we have examined
pairwise interactions between the three human checkpoint proteins in the
present
examples, the simplest explanation of the present data and the yeast data
together
is that a three way complex exists between HRAD1, IiRAD9, and hHUSl. We
cannot rule out the possibility that the ob;cerved HRAD1-hHUSI interaction
described here are bridged by DDC1, the S. cerevisiae homolog of HRAD9
(Longhese et al., EMBO J. 16:5216-5226 (1!97); Paclotti et al. 1998), or by
and
endogenous monkey homolog of HRAD9 iin COS-1 cells: such evidence will
ultimately have to be achieved using HRAI)9 null cell lines. Further, with the
highly similar phenotypes observed in all ~of the fission yeast checkpoint rad
.
CA 02268457 1999-04-19
-99-
mutants, and considering recent data delr~onstrating an interaction between
HRAD1 and HRAD17 (Parker et al., J. Biol. Chem. 273:18332-18339 (1998);
Parker et al., J. Biol. Chem. 273:18340-18346 (1998)), and that ATR, a human
homolog of fission yeast Rad3, exists predominantly as part of a high
molecular
weight complex (Wright etal., Proc. Natl. Acad. Sci. USA 95:7445-7450 (1998)),
the potential for a multi-protein complex involving all of the checkpoint rad
proteins must not be overlooked.
We have also shown here that both exogenous and endogenous HRAD9
is phosphorylated at multiple sites. Considtering that S. cerevisiae DDC 1 and
S. pombe Hus 1 both appear to be phosphorylated in response to DNA damage
(Kostrub et al., Mol. Gen. Genet. 254:389-399 (1997); Paciottl et al. 1998),
phosphorylation is an integral component of checkpoint signaling. To determine
if checkpoint activation affects HRAD9 phosphorylation, we investigated
whether y-radiation or hydroxyurea could induce a change in the migration
pattern of endogenous HRAD9 on a western blot. Neither a 4 Gy dose of gamma
radiation, nor incubation in 0.1 mM hydrox~rurea for up to 24 hours affected
the
migration of endogenous HRAD9 from HaC'aT cells, though HRAD9 is already
highly phosphorylated in these cells. We cannot rule out the possibility that
ongoing replication or the presence of endogenous DNA damage may be
inducing HRAD9 phosphorylation in the absence of exogenous signals. It is
worth noting that phosphorylation is not an absolute requirement for
association
of HRAD9 and HRAD1, as a HR.AD1 immunoprecipitation will co-
immunoprecipitate all forms of HRAD9, although the present data demonstrated
that the most highly phosphorylated forms were preferentially co-precipitated.
Finally, we have investigated the sub-cellular localization ofHR.AD9, and
we have shown that HRAD9 is a nuclear protein. This observation was not a
foregone conclusion, as the start of the checkpoint signal transduction
pathway
is nuclear (DNA damage), while the end is cytoplasmic(the cell cycle
machinery).
Unlike HRAD1, which has been shown to be present mainly in a diffuse pattern
in the nucleus (Freire et al., Genes Dev. x'2:2560-2573 (1998)), the staining
pattern of HRAD9 within the nucleus shows discrete areas of intense staining.
CA 02268457 1999-04-19
-100-
As alluded to above, one reason for the current intense interest in cell
cycle checkpoint control is the association of defects in checkpoint control
with
human cancers. Genomic instability is a common feature accompanying
checkpoint loss, regardless of which checkpoint is compromised, and whether or
S not the cell is subjected to exogenous stresses (Weinert, T.A., and
Hartwell, L.H.,
Mol. Cell. Biol. 10:6554-64 (1990); Livings;tone et al., Cell 70:923-935
(1992);
Yin, Y., et al., Cell 70:937-48 (1992)). A great deal of evidence now links
genomic instability with the mufti-step oril;in of human cancer (Loeb, Cancer
Res. 51:3075-3079 (1991); Hartwell, Cell 71:543-546 (1992); Meyn, CancerRes.
55:5991-6001 (1995); Smith et al., Curr. Opin. Oncol. 7:69-75 (1995); Thrash-
Bingham et al., Cancer Res. 55:6189-6195 (1995); Tlsty et al., Mutat. Res.
337:1-7 (1995); Loeb et al., Mutat. Res. 350:279-286 (1996); Perucho, Biol.
Chem. 377:675-684 (1996)). The number ofcheckpoint control genes which act
as tumor suppressors under normal circumstances is growing, and currently
includes p53 (Malkin, D., et al., Science 2~~0:1233-1238 (1990); Kastan et
al.,
Cell 71:587-597 (1992); Kuerbitz et al., Proc. Natl. Acad. Sci. USA 89:7491-
7495 (1992)), ATM (Savitsky, K., et al., Science 268:1749-53 (1995); Savitsky
et al., Hum. Mol. Gen. 4:2025-2032 (1995); Xu et al., Genes Dev. 10:2401-2410
(1996)), and hBUBl (Cahill et al., Nature 392:300-303 (1998)). While none of
the checkpoint rad proteins has yet been shown to act per se as a tumor
suppressor, several have been mapped to regions associated with loss of
heterozygosity in human tumors, which is :indicative of the presence of tumor
suppressing genes Lieberman, H.B., et al., Proc. Natl. Acad. Sci. USA 93:13890-
13895 (1996); Parker et al., J. Biol. Chem. 273:18332-18339 (1998); Parker et
al., J. Biol. Chem. 273:18340-18346 (1998)). Also, genomic instability has
been
associated with G2 checkpoint deficiency in budding yeast rad9 mutants
(Weinert, T.A., and Hartwell, L.H., Mol. Cell. Biol. 10:6554-64 (1990)).
Having now fully described the present invention in some detail by way
of illustration and example for purposes of clarity of understanding, it will
be
obvious to one of ordinary skill in the art that the same can be performed by
modifying or changing the practice of the invention within a wide and
equivalent
CA 02268457 1999-04-19
-1~1-
range of conditions, formulations and other parameters without affecting the
scope of the invention or any specific embodiment thereof, and that such
modifications or changes are intended to be encompassed within the scope of
the
appended claims.
All publications, patents and patent applications mentioned in this
specification are indicative of the level of skill of those skilled in the art
to which
this invention pertains, and are herein incorporated by reference to the same
extent as if each individual publication, patent or patent application was
specifically and individually indicated to be: incorporated by reference.
