Note: Descriptions are shown in the official language in which they were submitted.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
DESCRIPTION
DIAGNOSIS OF DISEASE STATE USING MRNA PROFILES
BACKGROUND OF THE INVENTION
A. Field of the Invention
The present invention relates generally to the detection and diagnosis of
human disease
states and methods relating thereto. More particularly, the present invention
concerns probes and
methods useful in diagnosing, identifying and monitoring the progression of
disease states through
measurements of gene products.
B. Description of the Related Art
Genetic detection of human disease states is a rapidly developing field
(Taparowsky et al.,
1982; Slamon etal., 1989; Sidransky etal., 1992; Miki etal., 1994; Dong etal.,
1995; Morahan et
aL, 1996; Lifton, 1996; Barinaga, 1996). One advantage presented by this field
is that certain
disease states may be detected by non-invasive means, e.g. sampling peripheral
blood or amniotic
fluid. Affected individuals may be diagnosed early in disease progression,
allowing more effective
patient management with better clinical outcomes.
Some problems exist with this approach. A number of known genetic lesions
merely
predispose to development of specific disease states. Individuals carrying the
genetic lesion may
not develop the disease state, while other individuals may develop the disease
state without
possessing a particular genetic lesion. In human cancers, genetic defects may
potentially occur in a
large number of known tumor suppresser genes and proto-oncogenes.
The genetic detection of cancer has a long history. One of the earliest
genetic lesions
shown to predispose to cancer was transforming point mutations in the ras
oncogenes (Taparowsky
et al., 1982). Transforming ras point mutations may be detected in the stool
of individuals with
benign and malignant colorectal tumors (Sidransky et aL, 1992). However, only
50% of such
tumors contained a ras mutation (Sidransky et al., 1992). Similar results have
been obtained with
amplification of HER-2/neu in breast and ovarian cancer (Slamon et al., 1989),
deletion and
CA 02273847 1999-06-03
WO 98/24935
PCTfUS97/22105
2
mutation of p53 in bladder cancer (Sidransky et al., 1991), deletion of DCC in
colorectal cancer
(Fearon et al., 1990) and mutation of BRCA/ in breast and ovarian cancer (Miki
et al., 1994).
None of these genetic lesions are capable of predicting a majority of
individuals with cancer
and most require direct sampling of a suspected tumor, making screening
difficult. Further, none of
the markers described above are capable of distinguishing between metastatic
and non-metastatic
forms of cancer. In effective management of cancer patients, identification of
those individuals
whose tumors have already metastasized or are likely to metastasize is
critical. Because metastatic
cancer kills 560,000 people in the US each year (ACS home page),
identification of markers for
metastatic cancer, such as metastatic prostate and breast cancer, would be an
important advance.
A particular problem in cancer detection and diagnosis occurs with prostate
cancer.
Carcinoma of the prostate (PCA) is the second-most frequent cause of male
cancer-related death in
the United States (Boring, 1993). The incidence of prostate cancer increased
by 50% between 1980
and 1990 (Stone et al., 1994). Although relatively few prostate tumors
progress to clinical
significance during the lifetime of the patient, those which are progressive
in nature are likely to
have metastasized by the time of detection. Survival rates for individuals
with metastatic prostate
cancer are quite low. Between these extremes are patients with prostate tumors
that will
metastasize but have not yet done so, for whom surgical prostate removal is
curative.
Determination of which group a patient falls within is critical in determining
optimal treatment and
patient survival.
Genetic changes reported to be associated with prostate cancer include:
allelic loss (Bova, et
al., 1993; Macoska et al., 1994; Carter et aL, 1990); DNA hypermethylation
(Isaacs et al., 1994);
point mutations or deletions of the retinoblastoma (Rb) and p53 genes
(Bookstein et al., 1990a;
Bookstein et al., 1990b; Isaacs et aL, 1991); and aneuploidy and aneusomy of
chromosomes
detected by fluorescence in situ hybridization (FISH) (Macoska et al., 1994;
Visakorpi et al., 1994;
Takahashi et al., 1994; Alcaraz et al., 1994).
A recent development in this field was the identification of a prostate
metastasis suppresser
gene, KALI (Dong et aL, 1995). Insertion of wild-type Kill gene into a rat
prostate cancer line
caused a significant decrease in metastatic tumor formation (Dong et al.,
1995). However,
detection of KAI] mutations is dependent upon direct sampling of mutant
prostate cells. Thus,
either a primary prostate tumor must be sampled or else sufficient transformed
cells must be present
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
3
in blood, lymph nodes or other tissues to detect the missing or abnormal gene.
Further, the
presence of a deleted gene may frequently be masked by large numbers of
untransformed cells that
may be present in a given tissue sample.
The most commonly utilized current tests for prostate cancer are digital
rectal examination
. 5 (DRE) and analysis of serum prostate specific antigen (PSA). Although
PSA has been widely used
as a clinical marker of prostate cancer since 1988 (Partin & Oesterling,
1994), screening programs
utilizing PSA alone or in combination with digital rectal examination have not
been successful in
improving the survival rate for men with prostate cancer (Partin & Oesterling,
1994). While PSA is
specific to prostate tissue, it is produced by normal and benign as well as
malignant prostatic
epithelium, resulting in a high false-positive rate for prostate cancer
detection (Partin & Oesterling,
1994).
Other markers that have been used for prostate cancer detection include
prostatic acid
phosphatase (PAP) and prostate secreted protein (PSP). PAP is secreted by
prostate cells under
hormonal control (Brawn et al., 1996). It has less specificity and sensitivity
than does PSA. As a
result, it is used much less now, although PAP may still have some
applications for monitoring
metastatic patients that have failed primary treatments. In general, PSP is a
more sensitive
biomarker than PAP, but is not as sensitive as PSA (Huang et al., 1993). Like
PSA, PSP levels are
frequently elevated in patients with BPH as well as those with prostate
cancer.
Another serum marker associated with prostate disease is prostate specific
membrane
antigen (PSMA) (Horoszewicz et al., 1987; Carter et al., 1996; Murphy et al.,
1996). PSMA is a
Type II cell membrane protein and has been identified as Folic Acid Hydrolase
(FAH) (Heston,
1996; Carter et al., 1996). Antibodies against PSMA react with both normal
prostate tissue and
prostate cancer tissue (Horoszewicz et al., 1987). Murphy et al. (1995) used
ELISA to detect
serum PSMA in advanced prostate cancer. As a serum test, PSMA levels are a
relatively poor
indicator of prostate cancer. However, PSMA may have utility in certain
circumstances. PSMA
is expressed in metastatic prostate tumor capillary beds (Silver et al., 1997)
and is reported to be
more abundant in the blood of metastatic cancer patients (Murphy et al.,
1996). PSMA
messenger RNA (mRNA) is down-regulated 8-10 fold in the LNCaP prostate cancer
cell line
after exposure to 5-a-dihydroxytestosterone (DHT) (Israeli et al., 1994).
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
4
A relatively new potential biomarker for prostate cancer is human kallekrein 2
(HK2)
(Piironen et aL, 1996). HK2 is a member of the kallekrein family that is
secreted by the prostate
gland. In theory, serum concentrations of HK2 may be of utility in prostate
cancer detection or
diagnosis, but the usefulness of this marker is still being evaluated.
Interleukin 8 (IL-8) is a potent serum cytokine that is synthesized and
secreted by a large
variety of cell types, including neutrophils, endothelial cells, T-cells,
macrophages, monocytes,
and fibroblasts (Saito et al., 1994). Previous reports have found
overexpression of IL-8 in some
forms of cancer. (di Celle etal., 1994; Ikei etal., 1992; Scheibenbogen et
al., 1995; Vinante etal.,
1993). RT-PCR analysis was used by di Celle etal. (1994) to demonstrate IL-8
production in B-
cell chronic lymphocytic leukemia. Vinante et al. (1993) used Northern blot
analysis to show
upregulation of IL-8 expression in acute myelogenous leukemia. Ikei et al.
(1992) found an
increase in serum levels of IL-8 in hepatic cancer patients following
therapeutic treatment.
Scheibenbogen et al. (1995) observed a correlation between IL-8 levels and
tumor loads in patients
with metastatic melanoma, while reporting that serum IL-8 was undetectable in
healthy individuals
or in patients with metastatic renal cell carcinoma. These authors suggested
that the IL-8 was
produced by the melanoma cells themselves, rather than by circulating
lymphocytes. Andrawis et
al. (1996) reported that while IL-8 was expressed in prostate and bladder
cancer, it was also
abundantly expressed in normal bladder epithelium and in some basal cells in
BPH.
The instant disclosure is the first to combine measurement of IL-8 gene
products with
serum markers of prostate disease, such as PSA, PAP, HK2 or PSMA. The
surprising result of this
multivariate detection is a dramatic increase in sensitivity and specificity
of prostate cancer
detection, while simultaneously allowing the differentiation of advanced from
localized forms of
prostate tumor.
SUMMARY OF THE INVENTION
The present invention addresses deficiencies in the prior art by providing
methods for
identifying specific disease state markers that are expressed in peripheral
lymphocytes of patients in
response to a disease state, at a different level than such markers are
expressed in the peripheral
blood of a normal subject (a healthy individual). An important advantage
provided by the present
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
invention is that a disease state may be detected, diagnosed, or a prognosis
may be derived by
examining a blood sample rather than relying on a more invasive, or less
sensitive test. In
addition, a subject may be monitored for disease progression, status and
response to therapies
through monitoring of differentially expressed disease markers. In certain
embodiments of the
5 present invention a "patient" "individual" or "subject" may be an animal,
including a laboratory
animal or other animal species, or in certain embodiments a human subject.
In certain embodiments of the invention the terms "expression", "gene
expression" and
"expression products" may refer to either production of a marker gene RNA
message or the RNA
message produced or both. In certain other embodiments of the invention the
terms
"expression", "gene expression" and "expression products" may refer to either
translation of a
marker RNA message into proteins, polypeptides and/or peptides, and/or to the
produced
proteins, polypeptides, and/or peptides. In certain aspects of the invention a
marker may be a
gene whose expression is activated to a higher level in a patient suffering a
disease state, relative
to its expression in a healthy subject. It is also understood that a
differentially expressed marker
may be either activated or inhibited at the nucleic acid level or protein
level, or may it may
subject to alternative splicing to result in a different polypeptide product.
Such differences may
be evidenced by a change in mRNA levels, surface expression, secretion or
other partitioning of
a polypeptide, for example. In certain aspects of the invention, a marker may
be a comparison of
expression between two or more marker genes, and/or a comparison of the ratios
of the
expression between two or more marker genes, or even a comparison of two
differently
processed products of the same gene, which differ between healthy subjects and
subjects
suffering a diseased state.
As demonstrated in the examples included herein, the present inventors have
identified
certain markers and methods of identifying markers that have been applied for
the detection of
metastatic prostate and metastatic breast cancer. These examples have
demonstrated that disease
states may be detected and monitored by surveying the response of healthy
immune cells to the
disease condition. As such, this novel method is contemplated to be suitable
for detection of
markers that are differentially expressed in response to other forms of cancer
as well as other
diseases such as asthma, lupus erythematosis, rheumatoid arthritis, multiple
sclerosis, myasthenia
CA 02273847 2006-12-05
WO 98/24935 PCT/US97/22105
6
gravis, autoimmune thyroiditis, amyloid lateral sclerosis, interstitial
cystitis, prostatitis or other
systemic or chronic conditions.
In a certain embodiment of the present invention, the inventors have
demonstrated the
ability to detect and discriminate between benign prostatic hyperplasia (BPH)
and prostate cancer,
using multivariate analysis with several different prostate disease markers.
By combining test
results for serum prostate specific antigen (PSA) and IL-8 gene products, it
is possible to identify a
significant proportion of individuals with prostate cancer, while achieving
close to one hundred
percent accuracy in differentiating between individuals presenting with
prostate cancer versus BPH.
These levels of sensitivity and specificity represent significant advances
over the prior art in
prostate cancer detection and differentiation, which traditionally have been
performed with
univariate analysis with PSA, digital rectal examination and other techniques.
It is further disclosed
that levels of IL-8 gene product in the peripheral circulation may be used to
discriminate advanced
from localized stages of prostate cancer.
It is an important aspect of the present invention that it is the response of
the normal
blood lymphocytes that is being examined, rather than the prostate, breast or
other disease cells
themselves as in previous methods. As an aspect of the invention, certain
mRNAs are identified
that are differentially expressed in normal cells, as a reaction to a disease
state, relative to their
expression in healthy subjects. Two of the metastatic cancer-markers disclosed
herein represent
previously unreported genes, with one of the two matching a small expressed
sequence tag (EST)
described in GenebankAccession# T03013 and SEQ ID NO:1, and another matching
the sequence
disclosed in SEQ ID N0:2. Another marker corresponds to the sequence of
elongation factor 1-
alpha (Genebank Accession # X03558 and SEQ ID NO:3). Two other markers
represent
alternatively spliced forms (Genebank Accession # M28130 and SEQ ID NO:5;
Genebank
Accession # Y00787 and SEQ ID NO:4) of mRNA from the IL-8 (interleukin 8)
gene. One
metastatic cancer marker is a previously uncharacterized gene (SEQ ID NO:29)
that has homology
to a number of previously identified EST sequences, while another marker is a
previously identified
gene sequence (KA000262, Genebank Accession g D87451).
The markers and marker genes comprising the group of total prostate specific
antigen
(PSA); prostate specific membrane antigen (PSMA=Folie Acid I lydrolase);
prostate acid
phosphatase (PAP); prostatic secretory proteins (PSP94); human kallikrein 2 (I-
11(2); and the ratio
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
7
of the concentrations of free and bound forms of PSA (fit PSA), in combination
with any of the
markers identified herein as SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID
NO:4, SEQ ID
NO:2 or SEQ ID NO:29, and the sequences identified in Genebank Accession #s
D87451, T03013,
X03558, M28130, and Y00787, their complementary nucleic acid sequences, or
their expression
products may be used in all embodiments using or detecting the markers in any
of the methods
disclosed herein or known in the art. In the examples disclosed herein, the
differential expression
of marker genes is detected by RNA fingerprinting methods, however,
differential expression
detected by any other means, including but not limited to other RNA
fingerprinting methods,
Northern blotting, immunodetection, protein-protein interactions, biological
activity or other
methods known in the art would fall within the scope of the present invention.
The present disclosure is the first report of an alternatively spliced form of
IL-8 mRNA that
includes intron 3. In the peripheral blood of normal individuals the mRNA
transcript containing
intron 3 (Genebank Accession # M28130) is more abundant than the previously
reported spliced
form from which intron 3 is missing (Genebank Accession # Y00787).
Surprisingly, in patients
with metastatic prostate cancer the previously reported spliced form is much
more abundant, with a
seven-fold increase compared to normal individuals. In contrast, the
transcript containing intron 3
is approximately seven-fold less abundant in patients with metastatic prostate
cancer than in normal
individuals.
The substantial change in levels of alternatively spliced mRNA species in the
peripheral
blood of individuals with metastatic cancer provides a simple and effective
diagnostic test for the
presence of cancer metastases, that is unaffected by problems in sampling
primary tumors or the
masking influence of normal cells in a tissue sample. It therefore represents
a significant advance
over previous methods for detecting and diagnosing metastatic cancer in
humans. The skilled
practitioner will realize that metastatic cancer detection and diagnosis may
be performed by
quantitative analysis of either the IL-8 mRNA transcripts themselves or their
protein products.
The present disclosure represents a substantial and unexpected advance over
previous
knowledge in this field. It reports a novel spliced form of IL-8 mRNA that is
repressed in
metastatic prostate cancer. It provides a sensitive means for detecting
metastatic cancer by
measuring the levels of the two alternatively spliced IL-8 mRNA forms. It
provides a highly
sensitive and specific method for detecting and differentiating between BPH,
localized and
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
8
advanced forms of prostate cancer by combining detection of IL-8 gene product
with other markers
of prostate disease.
The present disclosure further demonstrates the feasibility of detecting and
diagnosing
human disease states in general by monitoring changes in the expression of
specific genes in
peripheral lymphocytes. The skilled practitioner of the art will realize that
such a technique has
widespread applicability for screening of asymptomatic individuals for disease
state markers.
The identified disease state markers may in turn be used to design specific
oligonucleotide
probes and primers. In certain preferred embodiments the term "primer" as used
here includes any
nucleic acid capable of priming template-dependent synthesis of a nascent
nucleic acid. In certain
other embodiments the nucleic acid may be able to hybridize a template, but
not be extended for
synthesis of nascent nucleic acid that is complementary to the template. As
used herein a "primer"
may be at least about 5, about 6, about 7, about 8, about 9, about 10, about
11, about 12, about 13,
about 14, about 15, about 16, about 17, about 18, about 19, about 20, about
21, about 22, about 23,
about 24, about 25, about 26, about 27, about 28, about 29, about 30, about
35, about 40, about 50,
about, 75, about 100, about 150, about 200, about 300, about 400, about 500,
to one base shorter in
length than the template sequence at the 3' end of the primer to allow
extension of a nascent nucleic
acid chain, though the 5' end of the primer may extend in length beyond the 3'
end of the template
sequence. In certain embodiments of the present invention the term "template"
may refer to a
nucleic acid that is used in the creation of a complementary nucleic acid
strand to the "template"
strand. The template may be either RNA and/or DNA, and the complementary
strand may also be
RNA and/or DNA. In certain embodiments the complementary strand may comprise
all or part of
the complementary sequence to the template, and/or may include mutations so
that it is not an
exact, complementary strand to the template. Strands that are not exactly
complementary to the
template strand may hybridize specifically to the template strand in detection
assays described here,
as well as other assays known in the art, and such complementary strands that
can be used in
detection assays are part of the invention.
When used in combination with nucleic acid amplification procedures, these
probes and
primers enable the rapid analysis of peripheral blood samples. In certain
aspects of the invention,
the term "amplification" may refer to any method or technique known in the art
or described herein
for duplicating or increasing the number of copies or amount of a target
nucleic acid or its
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
9
complement. In certain aspects of the invention, the term "amplicon" refers to
the target sequence
for amplification, or that part of a target sequence that is amplified, and/or
the amplification
products of the target sequence being amplified. In certain other embodiments
an "amplicon" may
include the sequence of probes or primers used in amplification. This analysis
assists physicians in
detecting and diagnosing the disease state and in determining optimal
treatment courses for
individuals at varying stages of disease state progression.
In light of the present disclosure, one of ordinary skill in the art will
select segments from
the identified marker genes for use in the different detection, diagnostic, or
prognostic methods,
vector constructs, antibody production, kit, and/or any of the embodiments
described herein as part
of the present invention. Marker gene sequences include those published in the
Genebank database
that match the identified marker genes: Genebank Accession numbers D87451,
T03013, X03558,
M28130, and Y00787, as well as the sequences disclosed herein as SEQ ID NO:1,
SEQ ID NO:2,
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:29, which also include
sequences
for previously uncharacterized marker genes (UCPB 35, SEQ ID NO:1; UC 302, SEQ
ID NO:2;
UC 331, SEQ ID NO:29) identified herein. For example, in certain embodiments
in which one
may be practicing the present invention for the identification of a disease
marker, for example, the
sequences selected to design probes and primers may include repetitive
stretches of adenine
nucleotides (poly-A tails) normally attached at the ends of the RNA for the
identified marker genes.
In certain other embodiments, probes and primers may be specifically designed
to not include these
or other segments from the identified marker genes, as one of ordinary skilled
in the art may deem
certain segments more suitable for use in the detection methods disclosed.
For example, where a genomic sequence is disclosed, one would use sequences
that
correspond to exon regions of the gene in most cases. However, as described
herein, at least one
metastatic cancer marker includes alternately spliced transcripts so that
intronic sequences may be
used for diagnostic or prognostic purposes (Genebank Accession # M28130). Exon
sequences in
the gene structure, as described in the Genebank listing for Accession #
M28130, include bases
1482 to 1647, 2464 to 2599, 2871 to 2954, and 3370 to 4236. Intron 3 includes
bases 2954 to
3370. One of ordinary skill in the art may select segments from the published
exon sequences, or
may assemble them into a reconstructed mRNA sequence that does not contain
intronic sequences,
such as intron 3. Alternatively, the published sequence for IL-8 that reports
a spliced form from
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
which intron 3 is missing (Genebank Accession # Y00787) may be used. By
choosing or selecting
the sequences to include or exclude intron 3, one could preferentially detect
expression of one
alternatively spliced form of IL-8, or even the ratio of the two forms using
the methods disclosed
herein. One of ordinary skill in the art may select and/or assemble segments
from any of the
5
identified marker gene sequences into other useful forms, such as coding
segment reconstruction's
of mRNA sequences from published genomic sequences of the identified marker
genes, as part of
the present invention. Such assembled sequences would be useful in designing
probes and primers,
as well as providing coding segments for protein translation, for detection,
diagnosis, and prognosis
embodiments of the invention described herein.
10
For example, primers to detect the message of IL 8 using the transcribed
portions of the
marker sequence as set forth in the listing in Genebank Accession # M28130 may
hybridize to
nucleotides 1482 to 1503 and the complement of nucleotides 1626-1647. These
particular primers
would amplify a segment of message of the marker gene 166 base pairs in
length. Primers
designed to nucleotides 1482 to 1503 and the complement of nucleotides 2464 to
2483 would
amplify a segment of message of the marker gene 186 base pairs long in
messages that have the
intervening intron between nucleotides 1648 to 2463 removed. Thus, one skilled
in the art would
be able to calculate the expected size of transcribed sequences from marker
genes identified herein
whose sequences are published either as genomic sequence, mRNA, or cDNA, as
well as the
sequences disclosed herein, taking into account the differences in size of the
products produced
depending on the presence or absence of intronic sequences. In preferred
embodiments, the
differences in size of amplification products using primers designed to
regions flanking both sides
of intron 3 in the IL-8 marker gene sequences identified (Genebank Accession #
Y00787 and #
M28130) can be used in detection, diagnosis, and/or prognosis of metastatic
cancer. However,
primers designed to regions of IL-8 sequences that do not flank intron 3, or
the other marker genes
that do not have differences in intron splicing, or that prime mRNA or cDNA
template sequences,
would not be expected to produce amplification products that include intronic
segments.
For example, primers designed to nucleotides 1 to 20 and the complement of
nucleotides
200 to 220 of SEQ ID NO:1 would amplify a metastatic marker gene segment 220
base pairs long.
Primers designed to nucleotides 115 to 138 and the complement of nucleotides
730 to 744 of SEQ
ID NO:29 would amplify a metastatic marker gene segment 630 base pairs long.
Primers designed
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
11
to nucleotides 102 to 120 and the complement of nucleotides 381 to 401 of the
IL-8 marker gene
sequence identified in Genebank Accession 11 Y00787 would amplify a metastatic
marker gene
segment 302 base pairs long that would be approximately sevenfold less
abundant in normal
patients when compared to patients with metastatic prostate cancer. Primers
can be designed to
amplify the transcribed portions of the metastatic cancer markers that would
include any length of
nucleotide segment of the transcribed sequences, up to and including the full
length of each marker
gene message. It is preferred that the amplified segments of identified marker
genes be an
amplicon of at least about 50 to about 500 base pairs in length. It is
particularly preferred that the
amplified segments of identified marker genes be an amplicon of at least about
100 to about 415
base pairs in length, and/or no longer in length than the amplified segment
used to normalize the
quantity of message being amplified in the detection assays described herein.
Such assays include
RNA fingerprinting methods, however, differential expression may be detected
by other means,
and all such methods would fall within the scope of the present invention. The
predicted size of the
amplified metastatic cancer marker gene segment, calculated by the location of
the primers relative
to the transcribed sequence, would be used to determine if the detected
amplification product is
indeed the marker gene being amplified. Sequencing the amplified or detected
band that matches
the expected size of the amplification product and comparison of the band's
sequence to the known
or disclosed sequence of the marker gene would confirm that the correct marker
gene is being
amplified and detected.
The identified markers may also be used to identify and isolate full length
gene sequences,
including regulatory elements for gene expression, from genomic human DNA
libraries. The
cDNA sequences identified in the present disclosure may be used as
hybridization probes to screen
genomic human DNA libraries by conventional techniques. Once partial genomic
clones have been
identified, full-length genes may be isolated by "chromosomal walking" (also
called "overlap
hybridization"). See, Chinault & Carbon "Overlap Hybridization Screening:
Isolation and
Characterization of Overlapping DNA Fragments Surrounding the LEU2 Gene on
Yeast
Chromosome III." Gene 5: 111-126, 1979. Once a partial genomic clone has been
isolated using a
cDNA hybridization probe, nonrepetitive segments at or near the ends of the
partial genomic clone
may be used as hybridization probes in further genomic library screening,
ultimately allowing
isolation of entire gene sequences for the disease state markers of interest.
It will be recognized that
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
12
full length genes may be obtained using the small expressed sequence tags
(ESTs) described in this
disclosure using technology currently available and described in this
disclosure (Sambrook et al.,
1989; Chinault & Carbon, 1979). Sequences identified and isolated by such
means may be useful
in the detection of the prostate marker genes using the detection methods
described herein, and are
part of the invention.
The identified markers may be used to identify and isolate cDNA sequences. The
EST
sequences identified in the present disclosure may be used as hybridization
probes to screen human
cDNA libraries by conventional techniques. It will be recognized that these
techniques would start
by obtaining a high quality human cDNA library, many of which are readily
available from
commercial or other sources. The library may be plated on, for example,
agarose plates containing
nutrients, antibiotics and other conventional ingredients. Individual colonies
may then be
transferred to nylon or nitrocellulose membranes and the EST probes hybridized
to complementary
sequences on the membranes. Hybridization may be detected by radioactive or
enzyme-linked tags
associated with the hybridized probes. Positive colonies may be grown up and
sequenced by, for
example, Sanger dideoxynucleotide sequencing or similar methods well known in
the art.
Comparison of cloned cDNA sequences with known human or animal cDNA or genomic
sequences may be performed using computer programs and databases well known in
the art.
Sequences identified and isolated by such means may be useful in the detection
of the prostate
disease, or other disease marker genes using the detection methods described
herein, and are part of
the invention.
In one embodiment of the present invention, the isolated nucleic acids of the
identified
marker genes are incorporated into expression vectors and expressed as the
encoded proteins or
peptides. Isolated nucleic acid segments may be from published sequences
identified, or the
sequences disclosed herein, as marker genes. Coding sequences may be assembled
from amino
acid encoding segments of marker genes to remove noncoding segments, or to
truncate coding
sequence, or to use the coding sequences or segments thereof in expression
vectors as is known in
the art. In certain embodiments, genomic sequences may be used to express
peptides or proteins of
the metastatic cancer maker genes identified herein.
Such proteins or peptides are in turn used as antigens for induction of
monoclonal or
polyclonal antibody production. Such antibodies may in turn be used to detect
expressed proteins
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
13
as additional markers for human disease states. Antibody-protein binding may
be detected and
quantitated by a variety of means known in the art, such as labeling with
fluorescent or radioactive
ligands.
Certain metastatic marker genes disclosed herein (SEQ ID NO:! and Genebank
accession #
T03013; and SEQ ID NO:2) do not have reading frames for translation disclosed.
However, one of
ordinary skill in the art may translate the identified sequences or segments
thereof in the three
potential reading frames to obtain peptides or proteins for use in generating
antibodies to these
marker genes. Such antibodies may be used to purify the proteins of the marker
genes, and the
identity of protein being detected is confirmed by peptide sequencing of the
protein. Once
confirmed as binding the translation products of the marker genes
corresponding to SEQ ID NO:1
and Genebank accession # TO3013, and/or SEQ ID NO:2, the antibodies that bind
the marker gene
protein would be useful in detecting, diagnosis, or prognosis of metastatic
cancer.
An example of an marker gene sequence that would be preferred for translation
would be
intron 3 of IL-8 (Genebank Accession # M28130). Peptides or polypeptides that
contain amino
acid sequences from this intron would be preferred in the creation of
polyclonal or monoclonal
antibodies that preferentially detect forms of IL-8 which include intron 3.
In certain aspects of the present invention the terms "immunodetection",
"immunobinding",
"immunoreaction", "immunohistochemical", "immunosorbent", and
"radioimmunoassays" refers
to methods that concern binding, purifying, removing, quantifying or otherwise
generally detecting
biological components by obtaining a sample suspected of containing a protein,
peptide or
antibody, and contacting the sample with an antibody or protein or peptide in
accordance with the
present invention, as the case may be, under conditions effective to allow the
formation of
immunocomplexes. In certain preferred aspects of the present invention, one
obtains a sample
suspected of containing a disease state-marker encoded protein, peptide or a
corresponding
antibody, and contacts the sample with an antibody or encoded protein or
peptide, as the case may
be, and then detects or quantifies the amount of immune complex formed under
the specific
conditions. The steps of various useful immunodetection methods have been
described in the
scientific literature, such as, e.g., Nakamura et al. (1987).
In another embodiment of the present invention, the aforementioned
oligonucleotide
hybridization probes and primers are specific for disease state markers
comprising isolated nucleic
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
14
acids of a sequence comprising the sequences published in Genebank Accession
numbers D87451,
T03013, X03558, M28130, and Y00787, as well as the sequences disclosed herein
as SEQ ID
NO:!, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:29.
Such
probes and primers may be of any length that would specifically hybridize to
the identified marker
gene sequences and may be at least about 14, about 15, about 16, about 17,
about 18, about 19,
about 20, about 21, about 22, about 23, about 24, about 25, about 26, about
27, about 28, about 29,
about 30, about 35, about 40, about 50, about, 75, about 100, about 150, about
200, about 300,
about 400, about 500, and in the case of probes, up to the full length of the
sequences of the marker
genes identified herein. Probes may also include additional sequence at their
5' and/or 3' ends so
that they extend beyond the target sequence with which they hybridize. Such
primers may be used
to amplify disease state markers present in a biological sample, such as
peripheral human blood.
Amplification increases the sensitivity of various known techniques for
detecting the presence of
nucleic acid markers for human disease. Probes that hybridize with nucleic
acid markers for human
disease may be detected by conventional labeling methods, such as binding of
fluorescent or
radioactive ligands. The availability of probes and primers specific for such
unique markers
provides the basis for diagnostic kits identifying disease state progression.
An embodiment of the present invention encompasses a kit for detecting a
disease state in a
biological sample, comprising pairs of primers for amplifying nucleic acids
corresponding to the
marker genes and containers for each of these primers. In another embodiment,
the invention
encompasses a kit for detecting a disease state in a biological sample,
comprising oligonucleotide
probes that bind with high affinity to markers of the disease state and
containers for each of these
probes. In a further embodiment, the invention encompasses a kit for detecting
a disease state in a
biological sample, comprising antibodies specific for proteins encoded by the
nucleic acid markers
of the disease state identified in the present invention.
In one broad aspect, the present invention comprises an isolated nucleic acid
of a sequence
comprising SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:2,
SEQ ID
NO:29, and the sequences identified in Genebank Accession #s D87451, T03013,
X03558,
M28130, and Y00787. The invention further broadly comprises an isolated
nucleic acid of between
17 and 100 bases in length, either identical to or complementary with portions
of the above
mentioned isolated nucleic acids. Such isolated nucleic acids may themselves
be used as probes for
I
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
human disease markers, or may be used to design probes and primers specific
for disease state
markers. The invention further broadly comprises an isolated nucleic acid of
between 17 bases to
the full sequence length, either identical to or complementary with portions
of the above mentioned
isolated nucleic acids.
5
In another broad aspect, the present invention comprises proteins and peptides
with amino
acid sequences encoded by the aforementioned isolated nucleic acids. The
proteins and peptides
may be directly detected in the practice of the invention, or used for
antibody production.
The invention also broadly comprises methods for identifying biomarkers for
use in
prognostic or diagnostic assays of a disease state, using the technique of RNA
fingerprinting to
10 identify RNAs that are differentially expressed between individuals with
the disease state versus
normal individuals. In the practice of the method, one may use random
hexamers, arbitrarily
chosen oligonucleotides, promiscuous oligonucleotide primers or anchoring
primers, as well as
oligonucleotide primers specific for known gene sequences for the reverse
transcription step
and/or for the amplification step. The term "promiscuous oligonucleotide
primers" as used
15 herein denotes oligonucleotides that are statistically designed to
sample sequence complexity in
mRNAs, or open reading frames of mRNAs without bias as applied in a PCR based
RNA
fingerprinting technique. The use of promiscuous primers is preferred because
such use
increases the sampling rate of RNA for fingerprinting by increasing the
displayed fingerprint
complexity. This increases the rate at which differentially expressed mRNAs
can be discovered.
The use of promiscuous oligonucleotide primers as disclosed herein will be
evident to one of
skill in the art in light of the publication by Lopez-Nieto and Nigam, Nature
Biotechnology
14:857-861, 1996.
In certain embodiments
the terms "random hexamers" or "small random oligonucleotides" refer to
primers of random or
semi-random nucleotide sequence of about 6 bases in length, though in certain
embodiments the
length of the primers may be of any length previously described for "primers".
In certain aspects
of the invention "arbitrarily chosen oligonucleotides" may refer to primers
that are selected at the
discretion of one skilled in the art, and may be of random or nonrandom
sequence. In certain
other embodiments "arbitrarily chosen oligonucleotides" may refer to primers
as described by
Welsh et al., 1992
Oligonucleotide sequences designed to
bind to specific genes, IL-8 or PSA for example, may also be used in the
practice of this method.
CA 02273847 2006-01-11
WO 98/24935
PCT/U897/22105
16
The present invention may be described in a broad aspect as a method for
identifying
serological markers for a human disease state. The method comprises the steps
of providing
human peripheral blood mRNAs; amplifying the mRNAs to provide nucleic acid
amplification
products; separating the nucleic acid amplification products; and identifying
those mRNAs that
are differentially expressed between normal individuals and individuals
exhibiting a disease
state. The described method may also comprise, in certain embodiments, the
step of converting
the RNAs into cDNAs using reverse transcriptase to detect and quantitate
circulating cells
induced by the disease state. In certain embodiments of the invention
conversion of RNA into
cDNAs using reverse transcriptase is referred to as a "reverse transcriptase"
reaction. Methods
of reverse transcribing RNA into cDNA are well known and described in Sambrook
et al., 1989.
Alternative methods for reverse transcription utilize thermostable, RNA-
dependent DNA
polymerases. These methods are described in WO 90/07641, filed December 21,
1990.
In certain other embodiments of the invention a "reverse
transcriptase" reaction refers to additional steps of amplification of the RNA
template or its
cDNA product. Such step of amplification may include any methods known in the
art of
increasing the number of copies of RNA or DNA, as well as the methods
described herein.
Methods of amplification include the methods described in Davey et al., EPA
No. 329 822,
as well as polymerase chain reaction or ligase
chain reaction.
The method described in the previous paragraph may be used to discover disease
markers
for any disease state that affects the peripheral blood lymphocytes. Such
diseases include, but
are not limited to metastatic or organ defined cancer, particularly metastatic
prostate or breast
cancer, asthma, lupus erythematosis, rheumatoid arthritis, multiple sclerosis,
myasthenia gravis,
autoimmune thyroiditis, arnyotrophic lateral sclerosis (ALS or Lou Gehrig's
disease), interstitial
cystitis or prostatitis.
The invention further broadly comprises methods for detecting a disease state
in biological
samples, using nucleic acid amplification techniques with primers and
hybridization probes
selected to bind specifically to an isolated nucleic acid of a sequence
comprising SEQ ID NO:1,
SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:2 and SEQ ID NO:29 and the
sequences
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
17
identified in Genebank Accession #s D87451, T03013, X03558, M28130, and
Y00787, thereby
measuring the amounts of nucleic acid amplification products formed.
The invention further broadly comprises the prognosis and/or diagnosis of a
disease state by
measuring the amounts of nucleic acid amplification products formed. The
amounts of nucleic
amplification products identified in an individual patient may be compared
with groups of normal
individuals or individuals with an identified disease state. Diagnosis may be
accomplished by
finding that the patient's levels of disease state markers fall within the
normal range, or within the
range observed in individuals with the disease state. Further comparison with
groups of individuals
of varying disease state progression, such as metastatic vs. non-metastatic
cancer, may provide a
prognosis for the individual patient. The invention further broadly comprises
kits for performing
the above-mentioned procedures, containing amplification primers and/or
hybridization probes.
The invention may be described therefore, in certain broad aspects as a method
of
detecting a human disease state, comprising the steps of detecting the
quantity of a disease
marker expressed in human peripheral blood and comparing the quantity of the
said marker to
the quantity expressed in peripheral blood of a normal individual, where a
difference in quantity
of expression is indicative of a disease state. In the practice of the method
the disease marker
may preferably be an mRNA, or even an mRNA amplified by an RNA polymerase
reaction, for
example. The mRNA may also be amplified by any other means such as reverse
transcriptase
polymerase chain reaction or the ligase chain reaction. The RNA may be
detected by any means
known in the art, such as by RNA fingerprinting, branched DNA or a nuclease
protection assay,
for example. Disease states that may be detected by the present method include
any disease state
for which a marker is known and may include metastatic cancer, particularly
metastatic prostate
cancer, asthma, lupus erythromatosis, rheumatoid arthritis, multiple
sclerosis, myasthenia gravis,
autoimmune thyroiditis, amyotrophic lateral sclerosis, interstitial cystitis
or prostatitis.
In certain preferred embodiments of this method, the mRNA will comprise one or
more
of the sequences or the complements of the transcribed sequences disclosed
herein as SEQ ID
NO:!, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:2, SEQ ID NO:29 and the
sequences identified in Genebank Accession i4s D87451,103013, X03558, M28130,
and Y00787,
or the mRNA may comprise a product of the interleukin 8 (IL-8) gene.
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
18
The method of detecting a disease state described in the previous paragraphs
may further
comprise the steps of providing primers that selectively amplify the disease
state marker,
amplifying the nucleic acid with said primers to form nucleic acid
amplification products,
detecting the nucleic acid amplification products and measuring the amount of
the nucleic acid
amplification products formed. In the practice of certain embodiments of the
method, the
primers may be selected to specifically amplify a nucleic acid having a
sequence comprising
SEQ ID NO:], SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:2, SEQ ID NO:29
and
the sequences identified in Genebank Accession #s D87451, 103013, X03558,
M28130, and
Y00787. In certain alternate embodiments, the marker may be a polypeptide, and
may even be a
polypeptide encoded by a nucleic acid sequence comprising a sequence disclosed
herein as SEQ
ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:2, SEQ ID NO:29 and
the
sequences identified in Genebank Accession #s D87451, T03013, X03558, M28130,
and Y00787,
or it may be described in certain embodiments as a polypeptide encoded by the
IL-8 gene.
Detection of the disease state may be by detection of an antibody
immunoreactive with said
marker. It is also an embodiment of the invention that detection may be by a
cellular bioassay,
that responds to the presence of a biologically active agent such as IL-8, for
example. In certain
embodiments of the present invention a "bioassay" is any assay that measures
or detects the
presence of a compound or effector, such as a protein, polypeptide, or peptide
product of an
expressed marker gene, by its affect on a cell, organism, or biologically
derived reagent or
detection system. Bioassays that may be used in the present invention,
include, but are not
limited to, those described in Schroder et aL, 1990 and Yoshimura et al.,
1989, Kurdowska et al.,
1997, Hedges et al., 1996)
and all bioassays known in the
art that can be used to detect the expressed markers.
The present invention broadly comprises production of antibodies specific for
proteins or
peptides encoded by SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:4, SEQ ID
NO:2,
SEQ ID NO:29 and the sequences identified in Genebank Accession D87451,
T03013, X03558,
M28130, and Y00787, and the use of those antibodies for diagnostic
applications in detecting and
diagnosing the disease state. The levels of such proteins present in the
peripheral blood of a patient
may be quantitated by conventional methods. Correlation of protein levels with
the presence of a
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
19
human disease or the progression of a human disease may be accomplished as
described above for
nucleic acid markers of human disease.
Another broad aspect of the present invention comprises the detection and
diagnosis of
disease states, including BPH and prostate cancer, by combining measurement of
levels of two or
more disease state markers. A broad embodiment of the invention comprises
combining
measurement of serum IL-8 gene product with other markers of prostate disease,
such as PSA,
PAP, 141(2, PSP94 and PSMA. Yet another broad aspect of the present invention
comprises kits for
detection and measurement of the levels of two or more disease state markers
in biological samples.
The skilled practitioner will realize that such kits may incorporate a variety
of methodologies for
detection and measurement of disease state markers, including but not limited
to oligonucleotide
probes, primers for nucleic acid amplification, antibodies which bind
specifically to protein
products of disease state marker genes, and other proteins or peptides which
bind specifically to
disease state marker gene products.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to further
demonstrate certain aspects of the present invention. The invention may be
better understood by
reference to one or more of these drawings in combination with the detailed
description of
specific embodiments presented herein.
FIG. 1A. Relative quantitative RT-PCR of UC Bands #325-1 (intron 3-) and 325-2
(intron 3+) shows that the normally spliced form of IL-8 mRNA (intron 3-) is
abundantly
expressed in individuals with metastatic prostate cancer (M) compared with
normal individuals
(N). The amplification reactions were sampled at different cycle numbers. The
alternatively
spliced form of IL-8 mRNA (intron 3+) is more abundant in normal individuals
than in patients
with metastatic cancer. The data were normalized against B-actin mRNA.
FIG. 1B. Relative quantitative RT-PCR of UC Bands #325-1 (intron 3-) and 325-2
(intron 3+) shows that the normally spliced form of IL-8 mRNA (intron 3-) is
abundantly
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
expressed in individuals with metastatic prostate cancer (M) compared with a
pool of normal
individuals (N). The alternatively spliced form of IL-8 mRNA (intron 3+) is
more abundant in
normal individuals than in patients with metastatic cancer. The data were
normalized against 13-
actin mRNA.
5
FIG. 2. Ability of total PSA (t-PSA) to distinguish BPH and Stages A, B, & C
prostate
cancer.
FIG. 3. Ability of corrected free/total PSA (f/t PSA) ratio to distinguish BPH
and Stages
10 A, B, & C prostate cancer.
FIG. 4. Ability of UC325 (IL-8) to distinguish BPH and Stages A, B, & C
prostate
cancer.
15 FIG. 5. Ability of UC325 (IL-8) and t-PSA combined to distinguish
BPH and Stages A,
B, & C prostate cancer.
FIG. 6. Ability of UC325 (IL-8) and the f/t PSA ratio combined to distinguish
BPH and
Stages A, B, & C prostate cancer.
FIG. 7. Relative quantitative RT-PCRTm showing that UC331 mRNA is roughly
seven
times more abundant in the peripheral blood of individuals with recurrent
metastatic breast or
prostate cancer compared to UC331 mRNA levels from healthy volunteers. PCRTM
amplification
of a UC331 specific cDNA fragment was performed using the same pools of13-
actin normalized
cDNAs as templates. PCRTM reactions were terminated after either 25, 28 or 31
cycles. Pools of
cDNAs were constructed from peripheral blood RNAs from eight healthy
volunteers (N), ten
individuals with recurrent metastatic prostate cancer (P), or ten individuals
with recurrent
metastatic breast cancer (B). The intensity of the bands are proportional to
the relative amounts
of UC331 mRNA in the individuals from which these cDNA pools were constructed.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
21
FIG. 8. PCRTM amplification of a UC332 specific cDNA fragment using the same
pools
of normalized cDNAs as templates. PCRTM reactions were terminated after either
25, 28 or 31
cycles. Pools of cDNAs were constructed from peripheral blood RNAs from eight
healthy
volunteers (N), ten individuals with recurrent metastatic prostate cancer (P),
or ten individuals
with recurrent metastatic breast cancer (B). The intensity of the bands are
proportional to the
relative amounts of UC332 mRNA in the individuals from which these cDNA pools
were
constructed.
DETAILED DESCRIPTION OF THE INVENTION
Terms used:
HK2: human kallekrein 2 gene product
PAP: prostatic acid phosphatase
PSA: prostate specific antigen
PSMA: prostate specific membrane antigen (Folic Acid Hydrolase)
PSP94: prostate secreted protein (94 kDa)
t-PSA: total PSA
fit (Free/Total PSA): ratio of free to total PSA, measured in serum specimens
with moderately
elevated t-PSA
IL-8: Interleukin-8 (UC 325)
SENSITIVITY = (True Positives/(True Positives + False Negatives); plotted on y-
axis of ROC
curve.
SPECIFICITY = (True Negatives)/(True Negatives + False Positives); plotted on
x-axis (as 1-
Specificity) of ROC curve
ROC: Receiver Operator Character Curve; a means of plotting
sensitivity and
specificity over a range of cut-off (threshold) values.
BPH: benign prostate hyperplasia (or hypertrophy)
CaP: adenocarcinoma of the prostate
Stage A CaP: organ-confined clinical stage of prostate cancer in
which tumor is not
palpable by a digital rectal exam (DRE) (Walsh & Worthington, 1995).
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
22
Stage B CaP:
organ-confined clinical stage of prostate cancer in which tumor is
palpable
by a digital rectal exam and involves one or both lobes of the gland
(Walsh & Worthington, 1995).
Stage C CaP:
non-organ-confined clinical stage of prostate cancer in which tumor is
palpable by a DRE and invades beyond the capsule and/or the seminal
vesicles (Walsh & Worthington, 1995).
Stage D CaP: non-organ-confined clinical stage of prostate cancer
characterized by
metastases to lymph nodes, bone or other distant organ site (Walsh &
Worthington, 1995).
The present invention concerns the early detection, diagnosis, and prognosis
of human
disease states. Markers of a disease state, in the form of isolated nucleic
acids of specified
sequences from the peripheral blood of individuals with the disease state, are
disclosed. These
markers are indicators of the disease state and are diagnostic for the
presence of the disease state in
patients. Such markers provide considerable advantages over the prior art in
this field. Since they
are detected in peripheral blood samples, it is not necessary to suspect that
an individual exhibits
the disease state before a sample may be taken. The detection methods
disclosed are thus suitable
for widespread screening of asymptomatic individuals. Further, the methods
provide for sensitive
detection of disease state markers that is relatively unaffected by the
presence of normal, non-
diseased cells in a biological sample such as peripheral blood.
It will be apparent that the nucleic acid sequences disclosed will find
utility in a variety of
applications in disease state detection, diagnosis, prognosis and treatment.
Examples of such
applications within the scope of the present disclosure comprise amplification
of markers of the
disease state using specific primers, detection of markers of the disease
state by hybridization with
oligonucleotide probes, incorporation of isolated nucleic acids into vectors,
expression of vector-
incorporated nucleic acids as RNA and protein, and development of immunologic
reagents
corresponding to marker encoded products.
It is important to note that UC-325 (IL-8) serology in combination with PSA
and f/t PSA
can more accurately differentially diagnose prostate cancer and BPH. This
method provides
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
23
significant advantages over previous methodologies for detecting prostatic
cancer, which often
failed to differentiate between prostatic cancer and BPH.
A. Nucleic Acids
As described in Examples 1 through 4, the present disclosure provides five
markers of a
disease state, identified by RNA fingerprinting. These include two previously
previously
uncharacterized gene products, as well as nucleic acid products of the IL-8
(interleukin 8) and
human elongation factor 1-alpha genes.
In one embodiment, the sequences of isolated nucleic acids disclosed herein
find utility as
hybridization probes or amplification primers. These nucleic acids may be
used, for example, in
diagnostic evaluation of tissue samples or employed to clone full length cDNAs
or genomic clones
corresponding thereto. In certain embodiments, these probes and primers
comprise oligonucleotide
fragments. Such fragments are of sufficient length to provide specific
hybridization to an RNA or
DNA sample extracted from tissue. The sequences typically will be 10-20
nucleotides, but may be
longer. Longer sequences, e.g., 40, 50, 100, 500 and even up to full length,
are preferred for certain
embodiments.
Nucleic acid molecules having contiguous stretches of about 10, 15, 17, 20,
30, 40, 50, 60,
75 or 100 or 500 nucleotides of a sequence comprising Genebank Accession
numbers D87451,
T03013, X03558, M28130, Y00787, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4,
SEQ ID NO:5, or SEQ ID NO:29 are contemplated. Molecules that are
complementary to the
above mentioned sequences and that bind to these sequences under high
stringency conditions are
also contemplated. These probes are useful in a variety of hybridization
embodiments, such as
Southern and northern blotting. In some cases, it is contemplated that probes
may be used that
hybridize to multiple target sequences without compromising their ability to
effectively diagnose
the disease state.
Various probes and primers may be designed around the disclosed nucleotide
sequences.
Primers may be of any length but, typically, are 10-20 bases in length. By
assigning numeric
values to a sequence, for example, the first residue is 1, the second residue
is 2, etc., an algorithm
defining all primers may be proposed:
n to n + y
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
24
where n is an integer from 1 to the last number of the sequence and y is the
length of the primer
minus one (9 to 19), where n + y does not exceed the last number of the
sequence. Thus, for a 10-
mer, the probes correspond to bases 1 to 10, 2 to 11, 3 to 12 ... and so on.
For a 15-mer, the probes
correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on. For a 20-mer, the
probes correspond to
bases 1 to 20, 2 to 21, 3 to 22 ... and so on.
The values of n in the algorithm above for each of the nucleic acid sequences
is: SEQ ID
NO:1, n= 253; SEQ ID NO:2, n= 183; SEQ ID NO:3, n= 387; SEQ ID NO:4, n= 366;
SEQ ID
NO:5, n= 598.
In certain embodiments, it is contemplated that multiple probes may be used
for
hybridization to a single sample. For example, an alternatively spliced form
of IL-8 mRNA,
containing intron 3, may be detected by probing human tissue samples with
oligonucleotides
specific for intron 3 and for exon portions of the IL-8 transcript.
Hybridization with the intron 3
and exon sequences probe would be indicative of a normal individual and
binding to only the exon
probe would be indicative of metastatic prostate cancer.
The use of a hybridization probe of between 17 and 100 nucleotides in length
allows the
formation of a duplex molecule that is both stable and selective. Molecules
having complementary
sequences over stretches greater than 20 bases in length are generally
preferred in order to increase
stability and selectivity of the hybrid, and thereby improve the quality and
degree of hybrid
molecules. It is generally preferred to design nucleic acid molecules having
stretches of 20 to 30
nucleotides, or even longer. Such fragments may be readily prepared by, for
example, directly
synthesizing the fragment by chemical means or by introducing selected
sequences into
recombinant vectors for recombinant production.
The complement of a nucleic acid sequence is well known in the art and is
based on the
anti-parallel, Watson-Crick pairing of nucleotides (bases) for a given nucleic
acid polymer
(strand). Two complementary strands of DNA are formed into a duplex by pairing
of bases, e.g.
"G" to "C" , "C" to "G", "A" to "T" (in the case of DNA) or "U" (in the case
of RNA) and all "T"
or "U" to "A", in reverse 5' to 3' orientation (anti-parallel). As used herein
therefore, the term
"complement" defines a second strand of nucleic acid which will hybridize to a
first strand of
nucleic acid to form a duplex molecule in which base pairs are matched as G:C,
C:G, A:T/U or
T/U:A.
T
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
A complement may also be described as a fragment of DNA (nucleic acid segment)
or a
synthesized single stranded oligomer that may contain small mismatches or gaps
when
hybridized to its complement, but that is able to hybridize to the
complementary DNA under
high stringency conditions. To hybridize is understood to mean the forming of
a double stranded
5 molecule or a molecule with partial double stranded nature. High
stringency conditions are those
that allow hybridization between two homologous nucleic acid sequences, but
precludes
hybridization of random sequences. For example, hybridization at low
temperature and/or high
ionic strength is termed low stringency. Hybridization at high temperature
and/or low ionic
strength is termed high stringency. Low stringency is generally performed at
0.15 M to 0.9 M
10 NaCl at a temperature range of 20 C to 50 C. High stringency is
generally performed at 0.02 M
to 0.15 M NaCl at a temperature range of 50 C to 70 C. It is understood that
the temperature
and ionic strength of a desired stringency are determined in part by the
length of the particular
probe, the length and base content of the target sequences, and to the
presence of formamide,
tetramethylammonium chloride or other solvents in the hybridization mixture.
It is also
15 understood that these ranges are mentioned by way of example only, and
that the desired
stringency for a particular hybridization reaction is often determined
empirically by comparison
to positive and negative controls.
Accordingly, the nucleotide sequences of the disclosure may be used for their
ability to
selectively form duplex molecules with complementary stretches of genes or
RNAs or to provide
20 primers for amplification of DNA or RNA from tissues. Depending on the
application envisioned,
it is preferred to employ varying conditions of hybridization to achieve
varying degrees of
selectivity of probe towards target sequence.
For applications requiring high selectivity, it is preferred to employ
relatively stringent
conditions to form the hybrids. For example, relatively low salt and/or high
temperature
25 conditions, such as provided by about 0.02 M to about 0.10 M NaCl at
temperatures of about 50 C
to about 70 C. Such high stringency conditions tolerate little, if any,
mismatch between the probe
and the template or target strand, and would be particularly suitable for
isolating specific genes or
detecting specific mRNA transcripts. It is generally appreciated that
conditions may be rendered
more stringent by the addition of increasing amounts of formamide.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
26
For certain applications, for example, substitution of amino acids by site-
directed
mutagenesis, it is appreciated that lower stringency conditions are required.
Under these
conditions, hybridization may occur even though the sequences of probe and
target strand are not
perfectly complementary, but are mismatched at one or more positions.
Conditions may be
rendered less stringent by increasing salt concentration and decreasing
temperature. For example, a
medium stringency condition may be provided by about 0.1 to 0.25 M NaCl at
temperatures of
about 37 C to about 55 C, while a low stringency condition may be provided by
about 0.15 M to
about 0.9 M salt, at temperatures ranging from about 20 C to about 55 C. Thus,
hybridization
conditions may be readily manipulated depending on the desired results.
The following codon chart may be used, in a site-directed mutagenic scheme, to
produce
nucleic acids encoding the same or slightly different amino acid sequences of
a given nucleic acid:
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
27
TABLE 1
Amino Acids Codons
Alanine Ala A GCA GCC GCG GCU
Cysteine Cys C UGC UGU
Aspartic acid Asp D GAC GAU
Glutamic acid Glu E GAA GAG
Phenylalanine Phe F UUC UUu
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU
Lysine Lys K AAA AAG
Leucine Leu L UUA UUG CUA CUC CUG CUU
Methionine Met M AUG
Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG CCU
Glutamine Gin Q CAA CAG
Arginine Arg R AGA AGG CGA CGC CGG CGU
Serine Ser S AGC AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Valine Val V GUA GUC GUG GUU
Tryptophan Trp W UGG
Tyrosine Tyr Y UAC UAU
In other embodiments, hybridization may be achieved under conditions of, for
example, 50
mM Tris-HC1(pH 8.3), 75 mM KC1, 3 mM MgC12, 10 mM dithiothreitol, at
temperatures between
approximately 20 C to about 37 C. Other hybridization conditions utilized may
include
approximately 10 mM Tris-HC1 (pH 8.3), 50 mM KC1, 1.5 mM MgC12, at
temperatures ranging
from approximately 40 C to about 72 C.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
28
In certain embodiments, it is preferred to employ isolated nucleic acids of
the present
disclosure in combination with an appropriate means, such as a label, for
determining
hybridization. A wide variety of appropriate indicator means are known in the
art, including
fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin,
which are capable of
being detected. In preferred embodiments, one may employ a fluorescent label
or an enzyme tag
such as urease, alkaline phosphatase or peroxidase, instead of radioactive or
other environmentally
undesirable reagents. In the case of enzyme tags, colorimetric indicator
substrates are known which
may be employed to provide a detection means visible to the human eye or
spectrophotometrically,
to identify specific hybridization with complementary nucleic acid-containing
samples.
In general, it is contemplated that the hybridization probes described herein
are useful both
as reagents in solution hybridization, as in PCR, for detection of expression
of corresponding genes,
as well as in embodiments employing a solid phase. In embodiments involving a
solid phase, the
test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or
surface. This fixed,
single-stranded nucleic acid is then subjected to hybridization with selected
probes under selected
conditions. The selected conditions depend on the particular circumstances
based on the particular
criteria required (depending, for example, on the G+C content, type of target
nucleic acid, source of
nucleic acid, size of hybridization probe, etc.). Following washing of the
hybridized surface to
remove non-specifically bound probe molecules, hybridization is detected, or
even quantified, by
means of the label.
It is understood that this disclosure is not limited to the particular probes
disclosed herein
and particularly is intended to encompass at least isolated nucleic acids that
are hybridizable to
nucleic acids comprising the disclosed sequences or that are functional
sequence analogs of these
nucleic acids. For example, a nucleic acid of partial sequence may be used to
identify a
structurally-related gene or the full length genomic or cDNA clone from which
it is derived.
Methods for generating cDNA and genomic libraries which may be used as a
target for the above-
described probes are known in the art (Sambrook et al., 1989).
For applications in which the nucleic acid segments of the present disclosure
are
incorporated into vectors, such as plasmids, cosmids or viruses, these
segments may be combined
with other DNA sequences, such as promoters, polyadenylation signals,
restriction enzyme sites,
multiple cloning sites, other coding segments, and the like, such that their
overall length may vary
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
29
considerably. It is contemplated that a nucleic acid fragment of almost any
length may be
employed, with the total length preferably being limited by the ease of
preparation and use in the
intended recombinant DNA protocol.
DNA segments encoding a specific gene may be introduced into recombinant host
cells for
expressing a specific structural or regulatory protein. Alternatively, through
the application of
genetic engineering techniques, subportions or derivatives of selected genes
may be employed.
Upstream regions containing regulatory regions such as promoter regions may be
isolated and
subsequently employed for expression of the selected gene.
Where an expression product is to be generated, it is possible for the nucleic
acid sequence
to be varied while retaining the ability to encode the same product. Reference
to the codon chart,
provided in Table 1, enables the design of any nucleic acid encoding the same
protein or peptide
product.
B. Encoded Proteins
Once the entire coding sequence of a marker-associated gene has been
determined, the gene
may be inserted into an appropriate expression system. The gene may be
expressed in any number
of different recombinant DNA expression systems to generate large amounts of
the polypeptide
product, which may then be purified and used to vaccinate animals to generate
antisera which may
also be useful in the practice of the disclosed invention. For example,
polyclonal or monoclonal
antibodies may be prepared that specifically bind to the protein product(s) of
the marker-associated
gene. Such antibodies may be incorporated into kits that may in turn be used
for detection and
diagnosis of the disease state in peripheral blood or other tissue samples.
Examples of expression systems known in the art include bacteria such as E.
con, yeast
such as Saccharomyces cerevisia and Pichia pastoris, baculovirus, and
mammalian expression
systems such as in Cos or CHO cells. In one embodiment, polypeptides are
expressed in E. coli
and in baculovirus expression systems. A complete gene may be expressed or,
alternatively,
fragments of the gene encoding portions of polypeptide may be produced.
In one embodiment, the gene sequence encoding the polypeptide is analyzed to
detect
putative transmembrane sequences. Such sequences are typically very
hydrophobic and are readily
detected by the use of sequence analysis software, such as Lasergene (DNAstar,
Madison, WI).
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
The presence of transmembrane sequences is often deleterious when a
recombinant protein is
synthesized in many expression systems, especially E. coli, as it leads to the
production of insoluble
aggregates that are difficult to renature into the native conformation of the
protein. Deletion of
transmembrane sequences typically does not significantly alter the
conformation of the remaining
5 protein structure.
Moreover, transmembrane sequences, being by definition embedded within a
membrane,
are inaccessible. Antibodies to these sequences will not prove useful for in
vivo or in situ studies.
Deletion of transmembrane-encoding sequences from the genes used for
expression may be
achieved by conventional techniques. For example, restriction enzyme sites may
be used to excise
10 the desired gene fragment, or PCR-type amplification may be used to
amplify only the desired part
of the gene.
In another embodiment, computer sequence analysis is used to determine the
location of
predicted major antigenic determinant epitopes of the polypeptide. Software
capable of carrying
out this analysis is readily available commercially. Such software typically
uses conventional
15 algorithms such as the Kyte/Doolittle or Hopp/Woods methods for locating
hydrophilic sequences
which are characteristically found on the surface of proteins and are,
therefore, likely to act as
antigenic determinants.
Once this analysis is made, polypeptides may be prepared which contain at
least the
essential features of the antigenic determinant and which may be employed in
the generation of
20 antisera against the polypeptide. Minigenes or gene fusions encoding
these determinants may be
constructed and inserted into expression vectors by conventional methods, for
example, using PCR
cloning methodology.
A gene or gene fragment encoding a polypeptide may be inserted into an
expression vector
by conventional subcloning techniques. In one embodiment, an E. coil
expression vector is used
25 which produces the recombinant polypeptide as a fusion protein, allowing
rapid affinity purification
of the protein. Examples of such fusion protein expression systems are the
glutathione S-
transferase system (Pharmacia, Piscataway, NJ), the maltose binding protein
system (NEB,
Beverley, MA), the FLAG system (IBI, New Haven, CT), and the bxHis system
(Qiagen,
Chatsworth, CA).
T
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
31
Some of these systems produce recombinant polypeptides bearing only a small
number of
additional amino acids, which are unlikely to affect the antigenic character
of the recombinant
polypeptide. For example, both the FLAG system and the 6xHis system add only
short sequences,
both of which are known to be poorly antigenic and which do not adversely
affect folding of the
polypeptide to its native conformation. Other fusion systems produce
polypeptide where it is
desirable to excise the fusion partner from the desired polypeptide. In one
embodiment, the fusion
partner is linked to the recombinant polypeptide by a peptide sequence
containing a specific
recognition sequence for a protease. Examples of suitable sequences are those
recognized by the
Tobacco Etch Virus protease (Life Technologies, Gaithersburg, MD) or Factor Xa
(New England
Biolabs, Beverley, MA).
In another embodiment, the expression system used is one driven by the
baculovirus
polyhedron promoter. The gene encoding the polypeptide may be manipulated by
conventional
techniques in order to facilitate cloning into the baculovirus vector. One
baculovirus vector is the
pBlueBac vector (Invitrogen, Sorrento, CA). The vector carrying the gene for
the polypeptide is
transfected into Spodoptera frugiperda (Sf9) cells by conventional protocols,
and the cells are
cultured and processed to produce the recombinant antigen. See Summers et al.,
A MANUAL OF
METHODS FOR BACULO VIRUS VECTORS AND INSECT CELL CULTURE
PROCEDURES, Texas Agricultural Experimental Station; U.S. Patent No.
4,215,051.
As an alternative to recombinant polypeptides, synthetic peptides
corresponding to the
antigenic determinants may be prepared. Such peptides are at least six amino
acid residues long,
and may contain up to approximately 50 residues, which is the approximate
upper length limit of
automated peptide synthesis machines, such as those available from Applied
Biosystems (Foster
City, CA). Use of such small peptides for vaccination typically requires
conjugation of the peptide
to an immunogenic carrier protein such as hepatitis B surface antigen, keyhole
limpet hemocyanin
or bovine serum albumin. Methods for performing this conjugation are well
known in the art.
In one embodiment, amino acid sequence variants of the polypeptide may be
prepared.
These may, for instance, be minor sequence variants of the polypeptide which
arise due to natural
variation within the population or they may be homologues found in other
species. They also may
be sequences which do not occur naturally but which are sufficiently similar
that they function
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
32
similarly and/or elicit an immune response that cross-reacts with natural
forms of the polypeptide.
Sequence variants may be prepared by conventional methods of site-directed
mutagenesis such as
those described above for removing the transmembrane sequence.
Amino acid sequence variants of the polypeptide may be substitutional,
insertional or
deletion variants. Deletion variants lack one or more residues of the native
protein which are not
essential for function or immunogenic activity, and are exemplified by the
variants lacking a
transmembrane sequence described above. Another common type of deletion
variant is one lacking
secretory signal sequences or signal sequences directing a protein to bind to
a particular part of a
cell. An example of the latter sequence is the SH2 domain, which induces
protein binding to
phosphotyrosine residues.
Substitutional variants typically exchange one amino acid for another at one
or more sites
within the protein and may be designed to modulate one or more properties of
the polypeptide, such
as stability against proteolytic cleavage. Substitutions preferably are
conservative, that is, one
amino acid is replaced with another of similar shape and charge. Conservative
substitutions are
well known in the art and include, for example, the changes of: alanine to
serine; arginine to lysine;
asparagine to glutamine or histidine; aspartate to glutamate; cysteine to
serine; glutamine to
asparagine; glutamate to aspartate; histidine to asparagine or glutamine;
isoleucine to leucine or
valine; leucine to valine or isoleucine; lysine to arginine or glutamine;
methionine to leucine or
isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to
threonine; threonine to
serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and
valine to isoleucine or
leucine.
Insertional variants include fusion proteins such as those used to allow rapid
purification of
the polypeptide and also may include hybrid proteins containing sequences from
other homologous
proteins and polypeptides. For example, an insertional variant may include
portions of the amino
acid sequence of the polypeptide from one species, together with portions of
the homologous
polypeptide from another species. Other insertional variants may include those
in which additional
amino acids are introduced within the coding sequence of the polypeptide.
These typically are
smaller insertions than the fusion proteins described above and are
introduced, for example, to
disrupt a protease cleavage site.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
33
In one embodiment, major antigenic determinants of the polypeptide are
identified by an
empirical approach in which portions of the gene encoding the polypeptide are
expressed in a
recombinant host, and the resulting proteins tested for their ability to
elicit an immune response.
For example, PCR may be used to prepare a range of peptides lacking
successively longer
fragments of the C-terminus of the protein. The immunoprotective activity of
each of these
peptides then identifies those fragments or domains of the polypeptide which
are essential for this
activity. Further studies in which only a small number of amino acids are
removed at each iteration
then enables the location of the antigenic determinants of the polypeptide.
Another embodiment for the preparation of polypeptides according to the
disclosure is the
use of peptide mimetics. Mimetics are peptide-containing molecules which mimic
elements of
protein secondary structure. See, for example, Johnson et al., "Peptide Turn
Mimetics" in
BIOTECHNOLOGY AND PHARMACY, Pezzuto et al., Eds., Chapman and Hall, New York
(1993). The underlying rationale behind the use of peptide mimetics is that
the peptide backbone of
proteins exists chiefly to orient amino acid side chains in such a way as to
facilitate molecular
interactions, such as those of antibody and antigen. A peptide mimetic is
expected to permit
molecular interactions similar to the natural molecule.
Successful applications of the peptide mimetic concept have thus far focused
on mimetics
of 13-turns within proteins, which are known to be highly antigenic. Likely 13-
turn structure within
an polypeptide may be predicted by computer-based algorithms as discussed
above. Once the
component amino acids of the turn are determined, peptide mimetics may be
constructed to achieve
a similar spatial orientation of the essential elements of the amino acid side
chains.
C. Preparation of Antibodies Specific for Encoded Proteins
1. Expression of Proteins from Cloned cDNAs
The cDNAs of sequences comprising Genebank Accession numbers D87451,
T03013, X03558, M28130, Y00787, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4,
SEQ ID NO:5, or SEQ ID NO:29 may be expressed as encoded peptides or proteins.
The
engineering of DNA segment(s) for expression in a prokaryotic or eukaryotic
system may be
performed by techniques generally known in the art of recombinant expression.
It is believed that
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
34
virtually any expression system may be employed in the expression of the
claimed isolated nucleic
acids.
Both cDNA and genomic sequences are suitable for eukaryotic expression, as the
host cell
generally processes the genomic transcripts to yield functional mRNA for
translation into protein.
In addition, it is possible to use partial sequences for generation of
antibodies against discrete
portions of a gene product, even when the entire sequence of that gene product
remains unknown.
Computer programs are available to aid in the selection of regions which have
potential
immunologic significance. Software capable of carrying out this analysis is
readily available
commercially, for example MacVector (IBI, New Haven, CT). The software
typically uses
conventional algorithms such as the Kyte/Doolittle or Hopp/Woods methods for
locating
hydrophilic sequences which are characteristically found on the surface of
proteins and are
therefore likely to act as antigenic determinants.
It may be more convenient to employ as the recombinant gene a cDNA version of
the gene.
It is believed that the use of a cDNA version provides advantages in that the
size of the gene is
generally much smaller and more readily employed to transfect the targeted
cell than a genomic
gene, which is typically up to an order of magnitude larger than the cDNA
gene. However, the
possibility of employing a genomic version of a particular gene or fragments
thereof is specifically
contemplated.
As used herein, the terms "engineered" and "recombinant" cells are intended to
refer to a
cell into which an exogenous DNA segment or gene, such as a cDNA or gene has
been introduced.
Therefore, engineered cells are distinguishable from naturally occurring cells
which do not contain
a recombinantly introduced exogenous DNA segment or gene. Engineered cells are
thus cells
having a gene or genes introduced through the hand of man. Recombinant cells
include those
having an introduced cDNA or genomic gene, and also include genes positioned
adjacent to a
promoter not naturally associated with the particular introduced gene.
To express a recombinant encoded protein or peptide, whether mutant or wild-
type, in
accordance with the present disclosure one prepares an expression vector that
comprises one of the
claimed isolated nucleic acids under the control of, or operatively linked to,
one or more promoters.
To bring a coding sequence "under the control of' a promoter, or to
"operatively link" to a
promoter, one positions the 5' end of the transcription initiation site of the
transcriptional reading
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
frame generally between about 1 and about 50 nucleotides "downstream" of
(i.e., 3' of) the chosen
promoter. The "upstream" promoter stimulates transcription of the DNA and
promotes expression
of the encoded recombinant protein. This is the meaning of "recombinant
expression" in this
context.
5
Many conventional techniques are available to construct expression vectors
containing the
appropriate nucleic acids and transcriptional/translational control sequences
in order to achieve
protein or peptide expression in a variety of host-expression systems. Cell
types available for
expression include, but are not limited to, bacteria, such as E. coli and B.
subtilis transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors.
10
Certain examples of prokaryotic hosts are E. coli strain RR1, E. coli LE392,
E. coli B,
E. coli X 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-,
prototrophic, ATCC No.
273325); bacilli such as Bacillus subtilis; and other enterobacteriaceae such
as Salmonella
typhimurium, Serratia marcescens, and various Pseudomonas species.
In general, plasmid vectors containing replicon and control sequences which
are derived
15
from species compatible with the host cell are used in connection with these
hosts. The vector
ordinarily carries a replication site, as well as marking sequences which are
capable of providing
phenotypic selection in transformed cells. For example, E. coli is often
transformed using pBR322,
a plasmid derived from an E. coli species. pBR322 contains genes for
ampicillin and tetracycline
resistance and thus provides easy means for identifying transformed cells. The
pBR plasmid, or
20
other microbial plasmid or phage must also contain, or be modified to
contain, promoters which
may be used by the microbial organism for expression of its own proteins.
In addition, phage vectors containing replicon and control sequences that are
compatible
with the host microorganism may be used as transforming vectors in connection
with these hosts.
For example, the phage lambda GEMTm-1 I may be utilized in making a
recombinant phage vector
25 which may be used to transform host cells, such as E. coli LE392.
Further useful vectors include pIN vectors (Inouye et al., 1985); and pGEX
vectors, for use
in generating glutathione S-transferase (GST) soluble fusion proteins for
later purification and
separation or cleavage. Other suitable fusion proteins are those with B-
galactosidase, ubiquitin, or
the like.
=
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
36
Promoters that are most commonly used in recombinant DNA construction include
the p-
lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.
While these are the most
commonly used, other microbial promoters have been discovered and utilized,
and details
concerning their nucleotide sequences have been published, enabling their
ligation into plasmid
vectors.
For expression in Saccharomyces, the plasmid YRp7, for example, is commonly
used. This
plasmid already contains the trpl gene which provides a selection marker for a
mutant strain of
yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or
PEP4-1. The
presence of the trpl lesion as a characteristic of the yeast host cell genome
then provides an
effective environment for detecting transformation by growth in the absence of
tryptophan.
Suitable promoting sequences in yeast vectors include the promoters for 3-
phosphoglyceratekinase or other glycolytic enzymes, such as enolase,
glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase,
glucose-6-phosphate
isomerase, 3 -phosphog lycerate mutase, pyruvate kinase, triosephosphate
isomerase,
phosphoglucose isomerase, and glucokinase. In constructing suitable expression
plasmids, the
termination sequences associated with these genes are also ligated into the
expression vector 3' of
the sequence desired to be expressed to provide polyadenylation of the mRNA
and termination.
Other suitable promoters, which have the additional advantage of transcription
controlled
by growth conditions, include the promoter region for alcohol dehydrogenase 2,
isocytochrome C,
acid phosphatase, degradative enzymes associated with nitrogen metabolism, and
the
aforementioned glyceraldehyde-3-phosphatedehydrogenase, and enzymes
responsible for maltose
and galactose utilization.
In addition to micro-organisms, cultures of cells derived from multicellular
organisms may
also be used as hosts. In principle, any such cell culture is workable,
whether from vertebrate or
invertebrate culture. In addition to mammalian cells, these include insect
cell systems infected with
recombinant virus expression vectors (e.g., baculovirus); and plant cell
systems infected with
recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV;
tobacco mosaic virus,
TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti
plasmid) containing
one or more coding sequences.
r
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
37
In a useful insect system, Autographia cahfornica nuclear polyhidrosis virus
(AcNPV) is
used as a vector to express foreign genes. The virus grows in Spodoptera
frugiperda cells. The
isolated nucleic acid coding sequences are cloned into non-essential regions
(for example the
polyhedrin gene) of the virus and placed under control of an AcNPV promoter
(for example the
polyhedrin promoter). Successful insertion of the coding sequences results in
the inactivation of
the polyhedrin gene and production of non-occluded recombinant virus (i.e.,
virus lacking the
proteinaceous coat coded for by the polyhedrin gene). These recombinant
viruses are then used to
infect Spodoptera frugiperda cells in which the inserted gene is expressed
(e.g., U.S. Patent No.
4,215,051 (Smith)).
Examples of useful mammalian host cell lines are VERO and HeLa cells, Chinese
hamster
ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell
lines. In
addition, a host cell strain may be chosen that modulates the expression of
the inserted sequences,
or modifies and processes the gene product in the specific fashion desired.
Such modifications
(e.g., glycosylation) and processing (e.g., cleavage) of protein products may
be important for the
function of the encoded protein.
Different host cells have characteristic and specific mechanisms for the post-
translational
processing and modification of proteins. Appropriate cells lines or host
systems may be chosen to
help ensure the correct modification and processing of the foreign protein
expressed. Expression
vectors for use in mammalian cells ordinarily include an origin of
replication, a promoter located in
front of the gene to be expressed, along with any necessary ribosome binding
sites, RNA splice
sites, polyadenylation site, and transcriptional terminator sequences. The
origin of replication may
be provided either by construction of the vector to include an exogenous
origin, such as may be
derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or
may be provided
by the host cell chromosomal replication mechanism. If the vector is
integrated into the host cell
chromosome, the latter is often sufficient.
The promoters may be derived from the genome of mammalian cells (e.g.,
metallothionein
promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the
vaccinia virus 7.5K
promoter). Further, it is also possible to utilize promoter or control
sequences normally associated
with the gene sequence of interest, provided such control sequences are
compatible with the host
cell systems.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
38
A number of viral based expression systems may be utilized. For example,
commonly used
promoters are derived from polyoma, Adenovirus 2, and most frequently Simian
Virus 40 (SV40).
The early and late promoters of SV40 virus are particularly useful because
both are obtained easily
from the virus as a fragment which also contains the SV40 viral origin of
replication. Smaller or
larger SV40 fragments may also be used, provided there is included the
approximately 250 bp
sequence extending from the Hind III site toward the Bgl I site located in the
viral origin of
replication.
In cases where an adenovirus is used as an expression vector, the coding
sequences may be
ligated to an adenovirus transcription/ translation control complex, e.g., the
late promoter and
tripartite leader sequence. This chimeric gene may then be inserted in the
adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region of the
viral genome (e.g., region
El or E3) results in a recombinant virus that is viable and capable of
expressing proteins in infected
hosts.
Specific initiation signals may also be required for efficient translation of
the claimed
isolated nucleic acid coding sequences. These signals include the ATG
initiation codon and
adjacent sequences. Exogenous translational control signals, including the ATG
codon, may
additionally need to be provided. This need is readily determinable and the
necessary signals
readily provided. It is well known that the initiation codon must be in-frame
(or in-phase) with the
reading frame of the desired coding sequence to help ensure translation of the
entire insert. These
exogenous translational control signals and initiation codons may be of a
variety of origins, both
natural and synthetic. The efficiency of expression may be enhanced by the
inclusion of
appropriate transcription enhancer elements or transcription terminators
(Bittner et al., 1987).
In eukaryotic expression, it is typically preferred to incorporate into the
transcriptional unit
an appropriate polyadenylation site (e.g., 5'-AATAAA-3') if one was not
contained within the
original cloned segment. Typically, the poly A addition site is placed about
30 to 2000 nucleotides
"downstream" of the termination site of the protein at a position prior to
transcription termination.
For long-term, high-yield production of recombinant proteins, stable
expression is
preferred. For example, cell lines that stably express constructs encoding
proteins may be
engineered. Rather than using expression vectors that contain viral origins of
replication, host cells
may be transformed with vectors controlled by appropriate expression control
elements (e.g.,
1
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
39
promoter or enhancer sequences, transcription terminators, polyadenylation
sites, etc.), and a
selectable marker. Following the introduction of foreign DNA, engineered cells
may be allowed to
grow for 1-2 days in an enriched medium and then are switched to a selective
media. The
selectable marker in the recombinant plasmid confers resistance to the
transformant and allows
cells to stably integrate the plasmid into their chromosomes and grow to form
foci which in turn
may be cloned and expanded into cell lines.
A number of selection systems may be used, including, but not limited, to the
herpes
simplex virus thymidine kinase (Wigler et al., 1977), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska et al., 1962) and adenine
phosphoribosyltransferase genes
(Lowy et aL, 1980), in tk-, hgprt- or aprt- cells, respectively. Also,
antimetabolite resistance may
be used as the basis of selection for dhfr, that confers resistance to
methotrexate (Wigler et al.,
1980; O'Hare et al., 1981); gpt, that confers resistance to mycophenolic acid
(Mulligan et al.,
1981); neo, that confers resistance to the aminoglycoside G-418 (Colberre-
Garapin et aL, 1981);
and hygro, that confers resistance to hygromycin.
It is contemplated that the isolated nucleic acids of the disclosure may be
"overexpressed",
i.e., expressed in increased levels relative to their natural expression in
normal human cells, or even
relative to the expression of other proteins in the recombinant host cell.
Such overexpression may
be assessed by a variety of methods, including radio-labeling and/or protein
purification. However,
simple and direct methods are preferred, for example, those involving SDS/PAGE
and protein
staining or Western blotting, followed by quantitative analyses, such as
densitometric scanning of
the resultant gel or blot. A specific increase in the level of the recombinant
protein or peptide in
comparison to the level in natural human cells is indicative of
overexpression, as is a relative
abundance of the specific protein in relation to the other proteins produced
by the host cell and, e.g.,
visible on a gel.
2. Purification of ExpressedProteins
Further aspects of the present disclosure concern the purification, and in
particular
embodiments, the substantial purification, of an encoded protein or peptide.
The term "purified
protein or peptide " as used herein, is intended to refer to a composition,
isolatable from other
components, wherein the protein or peptide is purified to any degree relative
to its naturally-
_
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
obtainable state, i.e., in this case, relative to its purity within a cell
extract. A purified protein or
peptide therefore also refers to a protein or peptide, free from the
environment in which it may
naturally occur.
Generally, "purified" refers to a protein or peptide composition which has
been subjected to
5
fractionation to remove various other components, and which composition
substantially retains its
expressed biological activity. Where the term "substantially purified" is
used, this refers to a
composition in which the protein or peptide forms the major component of the
composition, such
as constituting about 50% or more of the proteins in the composition.
Various methods for quantifying the degree of purification of the protein or
peptide are
10
known in the art. These include, for example, determining the specific
activity of an active
fraction, or assessing the number of polypeptides within a fraction by
SDS/PAGE analysis. A
preferred method for assessing the purity of a fraction is to calculate the
specific activity of the
fraction, to compare it to the specific activity of the initial extract, and
to thus calculate the degree
of purity, assessed by a "-fold purification number". The actual units used to
represent the amount
15
of activity is dependent upon the particular assay technique chosen to
follow the purification and
whether or not the expressed protein or peptide exhibits an enzymatic or other
activity.
Various techniques suitable for use in protein purification are known in the
art. These
include, for example, precipitation with ammonium sulfate, PEG, antibodies and
the like or by heat
denaturation, followed by centrifugation; chromatography steps such as ion
exchange, gel filtration,
20
reverse phase, hydroxylapatite and affinity chromatography; isoelectric
focusing; gel
electrophoresis; and combinations of such and other techniques. As is
generally known in the art, it
is believed that the order of conducting the various purification steps may be
changed, or that
certain steps may be omitted, and still result in a suitable method for the
preparation of a
substantially purified protein or peptide.
25
There is no general requirement that a protein or peptide always be
provided in its most
purified state. Indeed, it is contemplated that less substantially purified
products have utility in
certain embodiments. Partial purification may be accomplished by using fewer
purification steps in
combination, or by utilizing different forms of the same general purification
scheme. For example,
it is appreciated that a cation-exchange column chromatography performed
utilizing an HPLC
30
apparatus generally results in a greater -fold purification than the same
technique utilizing a low
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
41
pressure chromatography system. Methods exhibiting a lower degree of relative
purification may
have advantages in total recovery of protein product, or in maintaining the
activity of an expressed
protein.
It is known that the migration of a polypeptide may vary, sometimes
significantly, with
different conditions of SDS/PAGE (Capaldi et al., Biochem. Biophys. Res.
Comm., 76:425, 1977).
It is therefore appreciated that under differing electrophoresis conditions,
the apparent molecular
weights of purified or partially purified expression products may vary.
3. Antibody Generation
For some embodiments, it is preferred to produce antibodies that bind with
high
specificity to the protein product(s) of an isolated nucleic acid of a
sequence comprising Genebank
Accession numbers D87451, T03013, X03558, M28130, Y00787, SEQ ID NO:1, SEQ ID
NO:2,
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:29. Means for preparing
and
characterizing antibodies are well known in the art (See, e.g., Antibodies: A
Laboratory Manual,
Cold Spring Harbor Laboratory, 1988).
Methods for generating polyclonal antibodies are well known in the art.
Briefly, a
polyclonal antibody is prepared by immunizing an animal with an immunogenic
composition and
collecting antisera from that immunized animal. A wide range of animal species
may be used for
the production of antisera, including rabbits, mice, rats, hamsters, guinea
pigs or goats. Because of
the relatively large blood volume of rabbits, a rabbit is a preferred choice
for production of
polyclonal antibodies.
As is well known in the art, a given composition may vary in its
immunogenicity. It is
often necessary therefore to boost the host immune system, as may be achieved
by coupling a
peptide or polypeptide immunogen to a carrier. Exemplary and preferred
carriers are keyhole
limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as
ovalbumin,
mouse serum albumin or rabbit serum albumin may also be used as carriers.
Means for conjugating
a polypeptide to a carrier protein are well known in the art and include
glutaraldehyde,
m-maleimidobenzoyl-N-hydroxysuccinimithester, carbodiimide and bis-biazotized
benzidine.
As is also well known in the art, the immunogenicity of a particular immunogen
composition may be enhanced by the use of non-specific stimulators of the
immune response,
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
42
known as adjuvants. Exemplary and preferred adjuvants include complete
Freund's adjuvant (a
non-specific stimulator of the immune response containing killed Mycobacterium
tuberculosis),
incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
The amount of immunogen composition used in the production of polyclonal
antibodies
varies with the nature of the immunogen as well as the animal used for
immunization. A variety of
routes may be used to administer the immunogen (subcutaneous, intramuscular,
intradermal,
intravenous and intraperitoneal). The production of polyclonal antibodies may
be monitored by
sampling blood of the immunized animal at various points following
immunization. A second,
booster, injection may also be given. The process of boosting and titering is
repeated until a
suitable titer is achieved. When a desired level of immunogenicity is
obtained, the immunized
animal may be bled and the serum isolated and stored, and/or the animal may be
used to generate
monoclonal antibodies. For production of rabbit polyclonal antibodies, the
animal may be bled
through an ear vein or alternatively by cardiac puncture. The removed blood is
allowed to
coagulate and then centrifuged to separate serum components from whole cells
and blood clots.
The serum may be used as is for various applications or else a particular
antibody fraction may be
purified by well-known methods, such as affinity chromatography using another
antibody or a
peptide bound to a solid matrix.
Monoclonal antibodies (MAbs) may be readily prepared through use of well-known
techniques, such as those exemplified in U.S. Patent 4,196,265,
Typically, this technique involves immunizing a suitable animal with a
selected immunogen
composition, e.g., a purified or partially purified expressed protein,
polypeptide or peptide. The
immunizing composition is administered in a manner effective to stimulate
antibody producing
cells, as described above.
The methods for generating monoclonal antibodies (MAbs) generally begin along
the same
lines as those for preparing polyclonal antibodies. Rodents such as mice and
rats are preferred
animals, however, the use of rabbit, sheep or frog cells is also possible. The
use of rats may
provide certain advantages (Goding, 1986, pp. 60-61), but mice are preferred,
with the BALB/c
mouse being most preferred as this generally gives a higher percentage of
stable fusions.
The animals are injected with antigen as described above. The antigen may be
coupled to
carrier molecules such as keyhole limpet hemocyanin if necessary. The antigen
is typically mixed
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/221.05
43
with adjuvant, such as Freund's complete or incomplete adjuvant. Booster
injections with the same
antigen typically occur at approximately two-week intervals.
Following immunization, somatic cells with the potential for producing
antibodies,
specifically B lymphocytes (B cells), are selected for use in the MAb
generating protocol. These
cells may be obtained from biopsied spleens, tonsils or lymph nodes, or from a
peripheral blood
sample. Spleen cells and peripheral blood cells are preferred, the former
because they are a rich
source of antibody-producing cells that are in the dividing plasmablast stage,
and the latter because
peripheral blood is easily accessible. Often, a panel of animals are immunized
and the spleen of the
animal with the highest antibody titer is removed and the spleen lymphocytes
obtained by
homogenizing the spleen with a syringe. Typically, a spleen from an immunized
mouse contains
approximately 5 X 107 to 2 X 108 lymphocytes.
The antibody-producing B lymphocytes from the immunized animal are then fused
with
cells of an immortal myeloma cell, generally one of the same species as the
animal that was
immunized. Myeloma cell lines suited for use in hybridoma-producing fusion
procedures
preferably are non-antibody-producing, have high fusion efficiency, and enzyme
deficiencies that
render then incapable of growing in selective media which support the growth
of only the desired
fused cells (hybridomas).
Any one of a number of myeloma cells may be used, as are known in the art
(Goding, pp.
65-66, 1986; Campbell, pp. 75-83, 1984). For example, where the immunized
animal is a mouse,
one may use P3-X63/Ag8, X63-Ag8.653, NS1/1.Ag 4 1, Sp210-Ag14, FO, NSO/U, MPC-
11,
MPC11-X45-GTG 1.7 and S194/5XXO Bul; for rats, one may use R210.RCY3, Y3-Ag
1.2.3,
IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all
useful in
connection with human cell fusions.
One preferred murine myeloma cell is the NS-1 myeloma cell line (also termed
P3-NS-1-
Ag4-1), which is readily available from the NIGMS Human Genetic Mutant Cell
Repository by
requesting cell line repository number GM3573. Another mouse myeloma cell line
that may be
used is the 8-azaguanine-resistant mouse murine myeloma SP2/0 non-producer
cell line.
Methods for generating hybrids of antibody-producing spleen or lymph node
cells and
myeloma cells usually comprise mixing somatic cells with myeloma cells in a
2:1 proportion,
though the proportion may vary from about 20:1 to about 1:1, respectively, in
the presence of an
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
44
agent or agents (chemical or electrical) that promote the fusion of cell
membranes. Fusion methods
using Sendai virus have been described by Kohler and Milstein (1975; 1976),
and those using
polyethylene glycol (PEG), such as 37% (v/v) PEG, by Gefter et al. (1977). The
use of electrically
induced fusion methods is also appropriate (Goding pp. 71-74, 1986).
Fusion procedures usually produce viable hybrids at low frequencies, about 1 X
1 (i6 to
10-8. However, this does not pose a problem, as the viable, fused hybrids are
differentiated
from the parental, unfused cells (particularly the unfused myeloma cells that
would normally
continue to divide indefinitely) by culturing in a selective medium. The
selective medium is
generally one that contains an agent that blocks the de novo synthesis of
nucleotides in the tissue
culture media. Exemplary and preferred agents are aminopterin, methotrexate,
and azaserine.
Aminopterin and methotrexate block de novo synthesis of both purines and
pyrimidines, whereas
azaserine blocks only purine synthesis. Where aminopterin or methotrexate is
used, the media is
supplemented with hypoxanthine and thymidine as a source of nucleotides (HAT
medium). Where
azaserine is used, the media is supplemented with hypoxanthine.
The preferred selection medium is HAT. Only cells capable of operating
nucleotide salvage
pathways are able to survive in HAT medium. The myeloma cells are defective in
key enzymes of
the salvage pathway, e.g., hypoxanthine phosphoribosyl transferase (HPRT), and
they cannot
survive. The B cells may operate this pathway, but they have a limited life
span in culture and
generally die within about two weeks. Therefore, the only cells that may
survive in the selective
media are those hybrids formed from myeloma and B cells.
This culturing provides a population of hybridomas from which specific
hybridomas are
selected. Typically, selection of hybridomas is performed by culturing the
cells by single-clone
dilution in microtiter plates, followed by testing the individual clonal
supernatants (after about two
to three weeks) for the desired reactivity. The assay should be sensitive,
simple and rapid, such as
radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays,
dot
immunobinding assays, and the like.
The selected hybridomas are then serially diluted and cloned into individual
antibody-producing cell lines, which clones may then be propagated
indefinitely to provide MAbs.
The cell lines may be exploited for MAb production in two basic ways. A sample
of the hybridoma
may be injected (often into the peritoneal cavity) into a histocompatible
animal of the type that was
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
used to provide the somatic and myeloma cells for the original fusion. The
injected animal
develops tumors secreting the specific monoclonal antibody produced by the
fused cell hybrid. The
body fluids of the animal, such as serum or ascites fluid, may then be tapped
to provide MAbs in
high concentration. The individual cell lines may also be cultured in vitro,
where the MAbs are
5 naturally secreted into the culture medium from which they may be readily
obtained in high
concentrations. MAbs produced by either means may be further purified as
needed, using filtration,
centrifugation and various chromatographic methods such as HPLC or affinity
chromatography.
Large amounts of the monoclonal antibodies of the present disclosure may also
be obtained
by multiplying hybridoma cells in vivo. Cell clones are injected into mammals
which are
10 histocompatible with the parent cells, e.g., syngeneic mice, to cause
growth of antibody-producing
tumors. Optionally, the animals are primed with a hydrocarbon, especially oils
such as pristane
(tetramethylpentadecane)prior to injection.
In accordance with the present invention, fragments of monoclonal antibodies
may be
obtained by methods which include digestion of monoclonal antibodies with
enzymes such as
15 pepsin or papain and/or cleavage of disulfide bonds by chemical
reduction. Alternatively,
monoclonal antibody fragments encompassed by the present disclosure may be
synthesized using
an automated peptide synthesizer.
The monoclonal conjugates of the present disclosure are prepared by methods
known in the
art, e.g., by reacting a monoclonal antibody prepared as described above with,
for instance, an
20 enzyme in the presence of a coupling agent such as glutaraldehyde or
periodate. Conjugates with
fluorescein markers are prepared in the presence of these coupling agents or
by reaction with an
isothiocyanate. Conjugates with metal chelates are similarly produced. Other
moieties to which
antibodies may be conjugated include radionuclides such as 3H, 1251, 131/
32/3, 35s, '4C,
5ICT, 36C1,
57 58
58CO, 59 75 75Se, 152 99m and 99mTc, or other useful labels
which may be conjugated to
25 antibodies. Radioactively labeled monoclonal antibodies of the present
disclosure are produced
according to well-known methods in the art. For instance, monoclonal
antibodies may be iodinated
by contact with sodium or potassium iodide and a chemical oxidizing agent such
as sodium
hypochlorite, or an enzymatic oxidizing agent, such as lactoperoxidase.
Monoclonal antibodies
according to the disclosure may be labeled with technetium99 by ligand
exchange process, for
30 example, by reducing pertechnate with stannous solution, chelating the
reduced technetium onto a
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
46
Sephadex column and applying the antibody to this column or by direct labeling
techniques, e.g.,
by incubating pertechnate, a reducing agent such as SNC12, a buffer solution
such as sodium-
potassium phthalate solution, and the antibody.
It will be appreciated that monoclonal or polyclonal antibodies specific for
proteins that are
preferentially expressed in the peripheral blood of individuals with the
disease state have utilities in
several types of applications. These may include the production of diagnostic
kits for use in
detecting or diagnosing the disease state. It will be recognized that such
uses are within the scope
of the present invention.
D. Immunodetection Assays
1. ImmunodetectionMethods
In still further embodiments, the present disclosure concerns immunodetection
methods for
binding, purifying, removing, quantifying or otherwise generally detecting
biological components.
The encoded proteins or peptides of the present disclosure may be employed to
detect antibodies
having reactivity therewith, or, alternatively, antibodies prepared in
accordance with the present
invention, may be employed to detect the encoded proteins or peptides. The
steps of various useful
irrununodetection methods have been described in the scientific literature,
such as, e.g., Nakamura
etal. (1987).
In general, the immunobinding methods include obtaining a sample suspected of
containing
a protein, peptide or antibody, and contacting the sample with an antibody or
protein or peptide in
accordance with the present invention, as the case may be, under conditions
effective to allow the
formation of irnmunocomplexes.
The immunobinding methods include methods for detecting or quantifying the
amount of a
reactive component in a sample, which methods require the detection or
quantitation of any
immune complexes formed during the binding process. Here, one obtains a sample
suspected of
containing a disease state-marker encoded protein, peptide or a corresponding
antibody, and
contacts the sample with an antibody or encoded protein or peptide, as the
case may be, and then
detects or quantifies the amount of immune complex formed under the specific
conditions.
In terms of antigen detection, the biological sample analyzed would ordinarily
consist of
peripheral blood. However, it may be any sample that is suspected of
containing a disease state-
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
47
specific antigen, such as a lymph node tissue section or specimen, a
homogenized tissue extract, an
isolated cell, a cell membrane preparation, separated or purified forms of any
of the above protein-
containing compositions, or any other biological fluid that comes into contact
with diseased tissues,
including lymphatic fluid, urine and even seminal fluid.
Contacting the chosen biological sample with the protein, peptide or antibody
under
conditions effective and for a period of time sufficient to allow the
formation of immune complexes
(primary immune complexes) is generally a matter of simply adding the
composition to the sample
and incubating the mixture for a period of time long enough for the antibodies
to form immune
complexes with, Le., to bind to, any antigens present. After this time, the
sample-antibody
composition, such as a tissue section, ELISA plate, dot blot or Western blot,
is generally washed to
remove any non-specifically bound antibody species, allowing only those
antibodies specifically
bound within the primary immune complexes to be detected.
In general, the detection of immunocomplex formation is well known in the art
and may be
achieved through the application of numerous approaches. These methods are
generally based
upon the detection of a label or marker, such as any radioactive, fluorescent,
biological or
enzymatic tags or labels of conventional use in the art. U.S. Patents
concerning the use of such
labels include 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437;
4,275,149 and 4,366,241,
Of course, one may find additional advantages through the
use of a secondary binding ligand such as a second antibody or a biotin/avidin
ligand binding
arrangement, as is known in the art.
The encoded protein, peptide or corresponding antibody employed in the
detection may
itself be linked to a detectable label, wherein one would then simply detect
this label, thereby
allowing the amount of the primary immune complexes in the composition to be
determined.
Alternatively, the first added component that becomes bound within the primary
immune
complexes may be detected by means of a second binding ligand that has binding
affinity for the
encoded protein, peptide or corresponding antibody. In these cases, the second
binding ligand may
be linked to a detectable label. The second binding ligand is itself often an
antibody, which may
thus be termed a "secondary" antibody. The primary immune complexes are
contacted with the
labeled, secondary binding ligand, or antibody, under conditions effective and
for a period of time
sufficient to allow the formation of secondary immune complexes. The secondary
immune
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
48
complexes are then generally washed to remove any non-specifically bound
labeled secondary
antibodies or ligands, and the remaining label in the secondary immune
complexes is then detected.
Further methods include the detection of primary immune complexes by a two
step
approach. A second binding ligand, such as an antibody, that has binding
affinity for the encoded
protein, peptide or corresponding antibody is used to form secondary immune
complexes, as
described above. After washing, the secondary immune complexes are contacted
with a third
binding ligand or antibody that has binding affinity for the second antibody,
again under conditions
effective and for a period of time sufficient to allow the formation of immune
complexes (tertiary
immune complexes). The third ligand or antibody is linked to a detectable
label, allowing detection
of the tertiary immune complexes thus formed. This system may provide for
signal amplification if
this is desired.
The immunodetection methods of the present disclosure have evident utility in
the
diagnosis of human disease states. A biological or clinical sample suspected
of containing either
the encoded protein or peptide or corresponding antibody is used. However,
these embodiments
also have applications to non-clinical samples, such as in the titering of
antigen or antibody
samples, in the selection of hybridomas, and the like.
In the clinical diagnosis or monitoring of patients with a disease state, the
detection of an
antigen encoded by a disease state marker nucleic acid, or an increase in the
levels of such an
antigen, in comparison to the levels in a corresponding biological sample from
a normal subject is
indicative of a patient with the disease state. The basis for such diagnostic
methods lies, in part,
with the finding that the nucleic acid disease state markers identified in the
present disclosure are
overexpressed in peripheral blood samples from individuals with the disease
state (see Examples 1
through 4 below). By extension, it may be inferred that at least some of these
markers produce
elevated levels of encoded proteins, that may also be used as disease state
markers.
Methods of differentiating between significant expression of a biomarker,
which represents
a positive identification, and low level or background expression of a
biomarker are well known in
the art. Background expression levels are often used to form a "cut-off' above
which increased
staining is scored as significant or positive. Significant expression may be
represented by high
levels of antigens in tissues or within body fluids, or alternatively, by a
high proportion of cells
from within a tissue that each give a positive signal.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
49
2. Immunohistochemistry
The antibodies of the present disclosure may also be used in conjunction with
both
fresh-frozen and formalin-fixed, paraffin-embedded tissue blocks prepared from
study by
immunohistochemistry (IHC) or fixed cells on microscope slides for
immunocytochemistry. The
method of preparing tissue blocks from these particulate specimens has been
successfully used in
previous IHC studies of various prognostic factors and is well known to those
of skill in the art
(Brown et al., 1990; Abbondanzo et al., 1990; Allred et al., 1990).
Briefly, frozen-sections may be prepared by rehydrating 50 ng of frozen
"pulverized" tissue
at room temperature in phosphate buffered saline (PBS) in small plastic
capsules; pelleting the
particles by centrifugation; resuspending them in a viscous embedding medium
(OCT); inverting
the capsule and pelleting again by centrifugation; snap-freezing in -70 C
isopentane; cutting the
plastic capsule and removing the frozen cylinder of tissue; securing the
tissue cylinder on a cryostat
microtome chuck; and cutting 25-50 serial sections containing an average of
about 500 intact cells.
Permanent-sections may be prepared by a similar method involving rehydration
of the 50
mg sample in a plastic microfuge tube; pelleting; resuspending in 10% formalin
for 4 hours
fixation; washing/pelleting; resuspending in warm 2.5% agar; pelleting;
cooling in ice water to
harden the agar; removing the tissue/agar block from the tube; infiltrating
and embedding the block
in paraffin; and cutting up to 50 serial permanent sections.
3. Flow Cytometry
Expressed proteins may also be detected by flow cytometry as described in
Fujishima et al, 1996. In the practice of the method, the cells are fixed and
then incubated with a
monoclonal antibody against the expressed protein to be detected. The bound
antibodies are then
contacted with labeled anti-IgG for example for detection. A typical label is
FITC. The fluorescent
intensity may then be measured by flow cytometer such as Ortho Cytron, Ortho
diagnostics, or
FAC Scan; Becton Dickinson.
FACS permits the separation of sub-populations of cells initially on the basis
of their light
scatter properties as they pass through a laser beam. The forward light
scatter (FALS) is related to
cell size and the right angle light scatter to cell density, cell contour and
nucleo-cytoplasmic ratio.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
Since cells are tagged with fluorescent labeled antibody they can then be
further characterized by
fluorescence intensity and positive and negative windows set on the FACS to
collect bright
fluorescence and low fluorescence cells. Cells are sorted at a flow rate of
about 3000 cells per
second and collected in positive and negative cells.
5
4. ELISA
As noted, it is contemplated that the encoded proteins or peptides of the
disclosure
have utility as immunogens, e.g., in connection with vaccine development, in
immunohistochemistry and in ELISA assays. One evident utility of the encoded
antigens and
10 corresponding antibodies is in immunoassays for the detection of disease
state marker proteins, as
needed in diagnosis and prognostic monitoring.
Immunoassays, in their most simple and direct sense, are binding assays.
Certain preferred
immunoassays are the various types of enzyme linked immunosorbent assays
(ELISAs) and
radioimmunoassays (RIA) known in the art. Immunohistochemical detection using
tissue sections
15 is also particularly useful. However, it is readily appreciated that
detection is not limited to such
techniques, and Western blotting, dot blotting, FACS analyses, and the like
may also be used.
In one exemplary ELISA, antibodies binding to the encoded proteins of the
disclosure are
immobilized onto a selected surface exhibiting protein affinity, such as a
well in a polystyrene
microtiter plate. Then, a test composition suspected of containing the disease
state marker antigen,
20 such as a clinical sample, is added to the wells. After binding and
washing to remove non-
specifically bound immunecomplexes, the bound antigen may be detected.
Detection is generally
achieved by the addition of a second antibody specific for the target protein,
that is linked to a
detectable label. This type of ELISA is a simple "sandwich ELISA". Detection
may also be
achieved by the addition of a second antibody, followed by the addition of a
third antibody that has
25 binding affinity for the second antibody, with the third antibody being
linked to a detectable label.
In another exemplary ELISA, the samples suspected of containing the disease
state marker
antigen are immobilized onto the well surface and then contacted with the
antibodies of the
invention. After binding and washing to remove non-specifically bound
immunecomplexes, the
bound antigen is detected. Where the initial antibodies are linked to a
detectable label, the
30 immunecomplexes may be detected directly. Again, the immunecomplexes may
be detected using
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
51
a second antibody that has binding affinity for the first antibody, with the
second antibody being
linked to a detectable label.
Another ELISA in which the proteins or peptides are immobilized, involves the
use of
antibody competition in the detection. In this ELISA, labeled antibodies are
added to the wells,
allowed to bind to the disease state marker protein, and detected by means of
their label. The
amount of marker antigen in an unknown sample is then determined by mixing the
sample with the
labeled antibodies before or during incubation with coated wells. The presence
of marker antigen
in the sample acts to reduce the amount of antibody available for binding to
the well and thus
reduces the ultimate signal. This is appropriate for detecting antibodies in
an unknown sample,
where the unlabeled antibodies bind to the antigen-coated wells and reduces
the amount of antigen
available to bind the labeled antibodies.
Irrespective of the format employed, ELISAs have certain features in common,
such as
coating, incubating or binding, washing to remove non-specifically bound
species, and detecting
the bound immunecomplexes. These are described as follows:
In coating a plate with either antigen or antibody, it is typical to incubate
the wells of the
plate with a solution of the antigen or antibody, either overnight or for a
specified period of hours.
The wells of the plate are then washed to remove incompletely adsorbed
material. Any remaining
available surfaces of the wells are then "coated" with a nonspecific protein
that is antigenically
neutral with regard to the test antisera. These include bovine serum albumin
(BSA), casein and
solutions of milk powder. The coating allows for blocking of nonspecific
adsorption sites on the
immobilizing surface and thus reduces the background caused by nonspecific
binding of antisera
onto the surface.
In ELISAs, it is more customary to use a secondary or tertiary detection means
rather than a
direct procedure. Thus, after binding of a protein or antibody to the well,
coating with a non-
reactive material to reduce background, and washing to remove unbound
material, the
immobilizing surface is contacted with the control and/or clinical or
biological sample to be tested
under conditions effective to allow immunecomplex (antigen/antibody)
formation. Detection of the
immunecomplex then requires a labeled secondary binding ligand or antibody, or
a secondary
binding ligand or antibody in conjunction with a labeled tertiary antibody or
third binding ligand.
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
52
"Under conditions effective to allow immunecomplex (antigen/antibody)
formation" means
that the conditions preferably include diluting the antigens and antibodies
with solutions such as
BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween.
These added
agents also tend to assist in the reduction of nonspecific background.
The "suitable" conditions also mean that the incubation is at a temperature
and for a period
of time sufficient to allow effective binding. Incubation steps are typically
from about 1 to 2 to
4 hours, at temperatures preferably on the order of 25 to 27 C, or may be
overnight at about 4 C
or so.
Following all incubation steps in an ELISA, the contacted surface is washed so
as to
remove non-complexed material. A preferred washing procedure includes washing
with a solution
0
such as PBS/Tween, or borate buffer. Following the formation of specific
immunecomplexes
between the test sample and the originally bound material, and subsequent
washing, the occurrence
of even minute amounts of immunecomplexes may be determined.
To provide a detecting means, the second or third antibody has an associated
label to allow
detection. Preferably, this is an enzyme that generates color development upon
incubating with an
appropriate chromogenic substrate. Thus, for example, one may contact and
incubate the first or
second immunecomplex with a urease, glucose oxidase, alkaline phosphatase or
hydrogen
peroxidase-conjugated antibody for a period of time and under conditions that
favor the
development of further immunecomplex formation (e.g., incubation for 2 hours
at room
0
temperature in a PBS-containing solution such as PBS-Tween).
After incubation with the labeled antibody, and subsequent to washing to
remove unbound
material, the amount of label is quantified, e.g., by incubation with a
chromogenic substrate such as
urea and bromocresol purple or 2,2'-azido-di-(3-ethyl)-benzthiazoline-6-
sulfonicacid [ABTS] and
H202, in the case of peroxidase as the enzyme label. Quantitation is then
achieved by measuring
the degree of color generation, e.g., using a spectrophotometer.
5. Use of Antibodiesfor Radioimaging
The antibodies of this disclosure are used to quantify and localize the
expression of
the encoded marker proteins. The antibody, for example, may be labeled by any
one of a variety of
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
53
methods and used to visualize the localized concentration of the cells
producing the encoded
protein.
A radionuclide may be bound to an antibody either directly or indirectly by
using an
intermediary functional group. Intermediary functional groups which are often
used to bind
radioisotopes which exist as metallic ions to antibody are
diethylenetriaminepentaacetic acid
(DTPA) and ethylene diaminetetracetic acid (EDTA). Examples of metallic ions
suitable for use in
99 123/, 1311 /n, 111 97 67c 67 125/,
Ga, 68 72 89
this disclosure are mTc, Ru,u, Ga,
As, Zr, and
MITI.
In accordance with this disclosure, the monoclonal antibody or fragment
thereof may be
labeled by any of several techniques known to the art. The methods of the
present disclosure may
also use paramagnetic isotopes for purposes of in vivo detection. Elements
particularly useful in
Magnetic Resonance Imaging ("MRI") include I 57Gd, 55Mn, 162-D y,
"Cr, and 56Fe.
Administration of the labeled antibody may be local or systemic and
accomplished
intravenously, intraarterially, via the spinal fluid or the like.
Administration may also be
intradermal or intracavitary, depending upon the body site under examination.
After a sufficient
time has lapsed for the monoclonal antibody or fragment thereof to bind with
the diseased tissue,
for example 30 minutes to 48 hours, the area of the subject under
investigation is examined by
routine imaging techniques such as MRI, SPECT, planar scintillation imaging
and emerging
imaging techniques, as well. The exact protocol necessarily varies depending
upon factors specific
to the patient, as noted above, and depending upon the body site under
examination, method of
administration and type of label used. The determination of specific
procedures is routine in the art.
The distribution of the bound radioactive isotope and its increase or decrease
with time is then
monitored and recorded. By comparing the results with data obtained from
studies of clinically
normal individuals, the presence and extent of the diseased tissue may be
determined.
The instant disclosure addresses detection of disease state cells by their
effect on gene
expression in immune system lymphocytes. In early stages of the disease state,
such immune
response may be localized. For example, the response may be limited to lymph
nodes immediately
surrounding a metastasizing tumor or other localized form of a disease state.
Localization of
differentially expressed disease state markers may be of utility for
separating disease states of
widespread distribution from those of limited distribution within the patient.
Such a detection
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
54
means is therefore of significance in the management and care of patients with
the disease state. It
will be recognized that this utility is included within the scope of the
present disclosure.
6. Kits
In still further embodiments, the present disclosure concerns immunodetection
kits
for. use with the immunodetection methods described above. As the encoded
proteins or peptides
may be employed to detect antibodies and the corresponding antibodies may be
employed to detect
encoded proteins or peptides, either or both of such components may be
provided in the kit. The
immunodetection kits thus comprise, in suitable container means, an encoded
protein or peptide, or
a first antibody that binds to an encoded protein or peptide, and an
immunodetectionreagent.
In certain embodiments, the encoded protein or peptide, or the first antibody
that binds to
the encoded protein or peptide, may be bound to a solid support, such as a
column matrix or well of
a microtiter plate.
The immunodetection reagents of the kit may take any one of a variety of
forms, including
those detectable labels that are associated with or linked to the given
antibody or antigen, and
detectable labels that are associated with or attached to a secondary binding
ligand. Exemplary
secondary ligands are those secondary antibodies that have binding affinity
for the first antibody or
antigen, and secondary antibodies that have binding affinity for a human
antibody.
Further suitable immunodetection reagents for use in the present kits include
the two-
component reagent that comprises a secondary antibody that has binding
affinity for the first
antibody or antigen, along with a third antibody that has binding affinity for
the second antibody,
the third antibody being linked to a detectable label.
The kits may further comprise a suitably aliquoted composition of the encoded
protein or
polypeptide antigen, whether labeled or unlabeled, as may be used to prepare a
standard curve for a
detection assay.
The kits may contain antibody-label conjugates either in fully conjugated
form, in the form
of intermediates, or as separate moieties to be conjugated by the user of the
kit. The components of
the kits may be packaged either in aqueous media or in lyophilized form.
The container means of the kits generally includes at least one vial, test
tube, flask, bottle,
syringe or other container means, into which the antibody or antigen may be
placed, and preferably,
CA 02273847 1999-06-03
WO 98/24935
PCTMS97/22105
suitably aliquoted. Where a second or third binding ligand or additional
component is provided,
the kit also generally contains a second, third or other additional container
into which this ligand or
component may be placed. The kits of the present disclosure also typically
include a means for
containing the antibody, antigen, and any other reagent containers in close
confinement for
5 commercial sale. Such containers may include injection or blow-molded
plastic containers into
which the desired vials are retained.
E. Detection and Quantitation of RNA Species
One embodiment of the instant disclosure comprises a method for identification
of a disease
10 state in a biological sample by amplifying and detecting nucleic acids
corresponding to disease
state markers. The biological sample may be any tissue or fluid in which
lymphocyte cells might
be present. Various embodiments include bone marrow aspirate, bone marrow
biopsy, lymph node
aspirate, lymph node biopsy, spleen tissue, fine needle aspirate, skin biopsy
or organ tissue biopsy.
Other embodiments include samples of body fluid such as peripheral blood,
lymph fluid, ascites,
15 serous fluid, pleural effusion, sputum, cerebrospinal fluid, lacrimal
fluid, stool or urine.
Nucleic acid used as a template for amplification is isolated from cells
contained in the
biological sample, according to conventional methodologies. (Sambrook et al.,
1989) The nucleic
acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used,
it may be
desired to convert the RNA to a complementary cDNA. In one embodiment, the RNA
is whole cell
20 RNA and is used directly as the template for amplification.
Pairs of primers that selectively hybridize to nucleic acids corresponding to
disease state-
specific markers are contacted with the isolated nucleic acid under conditions
that permit selective
hybridization. Once hybridized, the nucleic acid:primer complex is contacted
with one or more
enzymes that facilitate template-dependent nucleic acid synthesis.
Multiple rounds of
25 amplification, also referred to as "cycles," are conducted until a
sufficient amount of amplification
product is produced.
Next, the amplification product is detected. In certain applications, the
detection may be
performed by visual means. Alternatively, the detection may involve indirect
identification of the
product via chemiluminescence, radioactive scintigraphy of incorporated
radiolabel or fluorescent
CA 02273847 2006-01-11
WO 98124935
PCIIUS97/22105
56
label or even via a system using electrical or thermal impulse signals
(Affymax technology; Bellus,
1994).
Following detection, one may compare the results seen in a given patient with
statistically
significant reference groups of normal individuals and patients with the
disease state. In this way, it
is possible to correlate the amount of marker detected with various clinical
states.
1. Primers
The term primer, as defined herein, is meant to encompass any nucleic acid
that is
capable of priming the synthesis of a nascent nucleic acid in a template-
dependent process.
Typically, primers are oligonucleotides from ten to twenty base pairs in
length, but longer
sequences may be employed. Primers may be provided in double-stranded or
single-stranded form,
although the single-stranded form is preferred.
2. Template Dependent Amplification Methods
A number of template dependent processes are available to amplify the marker
sequences present in a given template sample. One of the best known
amplification methods is the
polymerase chain reaction (referred to as PCR) which is described in detail in
U.S. Patent Nos.
4,683,195, 4,683,202 and 4,800,159, and in Innis etal., 1990.
Briefly, in PCR, two primer sequences are prepared which are complementary to
regions on
opposite complementary strands of the marker sequence. An excess of
deoxynucleoside
triphosphates is added to a reaction mixture along with a DNA polymerase,
e.g.. Tag polymerase.
If the marker sequence is present in a sample, the primers bind to the marker
and the polymerase
causes the primers to be extended along the marker sequence by adding on
nucleotides. By raising
and lowering the temperature of the reaction mixture, the extended primers
dissociate from the
marker to form reaction products, excess primers bind to the marker and to the
reaction products
and the process is repeated.
A reverse transcriptasePCR amplification procedure may be performed in order
to quantify
the amount of mRNA amplified. Methods of reverse transcribing RNA into cDNA
are well known
and described in Sambrook et aL, 1989. Alternative methods for reverse
transcription utilize
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
57
thermostable DNA polymerases. These methods are described in WO 90/07641 filed
December
21, 1990. Polymerase chain reaction methodologies are well known in the art.
Alternatively, RNA species can be quantitated by means that do not necessarily
require
amplification by PCR. These means may include other amplification techniques,
for example,
isothermic amplification techniques such as the one developed by Gen-Probe
(San Diego, CA), and
the ligase chain reaction ("LCR"), disclosed in EPA No. 320 308.
In LCR, two complementary probe pairs are prepared, and in the presence of the
target sequence, each pair binds to opposite complementary strands of the
target such that they
abut. In the presence of a ligase, the two probe pairs link to form a single
unit. By temperature
cycling, as in PCR, bound ligated units dissociate from the target and then
serve as "target
sequences" for ligation of excess probe pairs. U.S. Patent 4,883,750 describes
a method similar to
LCR for binding probe pairs to a target sequence.
Qbeta Replicase, described in PCT Application No. PCT/US87/00880, may also be
used as
still another amplification method in the present invention. In this method, a
replicative sequence
of RNA which has a region complementary to that of a target is added to a
sample in the presence
of an RNA polymerase. The polymerase copies the replicative sequence which may
then be
detected.
An isothermal amplification method, in which restriction endonucleases and
ligases are
used to achieve the amplification of target molecules that contain nucleoside
5'-[alpha-thio]-
triphosphates in one strand of a restriction site may also be useful in the
amplification of nucleic
acids in the present invention. Walker etal., Proc. Nat? Acad. Sci. USA 89:392-
396 (1992).
Strand Displacement Amplification (SDA) is another method of carrying out
isothermal
amplification of nucleic acids which involves multiple rounds of strand
displacement and synthesis,
i.e., nick translation. A similar method, called Repair Chain Reaction (RCR),
involves annealing
several probes throughout a region targeted for amplification, followed by a
repair reaction in
which only two of the four bases are present. The other two bases may be added
as biotinylated
derivatives for easy detection. A similar approach is used in SDA. Target
specific sequences may
also be detected using a cyclic probe reaction (CPR). In CPR, a probe having
3' and 5' sequences of
non-specific DNA and a middle sequence of specific RNA is hybridized to DNA
which is present
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
58
in a sample. Upon hybridization, the reaction is treated with RNase H, and the
products of the
probe identified as distinctive products which are released after digestion.
The original template is
annealed to another cycling probe and the reaction is repeated.
Other amplification methods are described in GB Application No. 2 202 328, and
in PCT
Application No. PCT/US89/01025.
may be used in accordance with the present invention. In the former
application, "modified"
primers are used in a PCR like, template and enzyme dependent synthesis. The
primers may be
modified by labeling with a capture moiety (e.g., biotin) and/or a detector
moiety (e.g., enzyme). In
the latter application, an excess of labeled probes are added to a sample. In
the presence of the
target sequence, the probe binds and is cleaved catalytically. After cleavage,
the target sequence is
released intact to be bound by excess probe. Cleavage of the labeled probe
signals the presence of
the target sequence.
Other nucleic acid amplification procedures include transcription-based
amplification
systems (TAS), including nucleic acid sequence based amplification (NASBA) and
3SR. Kwoh
etal., Proc. Nat7 Acad. ScL USA 86:1173(1989); Gingeras et PCT
Application WO 88/10315.
In NASBA, the nucleic acids may be prepared
for amplification by conventional phenol/chloroform extraction, heat
denaturation of a clinical
sample, treatment with lysis buffer and minispin columns for isolation of DNA
and RNA or
guanidinium chloride extraction of RNA. These amplification techniques involve
annealing a
primer which has target specific sequences. Following polymerization, DNA/RNA
hybrids are
digested with RNase H while double stranded DNA molecules are heat denatured
again. In either
case the single stranded DNA is made fully double stranded by addition of
second target specific
primer, followed by polymerization. The double-stranded DNA molecules are then
multiply
transcribed by a polymerase such as T7 or SP6. In an isothermal cyclic
reaction, the RNA's are
reverse transcribed into double stranded DNA, and transcribed once against
with a polymerase such
as T7 or SP6. The resulting products, whether truncated or complete, indicate
target specific
sequences.
Davey et al., EPA No. 329 822
disclose a
nucleic acid amplification process involving cyclically synthesizing single-
stranded RNA
("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be used in
accordance with
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
59
the present invention. The ssRNA is a first template for a first primer
oligonucleotide, which is
elongated by reverse transcriptase (RNA-dependent DNA polymerase). The RNA is
then removed
from the resulting DNA:RNA duplex by the action of ribonuclease H (RNasell, an
RNase specific
for RNA in duplex with either DNA or RNA). The resultant ssDNA is a second
template for a
second primer, which also includes the sequences of an RNA polymerase promoter
(exemplified by
T7 RNA polymerase) 5' to its homology to the template. This primer is then
extended by DNA
polymerase (exemplified by the large "Klenow" fragment of E. coli DNA
polymerase I), resulting
in a double-stranded DNA ("dsDNA") molecule, having a sequence identical to
that of the original
RNA between the primers and having additionally, at one end, a promoter
sequence. This promoter
sequence may be used by the appropriate RNA polymerase to make many 'RNA
copies of the
DNA. These copies may then re-enter the cycle leading to very swift
amplification. With proper
choice of enzymes, this amplification may be done isothermally without
addition of enzymes at
each cycle. Because of the cyclical nature of this process, the starting
sequence may be chosen to
be in the form of either DNA or RNA.
Miller et al., PCT Application WO 89/06700
disclose a nucleic acid sequence amplification scheme based on the
hybridization of a
promoter/primer sequence to a target single-stranded DNA ("ssDNA") followed by
transcription of
many RNA copies of the sequence. This scheme is not cyclic, i.e., new
templates are not produced
from the resultant RNA transcripts. Other amplification methods include "race"
and "one-sided
PCR." Frohman, M.A., In: PCR PROTOCOLS: A GUIDE TO METHODS AND
.APPLICATIONS, Academic Press, N.Y. (1990) and Ohara etal., Proc. Nall Acad.
,S'ci. USA,
86:5673-5677(1989).
Methods based on ligation of two (or more) oligonucleotides in the presence of
nucleic acid
having the sequence of the resulting "di-oligonucleotide", thereby amplifying
the di-
oligonucleotide, may also be used in the amplification step of the present
invention. Wu et al.,
Genomics 4:560(1989),,
An example of a technique that does not require nucleic acid amplification,
that can also be
used to quantify RNA in some applications is a nuclease protection assay.
There are many different
versions of nuclease protection assays known to those practiced in the art.
The characteristic that
all versions of nuclease protection assays share in common is that they
involve hybridization of an
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
antisense nucleic acid with the RNA to be quantified. The resulting hybrid
double stranded
molecule is then digested with a nuclease that digests single stranded nucleic
acids more efficiently
than double stranded molecules. The amount of antisense nucleic acid that
survives digestion is a
measure of the amount of the target RNA species to be quantified. An example
of a nuclease
5 protection assay that is commercially available is the RNase protection
assay manufactured by
Ambion, Inc. (Austin, TX).
3. Separation Methods
Following amplification, it may be desirable to separate the amplification
product
10 from the template and the excess primer for the purpose of determining
whether specific
amplification has occurred. In one embodiment, amplification products are
separated by agarose,
agarose-acrylamide or polyacrylamide gel electrophoresis using conventional
methods. See
Sambrook et al., 1989.
Alternatively, chromatographic techniques may be employed to effect
separation. There are
15 many kinds of chromatography which may be used in the present invention:
adsorption, partition,
ion-exchange and molecular sieve, HPLC, and many specialized techniques for
using them
including column, paper, thin-layer and gas chromatography (Freifelder, 1982).
Another example of a separation methodology is done by covalently labeling the
oligonucleotide primers used in a PCR reaction with various types of small
molecule ligands. In
20 one such separation, a different ligand is present on each
oligonucleotide. A molecule, perhaps
an antibody or avidin if the ligand is biotin, that specifically binds to one
of the ligands is used to
coat the surface of a plate such as a 96 well ELISA plate. Upon application of
the PCR reactions
to the surface of such a prepared plate, the PCR products are bound with
specificity to the
surface. After washing the plate to remove unbound reagents, a solution
containing a second
25 molecule that binds to the first ligand is added. This second molecule
is linked to some kind of
reporter system. The second molecule only binds to the plate if a PCR product
has been
produced whereby both oligonucleotide primers are incorporated into the final
PCR products.
The amount of the PCR product is then detected and quantified in a commercial
plate reader
much as ELISA reactions are detected and quantified. An ELISA-like system such
as the one
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
61
described here has been developed by the Raggio Italgene company under the C-
Track trade
name.
4. IdentificationMethods
Amplification products must be visualized in order to confirm amplification of
the
marker sequences. One typical visualization method involves staining of a gel
with ethidium
bromide and visualization under UV light. Alternatively, if the amplification
products are
integrally labeled with radio- or fluorometrically-labeled nucleotides, the
amplification products
may then be exposed to x-ray film or visualized under the appropriate
stimulating spectra,
following separation.
In one embodiment, visualization is achieved indirectly. Following separation
of
amplification products, a labeled, nucleic acid probe is brought into contact
with the amplified
marker sequence. The probe preferably is conjugated to a chromophore but may
be radiolabeled.
In another embodiment, the probe is conjugated to a binding partner, such as
an antibody or biotin,
where the other member of the binding pair carries a detectable moiety.
In one embodiment, detection is by Southern blotting and hybridization with a
labeled
probe. The techniques involved in Southern blotting are well known to those of
skill in the art and
may be found in many standard books on molecular protocols. See Sambrook et
aL, 1989. Briefly,
amplification products are separated by gel electrophoresis. The gel is then
contacted with a
membrane, such as nitrocellulose, permitting transfer of the nucleic acid and
non-covalent binding.
Subsequently, the membrane is incubated with a chromophore-conjugatedprobe
that is capable of
hybridizing with a target amplification product. Detection is by exposure of
the membrane to x-ray
film or ion-emitting detection devices.
One example of the foregoing is described in U.S. Patent No. 5,279,721,.
which discloses an apparatus and method for the automated electrophoresis and
transfer of nucleic acids. The apparatus permits electrophoresis and blotting
without external
manipulation of the gel and is ideally suited to carrying out methods
according to the present
invention.
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
62
5. Kit Components
All the essential materials and reagents required for detecting disease state
markers in a
biological sample may be assembled together in a kit. This generally comprises
preselected
primers for specific markers. Also included may be enzymes suitable for
amplifying nucleic acids
including various polymerases (RT, Taq, etc.), deoxynucleotides and buffers to
provide the
necessary reaction mixture for amplification.
Such kits generally comprise, in suitable means, distinct containers for each
individual
reagent and enzyme as well as for each marker primer pair. Preferred pairs of
primers for
amplifying nucleic acids are selected to amplify the sequences specified in
Genebank Accession
numbers D87451, T03013, X03558, M28130, Y00787, SEQ ID NO:1, SEQ ID NO:2, SEQ
ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:29.
In another embodiment, such kits comprise hybridization probes specific for
disease state
markers, chosen from a group including nucleic acids corresponding to the
sequences specified in
Genebank Accession numbers D87451, T03013, X03558, M28130, Y00787, SEQ ID
NO:1, SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:29. Such kits
generally
comprise, in suitable means, distinct containers for each individual reagent
and enzyme as well as
for each marker hybridization probe.
F. Use of RNA Fingerprintingto Identify Markers of Human Disease
RNA fingerprinting is a means by which RNAs isolated from many different
tissues, cell
types or treatment groups may be sampled simultaneously to identify RNAs whose
relative
abundances vary. Two forms of this technology were developed simultaneously
and reported in
1992 as RNA fingerprinting by differential display (Liang and Pardee, 1992;
Welsh et aL, 1992).
(See also Liang and Pardee, U.S. Patent 5,262,311.
Some of the studies described herein were performed similarly to Donahue et
aL, J. Biol. Chem.
269: 8604-8609, 1994.
All forms of RNA fingerprinting by PCR are theoretically similar but differ in
their primer
design and application. The most striking difference between differential
display and other
methods of RNA fingerprinting is that differential display utilizes anchoring
primers that hybridize
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
63
to the poly A tails of mRNAs. As a consequence, the PCR products amplified in
differential
display are biased towards the 3' untranslated regions of mRNAs.
The basic technique of differential display has been described in detail
(Liang and Pardee,
1992). Total cell RNA is primed for first strand reverse transcription with an
anchoring primer
composed of oligo dT. The oligo dT primer is extended using a reverse
transcriptase, for example,
Moloney Murine Leukemia Virus (MMLV) reverse transcriptase. The synthesis of
the second
strand is primed with an arbitrarily chosen oligonucleotide, using reduced
stringency conditions.
Once the double-stranded cDNA has been synthesized, amplification proceeds by
conventional
PCR techniques, utilizing the same primers. The resulting DNA fingerprint is
analyzed by gel
electrophoresis and ethidium bromide staining or autoradiography. A side by
side comparison of
fingerprints obtained from different cell derived RNAs using the same
oligonucleotide primers
identifies mRNAs that are differentially expressed.
RNA fingerprinting technology has been demonstrated as being effective in
identifying
genes that are differentially expressed in cancer cells (Liang et al., 1992;
Wong et al., 1993; Sager
etal., 1993; Mok etal., 1994; Watson etal., 1994; Chen etal., 1995; An etal.,
1995). The present
disclosure utilizes the RNA fingerprinting technique or other techniques
described herein to
identify genes that are differentially expressed in peripheral blood cells in
human disease states.
G. Design and Theoretical Considerations for Relative Quantitative RT-
PCR
Reverse transcription (RT) of RNA to cDNA followed by relative quantitative
PCR (RT-
PCR) may be used to determine the relative concentrations of specific mRNA
species in a series of
total cell RNAs isolated from peripheral blood of normal individuals and
individuals with a disease
state. By determining that the concentration of a specific mRNA species
varies, it is shown that the
gene encoding the specific mRNA species is differentially expressed. This
technique may be used
to confirm that mRNA transcripts shown to be differentially regulated by RNA
fingerprinting are
differentially expressed in disease state progression.
In PCR, the number of molecules of the amplified target DNA increase by a
factor
approaching two with every cycle of the reaction until some reagent becomes
limiting. Thereafter,
the rate of amplification becomes increasingly diminished until there is not
an increase in the
amplified target between cycles. If one plots a graph on which the cycle
number is on the X axis
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
64
and the log of the concentration of the amplified target DNA is on the Y axis,
one observes that a
curved line of characteristic shape is formed by connecting the plotted
points. Beginning with the
first cycle, the slope of the line is positive and constant. This is said to
be the linear portion of the
curve. After some reagent becomes limiting, the slope of the line begins to
decrease and eventually
becomes zero. At this point the concentration of the amplified target DNA
becomes asymptotic to
some fixed value. This is said to be the plateau portion of the curve.
The concentration of the target DNA in the linear portion of the PCR is
directly
proportional to the starting concentration of the target before the PCR was
begun. By determining
the concentration of the PCR products of the target DNA in PCR reactions that
have completed the
same number of cycles and are in their linear ranges, it is possible to
determine the relative
concentrations of the specific target sequence in the original DNA mixture. If
the DNA mixtures
are cDNAs synthesized from RNAs isolated from different tissues or cells, the
relative abundances
of the specific mRNA from which the target sequence was derived may be
determined for the
respective tissues or cells. This direct proportionality between the
concentration of the PCR
products and the relative mRNA abundances is only true in the linear range
portion of the PCR
reaction.
The final concentration of the target DNA in the plateau portion of the curve
is determined
by the availability of reagents in the reaction mix and is independent of the
original concentration
of target DNA. Therefore, the first condition that must be met before the
relative abundances of a
mRNA species may be determined by RT-PCR for a collection of RNA populations
is that the
concentrations of the amplified PCR products must be sampled when the PCR
reactions are in the
linear portion of their curves.
The second condition that must be met for an RT-PCR study to successfully
determine the
relative abundances of a particular mRNA species is that relative
concentrations of the amplifiable
cDNAs must be normalized to some independent standard. The goal of an RT-PCR
study is to
determine the abundance of a particular mRNA species relative to the average
abundance of all
mRNA species in the sample. In the studies described below, mRNAs for B-actin,
asparagine
synthetase and lipocortin II were used as external and internal standards to
which the relative
abundance of other mRNAs are compared.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
Most protocols for competitive PCR utilize internal PCR standards that are
approximately
as abundant as the target. These strategies are effective if the products of
the PCR amplifications
are sampled during their linear phases. If the products are sampled when the
reactions are
approaching the plateau phase, then the less abundant product becomes
relatively over represented.
5 Comparisons of relative abundances made for many different RNA samples,
such as is the case
when examining RNA samples for differential expression, become distorted in
such a way as to
make differences in relative abundances of RNAs appear less than they actually
are. This is not a
significant problem if the internal standard is much more abundant than the
target. If the internal
standard is more abundant than the target, then direct linear comparisons may
be made between
10 RNA samples.
The discussion above describes the theoretical considerations for an RT-PCR
assay for
clinically derived materials. The problems inherent in clinical samples are
that they are of variable
quantity (making normalization problematic), and that they are of variable
quality (necessitating the
co-amplification of a reliable internal control, preferably of larger size
than the target). Both of
15 these problems are overcome if the RT-PCR is performed as a relative
quantitative RT-PCR with
an internal standard in which the internal standard is an amplifiable cDNA
fragment that is larger
than the target cDNA fragment and in which the abundance of the mRNA encoding
the internal
standard is roughly 5-100 fold higher than the mRNA encoding the target. This
assay measures
relative abundance, not absolute abundance of the respective mRNA species.
20 Other studies may be performed using a more conventional relative
quantitative RT-PCR
with an external standard protocol. These assays sample the PCR products in
the linear portion of
their amplification curves. The number of PCR cycles that are optimal for
sampling must be
empirically determined for each target cDNA fragment. In addition, the reverse
transcriptase
products of each RNA population isolated from the various tissue samples must
be carefully
25 normalized for equal concentrations of amplifiable cDNAs. While
empirical determination of the
linear range of the amplification curve and normalization of cDNA preparations
are tedious and
time consuming processes, the resulting RT-PCR assays may, in certain cases,
be superior to those
derived from a relative quantitative RT-PCR with an internal standard.
One reason for this is that without the internal standard/competitor, all of
the reagents may
30 be converted into a single PCR product in the linear range of the
amplification curve, increasing the
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
66
sensitivity of the assay. Another reason is that with only one PCR product,
display of the product
on an electrophoretic gel or some other display method becomes less complex,
has less background
and is easier to interpret.
H. Diagnosis and Prognosis of Human Cancer
In certain embodiments, the present disclosure enables the diagnosis and
prognosis of
human cancer by screening for marker nucleic acids. Various markers have been
proposed to be
correlated with metastasis and malignancy. They may be classified generally as
cytologic, protein
or nucleic acid markers.
Cytologic markers include such things as "nuclear roundedness" (Diamond et
al., 1982) and
cell ploidy. Protein markers include prostate specific antigen (PSA) and
CA125. Nucleic acid
markers have included amplification of Fler2/neu, point mutations in the p53
or ras genes, and
changes in the sizes of triplet repeat segments of particular chromosomes.
All of these markers exhibit certain drawbacks, associated with false
positives and false
negatives. A false positive result occurs when an individual without malignant
cancer exhibits the
presence of a "cancer marker". For example, elevated serum PSA has been
associated with prostate
carcinoma. However, it also occurs in some individuals with non-malignant,
benign hyperplasia of
the prostate. A false negative result occurs when an individual actually has
cancer, but the test fails
to show the presence of a specific marker. The incidence of false negatives
varies for each marker,
and frequently also by tissue type. For example, ras point mutations have been
reported to range
from a high of 95 percent in pancreatic cancer to a low of zero percent in
some gynecologic
cancers.
Additional problems arise when a marker is present only within the transformed
cell itself.
Ras point mutations may only be detected within the mutant cell, and are
apparently not present in,
for example, the serum or urine of individuals with ras-activated carcinomas.
This means that, in
order to detect a malignant tumor, one must take a sample of the tumor itself,
or its metastatic cells.
Essentially one must first identify and sample a tumor before the presence of
the cancer marker
may be detected.
Finally, specific problems occur with markers that are present in normal cells
but absent in
cancer cells. Most tumor samples contain mixed populations of both normal and
transformed cells.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
67
If one is searching for a marker that is present in normal cells, but occurs
at reduced levels in
transformed cells, the "background" signal from the normal cells in the sample
may mask the
presence of transformed cells.
The ideal disease state marker would be one that is present in individuals
with the disease
state, and either missing or expressed at significantly lower levels in normal
individuals. The
present disclosure addresses this need, in the case of metastatic prostate
cancer for example, by
identifying several new nucleic acid markers that are expressed at higher
levels in individuals with
metastatic prostate cancer than in normal individuals. In particular, the
results for markers UC302
(SEQ ID #3) and UC325 (SEQ ID #4) are quite promising in that these markers
are apparently only
overexpressed in the peripheral blood of individuals with metastatic tumors
and are present at
relatively low levels in normal individuals.
Further, since the markers are present in the whole blood of individuals with
the disease
state, the present detection method avoids the problem of having to suspect a
tumor is in place
before it may be sampled. The instant disclosure has utility as a general
screening tool for
asymptomatic individuals, as well as a means of differentially diagnosing
those patients whose
tumors have already metastasized. Depending upon the type of tumor involved,
such individuals
may be selected for systemic forms of anti-cancer therapy rather than surgical
removal of localized
tumor masses. Certain individuals with advanced forms of highly malignant
metastatic tumors may
be optimally treated by pain management alone.
It is anticipated that in clinical applications, human tissue samples will be
screened for the
presence of the disease state markers identified herein. Such samples would
normally consist of
peripheral blood, but may also consist of needle biopsy cores or lymph node
tissue. In certain
embodiments, nucleic acids would be extracted from these samples and amplified
as described
above. Some embodiments would utilize kits containing pre-selected primer
pairs or hybridization
probes. The amplified nucleic acids would be tested for the markers by, for
example, gel
electrophoresis and ethidium bromide staining, or Southern blotting, or a
solid-phase detection
means as described above. These methods are well known within the art. The
levels of selected
markers detected would be compared with statistically valid groups of
individuals with metastatic,
non-metastatic malignant, or benign tumors or normal individuals. The
diagnosis and prognosis of
the individual patient would be determined by comparison with such groups.
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
68
Another embodiment of the present disclosure involves application of RT-PCR
techniques
to detect a disease state using probes and primers selected from sequences
comprising Genebank
Accession numbers D87451, T03013, X03558, M28130, Y00787, SEQ ID NO:1, SEQ ID
NO:2,
SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:29. Similar techniques
have been
described in PCT Patent Application No. WO 94/10343.
In this embodiment, the disease state is detected in hematopoietic samples by
amplification
of disease state-specific nucleic acid sequences. Samples taken from blood or
lymph nodes are
treated as described below to purify total cell RNA. The isolated RNA is
reverse transcribed using
a reverse transcriptase and primers selected to bind under high stringency
conditions to a nucleic
acid sequence from a group comprising Genebank Accession numbers D87451,
T03013, X03558,
M28130, Y00787, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID
NO:5, or
SEQ ID NO:29. Following reverse transcription, the resulting cDNAs are
amplified using
conventional PCR techniques and a thermostable DNA polymerase.
The presence of amplification products corresponding to disease state-marker
nucleic acids
may be detected by several alternative means. In one embodiment, the
amplification product may
be detected by gel electrophoresis and ethidium bromide staining.
Alternatively, following the gel
electrophoresis step the amplification product may be detected by conventional
Southern blotting
techniques, using an hybridization probe selected to bind specifically to a
disease state-marker
nucleic acid sequence. Probe hybridization may in turn be detected by a
conventional labeling
means, for example, by incorporation of [3211-nucleotides followed by
autoradiography. The
amplification products may alternatively be detected using a solid phase
detection system such as
those utilizing a disease state-marker specific hybridization probe and an
appropriate labeling
means, or even the ELISA-like system known as C-trackTu as described above.
The following examples are included to demonstrate preferred embodiments of
the
invention. It should be appreciated by those of skill in the art that the
techniques disclosed in the
examples which follow represent techniques discovered by the inventors to
function well in the
practice of the invention, and thus may be considered to constitute preferred
modes for its practice.
However, those of skill in the art should, in light of the present disclosure,
appreciate that many
changes may be made in the particular embodiments which are disclosed and
still obtain a like or
similar result without departing from the spirit and scope of the invention.
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
69
I. Materials and Methods
1. Application of RNA fingerprinting to discover biomarkersfor
disease states
RNA fingerprinting (according to Liang and Pardee, 1992; Welsh et al., 1992;
Liang and Pardee, 1993) was applied to nucleic acids isolated from the
peripheral blood of
individuals with metastatic prostate cancer, compared with normal individuals.
Blood was drawn from cancer patients and normal individuals into Vacutainer0
CPT tubes
with ficol gradients (Becton Dickinson and Company, Frankin Lanes, NJ). The
tubes were
centrifuged to separate the red blood cells from various types of nucleated
cells, collectively
referred to as the buffy coat, and from blood plasma. Total cell RNA was
isolated from the buffy
coats by the RNA STAT-60 method (Tel-Test, Inc., Friendswood, TX). After RNA
isolation, the
nucleic acids were precipitated with ethanol. The precipitates were pelleted
by centrifugation and
redissolved in water. The redissolved nucleic acids were then digested with
RNase-free DNase I
(Boehringer Mannheim, Inc.) following the manufacturer's instructions,
followed by organic
extraction with phenol:chloroform:isoamylalcohol (25:24:1) and re-
precipitation with ethanol.
The DNase I treated RNA was then pelleted by centrifugation and redissolved in
water.
The purity and concentration of the RNA in solution was estimated by
determining optical density
at wave lengths of 260 nm and 280 nm (Sambrook et al., 1989). The RNA was then
examined by
electrophoresison a native TAE agarose gel (Sambrook et al, 1989) to determine
its integrity. The
RNA was then divided into three aliquots. One aliquot was set aside for
relative quantitative RT-
PCR confirmation using the external standard method described below.
A second aliquot was used to fingerprint the RNA by converting the RNA to
first strand
cDNA using random hexamers and reverse transcriptase; fingerprinting the cDNA
by PCR using
arbitrarily chosen oligonucleotides, (10 nucleotides in length); displaying
the resulting PCR
amplified products on an agarose gel stained with ethidium bromide and cutting
differentially
appearing bands out of the gel. The excised bands were then cloned and
sequenced.
The RNA of the third aliquot was pooled to make a pool of blood RNA from
normal
individuals and a pool of RNA from the blood of patients with metastatic
prostate cancer. The
pools were fingerprinted using the sequential pairwise method of arbitrarily
primed PCR
fingerprinting of RNA (McClelland et al., 1994, Nucleic Acids Research 22,
4419-4431,
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
with several changes. For example, arbitrary oligonucleotides of
15 to 24 nucleotides were used with Taq polymerase, and one tenth of each
first strand cDNA
reaction in each arbitrarily primed PCR reaction. One hundred and 200 ng were
used in each first
strand cDNA synthesis, respectively. Certain genes disclosed herein were
discovered by the
5 sequential pairwise method.
2. Methods Utilized in the RNA Fingerprinting Technique
The second type of RNA fingerprinting studies performed more closely resembled
the protocol of Welsh et al. (1992). This approach used a variation of the
above as modified by the
10 use of agarose gels and non-isotopic detection of bands by ethidium
bromide staining (An et al.,
1995). Total RNAs were isolated from peripheral blood samples as described
(Chomczynski &
Sacchi, 1987). Ten micrograms of total cellular RNAs were treated with 5 units
of RNAse-free
DNAse I (GIBCO/BRL) in 20 mM Tris-HC1 (pH 8.4), 50 mM KC1, 2 mM MgCl2, and 20
units of
RNAse inhibitor (Boehringer Mannheim). After extraction with phenol/chloroform
and ethanol
15 precipitation, the RNAs were redissolved in DEPC-treated water.
Two jig of each total cell RNA sample was reverse transcribed into cDNA using
randomly
selected hexamer primers and MMLV reverse transcriptase (GIBCO/BRL). PCR was
performed
using one or two arbitrarily chosen oligonucleotide primers (10-12mers). PCR
conditions were: 10
mM (p1-18.3), 50 mM KC1, 1.5 mM MgC12, 50 mM dNTPs, 0.2 mM of
primer(s), 1 unit
20 of Taq DNA polymerase (GIBCO/BRL) in a final volume of 20 mt. The
amplification parameters
included 35 cycles of reaction with 30 sec denaturing at 94 C, 90 sec
annealing at 40 C, and 60 sec
extension at 72 C. A final extension at 72 C was performed for 15 min. The
resulting PCR
products were resolved into a fingerprint by size separation by
electrophoresis through 2% agarose
gels in TBE buffer (Sambrook et al., 1989). The fingerprints were visualized
by staining with
25 ethidium bromide. No re-amplification was performed.
Differentially appearing PCR products, that might represent differentially
expressed genes,
O
were excised from the gel with a razor blade, purified from the agarose using
the Geneclean kit
(Bio 101, Inc.), eluted in water and cloned directly into plasmid vectors
using the TA cloning
strategy (Invitrogen, Inc., and Promega, Inc.). These products were not re-
amplified after the initial
30 PCR fingerprinting protocol.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
71
3.
Confirmation of Differential Expression by Relative Quantitative RT-PCR:
Protocols/or RT-PCR
a. Reverse transcription
One to five p.g of total cell RNA from each tissue sample was reverse
transcribed
into cDNA. Reverse transcription was performed with 400 units of MMLV reverse
transcriptase
(GIBCO/BRL) in the presence of 50 mM Tris-HC1 (pH 8.3), 75 mM KC1, 3 mM MgC12,
10 mM
DTT, 500 mM dNTP, 50 ng random hexamers per microgram of RNA, and 1 U/ml RNase
inhibitor. The reaction volume was 60 ml. The reaction mixture was incubated
at room
temperature for 10 minutes, then at 37 C for 50 minutes. After reverse
transcription the enzyme
was denatured by heating to 65 C for 10 minutes. After heat denaturation the
samples were diluted
with water to a final volume of 300 ml.
RT-PCR was utilized to examine mRNAs for differential expression. The
sequences of
oligonucleotides used as primers to direct the amplification of the various
cDNA fragments are
presented in Table 3.
b. Relative Quantitative RT-PCR With an Internal Standard
The concentrations of the original total cell RNAs were determined by
measurement
of 0O2601280 (Sambrook et al., 1989) and confirmed by examination of ribosomal
RNAs on
ethidium bromide stained agarose gels. It is required that all quantitative
PCR reactions be
normalized for equal amounts of amplifiable cDNA after the reverse
transcription is completed.
One solution to this is to terminate the reactions by driving the PCR
reactions into plateau phase.
This approach was utilized in some studies because it is quick and efficient.
Lipocortin II was used
as the internal standard or competitor. These PCRs were set up as follows:
Reagents: 200 mM each dNTP, 200 nM each oligonucleotide primer, 1X PCR buffer
(Boehringer
Mannheim including 1.5 mM MgC12), 3 ml diluted cDNA, and 2.5 units of Taq DNA
polymerase/1 00 ml of reaction volume.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
72
Cycling parameters: 30 cycles of 94 C for 1 min; 55 C for 1 min; and 72 C for
two min.
Thermocyclers were either the MJ research thermocycler or the Stratagene
Robocycler.
c. Relative Quantitative RT-PCR with an External
Standard
There are three problems with the relative quantitative RT-PCR strategy
described
above. First, the internal standard must be roughly 4-10 times more abundant
than the target for
this strategy to normalize the samples. Second, because most of the PCR
products are templated
from the more abundant internal standard, the assay is less than optimally
sensitive. Third, the
internal standard must be truly unvarying. The result is that while the
strategy described above is
fast, convenient and applicable to samples of varying quality, it lacks
sensitivity to modest changes
in abundances.
To address these issues, a normalization was performed using the B-actin mRNA
as external
standard. These PCR reactions were performed with sufficient cycles to observe
the products in the
linear range of their amplification curves. The intensities of the ethidium
bromide stained bands
were documented and quantified using the Isl 000 imaging analysis system
manufactured by the
Alpha Innotech, Corp. The quantified data was then normalized for variations
in the starting
concentrations of amplifiable cDNA by comparing the quantified data from each
study with that
derived from a similar study which amplified a cDNA fragment copied from the B-
actin mRNA.
Quantified data that had been normalized to beta actin were converted into bar
graph
representations.
4. Multivariate Analysis of Prostate Disease State
a. Specimen Collection
Blood specimens (8-10 mls) were collected by venipuncture into standard serum
or serum-separating tubes (Becton-Dickinson), allowed to coagulate for 30
minutes at room
temperature, and then centrifuged at low speed (1000x g) for 10 minutes. Some
specimens
coming were immediately frozen and shipped overnight by delivery courier.
Others were
collected, processed, frozen, and shipped on dry ice by overnight mail. Upon
arrival, all
specimens were stored at -20 C. Repeated freeze-thaw cycles were avoided.
CA 02273847 1999-06-03
WO 98/24935 PCT/US97/22105
73
b. Measurement of Free and Total PSA
Two commercially available assays were utilized to measure PSA concentrations,
an IMMULITE solid-phase chemiluminescence-based assay to measure free PSA
(Diagnostic
Products Corp.; Los Angeles, CA), and the FDA approved assay from TOSOH (San
Diego, CA)
that utilizes an enzyme-conjugated monoclonal antibody and fluorescent
substrate to measure
total PSA. However, since two different instruments were utilized to measure
the components of
the f/t PSA ratio, the international reference standards for free and total
PSA were utilized to
calibrate both assays and calculate the "corrected" f/t PSA ratio (Stamey,
1995).
c. ft PSA Reference Standards and Correction offit PSA ratio
The corrected f/t PSA ratio was determined according to Marley et al., 1996.
Reference standards for free and total PSA assays were purchased from the
Stanford University
Prostate Center and consisted of an equimolar mixture of 90% PSA-a- 1 -
antichymotrypsin and
10% free-PSA (Stamey, 1995; Chen et al., 1995). All testing dilutions were
performed with I%
bovine serum albumin (Fraction V; Sigma Chemical Co.) in 20 mM phosphate-
buffered saline
(PBS), pH 7.4. Expected concentrations of the reference standards, determined
from molar
extinction coefficients (6), were also provided.
Free and total PSA assays were standardized as follows. Based upon the mean of
seven
linear standard curve runs of the reference standards (Stamey, 1995),
correlation factors for free
and total PSA measurement were calculated. Slope (m) deviations were measured
relative to the
linear plot based upon the PSA molar extinction coefficients (6) of the
reference standards. Since
all curves passed through the origin, the correction factor for the free/total
PSA ratio was
calculated from the difference in slopes. Intra-assay coefficients of
variation for free PSA (range
= 0-2.0 ng/ml) and total PSA (range = 0-20.0 ng/ml) assays were 7% and 8%,
respectively. The
correction factors applied to the free and total PSA values were 1.19 and
0.83, respectively. For
analysis purposes, only the f/t PSA ratio values were corrected.
The (TOSOH) total PSA assay reacted equally to the free and bound (PSA-ACT)
forms
of PSA. The (Immulite) free PSA assay system was unable to detect the bound
fraction of PSA
(PSA-ACT) below a concentration of 20 ng/ml. Antibodies for detecting both
total and free PSA
were unable to detect PSA covalently linked to a-2 macroglobulin (PSA-MG or
occult PSA).
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
74
d. Statistical Methods
Differences in free and total serum PSA data between BPH and cancer samples
were examined using the non-parametric statistical method of Wilcoxon rank-sum
tests
(Vollmer, 1996). The binary dependent variable assessed was the clinical
outcome of BPH or
CaP. Sensitivity, specificity and Receiver Operator Characteristics (ROC)
Curves analyses were
derived by Logistic regression modeling using the STATATm software package
(Stata
Corporation, College Station, TX). Classification and Regression Tree (CART)
analysis (CART
v1.01, SYSTAT Inc., Evanston, IL), was used to determine the optimal cutoff
for the serum
assays as well as the logistic regression models (Breiman et al., 1984;
Steinberg and CoIla,
1992). The correlation values of the independent parameters were also
determined using the
STATATm software package.
e. IL-8 Quantitation
A commercial IL-8 immunoassay kit was purchased for use in this study (IL-8
Solid Phase Immunoassay, Cat. I#D8050, 96 well microtiter plate format, from
R&D Systems,
614 McKinley Pl. NE; Minneapolis, MN 55413). Solutions consisted of wash
buffer, substrate
solution (color reagents A&B), calibrator diluent RD6Z, assay diluent RD1-8,
stop solution and
IL-8 stock solution (2000 pg/ml). To prepare the IL-8 standards, 500 t1 of
calibrator diluent
RD6Z was pipetted into each of a series of dilution tubes. A serial dilution
of the IL-8 stock
solution (2000 pg/ml) was prepared to yield standards of the following
concentrations: 1000,
500, 250, 125, 62.5, 31.2, 15.6, 7.8 pg/ml.
The manufacturer's recommended protocol was used to assay IL-8 concentrations.
All
reagents and samples were first brought to room temperature. The assay mixture
contained in
each well; 100 1 of assay diluent RD1-8, 50 p,1 of sample (or appropriate
standard) and 100 IA of
IL-8 conjugate. The wells were covered with the provided adhesive strip and
samples were
incubated for 3 hours at room temperature. Each assay well was aspirated and
washed with wash
buffer for a total of six washes. After the final wash, the plate was inverted
onto a paper towel to
wick up excess moisture. Then 200 p.1 of substrate solution was added to each
assay well and
incubated for 30 min at room temperature. Fifty 1 of stop solution was added
to each assay well
CA 02273847 2006-01-11
WO 98/24935
PCT/US97/22105
and mixed by gentle tapping. Optical density was measured within 30 min of
addition of stop
solution, using a Bio-Tek EL-808 microplate reader (96 well format) at 450
rim.
IL-8 Standard Curve and Coefficient of Variation (CV)
5
The IL-8 standard curve consisted of eight concentrations: 1000, 500, 250,
125,
62.5, 31.2, 15.6, 7.8 pg IL-8/ml. The mean of six different measurements of
each standard
dilution was plotted (x-axis) vs. the mean optical density measured (y-axis).
Results were
plotted using the KC3 software package (Bio-Tek Instruments; Winooski, VT).
Coefficient of variation (CV): From the eight data points for each
concentration of the
10
standard curve, Coefficient of Variation (CV) = Standard Deviation/Mean was
calculated to be
6.9, 6.4, 11.1, 10.1, 4.5, 4.4, 13.0 and 34.1%, respectively for the standard
curve concentrations
listed above. Points with a CV of greater than 13% were not utilized for this
study.
K. EXAMPLES
15 Example]
Relative Quantitative Reverse Transcriptase-PolymeraseChain Reaction -
A method to evaluate novel genes (ESTs) as diagnostic biornarkers.
The reverse transcription-polymerase chain reaction (RT-PCR) protocols
described in the
20 following examples were developed as a means to determine the
relative abundances of mRNA
species that are expressed in various tissues, organs and cells. This protocol
has been described
as applied to prostate tissue in USPatent No. 5,882,864.
The protocols used to meet this need must be robust, reproducible, relatively
quantitative, sensitive, conservative in its use of resources, rapid and have
a high throughput rate.
25 Relative quantitative RT-PCR has the technical features that, in theory,
meet all of these criteria.
In practice there are six important barriers to implementing an RT-PCR based
assay that
compares the relative abundances of mRNA species. The protocol described
herein addresses
each of these six barriers and has permitted the realization of the potential
of RT-PCR for this
application. Although the present example is drawn to the identification and
confirmation of
30 differential expression in various physiological states in prostate
tissue, the methods described
herein may be applied to any type of tissue, and particularly to peripheral
blood cells to provide a
sensitive method of identifying differential expression.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
76
The inventors have described the examination of candidate genes by this method
that
were partial cDNA fragments identified by RNA fingerprinting methodologies.
This necessitated
development of a relatively quantitative approach to independently confirm the
differential
expression of the mRNAs from which these partial cDNA fragments were derived.
The key
objective of the described screening protocol is the assessment of changes in
the relative
abundances of mRNA.
The gene discovery program previously described is focused on analysis of
human tissue
and confirmation must be performed on the same biological material. Access to
human tissue for
isolation of RNA is limited. This limitation is especially problematic in
Northern blots, the
traditional means to determine differential gene expression. Northern blots
typically consume
roughly 20 ps of RNA per examined tissue per gene identified. This means that
for the average
size of tissue sample available, only 1-5 Northern blots can be performed
before all of the RNA
from a tissue sample is completely consumed. Clearly Northern blots are
seriously limited for
primary confirmation of discovered genes and consume extremely valuable
biological resources
required for gene discovery and characterization.
Because of such limitations on the amount of available tissue, and because of
the need for
high throughput and rapid turnaround of results, a two tiered assay protocol
was developed that
is technologically grounded on reverse transcription (RT) of RNA into cDNA
followed by
amplification of specific cDNA sequences by polymerase chain reaction (PCR).
This coupling of
techniques is frequently referred to as RT-PCR.
One advantage of RT-PCR is that it consumes relatively small quantities of
RNA. With
20pg of RNA per examined sample, the amount of RNA required to perform a
single Northern
blot experiment, 50-200 RT-PCR assays may be performed with up to four data
points per assay.
Another advantage is a high throughput, eight independent experiments which
examine eight
different mRNA species for differential expression may be performed
simultaneously in a single
PCR machine with 96 wells. A single individual skilled in this technique may
thereby examine
and evaluate eight genes per day without significant time constraints. By
comparison, even if
RNA of sufficient quality and quantity were available to do this number of
Northern blots, a
similarly skilled individual performing Northern blots would be hard pressed
to examine and
evaluate eight genes per week. In addition to the lower throughput rate of
Northern blots, eight
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
77
Northern blots per week would require the consumption of about 4002Ci of 32P
per week. While
not dangerous to use in the hands of a skilled individual, 32P is certainly
inconvenient to use. RT-
PCR avoids the use of radioactive materials.
An additional advantage of RT-PCR over Northern blots as a technological
platform for
evaluating the relative expression of mRNA species is that RT-PCR is much less
sensitive to
differences in quality of the RNA being examined. The human tissues described
were removed
from patients for treatment purposes and were only incidentally saved for
further studies. Hence
the RNA, an extremely labile molecule, is expected to be at least partially
degraded. Because the
RNA is separated by size on a gel in the Northern blot assay, partially
degraded RNA appears as
a smear, rather than discrete bands. By contrast, RT-PCR amplifies only a
section or domain of
an RNA molecule, and as long as that portion is intact, the size or
degradation state of the entire
molecule is irrelevant. As a result, RNAs that are identical except that they
vary by degree of
partial degradation will give much more variable signals in a Northern blot
than they will in an
RT-PCR. When samples are of variable quality, as is often the case in human
studies, the relative
sensitivities of the techniques to variation in sample quality is an important
consideration.
In the practice of this method, total cell RNA is first converted into cDNA
using reverse
transcriptase primed with random hexamers. This protocol results in a cDNA
population in
which each RNA has contributed according to its relative proportion in
original total cell RNA.
If two RNA species differ by ten fold in their original relative abundances in
the total cell RNA,
then the cDNA derived from these two RNAs will also differ by ten fold in
their relative
abundances in the resulting population of cDNA. This is a conservation of
relative
proportionality in the conversion of RNA to cDNA.
Another consideration is the relative rates of amplification of a targeted
cDNA by PCR.
In theory, the amount of an amplified product synthesized by PCR will be equal
to M(Ec).
Where M is the mass of the targeted cDNA molecules before the beginning of PCR
and C is the
number of PCR cycle performed. E is an efficiency of amplification factor.
This factor is
complex and varies between 1 and 2. The important consideration in this assay
is that over most
of a PCR amplification, E will be nearly constant and nearly equal to 2. In
PCR reactions that are
identical in every way except the cDNAs being used as templates are derived
from different total
cell RNAs, then E will have the same value in each reaction. If a cDNA target
has an initial mass
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
78
of MI in one PCR reaction and a mass of M2 in another PCR reaction and if E
has the same value
in each reaction, then after C cycles of PCR there will be a mass of M1 (EC)
of the amplified
target in the first reaction and a mass of M2(E) of the amplified target in
the second reaction.
The ratios of these masses is unaltered by PCR amplification. That is Ml/M2=
[M1(Ec)]/M2(Ec).
Hence, there is a conservation of relative proportionality of amplified
products during PCR.
Since both reverse transcription and PCR may be performed in such a way as to
conserve
proportionality, it is possible to compare the relative abundance of an mRNA
species in two or
more total cell RNA populations by first converting the RNA to cDNA and then
amplifying a
fragment of the cDNA derived from the specific mRNA by PCR. The ratio of the
amplified
masses of the targeted cDNA is very close to or identical to the ratios of the
mRNAs in the
original total cell RNA populations.
Six major challenges or barriers to be overcome in order to best use RT-PCR to
quantify
the relative abundances of RNA are as follows:
1) Degradation of RNA must be minimized during RNA preparation.
2) Genomic DNA must be eliminated.
3) RNA must be free of contaminants that might interfere with reverse
transcription.
4) The efficiency of RT is variable. cDNAs, not RNA, must be normalized for
equal
concentrations of amplifiable cDNA.
5) Limited linear range requires multiple sampling points in any amplification
curve.
6) Tube to tube variability in PCR
It is the development of techniques to overcome these barriers and to provide
a sensitive
and accurate method of quantitative RT-PCR that is applicable to any tissue
type, or cell type
such as peripheral blood cells, or physiological state that is a part of the
present invention.
The first three barriers to successful RT-PCR are all related to the quality
of the RNA
used in this assay. The protocols described in this section address the first
two barriers as
described in the last section. These are the requirements that degradation of
RNA must be
minimized during RNA preparation and that genomic DNA must be eliminated from
the RNA.
r-
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
79
Two preferred methods for RNA isolation are the guanidinium thiocyanate
method,
which is well known in the art, and kits for RNA isolation manufactured by
Qiagen, Inc.
(Chatworth, CA), with the kits being the most preferred for convenience. Four
protocols are
performed on the RNA isolated by either method (or any method) before the RNA
is be used in
RT-PCR.
The first of these four protocols is digestion of the RNAs with DnaseI to
remove all
genomic DNA that was co-isolated with the total cell RNA. Prior to DNaseI
digestion, the RNA
is in a particulate suspension in 70% ethanol. Approximately 50 lag of RNA (as
determined by
0D260/280) is removed from the suspension and precipitated. This RNA is
resuspended in DEPC
treated sterile water. To this is added 10X DNaseI buffer (200 mM Tris-HC1; pH
8.4, 20 mM
MgC12, 500 mM KC1), 10 units of RNase Inhibitor (GIBCO-BRL Cat#15518-012) and
20 units
of DNaseI (GIBCO-BRL # 18068-015). The volume is adjusted to 50 IA with
additional DEPC
treated water. The reaction is incubated at 37 C for 30 minutes. After DNaseI
digestion the
RNAs are organic solvent-extracted with phenol and chloroform followed by
ethanol
precipitation. This represents the second ethanol precipitation of the
isolated RNA. Empirical
observations suggest that this repeated precipitation improves RNA performance
in the RT
reaction to follow.
Following DNaseI digestion, an aliquot of the RNA suspension in ethanol is
removed and
divided into thirds. A different procedure is performed on each one of the
aliquot thirds. These
three procedures are: (1). An 0D260/280 is obtained using a standard protocol
and is used to
estimate the amount of RNA present and its likely quality. (2). An aliquot is
run out on an
agarose gel, and the RNA is stained with ethidium bromide. Observation that
both the 28S and
18S RNAs are visible as discreet bands and that there is little staining above
the point at which
the 28S rRNA migrates indicate that the RNA is relatively intact. While it is
not critical to assay
performance that the examined RNAs be completely free of partial degradation,
it is important to
determine that the RNA is not so degraded as to significantly effect the
appearance of the 28S
rRNA. (3). The total cell RNAs are run using a PCR-based test that confirms
that the DNaseI
treatment actually digested the contaminating genomic DNA to completion. It is
very important
to confirm complete digestion of genomic DNA because genomic DNA may act as a
template in
PCR reactions resulting in false positive signals in the relative quantitative
RT-PCR assay
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
described below. The assay for contaminating genomic DNA utilizes gene
specific
oligonucleotides that flank a 145 nucleotide long intron (intron #3) in the
gene encoding Prostate
Specific Antigen (PSA).This is a single copy gene with no pseudogenes. It is a
member of the
kallikrein gene family of serine proteases, but the oligonucleotides used in
this assay are specific
5 to PSA. The sequences of these oligonucleotides are:
5'CGCCTCAGGCTGGGGCAGCATT 3', SEQ ID NO:6
and
5'ACAGTGGAAGAGTCTCATTCGAGAT 3', SEQ ID NO:7.
In the assay for contaminating genomic DNA, 500 ng to 1.0 i_tg of each of the
DNaseI
10 treated RNAs are used as templates in a standard PCR (35-40 cycles under
conditions described
below) in which the oligonucleotides described above are used as primers.
Human genomic DNA
is used as the appropriate positive control. This DNA may be purchased from a
commercial
vender. A positive signal in this assay is the amplification of a 242
nucleotide genomic DNA
specific PCR product from the RNA sample being tested as visualized on an
ethidium bromide
15 stained electrophoretic gel. There should be no evidence of genomic DNA
as indicated by this
assay in the RNAs used in the RT-PCR assay described below. Evidence of
contaminating
genomic DNA results in re-digestion of the RNA with DNaseI and reevaluation of
the DNase
treated RNA by determining its 0D260/280 ratio, examination on electrophoretic
gel and re-testing
for genomic DNA contamination using the described PCR assay.
20 The standard conditions used for PCR (as mentioned in the last
paragraph) are:
lx GIBCO-BRL PCR reaction buffer [20 mM Tris-C1 (pH 8.4), 50 mM KC1]
1.5 mM MgCl2
2001.1M each of the four dNTPs
200 nM each oligonucleotide primer
25 concentration of template as appropriate
2.5 units of Taq polymerase per 100111 of reaction volume.
Using these conditions, PCR is performed with 35-40 cycles of:
94 C for 45 sec
55 -60 C for 45 sec
30 72 C for 1:00 minute.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
81
The protocols described in the above section permit isolation of total
cellular RNA that
overcomes two of the six barriers to successful RT-PCR, i.e. the RNA is
acceptably intact and is
free from contaminating genomic DNA.
Reverse transcriptases, also called RNA dependent DNA polymerases, as applied
in
currently used molecular biology protocols, are known to be less processive
than other
commonly used nucleic acid polymerases. It has been observed that not only is
the efficiency of
conversion of RNA to cDNA relatively inefficient, there is also several fold
variation in the
efficiency of cDNA synthesis between reactions that use RNAs as templates that
otherwise
appear indistinguishable. The sources of this variation are not well
characterized, but empirically,
it has been observed that the efficiencies of some reverse transcription (RT)
reactions may be
improved by repeated organic extractions and ethanol precipitations. This
implies that some of
the variation in RT is due to contaminants in the RNA templates. In this case,
the DNaseI
treatment described above may be aiding the efficiency of RT by subjecting the
RNA to an
additional cycle of extraction with phenol and chloroform and ethanol
precipitation.
Contamination of the template RNA with inhibitors of RT is an important
barrier to successful
RT that is partially overcome by careful RNA preparation and repeated organic
extractions and
ethanol precipitations.
Reverse transcription reactions are performed using the SuperscriptTM
Preamplification
System for First Strand cDNA Synthesis kit which is manufactured by GIBCO-BRL
LifeTechnologies (Gaithersburg, MD). SuperscriptTM is a cloned form of M-MLV
reverse
transcriptase that has been deleted for its endogenous Rnase H activity in
order to enhance its
processivity. In the present example, the published protocols of the
manufacturer are used for
cDNA synthesis primed with random hexamers. cDNA synthesis may also be primed
with a
mixture of random hexamers (or other small oligonucleotides of random
sequence) and oligo dT.
The addition of oligo dT increases the efficiency of conversion of RNA to cDNA
proximal to the
polyA tail. As template, either 5 or 10 micrograms of RNA is used (depending
on availability).
After the RT reaction has been completed according to the protocol provided by
GIBCO-BRL,
the RT reaction is diluted with water to a final volume of 100 I.
Even with the best prepared RNA and the most processive enzyme, there may be
significant variation in the efficiency of RT. This variation would be
sufficiently great that
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
82
cDNA made in different RTs could not be reliably compared. To overcome this
possible
variation, cDNA populations made from different RT reactions may be normalized
to contain
equal concentrations of amplifiable cDNA synthesized from mRNAs that are known
not to vary
between the physiological states being examined. In the present examples,
cDNAs made from
total cell RNAs are normalized to contain equal concentrations of amplifiable
b-actin cDNA.
One Jul of each diluted RT reaction is subjected to PCR using oligonucleotides
specific to
13-actin as primers. These primers are designed to cross introns, permitting
the differentiation of
cDNA and genomic DNA. These 13-actin specific oligonucleotides have the
sequences:
5' CGAGCTGCCTGACGGCCAGGTCATC 3', SEQ ID NO:8
and
5' GAAGCATTTGCGGTGGACGATGGAG 3', SEQ ID NO:9
PCR is performed under standard conditions as described previously for either
19 or 20
cycles. The resulting PCR product is 415 nucleotides in length. The product is
examined by PCR
using agarose gel electrophoresis followed by staining with ethidium bromide.
The amplified
cDNA fragment is then visualized by irradiation with ultra violet light using
a transilluminator.
A white light image of the illuminated gel is captured by an IS-1000 Digital
Imaging System
manufactured by Alpha Innotech Corporation. The captured image is analyzed
using either
version 2.0 or 2.01 of the software package supplied by the manufacturer to
determine the
relative amounts of amplified 13-actin cDNA in each RT reaction.
To normalize the various cDNAs, water is added to the most concentrated cDNAs
as
determined by the assay described in the last paragraph. PCR using 1 1.11 of
the newly rediluted
and adjusted cDNA is repeated using the 13-actin oligonucleotides as primers.
The number of
cycles of PCR must be increased to 21 or 22 cycles in order to compensate for
the decreased
concentrations of the newly diluted cDNAs. With this empirical method the
cDNAs may be
adjusted by dilution to contain roughly equal concentrations of amplifiable
cDNA. Sometimes
this process must be repeated to give acceptable final normalization. By
dividing the average
optical density of all observed bands by that of a particular band, a
normalization statistic may be
created that will permit more accurate comparisons of the relative abundances
of RNAs
examined in the normalized panel of cDNAs.
CA 02273847 1999-06-03
WO 98/24935
PCTTUS97/22105
83
Once the normalization statistics are derived, PCR may be performed using
different gene
specific oligonucleotides as primers to determine the relative abundances of
other mRNAs as
represented as cDNAs in the normalized panel of diluted RT reaction products.
The relative
intensities of the bands is then adjusted and normalized to 13-actin
expression by multiplying the
intensity quantities by the normalization statistics derived.
In the next section an RT-PCR assay is discussed that uses pooled cDNAs and is
more
likely to capture data from PCRs while in the linear portions of their
amplification curves. The
error caused by observing PCRs after the linear portion of PCR is in the
direction of
quantitatively underestimating mRNA abundance differences. To determine
quantitative
differences in mRNA expression, it is necessary that the data is collected in
the linear portion of
the respective PCR amplification curves. This requirement is met in the assay
described in
following paragraphs.
The last two barriers to RT-PCR are addressed in the sections that follow
involving the
use of pooled cDNAs as templates in RT-PCR. In practice, the protocols using
pooled templates
are usually performed before the protocol described above.
There are two additional barriers to relative mRNA quantitation with RT-PCR
that
frequently compromise interpretations of results obtained by this method. The
first of these
involves the need to quantify the amplification products while the PCR is
still in the linear
portion of the process where "E" behaves as a constant and is nearly equal to
two. In the "linear"
portion of the amplification curve, the log of the mass of the amplified
product is directly
proportional to the cycle number. At the end of the PCR process, "E" is not
constant. Late in
PCR, "E" declines with each additional cycle until there is no increase in PCR
product mass with
additional cycles.
The most important reason why the efficiency of amplification decreases at
high PCR
cycle number, may be that the concentration of the PCR products becomes high
enough that the
two strands of the product begin to anneal to each other with a greater
efficiency than that at
which the oligonucleotide primers anneal to the individual product strands.
This competition
between the PCR product strands and the oligonucleotide primers creates a
decrease in PCR
efficiency. This part of the PCR where the efficiency of amplification is
decreased is called the
"plateau" phase of the amplification curve. When "E" ceases to behave as a
constant and the
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
84
PCR begins to move towards the plateau phase, the conservation of relative
proportionality of
amplified products during PCR is lost. This creates an error in estimating the
differences in
relative abundance of an mRNA species occurring in different total cell RNA
populations. This
error is always in the same direction, in that it causes differences in
relative mRNA abundances
to appear less than they actually are. In the extreme case, where all PCRs
have entered the
plateau phase, this effect will cause differentially expressed mRNAs to appear
as if they are not
differentially expressed at all.
To control for this type of error, it is important that the PCR products be
quantified in the
linear portion of the amplification curve. This is technically difficult
because currently used
means of DNA quantitation are only sensitive enough to quantify the PCR
products when they
are approaching concentrations at which the product strands begin to compete
with the primers
for annealing. This means that the PCR products may only be detected at the
very end of the
linear range of the amplification curve. Predicting in advance at what cycle
number the PCR
products should be quantified is technically difficult.
Practically speaking, it is necessary to sample the PCR products at a variety
of cycle
numbers that are believed to span the optimum detection range in which the
products are
abundant enough to detect, but still in the linear range of the amplification
curve. It is impractical
to do this in a study that involves large numbers of samples because the
number of different PCR
reactions and/or number of different electrophoretic gels that must be run
becomes prohibitively
large.
To overcome these limitations, a two tiered approach was designed to
relatively quantify
mRNA abundance levels using RT-PCR. In the first tier, pools of cDNAs produced
by
combining equal amounts of normalized cDNA are examined to determine how mRNA
abundances vary in the average individual with a particular physiological
state. This reduces the
number of compared samples to a very small number such as two to four. In the
studies
described herein, two pools are examined. These are pools of normal
individuals and those
individuals with metastatic prostate cancer. Each pool may contain a large
number of individuals.
While this approach does not discriminate differences between individuals, it
may easily discern
broad patterns of differential expression. The great advantage of examining
pooled cDNAs is that
it permits many duplicate PCR reactions to be simultaneously set up.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
The individual duplicates may be harvested and examined at different cycle
numbers of
PCR. In studies described below, four duplicate PCR reactions were set up. One
duplicate was
collected at 31, 34, 37, and 40 PCR cycles. Occasionally, PCR reactions were
also collected at 28
cycles. Examining the PCRs at different cycle numbers yielded the following
benefits. It is very
5 likely that at least one of the RT-PCRs will be in the optimum portion of
the amplification curves
to reliably compare relative mRNA abundances. In addition, the optimum cycle
number will be
known, so that studies with much larger sample sizes are much more likely to
succeed. This is
the second tier of a two tiered approach that has =been taken to relatively
quantify mRNA
abundance levels using RT-PCR. Doing the RT-PCR with the pooled samples
permits much
10 more efficient application of RT-PCR to the samples derived from
individuals. A further benefit,
also as discussed below, tube to tube variability in PCR may be discounted and
controlled
because most studies yield multiple data points due to duplication.
Like the previously described protocol involving individuals, the first step
in this protocol
is to normalize the pooled samples to contain equal amounts of amplifiable
cDNA. This is done
15 using oligonucleotides that direct the amplification of I3-actin. In
this example, a PCR
amplification of a cDNA fragment derived from the f3-actin mRNA from pools of
normal
individuals and individuals with metastatic prostate cancer was performed.
This study was set up
as four identical PCR reactions. The products of these PCRs were collected and
electrophoresed
after 22, 25, 28 and 31 PCR cycles. Quantitation of these bands using the IS
1000 system showed
20 that the PCRs were still in the linear ranges of their amplification
curves at 22, 25 and 28 cycles
but that they left linearity at 31 cycles. This is known because the ratios of
the band intensities
remain constant and internally consistent for the data obtained from 22, 25
and 28 cycles, but
these ratios become distorted at 31 cycles. This quantitation will also permit
the derivation of
normalizing statistics for the three pools relative to each other in exactly
the same manner as was
25 done previously for individuals.
This study is then repeated using gene specific primers for a gene other than
f3-actin. The
intensities of the relevant bands were quantitated using the IS 1000 and
normalized to the 13-actin
signals.
The central question to be answered in analyzing this data is whether the PCRs
have been
30 examined in the linear portions of their amplification curves. A test
for this may be devised by
_
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
86
determining if the proportionality of the PCR products has been conserved as
PCR cycle number
has increased. If the ratio between the two pools of a given PCR product
remains constant with
increasing cycle number, this is strong evidence that the PCRs were in the
linear portions of their
amplification curves when these observations were made. (This is better
conservation of
proportionality than is frequently observed. In some studies, data was
excepted when the ratios
were similar but not identical.) This conservation of proportionality was lost
at 40 cycles. This
indicates that these PCRs are nearing the plateau phases of their
amplification curves.
The final major barrier to quantifying relative mRNA abundances with RT-PCR is
tube
to tube variability in PCR. This may result from many factors, including
unequal heating and
cooling in the thermocycler, imperfections in the PCR tubes and operator
error. To control for
this source of variation, the Cole-Parmer digital thermocouple Model # 8402-00
was used to
calibrate the thermocyclers used in these studies. Only slight variations in
temperature were
observed.
To rigorously demonstrate that PCR tube to tube variability was not a factor
in the studies
described above, 24 duplicate PCRs for 13-actin using the same cDNA as
template were
performed. These PCR tubes were scattered over the surface of a 96 well
thermocycler, including
the corners of the block where it might be suspected the temperature might
deviate from other
areas. Tubes were collected at various cycle numbers. Nine tubes were
collected at 21 cycles.
Nine tubes were collected at 24 cycles, and six tubes were collected at 27
cycles. Quantitation of
the intensities of the resulting bands with the IS 1000 system determined that
the standard error
of the mean of the PCR product abundances was 13%. This is an acceptably
small number to be
discounted as a major source of variability in an RT-PCR assay.
The RT-PCR protocol examining pooled cDNAs is internally controlled for tube
to tube
variability that might arise from any source. By examining the abundance of
the PCR products at
several different cycle numbers, it may be determined that the mass of the
expected PCR product
is increasing appropriately with increasing PCR cycle number. Not only does
this demonstrate
that the PCRs are being examined in the linear phase of the PCR, where the
data is most reliable,
it demonstrates that each reaction with the same template is consistent with
the data from the
surrounding cycle numbers. If there was an unexplained source of variation,
the expectation that
PCR product mass would increase appropriately with increasing cycle number
would not be met.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
87
This would indicate artifactual variation in results. Internal duplication and
consistency of the
data derived from different cycle numbers controls for system derived
variation in tube to tube
results.
As described in the preceding paragraphs, the RT-PCR protocol using pooled
cDNA
.5 templates overcomes the last two barriers to effective relative
quantitative RT-PCR. These
barriers are the need examine the PCR products while the reactions are in the
linear portions of
their amplification curves and the need to control tube to tube variation in
PCR. The described
protocol examines PCR products at three to four different cycle numbers. This
insures that the
PCRs are quantitated in their linear ranges and, as discussed in the last
paragraph, controls for
possible tube to tube variation.
One final question is whether (3-actin is an appropriate internal standard for
mRNA
quantitation. P-actin has been used by many investigators to normalize mRNA
levels. Others
have argued that 13-actin is itself differentially regulated and therefore
unsuitable as an internal
normalization standard. In the protocols described herein differential
regulation of (3-actin is not
a concern. More than fifty genes have been examined for differential
expression using these
protocols. Fewer than half were actually differentially expressed. The other
half were regulated
similarly to P-actin within the standard error of 13%. Either all of these
genes are coordinately
differentially regulated with 3-actin, or none of them are differentially
regulated. The possibility
that all of these genes could be similarly and coordinately differentially
regulated with p-actin
seems highly unlikely. This possibility has been discounted.
13-actin has also been criticized by some as an internal standard in PCRs
because of the
large number of pseudogenes of 13-actin that occur in mammalian genomes. This
is not a
consideration in the described assays because all of the RNAs used herein are
demonstrated to be
free of contaminating genomic DNA by a very sensitive PCR based assay. In
addition, the cycle
number of PCR needed to detect 13-actin cDNA from the diluted RT reactions,
usually between
19 and 22 cycles, is sufficiently low to discount any contribution that
genomic DNA might make
to the abundance of amplifiable 13-actin templates.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
88
Example 2:
Identification of Markers of Metastatic Prostate Cancer by Use of
RNA fingerprinting by PCR primed with oligonucleotides of arbitrary sequence.
RNA fingerprinting by PCR, primed with oligonucleotides of arbitrary sequence
was
performed on RNAs isolated from peripheral human blood. Bands which appeared
to be
differentially expressed were cloned.
For this study, total cell RNA was isolated from buffy coat cells as described
above. cDNA
was made from one to five ug of each isolated RNA. All cDNAs were normalized
for similar
amounts of B-actin cDNA by RT-PCR. RT-PCR products were electrophoresed
through agarose.
For relative quantitative RT-PCR with an external standard, quantitation of
band intensities
on ethidium bromide stained gels was performed using the IS-1000 image
analysis system
manufactured by the Alpha Innotech Corp. A normalizing statistic was generated
for each cDNA
sample, as the average of all B-actin signals divided by the B-actin signal
for each cDNA sample
respectively. Data for each sample was then normalized by multiplying the
observed densitometry
observation by the individual normalizing statistics. Normalized values
predict differences in the
steady state abundances of the respective mRNAs in the original total cell RNA
samples.
The nucleotide sequences of all cloned PCR products were determined by dideoxy
termination sequencing using either the ABI or Pharmacia automated sequencers.
This protocol resulted in the discovery of an mRNA species that was 2-3 fold
less abundant
in the peripheral blood of metastatic prostate cancer patients than in the
peripheral blood of normal
individuals of both sexes. The sequence of this band, referred to as UCBP Band
#35 (SEQ ID
NO:!), matches an EST derived from a fetal brain cDNA library (GenBank
Accession #T03013).
Down regulation of this band in the peripheral blood of metastatic prostate
cancer patients was
confirmed by relative quantitative RT-PCR.
Example 3:
Identification of Markers of Metastatic Prostate Cancer by
Use of RNA fingerprinting by the Pairwise Sequential Method
RNA fingerprinting was used to identify differentially expressed RNA species
according to
the pairwise sequential method of McClelland et al. (1994), as modified to use
larger (17-25 mer)
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
89
arbitrary oligonucleotides. PCR amplification products were labeled using a-
32P-dCTP and were
visualized by autoradiography after electrophoresis on denaturing
polyacrylamide gels. A number
of bands appeared to be differentially expressed, and were cloned as described
above.
UC Band #321 was confirmed by RT-PCR to be down regulated in the peripheral
blood of
prostate cancer patients, with a four-fold decrease observed compared with
normal individuals.
The DNA sequence of Band #321 does not match any known sequences in the
GenBank database.
It therefore represents a previously undescribed gene product.
UC Band #302 and UC Band #325 were both observed to be up regulated in the
peripheral
blood of metastatic prostate cancer patients. UC Band #302 is identical in
sequence to a portion of
the sequence of elongation factor 1-a (GenBank Accession #X03558). This band
was modestly
increased between 1.6 and 2-fold in metastatic cancer patients compared with
normal individuals.
UC Band #325 was found to consist of two different alternatively spliced forms
of mRNA,
encoded by the interleukin-8 (IL-8) gene. UC Band #325-1, the previously
identified mRNA
species of IL-8 (Genbank Accession #Y00787), is approximately seven-fold more
abundant in the
peripheral blood of metastatic prostate cancer patients. The alternatively
spliced IL-8 mRNA,
containing intron #3 of the IL-8 gene (Genbank Accession #M28130) is up to
seven-fold less
abundant in the peripheral blood of metastatic prostate cancer patients. Fig.
IA shows relative
quantitative RT-PCR of the differential expression of IL-8 (---UC235) in
peripheral blood of
patients with metastatic prostate cancer (M) and normal individuals (N) at
different PCR cycles
(cy). The two alternatively spliced forms of the IL-8 mRNA are observed. The
upper band (int.+)
includes intron 3 in the mature mRNA. The lower band (int.-) lacks intron 3.
Fig. 1B shows
relative quantitative RT-PCR showing Differential Expression of IL-8 (UC325)
in peripheral blood
of patients with metastatic prostate cancer in lanes 1-5 and a pool of normal
individuals (N). The
alternatively spliced forms of the IL-8 mRNA observed are different between
normal individuals
and those with prostate cancer. Overall, there is an approximately 30-fold
change in the ratios of
the two spliced forms of IL-8 mRNA in individuals with metastatic prostate
cancer compared with
normal individuals. These results have been confirmed by relative quantitative
RT-PCR.
As described above, an increased expression of IL-8 mRNA has been previously
reported in
cancer patients. However, this represents the first finding of an
alternatively spliced form of IL-8
mRNA, containing intron 3, that is significantly more abundant in normal
individuals compared
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
with metastatic prostate cancer patients. These results are surprising in view
of previous reports
which had failed to find any alternatively spliced forms of IL-8 mRNA in
normal individuals or
cancer patients.
It will be recognized that the genes and gene products (RNAs and proteins) for
the above
5 described markers of metastatic prostate cancer are included within the
scope of the disclosure
herein described. It will also be recognized that the diagnosis and prognosis
of metastatic prostatic
cancer by detection of the nucleic acid products of these genes are included
within the scope of the
present invention. Serological and other assays to detect these mRNA species
or their translation
products are also indicated. It is obvious that these assays are of utility in
diagnosing metastatic
10 cancers derived from prostate and other tissues.
Most significantly, these Examples demonstrate the feasibility of using RNA
fingerprinting
to identify mRNA species that are differentially expressed in the peripheral
blood of patients with
asymptomatic diseases or in patients with symptoms that are insufficient for a
definitive
diagnosis. It will be appreciated that this technique is applicable not only
to the detection and
15 diagnosis of prostate and other cancers, but also to any other disease
states which produce
significant effects on lymphocyte gene expression. Uses which are contemplated
within the scope
of the present disclosure include the detection and diagnosis of clinically
significant diseases that
requires medical intervention, including but not limited to asthma, lupus
erythromatosis,
rheumatoid arthritis, multiple sclerosis, myasthenia gravis, autoimmune
thyroiditis, ALS, interstitial
20 cystitis and prostatitis.
TABLE 2
Genes Whose mRNAs have Abundances that Vary in
Metastatic Prostate Cancer Relative to Normal Individuals
Name of Sequence Confirmed
Previously
cDNA Fragment Determined by RT-PCR Known
UCPB 35 Yes Yes
GB #T03013
UC 302 SEQ ID NO:3 Yes Yes EF 1-
cc
UC 321 SEQ ID NO:2 Yes Yes No
UC 325-1 SEQ ID NO:4 Yes Yes
GB #Y00787
UC 325-2 SEQ ID NO:5 Yes Yes IL-
8
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
91
TABLE 3.
Oligonucleotides used in the relative quantitative RT-PCR portion of these
studies.
Oligonucleotidesused to examine the expression of genes:
UCPB Band #35 (previously uncharacterized gene).
5' TGCAAACTTTCACCTGGACTT3', SEQ ID NO:10
5' CTTGTGACTTGCTTTGATAGAATG3', SEQ ID NO:11
UC Band #302 (elongation factor 1-a).
5' GACAACATGCTGGAGCCAAGTGC3', SEQ ID NO:12
5' ACCACCAATTTTGTAAGAACATCCT3', SEQ ID NO:13
UC Band #321 (previously uncharacterized gene).
5' TGTCCAGAGATCCAAGTGCAGAAGG3', SEQ ID NO:14
5' GAGCTCCAGGAGACAGAAGCCATAG3', SEQ ID NO:15
UC Band #325-1 (IL-8).
5' GGGCCCCAAGGAAAACT 3', SEQ ID NO:16
5' TGGCAACCCTACAACAGACC3', SEQ ID NO:17
UC Band #325-2 (IL-8).
5' GGGCCCCAAGGAAAACT3', SEQ ID NO:18
5' TGGCAACCCTACAACAGACC3', SEQ ID NO:19
Controls used to normalize relative quantitative RT-PCR
B-actin
5' CGAGCTGCCTGACGGCCAGGTCATC3', SEQ ID NO:8
5' GAAGCATTTGCGGTGGACGATGGAG3', SEQ ID NO:9
Asparagine Synthetase (AS)
5' ACATTGAAGCACTCCGCGAC3', SEQ ID NO:20
5' AGAGTGGCAGCAACCAAGCT3', SEQ ID NO:21
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
92
Example 4:
DNA Sequences of Markers of Metastatic Prostate Cancer
The DNA sequences of the markers of metastatic prostate cancer were determined
by
Sanger dideoxy sequencing as detailed above. The identified sequences are
provided in Table 4.
TABLE 4.
DNA Sequences of Markers of Metastatic Prostate Cancer:
UCPB Band #35 (SEQ ID NO:1) Matches a fetal brain EST, GenBank Accession #
T03013
5'GGCAGGGGCTTGTGACTCTAAGATGGCTTCATTCACATGCCTAGGGCCTCAGTAGG
ATGACTGGCATGGCCCTGGAAAACTGCGAAGTCTTCTCTCTGTGCAAACTTTCACCT
GGACTTTTTATATGATTCTGGAAGTATTCCAAGAAGGCAAAAGTAAAAACTGCAAA
GCGTCTTAAAATAGAAGTTCAGAAGCCACATTATATCACTTCTGTTGCATTCTATCA
AAGCAAGTCACAAGCCCCTGCCAATCA 3'
UC Band # 321 (SEQ ID NO:2) previously uncharacterized Gene
5'CACACACTCCCCCATTCTGAGCCCCAAGAGGCTCATCCCTAAGGATGTCCAGAGA
TCCAAGTGCAGAAGGAGAATGTGGTGAGGCTATTTATTCCCCCAGTGCCTTCCCTGC
TGGGCTATGGATGAACAGTGGCTGACTTCATCTAGGAAAGAGCTATGGCTICTGTCT
CCTGGAGCTCACCA 3'
UC Band # 302 (SEQ ID NO:3) Human Elongation Factor 1-alpha, GenBank Accession
#X03558
5 ' GGTGA GC C C CA GGAGACAGAAGAGATATGAGGAAATTGTTAA GGAAGTCAGCAC
TTACATTAAGAAAATTGGCTACAACCCCGACACAGTAGCATTTGTGCCAATTTCTGG
TTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAACATGCCTTGGTTCAAGGGAT
GGAAAGTCACCCGTAAGGATGGCAATGCCAGTGGAACCACGCTGCTTGAGGCTCTG
GACTGCATCCTACCACCAACTCGTCCAACTGACAAGCCCTTGCGCCTGCCTCTCCAA
GGATGTTCTTACAAAATTGGTGGTATTGGTACTGTTCCCTGTTTGGCCGAATTGGAA
AACTGGTGTTCCTCCAAACCCCGGTTATGGTGGGTTTCCTCCTCCTTGGA 3'
UC Band #325-1 (SEQ ID NO:4) Human IL-8 mRNA, GenBank Accession #Y00787
5' GGGCGGAACAAGGGAGCGCTAAAAGGAAATTAGGATGTCAGGTGCATAAAGGAC
ATAATTCCAAAACCTTTCCAAACCCCAAAMATTCAAAGGAACTGAGGAGTGGATT
GAGGAGTGGACCAACACTGGCGCCAAACACAGAAATTATTGTAAAGCTTTCTGATG
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
93
GAAGAGAGCTCTGTCTGGGCCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAG
TTTTTGAAGAGGGCTGAGAATTCATAAAAAAATTCATTCTCTGTGGTATCCAAGAAT
CAGTGAAGATGCCAGTGAAACTTCAAGCAAATCTACTTCAACACTTCATGTATTGTG
TGGGTCTGTTGTAGGGTTGCCAGTTGTT 3'
UC Band #325-2 (SEQ ID NO:5) Human IL-8 mRNA Containing Intron #3
5'GCTTGGGCCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAG
GTAAGTTATATATTTTTGAATTTAAAATTTGTCATTTATCCGTGAGACATATAATCCA
AAGTCAGCCTATAAATTTCTTTCTGTTGCTAAAAATCGTCATTAGGTATCTGCCTTTT
TGGTTAAAAAAAAAAGGAATAGCATCAATAGTGAGTGTGTTGTACTCATGACCAGA
AAGACCATACATAGTTTGCCCAGGAAATTCTGGGTTTAAGCTTGTGTCCTATACTCTT
AGTAAAGTTCTTTGTCACTCCCAGTAGTGTCCTATGTTAGATGATAATGTCTTTGATC
TCCCTATTTATAGTTGAGAATATAGAGCATGTCTAACACATGAATGTCAAAGACTAT
ATTGACTTTTCAAGAACCCTACTTTCCTTCTTATTAAACATAGCTCATCTTTATATTGT
GAATTTTATTTTAGGGCTGAGAATTCATAAAAAAATTCATTCTCTGTGGTATCCAAG
AATCAGTGAAGATGCCAGTGAAACTTCAAGCAAATCTACTTCAACACTTCATGTATT
GTGTGGGTCTGTTGTAGGGTTGCCA 3'
Example 5:
Detection and Differential Diagnosis of BPH versus Localized and
Advanced Stage Prostate Carcinomas Using
Combinations of IL-8 with Other Prostate Disease Markers.
A total of 164 serum specimens from normal men or men with a biopsy confirmed
diagnosis of BPH or prostate cancer were studied. These serum specimens were
provided by Dr.
George Wright from the Virginia Prostate Center at the Eastern Virginia
Medical School and by
Dr. Robert Vessella from the University of Washington or were normal donors
from UroCor,
Inc. All patients were biopsy-confirmed for either BPH or prostate carcinoma
(stages A, B, and
C only) within six months after PSA serum collection and/or a DRE-positive
diagnosis. All
patient sera were obtained prior to any surgical or hormonal therapies. The
mean age of the total
sample was 69.4 8.6 years (range = 37 - 91 years) old.
The subset of patients utilized for multivariate diagnostic serum model
consisted of 13
BPH and 64 CaP (Stages A, B, C) cases from the parent population (Marley et
al., 1996). All
patients in the subset had a total PSA between 2.0 - 20.0 ng/ml, which is a
standard range for f/t
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
94
PSA testing (Marley et al., 1996). Also evaluated were a subset of Stage D CaP
patients, with t-
PSA values ranging from 6.5 - 867 ng/ml.
Diagnosis N Mean Age Std. Dev. (Range)
Normal 8 <50 years
BPH 55 66.4 8.6 (37 - 87) years
CaP Stage A 24 74.7 7.8 (61 - 91) years
CaP Stage B 48 68.3 7.9 (51 - 85) years
CaP Stage C 14 68.9 6.9 (60 - 80) years
CaP Stage D 14 72.3 8.6 (58 - 86) years
Table 5 shows the distribution of the total PSA levels, the f/t PSA ratios,
and the UC325
levels for the 164 patients, broken down by normals, BPH, and Stages A, B, C,
& D prostate
cancer. Only the BPH, Stage A, Stage B, and Stage C prostate cancer patients
were included in
the statistical analysis.
TABLE 5
UC325 Patient Sample Characteristics (n = 164)
Mean Value Std. Dev.
UC325 Total PSA f/t PSA
Diagnosis N (Pgiml) (ng/ml) Ratio ("/0)
Normal 8 0.2 0.6 N/A N/A
BPH 55 6.8 6.1 6.9 4.0 21.9 10.9%
CaP Stage A 24 19.1 10.4 6.2 2.7 14.6 10.5%
CaP Stage B 48 13.5 9.5 8.8 6.6 11.9 5.7%
CaP Stage C 15 19.1 7.9 16.2 7.6 11.2 8.3
CaP State D 14 78.9 197 244 332 12.4 7.1%
Table 6 illustrates the ability for f/t PSA ratio at three different cutoffs
to differentiate
prostate cancer and BPH in the inventors' patient sample. UC325 (IL-8) and t-
PSA are analyzed
at single Classification and Regression Tree (CART) cutoff points for the same
outcome. Note
the significant improvement in both sensitivity and specificity contributed by
the UC325 (IL-8)
serum assay to detect clinically organ confined. The combination of UC325 (IL-
8), treated as a
continuous variable, and t-PSA or f/t PSA ratio provides a highly predictive
multivariate test
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
system to diagnose CaP (clinical stages A & B) without any interference
provided by BPH in the
inventors' patient subset.
TABLE 6
- 5 Ability of Serum Tests to Discriminate BPH and CaP.
Serum Test Cutoff Sensitivity Specificity AUC p-
value
f/t PSA Ratio 11% 52.9% 91.9% 0.7905
<0.0001
14% 70.1% 80.0 /III It
It
1111 20% 85.1 47.3 /I 11
UC325 9.8 pg/ml 72.4% 74.5% 0.7973
<0.0001
Total PSA 14.8 ng/ml 17.2% 98.2% 0.5995
0.0134
f/t PSA & UC325 0.69** 71.3% 90.9% 0.8784
<0.0001
Total PSA & UC325 0.64** 62.1% 85.5% 0.8069
<0.0001
*All cutoffs determined using Classification and Regression Tree Analysis
(CART)
**Predicated Probability value calculated using logistic regression function
To further substantiate the results of Table 6, individual analysis using
Receiver Operator
10 Characteristic (ROC) curves are provided for each variable. Figure 2
illustrates the ability of t-
PSA to distinguish BPH and Stages A, B, and C prostate cancer. Figure 3 shows
the ability of f/t
PSA ratio to distinguish BPH and Stages A, B, and C prostate cancer. Figure 4
shows the ability
of UC325 (IL-8) alone to distinguish BPH and Stages A, B, and C prostate
cancer. Figure 5
shows the ability of the combination of UC325 (IL-8) and total PSA (t-PSA) to
distinguish BPH
15 and Stages A, B and C prostate cancer. Figure 6 shows the ability of the
combination of UC325
(IL-8) and the f/t PSA ratio to distinguish between BPH and stages A, B and C
prostate cancer.
It is apparent that the combination of UC325 measurement with either t-PSA or
f/T PSA
provides a significant increase in sensitivity of detection, while maintaining
a high degree of
specificity. Thus, the combination of UC325 (IL-8) with other prostate disease
markers, such as
20 t-PSA or f/t PSA ratio, provides a significant advance in the detection
and differential diagnosis
of prostate cancer.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
96
Table 7 presents the correlation values for the different serum markers. This
table clearly
shows that the UC325 biomarker provides information which is independent of
that provided by
the f/t PSA ratio.
TABLE 7
Correlation Values for BPH vs Stages A, B & C (n = 142)
Diagnosis Total PSA f/t PSA UC325 Age
Clinical
(ng/m1) Ratio CYO (pg/ml) Stage
Diagnosis 1.0000 0.5647 -0.1912
0.2262 0.1590 0.3497
Total PSA
(ng/ml) 0.5647 1.000 -0.2319 0.5991
0.0898 0.3729
f/t PSA
Ratio (%) -0.1912 0.2319 1.0000 -0.2142
0.0641 -0.4126
UC325
(pg/ml) 0.2262 0.5991 0.2142 1.0000
0.0881 0.2486
Age 0.1590 0.0898 0.0641 0.0881
1.0000 0.1372
Clinical
Stage 0.3497 0.3729 -0.4126
0.2486 0.1372 1.0000
Table 8 clearly demonstrates *a relationship between tumor burden and serum UC-
325
gene product measured by IL-8 assay. Note that as biopsy-confirmed clinical
stage of the cancer
increases, so does the IL-8 serum marker concentration, whereas the same
relationship did not
occur with [t-PSA] or f/t PSA ratio.
TABLE 8
UC325 Culled Dataset, One High and Low Value Removed (n=164)
UC325 (10 pm/ml Cutoff) UC325 (15 pg/ml Cutoff)
Specimen
Stage N Negative Positive Negative
Positive
Normal 8 8 (100%) 0 (0%) 8
(100%) 0 (0%)
BPH 55 41(75%) 14 (25%) 50 (91%) 5 (9%)
Stage A & B 72 25 (35%) 47 (65%) 43
(60%) 29 (40%)
Stage C 15 0 (0%) 15 (100%) 5
(33%) 10 (67%)
Stage D 14 2 (14%) 12 (86%) 3 (21%)
11(79%)
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
97
Example 6:
Identification of Markers of Metastatic Prostate and Breast Cancer by Use of
RNA fingerprinting by PR primed with oligonucleotides of arbitrary sequence.
RNA fingerprinting displays PCRTM amplified cDNA fragments that represent a
sample
of RNA species derived from a population of total cell RNAs. When displayed
side by side,
comparisons of similarly produced fingerprints representing RNA populations
from cells of
differing physiologic states identifies mRNA species whose relative abundances
vary between
the examined physiologic states. In this study, RNA fingerprinting identified
two cDNA
fragments derived from mRNA species that had higher steady state abundances in
the peripheral
blood leukocytes of patients with recurrent metastatic prostate cancer as
compared to a group of
healthy volunteers.
Eight ml of peripheral blood was collected from healthy volunteers, patients
with
clinically and biopsy confirmed BPH, localized and advanced metastatic
prostate cancer, and
from patients with advanced metastatic breast cancer. Metastatic prostate and
breast cancer
patients that had failed a primary therapy and had evidence of recurrence of
disease were
selected. The metastatic prostate cancer patients had high (.?_ 50 ng/ml)
serum concentrations of
PSA. Circulating nucleated peripheral blood cells were separated from
erythrocytes by
centrifugation in Vacutainer CPTTm tubes (Becton Dickinson and Company,
Franklin Lakes, N
J). Total RNA was prepared from isolated nucleated peripheral blood cells by
lysis with RNA
Stat60TM (Tel-Test, Inc., Friendswood, TX) following the instructions provided
by the vendor.
Contaminating genomic DNA was removed from the total RNAs by digestion with
RNase free
DNasel (GIBCO-BRL, Gaithersburg, MD). For the PCRTM based applications of RNA
fingerprinting and relative quantitative RT-PCRTm, it is absolutely critical
that the total RNA is
completely free of genomic DNA. Typically, 5.0 to 10.0 [ig of total RNA was
digested with
20-40 units of RNase free DNasel in 100-200 ul of reaction volume for 20 min
at 37 C.
Following digestion, the total RNAs were extracted with phenol (pH=4.3,
Amresco, Inc.,
Solon, OH) and ethanol precipitated. To confirm that the RNA was free of
contaminating
genomic DNA, 500 ng to 1.0 1.1.g of each DNaseI treated RNA was resuspended in
water. These
were used as templates for PCRTM using oligonucleotide primers that anneal to
exons 3 and 4 of
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
98
the gene encoding PSA (exon 3: 5' OCCTCAGGCTGGGGCAGCATT 3' SEQ ID NO:22, exon
4: 5' GGTCACCTTCTGAGGGTGAACTTGC 3' SEQ ID NO:23). These primers anneal to
opposite strands of genomic DNA that flank the 145 bp intron 3 of the PSA
gene. PCRTM was
performed at 94 C for 1:15 min, followed by 40 cycles of 94 C for 45 sec, 55 C
for 45 sec, and
72 C for 1:15 min, then a final extension of 72 C for 5:00 min. RNA was
considered DNA-free
if no PCRTM products could be visualized upon gel electrophoresis that co-
migrated with the PSA
gene positive control of known human genomic DNA. If PSA gene products were
observed after
PCRTM, the RNA was redigested with DNaseI and analyzed again for contaminating
genomic
DNA. After it was confirmed that the RNAs were free of genomic DNA, 500 ng to
1.0 p.g of
RNA was electrophoresed on a 1.2% agarose Tris Acetate EDTA (TAE) to visualize
the
ribosomal RNAs (Fridell et al., 1995). Only RNA preparations for which the 28S
ribosomal
RNA could be visualized were selected for further analysis by RNA
fingerprinting and relative
quantitative RT-PCRTm.
RNA fingerprinting with arbitrarily chosen oligonucleotide primers (Welsh et
al., 1992)
is conceptually similar to differential display (Liang and Pardee, 1992),
except that
oligonucleotides of arbitrary sequence are used to prime both strands of cDNA
synthesis instead
of just second strand synthesis, as in differential display. In this
investigation, the strategy of
RNA fingerprinting used was similar to that described in Ralph et al. (1993)
except that
oligonucleotide primers used were composed of two discrete domains. The 5'
domain of these
oligonucleotides consisted of ten nucleotides that complemented sequences from
either the T7
promotor or the M13 reverse sequencing primer. The 3' domains of these
oligonucleotides were
8-mer sequences predicted to anneal frequently to the protein-coding regions
of mRNAs in a
permiscuous fashion (Lopez-Nieto and Nigam, 1996). These oligonucleotides were
then used in
a sequential pairwise strategy that optimizes the amount of mRNA complexity
that can be
surveyed with limited numbers of primers and starting RNA. Care was taken to
ensure that the
two oligonucleotides used to produce any single fingerprint did not share
sequence similarity in
either their 5' or 3' domains. Because these oligonucleotides were constructed
of short sequence
domains that have specific functions within this experimental design, the
oligonucleotides are
permiscuous rather than truly arbitrary in nature.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
99
Two RNA pools were fingerprinted. These two pools were each created by
combining
equal amounts of peripheral blood total RNA from five individuals. One pool
was constructed
by pooling RNA from five healthy individuals while the other pool was derived
from five
individuals with recurring metastatic prostate cancer. Using the pooled RNAs
as templates, first
strand cDNA synthesis was primed by annealing one of the permiscuous
oligonucleotide primers
to the pooled RNAs at low stringency. All fingerprinting studies were
performed in duplicate
using different initial concentrations of template RNA. The replicate
fingerprints were initiated
by using either 125 ng or 250 ng of RNA as template during first strand cDNA
synthesis.
Reaction conditions for first strand cDNA synthesis were 250 units of
SuperScript JJTM
(GIBCO-BRL Gaithersburg, MD) in 1X supplier' s reaction buffer (25 mM Tris-HC1
[p11=8.3],
37.5 mM KC1, 3.0 mM MgC12), 10 mM DTT, 400 pM each dNTP, and 2.0 p.M
permiscuous
oligonucleotide in a 40 pl volume. The latter was incubated for 1 h at 37 C.
Following first
strand cDNA synthesis, the RNA was digested with RNase H and heat inactivated
at 70 C as
directed by the supplier.
One-tenth (4.0 p.1) of the first strand cDNA reaction mixture was used in the
fingerprinting PCRTM reaction. As many as ten different RNA fingerprints were
generated from
each first strand cDNA reaction. To the first strand cDNA, 36 pl of a PCRTM
mix solution was
added. The latter contained 50 mM Tris-Cl (pH=8.3), 50 mM KC1, 200 !AM each
dNTP, 1.0/p,Ci
of a33 P-dCTP, 2.0 p,M second permiscuous oligonucleotide and 1.0 unit of
recombinant Taq
DNA polymerase (GIBCO-BRL, Gaithersburg, MD). Note that the concentration of
the first
oligonucleotide is now slightly less that 200 nM. PCRTM fingerprinting was
performed with one
cycle of 94 C for 2:00 min, 48 C for 5:00 min then 72 C for 5:00 min. This was
followed by 35
cycles of 94 C for 45 sec, 48 C for 1:30 min, and 72 C for 2:00 min. A final
extension step of
72 C for 5:00 was performed. Next, 4.0 1 of the final PCRTM products were
mixed with 6.0 p.1
of sequencing formamide dye solution and denatured by heating to 75 C for 5:00
min.
Approximately 2.5 p,1 of the denatured PCRTM products in formamide dye was
electrophoresed
through a 6% polyacrylamide, 7M urea DNA sequencing gel. PCRTM products were
visualized
by autoradiography.
The two differentially appearing PCRTM amplified cDNA fragments identified in
these
studies that are the subjects of this report were termed UC331 and UC332.
UC331 was
_
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
100
identified in a study in which the first permiscuous primer used in the
reverse transcription
reaction had the sequence 5' ACGACTCACTATAAGCAGGA 3' (SEQ ID NO:24). The
second
permiscuous primer that was used in the PCRTM fingerprinting reaction that
identified UC331
was 5' AACAGCTATGACCATCGTGG 3' (SEQ ID NO:25). UC332 was identified in a study
in which the first permiscuous primer used in the reverse transcription
reaction had the sequence
5' ACGACTCACTATGTGGAGAA 3' (SEQ ID NO:26). The second permiscuous primer that
was used in the PCRTM fingerprinting reaction that identified UC332 was 5'
AACAGCTATGACCCTGAGGA 3' (SEQ ID NO:27). After autoradiography, bands that
appeared differentially in fingerprinting reactions on the pooled total RNAs
described above
were cut out of the gels and reamplified by PCRTM. The reamplified PCRTM
products were
directly sequenced using the SequenaseTM reagent system (Amersham Life
Sciences, Inc.,
Arlington Heights, IL.).
The sequences of UC331 and UC332 were compared to those deposited in release
101 of
GenBank (July 1997) using the LasergeneTM software package (DNAstar, Inc.,
Madison, WI).
The DNA sequence of these cDNA fragments, when compared to the GenBank
database,
revealed that the mRNAs, from which these cDNA fragments were derived, were
previously
uncharacterized. Neither UC331 nor UC332 are genes whose products have been
previously
characterized as being significant in any physiological pathway, both UC33 1
and UC332 match
sequences on the GenBank data base.
In the case of UC331, these matches are confined to ESTs. UC331 was identical
within
the limits of sequencing accuracy to several human EST sequences. The human
EST sequences
with high similarity to UC331 could be assembled into a virtual contig that
predicts the sequence
of a larger mRNA. The ends of the UC331 contig were then used to requery the
EST data base
whereby more ESTs were identified that extended the contig. This process was
continued until
the UC331 contig predicted a mRNA with an ORF and a poly-A tail. A description
of the
human ESTs that were used to construct the UC331 contig are provided in Table
9. The
sequence of the UC331 contig and the ORF was identified at its 5' end. A
significant feature of
this contig is that the ORF extends all the way to its 5' end. This indicates
that the UC33 1
mRNA extends further 5' than is indicated by the contig constructed from the
EST database.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
101
TABLE 9
UC331 EST Distribution
Human
GB Accession Number Tissue Library
AA403120 Total Fetus Soares
AA401845 Total Fetus Soares
AA121473 Pregnant Uterus Soares
AA121262 Pregnant Uterus Soares
R221451 Placenta Soares
R22146 Placenta Soares
R30954' Placenta Soares
R31006' Placenta Soares
R32887h Placenta Soares
R31390h Placenta Soares
R67806g Placenta Soares
R67807g Placenta Soares
AA385620 Thyroid TIGR
W37985 Parathyroid Tumor Soares
W37986 Parathyroid Tumor Soares
AA380401 Cell line (Supt) TIGR
AA182471 Cell line (HeLa) Stratagene
(IMAGE)
AA181530 Cell line (Hela) Stratagene
(IMAGE)
W31231 Senescent Fibroblasts Soares
N22701 Normal Melanocyte Soares
N31175 Normal Melanocyte Soares
N34446 Normal Melanocyte Soares
N34538 Normal Melanocyte Soares
N36424 Normal Melanocyte Soares
N36521 Normal Melanocyte Soares
N42854 Normal Melanocyte Soares
N44299 Normal Melanocyte Soares
,
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
102
GB Accession Number Tissue Library
W56398 Normal Melanocyte Soares
N66813 Normal Melanocyte Soares
AA379996 Skin Tumor TIGR
AA370040 Prostate Gland TIGR
AA369851 Prostate Gland TIGR
H08822k Brain (Whole infant) Soares
H08905k Brain (Whole infant) Soares
H19533 Brain (Whole Adult) Soares
H21379f Brain (Whole Adult) Soares
H21421f Brain (Whole Adult) Soares
H24360e Brain (Whole Adult) Soares
H25176e Brain (Whole Adult) Soares
H38689 Brain (Whole Adult) Soares
H38791 Brain (Whole Adult) Soares
H39147d
Brain (Whole Adult) Soares
H39148d
Brain (Whole Adult) Soares
H45092c Brain (Whole Adult) Soares
H45054e Brain (Whole Adult) Soares
H49928 Brain (Whole Adult) Soares
H50463 Brain (Whole Adult) Soares
H51403a Brain (Whole Adult) Soares
H51444a Brain (Whole Adult) Soares
H52811b
Brain (Whole Adult) Soares
H52774b
Brain (Whole Adult) Soares
R85542 Brain (Whole Adult) Soares
R84652 Brain (Whole Adult) Soares
AA324855 Brain (Cerebellum) TIGR
AA317211 Retina TIGR
AA371911 Pituitary Gland TIGR
AA302113 Endothelial Cells, Aorta TIGR
AA247643 Fetal Heart U. Toronto
W60049 Fetal Heart Soares
W61359 Fetal Heart Soares
r- 1 .
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
103
GB Accession Number Tissue Library
AA243511 B-Cells Soares
AA234769 Pooled; fetal heart, melanocytes, pregnant uterus
Soares
AA 158239 Pancreas Stratagene
(IMAGE)
AA 150565 Pancreas Stratagene
(IMAGE)
AA 160836 Pancreas Stratagene
(IMAGE)
H73822 Fetal Liver Spleen Soares
N58180 Fetal Liver Spleen Soares
W04414 Fetal Liver Spleen Soares
N94254 Fetal Liver Spleen Soares
N75996 Fetal Liver Spleen Soares
N69644 Fetal Liver Spleen Soares
183329 Fetal Liver Spleen Soares
172755 Fetal Liver Spleen Soares
153976 Pooled Fetal Spleens Soares
N76701 Multiple Sclerosis Soares
N90814 Multiple Sclerosis Soares
N63292 Multiple Sclerosis Soares
N59233 Multiple Sclerosis Soares
N53207 Multiple Sclerosis Soares
N51545 Multiple Sclerosis Soares
F22624 Skeletal Muscle. CRIB! (Italy)
Note:Paired superscripts indicate opposite ends of the same cDNA clone.
When the human UC331 contig was used to query the GenBank database many mouse
EST sequences were identified with significant similarity. This was especially
true in the region
spanning the putative ORE. The identified mouse ESTs were found to have areas
of overlap and
similarity with each other that permitted them to be assembled into a mouse
UC331 virtual
_
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
104
contig in a process that was identical to that used to create the human
contig. The mouse UC331
virtual contig was also observed to have an ORF at its 5' end and a poly-A
tail at its 3' end. A
description of the mouse ESTs that were used to construct this contig are
provided in Table 10.
TABLE 10
Mouse
GB Accession Number Tissue Library Clone #
AA027487 Placenta Soares 459407 (5')
AA023708 Placenta Soares 456984 (5')
AA023154 Placenta Soares 456027 (5')
AA024303 Placenta Soares 458313 (5')
W35948 Total Fetus Soares 350258 (5')
W 11581 Total Fetus Soares 318665 (5')
W36820 Total Fetus Soares 336707 (5')
AA002492 Mouse Embryo Soares 426498 (5')
AA097370 Mouse Embryo Soares 493073 (5')
AA014313 Mouse Embryo Soares 468491 (5')
AA450512 Beddington embryonic region IMAGE 865186 (5')
AA4081791- Embryo Ectoplacental Cone Ko
C0025F09 (3')
AA4082611 Embryo Ectoplacental Cone Ko
C0025F09 (5')
AA117174 T-cells Stratagene 558134 (5')
AA119346 Thymus Soares 573567 (5')
AA183195 Lymph Node Soares 636222 (5')
AA122933 Kidney Barstead 579415 (5')
AA423613 Mammary Gland Soares 832219 (5')
Note:Paired superscripts indicate opposite ends of the same cDNA clone.
When the MegAlignTM program of the LasergeneTM DNA analysis software package
(DNAstar, Inc.) was used to compare the mouse and human UC331 contigs, the two
contigs were
predicted to represent mRNA species that were highly similar and nearly
collinear throughout
their lengths. This similarity was most striking in the region comprising the
putative ORFs.
Within the ORFs the mouse and human contigs, the DNA sequences are 89%
identical. In the
=
CA 02273847 2006-01-11
WO 98124935
PCT/US97/22105
105
predicted 3' untranslated regions of the two contigs, the DNA sequence
similarity falls to 73%
with several small deletions and insertions. This higher degree of sequence
similarity in the
putative ORFs as compared to the proposed 3' untranslated region is
interpreted as evidence that
the ORFs encode proteins on which natural selection constrains amino acid
sequence divergence.
Like the human UC33 1 contig, the mouse contig also encodes a putative ORF
that extends all the
way to its 5' end. This provides additional support for the contention that
the UC331 mRNA
contains more sequences at its 5' end than are represented by the EST based
contigs presented
here.
The ORFs of the mouse and human UC33 1 contigs were conceptually translated
and the
amino acid sequences were compared. The amino acid sequence of the human UC331
ORF was
used to query the Swiss, FIR and Translation release 101 using the LasergeneTM
software
package. For the 157 amino acids for which this comparison is possible, the
mouse and human
sequences are collinear and identical at 151 positions (96%) with five of the
six differences being
conservative substitutions. This putative protein domain is highly acidic with
26 acidic and 17
basic amino acids. There were also 48 hydrophobic and 41 polar amino acids
predicted. When
either the predicted mouse or human UC331 amino acid sequences was compared to
amino acid
sequences in the public protein sequence data bases, no significant matches
were found to any
previously characterized vertebrate proteins. However, a significant match was
observed to a
putative protein, termed ZK353.1 (PIR Accession number S44654), encoded in the
genome of
the nematode. Caenorhabditis elegans. The mammalian amino acid sequence is
similar and
collinear with the C-terminal 157 amino acids of the putative C. elegans
protein. Like the
mammalian UC331 amino acid sequences, the C-terminal 157 amino acid sequence
of the
ZK353.1 is also highly acidic with 31 acidic and only 20 basic amino acids.
Over the 203 amino
acids for which a comparison can be made the ZK353.1 amino acid sequence is
identical to the
human or mouse sequence at 84 (41%) positions with many of the differences
representing
conservative substitutions.
The putative C elegans protein, ZK353.1, has no currently known function. Its
existence
is predicted from the C. elegans genome sequencing effort (Sulston et aL,
1992). The
polypeptide sequence for ZK353.1 is a conceptual translation of an area on the
C. elegans
chromosome III (FIR Accession Number 544654), The predicted sequence for
Z1(353.1 is
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
106
548 amino acids long and includes an additional 371 amino acids that are N-
terminal of the
domain with similarity to the predicted amino acid sequence of UC331. If UC331
is the
mammalian homolog of ZK353.1 and if UC331 is collinear with the C. elegans
protein over its
entire length, it could be expected that the ORF of UC33 1 would extend
roughly an additional
1100 nucleotides 5' of the sequence in SEQ ID NO:29. While it is likely that
the UC331 ORF
extends further 5' than is accounted for in the virtual mouse and human UC331
contigs, Northern
blot data from human poly-A plus RNA discussed below indicates that the human
UC331
mRNA extends only about 350 nucleotides further 5'. This may indicate an error
in interpreting
the possible pattern of 'mRNA processing from the C. elegans sequence or
indicate simply that
the mammalian and nematode mRNAs and encoded proteins are significantly
different from each
other at their 5' and N-terminal ends respectively.
To confirm that the human UC33 1 virtual contig accurately represented the
sequence of
an authentic mRNA, oligonucleotides were designed to direct the PCRTM
amplification of large
cDNA fragments predicted to be continuous from the virtual contig but which
contain
significantly more sequence than can be found in any single EST.
UC332 did not match any EST sequences but was identical to a portion of a
previously
sequenced full length cDNA with a GenBank accession number of D87451.
RELATIVE QUANTITATIVE RT-PCRTm
Frequently, mRNAs identified by RNA fingerprinting or differential display as
being
differentially regulated turn out not to be so when examined by independent
means. It is,
therefore, critical that the differential expression of all mRNAs identified
by RNA fingerprinting
be confirmed as such by an independent methodology. To independently confirm
the differential
expression of UC33 I in the peripheral blood of patients with recurrent
metastatic cancer
compared to the peripheral blood of healthy volunteers, two different formats
for a relative
quantitative RT-PCRTm were performed. The first format of this assay examined
normalized
pools of cDNA constructed by combining equal amounts of cDNA from various
individuals
representing similar physiologic states. In this study, a cDNA pool
representing 8 healthy
volunteers was compared to a pool representing 10 individuals with recurrent
metastatic prostate
cancer. A third pool representing 10 individuals with recurrent metastatic
breast cancer was also
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
107
examined. The inclusion of the breast cancer patient samples in this study was
made to
determine if the mRNAs examined were being differentially regulated in the
immune system in a
response that was specific for prostate cancer or if the response was more
general to metastatic
cancer in general. Using these pools of cDNA as templates, triplicate PCRTM
was performed.
Each of the three replicates were terminated at a different cycle number of
PCRTM. This format
of relative quantitative RT-PCRTm insures that the results taken for relative
quantitation represent
the PCRsTM when they are in the log linear portions of their amplification
curves where such
quantitation is most accurate.
Approximately 1.5-5.0 1.i.g of DNA-free total RNA from the peripheral blood of
healthy
volunteers or patients with either metastatic prostate or breast cancer were
converted into first
strand cDNA using the SuperScripirm Preamplification System for First Strand
cDNA Synthesis
(GIBCO-BRL, Cat# 18089-011) following the directions provided by the supplier.
These
cDNAs were then normalized to contain equal concentrations of amplifiable cDNA
by PCRTM
amplification of 13-actin cDNA using the primers 5' GGAGCTGCCTGACGGCCAGGTCATC
3'
(SEQ ID NO:28) and 5' GAAGCATTTGCGGTGGACGATGGAG 3' (SEQ ID NO:9). A
typical PCRTM program would be 94 C for 1:15 min, followed by 22 cycles of 94
C for 45 sec,
55 C for 45 sec and 72 C for 1:15 min. This was followed by final extension of
72 C for 5:00
min. PCRTM products were visualized by gel electrophoresis through 1.5%
agarose TAE gels
stained with ethidium bromide. Images of the gels were captured, digitized and
analyzed using
the IS-1000 Digital Imaging System (Alpha Innotech Corp.). The concentrations
of the cDNAs
were adjusted by adding various amounts of water to create cDNA stocks that
contained equal
concentrations of amplifiable 13-actin cDNA. Typically, the cDNA derived from
the reverse
transcription of 5.0 jig of RNA resulted in enough normalized cDNA to perform
50-200
RT-PCRTm reactions.
Equal amounts of the normalized cDNA stock from individuals having the same
disease
state were pooled. Pools of cDNAs from healthy volunteers, patients with
metastatic prostate
cancer and metastatic breast cancer were produced. These pools were then
examined by PCRTM
for I3-actin to determine that they contained equal amounts of amplifiable
cDNA.
To demonstrate that all observations were made in the log-linear phase of the
PCRTM
amplification curve, a series of PCRTM reactions using different cycle number
were performed on
_
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
108
each cDNA pool for each gene (primer pair) examined. Display of the PCRTM
products on
electrophoretic gels and analysis with the IS 1000 Digital Imaging System
illustrates that the
mass of the PCRTM products is increased exponentially with increasing cycle
number, confirming
that the observed results are in the log-linear portion of the PCRTM
amplification curve.
Relative quantitative RT-PCRTm showing near equal amounts of amplifiable 13-
actin
cDNA in three pools cDNA. Pools of normalized cDNAs were constructed from
peripheral
blood RNAs from eight healthy volunteers, ten individuals with recurrent
metastatic prostate
cancer, or ten individuals with recurrent metastatic breast cancer.
Three separate PCRTM
reactions were performed on each pool of cDNA. PCRTM was terminated at
differing cycle
numbers (cycle 22, cycle 24, and cycle 26), and the products were visualized
by electrophoreses
and ethidiumn bromide staining. Images were captured and quantitated using a
digital image
analysis system. At all three cycle numbers examined, there are relatively
similar band
intensities representing the three cDNA pools and increasing band intensity
with increasing cycle
number, verifying that the observations are being made in the log linear range
of the
amplification curves. Similar band intensities indicate similar relative
concentrations of [3-actin
mRNA in the RNAs from individuals from which these cDNA pools were
constructed.
The oligonucleotides used in the relative quantitative RT-PCRTm studies that
independently confirmed the differential expression of UC331 were designed
from the sequence
in the human UC331 virtual contig. These UC331 specific oligonucleotides had
the sequences of
5' CTGGCCTACGGAAGATACGACAC 3' (SEQ ID NO:31) and 5'
ACAATCCGGAGGCATCAGAAACT 3' (SEQ ID NO:32). These oligonucleotides direct the
amplification of a 277 nucleotide long PCRTM product that is specific for
UC331. The
oligonucleotides used in the relative quantitative RT-PCRTm studies that
independently
confirmed the differential expression of UC332 were designed using the
sequences of the cDNA
with the GenBank accession number D87451. These UC332 specific
oligonucleotides had the
sequences 5' AGCCCCGGCCTCCTCGTCCTC 3' (SEQ ID NO:33) and 5'
GGCGGCGGCAGCGGTTCTC 3' (SEQ ID NO:34). These oligonucleotides direct the
amplification of a 140 nucleotide long PCRTM product that is specific for
UC332.
The results for relative levels of 13-actin expression contrasts sharply with
those observed
when oligonucleotide primers specific for UC331 were used to direct PCRTM
amplification (FIG.
1
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
109
7). At 25 cycles of PCRTM, clear bands are visible in the lanes representing
the pools of cDNA
from peripheral blood of patients with either metastatic breast or prostate
cancer. In the lane
representing the peripheral blood of healthy volunteers, only a very faint
band is present. At 28
cycles of PCRTM, the band intensities representing all three pools are
brighter than they were at
25 cycles, but the relative increase in intensity of the bands representing
the metastatic cancer
patient pools compared to the healthy volunteers remains the same as was
observed at 25 cycles
of PCRTM. This indicates that these observations are being made in the log
linear range of the
PCRTM amplification curves. At 31 cycles of PCRTM, there is still an increase
in the intensity of
the bands representing the pools of metastatic cancer patients compared to the
pool representing
the healthy volunteers, but a quantitative analysis of these bands indicates
that the PCR5TM have
left the log linear range of their amplification curves. Quantitation of the
data for 25 and 28
cycles of PCRTM independently confirms that UC331 mRNA is differentially
regulated and is
roughly seven fold more abundant in the peripheral blood leukocytes of the
average patient with
either recurrent metastatic prostate cancer or breast cancer than in the
peripheral blood
leukocytes of healthy volunteers.
The second format of relative quantitative RT-PCRTm used to examine the
differential
expression of UC331 examined the relative abundance of UC331 mRNA in the
peripheral blood
of healthy individuals or individuals with recurrent metastatic cancer. The
individuals examined
in this study were the same as those whose cDNAs were combined to construct
the pools
examined as described above. Using the information obtained from the pooled
cDNA study to
predict at what PCRTM cycle numbers relative quantitative RT-PCRTm would be
most
informative, these individuals were examined for the relative abundance of 13-
actin and UC331
mRNAs present in their peripheral blood leukocytes. PCRTM was for 22 cycles.
All individuals
examined contain roughly equal amounts of amplifiable 13-actin cDNA. Some of
the differences
in 13-actin band intensity observed in this study are probably due to the
internal variation inherent
of this study. Results from studies designed to quantitate this internal
variation indicate that
identical replicates of a 13-actin PCRTM can be expected to vary in the
intensity of product bands
with a standard deviation of 15%.
Relative quantitative RT-PCRTm of UC331 cDNA was conducted using reverse
transcribed from RNA isolated from the peripheral blood of eight healthy
volunteers (group N),
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
110
ten individuals with recurrent methstatic prostate cancer (group P), or ten
individuals with
recurrent metastatic breast cancer (group B). PCRTM was for 30 cycles. As was
seen in the study
using the pooled cDNAs, the results of the relative quantitative RT-PCRTm for
UC33 I using
cDNA from individuals contrasts sharply with that observed for 13-actin. The
intensity of the
band representing the abundance of the UC331 mRNA in peripheral blood
leukocytes was
greater for all of the patients with either metastatic prostate or breast
cancer as compared to the
intensity of the UC331 band representing the mRNA level in the peripheral
blood leukocytes of
healthy volunteers. Therefore, the elevated UC331 mRNA levels indicated by the
relative
quantitative RT-PCRTm results using the pooled cDNA templates was caused by an
elevated
mRNA level in all individuals comprising the pools and not from a subset of
individuals with
very high elevations in UC331 mRNA levels. This study is a second independent
confirmation
of the differential expression of the UC331 mRNA.
As is indicated by the wide distribution of tissues from which the ESTs used
to assemble
the UC331 contigs (Table 9), UC331 is widely expressed in many tissue and cell
types.
However, because most of ESTs comprising UC331 are from normalized libraries,
little
information can be gained from this data on the relative abundance of the
UC331 mRNA in
different tissues. Also, while the extension of the ORFs of the mouse and
human UC331 contigs
all the way to their 5' ends and the similarity of mammalian UC331 mRNAs to a
much larger
putative C. elegans mRNA both predict that the mammalian UC331 mRNA extends
even further
5', the exact size of the UC331 mRNA was unknown. To address all of these
issues, a Northern
blot of poly-A plus RNA from eight different human tissues was probed with the
850 nucleotide
long RT-PCRTm product described above labeled with 32P. Approximately 2.0 ptg
of poly-A plus
RNA from spleen, thymus, prostate, testis, ovary, small intestine, colon, and
peripheral blood
leukocytes were loaded in each lane. UC331 mRNA is expressed in all eight
human tissue and
cell types. Size standards indicate a message size of approximately 1.75 kb.
Interestingly,
UC331 is least abundant in peripheral blood leukocytes but is highly expressed
in the thymus,
demonstrating a difference in expression between cells of different
developmental stages in the
immune system. UC331 is most abundantly expressed in the testes. The UC331
mRNA is about
1.75 kb which indicated that the mRNA only extends about 350 nucleotides
further 5' than is
accounted for by the virtual contig shown in SEQ ID NO:29. The translation
product of the
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
111
virtual contig is shown in SEQ ID NO:30. Clearly, the putative C. elegans mRNA
extends much
more 5' than do the mammalian mRNA species.
The other gene identified as being differentially regulated in this RNA
fingerprinting
study was UC332. UC332 was analyzed in much the same way as UC331 was. When
the
sequence of the cDNA fragment from the RNA fingerprinting gel representing
UC332 was used
to query GenBank, no ESTs were identified. The sequence of the UC332 cDNA
fragment did,
however, identify a sequence of a full length cDNA, KA000262 (GB:accession
number
D87451). The sequence of KA000262, (hereafter referred to interchangeably with
the name,
UC332) was determined as part of a project to examine previously unidentified
mRNAs
expressed in the bone marrow myeloblast cell line, KG-1 (Nagase et aL, 1996).
This mRNA
contains an ORF encoding a putative protein with 761 amino acid sequence.
Perhaps the most
striking feature of this polypeptide sequence is the appearance of a C3HC4
RING zinc finger or
RING finger motif (Freemont, 1993) located between amino acids 175 and 216.
The RING
finger domain binds two zinc ions in a conserved structure that has been
resolved (Barlow et al.,
1994). RING finger domains have been identified in dozens of proteins derived
from eukaryotes
as diverse as yeasts, flies, birds, nematodes and humans. In most of these
cases, the RING finger
containing proteins have been shown to be essential for some important
biological process
although the these processes vary considerably one from another. Among these
mammalian
encoded RING finger proteins are several genes implicated in the ontogeny of
cancer including
the ret viral oncogene (Takahashi et al., 1988) and bmi-1, a gene whose
product collaborates
with myc induced transformation (Haupt et al., 1991). The BRCA-1 tumor
suppressor gene
involved in hereditary breast and ovarian cancer susceptibility contains a
RING finger domain
(Miki et al., 1994), and MAT-1, a novel 36 kDa RING finger protein, is
required for the
assembly of enzymatically active CDK7- cyclin H complexes (Tassan et al.,
1995). A
comparison of the RING finger domains of UC332 and various representative
members of this
group, including BRAC1, rpt-1, Traf5, HT2A, MAT!, rfp, bmi-1, CRZF, and neu,
indicates the
RING finger domain of UC332 is slightly more similar to those found in the
tumor suppressor
gene, BRCA1, and the T cell repressor of transcription protein, rpt-1.
However, BRCA1 and
rpt-1 are more similar to each other than they are to UC332.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
112
Proteins with RING finger motifs exhibit heterogeneity in their subcelluar
localizations.
Some, that are important regulators of differential gene regulation, localize
to the cell nucleus.
When the amino acid sequence of UC332 was scanned for evidence of subcellular
localization,
two domains were identified that contained sequences for putative nuclear
localization signals
(NLS). NLS are highly basic stretches of six are more amino acids of which at
least four are
basic that tend to be flanked by acidic amino acids and/or prolines (Boulikas,
1994). Both of the
putative NLS in UC332 longer and more basic than the minimum requirements for
the consensus
NLS motif. The first of these putative NLS motifs occurs between amino acid
548 and 567.
Within this domain, 13 of 19 amino acids are basic. In fact, this domain could
be viewed as two
NLS in tandem separated by two glutamic acid residues. If divided this way,
the first NLS
domain would have 8 of eleven positions as basic amino acids while the second
motif would
have 5 of 6 amino acids being basic. The second NLS motif in UC332 is located
near the
C-terminal end between positions 739 and 750 in the amino acid sequence. This
domain has 8 of
12 amino acids as basic residues with a core of 5 consecutive lysines and
arginines. The
presence of these putative NLS in the amino acid sequence of UC332 suggest the
possibility that
UC332 plays an important role in regulating the expression of other genes.
Finally, the amino
acid sequence of UC332 lacks a signal sequence for cellular export or an
obvious hydrophobic
transmembrane domains.
To independently verify that UC332 mRNA is more abundant in the peripheral
blood
leukocytes of patients with recurrent metastatic cancer as compared to the
peripheral blood
leukocytes of healthy volunteers, relative quantitative RT-PCRTm was performed
using the same
cDNAs and formats as were used to investigate the differential regulation of
UC331. A relative
quantitative RT-PCRTm study using UC332 specific oligonucleotide primers and
cDNA pools as
templates was conducted. At 25 and 28 cycles of PCRTM, the amplified DNA band
representing
the relative abundance of the UC332 mRNA is stained more intensely for those
reactions that
used cDNA template pools constructed from the peripheral blood leukocyte RNA
isolated from
metastatic prostate and breast cancer patients as compared to a similar pool
constructed from
RNA from healthy volunteers. Quantitation of this image using the IS-1000
Digital Imaging
System (Alpha Innotech, Inc.) indicates that UC332 mRNA is roughly 5 times
more abundant in
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
113
the peripheral blood leukocytes of metastatic cancer patients compared to
healthy volunteers. At
31 cycles of PCRTM, the reactions have left the log linear range of their
amplification curves.
In a second relative quantitative RT-PCRTm study using UC332 specific
oligonucleotide
primers, peripheral blood leukocyte cDNA from the individuals that comprised
the pools from
the peripheral blood of eight healthy volunteers, ten individuals with
recurrent metastatic prostate
cancer, or ten individuals with recurrent metastatic breast cancer were
examined separately.
PCRTM was for 26 cycles. The results of this study are similar to those
obtained when the pooled
cDNAs were used as PCRTM templates. All of the cancer patients had higher
levels of UC332
mRNA in their peripheral blood leukocytes than did any of the healthy
volunteers.
In this study, the inventors showed that UC332, encoding a RING finger
protein, is up
regulated in the peripheral blood leukocytes of patients with either recurrent
metastatic breast or
prostate cancer. From the literature, RING finger proteins have been shown to
participate in the
regulation of several important lymphocytic processes (Patarca et al., 1988;
Fridell et al., 1995;
Takeuchi et al., 1996; van Arsdale et al., 1997; Nakano et al., 1996). The
observed differential
regulation of the RING protein encoding mRNA, UC332, in the immune response of
patients
with metastatic breast or prostate cancer strongly suggests that UC332
participates in regulating
.this immune response.
All of the compositions and methods disclosed and claimed herein may be made
and
executed without undue experimentation in light of the present disclosure.
While the compositions
and methods of this disclosure have been described in terms of preferred
embodiments, it is
apparent that variations may be applied to the composition, methods and in the
steps or in the
sequence of steps of the method described herein without departing from the
concept, spirit and
scope of the invention.
More specifically, it is apparent that certain agents which are both
chemically and
physiologically related may be substituted for the agents described herein
while the same or similar
results would be achieved. All such similar substitutes and modifications
apparent to those skilled
in the art are deemed to be within the spirit, scope and concept of the
disclosure as defined by the
appended claims.
UC325-1 is derived from the IL-8 gene (Genebank Accession #M28130). UC325-1
and
UC325-2, an alternatively spliced form that includes the third intron of the
IL-8 primary transcript,
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
114
are transcribed from the IL-8 gene. Our definition of IL-8 gene products means
all mRNAs
transcribed from the IL-8 gene, the polypeptides encoded by those mRNAs and
their post-
translationally processed protein products.
Those practiced in the art will realize that there exists naturally occurring
genetic
variation between individuals. As a result, some individuals may synthesize IL-
8 gene products
that differ from those described by the sequences entailed in the Genebank
number listed above.
We include in our definition of IL-8, those products encoded by IL-8 genes
that vary in sequence
from those described above. Those practiced in the art will realize that
modest variations in DNA
sequence will not significantly obscure the identity of a gene product as
being derived from the
IL-8 gene.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
115
REFERENCES
The following references, to the extent that they provide exemplary procedural
or other
details supplementary to those set forth herein, are specifically incorporated
herein by reference.
Abbondanzo et al., Breast Cancer Res. Treat., 16: 182(4151), 1990.
Adams et al., 1995.
Adams, Kelley, Gocayne, Dubnick, Polymeropoulos, Xiao, Merril, Wu, Olde,
Moreno,
Kerlavage, McCombie, Venter, "Complementary DNA sequencing: Expressed sequence
tags and he human genome," Science, 252:1651-1656, 1991.
Adams, Kerlavage, Fleischmann, Fuldner, et al., "Initial assessment of the
human gene diversity
and expression patterns based upon 83 million nucleotides of cDNA sequence,"
Nature
377: Supplement: The Genome Directory, pages 3-174.
Alcaraz et al., Cancer Res., 55:3998-4002, 1994.
Allred et al., Breast Cancer Res. Treat., 16:182(#149), 1990.
An etal., Proc. Amer. Assn. Canc. Res., 36:82, 1995.
Andrawis et aL, Proc. Am. (Ira Assn. 155(5): 512A, 1996.
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor Press,
Cold Spring Harbor, New York, 1988.
Barinaga, Science, 271: 1233, 1996.
Barlow, Luisi, Milner, Elliott, Everett, "Structure of the C3HC4 Domain by H-
nuclear Magnetic
Resonance Spectroscopy," J. MoL Biol., 237:201-211, 1994.
Barry et al., Urology, 46:2-14, 1995.
Beck, Kaftan and Miles, J. Urol., 152:1894-99, 1994.
Bellus,J. MacromoL Sci. Pure App!. Chem, A31(1): 1355-1376, 1994.
Bittner et al., Methods in Enzymol, 153: 516-544, 1987.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
116
Bookstein et al., Proc. Nat' I Acad. Sci. USA, 87:7762-7767, 1990b.
Bookstein et al., Science, 247:712-715, 1990a.
Boring et al., CA-Cancer J. Piaci., 43:7-26, 1993.
Boulikas, "Putative nuclear localization signals (NLS) in protein
transcription factors," J. Cell.
BioL , 55:32-58, 1994.
Bova et al., Cancer Res., 53:3869-3873,1993.
Brawn et al., The Prostate, 28: 295-299, 1996.
Breiman et al., "Classification and Regression Trees," Pacific Grove:
Wadsworth, 1984.
Brown et at , Breast Cancer Res. Treat., 16:192(#191), 1990.
Campbell, In: Monoclonal Antibody Technology, Laboratory Techniques in
Biochemistry and
Molecular Biology, Burden and Von Knippenberg, Eds., Vol. 13:75-83, Elsevier,
Amsterdam, 1984.
"Cancer facts and figures-1997," American Cancer Society Surveillance
Research, Pp. 4-5, 1997.
Capaldi et al., Biochem. Biophys. Res. Comm., 76: 425, 1977
Carter and Coffey, In: Prostate Cancer: The Second Tokyo Symposium, J.P. Karr
and H. Yamanak
(eds.), pp. 19-27, New York: Elsevier, 1989.
Carter and Coffey, Prostate, 16:39-48, 1990.
Carter et al., Proc. Nat Acad Sci. USA 93: 749-753, 1996.
Carter et al., Proc. Nati I Acad. Sci. USA, 87:8751-8755,1990.
Catalona et al., J. UroL, 151:1283-1290, 1994.
Catalona etal., J.A.M.A., 274:1214, 1995.
Chen et al., Clin. Chem., 41:273-282, 1995.
Chen et al., Proc. Am. UroL Assn., 153:267A, 1995.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
117
Chinault and Carbon, Gene, 5:111-126, 1979.
Chomczynski and Sacchi, Anal. Biochem., 162: 156-159, 1987.
Christensson et al., J. UroL, 150:100-105, 1993.
Colberre-Garapin et Mol. Biol., 150: 1, 1981.
Damaj etal., FASEB J. 10: 1426-1434,1996.
Davey et aL, EPO No. 329 822.
Dbom, J. Cancer Res. Clin. OncoL, 106:210-218,1983.
di Celle et al., Blood, 84: 220-228, 1994.
Diamond et al., J. UroL, 128: 729-734, 1982.
Donahue et al., Biol. Chem., 269:8604-8609,1994.
Dong et al., Science, 268: 884-886, 1995.
Dugan et al., J.A.M.A., 275(4):288-294, 1996.
Dumont et al., I ImmunoL, 152:992-1003,1994.
Everett, O'Hara, O'Rourke, Barlow, On, "Point mutations in the herpes simplex
virus type 1
Vmwl 10 RING finger helix affect activation of gene expression, viral growth,
and
interaction with PML-containing nuclear structures," J. Virology, 69:7339-
7344, 1995.
Freemont, "The RING finger: A novel protein sequence motif related to the zinc
finger," Ann.
N.Y. Acad. Sci., 684:174-192, 1993.
Freifelder, Physical Biochemistry Applications to Biochemistry and Molecular
Biology, 2nd ed.,
Wm. Freeman and Co., New York, NY, 1982.
Fridell, Harding, Bogerd, Cullen, "Identification of a novel human zinc finger
protein that
specifically interacts with the activation domain of lentiviral Tat proteins,"
Virology,
209:347-357.1995.
Frohlich et al., Molec. Cell. Biol., 10:3216-3223,1990.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
118
Frohman, PCR PROTOCOLS.. A GUIDE TO METHODS AND APPLICATIONS, Academic Press,
N.Y., 1990.
Fujichima et al., Cytomeuy, 24:382-389, 1986.
Garnick, Scientific Amer. 270: 72-81, 1994.
Gefter et al., Somatic Cell Genet., 3: 231-236, 1977.
Gingeras et al., PCT Application WO 88/10315.
Goding, In: Monoclonal Antibodies.- Principles and Practice, 2d ed., Orlando,
Fla., Academic
Press, pp. 60-61, 65-66, 71-74, 1986.
Haupt, Alexander, Barn, Klinken, Adams, "Novel zinc finger gene implicated as
myc
collaborator by retrovirally accelerated lymphomagenesis in Ep.-myc transgenic
mice,"
Cell, 65:753-763, 1991.
Hedges etal., Cytokine 8:686-697, 1996.
Hess et al.,1 Adv. Enzyme Reg., 7:149,1968.
Heston, personal communication, CapCURE meeting, Lake Tahoe, CA, 1996.
Hitzeman et aL, J. Biol. Chem., 255:2073,1980.
Holland et al., Biochemistry, 17:4900, 1978.
Holmes etal., Prostate, 27:25-29, 1996.
Horoszewicz, Kawinski and Murphy, Anticancer Res., 7:927-936, 1987.
Hosmer and Lemeshow, In: Applied Logistic Regression, New York, John Wiley &
Sons, 1989.
Huang etal., Prostate, 23: 201-212, 1993.
Ikei et al., Cytokine 4: 581-584, 1992.
IMAGE ref.
Innis et al., PCR Protocols, Academic Press, Inc., San Diego CA, 1990.
= Inouye etal., Nucleic Acids Res., 13:3101-3109,1985.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
119
Isaacs et al., Cancer Res., 51:4716-4720, 1991.
Isaacs et al., Seminars in Oncology, 21:1-18, 1994.
Israeli et al., Cancer Research, 54:1807-1811, 1994.
Issacs Reference
Johnson et al., In: BIOTECHNOLOGY AND PHARMACY, Pezzuto et al., Eds., Chapman
and Hall,
New York, 1993.
Jones, Genetics, 85:12, 1977.
Kingsman et al., Gene, 7: 141, 1979.
Koch et al., Science, 258:1798-1801, 1992.
Kohler and Milstein, Eur. J. Immunol., 6: 511-519, 1976.
Kohler and Milstein, Nature, 256:495-497, 1975.
Kurdowska et al., .I Immunol., 154:1930-1940,1997.
Kwoh et al., Proc. Nat. Acad. Sci. USA, 86: 1173, 1989.
Liang and Pardee, "Differential display of eukaryotic messenger RNA by means
of polymerase
chain reaction," Science, 257:967-971.1992.
Liang and Pardee, Science, 257: 967-971, 1992.
Liang and Pardee, U.S. Patent 5,262,311, 1993.
Liang etal., Cancer Res., 52:6966-6968,1992.
Lifton, Science, 272: 676, 1996.
Lilja et at, Clin. Chem., 37:1618-1625, 1991.
Lopez-Nieto and Nigam, "Selective amplification of protein-coding regions of
large sets of genes
using statistically designed primer sets," Nature Biotechnology, 14:857-861,
1996.
Lowy et al., Cell, 22:817, 1980.
Macoska et al., Cancer Res., 54:3824-3830,1994.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
120
Marley etal., Urology, 48(6A):16-22, 1996.
McClelland et al, Nucl. Acids Res. 22: 4419-4431, 1994.
McCormack etal., Urology, 45:729-744, 1995.
Miki etal., Science, 266: 66-71, 1994.
Miki, Swensen, Shatmck-Eiden, Futreal, Harshman, Tavigian, Liu, Cochran,
Bennett, Ding, Bell,
Rosenthai, Hussey, Tran, McClure, Frye, Hattier, Phelps, Haugen-Strano,
Katcher,
Yakumo, Gholami, Shaffer, Stone, Bayer, Wray, Bogden, Dayananth, Ward, Tonin,
Narod, Bristow, Norris, Helvering, Morrison, Rosteck, Lie, Barrett, Lewis,
Neuhauses,
Cannon-Albright, Goldgar, Wiserman, Kamb, Skolnick, "A strong candidate for
the
breast and ovarian cancer susceptibility gene BRCA1," Science, 266: 66-71,
1994.
Miller et al., PCT Application WO 89/06700.
Mok al., Gynecol. Oncol, 52: 247-252, 1994.
Montie, Urology, 44: 2-8, 1994.
Morahan etal., Science 272: 1811, 1996.
Morise etal., Med. Dec. Making, 16(2):133-142, 1996.
Morton et al., Cancer Res., 53:3585-3590,1993.
Morton et al., In: CANCER MEDICINE (3rd Ed.), Holland, J.F., Frei III, E.,
Bast Jr., C.C. (eds),
Lea and Febiger, Philadelphia, PA, pp. 1793-1824, 1993.
Mulligan et al., Proc. Nat'l Acad. Sci. USA, 78:2072, 1981.
Murphy et al., Cancer, 78: 809-818, 1996.
Murphy etal., Prostate, 26:164-168, 1995.
Nagase, Seki, Ishikawa, Ohira, Kawarabayasi, Ohara, Tanaka, Kotani, Miyajima,
Nomura,
"Prediction of the coding sequences of unidentified human genes. VI. The
coding
sequences of 80 new genes (KIAA0201-KIAA0280) deduced by analysis of cDNA
clones from cell line KG-1 and brain," DNA Res., 3(5):321-329, 1996.
-r-
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
121
Nakamura et al., In: Handbook of Experimental Immunology (4th Ed.), Weir, E.,
Herzenberg, L.A.,
Blackwell, C., Herzenberg, L. (eds), Vol. 1, Chapter 27, Blackwell Scientific
Pub!., Oxford,
1987.
Nakano, Oshima, Chung, Williams-Abbott, Wares, Yagita, Okumura, "TRAF5, an
activator of
NF-KB an putative signal transducer for lymphotoxin-P receptor," J Biol.
Chem.,
271:14661-14664, 1996.
O'Hare et al., Proc. Nat'l Acad. Sci. USA, 78:1527, 1981.
Oesterling et al., J. Urol., 154:1090-1095, 1995.
Oesterling, Contemporary Urology, 8:76-92, 1996.
Ohara et at, Proc. Nat'l Acad. Sci. USA, 86:5673-5677,1989.
Papsidero etal., Cancer Research, 40:2428-2432, 1980.
Parker et al., CA Cancer J. Clin., 65:5-27, 1996.
Parker, Tong, Bolden, Wingo, "Cancer statistics," CA Cancer J. Clin., 65:5-27,
1996.
Partin and Oesterling, (Eds.) Urology, 48(6A) supplement: 1-87, 1996.
Partin and Oesterling, I UroL, 152:1358-1368, 1994.
Partin etal., Cancer Res., 53:744-746,1993.
Patarca, Scwartz, Singh, Kong, Murphy, Anderson, Sheng, Singh, Johnson,
Guamagia, Durfee,
Blattner, Cantor, "rpt-1, an intracellular protein from helper/inducer T cells
that regulates
gene expression of interleukin 2 receptor and human immunodeficiency virus
type 1,"
Proc. Natl. Acad. ScL USA, 85:2733-2737, 1988.
Pearsons et aL, J. UroL, 150:120-125,1993.
Pettersson et al., Clin. Chem., 41:1480-88, 1995.
Piironen etal., Clin. Chem. 42: 1034-1041, 1996.
Price, Chang, Smith, Bockheim, Laughon, "The Drosophila neutralized gene
encodes a C3HC4
zinc finger," EMBO J., 12:2411-2418, 1993.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
122
Qiao etal., Biochem. Biophys. Res. Comm., 201:581-588, 1994.
Ralph et al. 1993.
Ribas de Pouplana and Fothergill-Gilmore,Biochemistry, 33:7047-7055, 1994.
Rieber, M. and Rieber, M. S., Cell Growth Dill, 5:1339-1346,1994.
Sager et al., FASEB J, 7:964-970, 1993.
Saito et al., Biochem. Biophys. Res. Commun., 200:378, 1994.
Sambrook et at., (ed.), MOLECULAR CLONING, Cold Spring Harbor Laboratory
Press, Cold
Spring Harbor, NY, 1989.
Schadendorf et al., J. Immunol. , 151:2667 -2675, 1993.
Scheibenbogen eta!, Melanoma Research, 5:179-181, 1995.
Schroder, J.M., Sticherling, M., Hermeicke, H. H., Preissner, W. C.,
Christophers, E.
J. Immunol. 144:2223-2232, 1990.
Scott et at., Molec. Cell. Biol., 13:2247-2257,1993.
Sidransky et al., Science, 252: 706-709, 1991.
Silver et al., Clin. Cancer Res., 3: 81-85, 1997.
Slamon et al., Science, 224:256-262, 1984.
Slamon et at., Science, 244: 707-712, 1989.
Smith, U.S. Patent No. 4,215,051
Stamey, Urology, 45(2):173-184, 1995.
Steinberg and Colla, CART: A supplementary module for SYSTAT, Evanston, IL,
SYSTAT Inc.,
1992.
Stenman et al., Cancer Research, 51:222-226, 1991.
Stinchcomb et al., Nature, 282:39, 1979.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
123
Stone etal., Urology, 44: 18-25, 1994.
Sulston, Du, Thomas, Wilson, Hillier, Staden, Halloran, Greenõ Thierry-Mieg,
Qiu, Dear,
Coulson, Craxton, Durbin, Berks, Metzstein, Hawkins, Ainscough, Waterston,
"The
C. elegans genome sequencing project: A beginning," Nature, 356:37-41, 1992.
Sun and Cohen, Gene, 137:127-132,1993.
Szybalska et al., Proc. Nat'l Acad Sci. USA, 48: 2026, 1962.
Takahashi et al., Cancer Res., 54 :3574-3579, 1994.
Takahashi, Inaguma, Hiai, Hirose, "Developmentally regulated expression of
human
"Finger"-containing gene encoded by the 5' half of the ret transforming gene,"
Mol.
Biol., 8:1853-1856, 1988.
Takeuchi, Roth, Goeddel, "Anatomy of TRAF2: Distinct domains for Nuclear
Factor-KB
activation and association with tumor necrosis factor signaling proteins," J.
Biol. Chem.,
271:19935-19942, 1996.
Tan, Waterham, Veenhuis, Gregg, "The Hansenula polymorpha PER8 gene encodes a
novel
peroxisomal integral membrane protein involved in proliferation," J. Cell
Biol.,
128:307-319, 1995.
Taparowsky et al. , Nature, 300: 762-764,1982.
Tassan, Jaquenoud, Fry, Frutiger, Hughes, Nigg, "In vitro assembly of a
functional human
CDK7-cyclin H complex requires MAT1, a novel 36 kDa RING finger protein," EMBO
J, 14:4508-5617, 1995.
Thanos and Maniatis, "NF-KB: A lesson in family values," Cell, 80:529-532,"
1995.
TIGR reference
Tranque, Crossin, Cirelli, Edelman, Mauro, "Identification and
characterization of a RING zinc
finger gene (C-RZ,F) expressed in chicken embryo cells," Proc. Natl. Acad.
Sci. USA,
93:3105-31.09, 1996.
Tschemper et al., Gene, 10:157, 1980.
Tummuru, Sharma and Blaser, Molec. MicrobioL 18: 8670876, 1995.
Umbas et al., Cancer Res., 52:5104-5109, 1992.
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
124
VanArsdale, VanArsdale, Force, Walter, Mosialos, Kieff, Reed, Ware,
"Lymphotoxic-r3 receptor
signaling complex: Role of tumor necrosis factor receptor-associated factor 3
recruitment
in cell death and activation of nuclear factor KB," Proc. Natl. Acad. Sci.
USA,
94:2460-2465, 1997.
Vinante etal., Leukemia, 7:1552-1556, 1993.
Visakorpi et aL , Am. 1 Pathol, 145:1-7, 1994.
Vishwanatha et al., Carcinogenesi.s, 14:2575-2579, 1993.
Vollmer, Am. I Clin. Pathot , 105:115-126, 1996.
Walker et al., Proc. Nat'l Acad. Sci. USA, 89:392-396,1992.
Walsh and Worthington, The Prostate, Chap. 3, Johns Hopkins University Press,
1995.
Wan, Sharp, Poirier, Wagaman, Chambers, Pyati, Horn, Galindo, Huvar, Peterson,
Jackson,
Erlander, "Cloning differentially expressed mRNAs," Nature Biotechnology,
14:1685-1691, 1996.
Watson et al., Cancer Res., 54:4598-4602,1994.
Webb and Lin, Invest. UroL, 17:401-404, 1980.
Welsh and McClelland, NucL Acids Res., 18:7213-7218,1990.
Welsh et al., Nucleic Acids Res., 20:4965-4970, 1992.
Welsh, Chada, Dalal, Chang, Ralph, McClelland, "Arbitrarily primed PCRTM
fingerprinting of
RNA," NucL Acids Res., 20: 4965-70, 1992.
Whittemore, Biometrika, 82(1):57-67, 1995.
Wigler et al., Cell, 11: 223, 1977.
Wigler et aL, Proc. Nati Acad. Sci. USA, 77:3567, 1980.
Wong et al., Int. .1 OncoL, 3:13-17, 1993.
Wu et aL, Genomics, 4:560, 1989.
T
CA 02273847 1999-06-03
WO 98/24935
PCT/US97/22105
125
Yoon, Lee, Jongeward, Steinberg, "Similarity of sli-1, a regulator of vulva]
development in
C. elegans, to the mammalian proto-oncogene c-cbl," Science, 269:1102-1105,
1995.
Yoshimura, T., Robinson, E. A., Appella, E., Matsushima, K., Showalter, S.D.,
Skeel, A.,
and Leonard, E.J. Molecular Immunology. 26: 87-93, 1989.
Zhang etal., Clin. Chem., 41(11):1567-73, 1995.
CA 02273847 1999-08-12
,
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: UROCOR, Inc.
(ii) TITLE OF INVENTION: DIAGNOSIS OF DISEASE STATE USING MRNA
PROFILES
(iii) NUMBER OF SEQUENCES: 34
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: DEETH WILLIAMS WALL
(B) STREET: National Bank Building, 150 York Street, Suite 400
(C) CITY: Toronto
(D) PROVINCE: Ontario
(E) COUNTRY: Canada
(F) POSTAL CODE: M5H 3S5
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: Dell (IBM PC compatible)
(C) OPERATING SYSTEM: Microsoft Word 97
(D) SOFTWARE: Windows 95
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,273,847
(B) FILING DATE: December 5, 1997
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/032,619
(B) FILING DATE: December 6, 1996
(C) CLASSIFICATION:
(viii) PATENT AGENT INFORMATION:
(A) NAME: Eileen McMahon
(B) REFERENCE NUMBER: 2542/0003
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 253 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GGCAGGGGCT TGTGACTCTA AGATGGCTTC ATTCACATGC CTAGGGCCTC AGTAGGATGA
60
CTGGCATGGC CCTGGAAAAC TGCGAAGTCT TCTCTCTGTG CAAACTTTCA CCTGGACTTT
120
TTATATGATT CTGGAAGTAT TCCAAGAAGG CAAAAGTAAA AACTGCAAAG CGTCTTAAAA
180
TAGAAGTTCA GAAGCCACAT TATATCACTT CTGTTGCATT CTATCAAAGC AAGTCACAAG
240
CA 02273847 1999-08-12
CCCCTGCCAA TCA 253
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 183 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
CACACACTCC CCCATTCTGA GCCCCAAGAG GCTCATCCCT AAGGATGTCC AGAGATCCAA 60
GTGCAGAAGG AGAATGTGGT GAGGCTATTT ATTCCCCCAG TGCCTTCCCT GCTGGGCTAT 120
GGATGAACAG TGGCTGACTT CATCTAGGAA AGAGCTATGG CTTCTGTCTC CTGGAGCTCA 180
CCA 183
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 387 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
GGTGAGCCCC AGGAGACAGA AGAGATATGA GGAAATTGTT AAGGAAGTCA GCACTTACAT 60
TAAGAAAATT GGCTACAACC CCGACACAGT AGCATTTGTG CCAATTTCTG GTTGGAATGG 120
TGACAACATG CTGGAGCCAA GTGCTAACAT GCCTTGGTTC AAGGGATGGA AAGTCACCCG 180
TAAGGATGGC AATGCCAGTG GAACCACGCT GCTTGAGGCT CTGGACTGCA TCCTACCACC 240
AACTCGTCCA ACTGACAAGC CCTTGCGCCT GCCTCTCCAA GGATGTTCTT ACAAAATTGG 300
TGGTATTGGT ACTGTTCCCT GTTTGGCCGA ATTGGAAAAC TGGTGTTCCT CCAAACCCCG 360
GTTATGGTGG GTTTCCTCCT CCTTGGA 387
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 366 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CA 02273847 1999-08-12
GGGCGGAACA AGGGAGCGCT AAAAGGAAAT TAGGATGTCA GGTGCATAAA GGAACATAAT 60
TCCAAAACCT TTCCAAACCC CAAATTTATT CAAAGGAACT GAGGAGTGGA TTGAGGAGTG 120
GACCAACACT GGCGCCAAAC ACAGAAATTA TTGTAAAGCT TTCTGATGGA AGAGAGCTCT 180
GTCTGGGCCC CAAGGAAAAC TGGGTGCAGA GGGTTGTGGA GAAGTTTTTG AAGAGGGCTG 240
AGAATTCATA AAAAAATTCA TTCTCTGTGG TATCCAAGAA TCAGTGAAGA TGCCAGTGAA 300
ACTTCAAGCA AATCTACTTC AACACTTCAT GTATTGTGTG GGTCTGTTGT AGGGTTGCCA 360
GTTGTT 366
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 598 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
GCTTGGGCCC CAAGGAAAAC TGGGTGCAGA GGGTTGTGGA GAAGTTTTTG AAGAGGTAAG 60
TTATATATTT TTGAATTTAA AATTTGTCAT TTATCCGTGA GACATATAAT CCAAAGTCAG 120
CCTATAAATT TCTTTCTGTT GCTAAAAATC GTCATTAGGT ATCTGCCTTT TTGGTTAAAA 180
AAAAAAGGAA TAGCATCAAT AGTGAGTGTG TTGTACTCAT GACCAGAAAG ACCATACATA 240
GTTTGCCCAG GAAATTCTGG GTTTAAGCTT GTGTCCTATA CTCTTAGTAA AGTTCTTTGT 300
CACTCCCAGT AGTGTCCTAT GTTAGATGAT AATGTCTTTG ATCTCCCTAT TTATAGTTGA 360
GAATATAGAG CATGTCTAAC ACATGAATGT CAAAGACTAT ATTGACTTTT CAAGAACCCT 420
ACTTTCCTTC TTATTAAACA TAGCTCATCT TTATATTGTG AATTTTATTT TAGGGCTGAG 480
AATTCATAAA AAAATTCATT CTCTGTGGTA TCCAAGAATC AGTGAAGATG CCAGTGAAAC 540
TTCAAGCAAA TCTACTTCAA CACTTCATGT ATTGTGTGGG TCTGTTGTAG GGTTGCCA 598
(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
CA 02273847 1999-08-12
CGCCTCAGGC TGGGGCAGCA TT 22
(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
ACAGTGGAAG AGTCTCATTC GAGAT 25
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:
CGAGCTGCCT GACGGCCAGG TCATC 25
(2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
GAAGCATTTG CGGTGGACGA TGGAG 25
(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
TGCAAACTTT CACCTGGACT T 21
(2) INFORMATION FOR SEQ ID NO: 11:
CA 02273847 1999-08-12
,
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
_
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
CTTGTGACTT GCTTTGATAG AATG
24
(2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
GACAACATGC TGGAGCCAAG TGC
23
(2) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
ACCACCAATT TTGTAAGAAC ATCCT
25
(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
TGTCCAGAGA TCCAAGTGCA GAAGG
25
(2) INFORMATION FOR SEQ ID NO: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
CA 02273847 1999-08-12
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
GAGCTCCAGG AGACAGAAGC CATAG 25
(2) INFORMATION FOR SEQ ID NO: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:
GGGCCCCAAG GAAAACT 17
(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
TGGCAACCCT ACAACAGAC 19
(2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:
GGGCCCCAAG GAAAACT 17
(2) INFORMATION FOR SEQ ID NO: 19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:
TGGCAACCCT ACAACAGACC 20
CA 02273847 1999-08-12
(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:
ACATTGAAGC ACTCCGCGAC 20
(2) INFORMATION FOR SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:
AGAGTGGCAG CAACCAAGCT 20
(2) INFORMATION FOR SEQ ID NO: 22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:
GCCTCAGGCT GGGGCAGCAT T 21
(2) INFORMATION FOR SEQ ID NO: 23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:
GGTCACCTTC TGAGGGTGAA CTTGC 25
(2) INFORMATION FOR SEQ ID NO: 24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
= CA 02273847 1999-08-12
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:
ACGACTCACT ATAAGCAGGA 20
(2) INFORMATION FOR SEQ ID NO: 25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25:
AACAGCTATG ACCATCGTGG 20
(2) INFORMATION FOR SEQ ID NO: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26:
ACGACTCACT ATGTGGAGAA 20
(2) INFORMATION FOR SEQ ID NO: 27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27:
AACAGCTATG ACCCTGAGGA 20
(2) INFORMATION FOR SEQ ID NO: 28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28:
CA 02273847 1999-08-12
=
GGAGCTGCCT GACGGCCAGG TCATC 25
(2) INFORMATION FOR SEQ ID NO: 29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1599 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 115..744
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29:
GCGGCAGGCG CGGCAAATTA CGTTGCCGGA GCTGAACGGC GCGGCTGGTC TGAAGGCAAA 60
CAAGCGAGCG AGCGCGCGAT AGGGGCCGAG AGGACGCGCA GGTGGCGGCG TTGC ATG 117
Met
1
TCG CAC GGT CAC AGC CAC GGA ATG GGT GAC TGC CGC TGC GCC GCC GAA 165
Ser His Gly His Ser His Gly Met Gly Asp Cys Arg Cys Ala Ala Glu
5 10 15
CGG GAG GAG CCG CCC GAG CAG CAC GCC ATG GCT ACG CTG TAC CTG CGC 213
Arg Glu Glu Pro Pro Glu Gin His Ala Met Ala Thr Leu Tyr Leu Arg
20 25 30
ATC GAC CTG GAG CGG CTG CAA TGC CTT AAC GAG AGC CGC GAG GGC AGC 261
Ile Asp Leu Glu Arg Leu Gln Cys Leu Asn Glu Ser Arg Glu Gly Ser
35 40 45
GGC CGC GGC GTC TTC AAG CCG TGG GAG GAG CGG ACC GAC CGC TCC AAG 309
Gly Arg Gly Val Phe Lys Pro Trp Glu Glu Arg Thr Asp Arg Ser Lys
50 55 60 65
TTT GTT GAA AGT GAT GCA GAT GAA GAG CTT CTG TTT AAT ATT CCA TTT 357
Phe Val Glu Ser Asp Ala Asp Glu Glu Leu Leu Phe Asn Ile Pro Phe
70 75 80
ACG GGC AAT GTC AAG CTC AAA GGC ATC ATT ATA ATG GGA GAG GAT GAT 405
Thr Gly Asn Val Lys Leu Lys Gly Ile Ile Ile Met Gly Glu Asp Asp
85 90 95
GAC TCA CAC CCC TCT GAG ATG AGA CTG TAC AAG AAT ATT CCA CAG ATG 453
Asp Ser His Pro Ser Glu Met Arg Leu Tyr Lys Asn Ile Pro Gin Met
100 105 110
TCC TTT GAT GAT ACA GAA AGG GAG CCA GAT CAG ACC TTT AGT CTG AAC 501
Ser Phe Asp Asp Thr Glu Arg Glu Pro Asp Gin Thr Phe Ser Leu Asn
115 120 125
CGG GAT CTT ACA GGA GAA TTA GAG TAT GCT ACA AAA ATT TCT CGT TTT 549
CA 02273847 1999-08-12
Arg Asp Leu Thr Gly Glu Leu Glu Tyr Ala Thr Lys Ile Ser Arg Phe
130 135 140 145
TCA AAT GTC TAT CAT CTC TCA ATT CAT ATT TCA AAA AAC TTC GGA GCA 597
Ser Asn Val Tyr His Leu Ser Ile His Ile Ser Lys Asn Phe Gly Ala
150 155 160
GAT ACG ACA AAG GTC TTT TAT ATT GGC CTG AGA GGA GAG TGG ACT GAG 645
Asp Thr Thr Lys Val Phe Tyr Ile Gly Leu Arg Gly Glu Trp Thr Glu
165 170 175
CTT CGC CGA CAC GAG GTG ACC ATC TGC AAT TAC GAA GCA TCT GCC AAC 693
Leu Arg Arg His Glu Val Thr Ile Cys Asn Tyr Glu Ala Ser Ala Asn
180 185 190
CCA GCA GAC CAT AGG GTC CAT CAG GTT ACC CCA CAG ACA CAC TTT ATT 741
Pro Ala Asp His Arg Val His Gln Val Thr Pro Gln Thr His Phe Ile
195 200 205
TCC TAAGGGCTGG CCAAGGCTCC CATAGAGGCG CTGTGTCAGT GAAGATGTAC 794
Ser
210
GACTACCTGT TGGGAAGGAC AAAGGGATGA GGCTCCAGAG AGAGTTGGCT GCCACAGCTC 854
TGCCAAGCTT TGTCTTTGGG GCTTGCTGCA GAAACCTGGC CTACGGAAGA TACGACACCA 914
CTGGGAGGGT TGTGTAGGTG CCAGGGGACC ATCGTGGTTC TCTAGGGCGC TGTGGAAATT 974
GGGTCTTGGG CTGGGTGGCA TCTGGCAGTC ATGGGTAACA CTTGCTTTTC CAGTTAATGT 1034
GGCCATGTGA TTCCAAGTGT CATGTTGCTT TGTGGAAGAT TGTTGTGTGA CTTGTTTTTT 1094
TGATTTTGTA TTTGTTTTTT TAAAGGAAAC TATTTGTGGG CTATAGGAAA CTTTCTGATG 1154
CCTCCGGATT GTGTTAGTAG TAGCCATCAG GAGGGTCTCC AACTAAAACA CTTGTTCCTG 1214
CTTGCTCCTT TCCCCTCTCA TTGTTCAGCA TTCTTGTCAA GTTGCCCAGC TTGGAGTTGT 1274
CTGTCACGCA CATGTGTCCT GTGGTTATAG CTAGAAGGAC AGGAGTCTCC TGCTGATGCG 1334
TGATAGCTTA AGCTTGGGGA GAAGGTCTTT TCCACTGCCT AGCTAAGCAG TCTGGGGAGA 1394
GCATGGGGAT CATTTCTATG TGTGTGGGTA ATCTGGTCAG TAAGATTGAG ACTTAGTTAA 1454
GATTCCCCTT GGAAATTCCT TAATGTTTAT TAGCTTCTAA CTAGTGTTGT AAGTCCGATG 1514
CCAGAATTTG GAGATTTGAG TTCTTCTTTT CATGGCTTTT ATTCACTGTG ACTAATAAGC 1574
TTCCTAATAA ATCCTTGCCA GACTT 1599
(2) INFORMATION FOR SEQ ID NO: 30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 210 amino acids
(B) TYPE: amino acid
CA 02273847 1999-08-12
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30:
Met Ser His Gly His Ser His Gly Met Gly Asp Cys Arg Cys Ala Ala
1 5 10 15
Glu Arg Glu Glu Pro Pro Glu Gin His Ala Met Ala Thr Leu Tyr Leu
20 25 30
Arg Ile Asp Leu Glu Arg Leu Gin Cys Leu Asn Glu Ser Arg Glu Gly
35 40 45
Ser Gly Arg Gly Val Phe Lys Pro Trp Glu Glu Arg Thr Asp Arg Ser
50 55 60
Lys Phe Val Glu Ser Asp Ala Asp Glu Glu Leu Leu Phe Asn Ile Pro
65 70 75 80
Phe Thr Gly Asn Val Lys Leu Lys Gly Ile Ile Ile Met Gly Glu Asp
85 90 95
Asp Asp Ser His Pro Ser Glu Met Arg Leu Tyr Lys Asn Ile Pro Gin
100 105 110
Met Ser Phe Asp Asp Thr Glu Arg Glu Pro Asp Gin Thr Phe Ser Leu
115 120 125
Asn Arg Asp Leu Thr Gly Glu Leu Glu Tyr Ala Thr Lys Ile Ser Arg
130 135 140
Phe Ser Asn Val Tyr His Leu Ser Ile His Ile Ser Lys Asn Phe Gly
145 150 155 160
Ala Asp Thr Thr Lys Val Phe Tyr Ile Gly Leu Arg Gly Glu Trp Thr
165 170 175
Glu Leu Arg Arg His Glu Val Thr Ile Cys Asn Tyr Glu Ala Ser Ala
180 185 190
Asn Pro Ala Asp His Arg Val His Gin Val Thr Pro Gln Thr His Phe
195 200 205
Ile Ser
210
(2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
. . , CA 02273847 1999-08-12
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31:
,
CTGGCCTACG GAAGATACGA CAC
23
(2) INFORMATION FOR SEQ ID NO: 32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32:
ACAATCCGGA GGCATCAGAA ACT
23
(2) INFORMATION FOR SEQ ID NO: 33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33:
AGCCCCGGCC TCCTCGTCCT C
21
(2) INFORMATION FOR SEQ ID NO: 34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34:
GGCGGCGGCA GCGGTTCTC
19
_______________________________________________ _¨____
