Note: Descriptions are shown in the official language in which they were submitted.
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22l98
-I
DESCRIPTION
INACTIVATION OF HIV CO-RECEPTORS AS THERAPY FOR HIV INFECTION
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates generally to the fields of HIV infection. More
particularly,
it concerns novel methods and compositions for the treatment of HIV infection
and methods for
confernng HIV resistance.
2. Description of Related Art
Human Immunodeficiency Virus-1 (HIV-1) infection has been reported throughout
the
world in both developed and developing countries. HIV-2 infection is found
predominately in
West Africa, Portugal and Brazil. It is estimated that as of 1990 there were
between 800,000 and
1.3 million individuals in the United states that were infected with HIV. An
important obstacle
to developing a vaccine against HIV is that the mechanism of immunity to HIV
infection is ill-
understood. Not all of those infected individuals will develop acquired
immunodeficiency
syndrome (AIDS). Indeed recent reports have suggested that there may be
certain individuals
that are resistant to HIV-1 infection.
C-C chemokine receptor (CCR)-5 is the principal co-receptor of the macrophage
(M~)-tropic human immunodeficiency virus (HIV)-1 (Cocchi et al., Science,
270:1811-1815,
1995; Deng et al., Nature, 3 81:661-666, 1996; Dragic et al., Nature, 3 81:667-
673, 1996;
Alkhatib et al., Science, 272:1955-1958, 1996; Choe et al., Cell, 85:1135-1
I48, 1996; Doranz et
al., Cell, 85:1149-1158, 1996). Several recent studies have shown that
individuals with a
homozygous defect in CCRS are resistant to HIV-1 infection with no apparent
clinical conditions
associated with the CCRS defect. HIV-1 infected individuals with a
heterozygous CCRS defect
' exhibit slower disease progression (Liu et al.) Cell, 86:367-377, 1996;
Samson et al., Nature,
382:722-725, 1996; Dean et al., Science, 273:1856-1862, 1996). In addition,
some individuals
whose lymphocytes express high levels of CC-chemokines are partially resistant
to HIV-1
infection (Paxton et al., Nature Med., 2:412-417, 1996).
CA 02273192 1999-OS-31
W0 98124923 PCT/US97/22198
w -2-
In light of the foregoing data it would be therapeutically beneficial to
prevent HIV-1
binding to the C-C receptors and thereby prevent HIV-1 infection of cells. One
way to achieve
this would be to prevent cell surface expression of the receptor. There are
numerous methods of
attempting abrogation of expression of a protein. These include homologous
recombination,
S antisense and ribozyme technologies and single chain antibodies to bind the
proteins
intracellularly. Each of these techniques has particular disadvantages.
Homologous
recombination techniques are difficult to use in a clinical applications,
whereas anitsense and
ribo~yme technologies require introduction of high concentrations of genetic
material and
present incomplete and non-specific effects. The monoclonal antibody approach
takes a long
time to develop and has the further complication that the antibody may be too
specific and thus
will not achieve a broad enough inhibition.
Thus it is clear that an easy efficient technique is needed to prevent the C-C
chemokine
receptors from being expressed at the cell surface of lymphocytes so that they
do not present the
opportunity for HIV to infect the cells.
SUMMARY OF THE INVENTION
The present invention seeks to overcome certain drawbacks in the prior art by
providing
compositions and methods for use in therapy or prevention of HIV infection and
in the
prevention or treatment of opportunistic infections in AIDS or ARC patients.
The present
invention provides lymphocytes that are resistant to HIV infection due to the
lack of an
expressed co-receptor. By co-receptor is meant a receptor on the lymphocyte
surface that is
necessary for HIV infection, other than the CD4 receptor, which is also
necessary for HIV-1
infection. In an embodiment of the invention, healthy lymphocytes that are
resistant to HIV
infection may be provided to a patient, thus maintaining a desirable level of
immune cells during
an HIV infection, thus helping the patient resist secondary infections. The
compositions and
methods disclosed herein will be particularly effective in conjunction with
other forms of
therapy, such as AZT and/or protease inhibitors that are designed to inhibit
viral replication, by
maintaining desirable levels of white blood cells. This, in effect, buys the
patient the time
necessary for the anti-viral therapies to work.
The present invention may be described in a certain broad aspect as an
expression vector,
wherein the expression region comprises in a 5' to 3' orientation: a promoter;
an intracellular
CA 02273192 1999-OS-31
WO 98/24923 PCTIUS97I22198
-3-
retention signal sequence encoding region; and a chemokine encoding gene;
wherein the
intracellular retention signal sequence and the chemokine encoding gene are
expressed as a
single intrakine transcript. The term "intrakine" has been coined by the
present inventors to
indicate a chemokine that is directed by a signal sequence to be retained in
an intracellular
compartment such as the lumen of the endoplasmic reticulum, the Golgi
apparatus, a lysosome,
an intracellular vesicle or other intracellular organelle. A vector of the
present invention may
also encode a secreted chemokine, preferably expressed from an internal
ribosome entry site
(IRES). The secreted chemokine preferably binds fo the same chemokine receptor
as the
expressed intrakine. In this way, the transduced cells that are resistant to
HIV infection because
of phenotypic knockout of the co-receptor are also able to inhibit infection
of non-transduced,
susceptible cells, by secreting a chemokine that competes with HIV for co-
receptor binding. The
secreted chemokine and/or the intrakine may also be a mutated form of
chemokine that maintains
receptor binding, but lacks biological activity. Such a chemokine analog in
which eight amino
acids are deleted from the N-terminus is described by Arenzana-Seladedos et
al, Nature, 383:
400, 1996 (incorporated herein by reference). In the practice of the
invention, one or more of the
N-terminal amino acids may be deleted to obtain such a chemokine analog.
A preferred expression vector of the present invention is a retroviral vector,
but any type
of vector known in the art may be used. For example, one may use an adenoviral
vector, an
adeno associated viral vector, a plasmid, a cosmid, liposome encapsulated DNA
or even RNA in
the practice of the invention. The inventors have demonstrated herein the use
of an endoplasmic
reticulum retention signal sequence, however, any signal sequence that directs
a translation
product to an intracellular organelle as described above may be used. A
preferred signal
sequence is a KDEL sequence.
The expression vector of the present invention preferably encodes a chernokine
gene
product that binds to a C-C chemokine S receptor, a C-C chemokine 3 receptor,
a C-C
chemokine 1 receptor or a CXR4 receptor. Preferred chemokines include, but are
not limited to
RANTES, MIP-la or SDF.
The present invention may also be described in certain broad aspects as a
method of
inhibiting phenotypic expression of a chemokine receptor in a cell, wherein
the method
comprises blocking cell surface expression of a chemokine receptor. This
method may be further
defined as comprising the steps of obtaining a vector comprising a nucleic
acid segment
encoding in a 5' to 3' orientation, a promoter, an intracellular retention
signal sequence and a
CA 02273192 1999-OS-31
WO: 98/24923 PCT/US97/22198
-4_
cherriokine receptor binding polypeptide gene; and transducing the vector into
the cell; wherein
the vector expresses the nucleic acid sequence to produce a fusion polypeptide
when transduced
into the cell. The expressed polypeptide may be a chemokine, a chemokine
analog, such as a
chemokine with an N-terminal deletion of up to eight amino acids, an antibody
such as a single
chain antibody or a peptide that binds the receptor. In the practice of the
invention, one may,
using techniques well known in the art, isolate peptides from a peptide
expression library, for
example, that are able to bind the chemokine receptors described herein. The
expression of any
of such peptides as a fusion with a leader sequence to direct the
peptide/receptor to an
intracellular organelle, as described herein, either a known or newly
discovered peptide would be
encompassed by the present invention. Preferred polypeptides include RANTES,
MIP-1 a, SDF,
HIV gp120 or the V3 region of HIV gp120.
In certain broad aspects, the invention may be described as a method of
inhibiting HIV
infection of a cell comprising phenotypic knock-out of an HIV co-receptor in
the cell. In the
practice of this method, the co-receptor is preferably the C-C chemokine 5
receptor, the C-C
chemokine 3 receptor, the C-C chemokine 1 receptor or the CXR4 receptor. The
phenotypic
knockout may be by any method known in the art, such as anti-sense expression,
genomic
recombination, or preferably by expressing a receptor binding polypeptide
fused to an
intracellular retention signal sequence .in the cell. In the practice of the
method, an intracellular
retention signal sequence directs the fusion polypeptide to the endoplasmic
reticulum, the Golgi
apparatus, a lysosome or intracellular vesicle or other intracellular
organelle. In the practice of
such methods, the vector may be a viral vector, or even a retroviral vector,
for example, and the
cell may be a lymphocyte, monocyte, macrophage or a stem cell. A preferred
intracellular
retention , signal sequence is an endoplasmic ~ reticulum signal sequence such
as a KDEL
sequence. The receptor binding polypeptide of the present method is preferably
a CC-
chemokine, a CXC chemokine, an analog of a CC or CXC chemokine, a single chain
antibody,
an HIV gpi20 protein, a V3 region of HIV gp120 or a peptide that binds to the
receptor.
In an exemplary embodiment of the method, a cell is transduced with a CC-
chemokine
gene fused to an endoplasmic reticulum (ER)-retention signal to
intracellularly block the
transport and surface expression of an endogenous CC receptor, especially a
CCRS, CCR3 or
CCR1 receptor. In an alternate exemplary embodiment, a cell is transduced with
a C'.XC'.-
chemokine gene fused to an endoplasmic reticulum (ER}-retention signal to
intracellularly block
the transport and surface expression of an endogenous CXR4 receptor.
CA 02273192 1999-OS-31
WO 98/24923 PCTIUS97I22198
-5-
Another broad aspect of the present invention is a method of treating an HIV
infection in
a subject comprising administering to-the subject lymphocytes, monocytes,
macrophages or stem
cells wherein the administered cells exhibit a phenotypic knock out of an HIV
co-receptor. In a
preferred embodiment of the method, the cells are transduced ex vivo with a
vector that expresses
a polypeptide that is able to bind the newly expressed vector and retain it in
an intracellular
organelle as described herein. The cells may preferably be autologous
lymphocytes,
macrophages, monocytes, stem cells or even heterologous stem cells. - In an
alternate
embodiment, the cell may express an antisense RNA effective to block
expression of the co-
receptor.
An embodiment of the present invention is also a method of increasing or
maintaining a
white blood cell (WBC) count in a subject with an HIV infection comprising
administering to the
subject a pharmaceutical composition comprising lymphocytes, monocytes,
macrophages or stem
cells transduced with a vector of the invention as described herein. In the
practice of the method,
the WBC count may be monitored on a regular basis, and when the count drops
below a certain
critical or dangerous level, then the transduced cells of the invention would
be administered in an
amount effective to keep the WBC count above the desired level. The cells
would be re-
administered every few weeks to months as needed. The intravenous infusion of
celis in a
pharmaceutical composition is well known in the art and could be practiced by
the skilled
practitioner in light of the present disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to further -
demonstrate certain aspects of the present invention. The invention may be
better understood by
reference to one or more of these drawings in combination with the detailed
description of
specific embodiments presented herein.
FIG.1. Schematic diagram of the strategy to phenotypically knock-out CCRS.
Lymphocytes or stem cells are genetically modified to co-express a mutated
chemokine, targeted
to the lumen of the endoplasmic reticulum (ER) that binds intracellularly and
prevents the
transport and surface expression of newly synthesized CCRS. The cells also co-
express a native
chemokine to be secreted out of the cell to competitively inhibit HIV-1
infection of susceptible
cells. As a result, the transduced cells with the phenotypic CCRS knock out
are not only
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
-6
resistant to HIV-I infection, but also produce chemokines to extracellularly
inhibit HIV-1
infection in susceptible cells.
FIG.2. Schematic representation of construction of expression vectors. The
human
MIP-1 a and RANTES cDNA genes and their derivatives containing an ER
retention~signal
(KDEL) were cloned into the pRc/CMV vector (Invitrogen). Bi-cistronic vectors
for
ca-expression of the native and mutated chemokines using an internal ribosome-
entry site (IRES)
sequence (Chen et al., Human Gene Ther., 7:1515-1526, 1996) were constructed,
and further
cloned into a retroviral vector (pLNCX) (Miller, Curr. Top. Microbiol.
Immunol. , I 5 8:1-24,
1992). A chimeric construct containing a short influenza hemagglutinin (HA)
tag sequence
(YPYDVPDYA SEQ ID NO:1 ) (Field et al., Mol. Cell. Biol., 8:2159-2165, 1988)
fused to the
N-terminus of CCRS (Liu et al., 1996) was also generated. ~I', packaging
sequence.
FIG. 3A, FIG. 3B, FIG. 3C and FIG. 3D. Blockade of surface expression of CCRS
by the
ER-retained MIP1-K. COS cells on 6-well plates were transfected with 2.5 pg of
pCMV-HA-CCRS alone (FIG. 3B), or co-transfected with different amounts of pCMV-
MIPI-K
(FIG. 3C and FIG. 3D). 48 hr later, the suspensions of transfected cells were
incubated with an
anti-HA antibody (BAbCo, Richmond, CA), and then stained with an anti-rabbit
IgG-FITC
conjugate (Sigma). COS cells were directly incubated with the second antibody
conjugate as a
negative control {FIG. 3A).
FIG. 3E. Inhibition of CCRS-mediated syncytium formation. HeLa-T4+ cells grown
on 6
well plates were transfected with 2 pg of pCMV-CCRS alone, or co-transfected
with different
amounts of chemokine expression vectors. 48 hr later, the transfected cells
were co-cultured
with COS cells expressing M~-tropic (ADA or YU2), or T-tropic envelope
proteins (IIIB), and
the syncytia in each well (duplicate) were counted 12 to 24 hr later. The
percentages of
inhibition of syncytium formation are presented. The syncytium formation of
ADA and YU2
was effectively inhibited by MIP I-K and RANTES-K intrakines, but the T-tropic
envelope-mediated syncytium formation was not inhibited by these intrakines.
FIG. 4A. Schematic representation of construction of expression vectors. The
SDF-1 gene
from a mouse spleen cDNA library was fused to a sequence encoding an ER
retention signal
(KDEL) and cloned into the pRc/CMV vector (Invitrogen). Bi-cistronic vectors
for
co-expression of the native and mutated chemokine using an internal ribosome-
entry site (IRES)
sequence (Chen et al., 1996) were constructed, and further cloned into a
retroviral vector
(pLNCX) (Miller, 1992). A chimeric construct containing a short influenza
hemagglutinin (HA)
CA 02273192 1999-OS-31
WO 98124923 PCTlUS97122198
tag sequence (YPYDVPDYA SEQ ID NO:1 ) (Field et al., 1988) fused to the N-
terminus of Eosin
(CXCR4) (Liu et al., 1996) was also generated. 'I', packaging sequence.
FIG. 4B. Resistance to T-tropic HIV-1 infection of transduced lymphocytes when
transduced with ER targeted SDF. Diamonds, JK-CTRL; Squares, JK-SDF-KDEL;
Triangles,
JK-SDF.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
- The present invention provides methods for treating and preventing HIV-1
infection. In
particular, the present invention employs novel methods for preventing the
cell surface
expression of C-C chemokine receptors, thereby preventing the binding of HIV
to its target cells.
The present invention also provides novel compositions for use in the
treatment and management
of HIV infection.
The phenotypic CCR knock-out can be achieved by genetically modifying
lymphocytes
to express intrakines, which result in resistance of permissive cells to Mc~-
tropic HIV-1 infection.
Significant advantages of this novel anti-HIV approach are outlined as
follows: Given the
well-documented importance of CCRS in HIV-1 infection and disease progression,
and the lack
of adverse clinical conditions associated with defects of CCRS expression,
reinfusion of
genetically modified lymphocytes or stem cells with phenotypic CCRS knock-out
may enable an
individual to partially or completely resist HIV-1 infection, and prevent or
delay disease
progression.
Currently described anti-HIV approaches are primarily targeted at viral
components, such
as viral envelope proteins, Tat, Rev or reverse transcriptase (RT), by anti-
sense constructs,
ribozymes, dominant negative mutants, intrabodies, or ER-retained CD4. A major
problem
facing anti-HIV therapy is frequent viral mutation, resulting in viral
resistance. In contrast, the
novel anti-HIV approach described herein is uniquely targeted at the cellular
receptor. As a
result, frequent HIV mutations may be unable to evade this strategy. It should
be noted that the
CD4 receptor is functionally indispensable, and therefore, not an appropriate
target for this
strategy.
Intrakines not only block CCRS, but also CCR3 and CCR1 which were also
reported as
co-receptors for some HIV-1 viruses, suggesting a broad effect on HIV-1. In
addition,
phenotypic CCR knock-out combined with extra-cellular inhibition of
susceptible cells by
CA 02273192 1999-OS-31
WO 98/24923 PGT/US97/22198
_g-
secreted chemokines is contemplated to have a synergistic anti-HIV effect. A
further advantage
of the present invention is that this approach is less technically challenging
than other gene
therapy- approaches. CCRS expression in human lymphocytes is very low (i. e.,
it cannot be
detected in radiolabeling), and therefore, expression levels of intrakines
achievable by currently
used expression vectors are expected to be sufficient to inactivate CCRS.
Another potential problem facing gene therapy is the host immune response
{cytotoxic
T-cells) that destroys genetically modified cells expressing foreign proteins.
However,
transduced cells expressing human chemokines as in the present disclosure
would not generate
new antigens. In addition, this approach can be used to phenotypically knock-
out other receptors
such as T-tropic HIV-1 co-receptor (Feng et al., Science, 272:872-877, 1996).
Thus, this novel
strategyas described herein provides an effective gene therapy for HIV-1
infection.
1. Human Inrmunodeficiency Virus
HIV is classified as a retrovirus because it contains reverse transcriptase.
Infection of
cells with HIV usually results in cell death. HIV presents two major antigenic
types, HIV-l and
HIV-2, that are readily distinguishable by differences in antibody reactivity
to the envelope
glycoprotein. HIV-l and HIV-2 share about 40% homology. It has been reported
that HIV-1 is
more efficient at causing AIDS than HIV-2.
The first step of HIV infection is the high affinity binding of gp 120
glycoprotein to the
CD4 receptor, present on the surface of many cell types including T4 cells,
monocyte
macrophages, dendriditic cells and cells of the central nervous system. The
high affinity of the
HIV envelope glycoprotein for the CD4 receptor is a crucial step in the
pathogenesis of HIV
since the major cells which express CD4 are the target cells (Dalgleish et
al., 1984; Klatzmann et
al., 1984; Maddon et al., 1986). Because T4 lymphocyte cells play a pivotal
role in all aspects of
- 25 the immune system, death or impairment of T4 lymphocyte function results
in catastrophic
immune dysfunction.
There are several ways in which HIV infection may directly result in the
destruction of
T4 cell function. HIV replication may kill T4 cells as a result of destruction
of the cell
membrane by viral proteins. Alternatively the production of large amounts of
viral genetic
material and proteins may interfere with normal cell metabolism and finally,
HIV may also infect
and destroy progenitor cells that are responsible for the propagation of the
lymphoid cell pool.
CA 02273192 1999-OS-31
WO 98124923 PCTJUS97/22198
-9-
- HIV infection may also indirectly cause T4 cell death. In one such mechanism
it is
thought that an autoimmune phenomena is triggered in which anti-HIV immune
responses are
targeted at uninfected T4 cells that either have free envelope proteins bound
to their membrane
or present processed antigens. Additionally since both the HIV envelope
protein and the class II
major histocompatibility complex (MHC) antigens bind to the CD4 receptor,
their common
binding sites may represent cross reacting antigens. Thus anti-HIV antibodies
may react with
uninfected T4 cells that express class II MHC molecules. Also it may be that
the anti-HIV-
immune effector cells kill many infected cells. -
The monocyte-macrophage is a target for HIV infection both in vivo and in
vitro.
Infection may occur through the CD4 receptor or via phagocytosis. Unlike T4
cells, monocyte
macrophages appear to be resistant to cell lysis. The virus is able to
replicate intracellularly in
monocyte macrophages with virions budding into intracytoplasmic vesicles. As a
result, viral
antigens may not be expressed at the cell surface thereby enabling the
monocyte-macrophage to
escape immune surveillance and to transmit infection to other organs.
There are a broad range of immune responses against HIV at all stages of
infection.
Antibodies produced throughout the course of the HIV infection and subsequent
AIDS
manifestation seem ineffective at halting the progress of this persistent
infective disorder. The
expression of genetic variants of HIV in vivo during the progress of the
disease is likely to be one
way in which HIV evades humoral and cellular immune responses.
Most primary HIV-1 viruses that initiate human infection and persist
throughout the
course of infection replicate to low levels in peripheral blood mononuclear
cells but do not
replicate in immortalized T cell lines (Schuitemaker et al., 1991; 1992 Conner
et al., 1993;
Conner and ho, 1994a and 1994b). These viruses are referred to herein as
macrophage tropic
primary isolates. In some HIV-1 infected individuals viruses that replicate to
higher levels in
PMBC and that can infect and induce the formation of syncytia in immortalized
CD4 cell lines
emerge late in the course of infection (Schuitemaker et al., 1992 Conner et
al., 1993; Conner and
Ho, 1994a and 1994b). These are referred to as T cell line-tropic primary
viruses.
2. Chemokine Receptors
There is a receptor that has been variously termed HUMSTSR, LCR- i , or LESTR
and
has been shown to allow a range of non-human, CD4-expressing cells to support
infection and
cell fusion. It has also been termed "Eosin". This receptor is also referred
to herein as CXR4.
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
- 10-
Antibodies against HUMSTSR have been shown to block fusion and infection by
laboratory
adapted HIV-1 isolates but not by macrophage tropic primary viruses.
It has further been observed that infection by macrophage tropic primary
isolates but not
laboratory adapted isolates can be inhibited by the (3 chemokines RANTES, MIP-
1 a and MIP-1 (3
S (Cocchi et al., 1995). A high endogenous expression of ~i-chemokines has
been suggested to
account for the in vitro resistance to HIV-1 infection of CD4+ T cells from
uninfected
individuals who have been exposed to seropositive partners (Paxton et al.,
1996). This resistance
was only seen from macrophage tropic and not T cell-line tropic viruses and
was influenced by
the structure of gp 120. It was suggested that at least one other host cell
surface molecule
besides CD4 and distinct from HUMSTSR facilitates entry of the primary
macrophage tropic
HIV isolates and that this factor might be influenced by interaction with the
(3-chemokines.
G-protein coupled receptors respond to a variety of chemoattractants,
neurotransmitters,
hormones and the Like. Seven transmembrane receptors that transduce their
signals through
heterotrimeric G proteins are used by leukocytes to respond to chemokines
(Horuk, 1994).
Chemokines are a family of structurally related peptides that recruit
leukocytes to inflammatory
lesions, induce the reels of granule contents from granulocytes, regulate
integrin avidity and
exhibit proinflammatory properties.
The a chemokines or CXC chemokines act upon neutrophils whilst the ~i-
chemokines, or
CC-chemokines, act upon monocytes, lymphocytes, basophils and eosinophils
(Baggiolini et al.,
1994; Schall and Bacon, 1994). Thus the CC chemokine receptors potentially
exhibit a tissue
distribution consistent with the known tropism of HIV-1. There are a number of
closely related
CC chemokine receptors, five of which have been characterized by Iigand
binding assays. These
are designated CCR1, CCR2A, CCR2B, CCR3, CCR4 and CCRS.
CCR-5 is a seven-transmembrane glycoprotein that is synthesized at the ER and
transported to the plasma membrane through the secretory pathway (Samson et
al.,
Biochemistry,. 35:3362-3367, 1996; Strader et al., 1994}. CXR4 is a seven-
transmembrane
glycoprotein that is synthesized at the ER and transported to the plasma
membrane, where CXR4
binds its ligand or the HIV-1 envelope protein with high affinity {Strader et
al. , 1994).
3. Intraltine Polypeptides
The chemokines, RANTES, MIP-1 a, and MIP-1 (3 which are produced by
macrophages,
lymphocytes and other cells, and bind their receptors (CCR-5, -3 and -1 ) with
high affinity
CA 02273192 1999-OS-31
WO 98/24923 PCTIUS97/22198
-11-
(Neote et'al., Cell, 72:415-425, 1993; Schall et al., J. Immunol., .141:1018-
1025, 1988; Gong et
al., J. Biol. Chem., 271:10521-10527, 1996), have been shown to suppress HIV-1
infection,
particularly in macrophage tropic isolates. It is believed that the
suppressive C-C chemokines
exert their infection inhibiting activities by binding to a chemokine receptor
for macrophage
tropic HIV-1 isolates thus inhibiting fusion mediated by the corresponding env
glycoproteins.
Thus RANTES MIP- l a and MIP-1 (3 are potent inhibitors of macrophage tropic
infection
in vitro. They are produced in elevated levels by CD8+ cells from HIV-1
infected individuals
and by CD4+ cells obtained from long term, high risk seronegative individuals
and are thought to
be refractory to HIV-1 infection-ex vivo. SDF-1 is a member of the CXC-
chemokines, and is
constitutively expressed by bone-marrow-derived stromal cells (Nagasawa, PNAS,
1994;
Tashiro, Science, 1993). SDF-1 was recently identified as a biological ligand
of fusin/CXR4,
which is a co-receptor for T-tropic HIV-1 virus (Neote et al., 1993; Schall et
al., 1988; Gong et
al., 1996).
Blockade of cell surface expression of a membrane protein by intracellular
binding of
intrabodies or other molecules targeted to the ER has been demonstrated in the
inventors' and
other studies (Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893, 1993;
Chen et al., Exp.
Opin. Invest. Drugs, 4:823-833, 1995a; Chen et al., Human Gene Therapy, 5:595-
601, 1995b;
Buonocore and Rose, Nature, 345:625-628, 1990. The chemokines RANTES, MIP-la
and
SDF-1 were used by the inventors to block the cell surface expression of C-C
chemokine
receptors.
The present invention contemplates altering the chemokine receptor ligands so
that the
ligands may be targeted to the endoplasmic reticulum. These molecules are
herein termed
intrakines. By "intrakine" is meant any ligand that binds to a C-C chemokine
receptor at the cell
surface but has been modified to be targeted to the ER of the lymphocyte or
other intracellular
organelle, such Iigands include but are not limited to RANTES, MIP-1 a, MIP-1
Vii, for binding to
CCRS and stromal cell derived factor-1(SDF-1) for binding to CCR4.
4. Intrakine-Encoding Polynucleotides
The polynucleotides according to the present invention may encode an entire
intrakine
gene, a functional intrakine protein domain, or any intrakine polypeptide.
"Complementary"
polynucleotides are those which are capable of base-pairing according to the
standard
Watson-Crick complementarity rules. That is, the larger purines will base pair
with the smaller
CA 02273192 1999-OS-31
WO 98124923 PCTIUS97/22198
-12
pyrimidines to form combinations of guanine paired with cytosine (G:C) and
adenine paired with
either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U)
in the case of
RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-
methyladenine,
hypoxanthine and others in hybridizing sequences does not interfere with
pairing.
As used herein, the term "complementary sequences" means polynucleotide
sequences
that are substantially complementary over their entire length and have very
few base mismatches.
For example, sequences of fifteen bases in length may be termed complementary
when they have
a complementary nucleotide at thirteen or fourteen positions. Naturally,
sequences which are
"completely complementary" will be sequences which are entirely complementary
throughout
their entire length and have no base mismatches.
Other sequences with lower degrees of homology also are contemplated. For
example, an
genetic construct which has limited regions of high homology, but also
contains _ a
non-homologous region (e.g., a ribozyme) could be designed. These molecules,
though having
less than 50% homology, would bind to target sequences under appropriate
conditions.
The polynucleotides may be derived from genomic DNA, i.e., cloned directly
from the
genome of a particular organism. In other embodiments, however, the
polynucleotides may be
complementary DNA (cDNA). cDNA is DNA prepared using messenger RNA (mRNA) as
template. Thus, a cDNA does not contain any interrupted coding sequences and
usually contains
almost exclusively the coding regions) for the corresponding protein. In other
embodiments, the
polynucleotide may be produced synthetically.
It may be advantageous to combine portions of the genomic DNA with cDNA or
synthetic sequences to generate specific' constructs. For example, where an
intron is desired in
the ultimate construct, a genomic clone will need to be used. Introns may be
derived from other
genes in addition to intrakine. The cDNA or a synthesized polynucleotide may
provide more
convenient restriction sites for the remaining portion of the construct and,
therefore, would be
used for the rest of the sequence. -- -
It is contemplated that natural variants of intrakine exist that have
different sequences
than those disclosed herein. Thus, the present invention is not limited to use
of any
polynucleotide sequence for Intrakine but, rather, includes use of any
naturally-occurring
variants. The present invention also encompasses chemically synthesized
mutants of these
sequences.
CA 02273192 1999-OS-31
WO 98/24923 PCTIUS97/22198
-13
Another kind of sequence variant results from codon variation. Because there
are several
codons for most of the 20 normal amino acids, many different DNA's can encode
the Intrakine.
Reference to the following table will allow such variants to be identified.
Table 1
Amino Acids Codons
Alanine Ala A GCA GCC GCG GCU
Cysteine Cys C UGC UGU
Aspartic acid Asp D GAC GAU ;
Glutamic acid Glu E GAA GAG
Phenylalanine Phe F UUC UUU
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU
Lysine Lys K AAA AAG
Leucine Leu L UUA UUG CUA CUC CUG CUU
Methionine Met M AUG
Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG CCU
Glutamine Gln Q CAA CAG
Arginine Arg R AGA AGG CGA CGC CGG CGU
Serine Ser S AGC AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Valine -Val V GUA GUC GUG GUU
Tryptophan Trp W UGG
Tyrosine Tyr Y UAC UAU
Allowing for the degeneracy of the genetic code, sequences that have between
about 50%
and about 75%, or between about 76% and about 99% of nucleotides that are
identical to the
nucleotides of the known chemokine genes will be preferred. Sequences that are
within the
scope of "an intrakine-encoding polynucleotide" are those that are capable of
base-pairing with a
polynucleotide segment set forth above under intracellular conditions.
CA 02273192 1999-OS-31
WO 98/24923 PG"T/US97122198
-14-
It also is well understood by the skilled artisan that, inherent in the
definition of a
biologically functional equivalent protein or peptide, is the concept that
there is a limit to the
number of changes that may be made within a defined portion of the molecule
and still result in a
molecule with an acceptable level of equivalent biological activity.
Biologically functional
equivalent peptides are thus defined herein as those peptides in which
certain, not most or all, of
the amino acids may be substituted. In particular, where the N-terminus of the
protein is
concerned, it is contemplated that only about 16 or more preferably, about 5
amino acids may be
changed within a given peptide. Of course, a plurality of distinct
proteins/peptides with different
substitutions may easily be made and used in accordance with the invention.
Amino acid substitutions are generally based on the relative similarity of the
amino acid
side-chain substituents, for example, their hydrophobicity, hydrophilicity,
charge, size, and the
like. An analysis of the size, shape and type of the amino acid side-chain
substituents reveals
that arginine, lysine and histidine are all positively charged residues; that
alanine, glycine and
serine are all a similar size; and that phenylalanine, tryptophan and tyrosine
all have a generally
similar shape. Therefore, based upon these considerations, arginine, lysine
and histidine;
alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are
defined herein as
biologically functional equivalents.
In making changes, the hydropathic index of amino acids may be considered.
Each
amino acid has been assigned a hydropathic index on the basis of their
hydrophobicity and
charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine
(+3.8); phenylalanine
(+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-
0.4); threonine (-
0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6);
histidine (-3.2); glutamate (-
3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9);
and arginine (-4.5).
The importance of the hydropathic amino acid index in conferring interactive
biological
function on a protein is generally understood in the art (Kyte & Doolittle,
1982; incorporated
herein by reference). It is known that certain amino acids may be substituted
for other amino
acids having a similar hydropathic index or score and still retain a similar
biological activity. In
making changes based upon the hydropathic index, the substitution of amino
acids whose
hydropathic indices are within ~2 is preferred, those which are within ~ 1 are
particularly
preferred, and those within X0.5 are even more particularly preferred.
It is understood that an amino acid can be substituted for another having a
similar
hydrophilicity value and still obtain a biologically equivalent protein. As
detailed in U.S. Patent
CA 02273192 1999-OS-31
W0 98124923 PCT/US9~122198
-15- -
4,554,101, the following hydrophilicity values have been assigned to amino
acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0 ~ 1 ); glutamate (+3.0 + 1 );
serine (+0.3);
asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-
0.5 + 1 ); alanine (-
0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5);
leucine (-1.8); isoleucine (-
1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).
In making changes based upon similar hydrophilicity values, the substitution
of amino
acids whose hydrophilicity values are within t2 is preferred, those which are
within + 1 are
particularly preferred, and those within +0.5 are even more particularly
preferred.
Site-specific mutagenesis. Site-specific mutagenesis is a technique useful in
the
preparation of individual peptides, or biologically functional equivalent
proteins or peptides,
through specific mutagenesis of the underlying DNA. The technique further
provides a ready
ability to prepare and test sequence variants, incorporating one or more of
the foregoing
considerations, by introducing one or more nucleotide sequence changes into
the DNA. Site-
specific mutagenesis allows the production of mutants through the use of
specific
oligonucleotide sequences which encode the DNA sequence of the desired
mutation, as well as a
sufficient number of adjacent nucleotides, to provide a primer sequence of
sufficient size and
sequence complexity to form a stable duplex on both sides of the deletion
junction being
traversed. Typically, a primer of about 17 to 25 nucleotides in length is
preferred, with about 5 to
10 residues on both sides of the junction of the sequence being altered.
In general, the technique of site-specific mutagenesis is well known in the
art. As will be
appreciated, the technique typically employs a bacteriophage vector that
exists in both a single
stranded and double stranded form. Typical vectors useful in site-directed
mutagenesis include
vectors such as the M 13 phage. These phage vectors are commercially available
and their use is
generally well known to those skilled in the art. Double stranded plasmids are
also routinely
employed in site directed mutagenesis, which eliminates the step of
transferring the gene of
interest from a phage to a plasmid.
In general, site-directed mutagenesis is performed by first obtaining a single-
stranded
vector, or melting of two strands of a double stranded vector which includes
within its sequence
a DNA sequence encoding the desired protein. An oligonucleotide primer bearing
the desired
mutated sequence is synthetically prepared. This primer is then annealed with
the single-stranded
DNA preparation, and subjected to DNA polymerizing enzymes such as E. coli
polymerase I
Klenow fragment, in order to complete the synthesis of the mutation-bearing
strand. Thus, a
CA 02273192 1999-OS-31
WO 98124923 PCTliTS97/22198
-16-
heteroduplex is formed wherein one strand encodes the original non-mutated
sequence and the
second strand bears the desired mutation. This heteroduplex vector is then
used to transform
appropriate cells, such as E. coli cells, and clones are selected that include
recombinant vectors
bearing the mutated sequence arrangement.
The preparation of sequence variants of the selected gene using site-directed
mutagenesis
is provided as a means of producing potentially useful species and is not
meant to be limiting, as
there are other ways in which sequence variants of genes may be obtained. For
example,
recombinant vectors encoding the desired gene may be treated with mutagenic
agents, such as
hydroxylamine, to obtain sequence variants.
5. Knockout Strategies
In light of the foregoing discussion, the critical importance of CCRS for HIV-
1 infection
and disease progression, and the dispensable nature of CCRS suggest that the
knock-out of
CCRS in stem cells or lymphocytes may have a therapeutic implication. The
present invention
may be used in conjunction with a variety of methods in order to reduce,
abrogate or knockout
the expression of the CCRS receptor at the cell surface of the lymphocyte or
other cell at which
the CCRS receptor may be expressed. These methods are described herein below.
ER targeting of Intrakines. In preferred embodiments of the present invention,
phenotypic CCRS knock-out is accomplished by transducing cells with a mutated
CC-chemokine
gene containing an endoplasmic reticulum (ER)-retention signal to
intracellularly block the
transport and surface expression of the newly synthesized CCRS. Human
peripheral blood
lymphocytes (PBLs) expressing the intracellular chemokine, termed "intrakine,"
were found to
resist M~-tropic HIV-1 infection. Furthermore, secreted chemokines as well as
intrakines were
co-expressed for additional inhibition of viral infection. Thus, this novel
anti-HIV approach
uniquely targeted at the cellular receptors, rather than the viral components
used by other
anti-HIV approaches, may overcome frequent mutations of HIV-1, and, therefore,
should have
significant implications for gene-based treatment and even prevention of HIV-
infection.
The tubular architecture of the ER and the directional flow of proteins
through the
secretory system combine to make phenotypic knockout of a receptor at the ER
level an
extremely effective mechanism of inhibition of cell surface receptor
expression. Molecules
intended for localization and targeting to the ER are generally equipped with
a leader peptide and
a C-terminus ER retention signal. One such signal is a KDEL amino acid motif
(Munro and
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
_17_
Pelham; Cell, 48:899-907, 1987): Thus the present invention employs genetic
recombination
techniques described herein to engineer an ER retention signal to chemokines
thereby targeting
these ligands to the ER where they bind the CCR proteins thereby preventing
their expression at
the cell surface.
Antisense. Antisense methodology takes advantage of the fact that nucleic
acids tend to
pair with "complementary" sequences. By complementary, it is meant that
polynucleotides are
those which are capable of base-pairing according to the standard Watson-Crick
complementarity rules. That is, the larger purines will base pair with the
smaller pyrimidines to
form combinations of guanine paired with cytosine (G:C) and adenine paired
with either thymine
(A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of
RNA. Inclusion of
less common bases such as inosine, 5-methylcytosine, 6-methyladenine,
hypoxanthine and others
in hybridizing sequences does not interfere with pairing.
Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix
formation;
targeting RNA will lead to double-helix formation. Antisense polynucleotides,
when introduced
into a target cell, specifically bind to their target polynucleotide and
interfere with transcription,
RNA processing, transport, translation and/or stability. Antisense RNA
constructs, or DNA
encoding such antisense RNA's, may be employed to inhibit gene transcription
or translation or
both within a host cell, either in vitro or in vivo, such as within a host
animal, including a human
subject.
Antisense constructs may be designed to bind to the promoter and other control
regions,
exons, introns or even exon-intron boundaries of a gene. It is contemplated
that the most
effective antisense constructs will include regions complementary to
intron/exon splice junctions.
Thus, it is proposed that a preferred embodiment includes an antisense
construct with
complementarity to regions within 50-200 bases of an intron-exon splice
junctiom- It has been
observed that some exon sequences can be included in the construct without
seriously affecting
the target selectivity thereof. The amount of exonic material included will
vary depending on the
particular exon and intron sequences used. One can readily test whether too
much exon DNA is
included simply by testing the constructs in vitro to determine whether normal
cellular function
is affected or whether the expression of related genes having complementary
sequences is
affected.
As stated above, "complementary" or "antisense" means polynucleotide sequences
that
are substantially complementary over their entire length and have very few
base mismatches.
CA 02273192 1999-OS-31 _
WO 98124923 PCTIUS97/2Z198
-18
For example, sequences of fifteen bases in length may be termed complementary
when they have
complementary nucleotides at thirteen or fourteen positions. Naturally,
sequences which are
completely complementary will be sequences which are entirely complementary
throughout their
entire length and have no base mismatches. Other sequences with lower degrees
of homology
also are contemplated. For example, an antisense construct which has limited
regions of high
homology, but also contains a non-homologous region (e.g., ribozyme) could be
designed.
These molecules, though having less than 50% homology, would bind to target
sequences under
appropriate conditions.
It may be advantageous to combine portions of genomic DNA with cDNA or
synthetic
i 0 sequences to generate specific constructs. For example, where an intron is
desired in the ultimate
construct, a genomic clone will need to be used. The cDNA or a synthesized
polynucleotide may
provide more convenient restriction sites for the remaining portion of the
construct and,
therefore, would be used for the rest of the sequence.
Ribozymes. Although proteins traditionally have been used for catalysis of
nucleic
acids, another class of macromolecules has emerged as useful in this endeavor.
Ribozymes are
RNA-protein complexes that cleave nucleic acids in a site-specific fashion.
Ribozymes have
specific catalytic domains that possess endonuclease activity (Kim and Cook,
1987; Gerlach et
al. , 1987; Forster and Symons, 1987). For example, a large number of
ribozymes accelerate
phosphoester transfer reactions with a high degree of specificity, often
cleaving only one of
several phosphoesters in an oligonucleotide substrate (Cook et al. , 1981;
Michel and Westhof,
1990; Reinhold-Hurek and Shub, 1992). This specificity has been attributed to
the requirement
that the substrate bind via specific base-pairing interactions to the internal
guide sequence
("IGS") of the ribozyme prior to chemical reaction.
Ribozyme catalysis has primarily been observed as part of sequence-specific
cleavage/ligation reactions involving nucleic acids (Joyce, 1989; Cook et a~:
, 1981 ). For
example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as
endonucleases with----
a sequence specificity greater than that of known ribonucleases and
approaching that of the DNA
restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of
gene expression
may be particularly-suited to therapeutic applications (Scanlon et al., 1991;
Sarver et al., 1990).
Recently, it was reported that ribozymes elicited genetic changes in some
cells lines to which
they were applied; the altered genes included the oncogenes H-ras, c-fos and
genes of HIV.
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/Z2198
-19-
Most of this work involved the modification of a target mRNA, based on a
specific mutant codon
that is cleaved by a specific ribozyme.
Homologous Recombination. Another approach for preventing CCRS expression at
the
cell surface involves the use of homologous recombination, or "knock-out
technology".
Homologous recombination relies, like antisense, on the tendency of nucleic
acids to base pair
with complementary sequences. In this instance, the base pairing serves to
facilitate the
interaction of two separate nucleic acid molecules so that strand breakage and
repair can take
place. In other words, the "homologous" aspect of the method relies on
sequence homology to
bring two complementary sequences into close proximity, while the
"recombination" aspect
provides for one complementary sequence to replace the other by virtue of the
breaking of certain
bonds and the formation of others.
Put into practice, homologous recombination is used as follows. First, the
target gene is
selected within the host cell, in this case, CCRS. Sequences homologous to the
CCRS target
gene are then included in a genetic construct, along with some mutation that
will render the
target gene inactive (stop codon, interruption, and the like). The homologous
sequences flanking
the inactivating mutation are said to "flank" the mutation. Flanking, in this
context, simply
means that target homologous sequences are located both upstream (5') and
downstream (3') of
the mutation. These sequences should correspond to some sequences upstream and
downstream
of the target gene. The construct is then introduced into the cell, thus
permitting recombination
between the cellular sequences and the construct.
As a practical matter, the genetic construct will normally act as far more
than a vehicle to
interrupt the gene. For example, it is important to be able to select for
recombinants and,
therefore, it is common to include within the construct a selectable marker
gene. This gene
permits selection of cells that have integrated the construct into their
genomic DNA by
conferring resistance to various biostatic and biocidal drugs. In addition, a
heterologous gene
that is to be expressed in the cell also may advantageously be included within
the construct. The
arrangement might be as follows:
...vector~S'-flanking sequence~heterologous gene~selectable marker
gene~flanking
sequence-3'~vector...
Thus, using this kind of construct, it is possible, in a single
recombinatorial event, to (i)
"knock out" an endogenous gene, (ii) provide a selectable marker for
identifying such an event
and (iii) introduce a heterologous gene for expression.
CA 02273192 1999-OS-31
WO 98124923 PCT/US97I22198
-20-
Another refinement of the homologous recombination approach involves the use
of a
"negative" selectable marker. This marker, -unlike the selectable marker,
causes death of cells
which express the marker. Thus, it is used to identify undesirable
recombination events. When
seeking to select homologous recombinants using a selectable marker, it is
difficult in the initial
screening step to identify proper homologous recombinants from recombinants
generated from
random, non-sequence specific events. These recombinants also may contain the
selectable
marker gene and may express the heterologous protein of interest, but will, in-
alI likelihood, not
have the desired "knock out" phenotype. By attaching a negative selectable
marker to the
construct, but outside of the flanking regions, one can select against many
random recombination
events that will incorporate the negative selectable marker. Homologous
recombination should
not introduce the negative selectable marker, as it is outside of the flanking
sequences.
Single Chain Monoclonal Antibodies. Single chain antibodies, synthesized by
the cell
and targeted to a particular cellular compartment can be used to interfere in
a highly specific
manner with cell growth and metabolism. Recent application include the
phenotypic knockout
of growth factor receptors, the functional inactivation of p21 and the
inhibition of HIV-1
replication.
Methods for the production of single-chain antibodies are well known to those
of skill in
the art.. The skilled artisan is referred to US Patent Number 5,359,046,
(incorporated herein by
reference) for such methods. A single chain antibody is created by fusing
together the variable
domains of the heavy and light chains using a short peptide linker, thereby
reconstituting an
antigen binding site on a single molecule.
Single-chain antibody variable fragments (Fvs) in which the C-terminus of one
variable
domain is tethered to the N-terminus of the other via a I S to 25 amino acid
peptide or linker,
have been developed without significantly disrupting antigen binding or
specificity of the
binding (Bedzyk et al., 1990; Chaudhary et al., 1990). These Fvs lack the
constant regions (Fc)
present in the heavy and light chains of the native antibody.
In principle, the high affinity and selective binding properties of
intracellular antibodies
or intrabodies can be used to modulate cellular physiology and metabolism by a
wide variety of
mechanisms. For example binding of an intrabody may -be used to block or
stabilize
macromolecular interactions, modulate enzyme function by occluding an active
site, sequestering
substrate or fixing the enzyme in an active or an inactive conformation as the
need may be.
lntrabodies may also be used to divert proteins from their usual cellular
compartment for
CA 02273192 1999-OS-31
WO 98124923 PCT/US97l22198
-21 -
example by sequestering transcription factors in the cytoplasm, or by
retention in the ER of the
proteins destined for the cell surface. In this regard intrabodies may be
useful in conjunction
with the present invention to prevent CCRS expression at the cell surface and
thereby inhibit
HIV-1 infectivity.
6. Expression Vectors
Throughout this application, the term "expression construct" is meant to
include any type
of genetic construct containing a nucleic acid coding for a gene product in
which part or all of the
nucleic acid encoding sequence is capable of being transcribed. The transcript
may be translated
into a protein, but it need not be. Thus, in certain embodiments, expression
includes both
transcription of an intrakine gene and translation of an intrakine mRNA into
an intrakine protein
product. In other embodiments, expression only includes transcription of the
nucleic acid
encoding an intrakine or its complement.
In order for the construct to effect expression of at least an intrakine
transcript, the
polynucIeotide encoding the Intrakine polynucleotide will be under the
transcriptional control of
a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic
machinery of
the host cell, or introduced synthetic machinery, that is required to initiate
the specific
transcription of a gene. The phrase "under transcriptional control" or
"operatively linekd" means
that the promoter is in the correct location in relation to the polynucleotide
to control RNA
polymerase initiation and expression of the polynucleotide.
The term promoter will be used here to refer to a group of transcriptional
control modules
that are clustered around the initiation site for RNA polymerase II. Much of
the thinking about
how promoters are organized derives from analyses of several viral promoters,
including those
for the HSV thymidine kinase (tk) and SV40 early transcription units. These
studies, augmented
by more recent work, have shown that promoters are composed of discrete
functional modules,
each consisting of approximately 7-20 by of DNA, and containing one or more
recognition sites
for transcriptional activator or repressor proteins.
At least one module in each promoter functions to position the start site for
RNA
. synthesis. The best known example of this is the TATA box, but in some
promoters lacking a
TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl
transferase gene
and the promoter for the SV40 late genes, a discrete element overlying the
start site itself helps to
fix the place of initiation.
CA 02273192 1999-OS-31
WO 98124923 PCT/US97/22198
-22-
Additional promoter elements regulate the frequency of transcriptional
initiation.
Typically, these are located in the region 30-110 by upstream of the start
site, although a number
of promoters have recently been shown to contain functional elements
downstream of the start
site as well. The spacing between promoter elements frequently is flexible, so
that promoter
function is preserved when elements are inverted or moved relative to one
another. In the tk
promoter, the spacing between promoter elements can be increased to SO by
apart before activity
begins to decline. Depending on the promoter, it appears that individual
elements can function
either co-operatively or independently to activate transcription.
The particular promoter that is employed to control the expression of a
Intrakine
polynucleotide is not believed to be critical, so long as it is capable of
expressing the
polynucleotide in the targeted cell. Thus, where a human cell is targeted, it
is preferable to
position the polynucleotide coding region adjacent to and under the control of
a promoter that is
capable of being expressed in a human cell. Generally speaking, such a
promoter might include
either a human or viral promoter.
In various embodiments, the human cytomegalovirus (CMV) immediate early gene
promoter, the SV40 early promoter and the Rous sarcoma virus long terminal
repeat can be used
to obtain high-level expression of the Intrakine polynucleotide. -- The use of
other viral or
mammalian cellular or bacterial phage promoters which are well-known in the
art to achieve
expression of polynucleotides is contemplated as well, provided that the
levels of expression are
sufficient to produce a growth inhibitory effect.
By employing a promoter with well-known properties, the level and pattern of
expression
of a polynucleotide following transfection can be optimized. For example,
selection of a
promoter which is active in specific cells, such as tyrosinase (melanoma),
alpha-fetoprotein and
albumin (liver tumors), CC10 (lung tumor) and prostate-specific antigen
(prostate tumor) will
permit tissue-specific expression Intrakine polynucleotides. Table 2 lists
several
elements/promoters which may be employed, in the context of the present
invention, to regulate
the expression of Intrakine constructs. This list is not intended to be
exhaustive of all the
possible elements involved in the promotion of Intrakine expression but;
merely, to be exemplary
thereof.
Enhancers were originally detected as genetic elements that increased
transcription from
a promoter located at a distant position on the same molecule of DNA. This
ability to act over a
- ! large distance had little precedent in classic studies of prokaryotic
transcriptional regulation.
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
- 23 -
Subsequent work showed that regions of DNA with enhancer activity are
organized much like
promoters. That is, they are composed of many individual elements, each of
which binds to one
or more transcriptional proteins.
The basic distinction between enhancers and promoters is operational. An
enhancer
S region as a whole must be able to stimulate transcription at a distance;
this need not be true of a
promoter region or its component elements. On the other hand, a promoter must
have one or
more elements that direct initiation of RNA synthesis at a particular site and
in a particular
orientation, whereas enhancers lack these specificities. Promoters and
enhancers are often
overlapping ans~ contiguous, often seeming to have a very similar modular
organization.
Additionally any promoter/enhancer combination (as per the Eukaryotic Promoter
Data
Base EPDB) could also be used to drive expression of an intrakine construct.
Use of a T3, T7 or
SP6 cytoplasmic expression system is another possible embodiment. Eukaryotic
cells can
support cytoplasmic transcription from certain bacteriophage promoters if the
appropriate
bacteriophage polymerase is provided, either as-part of the delivery complex
or as an additional
genetic expression vector.
CA 02273192 1999-OS-31
WO 98124923 PCT/US97/22198
-24
Table 2
ENHANCER
ImmunoglobulinHeavy Chain
ImmunoglobulinLight Chain
T-Cell Receptor
HLA DQ a and DQ !3
13-Interferon
Interleukin-2
Interleukin-2 Receptor
MHC Class II S
MHC Class II HLA-DRa
13-Actin
Muscle Creatine Kinase
Prealbumin (Transthyretin)
Elastase I
Metallothionein
Collagenase
Albumin Gene
a-Fetoprotein
i-Globin
13-Globin
c-fos
c-HA-ras
Insulin
Neural Cell Adhesion Molecule (NCAM)
a~-Antitrypsin
H2B (TH2B) Histone
Mouse or Type I Collagen
Glucose-Regulated Proteins (GRP94 and GRP78)
CA 02273192 1999-OS-31
WO 98124923 PCTIUS97122198
-25-
Table 2 (Continued)
Rat Growth Hormone
Human Serum Amyloid A (SAA)
Troponin I (TN I)
Platelet-Derived Growth Factor
Duchenne Muscular Dystrophy
SV40
Polyoma
Retroviruses
Papilloma Virus
Hepatitis B Virus
Human ImmunodeficiencyVirus
_ Cytomegalovirus
Gibbon Ape Leukemia Virus
Further, selection of a promoter that is regulated in response to specific
physiologic signals can
permit inducible expression of the Intrakine construct. For example, with the
polynucleotide under
the control of the human PAI-1 promoter, expression is inducible by tumor
necrosis factor. Table 3
illustrates several promoter/inducercombinations:
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
-26-
Table 3
Element Inducer
MT II Phorbol Ester (TFA) Heavy metals
MMTV (mouse mammary Glucocorticoids
tumor virus)
13-Interferon poly(rI)X
poly(rc)
Adenovirus 5 E2 Ela
c-jun Phorbol Ester (TPA), H2O2
Collagenase Phorbol Ester (TPA)
Stromelysin Phorbol Ester (TPA), IL-1
S V40 Phorbol Ester (TPA)
Murine MX Gene Interferon, Newcastle Disease Virus
GRP78 Gene A23187
oc-2-Macroglobulin IL-6
V imentin S erum
MHC Class I Gene H-2kB Interferon
HSP70 Ela, SV40 Large T Antigen
Proliferin Phorbol Ester-TPA
Tumor Necrosis Factor FMA
Thyroid Stimulating Thyroid Hormone
Hormone _
oc Gene
In certain embodiments of the invention, the delivery of an expression vector
in a cell
may be identified in vitro or in vivo by including a marker in the expression
vector. The marker
would result in an identifiable change to the transfected cell permitting easy
identification of
expression. Usually the inclusion of a drug selection marker aids in cloning
and in the selection
of transformants. Alternatively, enzymes such as herpes simplex virus
thymidine kinase (tk)
(eukaryotic) or chloramphenicol acetyltransferase (CAT) (prokaryotic) may be
employed.
Immunologic markers also can be employed. The selectable marker employed is
not believed to
be important, so long as it is capable of being expressed along with the
polynucleotide encoding
Intrakine. Further examples of selectable markers are well known to one of
skill in the art.
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
_ _
One will typically include a polyadenylation signal to effect proper
polyadenylation of
the transcript. The nature of the polyadenylation signal is not believed to be
crucial to the
successful practice of the invention, and any such sequence may be employed.
Also
contemplated as an element of the expression construct is a terminator. These
elements can serve
to enhance message levels and to minimize read through from the construct into
other sequences.
In some embodiments of the present invention, the expression construct
comprises a virus
or engineered construct derived from a viral genome. The ability of certain
viruses to enter cells
via receptor-mediated endocytosis and, in some cases, integrate into the host
cell chromosomes,
have made them attractive candidates for gene transfer in to mammalian cells.
However, direct
uptake of naked DNA, as well as receptor-mediated uptake of DNA complexes have
been
demonstrated, expression vectors need not be viral but, instead, may be any
plasmid, cosmid or
phage construct that is capable of supporting expression of encoded genes in
mammalian cells,
such as pUC or BluescriptTM plasmid series.
Retroviruses. The retroviruses are a group of single-stranded RNA viruses
characterized
by an ability to convert their RNA to double-stranded DNA in infected cells by
a process of
reverse-transcription (Coffin, 1990). The resulting DNA then stably integrates
into cellular
chromosomes as a provirus and directs synthesis of viral proteins. The
integration results in the
retention of the viral gene sequences in the recipient cell and its
descendants. The retroviral
genome contains three genes - gag, pol, and env - that code for capsid
proteins, polymerase
enzyme, and envelope components, respectively. A sequence found upstream from
the gag gene,
termed ~', functions as a signal for packaging of the genome into virions. Two
long terminal
repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome.
These contain
strong promoter and enhancer sequences and are also required for integration
in the host cell
genome (Coffin, 1990).
In order to construct a retroviral vector, a nucleic acid encoding Intrakine
is inserted into
the viral genome in the place of certain viral sequences to produce a virus
that is
replication-defective. In order to produce virions, a packaging cell line
containing the gag, pol
and env genes but without the LTR and ~I' components is constructed (Mann et
al., 1983). When
a recombinant plasmid containing a human cDNA, together with the retroviral
LTR and 'Y
sequences is introduced into this cell line (by calcium phosphate
precipitation for example), the
LY sequence allows the RNA transcript of the recombinant plasrnid to be
packaged into viral
- particles, which are then secreted into the culture media (Nicolas and
Rubenstein, 1988; Temin,
CA 02273192 1999-OS-31
w0 98124923 PCTIITS97122198
-28
1986; Mann et al., 1983). The media containing the recombinant retroviruses is
then collected,
optionally concentrated, and used for gene transfer. Retroviral vectors are
able to infect a broad
variety of cell types. However, integration and stable expression require the
division of host
cells (Paskind et al., 1975).
A novel approach designed to allow specific targeting of retrovirus vectors
was recently
developed based on the chemical modification of a retrovirus by the chemical
addition of lactose
residues to the viral envelope. This modification could permit the specific
infection of
hepatocytes via sialoglycoprotein receptors. _
A different approach to targeting of recombinant retroviruses was designed in
which
biotinylated antibodies against a retroviral envelope protein and against a
specific cell receptor
were used. The antibodies were coupled via the biotin components by using
streptavidin (Roux
et al., 1989). Using antibodies against major histocompatibility complex class
I and class I1
antigens, they demonstrated the infection of a variety of human cells that
bore those surface
antigens with an ecotropic virus in vitro (Roux et al., 1989).
1 S Adenoviruses. Human adenoviruses are double-stranded DNA tumor viruses
with
genome sizes of approximate 36 kb (Tooze, 1981). As a model system for
eukaryotic gene
expression, adenoviruses have been widely studied and well characterized,
which makes them an
attractive system for development of adenovirus as a gene transfer system.
This group of viruses
is easy to grow and manipulate, and they exhibit a broad host range in vitro
and in vivo. In
lyticaily infected cells, adenoviruses are capable of shutting off host
protein synthesis, directing
cellular machineries to synthesize large quantities of viral proteins, and
producing copious
amounts of virus.
The E 1 region of the genome includes E 1 A and E 1 B which encode proteins
responsibl a
for transcription regulation of the viral genome, as well as a few cellular
genes. E2 expression,
including E2A and E2B, allows synthesis of viral replicative functions, e.g.
DNA-binding
protein, DNA polymerase, and a terminal protein that primes replication. E3
gene products
prevent cytolysis by cytotoxic T cells and tumor necrosis factor and appear to
be important for
viral propagation. Functions associated with the E4 proteins include DNA
replication, late gene
expression, and host cell shutoff. The late gene products include most of the
virion capsid
proteins, and these are expressed only after most of the processing of a
single primary transcript
from the major late promoter has occurred. The major late promoter (MLP)
exhibits high
efficiency during the late phase of the infection (Stratford-Perncaudet and
Perricaudet, 1991 a).
CA 02273192 1999-OS-31
WO 98124923 PCT/US97122198
-29-
As only a small portion of the viral genome appears to be required in cis
(Tooze, 1981 ),
adenovirus-derived vectors offer excellent potential for the substitution of
large DNA fragments
when used in connection with cell lines such as 293 cells. Ad5-transformed
human embryonic
kidney cell lines (Graham, et al., 1977) have been developed to provide the
essential viral
proteins in tranr.
Particular advantages of an adenovirus system for delivering foreign proteins
to a cell
include (i) the ability to substitute relatively large pieces of viral DNA by
foreign DNA; (ii) the
structural stability of recombinant adenoviruses; (iii) the safety of
adenoviral administration to
humans; and (iv) lack of and known association of adenoviral infection with
cancer or
malignancies; (v) the ability to obtain high titers of the recombinant virus;
and (vi} the high
infectivity of Adenovirus.
In general, adenovirus gene transfer systems are based upon recombinant,
engineered
adenovirus which is rendered replication-incompetent by deletion of a portion
of its genome,
such as E1, and yet still retains its competency for infection. Sequences
encoding relatively large
foreign proteins can be expressed when additional deletions are made in the
adenovirus genome.
For example, adenoviruses deleted in both E 1 and E3 regions are capable of
carrying up to 10 Kb
of foreign DNA and can be grown to high titers in 293 cells (Stratford-
Perricaudet and
Perricaudet, 1991 a). Surprisingly persistent expression of transgenes
following adenoviral
infection has also been reported.
Adenovirus-mediated gene transfer has recently been investigated as a means of
mediating gene transfer into eukaryotic cells and into whole animals. For
example, in treating
mice with the rare recessive genetic disorder ornithine transcarbarnylase
(OTC) deficiency, it was
found that adenoviral constructs could be employed to supply the normal OTC
enzyme.
Unfortunately, the expression of normal levels of OTC was only achieved in-4
out of 17
instances (Stratford-Perricaudet et al., 1991b). Therefore, the defect was
only partially corrected
in most of the mice and led to no physiological or phenotypic change.
Attempts to use adenovirus to transfer the gene for cystic fibrosis
transmembrane
conductance regulator (CFTR} into the pulmonary epithelium of cotton rats have
also been
partially successful, although it has not been possible to assess the
biological activity of the
transferred gene in the epithelium of the animals (Rosenfeld et al., 1992).
Again, these studies
demonstrated gene transfer and expression of the CFTR protein in lung airway
cells but showed
no physiologic effect. In the 1991 Science article, Rosenfeld et al. showed
lung expression of
CA 02273192 1999-OS-31 _
WO 98/24923 PCT/US97/22198
-30-
al-antitrypsin protein but again showed no physiologic effect. In fact, they
estimated that the
levels of expression that they observed were only about 2% of the level
required for protection of
the lung in humans, i. e. , far below that necessary for a physiologic effect.
The gene for human oc 1-antitrypsin has been introduced into the liver of
normal rats by
intraportal inj ection, where it was expressed and resulted in the secretion
of the introduced
human protein into the plasma of these rats (Jaffe et al., 1992). However, and
disappointingly,
the levels that were obtained were not high enough to be of therapeutic value.
These type of results do not demonstrate that adenovirus is able to direct the
expression
of sufficient protein in recombinant cells to achieve a physiologically
relevant effect, and they do
not, therefore, suggest a usefulness of the adenovirus system for use in
connection with gene
therapy.
7. Other Viral Vectors As Expression Constructs
Other viral vectors may be employed as expression constructs in the present
invention.
Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal
and Sugden,
1986; Coupar et al., 1988) adeno-associated virus (AAV) (Ridgeway, 1988;
Baichwal and
Sugden, 1986; Hermonat and Muzycska, 1984) and herpes viruses may be employed.
They offer
several attractive features for various mammalian cells (Friedmann, 1989;
Ridgeway, 1988;
Baichwal and Sugden, 1986; Coupar et al., 1988; Norwich et al., 19.90).
With the recent recognition of defective hepatitis B viruses, new insight was
gained into
the structure-function relationship of different viral sequences. in vitro
studies showed that the
virus could retain the ability for helper-dependent packaging and reverse
transcription despite the
deletion of up to 80% of its genome {Norwich et al., 1990). This suggested
that large portions of
the genome could be replaced with foreign genetic material. The hepatotropism
and persistence
(integration) were particularly attractive properties for liver-directed gene
transfer. Chang et al.
recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck
hepatitis B virus - -
genome in the place of the polymerase, surface, and pre-surface coding
sequences. It was co-
transfected with wild-type virus into an avian hepatoma cell line. Culture
media containing high
titers of the recombinant virus were used to infect primary duckling
hepatocytes. Stable CAT
gene expression was detected for at least 24 days after transfection (Chang et
al., 1991).
Multigene Constructs and IRES. In certain embodiments of the invention, the
use of
internal ribosome binding sites (IRES) elements are used to create multigene,
or polycistronic,
CA 02273192 1999-OS-31
WO 98/24923 PCTIUS97/22198
-31 -
messages. IRES elements are able to bypass the ribosome scanning model of 5'
methylated Cap
dependent translation and begin translation at internal sites (Pelletier and
Sonenberg, 1988; Jang
et al., -1988). IRES elements from two members of the picomovirus family
(polio and
encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as
well an IRES
from a mammalian message (Macejak and Sarnow, 1991 ). IRES elements can be
linked to
heterologous open reading frames. Multiple open reading frames can be
transcribed together,
each separated by an IRES, creating polycistronic messages. By virtue of the
IRES element,
each open reading frame is accessible to ribosomes for efficient translation.
Multiple genes can
be efficiently expressed using a single promoter/enhancer to transcribe a
single message.
Any heterologous open reading frame can be linked to IRES elements. This
includes
genes for secreted proteins, mufti-subunit proteins, encoded by independent
genes, intracellular
or membrane-bound proteins and selectable markers. In this way, expression of
several proteins
can be simultaneously engineered into a cell with a single construct and a
single selectable
marker.
8. Methods For Gene Delivery
In order to effect expression of intrakine constructs, the expression vector
must be
delivered into a cell. As described above, the preferred mechanism for
delivery is via viral
infection where the expression vector is encapsidated in an infectious
adenovirus particle.
Several non-viral methods for the transfer of expression vectors into cultured
mammalian
cells also are contemplated by the present invention. These include calcium
phosphate
precipitation (Graham and Van Der Eb, 1973; Rippe et al., 1990) DEAE-dextran
(copal, 1985),
electroporation (Tur-Kaspa et al., 1986; Potter et al., 1984), direct
microinjection (Harland and
Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al.,
1979) and
lipofectamine-DNA complexes, cell sonication (Fechheimer et al., 1987), gene
bombardment
using high velocity microprojectiles (Yang et al., 1990), polycations (Boussif
et aL, 1995) and
receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of
these
techniques may be successfully adapted for in vivo or ex vivo use.
In one embodiment of the invention, the expression vector may simply consist
of naked
recombinant vector. Transfer of the construct may be performed by any of the
methods
mentioned above which physically or chemically permeabilize the cell membrane.
For example,
Dubensky_ et al. (1984) successfully injected polyomavirus DNA in the form of
CaP04
CA 02273192 1999-OS-31
WO 98124923 PCTIUS97/22198
-32
precipitates into liver and spleen of adult and newborn mice demonstrating
active viral
replication and acute infection. Benvenisty and Neshif (1986) also
demonstrated that direct
intraperitoneal injection of CaP04 precipitated plasmids results in expression
of the transfected
genes. It is envisioned that DNA encoding an Intrakine construct may also be
transferred in a
similar manner in vivo.
Another embodiment of the invention for transferring a naked DNA expression
vector
into cells may involve particle bombardment. This method depends on the
ability to accelerate
DNA coated microprojectiles to a high velocity allowing them to pierce cell
membranes and
enter cells without killing them-(Klein et al., 1987). Several devices for
accelerating small
particles have been developed. One such device relies on a high voltage
discharge to generate an
electrical current, which in turn provides the motive force (Yang et al.,
1990). The
microprojectiles used have consisted of biologically inert substances such as
tungsten or gold
beads.
Selected organs including the liver, skin, and muscle tissue of rats and mice
have been
bombarded in vivo (Yang et al., 1990; Zelenin et al., 1991 ). This may require
surgical exposure
of the. tissue or cells, to eliminate any intervening tissue between the gun
and the target organ.
DNA encoding a intrakine construct may be delivered via this method.
In a further embodiment of the invention, the expression vector may be
entrapped in a
liposorrie. Liposomes are vesicular structures characterized by a phospholipid
bilayer membrane
and an inner aqueous medium. Multilamellar liposomes have multiple lipid
layers separated by
aqueous medium. They form spontaneously when phospholipids are suspended in an
excess of
aqueous solution. The lipid components undergo self rearrangement before the
formation of
closed structures and entrap water and dissolved solutes between the lipid
bilayers (Ghosh and
Bachhawat, 1991 ). Also contemplated are lipofectamine-DNA complexes.
Liposome-mediated polynucleotide delivery and expression of foreign DNA in
vitro has
been very successful. Wong et al. ( 1980) demonstrated the feasibility of
liposome-mediated
delivery and expression of foreign DNA in cultured chick embryo, HeLa and
hepatoma cells.
Nicolau et al. (1987) accomplished successful liposome-mediated gene transfer
in rats after
intravenous inj ection.
In certain embodiments of the invention, the liposome may be complexed with a
hemagglutinating virus (HVJ). This has been shown to facilitate fusion with
the cell membrane
and promote cell entry of liposome-encapsulated DNA {Kaneda et al. , 1989). In
other
CA 02273192 1999-OS-31
W098124923 PCT/US97/22198
- 33
embodiments, the liposome may be complexed or employed in conjunction with
nuclear
non-histone chromosomal proteins (HMG-1 ) (Kato et al. , 1991 ). In yet
further embodiments, the
liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
In that
such expression vectors have been successfully employed in transfer and
expression of a
polynucleotide in vitro and in vivo, then they are applicable for the present
invention. Where a
bacteriophage promoter is employed in the DNA construct, it also will be
desirable to include
within the liposome an appropriate bacteriophage polymerase.
Another mechanism for transferring expression vectors into cells is receptor-
mediated
delivery. This approach takes advantage of the selective uptake of
macromolecules by
receptor-mediated endocytosis in almost all eukaryotic cells. Because of the
cell type-specific
distribution of various receptors, the delivery can be highly specific (Wu and
Wu, 1993).
Receptor-mediated gene targeting vehicles generally consist of two components:
a cell
receptor-specific ligand and a DNA-binding agent. Several ligands have been
used for
receptor-mediated gene transfer. The most extensively characterized ligands
are
asialoorosomucoid (ASOR) (Wu and Wu, 1987) and transferrin (Wagner et al.,
1993). Recently,
a synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has
been used as a
gene delivery vehicle (Ferkol et al., 1993; Perales et al., 1994) -and
epidermal growth factor
(EGF) has also been used to deliver genes to squamous carcinoma cells (Myers,
EPO 0273085).
In other embodiments, the delivery vehicle may comprise a Iigand and a
liposome. For
example, Nicolau et al. ( 1987) employed lactosyl-ceramide, a galactose-
terminal
asialganglioside, incorporated into liposomes and observed an increase in the
uptake of the
insulin gene by hepatocytes. Thus, it is feasible that an expression vector
also may be
specifically delivered into a cell type such as lung, epithelial or tumor
cells, by any number of
receptor-ligand systems, with or without liposomes. For example, epidermal
growth factor
(EGF) may be used as the receptor for mediated delivery of Intrakine construct
in many tumor
cells that exhibit upregulation of EGF receptor. Mannose can be used to target
the mannose
receptor on liver cells. Also; antibodies to CDS (CLL), CD22 (lymphoma), CD25
(T-cell
leukemia) and MAA (melanoma) can similarly be used as targeting moieties.
In certain embodiments, gene transfer may more easily be performed under ex
vivo
conditions. Ex vivo gene therapy refers to the isolation of cells from an
animal, the delivery of a
polynucleotide into the cells, in vitro, and then the return of the modified
cells back into an
animal. This may involve the surgical removal of tissue/organs from an animal
or the primary
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
-34
culture of cells and tissues. Anderson et al., U.S. Patent 5,399,346, and
incorporated herein in its
entirety, disclose ex vivo therapeutic methods. During ex vivo culture, the
expression vector can
express the Intrakine construct. Finally, the cells may be reintroduced into
the original animal,
or administered into a distinct animal, in a pharmaceutically acceptable form
by any of the means
described below.
For therapy of a human HIV or AIDS patient, the practice of the present
invention would
include obtaining peripheral blood or bone marrow from the patient. Peripheral
blood
lymphocytes or stem cells would then be isolated and stimulated. The intrakine
gene and any
further genetic material as discussed herein would then be introduced into the
isolated cells by a
transfer system as described above. It is contemplated that a retroviral
infection system offers
certain advantages. The transduced cells are then expanded in cell culture and
re-infused into the
patient. Treatment frequency as well as number of cells re-infused in each
treatment would
depend on the white blood cell count of the patient, and would be determined
by the practitioner
on an individual basis. It is contemplated, however, that treatments would be
required at three to
six month intervals.
9. Therapeutic composition
Where clinical application of an expression vector according to the present
invention is
contemplated, it will be necessary to prepare the complex as a pharmaceutical
composition
appropriate for the intended application. Generally this will entail preparing
a pharmaceutical
composition that is essentially free of pyrogens, as well as any other
impurities that could be
harmful to humans or animals. One also will generally ~ desire to employ
appropriate salts and
buffers to render the complex stable and allow for complex uptake by target
cells.
Aqueous compositions of the present invention comprise an effective amount of
the
expression vector, dissolved or dispersed in a pharmaceutically acceptable
carrier or aqueous
medium. Such compositions also are referred to as inocula. The phrases
"pharmaceutically or
pharmacologically acceptable" refer to molecular entities and compositions
that do not produce
an adverse, allergic or other untoward reaction when administered to an
animal, or a human, as
appropriate. As used herein, "pharmaceutically acceptable carrier" includes
any and all solvents,
dispersion media, coatings, antibacterial and antifungal agents, isotonic and
absorption delaying
agents and the like. The use of such media and agents for pharmaceutical
active substances is
well known in the art. Except insofar as any conventional media or agent is
incompatible with
CA 02273192 1999-OS-31
WO 98124923 PCTIUS97I22198
-35
the active ingredient, its use in the therapeutic compositions is
contemplated. Supplementary
active ingredients also can be incorporated into the compositions.
Solutions of the active compounds as free base or pharmacologically acceptable
salts can
be prepared in water suitably mixed with a surfactant, such as
hydroxypropylcellulose.
Dispersions also can be prepared in glycerol, liquid polyethylene glycols,
mixtures thereof and in
oils. Under ordinary conditions of storage and use, these preparations contain
a preservative to
prevent the growth of microorganisms.
The expression vectors and delivery vehicles of the present invention may
include classic
pharmaceutical, preparations. Administration of therapeutic compositions
according to the
present invention will be via any common route so long as the target tissue is
available via that
route. This includes oral, nasal, buccal, rectal, vaginal or topical.
Alternatively, administration
will be by orthotopic, intradermal, intraocular, subcutaneous, intramuscular,
intraperitoneal or
intravenous injection. Such compositions would normally be administered as
pharmaceutically
acceptable compositions that include physiologically acceptable carriers,
buffers or other
excipients.
The therapeutic compositions of the present invention are advantageously
administered in
the form of injectable compositions either as liquid solutions or suspensions;
solid forms suitable
for solution in, or suspension in, liquid prior to injection may also be
prepared. These
preparations also may be emulsified. A typical composition for such purpose
comprises a
~0 pharmaceutically acceptable carrier. For instance, the composition may
contain 10 mg, 25 mg,
SO mg or up to about 100 mg of human serum albumin per milliliter of phosphate
buffered
saline. Other pharmaceutically acceptable carriers include aqueous solutions,
non-toxic
excipients, including salts, preservatives, buffers and the like. Examples of
non-aqueous
solvents are propylene glycol, polyethylene glycol, vegetable oil and
injectable organic esters
~ such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous
solutions, saline
solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose,
etc. Intravenous ---
vehicles include fluid and nutrient repIenishers. Preservatives include
antimicrobial agents,
anti-oxidants, chelating agents and inert gases. The pH and exact
concentration of the various
components of the pharmaceutical composition are adjusted according to well
known parameters.
The immunopathologic effects of HIV infection are directly related to the
interaction of
the virus with cells that carry the high affinity receptors for the virus. The
immunological
abnormalities in patients with AIDS include selective T cell deficiency,
decreased in vitro
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
-36
lynphocyte proliferative responses and the presence of antilymphocyte
antibodies. Thus HIV
infection results in a depleted lymphocyte concentration. Lymphocyte
measurement of patients
manifesting AIDS are well known in the art, it is contemplate that the
compositions of the
present invention could be used to boost the active lymphocyte content of
patients that are HIV
positive and patients that manifest AIDS. In this respect the therapeutic
compositions of the
present invention may be employed in the alleviation of the symptoms of AIDS
and also in
conferring resistance to HIV infection.
As discussed earlier there are several ways in which HIV infection may
directly result in
the destruction of T4 cell function including infection and destruction of
progenitor cells that are
responsible for the propagation of the lymphoid cell pool. The present
invention thus
contemplates methods of treating HIV infection by providing autologous and
heterologous bone
marrow transplants comprising cells containing the genetic constructs of the
present invention.
Adoptive immunotherapy is a therapeutic regimen involving the isolation and in
vitro
cloning and expansion of immunologically active cells from a donor. The
expanded,
therapeutically active cells are provided to a patient to obtain a therapeutic
effect. If the donor is
the patient, the transfer is "autologous." If the donor is distinct from the-
patient, the transfer is
"heterologous."
In autologous bone marrow transplantation using the present invention
contemplates the
use of lymphocytes from patients that are seropositive but have not yet
developed the
characteristics of HIV infection and that do not have CCR expression at the
cell surface and
manipulates these cells to express intrakines. These cells are then
transplanted into the patient
thereby confernng resistance to HIV infection in that patient.
Heterologous bone marrow transplant using the present invention is also
contemplated.
In such cases lymphocytes from an HLA matched donor are manipulated to express
intrakines.
Such a bone marrow transplant will be useful in patients with HIV infection
whose immune
system has been compromised.
Bone marrow may be obtained from normal volunteer donors, normal donors for
bone
marrow transplantation, or from ribs excised at the time of cardiothoracic
surgery of patients
with no evidence of hematological disease. In preparing human mononuclear
cells, an aliquot of
marrow is layered into a receptacle such as a centrifuge tube. Initially,
mononuclear cells may be
obtained from a source of bone marrow, e.g., tibiae, femora, spine, ribs,
hips, sternum, as well as
the humeri, radi, ulna, tibiae, and fibulae. Additionally, these cells also
can be obtained from
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97/22198
-37_
cord blood, peripheral blood, or cytokine-mobilized peripheral blood. Other
sources of human
hematopoietic stem cells include embryonic yolk sac, fetal liver, fetal and
adult spleen, and
blood.
The marrow layer is centrifuged to produce a pellet of red cells at the bottom
of the tube,
a clear layer of media, an interface layer which contains the mononuclear
cells and a plasma
medium layer on top. The interface layer may then be using for example
suction. Centrifugation
of this layer at 1000g ultimately yields a mononuclear cells pellet. This
pellet may then be
resuspended in a suitable buffer for cell sorting by FAGS.
To transduce autologous T lymphocytes so that they produce the bicistronic
chemokine
constructs of the present invention, a blood sample of approximately 200
cc/sample, is isolated
from the subject. Lymphocytes are isolated from the blood sample and reared
under appropriate
conditions following standard protocols as exemplified by Janda et al., Manual
of Clinical
Microbiology, 5th Edition, American Society for Microbiology, Washington, DC,
Chapter 19, p
137; (incorporated herein by reference). In this manner approximately 1 O 1 ~
lymphocytes may be
isolated from culture after approximately two weeks.
Isolated cultured lymphocytes are transduced with a retroviral or other vector
as
described herein above such that they will produce the intrakine and secreted
forms of the
desired chemokyne. These lymphocytes may then be reinfused, or inj ected, back
into the host
subject in a pharmaceutically acceptable carrier such that a dose of about 109
lymphocytes is
delivered. The dosage may be readministered at intervals ranging from 2 weeks
to 6 months or
one year as desired depending on the state of the subj ect's immune system.
For example, as a
subjects WBC is reduced due to HIV infection, the transduced lymphocytes or
stem cells may be
infused to maintain acceptable levels of HIV immune lymphocytes and to
increase circulating
chemokynes to inhibit further infection and to reduce the danger of secondary
infections in
conjunction with other means of HIV therapy.
Of course it is understood that the compositions of the present invention may
also be used
in combination with traditional therapies for example, those therapies
involving zovidovudine
(AZT). This is one of a class of nucleoside analogues known as
dideoxynucleosides which block
HIV replication by inhibiting HIV reverse transcriptase.
CA 02273192 1999-OS-31
WO 98124923 PCT/ITS97122198
-38-
11. Examples
The following examples are included to demonstrate preferred embodiments of
the
invention. It should be appreciated by those of skill in the art that the
techniques disclosed in the
examples which follow represent techniques discovered by the inventor to
function well in the
practice of the invention, and thus can be considered to constitute preferred
modes for its
practice. However, those of skill in the art should, in light of the present
disclosure, appreciate
that many changes can be made in the specific embodiments which are disclosed
and still obtain
a like or similar result without departing from the spirit and scope of the
invention.
- EXAMPLE 1
Methods
Construction of Expression Vectors. The human MIP-1 oc and RANTES genes were
PCRTM-amplified from the cDNA of peripheral blood mononuclear cells (PBMCs).
The MIP-la
and RANTES genes were then linked with a KDEL sequence, SEKDEL, SEQ ID N0:7,
by
PCRTM reactions (Marasco et al., I 993). The native MIP-I oc and RANTES genes,
and their
mutants were cloned into expression vectors, respectively (FIG. 2). All of the
constructs were
confirmed by DNA sequencing (DNA sequencing core facility of Wake Forest
University).
Detection of Protein Expression and Immunofluorescent Staining. To label and
precipitate recombinant proteins, cells were radiolabeled with 35S-cysteine
and precipitated with
antibodies (Chen et al., Proc. Natl. Acad. Sci. USA , 91:2932-5936, 1994).
After heat
denaturation the protein samples were analyzed by electrophoresis on SDS-
polyacrylamide gels
and visualized by a phosphorimager. For flow cytometric assay, 6 x 105 cells
were incubated for
1 hour with a primary antibody, followed by incubation with a fluorescein-
conjugate. The cells
were analyzed on a Becton Dickinson FACScan. Indirect immunofluorescent
staining was
performed as described (Chen et al., 1994).
Syncytium Formation Assay. HeLa-T4+ cells grown on dishes (about 50%
confluence)
were co-transfected pCMV-CCRS with different amounts of chemokine expression
plasmid
DNA using a Calcium Phosphate System (Promega). At the same time, HeLa cells
were
transfected with T- or M~-tropic HIV-1 envelope protein expression vector: 48
hr later, the
transfected HeLa cells expressing the envelope proteins (2 x 105) were co-
cultured with
co-transfected HeLa-T4+ cells ( 1 x 1 OS). After 12 to 24 hr co-cultivation,
syncytia in each well
were counted after violet crystal staining.
CA 02273192 1999-OS-31
WO 98/24923 PCTIITS97/22198
-39
Generation of Retroviral Packaging Cell Lines and Gene Transfer. The
retroviral
pLNCX vectors containing the MIP/K or RANTES/K genes (FIG. 2) were transfected
into the
amphotropic packaging cells (PA317), and the culture medium of the transfected
cells was then
used to infect the PA317 cells. 48hr later, the infected packaging cells were
selected with a
6418 (800 ~g/ml) containing medium for two to three weeks. The 6418-resistant
colonies were
subcloned and characterized by genetic analysis to ensure the entire
incorporation of the genes
into the chromosome of the packaging cells. To generate human PBLs, PBMC from
healthy
individuals were separated on a FicolI-Hypaque density gradient, and
nonadherent PBLs were
stimulated in a culture medium (RPMI-1640/20% FCS supplemented with rIL-2 (
1,000 IU/ml)
(Chiron, CA), anti-CD3 (5 ng/ml) (PharMingen, CA) and PHA (5 pg/ml}) for 48
hr. The
stimulated PBL cells were then transduced by co-culture with the recombinant
packaging cells in
the culture medium containing protamine sulfate (S pg/ml) for 48 hr. The
transduced PBLs were
harvested and cultured for one day, followed by transduction in the
supernatant of the
recombinant packaging cells for additional two days. After final transduction,
the PBLs were
expanded in the culture medium for several days.
HIY-1 Infection and RT Assay. PBLs in the RPMI medium supplemented with 10%
FCS and rIL-2 (1,000 IU/ml) and anti-CD3 (5 ng/ml) were infected with 600 half
maximal
tissue-culture infectious dose units (TCIDso ) or 20,000 cpm RT activities of
M~- or T-tropic
HIV-1 viruses, respectively. After 4-hr incubation at 37°C, the
infected PBLs were then washed
once and resuspended in the culture medium, and the RT activities in these
cultures were then
determined as described (Chen et al., 1996).
EXAMPLE 2
Chemokine Targeting to The Endoplasmic Reticulum Lumen
A mutated chemokine was targeted to the lumen of the ER of lymphocytes to
intracellularly block the transport and surface expression of newly
synthesized CCRS, which
resulted in the phenotypic CCRS knock-out (FIG. 1 ).
MIP-1 a and RANTES, and their mutated genes (MIP 1-K and RANTES-K) linked with
a
retention signal sequence for residential soluble ER proteins (KDEL) (Munro
and Pelham, 1987)
were cloned into an expression vector {pRc/CMV) with a Neo marker, (FIG. 2). A
bi-cistronic
vector for co-expression of both the native and mutated chemokines was also
constructed to
inhibit HIV infection both intracellularly and extracellularly. Expression of
these two forms of
CA 02273192 1999-OS-31
WO 98/24923 PCT/LTS97I22I98
- 40 -
chemokines inhibits viral infection to susceptible cells by secreting
chemokines as well as to
phenotypically knock-out CCRS by intracellular binding (FIG. 2).
To determine the expression and localization of the native and mutated
chemokines,
radiolabeling and immunoprecipitation studies were performed. COS cells were
transfected with
S plasmid DNA, and 48 hr later radiolabeled with 35S-cysteine. The cell lysate
and culture medium
were then immunoprecipitated with an anti-human MIP-la. An 8 Kd protein band
corresponding to MIP-1 a was found in both the culture medium and cell lysates
of the
pCMV-MIP1-transfected cells, but not in the control cells.
In pCMV-MIP 1-K-transfected cells, the MIP-1 a proteins were predominately
found in
the cell lysate, not in the culture medium. To further determine the cellular
retention of MIP 1-K,
the transfected cells were pulse-radiolabeled for 30 min., chased for various
times, and then
immunoprecipitated. The MIP 1-K proteins were found to be stably retained
intracellularly with
a half life of over 4 hr. In the bi-cistronic expression vector-transfected
cells, both the MIP 1 and
MIP1-K proteins were co-expressed.
The localization of the native and mutated chemokines was further examined by
immunofluorescent staining. An ER staining pattern was observed throughout the
cytoplasm in
the cells transfected with pCMV-MIPl-K, while a perinuclear Golgi staining
pattern was seen in
the cells transfected with pCMV-MIP 1. The native and mutated RANTES proteins
were also
expressed in the transfected cells in a similar manner with the native and
mutated MIP 1 proteins.
Thus, these results indicate that the mutated chemokines were effectively
expressed, and stably
retained in the ER, while native chemokines were secreted out of the cells.
EXAMPLE 3
Effects of Intrakines on CCRS surface Expression
To examine the effects of intrakines on CCRS surface expression; a vector for
expression
of CCRS tagged with an HA epitope (Liu et al., 1996; Field et al., 1988) was
constructed (FIG.
2). A flow cytometric assay was used to determine the surface expression of HA-
CCRS on the
cells co-transfected with the intrakine expressing vectors.
As shown in FIG. 3B, when transfected with pCMV-HA-CCRS alone, the cell
surface
expression of HA-CCRS was detected in 64.7% cells. However, when co-
transfected with
increasing amounts of pCMV-MIP 1-K, the cell numbers with positive surface
staining for
HA-CCRS were dramatically decreased (FIG. 3C and FIG. 3D). Co-transfection
with
CA 02273192 1999-OS-31
WO 98/24923 PCTII1S97122198
-41 -
pCMV-MIP 1-K did not interfere with the cel l surface expression of an
unrelated marine
leukemia virus envelope protein (Matsuoka et al., J. Biol. Chem., 269:22565-
22573, 1994). This
result demonstrates that the CCRS surface expression is blocked by intrakines.
To determine whether the blockade of the HA-CCRS surface expression is a
result of the
intracellular binding of MIP I -K to newly synthesized HA-CCRS, a co-
immunoprecipitation
assay was performed. In the cells co-transfected with pCMV-MIP I -K and pCMV-
HA-CCRS,
the MIP I -K proteins were co-precipitated by the anti-HA antibody. The
specificity of the co
immunoprecipitation was further confirmed based on the observation that the
anti-HA antibody
did not precipitate the MIP 1-K in the cells transfected with pCMV-MIP I -K
alone, or co
transfected with a vector over-expressing irrelevant proteins such as viral
PTV G proteins
(Matsuoka et al., 1994; Chen et al., 1994).
It was noted that no distinguishable band of the CCRS proteins appeared on SDS-
PAGE,
although the specific co-immunoprecipitation and flow cytometric data
indicated the HA-CCRS
expression in the cells. Heterogeneous patterns of glycosylation or other
undefined properties
may contribute to the anomalous migration of these receptors on polyacrylamide
gels, as
observed in previous studies (Liu et al., 1996; Strader et al., 1994). Taken
together, these results
indicate that the ER-retained intrakines bind newly-synthesized CCRS molecules
and prevent
their transport to the cell surface.
'~ EXAMPLE 4
Effects of Intrakines on CCRS
To further examine the effects of intrakines on CCRS, a sensitive CCRS/CD4-
mediated
syncytium formation assay was performed (Deng et al., 1996). The transformed
cells expressing
CD4 (HeLa-T4+)(Marasco et al., 1993) were co-transfected pCMV-CCRS with
different amounts
of pCMV-MIP1-K, and 48 hr later, co-cultured with the HeLa cells
expressing~Vl~ (ADA and
YLJ2) or T (IIIB)-tropic HIV-1 envelope proteins (Choe et al. , 1996) for 12
to 24 hr. -
As shown in FIG. 3 E, in the co-cultures with the cells expressing pCMV-MIP 1-
K,
significant inhibition of M~-tropic envelope-mediated syncytium formation was
observed.
When co-transfected with increasing amounts of pCMV-MIP 1-K, M~-tropic
envelope-mediated
syncytium formation was almost completely inhibited. However, the T-tropic
envelope-mediated syncytium formation was not inhibited by transfection with
pCMV-MIP1-K.
Inhibitory effects on the syncytium formation of M~-tropic envelope proteins
at various degrees
CA 02273192 1999-OS-31
WO 98124923 PCT/US97122198
- 42
were also observed in the cells co-transfected with pCMV-MIP 1, pCMV-MIP 1/K,
pCMV-RANTES, pCMV-RANTES-K, or pCMV-RANTESIK (FIG. 3E). The inhibition of
syncytium formation by expression of native (secreted) MIP-1 or RANTES may be
due to the
partial saturation of the binding site on CCRS.
To evaluate potential therapeutic applications, the bi-cistronic expression
cassettes
(MIPIIK and RANTES/K) were cloned into a marine retrovirai shuttle vector,
pLNCX (Miller,
1992) (FIG. 2). Transformed packaging cell lines (PA317) (Miller, 1992)
producing
recombinant retroviruses containing the chemokine genes were generated, and
characterized.
Fresh human PBLs were then transduced with the MIP/K gene by co-culture with
the
transformed packaging cells. After transduction, the specific DNA fragments
corresponding to
the chemokine genes and IRES sequence were amplified from the genomic DNA of
transduced
PBLs by PCRTM. Expression of the MIP-1 and MIP1-K proteins was detected in the
transduced
PBLs, but not in untransduced PBLs by radiolabeling and immunoprecipitation
assays.
The transduced or mock-transduced PBLs were then infected with M~- or T-tropic
HIV-1
isolates, respectively, and the viral production in the cell cultures was-
examined by a reverse
transcriptase (RT) assay (Chen et al., 1994). The transduced or untransduced
PBLs (2 x 105)
were equally infected with 600 TCID50 or 20,000 cpm RT of several M~- or T-
tropic HIV 1
viruses for 4 hr, and then replaced with the fresh culture medium containing
1,000 IU/ml of rIL-2
and anti-CD3 (5 pg/ml). Every three to four days, cell numbers in each well
were counted, and
the culture medium was subjected to RT assays. RT activities (105 celis/ml) in
duplicate wells
after subtracting the background were calculated. Only low levels of RT
activities were detected
in the cultures of transduced PBLs infected with M~-tropic viruses, but high
levels of RT
activities detected in the control PBL culture. However, T-tropic HIV-1
viruses were able to
infect both the transduced and mock transduced PBLs. These results indicate
that human PBLs
transduced with intrakine genes are resistant to M~-tropic HIV-1 infection.
EXAMPLE 5
Genetic Modification of Lymphocytes Expressing Intracellular CXC-Chemokines to
Inactivate CXR4 Receptor for HIV-1 Gene Therapy
Fusin/CXC-chemokine receptor (CXR)-4 with seven-transmembrane segments is a
co-receptor of T-tropic human immunodeficiency virus (HIV)-type 1 which is
required for the
fusion and entry to CD4-positive lymphocytes. Because of the critical role of
CXR4 for HIV-1
CA 02273192 1999-OS-31
WO 98/24923 PCT/US97122198
- 43
infection, the inventors hypothesized that lymphocytes with phenotypic knock-
out of CXR4
would be resistant to HIV-infection. In this study, stromal cell-derived
factor-i (SDF), a
biological Iigand for CXR4, was genetically modified to target the lumenal
endoplasmic
reticulum (ER) of lymphocytes (FIG. 4A). As a result, the intracellularly
retained SDF bound
the newly synthesized CXR4 and prevented its transport to the cell surface.
The lymphocytes with the phenotypic CXR4 knock-out were resistant to T-tropic
HIV-1
infection. In addition, co-expression of the secreted and ER-retained
chemokines was achieved
for additional inhibition of viral infection. In summary, this novel approach
uniquely targeting at
the CXR4 co-receptor should have a significant application for HIV-1 gene
therapy.
Genetic defects in CC-chemokine receptor (CCR)-5, the co-receptor for
macrophage-
tropic HIV-1, were found to be responsible for natural resistance of some
individuals to HIV-1
infection. These data suggest that the knock-out of CXR4 in lymphocytes may
have a
therapeutic implication. In the inventors' and other studies, blockade of cell
surface expression
of a membrane protein has been accomplished by intracellular binding of
intrabodies or other
molecules targeted to the ER (Marasco et al., 1993; Chen et al., 1995a; Chen
et al., 1995b;
Buonocore and Rose, 1990). In this study, a mutated SDF was generated in order
to target the
lumen of the ER of lymphocytes for intracellular blockade of the transport and
surface
expression of newly synthesized CXR4s (FIG. 4A). The genetically modified
lymphocytes
without the co-receptor CXR4 on the cell surface were found to be resistant to
T-tropic HIV-1
infection.
The SDF-1 gene was cloned from the cDNA of mouse spleen, with only one amino
acid
difference with human SDF-1, and then genetically Linked with a retention
signal sequence for
residential soluble ER proteins (KDEL) (Munro and Pelham, 1987). The SDF gene
and its
derivative (SDF-K) were then cloned into an expression vector (pRc/CMV) with a
Neo selection
marker (FIG. 4A). A bi-cistronic vector for co-expression of the native and
mutated chemokines
was also constructed in order to inhibit viral infection to susceptible cells
by extracellular
secretion of chemokines, as well as to phenotypically knock-out CXR4s by
intracellular binding
(FIG. 4A).
Resistance to T-tropic HIV-1 infection of transduced lymphocytes is shown in
FIG. 4B.
The transduced cells expressing SDF, SDF-K or untransduced Jurkat cells (2 x
105) were equally
infected with 600 TCID50 T-tropic HIV-1 virus, for 4 hr, and then placed with
the fresh culture
CA 02273192 1999-OS-31
WO 98124923 PCT/US97122198
-44
medium. RT activities in duplicate wells after subtracting the background
level are presented
(FIG. 4B).
EXAMPLE 6
Effect of Intracellular SDF-Intrakine Expression on CXCR4 Surface Expression
The SDF-la gene and modified gene linked with an ER retention signal sequence
(KDEL) (Marasco et al., 1993) were cloned into expression vectors (FIG. 2).
Constructs
containing an influenza hemagglutinin (HA) tag (Field et al., 1988) were also
generated to
facilitate protein detection. Expression of the SDF-1 and SDF-K proteins was
determined by
radiolabeling and immunoprecipitation analysis. A SDF-1 protein band
precipitated by an
antibody to the HA tag was found in both culture medium and lysate of HeLa
cells transfected
with the construct containing the native SDF-1 gene with the HA tag (pCMV-SDF-
HA). No
corresponding protein band was detected in the cells transfected with a
control plasmid.
However, the SDF-K proteins were predominately found in the cell lysate, not
in the culture
medium of the transfected cells, suggesting that the native SDF-1 was secreted
out of the cells,
but the modified SDF-K (SDF-intrakine) was retained intracellularly. To
further demonstrate the
intracellular retention of SDF-K, pulse-chase experiments were performed. It
was shown that the
native SDF-1 was efficiently secreted from the cells, while the SDF-intrakine
was stably retained
intracellularly with a half life greater than 4 hr.
Inhibition of CXCR4 surface expression by SDF-intrakine expression was then
examined using a
sensitive CXCR4/CD4-mediated syncytium formation assay (Bluel et al., 1996;
Marasco et al.,
1993). The CXCR4 and CD4-positive HeLa-T4 cells seeded on 12-well plates were
co-
transfected with a IIIB envelope expressor {Marasco et al., 1993) and SDF
expression vectors. In
the cells transfected with the envelope expressor only or co-transfected with
the control vector,
extensive syncytium formation was observed. However, in the cells co-
transfected with pCMV-
SDF-K, no or only few polykaryons were formed. Co-transfection with pCMV-SDF
partially
inhibited the syncytium formation. Three repeated studies showed consistent
inhibitory effects of
SDF-intrakine on syncytium formation. A co-immunoprecipitation assay was
further performed
to determine the possible intracellular binding of the intrakine and CXCR4.
The SDF-intrakine
was co-precipitated from the CXCR4-positive HeLa cells (Bluel et al., 1996)
transfected with
pCMV-SDF-K using an anti-CXCR4 antibody, suggesting the association of the SDF-
intrakine
CA 02273192 1999-OS-31
WO 98/24923 PCT/US971Z2198
- 45 - _
and CXCR4. In addition, the surface expression of CXCR4 on the transduced
lymphocytes
expressing SDF-K were dramatically decreased as demonstrated by flow
cytometric assays.
Taken together, the results from these transient assays suggest that SDF-
intrakines bind newly
synthesized CXCR4 and block its transport to the cell surface.
Construction of expression vectors: The mouse SDF-1 a gene with a single amino
acid
difference with the human gene was PCR-amplified from the cDNA of mouse spleen
with the
primers
5'-TTAAGCTTCGCGCCATGAACGCCAAGGTC-3' (SEQ ID N0:2) (P 1 )
and S'-TTTGCGGCCGCTTACTTGTTTAAAGCCTTCTCCAGGT-3') (SEQ ID
N0:3}(Nagasawa et al., 1994; Shirozu et al., 1995). An HA tag sequence
(identified herein as
SEQ ID NO:1 ) was linked to the SDF-la gene by a PCR reaction with the primer
designated as
SEQ ID N0:2 and
5'-
TTTTCTAGATTAAGCATAATCTGGAACATCATACGGATACTTGTTTAAAGCCTTCTCC
AG-3') (SEQ ID N0:4). The SDF-la or SDF-la-HA gene was then linked with an ER
retention
signal (SEKDEL, SEQ ID N0:6) by a PCR reaction with the primers (P 1 and 5 '-
TTTTCTAGATTACAGCTCGTCCTTCTCGCTAGCATAATCTGGAACATCATA-3') (SEQ
ID NO:S). These DNA ftagments were digested with HindIII/XbaI and cloned into
an expression
vector (pRc/CMV) Marasco et al., 1993). The SDF-la-KDEL fragment was further
cloned into
the retroviral vector pLNCX (Chen et al., 1997), and the resultant construct
was designated as
LNCX-SDF-K/Neo. A truncated nerve growth factor receptor (aNGFR) gene PCR-
amplified
from the MN vector DNA (Phillips et al., 1996; Rudoll et al., 1996) was cloned
into LNCX-
SDF-K/Neo by replacing the neomycin selection marker. All of the constructs
were identified by
restriction enzyme digestion and confirmed by DNA sequencing.
EXAMPLE 7
Generation and Evaluation of Intrakine-Expressing Lymphocyte Lines
To further determine the effects of SDF-intrakine expression, two CD4/CXCR4+-
immortal
lymphocyte lines, Jurkat and Molt-4 (Marasco et al., 1993; Daniel et al., J.
Yirol. 62,4123-4128,
1988), were transfected with various expression vectors by electroporation,
followed by 6418
selection (Chen et al, 1994a; Chen et al., Nature 385, 78-80, 1997).
Incorporation of the SDF
CA 02273192 1999-OS-31
WO 98/24923 PCTIIJS97122198
-46
vectors into the transduced lymphocytes was demonstrated by genomic PCR
amplification.
Transcription of the incorporated SDF 1 or SDF-K genes was also detected by
reverse
transcriptase (RT)-PCR. Moreover, expressed SDF-1 was found to be secreted out
of the
transduced lymphocytes, while SDF-intrakine was retained inside the
lymphocytes. The effects
of SDF-intrakine on CXCR4 surface expression of the transduced lymphocytes
were examined
by flaw cytometric assay (Chen et al., 1994a). Surface expression of CXCR4 was
detected on
the Molt-control, but dramatically decreased on Molt-SDF-K. In contrast,
comparable levels of
CD4 surface expression were detected in both the parental and transduced Molt.
The biological
features of the transduced lymphocytes, including cell proliferation and DNA
synthesis rates,
were found to be similar to the parental lymphocytes.
To determine whether SDF-intrakine expression would lead to the resistance of
the
transduced lymphocytes to T-tropic HIV-1 entry, an envelope-complementation
assay was used.
In this assay, HIV-1 envelope glycoproteins expressed in traps complement a
single round of
replication of an envelope-deleted provirus encoding the chloramphenicol
acetyltransferase
(CAT) gene (Chen et al., 1994b; Choe et al., 1996) .Recombinant viruses that
were pseudotyped
with the envelope glycoproteins derived from the T-tropic (IIIB) virus were
produced, and the
efficiency of the recombinant pseudovirus entry was assessed by measuring CAT
activity in the
cells 60 hr after infection. High levels of CAT activity in the control
lymphocytes were detected
after infection with the recombinant IIIB virus, but the CAT activity levels
in the transduced
lymphocytes expressing SDF-intrakine were dramatically decreased. The partial
inhibition of
virus entry of the transduced lymphocyte expressing the native SDF-1 may be
due to the partial
saturation of the binding site on CXCR4 during and after SDF-1 secretion.
To further examine the effect of SDF-intrakine, transduced or control Molt
lymphocytes
were infected with 20,000 cpm RT of T-tropic IIIB viruses. Extensive syncytium
formation in
the Molt-control was observed six days postinfection, while only a few
syncytia were observed
in the Molt-SDF-K cell culture. In agreement, high levels of RT activities
were detected in the
Molt-control culture, but only low levels of RT detected in the Molt-SDF-K
culture. Molt-SDF
secreting the native SDF-1 were partially resistant to virus infection. To
confirm the result,
transduced or untransduced Jurkat lymphocytes were also infected with the IIIB
virus, and the
dramatic anti-HIV effects of SDF-intrakine were also observed in the
transduced cells. Thus,
these results indicate that the transduced lymphocytes expressing SDF-
intrakine are viable and
resistant to T-tropic HIV-I infection.
CA 02273192 1999-OS-31
WO 98124923 PCTIU597/22198
-47
Generation of transformed lymphocyte lines: About 1 x 106 Molt-4 and Jurkat
human immortal
lymphocytes were cultured in RPMI-1640 medium supplemented with 10% fetal calf
serum
(FCS), and transfected with 10 ug of plasmid DNA by electroporation (Yang et
al., Nature
Biotechnology 15, 46-51, 1997). 48 hr later, the transfected lymphocytes were
then selected in
the RPMI-1640/10% FCS containing 800 ug/ml of 6418 (Gibco-BRL) on 24-well
plates for two
to three weeks. The 6418-resistant cells were picked and subcloned by limited
dilution as
described elsewhere (Chen et al., 1994a) (incorporated herein by reference).
Envelope-complementation assay. 293 cells grown on 10-cm dishes were co-
transfected with
pHXB~envCAT (20 ug) and an envelope protein expressor (5 ug) Chen et al.,
1994b; Choe et
al., 1996). 48 hr later, the culture medium was harvested, and RT activities
in the supernatant
were measured (Yang et al., 1997). The recombinant viruses (20,000 cpm RT
activities) were
used to infect target cells by overnight incubation, and 60 hr later, the
target cells were then lysed
and used for determination of CAT activity using a kit (Promega).
Detection of protein expression and flow cytometric assay. To label and
immunoprecipitate
recombinant proteins, cells were radiolabeled with 35S-cysteine or -Trans for
various times, and
the cell lysates and culture media were then precipitated with antibodies as
described elsewhere
(Chen et al., 1996, encorporated herein by reference). After heat
denaturation, the protein
samples were analyzed by electrophoresis on SDS-polyacrylamide gels and
visualized by a
Phosphorimager. For flow cytometric assay, 1 x 106 lymphocytes were incubated
with a primary
antibody for 1 hour, followed by incubation with a fluorescein-conjugate. The
cells were then
analyzed on a Becton Dickinson FACScan.
EXAMPLE 8
Resistance to HIV-1 Infection of Transduced PBLs
The following example demonstrates the ability of SDF-intrakine to confer
resistance to HIV-1
infection on human peripheral blood lymphocytes (PBLs). Initially, PBLs were
transduced with
the recombinant retrovirus containing the SDF-K and Neo selection marker (FIG.
2), and viral
infection in the transduced PBLs after Neo selection was dramatically
inhibited. However, due to
the nonspecific toxicity to primary PBLs, difficulty in reliably assessing the
transduction
efficiency, and a prolonged process of the Neo selection, a truncated human
nerve growth factor
receptor (ONGFR) which expresses on transduced cells was used as a marker for
quantifying the
CA 02273192 1999-OS-31
WO 98!24923 PCTIUS97/22198
-48- _
gene transfer efficiency and isolating transduced PBLs (Phillips et al.,
Nature Medicine 2, 1154-
1156, .1996; Rudoll et al. Gene Therapy 3, 695-705, 1996). About 7 to 10
percent of the
stimulated PBLs were transduced by the recombinant retroviral vector (LNCX-SDF-
K/~NGFR)
or control retroviral vector (MN) that expresses the ONGFR marker only,
produced from
transiently transfected packaging cells (Bing) (Pear et al., Pro. Nat. Acad.
Sci. USA. 90, 8392-6,
1993: Pear et al., Methods in Molecular Biology: Methods in Gene Therapy (P.
Robbins, ed.),
(Humana Press, Totowa, NJ), 41-57, 1997). The transduced PBLs were then
isolated with an
anti-NGFRlanti-IgG-magnetic bead kit (ImmunoTech Inc., Westbreak, ME). After
isolation, over
93 percent of the PBL population were positive for the NGFR marker.
To evaluate the anti-HIV-1 effect of SDF-intrakine, the isolated PBLs
transduced with
either LNCX-SDF-K/DNGFR or MN control were infected with an identical IIIB
virus
inoculum, and the viral production in the cultures was examined by the RT
assay. Only low
levels of RT activity were detected in the cultures of transduced PBLs, but
high levels of RT
were detected in the MN (control)-transduced PBL culture. Thus, the SDF-
intrakine gene was
efficiently transduced into primary human PBLs, and the transduced PBLs were
resistant to T-
tropic HIV-I infection.
Biological Evaluation of Transduced PBLs
Although several lymphocyte lines expressing SDF-intrakine were shown to have
normal
biological features, the effect of expression of SDF-intrakine on primary
human lymphocytes
was examined. Accordingly, fresh human PBLs were transduced with LNCX-SDF-
K/~NGFR or
MN vectors, and the transduced PBLs were isolated. Several biological analyses
were carried
out. First, the PBLs transduced with either LNCX-SDF-K/ONGFR or MN were
subjected to flow
cytometric analysis. There were comparable levels of surface expression of CD3
and CD4
molecules on the PBLs transduced with LNCX-SDF-K/~NGFR or MN.
In contrast, CXCR4 surface expression on the PBLs transduced with LNCX-SDF-
K/ONGFR was
dramatically decreased, when compared to the CXCR4 expression on the PBLs
transduced with
MN. These results indicate that SDF-intrakine selectively blocks CXCR4 surface
expression.
Chemotaxis assays were also performed to determine the responsiveness of the
transduced PBLs
to chemokine stimulation. The responsiveness of PBLs transduced with LNCX-SDF-
K to the
stimulation of recombinant SDF-1 was significantly decreased, when compared to
that of PBLs
CA 02273192 1999-OS-31
WO 98/24923 PCT/ITS97/22198
-49
transduced with the control MN. However, the PBLs transduced with LNCX-SDF-K
or MN
were equally sensitive to the stimulation of_ MIP-1 a which binds to CC-
chemokine receptors
(Baggliolini et al., 1994). These results further demonstrate the selective
inactivation of CXCR4
by SDF-intrakine. It was noted that a portion of PBLs transduced with LNCX-SDF-
K responded
to SDF-1 at a high concentration, probably due to residual CXCR4 on a portion
of the PBLs, or
an unidentified interaction of SDF-1 with chemokine receptors, other than
CXCR4. Third, PBLs
transduced with LNCX-SDF-K/ONGFR were also shown to normally respond to anti-
CD3/CD28
or PHA stimulation in IL-2 production, cell proliferation, and DNA synthesis.
Thus, these results
suggest that human PBLs expressing SDF-intrakine maintain normal biological
activities.
Retroviral vector production and gene transduction. PBMC from healthy
individuals were
separated on a Ficoll-Hypaque density gradient, and nonadherent PBLs were
stimulated in a
culture medium (RPMI-1640/20% FCS supplemented with rIL-2 (500 IU/ml) (Chiron,
CA) and
anti-CD3 (5 ng/ml) (PharMingen, CA) for 48 hr. An amphotropic retroviral
packaging cell line,
Bing, was used to transiently produce recombinant retroviral vectors. Bing
cells were plated on
100 mm dishes at 80% confluence and transfected with 15 ug of LNCX-SDF-
K/DIVGFR or MN
plasmid DNA by using a calcium phosphate transfection kit (Promega). 48 hr
later, the
stimulated PBLs were cultured in the supernatant of the transfected Bing cells
containing rIL-2,
anti-CD3, and protamine sulfate (5 ug/ml) for 24 to 72 hr at 37°C. The
transduced PBLs were
harvested and subjected to flow cytometric analysis to detect the NGFR marker
on PBLs.
Isolation of transduced PBLs: Anti-mouse IgG magnetic immunobeads (ImmunoTech
Inc.), 1
micron spherical particles directly coated with affinity-purified sheep
polyclonal antibody
directed to the Fc fragment of mouse IgG, were diluted to 1:20 in PBS/0.2%
BSA. Separation of
the beads from the buffer solution was achieved by placing the tube in a
Cobalt-Samarium
magnet support (ImmunoTech Inc.) for 5 min. 5 to 20 ug of the anti-human NGFR
antibody
(Boehringer Mannheim, Indianapolis, 11V) were added into 1 to 4 mg of beads in
PBS/0.2% BSA
and incubated at room temperature for 15 min. After washing with PBS/1.2% BSA,
0.5 mg (50
~ul) of the beads were added into 1 ml of 107 PBLs in PBS/30% FCS, and
incubated 10 min at
room temperature. The beads/PBLs solution was then placed in the Cobalt-
Samarium magnet
support for 10 min, and the supernatants containing the unbound cells were
discarded. The
beads/PBLs rosettes were washed twice with PBS/0.2% BSA, and resuspended in
the culture
medium for 24 hr at 37° C.
CA 02273192 1999-OS-31
WO 98124923 PCT/US97/22198
-50-
Chemotaxis assay: 5x105 isolated PBLs transduced with LNCX-SDF-K/ONGFR or MN
control
vector were suspended in 100 ul of the RPMI-1640 medium containing 0.25% human
serum
albumin, and added to the top chamber of a 5-pm pore polycarbonate TransweIl
culture insert
(Costar, Cambridge, MA). 500 ul of the RPMI-1640/0.25% albumin containing
various
concentrations of the recombinant human MIP-Ia or SDF-1 (R & D System Inc.,
Minneapolis,
MN) were added to the bottom chamber of the Transwell. After 3 hr incubation
at 37°C, the cell
numbers in the bottom chamber were counted, and percentages of the
transmigration are
presented after substracting the background (absence of chemokines)
transmigration Bleul et al.,
1996}. -
All of the compositions and/or methods disclosed and claimed herein can be
made and
executed without undue experimentation in light of the present disclosure.
While the
compositions and methods of this invention have been described in terms of
preferred
embodiments, it will be apparent to those of skill in the art that variations
may be applied to the
compositions and/or methods and in the steps or in the sequence of steps of
the method described
herein without departing from the concept, spirit and scope of the invention.
More specifically,
it will be apparent that certain agents which are both chemically and
physiologically related may
be substituted for the agents described herein while the same or similar
results would be
achieved. All such similar substitutes and modifications apparent to those
skilled in the art are
deemed to be within the spirit, scope and concept of the invention as defined
by the appended
claims.
CA 02273192 1999-OS-31
WO 98/24923 PCTlUS97/22198
-51 -
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Wake Forest University
(B) STREET: Medical Center Boulevard
(C) CITY: Winston-Salem
(D) STATE: North Carolina
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP) : 27157-1023
(ii) TITLE OF INVENTION: INACTIVATION OF HIV CO-RECEPTORS AS THERAPY
FOR HIV INFECTION
(iii) NUMBER OF SEQUENCES: 6
(iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO)
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/032,277
(B) FILING DATE: 02-DEC-1996
(2} INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
1 5
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
TTAAGCTTCG CGCCATGAAC GCCAAGGTC 29
CA 02273192 1999-OS-31
WO 98124923 PCT/US97I22198
-52-
(2) INFORMATION FOR SEQ ID NO: 3:
(i} SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
TTTGCGGCCG CTTACTTGTT TAAAGCCTTC TCCAGGT _ 37
(2)INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
TTTTCTAGAT TAAGCATAAT CTGGAACATC ATACGGATAC TTGTTTAAAG CCTTCTCCAG 60
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs
(B) TYPE: nucleic acid
(C} STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 5:
TTTTCTAGAT TACAGCTCGT CCTTCTCGCT AGCATAATCT GGAACATCAT A S1
(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Ser Glu Lys Asp Glu Leu
1 5
