Note: Descriptions are shown in the official language in which they were submitted.
CA 02279241 1999-07-28
WO 98/32863 , . PCT/GB98/00263
MAMMALIAN THIOREDOXIN
This invention relates to the isolation and characterisation of nucleic acid
encoding for a
new mammalian thioredoxin and to a protein or polypeptide produced from such
nucleic
acid.
Thioredoxin (Trx) is a 12-kDa protein) known to be present in many prokaryotes
and
eukaryotes and appears to be truly ubiquitous in all living cells (Holmgren,
A. ( 1984).
Methods Enzymol. 107, 295-300, Holmgren, A. ( 1985). Ann. Rev. Biochem. 54)
237-271 ). It is characterized by an active site sequence -Trp-Cys-Gly-Pro-Cys-
Lys-, which
has been conserved throughout evolution. The active site of thioredoxin is
localised in a
protrusion of its three dimensional structure (Jeng. M. F. et al ( I 994)
Structure 2, 853-868)
and the two cysteine residues provide the sulfhydryl groups involved in Trx-
dependent
reducing activity. Oxidized thioredoxin, Trx-Sz, is reduced to Trx-(SH)z by
the
flavoenzyme thioredoxin reductase (TR) and NADPH (the thioredoxin system)
(Holmgren, A. ( 1985) supra).
Mammalian thioredoxins isolated from several sources (e.g. rat and calf liver,
rabbit bone
marrow and human placenta) have certain structural differences with respect to
those from
prokaryotes. In addition to the active site cysteine residues, two or three
(depending on the
Trx source) additional structural cysteine residues exist in the C-terminal
half of the
molecule. Oxidation of these residues leads to a loss of its enzymatic
activity (Ren. X et al.
(1993) Biochemistry 32, 9701-9708).
More than one thioredoxin exists in many eukaryotes, e.g. yeast (Muller E. G.
( 1992)
Yeast 8, 117-120). However, only one thioredoxin (Trx 1 ) has thus far been
cloned from
mammalian cells.
Mammalian thioredoxin has been implicated in a wide variety of biochemical
functions
acting as hydrogen donor for ribonucleotide reductase (Thelander, L.,
Reichard, P. ( 1979)
Ann. Rev. Biochem. 48, 133-I58) and methionine sulfoxide reductase (Holgren,
A. (1985)
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 2 PCT/GB98/00263
Supra), facilitating refolding of disulphide-containing proteins (Holmgren, A.
( 1988). In
"Plasma Membrane oxidoreductases in Control of Animal and Plant Growth". "NATO
ASI" series, eds, F.L. Grane et al., Plenum Press, New York 295-302),
(Lundstrom, J.,
Holgren, A. ( 1990). J. Biol. Chem. 265, 9114-91120)) and activating the
glucocorticoid or
IL-2 receptors (Grippo, J.F.) Holgren, A., Pratt, W.B. ( 1985) Biol. Chem.
260, 93-97),
Tagaya, et al ( 1989) EMBO J. 8, 757-764)). It can also modulate the DNA
binding activity
of some transcription factors either directly (TF)TIC(9)) BZLF1 ( 10) and NF-
kB( I 1 )) or
indirectly (AP-1) through the nuclear factor Ref-I which in turn is reduced by
thioredoxin
(Abate, C., et al ( I 990). Science 249, 1157-1 161 ). The importance of the
redox regulation
of transcription factors by thioredoxin is exemplified by the v fos oncogene
where a point
mutation of Cys 154/Ser results in constitutive activation of the AP-1 complex
(Okuno, H.
et al ( 1993) Oncogene 8, 695-701 ). Thioredoxin can be secreted by cells
using a leaderless
pathway (Ericson, M.L., et al ( 1992) Lumphokine & Cytokine Research l I, 201-
207;
RubartelIi, A.) et al { 1992) J. Biol. Chem. 267, 24161-24164; Rubartelli, A.,
et al ( 1995)
Cancer Res. 55, 675-680) and stimulate the proliferation of lymphoid cells,
fibroblasts and
a variety of human solid tumour cell lines (Wakasugi, N., et al ( 1990). Proc.
Natl. Acad.
SCI. USA 87, 8282-8286; Oblong, J. E., et al ( I994) J. Biol. Chem 269, 11714-
11720;
Nakamura, H., et al ( 1992) Cancer 69, 2091-2097; Gasdaska, J.R., et al (
1995) Cell
Growth & Differentiation 6, 1643-1650). Furthermore) Trx is an essential
component of
the early pregnancy factor (Clarke F. M. et al. ( 1991 ) Reproduction &
Fertility 93,
525-539), it inhibits HIV expression in macrophages (Newman) G.W. et al (
1994) J.
Experim. Medicine 180, 359-363)) can reduce HzOz (Spector A et al ( 1988) J.
Biol. Chem.
263, 4984-4990), scavenge free radicals (Schallreuter K. U., Wood J. M. (
1986) Biochem
Biophys. Res. Commun. 136, 630-637) and protect cells against oxidative stress
(Nakamura, H. et al ( 1994) Immunology Letters 42, 75-80).
The inventors have identified a novel mammalian thioredoxin which is
functionally and
structurally distinct from the previously known mammalian thioredoxin. This
novel
thioredoxin is known as Trx2.
Accordingly, a first aspect of the invention provides an isolated nucleic acid
molecule
encoding the Trx2 gene product or a polypeptide which is functionally similar
to Trx2.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 3 PCT/GB98/00263
Preferably, the nucleic acid molecule comprises the nucleic acid sequence
shown in Figure
I A or Figure 9.
The nucleic acid molecule may be cDNA.
Preferably the nucleic acid has at least 60%, 70% or 80% homology, more
preferably 90%
homology, to the nucleic acid sequences of Figure 1 A or Figure 9 encoding the
Trx2 gene
product or a polypeptide which is functionally similar to Trx2. This allows)
for example,
for variations in the sequence which still allows the production of Trx2) by
virtue of
degeneracy of the genetic code.
It is intended that the term "functionally similar to Trx2" means the
polypeptide has
thioredoxin activity, as indicated, for example by the catalysis of disulphide
reduction or
insulin with NADPH in the presence of mammalian thioredoxin reductase which is
resistant against oxidation compared to Trx 1. The known Trx 1 exhibits
oxidation of
cysteine residues which results in a loss of its enzymatic activity (Ren X et
al. ( 1993)
Biochemistry 32, 9701-9708). Trx2, however, lacks these cysteine residues.
A second aspect of the invention provides polypeptides, preferably mature
proteins,
encoded by nucleic acid according to the first aspect of the invention.
Preferably, the
polypeptide comprises the amino acid sequence of Figure 1 A or Figure 10.
Analysis of the amino acid sequence of Trx2 indicates that it may be processed
into a
mature protein by enzymatic action. Accordingly, the invention also provides a
mature
protein, fragment, homologue or analogue which is at least functionally
similar to Trx2.
The invention also includes recombinant or synthetic polypeptides having the
same or
preferably better, functionality compared to native Trx2.
Preferably the mature protein comprises the amino acid sequence of Figure 1 A
from Thr
59 to Asp 166, or the sequence of Figure 10 from Leu 59 to Ile 1b6.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98132863 PCT/GB98/00263
4
A further aspect of the invention provides plasmids or other vectors
comprising nucleic
acids according to the first aspect of the invention. Such plasmids or other
vectors are
preferably expression vectors of the sort known in the art, into which a
nucleic acid
according to the invention can be inserted.
Such plasmids or vectors may be inserted into a suitable microbial host, such
as E.coli,
or a suitable cell of the type known in the art far expression of the nucleic
acid sequences
of the invention such as a mammalian or insect cell. Accordingly, the
invention provides
bacterial, mammalian or insect cells comprising vectors or plasmids according
to the
invention.
Thioredoxin 2 (Trx2) is advantageous in that it is resistant to oxidation, and
is translocated
to mitochondria. Mitochondria are the sites of vital cellular functions such
as lipid
metabolism and aerobic respiration (oxidative phosphorylation). In
respiration, incomplete
reduction of dioxygen results in the formation of reactive oxygen
intermediates, ROIs,
(hydrogen peroxide, the superoxide anion 02_ and the hydroxyl radical OH).
Increased
levels of ROIs, referred to as oxidative stress, can result in lipid
peroxidation, inactivation
of proteins and strand breakage in DNA. Thioredoxin can: act as an
antioxidative
molecule and scavenge hydroxyl radicals) reduce hydrogen peroxide and
reactivate
proteins inactivated by oxidation.
Accordingly the invention provides therapeutic applications of Trx2 including
protection
against oxidative stress induced cytotoxicity and tissue damage. More
specifically Trx2
may be used to protect against ischaemic damage, eye disease, radiation, and
drug toxicity.
In relation to the treatment of ischaemic damage of organs, active oxygen
species are
thought to play a part in ischaemia reperfusion injury. In many heart attacks
and strokes an
ischaemic period is followed by a reperfusion period during which oxygen
radicals are
produced and probably are the true cause for heart attack and stroke damage.
Trx2 may be
used as protective compound to attenuate ischaemia reperfusion injury.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 , 5 PCT/GB98100263
In relation to the treatment of eye diseases, many diseases of the eye
including cataract
involve photo-oxidative stress. Trx2 may be used for protection of retinal
cells from
damage caused by active oxygen species generated during oxygen stress to the
retina.
In relation to the treatment of radiation, exposure to radiation is a major
source of oxygen
radical oxidation. Trx2 may be used as a radio-protective compound to
attenuate the
effects of radiation.
Finally, in relation to the treatment of drug toxicity, several commonly used
drugs (eg.
adriamycin) exhibit a variety of undesirable side effects caused by generation
of reactive
oxygen species. For example, in the use of adriamycin) where cardiotoxicity is
the major
form of damage, Trx2 can be used to eliminate side effects.
The invention will now be described by way of example only, and with reference
to the
accompanying Figures 1-15 in which:
Figure 1 shows eDNA, deduced amino acid sequence and predicted secondary
structure of
rat Trx2. A) The deduced amino acid sequence in the single letter code is
shown under the
nucleotide sequence. The active site is boxed and the potential
polyadenylation signal is
underlined. B) Secondary structure was predicted using the DNASTAR program and
the
Garnier-Robson algorithm. The Kyte-Doolittle algorithm was applied for the
hydropathy
blot of Trx2 amino acid sequence;
Figure 2 shows in vitro translation of Trx2 cDNA using the Sp6 RNA polymerase,
the
TNT coupled reticulocyte transcription translation system and [;SS]
methionine. The
product was analyzed by SDS-PAGE;
Figure 3 shows alignment of the predicted amino acid sequence of rat Trx2 with
that of
human and rat Trx 1. A) Analysis of the N-terminal part of the predicted rat
Trx2 amino
acid sequence. Secondary structure prediction of the region suggests an a-
helix as
indicated. The arrow indicates the probable mitochondria) signal peptide
protease cleavage
site as determined by the consensus motif for the cleavage by the two protease
model
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 6 PCT/GB98/00263
(Hendrick J. P., Hodges, P.E., Rosenberg, L.E. ( 1989) Proc. Natl. Acad SCI.
USA 86,
4056-4060). In bold are; arginine at -10; hydrophobic residues at position -8;
residues S, G
and T present in position -5. B) The alignment is based on a three-dimensional
structure of
E. coli thioredoxin (Eklund, H., Gleason, F.K., Holmgren, A. ( 1991 ) Proteins
11, 13-28).
Black boxes indicate conserved amino acid residues in human Trx, rat Trx 1 and
rat Trx2.
The structure contains four a-helices, a distorted 3,o helix and five 13-
sheets as indicated
below the amino acid sequence;
Figure 4 shows a phylogenetic tree. The phylogenetic tree was constructed by
the Clustal
method with the PAM250 residue weight table;
Figure 5 shows Northern blot analysis of Trx 1 and Trx2 in rat tissues. Each
lane contains 2
ug poly(A)+ RNA. The blot was hybridized with the Trx 1 and Trx2 probes as
described
under "Experimental Procedures". Tissues used for analysis are shown at the
top. The
estimated size of the mRNAs was 0.6 kb and 1.3 kb for Trx 1 and Trx2,
respectively;
Figure 6 shows RT-PCR analysis of transcripts encoding Trxl, and Trx2. One llg
of total
RNA was reverse transcribed and one pl was used as template for PCR with
specific
primers for Trx 1, Trx2 and f3-actin. The products were separated by agarose
gel
electrophoresis, transferred to membranes and probed with specific
oligonucleotide
probes;
Figure 7 shows immunoblotting analysis of cell fractions. Cell fractions were
analyzed by
SDS/PAGE and developed with anti-Trx2 antibodies. Lane 1, O-Trx2 (Sng). Lane
2, total
rat liver cell extract ( 15 llg), Lane 3, cytosolic fraction ( 15 pg), Lane 4,
mitochondria)
fraction ( 15 ~tg). Lane 5, peroxisomal fraction ( 15 llg). Lane 6, human Trx
1 (Sng);
Figure 8 shows analysis of Trx activity. Oxidized Trx2 and human thioredoxin
were
assayed for their ability to reduce insulin in the presence or absence of DTT.
The reaction
was stopped after 20 min by the addition of 6 M guanidine-HCI, 1mM DTNB;
Figure 9 shows human Trx2 cDNA sequence;
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 ~ PCTIGB98I00263
Figure 10 shows the predicted human Trx2 amino acid sequence based on the cDNA
sequence of Fig. 9;
Figure 11 shows two human liver cDNA sequences that code for proteins which
interact
with Trx2;
Figure 12 shows five rat brain cDNA sequences that code for proteins which
interact with
Trx2;
Figure 13 shows the human trx2 gene;
Figure 14 shows a gel picture of a PCR product in chromosome 22; and
Figure 15 shows the mRNA levels of the human Trx2 analysed by using an RNA
master
blot (Clontech).
1. Cloning of rat thioredoxin 2
The primary structure of the active site of thioredoxin (VVVDFSATWCGPCK),
which is
conserved throughout evolution was used to design degenerate primers which
were
labelled with "-P and used as probes for screening a rat heart cDNA library
(Clontech) for
novel thioredoxin genes. Approximately 1 x 106 plaques were screened according
the
instructions of the manufacturer (Amersham) and a positive bacteriophage was
isolated.
The insert from the bacteriophage was excised, cloned into the TA-vector
(Invitrogen) and
sequenced. A 392 by portion of the above clone was amplified by PCR (30 cycles
at; 94°C
for 1 min, 52°C for 1 min and 72°C for 1 min) with specific
primers (trx2f 1:
5'-AACCTTTATCGTCCAGGATGGAC-3' and trx2rl:
5'-GCTGGGAGTTCTACTAGGTTCC-3').
The PCR product was 'ZP-labelled by random priming and used to rescreen the
same
library under high-stringency conditions. Hybridization was performed at
60°C in
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 g PCT/GB98/00263
Expresshyb hybridization solution (Clontech), followed by five 10 min washes
in 2 x
SSC-0.1 %SDS ( 1 x SSC is 0.1 SM NaCI plus O.15M sodium citrate) at room
temperature
and finally two 40 min washes in 0.1 %SSC-0.1 %SDS at 60°C. More than
600,000 clones
were screened and 5 clones were isolated, cloned into the TA-vector and
sequenced. All
clones were overlapping and the longest one, Trx2, possessed an open reading
frame of
SOI by beginning with an ATG initiation codon and ending with a TGA
termination
codon. To obtain the full length cDNA 5' Rapid Amplification of cDNA Ends
(RACE)
with nested PCR using oligonucleotide-anchored heart cDNA template (Clontech)
in the
presence of an anchor-specific primer and an antisense primer complementary to
the 3'
untranslated region of Trx2 (trx2r2: 5'-GCTGGGAGTTCTACTAGGTTCC-3') was
performed as described in the Clontech protocol. PCR products were cloned into
the
TA-vector and sequenced. A cDNA fragment was amplified that overlapped Trx2
and
encoded 46 by of a novel 5' sequence including an in frame TGA stop codon
upstream of
the ATG initiation codon. The overall composite sequence consists of 1276 bp,
including a
stretch of 20 adenosines corresponding to the poly{A) tail and an AATAAAA
motif, 18 by
upstream from the poly(A) tail. The open reading frame encodes a protein of
166 amino
acids with a predicted mass of 18.2 kDa and a pI of 7.9 (Figures lA, 1B).
In order to confirm that the open reading frame sequence present in the Trx2
clone is
functional and codes for translatable protein, the cDNA was transcribed from
the SP6
promoter of the TA-Trx2 clone and 0.5 Ng was translated using the TNT coupled
reticulocyte lysate system (Promegi) and Sp6 RNA polymerise with incorporation
of
['SS]methionine for 60 min at 30°C. The translation products were
analyzed by 15%
SDS-polyacrylamide gei electrophoresis and visualized by autoradiography. The
results
showed a 20-kDa translation product, indicating the presence of translatable,
functional
coding sequence (Figure 2).
2. Analysis of the deduced amino acid sequence
The N-terminal region of the protein has a high content of positively charged
residues and
secondary structure prediction indicated a potential a-helix followed by 13-
sheets (Figure
1B).
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 , 9 PCTlGB98/00263
These features are common to most mitochondria) targeting signal peptides
(Neupert, W.
( 1994). Clinical Investigator 72, 251-261 ) and an algorithm analysis of the
partial amino
acid composition, indicated mitochondria) intracellular localization (Newman,
G. W. et al
( 1994). J. Experim. Medicine 180, 359-363). A motif for mitochondria)
prepeptide
proteases (Hendrick J. P., Hodges, P.E., Rosenberg, L.E. ( 1989) Proc. Natl.
Acad. SCI.
USA. 86, 4056-4060) was also found with the cleavage site between Ser 58 and
Thr 59
(Figure 3A). This putative cleavage results in a 12.2 kDa mature protein,
which is similar
in size to previously reported thioredoxins.
The C-terminal half of the protein contained the active site found in all
thioredoxins with
the characteristic amino acid sequence) Trp-Cys-Gly-Pro-Cys-Lys. The molecule
showed a
35% homology with other mammalian thioredoxins and many of the structural
amino acids
that are conserved in mammalian thioredoxins, i.e Phe-12, Pro-40, Asp-59) Lys-
82, were
also conserved in Trx2 (Figure 3B). However, amino acids participating in
protein-protein
interactions such as Ala-93 and Glu-57 are changed to Ile and Lys,
respectively. One major
difference between Trx2 and mammalian thioredoxins is the absence of
structural
cysteines, residues which are present in all mammalian thioredoxins.
Trx2 has higher homology with the E.coli thioredoxin than with the known
mammalian
proteins and a phylogenetic analysis places Trx2 in a different branch of the
tree, distant
from the mammalian proteins and closer to the prokaryotic and lower eukaryotic
ones.
Sequence relatedness is summarized in Figure 4. .
3. Northern blot and RT-PCR analyses of Trxl and Trx2 mRNA expression
A rat multiple tissue northern blot with 2 Ng/lane of highly pure poly (A) f
RNA from
different rat tissues (Clontech) was hybridized with two probes, one of 360 by
specific for
rat thioredoxin (Trx 1 ) and one of 392 by specific for Trx2 as described in
Spyrou et al
( 1996) J. Biol Chem 272, 2936-2941. Rat Trx 1 and Trx2 open reading frame
probes were
labelled with ['ZPJdCTP by a random priming procedure and hybridized in
ExpressHyb
solution (Clontech). The Trx 1 probe hybridized to an mRNA of 0.6 kb with
highest levels
in lung, liver and kidney (Figure 5). The Trx2 mRNA was detected as a 1.3 kb
band, in
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 10 PCT/GB98/00263
agreement with the size of cDNA ( 1,276 bp) and it was highly expressed in
heart, liver,
skeletal muscle and kidney. RT-PCR was used to compare the relative expression
of Trx 1
and Trx2 in tissues where the expression of these proteins may be very low.
(Figure 6).
For RT-PCR analysis) male and female rats (6-8 weeks old) were killed by
cervical
dislocation, tissues were collected and samples were immediately processed for
total RNA
isolation according to the acid guanidium thiocyanate-phenol-chloroform single
step
extraction protocol (Chomczynski, P., Sacchi, N. (1987) J. Biol. Chem. 162,
156-159). The
integrity and quality of the purified RNA was controlled by formaldehyde
denaturing
agarose gel electrophoresis and by measuring the Az6dA2so ratio.
For first strand synthesis, total RNA ( 1 pg) was dissolved in 10 pl water,
heated to 70°C for
5 min and then chilled on ice. The volume was increased to 20 pl, giving a
final
concentration of I mM each dATP dGTP> dCTP, dTTP, 10 mM DTT, 5 pmol random
hexamers/1 (Promega), I U RNAsin/111, 200 U Superscript RT (GIBCO-BRL) and the
incubation buffer recommended by the supplier. For PCR amplification 1 Nl of
cDNA
(total 20 ~l) was subjected to PCR and amplified for 24 cycles by incubation
at 94°C for
10 sec, 54°C for 30 sec and 72°C for 60 sec in a PCR9600
thermocycler (Perkin-Elmer,
Norwalk, CT). The oligonucleotides trx2f 1: S'-AACCTTTATCGTCCAGGATGGAC-3'
and trx2rl: S'-GCTGGGAGTTCTACTAGGTTCC-3' were used for the amplification of a
392 by fragment of the Trx2 mRNA. The oligonucleotides trxlfl: 5' -
CCAAAATGGTGAAGCTGATCGAGAG-3' and trx 1 r 1: 5'-
TGATTAGGCAAACTCCGTAATAGTG-3' were used for the amplification of a 360 by
fragment of the Trx 1 mRNA. The oligonucleotides Act S') CTGGCACCACACCTTCTA
and Act 3', GGGCACAGTGTGGGTGAC were used for the amplification of a 238 by
fragment from l3-actin mRNA. After agarose gel electrophoresis and blotting to
nitrocellulose filters the PCR products were hybridized to ~'-P-labelled
internal
oligonucleotides: trx2r2: S'-
CACCACCTTCCCGTGCTGTTT-GGCTACCATCTTCTCTAACCGAGGTCC-3' for
Trx2, trx 1 r2: 5'-
CTGGAATGTT-GGCGTGCATTTGACTTCACACTCTGAAGCAACATCCTG-3' for
Trx 1 and actin primer 5'- GATGACCCAGATCATGTTTGA-3'.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 PCT/GB98/00263
11
Hybridization was performed at 50°C in Expresshyb hybridization
solution followed by
five 10 min washes in 2xSSC-0.1 %SDS at room temperature and finally two 40
min
washes in 0.1 %SSC-0. I %SDS at 50°C. While Trx I is found to follow
the (3-actin
expression with higher expression in colon and liver, Trx2 gave a completely
different
pattern. It was highly expressed in cerebellum, heart, skeletal muscle)
kidney, adrenal
gland and testis. No cross hybridization between Trxl and Trx2 was observed.
4. Expression of recombinant thioredoxin2 and subcellular localization
The C-terminal part of the cDNA encoding a part of rat Trx2 (aa 60-166, Trx2 )
was
amplified by PCR from the TA-Trx2 plasmid by using two mutagenic primers that
introduce a Ndei (trx2p I : S'-ACCACCAGAGTCCATATGACAACCT'ITAACGTC-3')
and a BamH I (trx2p2: 5'-CTGGCCGGATCCCTGCTTATCAGCCAATTAGC-3') site at
the N-terminus and C-terminus of the polypeptide respectively. The amplified
DNA was
cloned into the Ndel-BamHI sites of the pET- I Sb expression vector (Novagen 1
under the
control of a T7 promoter, and the resulting plasmid, pET-trx2 was transformed
into the E.
toll strain BL21 (DE3). A single positive colony was innoculated in 1 I of L-
broth with
50 ltg/ml ampicillin and grown at 37°C until OD6«,=0.5. Then) fusion
protein expression
was induced by addition of 0.5 mM IPTG and growth continued for another 3.5 h.
The
cells were harvested by centrifugation at 10,000 x g for 10 min, the pellet
was resuspended
in 50 ml of 20 mM Tris-HCl pH 8.0, 100 mM NaCI and I mM PMSF. Lysozyme was
added to a final concentration of 0.5 mg/ml with stirring for 30 min on ice.
Subsequently,
MgClz ( 10 mM), MnClz ( I mM)) DNAse I ( 10 llg/ml), and RNAse ( 10 llg/ml)
were added
and the incubation was continued for another 45 min on ice. The cells were
disrupted by
sonication for 8 min, the supernatant was cleared by centrifugation at 15,000
x g for 30
min and loaded onto a Talon resin column (Clontech) and the protein was eluted
with 20
mM imidazole. The size and purity of the eluted protein was determined by SDS-
PAGE on
a I S% gel. A single band of 15 kD was detected after the Talon chromatography
(data not
shown).
The inventors next analyzed the subcellular localization of Trx2 using
affinity purified
polyclonal antibodies obtained from immunized rabbits (Zeneca Research
Biochemicals,
England). After 6 immunizations, serum from the rabbits was purified by
ammonium
SUBSTITUTE SHEET (RULE 28)
CA 02279241 1999-07-28
WO 98132863 12 PCT/GB98/00263
sulfate precipitation. Affinity-purified antibodies were prepared using a
cyanogen
bromide-activated Sepharose 4B column, onto which 0.5 mg of Trx2 had been
coupled
using the procedure recommended by the manufacturer (Pharmacia). Specificity
of the
antibodies was tested by western blotting using recombinant Trx2 and total
cell extracts.
Mitochondria), peroxisomal and cytosolic fractions were prepared from rat
liver as
described (Svensson, L.T., Alexson, S.E.H., Hiltunen, J.K. ( 1995) J, Biol.
Chem. 270,
12177-12183). For immunoblotting analysis samples were subjected to 15% SDS-
PAGE
and the separated proteins were electrophoretically transferred to
nitrocellulose membranes
(Hybond-C Super, Amersham). The membranes were blocked with PBS containing 5%
dry fat free milk powder and 0.05% Tween 80 and further incubated with
affinity purified
anti-Trx2 antibodies. Immunodetection was performed with horseradish
peroxidase-conjugated goat anti rabbit IgG (Amersham) diluted 1:5000 following
the ECL
protocol (Amersham) in a hydrogen peroxide catalyzed oxidation of luminol. As
shown in
Figure 7, Trx2 is only present in mitochondria) fractions as neither cytosolic
nor
peroxisome enriched fractions displayed any signal. Rat Trx 1 did not cross-
react with the
affinity purified antibodies against Trx2. By densitometric analyses Trx2
content in total
cell-free extracts from rat liver was estimated to be around 0.1 pg/mg protein
(data not
shown). The transient preprotein with the mitochondria) translocation peptide
was not
detected indicating that the translocation process is very fast. The
recombinant Trx2 in
lane 1 has a higher molecular weight because the His-tag was not removed by
thrombin.
5. Thioredoxin catalyzed insulin reduction
In order to confirm the specificity of the recombinant Trx2, the inventors
examined the
reduction of insulin, a classical assay in which thioredoxin catalyzes
disulfide reduction of
insulin with NADPH in the presence of mammalian thioredoxin reductase (TR}.
They
compared the activities of human thioredoxin with the recombinant Trx2. The
insulin
disulfide reduction assay was essentially performed as described (Holgrem, A.,
BjLTrnstedt,
M. ( 1995) Methods Enzymol 252, 199-208)with a slight modification to activate
Trx 1 and
Trx2 by reduction. Aliquots of Trx 1 and Trx2 were preincubated at 37°C
for 20 min with 2
ftl of: 50 mM Hepes pH 7.6, 100 pg/ml BSA and 2 mM DTT, in a total volume of
70 lzl.
Then, 40 ~tl of a reaction mixture composed of 200 ul Hepes ( 1 M) pH 7.6, 40
NI EDTA
(0.2 M), 40 ul NADPH (40 mg/ml) and 500 pl insulin ( 10 mg/ml) was added. The
reaction
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 , 13 PCT/GB98/00263
started with the addition of 10 lrl of TR from calf-thymus (3.0 A.~,~ unit)
and incubation
continued for 20 min at 37°C. The reaction was stopped by the addition
of 0.5 ml of 6 M
guanidine-HCI, 1mM DTNB and the absorbance at 412 nm was measured. Calf-thymus
TR and human thioredoxin were kind gifts from Prof. A. Holmgren, Karolinska
Institute,
Sweden. As shown in Figure 8, when the samples were preincubated with DTT,
Trx2 and
human Trx were equally good substrates for TR. However) oxidized human Trx
showed a
decreased capacity to reduce insulin with a pronounced lag phase. The activity
of Trx2 was
not affected upon oxidation. Although Trx2 is homologous to the prokaryotic
thioredoxins
it could not function as a substrate for E.coli TR (data not shown).
6. Isolation of human cDNA
Using polymerase chain reaction, human cDNA encoding Trx2 has been isolated.
This is
shown in Figure 9. This is 87.4 % homologous to rat Trx2 cDNA.
The predicted amino acid sequence of human Trx2 is shown in Figure 10. This
also
contains a putative mitochondria) prepeptide protease cleavage site between
Ser58 and
Leu59.
7. Thioredoxin 2 interacting proteins
In order to determine which proteins Trx 2 interacts with, a human liver cDNA
library was
used to isolate Trx2 interacting proteins with the yeast two hybrid system.
Trx2 was
cloned into the pGBT9y vector (Clontech), expressing the DNA binding domain of
GAL4
transcriptional activator fused with Trx2. The liver cDNA library was cloned
into the
pGAD 10 vector (Clontech) that expresses the cloned cDNA fused with the DNA
activation domain of GAL4. These two vectors were co-transformed to the HF7c
yeast
strain that is auxotrophic to tryptophan and leucine and has histidine as a
reporter gene
under the control of the upstream activating sequence (UAS) and TATA portion
of the
GAL 1 promoter. The pGBT9 (Clontech) and pGAD 10 vectors contain the selection
markers for tryptophan and leucine respectively. Upon interaction of Trx2 with
the cloned
protein in the pGAD 10 vector the transcriptional activation of GAL4 is
restored leading to
expression of histidine thus supporting growth on plates lacking histidine.
Approximately
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 PCT/GB98/00263
14
16x I06 clones were examined and 200 colonies could grow on plates lacking
LeulTrp/His.
For further analysis I 10 positive (growing) clones were selected.
The proteins isolated were fibrinogen ~3-chain precursor, plasminogen,
vitronectin, PDI,
y actin, serine hydroxymetyltransferase, NF-kB p65 and two cDNA sequences that
code
for proteins with no apparent homology to known proteins in a protein sequence
data base
(Figure I 1 ).
Using a rat brain cDNA library screened in the same way as above, the
following clones
were isolated: cytochrome c oxidase, rat ribosomal protein S 17, c-myc intron
binding
protein (zinc finger protein), and five cDNA sequences that code for proteins
with no
apparent homology in the database. The cDNA sequences can be seen in Figure
12.
8. Genomic organisation of Trx2
To locate the number and position of the introns within the trx2 gene (Figure
13} of the
human genome, 2 sets of primers were generated for use in the PCR
amplification of the
portions of trx2 gene, the first set comprising a forward primer corresponding
to as 1 to aa7
and a reverse primer from as 110 to as 117 and the second set comprising a
forward primer
from aa88 to aa96 and a reverse primer from downstream of the stop codon. The
first set
when used for amplification from human genomic DNA gave a product of
approximately
4.2kb and the second primer set gave a product of approximately 9bk thereby
giving a
combined intron total of approx. 13.2 kb. Both these products were cloned into
the
pGEMT easy vector (Promega) and sequenced. In the first PCT amplification
product,
only one intron of 4kb was present which was located between aa87 and aa88 of
trx2. The
9kb PCR amplification had only one intron as well which was located between as
129 and
as 130 of trx2. Both splice junctions conformed to the GT/AG rule. The trx2
gene was
therefore shown to possess 2 introns.
9. Isolation of human PAC clones and Chromosomal localisation
The human PAC library (No. 704 purchased from the Resource Center/Primary
Database
of the German Human Genome Project, Berlin), constructed from a human male
fibroblast
cell line and ligated into pCYPAC-2 (Lehrach et al., ( 1990); Loannou et al.,
( 1994)), was
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98132863 15 PCT/GB98/00263
screened with the genomic DNA probe H6-2. Trx2 from the human Trx2 gene. The
4.2
kb fragment was labelled with'ZP by random priming and hybridized to the
filter bound
PAC clones under stringent conditions (45% formamide, 42°C) over
night. After
hybridization the filters were washed 20 min in 2XSSC, 0.1 % SDS and 20 min in
O.1XSSC, 0.1% SDS at room temperature, followed by three 30 min washes in
O.1XSSC,
0.1 % SDS at 65°C. Autoradiography (FUJI Medical X-ray) was analyzed
after 4 days. One
clone of 130kb was found containing the trx2 gene from which DNA was isolated
by
Qiagen preparation. To further confirm that the clone is a true positive, a
PCR was
performed using the primer sets used above which gave the same amplification
products.
10. Somatic cell hybrid panel Fluorescence in situ Hybridization (FISH)
In order to identify which human chromosome carried the trx2 gene, high
molecular
weight DNA.was isolated from somatic hybrid cell tines (hamster/human and
mouse/human) retaining individual human chromosomes. PCR amplification was
carried
out on each chromosome using primers corresponding to the start and stop
codon. The
expected product size was approx. 130kb. Chromosome 22 was found to be the one
containing the trx2 gene since this was the chromosome that generated the
expected
product by PCR amplification (Figure 14).
The PAC clone of trx2 was used as a probe after labelling with biotin- I 6-
dUTP by
nick-translation. To obtain more detailed analyses of the localization of the
trx2 gene,
slides with human metaphase chromosomes were prepared using standard
procedures. The
slides were postfixed, Rnase treated and denatured as previously described
(Pinkel et al
( 1986) Proc. Natl. Acad. Sci USA 83, 2934-2938). The PAC clone for Trx2 was
used as a
probe after labelling with biotin-16-dUTP by nick-translation. The probe
(SOng, 100ng)
was pre-annealed with Cot-1 DNA (2.5-3.5 (g) for 30-60 min at 37°C
after denaturing in
68°C for 10 min. Hybridization was performed in 50% formamide at
37°C overnight in a
moist chamber. The slides were then washed three times for 5 min in 50%
formamide,
2XSSC at 42~C and three times in O.1XSSC at 60~C. After washing, the
hybridized
probe was coupled to fluorescein-isothiocyanate-avidin D and the fluorescent
signal
was amplified by three successive treatments with biotinylated anti-avidin
antibodies alternated with fluorescein-isothiocyanate-avidin D (Vector
Lab). After dehydration, the slides were mounted in glycerol containing
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 16 PCT/GB98/00263
2.3% DABCO (1,4-diazabicyclo- (2,2,2) octane) as antifade, and DAPI (4,6-
diamino-2-phenyl-indole) at 0.5(g/ml as counterstain. The signal was
visualized using a Zeiss Axioskop fluorescence microscope equipped with a
cooled CCD-camera (Photometrics Sensys) controlled by a Power Macintosh
Quadra 950 computer. Gray scale images were captured, pseudocolored and
merged using the SmartCapture software (Vysis). The hybridisation signal was
detected as
symmetrical spots on both chromatids of the homologues chromosomes 22 at q
131.1.
lI. Northern analysis of Trx2 expression
To detect the presence of trx2 mRNA molecules within human cell types, a trx2
cDNA
probe labelled with'ZP dUTP was hybridized to a human mRNA master blot
(Clontech).
After exposing the blot to autoradiography film, densitometric measurements
were
performed on the dots appearing on the film. The values measured were then
corrected
with G3PDH (glyceraldehyde-3-phosphate dehydrogenase). The highest value was
set as
100% and the rest were then compared to the set value. The relative values for
the various
tissue mRNAs blotted can be seen in Fig 15.
12. Submitochondrial localization and immunohistochemical analysis
To better understand the function of Trx2 in mitochondria and evaluate the
interaction of
Trx2 with some of the proteins isolated in the two hybrid screening it is
necessary to
elucidate its submitochondrial localization of Trx2. Using perfused rat kidney
and
immunohistochemistry in combination with electron microscopy, the inventors
showed
that trx2 is located in the inner mitochondria) membrane.
Immunocytochemistry
For light microscopic immunocytochemistry the rats were anesthesized with
pentobarbital
and perfused transcardially first with 100m1 of saline followed by a mixture
of 4%
paraformaldehyde and 0,1 % picric acid in 0.1 M phosphate buffered saline (PB
S; pH. 7.3)
for 4-5 minutes. After perfusion the tissues were excised and further fixed by
immersion
in the same solution for 60 min. The samples were cryoprotected with 15%
sucrose in PBS
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98132863 17 PCTIGB98/00263
before sectioning in the cryostat. Immunocytochemistry was performed using
ABC-method. The sections were first incubated with rabbit antiserum against
Trx2 (dil.
1:250 in PBS containing 1 % BSA and 0.3% Triton X-100) for 12-24h. After
several
washes the sections were incubated with biotinylated goat-anti-rabbit (Vector
Labs, dil.
1:300) and ABC-complex for 30 min each. Diaminobenzidine was used as a
chromogen
to visualize the sites expressing Trx2-immunoreactivity. The sections were
dehydrated,
mounted and examined with Nikon Microphot-FXA microscope.
Immunoelectron microscopy
For immunoelectron microscopy the anesthesized animals were perfused with a
mixture of
4% paraformaldehyde, 0.1 % picric acid and 0.2% glutaraldehyde in PBS for 5
min. The
tissues were postfixed by immersion for 5-6 h. The tissues were cryoprotected
with 50%
sucrose and IO% glycerol in PBS for several days. The tissues were rapidly
frozen in
liquid nitrogen and 50um frozen sections were cut with the cryostat. The
sections were
processed free floating. The Trx2 antibody was diluted ( 1:50) with PBS
containing 1 %
BSA and 0.2% Saponin and the sections were incubated for 4-6 days with the
antibody.
After several washes the sections were incubated with secondary antibody and
ABC-complex for 12 h each. Diaminobenzidine was used as chromogen.
Subsequently the
section were fixed with 2% glutaraldehyde, 1 % osmium tetraoxide and 1 %
uranyl acetate
for 30 min each. The tissues were dehydrated with ethanol and embedded in
Epon. The
samples were processed for electron microscopy and the thin sections were
examined in
Jeol 1200 electron microscope.
Nitric acid (NO) is a short lived free radical gas with a variety of
physiological roles which
include S-nitrosylation of proteins in vivo. Since Thioredoxin 1 is well known
to scavenge
free radicals (Schallreuter, K.V., Wood J. M. ( 1986) Biochem. Biophys. Res.
Commun 136,
630-637) and can reverse the action of NO in AP1 in vitro. (Nikitorite et al
(1998)
Biochem. Biophys Res. Commun. 242, 109-112}, it is therefore possible that
trx2 located in
mitochandria may have a similar function to trx 1, thus reversing the effect
of NO on
mitochondrial proteins.
SUBSTITUTE SHEET (RULE 2B)
CA 02279241 1999-07-28
WO 98/32863 PCT/GB98100263
I8
13. Immunocytochemistry and in situ hybridization in different tissues of
adult male
and female rat
In situ hybridization
In situ hybridization was carried out as described in detail
previously(Kononen and
Pelto-Huikko, 1997, TIPS online). Two oligonucleotides (nucleotides
trx2r2:CACCACCTTCCCGTGCTGTTTGGCTACCATCTTCTCTAACCGAGGTCC
and
trx2r3: GACAACTCTGTCTTGAAAGTCAGGTCCATCCTGGACGTTAAAGGTTGT)
specific for rat Trx2 were labeled to a specific activity of l x 109 cpm/mg at
the 3'-end
with 33P-dATP (NEN) Boston, MA) using terminal deoxynucleotidetransferase
(Amersham). Both probes produced similar results when used separately and were
usually
used together in the hybridizations to increase the intensity of the signal.
Several control
probes with similar CG-content and specific activity were used to ascertain
the specificity
of the hybridizations. Addition of 100 molar excess of the unlabeled probes
abolished all
hybridization signals. Rats were decapitated and the tissues excised and
frozen on dry ice.
Cryostat sections ( l4um) were sectioned with Micron HM500 cryostat and thawed
onto
Probe-On glass slides (Fisher Scientific, Philadelphia, PA). The sections were
stored at
-20°C until use. The sections were incubated in humidified boxes at
42°C for 18h with
Sng/ml of the labeled probe in the hybridization cocktail) washed) dried and
covered with
Amersham B-max autoradiograph film for 30-60 days. Alternatively the sections
were
dipped in Kodak NTB2 nuclear track emulsion (Rochester, NY) and exposed for 90
days at 4°C. The sections were examined in a Nikon Microphot-FXA
microscope
equipped for dark-field and epipolarization microscopy. Finally, the sections
were stained
with cresyl violet and analyzed under brightfield conditions.
The results of the immunocytochemical and in situ hybridization studies are
shown below:
Male Genital organs:
Testis:
In situ: high levels of trx2 mRNA in seminiferous tubules, variation during
spermatogenic
cycle.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 PCT/GB98/00263
19
Immuno: Strong labelling in Sertoli cells, primary spermatocytes and also some
labelling
in Leydig cells.
Epididymis:
In situ: Signal in the epithelium.
Immuno: The epithelial cells are clearly labelled.
Prostate:
In situ: Clear signal in epithelium.
Immuno: Most of the epithelial cells labelled.
Female genital organs:
In situ: Strong signal in ovary. Corpus lutea are strongest, also labelling in
follicles and
interstitium. Signal in epithelium and muscula layer in uterus.
Immuno: Strong labelling in collapsing follicles. Some labelling in corpus
luteum.
Labelling in Oocytes in primordial follicles. Clear signal in epithelium in
uterus and also
staining in smooth muscle cells in myometrium.
Skin
Immuno: Labelling in keratinocytes in the basal epidermis. Labelling in some
cells in hair
follicles. Labelling in epithelial cells in sweat glands.
Endocrine organs:
Pituitary: Moderate labelling with immuno in large number of cells, low signal
with in
situ.
Adrenal gland: Strong signal with in situ in the adrenal cortex, low signal in
medulla.
Strong labelling in adrenal cortex, especially zona glomerulosa and
fasciculata. No
staining in chromaffin cells in medulla.
Alimentary tract:
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 PCTlGB98/00263
20
Salivary gland: Some labelled cells in secretory alveoli.
Stomach: Strong labelling in the mucosa, in parietal cells (secrete acid) of
gastric glands
and in the epithelial cells of the mucosa.
Duodenum: Strong labelling in epithelial cells in the mucosa.
Liver: Uniform clear signal with in situ. Clear labelling in most of the
hepatocytes, some
are very strongly stained.
Eye:
Clear staining in cornea; in epithelium, stromal fibroblasts and endothelium.
Lens: Very strong staining in subcapsular epithelium of the lens.
Retina: Staining in ganglion neurons and in bipolar neurons {rods and cones
negative).
Labelling in pigment epithelium.
Respiratory tract:
Staining in several cells at alveolar level. Parasympathetic neurons in local
ganglia are
immunoreactive.
Kidney:
Strong signal with in situ in the medulla of kidney (loops of Henle at this
area), lower
labelling in the papilla (collecting tubules at this area). Labelling also in
cortex.
With immuno clear signal in tubules (Loops of Henle) in the medulla, in
collecting
tubules. Labelling also in glomeruli.
Immune system:
Clear signal with in lymph nodes, spleen, thymus and bone marrow. Strong
staining in
large number of lymphocytes (proliferating cells in germinal centres) in lymph
nodes with
immuno. Many cells stained both in spleen and in thymus. In bone marrow
several
celltypes, megacaryocytes are easily identified.
Brown fat:
Strong labelling with immuno especially in young animals.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98132863 21 PCTIGB98/00263
Bone:
Labelling in chondrocytes in cartilage. Labelling in cells lining bone. Strong
labelling in
some cells around developing bone. With in situ very strong signal in some
cells in
developing bone.
Muscle:
Labelling in large number of cells in muscles.
Peripheral nervous system:
Large number of labelled neurons in sympathetic ganglia, satellite cells
(glia) negative.
Part of the cells in carotid body (chemoreseptor) are immunoreactive.
Motoneurons in
spinal cord are labelled. Large number of the sensory neurons labelled,
strongest labelling
in small neurons (related to pain) and middle-sized neurons.
Central nervous system:
Trx2 is mainly localised in special sets of neurons (mural cells in olfactory
bulb,
magnocellular neurons in supraoptic nucleus, substantia nigra, Purkinje
cells).
Circulatory system:
Heart: Irz situ: Strong signal both in atrium and in ventrical (in cardiac
muscle).
Immuno: Strong staining in most of the muscle cells.
Blood vessels: Clear staining of the smooth muscle cells and in small blood
vessels.
From previous studies is known that smooth muscle cells do no contain any Trx
1.
Considering the antioxidant function of thioredoxins, the possibility of a
correlation of trx2
expression and artheriosclerosis is very interesting.
These results demonstrate the prolific nature of the trx2 mltNA and
translation product
within the tissues of the adult male and female rat.
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 22 PCT/GB98/00263
In particular, the very strong staining in the subcapsular epithelium of the
lens of the eye
suggests an important role of Trx2 in the protection of the lens caused by
active oxygen,
since thioredoxin has been shown to protect cells against oxidative stress
(Nakamura, H. et
al ( 1994). Immunology Letters 42, 75-80).
Similarly, the high level of expression of Trx2 in neurons suggests an
important role for
Trx2 in protecting these cells from oxidative damage. For example, the high
expression of
Trx2 in neurons together with the ability of thioredoxins to scavenge free
radicals and
regenerate damage proteins suggests Trx2 may have a role in the limitation
and/or reversal
of neuron damage since a common factor in a variety of neurodegenerative
diseases is the
production of free radicals.
Trx2 may also play a significant role in the control of pain, since there are
a lame number
of pain-related sensory neurons in the peripheral nervous system which are
strongly
labelled with the Trx2 antibody.
14. Comparison of Trx2 with known Trxl proteins
A Southern hybridization analysis of the human genome suggested several
thioredoxin
genes, including at least one inactive pseudogene (Tonissen, K. F., Wells, J.
R. ( 1991 )
Gene 102, 221-228).
The encoded protein sequence of Trx2 shows an interesting two-domain structure
consisting of a N-terminal part of a 60 amino acid region rich in basic amino
acids with a
theoretical pI of 12.1 and a C-terminal part homologous to thioredoxin with a
pI of 4.8.
The N-terminal of Trx2 has characteristic properties of a mitochondria)
translocation
peptide and a proposed protease cleavage site which may give a mature protein
of 12.2 kD.
In fact, a slightly larger mitochondria) form of Trx, compared to the
cytosolic Trx, has
been reported to be present in pig heart based on electrophoretic mobility
(Bodenstein, J.,
Follman, H. ( 1990) Z. Naturforsch 46c, 270-279). In vitro coupled
transcription/
translation confirmed the presence of the putative open reading frame in the
Trx2 clone.
The size of the translation products in the SDS-polyacrylamide gel
electrophoresis analysis
was somewhat larger than the calculated sizes (20 kDa versus 18.2 kDa), but
this may be
SUBSTITUTE SHEET (RULE 26)
CA 02279241 1999-07-28
WO 98/32863 23 PCT/GB98/00263
due to the primary characteristic of the protein (eg. charge}. Of course, the
native protein
may still have a different size due to post-translational modification.
Although Trx2 is phylogenetically closer to prokaryotic than mammalian
thioredoxin some
amino acids conserved in all prokaryotes like Trp-28 are not conserved in
Trx2. Also the
differences in amino acids involved in protein interaction such as Ala-93 and
Glu-57 will
probably confer a different specificity for Trx2 compared to Trx 1. All
previously described
mammalian thioredoxins have 2-3 additional cysteine residues to the two
located in the
active site. These structural or non catalytic cysteine residues can undergo
oxidation, a
process which leads to inactivation. From the structure of reduced human
thioredoxin
Cys-72 is located in a loop in proximity to the active site. Xilin et al.
(Ren, X. et al ( 1993)
Biochemistry 32, 9701-9708) showed that Cys-72 is responsible for dimer
formation and
subsequent loss of activity. The absence of corresponding structural cysteines
in Trx2
confers a resistance to oxidation. This property might have important
physiological
implications for the role of Trx2.
Mammalian Trx can be found in many different cellular compartments including
nucleus)
endoplasmic reticulum, mitochondria and plasma membrane (Martin, H., Dean, M.
( 1991 )
Biochem. Biophys. Res. Commun 175, 123-128), (Holgrem, A., Luthman, M. (1978)
Biochemistry 17, 4071-4077}). Also Trx is differentially regulated and has
separate
functions including promotion of cell growth to transcription factor
activation and radical
scavenging activities. Trx2 is highly expressed in tissues such as heart and
skeletal muscle
where Trx 1 protein is not detectable (Fuj ii) S. et al ( 1991 ). Virchows
Archiv A,
Pathological Anatomy & Histopathology 419, 317-326). Reactive oxygen
intermediates
(ROI), which comprise hydrogen peroxide, hydroxyl radicals and superoxide
anions, are
essential compounds of oxidative metabolism (Halliwell, B., Gutteridge, J.M.C.
( 1990)
Methods Enzymol 186, 1-85). An important source of ROI are mitochondria
(Turrens, J.
F., Boveris, R. (1980). Biochem. J. 191, 421-427). Generally, ROI are regarded
as toxic
and harmful metabolites and when their formation occurs in an uncontrolled
fashion, they
may be implicated in several diseases by inducing lipid peroxidation and
disruption of
structural proteins, enzymes and nucleic acids. Recently, ROI in addition to
being
cytotoxic, have been reported to function as signal transducers of TNF-induced
gene
SUBSTITUTE SHEET (RULE 2B)
CA 02279241 1999-07-28
WO 98132863 24 PCT/GB98/00263
expression (Schulze, O.K. et al (1993) EMBO. J. 12, 3095-3104). Thioredoxin
can reduce
hydrogen peroxide and scavenge free radicals (23-25). Using affinity purified
antibodies
against Trx2 the inventors showed that it is localised in the mitochondria and
the mature
protein has an apparent molecular weight of 13 kD. A mitochondria) localised
Trx2, which
is more resistant to oxidation than Trx 1, may explain its high expression in
heart and
skeletal muscle, tissues with high metabolic activity, and confer an important
regulatory
and/or protective function.
SUBSTITUTE SHEET (RULE 26)
