Note: Descriptions are shown in the official language in which they were submitted.
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
TITLE OF THE INVENTION
POLYNUCLEOTIDE VACCINE FORIViULATIONS
15
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
The present invention relates to novel vaccine formulations
comprising nucleic acid molecules and an adjuvant which does not
substantially bind the nucleic acid molecules, and their methods of use.
BACKGROUND OF THE INVENTIOrJ
A DNA vector containing a gene encoding a viral, bacterial,
parasitic or tumor antigen has been shown to express that respective
antigen in muscle cells and possibly other cell types subsequent to
intramuscular injection. Such a naked DNA vector has come to be
known as a polynucleotide vaccine (Pl'~TV) or DNA vaccine. The
technique of using naked DNA as ~a prophylactic agent was reported in
W090/11092 (4 October 1990), in which naked polynucleotides were used
to vaccinate vertebrates.
For example, both humoral and cell-mediated responses
have been shown to occur when using DNA plasmid vectors encoding
- 1-
CA 02280839 1999-08-10
W0~98/35562 PCT/US98/02414
influenza antigens as a PNV, providing both homologous and cross-
strain protection against a subsequent live virus challenge. The
generation of both of these types of immune responses by a single
vaccination approach offers a potential advantage over certain existing
. vaccination strategies. The use of PNVs to generate antibodies may
result in an increased duration of the antibody response, and may
express an antigen having both the exact sequence of the clinically
circulating strain of virus as well as the proper post-translational
modifications and conformation of the native protein (vs. recombinant
protein). The generation of CTL responses by this means offers the
benefits of cross-strain protection without the use of a live potentially
pathogenic vector or attenuated virus. For a review, see Donnelly, et al,
1997, Life Sciences 60: 163-172.
To date, PNVs have been in the form of DNA plasmid
vectors which consist of a bacterial plasmid with a strong viral
promoter, the DNA fragment containing an open reading frame which
expresses the antigen of interest, and a polyadenylation/transcription
termination sequence. The DNA plasmid vector is transformed into and
grown in a bacterial host (such as E. coli) then purified and injected into
the host in an aqueous solution. This PNV is taken up by a host cell
(such as a muscle cell) wherein the antigen of interest is expressed. The
plasmid is constructed so as to lack a eukaryotic origin of replication to
limit host cell replication and/or host genome integration of the PNV
construct.
Benvenisty and Reshef (1986, Proc. Natl. Acad. Sci., 83:
9551-9555) showed expression of DNA co-precipitated with calcium
phosphate and introduced into mice intraperitoneally into liver and
spleen cells.
Subsequent studies by Wolff, et al. (1990, Science 247: 1465-
1468) showed that the intramuscular injection of DNA expression
vectors without CaP04 (e.g., in saline) in mice resulted in the uptake of
DNA by the muscle cells and expression of the protein encoded by the
DNA. The piasmids were maintained episomally and did not replicate
Wolff, et al., 1992, Humacn Mol. Genetics 1:363-369). Persistent
expression has been observed after intramuscular injection in skeletal
muscle of rats, fish and primates, and cardiac muscle of rats.
-2-
CA 02280839 1999-08-10
W0~98/35562 PCTlUS98/02414
Intravenous injection of » DNA:cationic liposome complex
in mice was shown by Zhu et al. (1993, Science 261: 209-211) to result in
systemic expression of a cloned trans~;ene.
It has been shown that a :PNV may be delivered to the target
cell by particle bombardment, whereb~~ the polynucleotide is adsorbed
onto gold microprojectiles and delivered directly intracellularly by high
velocity bombardment. This method has been used to induce an
immune response to human growth hormone (Tang, et al., 1992, Nature
356: 152-154), influenza HA (Eisenbramn, et al., 1993, DNA Cell Biol: 12:
791-797; Fynan, et al., 1993, Proc. Natl, Acad. Sci. 90: 11478-11482) and
HIV gp120 (Eisenbraun, et al., 1993, DNA Cell Biol: 12: 791-797).
One major advantage pw-ported of DNA vaccines is direct
injection of the construct of interest in a saline or PBS solution without
the addition of an adjuvant as seen with whole cell, acellular and
subunit vaccines.
Adjuvants which have historically been used to enhance the
immune response of classical whole cell, acellular and subunit vaccines
include the mineral based compounds such as aluminum phosphate,
aluminum hydroxide and calcium phosphate. These particular
compounds are known in the art for a history of safe use as vaccine
adjuvants, and are currently the only adjuvants approved for use in
humans in the United States. Calcium phosphate is currently approved
for use in humans in Europe. An ahuninum phosphate adjuvant is
actually amorphous aluminum hydrcrxyphosphate, Al(OH)m(P04)n and
an aluminum hydroxide adjuvant is actually an aluminum
oxyhydroxide composition, Al0(OH). Aluminum phosphate is
commercially available as an amorphous aluminum hydroxyphosphate
gel (known as Adju-Phos~). These adjuvants have different charges at
neutral pH, with Al0(OH) being positively charged and aluminum
phosphate being negatively charged (epee Gupta, et al., 1995, Ch.8 at page
231, in Vaccine Design: The Subunit .and Adjuvant Approach, Eds.
Powell and Newman, Plenum Press I:New York and London). Vaccines
containing A1P04 as an adjuvant are :Lcnown to stimulate IL-4 and a TH2-
type of helper T cell response, as well as increasing levels of IgGl and
IgE antibodies (Vogel and Powell, 1915, Ch.7, in Vaccine Design: The
Subunit and Adjuvant Approach, Eds. Powell and Newman, Plenum
Press (New York and London) ~ p. 142. Aluminum hydroxide is
-3-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
commercially available in crystalline form as aluminum oxyhydroxide
(Alhydrogel~), and is also known as boehmite. Vaccines comprising
Al0(OH) as an adjuvant also stimulate IL-4, T-helper-2 subsets, as well
as increasing levels of IgG1 and IgE antibodies (Vogel and Powell, 1995,
Ch.7, in Vaccine Design: The Subunit and Adjuuant Approach, Eds.
Powell and Newman, Plenum Press (lVew York and London) ~ p. 146.
It is also known in the art that preparations of both
amorphous aluminum hydroxyphosplzate gel and aluminum
oxyhydroxide used in commercial vaccines vary. Shirodkar, et al. ( 1990,
Pharm. Res. 7(12): 1282-1288) investigated nine commercially available
aluminum-containing adjuvants by X-ray diffraction, infrared
spectroscopy, electron microscopy anf. energy dispersive spectrometry.
These authors reiterate that the commercially available form of
aluminum phosphate is an amorphous hydroxyphosphate and the
aluminum hydroxide form is aluminum oxyhydroxide, or boehmite.
Effective adjuvanticity is :known to be dependent on
adsorption of the antigen of interest to an aluminum adjuvant. Studies
suggest that electrostatic forces are p<<ramount in effective absorption.
Seeber, et al. (1991, Vaccine 9: 201-203) show that the importance of
electrostatic forces is such that antigens with a high isoelectric point
should be adsorbed to Adju-Phos~ whE~reas antigens with a low
isoelectric point may best be adsorbed to (Alhydrogel~').
Al-Shakhshir, et al. (1994, Vacccine 12(5): 472-474 show that
protein adsorption to preformed aluminum adjuvants affects the surface
charge characteristics of the adjuvant. Therefore, knowledge of both the
adjuvant and protein surface properties are of importance in predicting
the nature of a classical antigen-adjuwant vaccine formulation.
As noted above, calcium phosphate is another mineral salt
which has been successfully used as an adjuvant to traditional protein
vaccines. The use of calcium phosphate as an adjuvant is known and
was first disclosed by Relyveld, et al. (1964, Bull. WHO 30: 321-325). The
properties of a calcium phosphate adjuwant gel are controlled by the
concentration of disodium hydrogen phosphate and calcium chloride
utilized, as well the mixing rate (i.e., slower mixing rates resulting in a
lower calcium to phosphate ratao). As with other adjuvants, binding to
the antigen of interest is a prerequisii;e for enhanced immunogenicity.
-4-
CA 02280839 1999-08-10
WO'98/35562 PCT/US98/02414
Despite advances in the use of naked DNA vector-based
vaccines, there is a distinct need for ~~ pharmaceutical formulation
which results in an enhanced immu~nE~ response in a vertebrate host of
interest. The present invention addresses this need by disclosing a DNA
vaccine formulation comprising an ad juvant which does not
substantially bind DNA and increases; immunogenicity subsequent to
vaccination of a vertebrate host.
SUMMARY OF THE INVENTION
The present invention relates to a novel vaccine formulation
comprising nucleic acid molecules and an adjuvant provided in a
biologically effective concentration so as to promote the effective
induction of an immune response directed toward one or more specific
antigens encoded by the nucleic acid molecule.
A particular embodiment of the present invention relates to
a DNA vaccine formulation wherein the adjuvant comprises mineral-
based particles which are negatively charged in the DNA suspension.
These particles possess a sufRcient negative charge as to substantially
retard binding to the nucleic acid molecule of interest. Such a DNA-
adjuvant composition will increase the immune response and may
decrease nuclease digestion of the DN.A vaccine, within the vertebrate
host subsequent to immunization.
A preferred embodiment of the present invention relates
to a DNA vaccine formulation which comprises a non-DNA binding
mineral-based adjuvant generated from one or more forms of an
aluminum phosphate-based adjuvant.
An especially preferred embodiment of the present
invention relates to a DNA vaccine for.~ulation wherein the
aluminum phosphate-based adjuvant possesses a molar P04 /Al ratio
of approximately 0.9, including but not limited to Adju-Phos~.
Another embodiment of the present invention relates to a
DNA vaccine formulation which comprises a non-DNA binding
mineral-based adjuvant generated from one or more forms of a
calcium phosphate-based adjuvant. I)NA vaccines formulated with
calcimm phosphate increase antibody responses when the adjuvant is
added at concentrations which do not result in a high percentage of
bound DNA. In other words, calcium phosphate is an effective
_ 5 ..
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
adjuvant for a DNA vaccine if the formulation contains a substantial
amount of free DNA.
The nucleic acid molecule of the present invention may
include a deoxyribonucleic acid molecule (DNA), such as genomic
DNA and complementary DNA (cDNA) as well as a ribonucleic acid
molecule (RNA). The nucleic acid molecules comprising the vaccine
formulations of the present invention preferably do not show
substantial binding to the chosen adjuvant. Of course, the skilled
artisan will be aware that within any such vaccine formulation, the
possibility remains that a measurable, but not biologically
determinative, amount of nucleic acid molecules used in the present
invention may bind to the chosen adjuvant.
The DNA construct may be delivered to the host in the form
of a recombinant viral vector (including but in no way limited to a
recombinant adenovirus vector, a recombinant adeno-associated vector,
recombinant retrovirus vector, a recombinant Sindbis virus vector, and a
recombinant alphavirus vector, all known in the art). The DNA
construct may also be delivered via a recombinant bacterial vector, such
as recombinant BCG or Salmonella. Alternatively, the DNA may be
associated with liposomes, such as lecithin liposomes or other liposomes
known in the art, as a DNA-liposome mixture (see, for example,
W093/24640). However, a preferred vaccine formulation of the present
invention comprises a non-viral DNA vector, most preferably a DNA
plasmid-based vector. Standard recombinant DNA techniques for
preparing and purifying DNA constructs are used to prepare the DNA
polynucleotide constructs utilized in the exemplified PNV vaccine
constructs disclosed throughout this specification.
Vaccine vectors for use in generating the vaccine
formulations of the present invention, as well as practicing the related
methods, include but are not necessarily limited to the DNA plasmid
vectors V1, V1J, VlJneo, VIJns, VIJp, V1R and VlJns-tPA.
The Example sections exemplify various polynucleotide
vaccine constructs, such as a DNA plasmid vector expressing
hemaggiutinin (HA), a surface glycoprotein of influenza A, the
nucleoprotein of influenza A, the HBsAg surface antigen from
hepatitis B, as well as gp 120 and gag constructs from HIV. Therefore, it
is evident that this specification gives excellent guidance to the skilled
-6-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
artisan to utilize the nucleic acid formulations of the present invention
with an additional construction not expressly exemplified in the
Example sections. Therefore, numerous other constructs representing
different DNA constructs, modes of delivery, disease and antigen targets
are envisioned for use in the vaccine formulations of the present
invention. Examples of viral or bacte~~ial challenges which may be
amenable to either a prophylactic or therapeutic treatment include but
are not limited to influenza, herpes simplex virus (HSV), human
immunodeficiency virus (HIV), tuberculosis, human papilloma virus,
hepatitis A, hepatitis B, and hepatitis C. It will also be within the scope
of the present invention to provide prophylactic or, most likely,
therapeutic treatment for non-infectious diseases, such as cancer,
autoimmune disorders, and various a1',lergies. Additionally, it will be
within the purview of the skilled artisan to utilize the formulations of the
present invention for any number of veterinary applications, including
but not limited to rabies, distemper, foot and mouth disease, anthrax,
bovine herpes simplex and bovine tuberculosis.
The present invention also relates to methods of generating
an immune response in a vertebrate lost, such as a human, by
administering the DNA vaccine formL~lations of the present invention.
The term "polynucleotide" as used herein is a nucleic acid
which contains essential regulatory ellements such that upon
introduction into a living, vertebrate cell, it is able to direct the cellular
machinery to produce translation products encoded by the genes
comprising the polynucleotide.
The term "substantially retard binding", "does not
substantially bind", or similar language as used herein refers the
concept that a small proportion of the nucleic acid may in fact bind
adjuvant within the vaccine formulation. However, any such bound
material does not affect the intended biological consequence of the
vaccine formulations of the present invention. Any decrease in
biological activity in response to such binding may easily be overcome by
adjusting slightly upward the dosage given to the vertebrate host.
The term "promoter" as used herein refers to a recognition
site on a DNA strand to which the R,hfA polymerase binds. The
promoter forms an initiation complex with RNA polymerase to initiate
and drive transcriptional activity. The complex can be modified by
-7-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
activating sequences termed "enhancers" or inhibiting sequences
termed "silencers."
The term "leader" as used herein refers to a DNA sequence
at the 5' end of a structural gene which is transcribed along with the
gene. The leader usually results in the protein having an N-terminal
peptide extension sometimes called a pro-sequence. For proteins
destined for either secretion to the extracellular medium or a
membrane, this signal sequence, which is generally hydrophobic,
directs the protein into endoplasmic reticulum from which it is
discharged to the appropriate destination.
The term "intron" as used herein refers to a portion or
portions of a gene which does not encode a portion of the gene product.
Introns from the precursor RNA are excised, wherein the resulting
mRNA translates the respective protein.
The term "cassette" refers to the sequence of the present
invention which contains the nucleic acid sequence which is to be
expressed. The cassette is similar in concept to a cassette tape. Each
cassette will have its own sequence. Thus by interchanging the cassette
the vector will express a different sequence. Because of the restrictions
sites at the 5' and 3' ends, the cassette can be easily inserted, removed or
replaced with another cassette.
The term "3' untranslated region" or "3' UTR" refers to the
sequence at the 3' end of a structural gene which is usually transcribed
with the gene. This 3' UTR region usually contains the poly A sequence.
Although the 3' UTR is transcribed from the DNA it is excised before
translation into the protein.
The term "Non-Coding Region" or "NCR" refers to the
region which is contiguous to the 3' UTR region of the structural gene.
The NCR region contains a transcriptional termination signal.
The term "vector" refers to some means by which DNA
fragments can be introduced into a host organism or host tissue. There
are various types of vectors which include but are not limited to
recombinant vectors, including DNA plasmid vectors, viral vectors such
as adenovirus vectors, retrovirus vectors and adeno-associated virus
vectors, as well as bacteriophage vectors and cosmid vectors.
-g-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
The term "biologically effective amount" means sufficient
PNV is injected to produce the adequate levels of the polypeptide. One
skilled in the art recognizes that this l~wel may vary.
The term "gene" refers to a segment of nucleic acid
which encodes a discrete polypeptide.
The terms "pharmaceutical" and "vaccine" are used
interchangeably to indicate compositions useful for inducing
immune responses.
BRIEF DESCRIPTION OF THE FIGURES
Figure lA and Figure 1B show the effect of aluminum
phosphate on the generation of anti-H~~ antibody titers in mice at 4
weeks post 1 injection (Figure lA) and 8 weeks post 1 injection (Figure
1B) at DNA HA doses of 0.5 ~tg and 10 yg.
Figure 2A and Figure 2B show a time course measurement
of anti-HA antibody titers in mice afte~~ a single innoculation of FR-9502
HA DNA (A/Georgia/93), with ( ~) and without (~ ) aluminum
phosphate injection at DNA HA doses of 0.5 ~g (Figure 2A) and 10 ~tg
(Figure 2B).
Figure 3A and Figure 3B show that a range of DNA doses
enhance the immune response in mice, as measured by anti-HA
antibody production after a single innoculation of FR-9502 HA DNA
(A/Georgia/93) as measured by HI titer (Figure 3A) or ELISA titer
(Figure 3B).
Figure 4 shows the enhancement of anti-NP antibody
responses in mice after innoculation with NP plasmid DNA with or
without aluminum phosphate at DNA doses of 5 ~.g and 50 ~g at 6 weeks
post 1 injection and 3 weeks post 2 injE~ctions.
Figure 5A (IL-2), Figure aiB (INF-Y), Figure 5C (IL-4) and
Figure 5D (IL-10) show the effect of aluminuui phosphate on respective
cytokine secretion from antigen restimulation spleen cells of NP plasmid
DNA inoculated mice (6 weeks post 1 injection and 3 weeks post 2
injection) at DNA doses of 5 mcg and fi0 mcg with one, two or three
injections.
Figure 6A - Figure 6D show the effect of aluminum
phosphate on the cytotoxic T lymphoc3~te response after a single
innoculation of NP plasmid DNA innoculation in mice: Figure 6A (5 ~.g
-9-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
DNA, 6 weeks post injection, flu-infected target cells); Figure 6B (5 ~.g
DNA, 6 weeks post injection, peptide pulsed target cells); Figure 6C (50
p.g DNA, 6 weeks post injection, flu-infected target cells); and, Figure 6D
(50 ~,g DNA, 6 weeks post injection, peptide-pulsed target cells).
Figure 7 shows the effect of aluminum phosphate on the
antibody response to inoculation of mice with a DNA vaccine (V1R.S)
encoding hepatitis B surface antigen. A leg dose of Recombivax HBO
was compared for immunogenicity with the V1R.S vaccine injected with
or without 45 ~g of aluminum phosphate (Adju-Phos~). Mice were
injected at day 0 and day 42 with Recombivax HBO ( ~), 100 ~tg HBV DNA
with adjuvant (~ ), 100 ~.g HBV DNA without adjuvant ( 1 ), or leg of
HBsAg (protein) without adjuvant (0 ).
Figure 8 shows the effect of HBV DNA vaccine (V1R.S)
dosing with and without adjuvant on HBsAg antibody production six
weeks after a single injection of mice. Forty five ~g of aluminum
phosphate (AdjuPhos~) or aluminum hydroxyphosphate was added
with 1 ~tg, 10 ~.g and 100 ~g HBV DNA with and without adjuvant.
Figure 9 shows the effect of a second dose at day 42 (bleed at
day 63) for the dosing effects disclosed for Figure 8.
Figure 10 shows the induction of a CTL response in
response to DNA vaccination with V1R.S for a formulation with and
without an aluminum phosphate adjuvant (45 ~g/100 ~1 sample).
Figure 11 shows the effect of aluminum phosphate or
calcium phosphate on the gp120 and gag antibody response after
inoculation of mice with a HIV env/gag DNA plasmid construct, as
measured by an ELISA assay.
Figure 12A and Figure 12B show a time course
measurement of anti-DNA antibody titers in rhesus monkeys after a
single inoculation with FR-9502 DNA as measured by geometric mean
HI titer (Figure 12A) or ELISA (Figure 12B).
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a novel vaccine formulation
comprising nucleic acid molecules and an adjuvant provided in a
biologically effective concentration so as to promote the effective
- 10-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
induction of an immune response directed toward one or more specific
antigens encoded by the nucleic acid rnolecule.
A particular embodiment of the present invention relates to
a DNA vaccine formulation wherein the adjuvant comprises mineral-
s based particles which are negatively charged in the DNA suspension.
These particles possess a sufficient negative charge as to substantially
retard binding to the nucleic acid molE:cule of interest. Such a DNA-
adjuvant composition will increase the immune response and may
decrease nuclease digestion of the DNA vaccine, within the vertebrate
host subsequent to immunization.
A preferred embodiment of the present invention relates
to a DNA vaccine formulation which comprises a non-DNA binding
mineral adjuvant generated from one or more forms of an aluminum
phosphate-based adjuvant. The term "aluminum phosphate" is
oftentimes used in the art to describe members of a continuous series
of aluminum hydroxyphosphate compositions in which the molar
P04 /Al ratio ranges from about 0.3 to about 0.9 (Hem and White, 1995,
Ch. 9, in Vaccine Design: The Subunit and Adjuvant Approach, Eds.
Powell and Newman, Plenum Press (ZJew York and London). As
noted throughout this specification, n~imerous conditions exist to
generate the various aluminum hydroxyphosphate gels for use in the
vaccine formulations of the present invention. For instance, the
skilled artisan will note that Hem and White, supra at page 244-255
describe specific factors which will affect the surface charge of the
resulting adjuvant. Hem and White state that generating an
aluminum phosphate adjuvant with aluminum salts having a weak
affinity for aluminum, such as aluminium chloride, will result in an
adjuvant with a higher phosphate content than using an aluminum
salt with a higher afl~nity toward alwninum, such as a sulfate
anion. It will also be possible to affect the final adjuvant composition
by controlling the speed of mixing, the speed and conditions for
adjuvant precipitation, heating, and other physical manipulations
known to the skilled artisan. In other words, numerous strategies
are known and are available to gener~~te an aluminum phosphate-
based adjuvant which has a molar P04/Al ratio such that the
adjuvant will carry a net negative charge and would be expected to
- 11-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
not substantially bind to DNA in the vaccine formulations of the
present invention.
An especially advantageous aluminum phosphate
adjuvant, albeit by no means a limiting one, is a substantially
negatively charged aluminum phosphate based adjuvant wherein the
molar P04/Al is approximately 0.9. For example, Adju-Phos~ is a
commercially available form of amorphous aluminum
hydroxyphosphate gel which represents an especially preferred
adjuvant for use in the DNA vaccine formulations of the present
invention. This preference depends on the fact that the amorphous
aluminum hydroxyphosphate Adju-Phos~ is comprised of negatively
charged, micron-sized particles which do not substantially bind DNA
in the formulations of the present invention.
The skilled artisan will be aware that the nature of the
adjuvant and its ability to bind classic antigens is effected by the
conditions whereby the adjuvant is initially precipitated, the
precipitation conditions, pH, temperature, and ionic strength. These
same type of component manipulations will be available to the skilled
artisan to alter the surface charge of various aluminum phosphate-
based adjuvants to create an adjuvant surface charge conducive to
use in the DNA vaccine formulations of the present invention.
Therefore, it will be within the purview of the skilled artisan to take
an aluminum hydroxyphosphate adjuvant with, say for example, a
molar P04/Al ratio closer to 0.3, and alter the conditions of the
vaccine formulation such that the manipulated adjuvant will possess
a negative surface charge which substantially retards DNA binding.
It is also within the boundary of the present invention to manipulate
an aluminum hydroxide adjuvant (such as Alhydrogel~) by
manipulating conditions including but not limited to adjuvant
precipitation conditions, formulation buffer conditions, pH,
temperature, and ionic strength. The goal of such an adjuvant
manipulation will be to generate an adjuvant with a negatively
charged surface such that adjuvant-DNA binding will be
substantially prohibited. Therefore, the skilled artisan will
understand after review of this specification that negatively charged
adjuvants which inhibit substantial adjuvant-DNA binding may be
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
generated by any number of procedures which are well known and
readily available.
Also, the skilled artisan will be aware that non-
commercial sources of aluminum phosphate-based adjuvants may be
formed for use in the DNA vaccine formulations of the present
invention. Such methods include but are in no way limited to mixing
aluminum chloride and trisodium phosphate to generate aluminum
phosphate. Once again, the skilled artisan is aware that the nature
of the adjuvant and its ability to bind t,o classic antigens is affected by
numerous variables, including but not limited to adjuvant
precipitation conditions, formulation 'buffer conditions, pH,
temperature, and ionic strength. These same type of component
manipulations will be available to the skilled artisan to alter the
surface charge of various non-commE~rcial forms of aluminum
hydroxyphosphate adjuvants to creatE~ an adjuvant surface charge
conducive to use in the DNA vaccine formulations of the present
invention. More specifically, these negatively charged adjuvants will
inhibit substantial adjuvant-DNA binding and will promote the
expected immune response upon vertebrate host vaccination. The
present invention also relates to DNt?v vaccine formulations which
comprise a calcium phosphate-based adjuvant. A calcium phosphate
adjuvant gel may be generated by known methods of mixing
disodium hydrogen phosphate and calcium chloride. As noted
within this specification for aluminwn phosphate-based adjuvants, a
preferred calcium phosphate adjuvant for the vaccine formulations of
the present invention is an adjuvant with a sufficient negative
surface charge as to substantially ret;ird binding to the DNA
construct of interest. Data is presented in Example section 10
showing that calcium phosphate is air effective adjuvant for DNA
vaccines so long a there remains witl>in the formulation a
substantial amount of free (i.e., unbomnd) DNA. It will be within the
purview of the artisan to determine an optimal adjuvant and DNA
dose or dose range so as to maximize the adjuvant effect while a
biologically active amount of free DNA remains in the formulation.
The DNA vaccine formulations of the present invention will contain
from about 1 to about 20,000 mcg of F~luminum or calcium (in an
adjuvanted form such as aluminum phosphate, calcium phosphate),
- 1~3 -
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
preferably from about 10 to about 10,000 mcg and most preferably
from about 25 to about 2,500 mcg. Particular formulations may
require particular amounts within these ranges, for example, about
20, 45, 90, 100, 200, 450, ?50, 900, 1,500, 2,500, 3,500 mcg, 10,000 mcg,
etc., or other amounts not listed here, may be used. It is noted that a
majority of data reported for mice in the Example sections utilize a
100 ~tl injection of the DNA vaccine formulation. Therefore, a
formulation comprising aluminum at 450 mcg/mL results in a 45
mcg dose of aluminum, and is referred throughout the specification
as an adjuvant dose, such as 450 mcg/mL of Adju-Phos~. It should
be noted that the term "mcg" is used interchangebly with "fig"
throughout this specification to represent the unit of measurement,
microgram.
The nucleic acid molecule of the present invention may
include a deoxyribonucleic acid molecule (DNA), such as genomic
DNA and complementary DNA (cDNA) as well as a ribonucleic acid
molecule (RNA). The DNA of the present invention is associated, but
preferably does not bind, a mineral-based adjuvant.
The DNA construct may be delivered to the host in the form
of a recombinant viral vector (including but in no way limited to a
recombinant adenovirus vector, a recombinant adeno-associated vector,
recombinant retrovirus vector, a recombinant Sindbis virus vector, and a
recombinant alphavirus vector, all known in the art). The DNA
construct may also be delivered via a recombinant bacterial vector, such
as recombinant BCG or Salmonella. Alternatively, the DNA may be
associated with lipids to form DNA-lipid complexes or with lipids in the
form of liposomes, such as lecithin liposomes or other liposomes known
in the art, to form DNA-liposome mixture (see, for example,
W093/24640.
However, a preferred vaccine formulation of the present
invention comprises a non-viral DNA vector, most preferably a DNA
plasmid-based vector. Standard recombinant DNA techniques for
preparing and purifying DNA constructs are used to prepare the DNA
polynucleotide constructs utilized in the exemplified PNV vaccine
constructs disclosed throughout this specification. A gene of interest is
ligated into an expression vector which has been optimized for
polynucleotide vaccinations. Extraneous DNA is at least partially
- 14-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
removed, leaving essential elements such as a transcriptional promoter,
immunogenic epitopes, transcriptional terminator, bacterial origin of
replication and antibiotic resistance gene.
The amount of expressible DNA to be introduced to a
vaccine recipient will depez;d on the strength of the transcriptional and
translational promoters used in the Dl'.VA construct, and on the
immunogenicity of the expressed gene product. In general, an
immunologically or prophylactically efl~ective dose of about 1 ~g to
greater than about 5 mg, and preferably about 10 ~tg to 2 mg is
administered directly into muscle tissue. Subcutaneous injection,
intradermal introduction, impression through the skin, and other
modes of administration such as intraperitoneal, intravenous,
inhalation and oral delivery are also contemplated. It is also
contemplated that booster vaccinations are to be provided. In this case, it
is desirable for the DNA to be in a physiologically acceptable solution,
such as, but not limited to, sterile saline or sterile buffered saline, taking
into consideration the effect that pH, buffer conditions and ionic charge
may have on the net surface charge of the mineral-based adjuvant used
to formulate the DNA vaccines of the present invention.
Vaccine vectors for use in. practicing the present invention
include but are not necessarily limited to the DNA plasmid vectors V1,
V 1J, V 1R, V lJp, V lJneo, VIJns, and V lJns-tPA,
Vaccine vector V1 was constructed from pCMVIE-AKI-
DHFR (Whang et al., 1987, J. Virol. 61: 1796). The AKI and DHFR genes
were removed by cutting the vector with EcoRI and self Iigating. This
vector does not contain intron A in the. CMV promoter, so it was added
as a PCR fragment that had a deleted :internal SacI site [at 1855 as
numbered in Chapman, et al., 1991, N'uc. Acids Res. 19: 3979). The
template used for the PCR reactions vvas pCMYintA-Lux, made by
ligating the HindIII and NheI fragment from pCMV6a120 (see
Chapman et al., ibid.), which includes hCMV-IE1 enhancer/promoter
and intron A, into the HindIII and Xb~~I sites of pBL3 to generate
pCMVIntBL. The 1881 base pair luciferase gene fragment (HindIII-
SmaI Klenow filled-in) from RSV-Lux (de Wet et al., 1987, Mol. Cell Biol.
7: 725) was ligated into the SaII site off pCMVIntBL, which was HIenow
filled-in and phosphatase treated. The primers that spanned intron A
are: 5' primer: 5'-CTATATAAGCAG~~GCTCGTTTAG-3' (SEQ ID
-15-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
N0:1); 3' primer: 5'-GTAGCAAAGA.TCTAAGGACGGTGACTGCAG-3'
(SEQ ID N0:2). The primers used to remove the SacI site are:
sense primer, 5'-GTATGTGTCTGAAAATGAGC~GGAGATTGGGC
TCGCAC-3' (SEQ ID N0:3) and the antisense primer,
. 5'-GTGCGAGCCCAATCTCC~GCTCATTTTCAGACACATAC-3'
(SEQ ID N0:4). The PCR fragment was cut with Sac I and Bgl II and
inserted into the vector which had been cut with the same enzymes.
A V1J expression vector may be generated to remove the
promoter and transcription termination elements from vector V 1 in
order to place them within a more defined context, create a more
compact vector, and to improve plasmid purification yields. V1J is
derived from vectors V1 and pUCl8, a commercially available plasmid.
V1 was digested with SspI and EcoRI restriction enzymes producing two
fragments of DNA. The smaller of these fragments, containing the
CMVintA promoter and Bovine Growth Hormone (BGH ) transcription
termination elements which control the expression of heterologous
genes, was purified from an agarose Electrophoresis gel. The ends of
this DNA fragment were then "blunted" using the T4 DNA polymerase
enzyme in order to facilitate its ligation to another "blunt-ended" DNA
fragment. pUCl8 was chosen to provide the "backbone" of the
expression vector. It is known to produce high yields of plasmid, is well-
characterized by sequence and function, and is of small size. The entire
lac operon was removed from this vector by partial digestion with the
HaeII restriction enzyme. The remaining plasmid was purified from
an agarose electrophoresis gel, blunt-ended with the T4 DNA
polymerase treated with calf intestin~~l alkaline phosphatase, and
ligated to the CMVintA/BGH element. described above. Plasmids
exhibiting either of two possible orientations of the promoter elements
within the pUC backbone were obtained. One of these plasmids gave
much higher yields of DNA in E. coli and was designated V1J. This
vector's structure was verified by sequence analysis of the junction
regions and was subsequently demonstrated to give comparable or
higher expression of heterologous genes compared with V1.
Construction of the V lJneo expression vector requires
removal of the ampr gene used for antibiotic selection of bacteria
harboring V1J because ampicillin may not be desirable in large-scale
fermenters. The ampr gene from the pUC backbone of V1J was removed
- 1fi -
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
by digestion with SspI and Eam1105I restriction enzymes. The
remaining plasmid was purified by al;arose gel electrophoresis, blunt-
ended with T4 DNA polymerase, and i:hen treated with calf intestinal
alkaline phosphatase. 'The commerci~~lly available kanr gene, derived
from transposon 903 and contained within the pUC4K plasmid, was
excised using the PstI restriction enz3~nne, purified by agarose gel
electrophoresis, and blunt-ended with T4 DNA polymerase. This
fragment was ligated with the V 1J backbone and plasmids with the kanr
gene in either orientation were derived which were designated as
VlJneo #'s 1 and 3. Each of these plasmids was confirmed by restriction
enzyme digestion analysis, DNA sequencing of the junction regions, and
was shown to produce similar quantifies of plasmid as V1J. Expression
of heterologous gene products was also comparable to V1J for these
VlJneo vectors. VlJneo#3, referred to as VlJneo hereafter, was
selected which contains the kanr gene in the same orientation as the
ampr gene in V1J as the expression construct.
The expression vector Vhfns was generated by adding an
SfiI site to V lJneo to facilitate integration studies. A commercially
available 13 base pair SfiI linker (New England BioLabs) was added at
the KpnI site within the BGH sequence of the vector. VlJneo was
linearized with KpnI, gel purified, blurted by T4 DNA polymerase, and
ligated to the blunt SfiI linker. Clonal isolates were chosen by restriction
mapping and verified by sequencing tr~rough the linker. The new vector
was designated VlJns. Expression of heterologous genes in VlJns (with
SfiI) was comparable to expression of t;he same genes in VlJneo (with
KpnI).
The DNA vaccine vector ~TlJns-tPA was constructed in
order to provide an heterologous leaden peptide sequence to secreted
and/or membrane proteins. Plasmid VlJns was modified to include the
human tissue-specific plasminogen activator (tPA) leader. Two
synthetic complementary oligomers wE~re annealed and then ligated into
VlJn which had been BgIII digested. 'The sense and antisense
oligomers were 5'-GATCACCATG =A'1~GCAATGAAGAGAGGGCTC
TGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGC
GA-3' (SEQ ID N0:5); and, 5'-GATC'.CCGCTGGGCGAAACGAAGA
CTGCTCCACACAGCAGCAGCACAt;AGCAGAGCCCTCTCTTCATT
GCATCCATGGT-3' (SEQ ID N0:6). T:he Kozak sequence is underlined
- 17-
CA 02280839 1999-08-10
WO 98/35562 PG"f/US98/02414
in the sense oligomer. These oligomers have overhanging bases
compatible for ligation to BglII-cleaved sequences. After ligation the
upstream BglII site is destroyed while the downstream BglII is retained
for subsequent ligations. Both the junction sites as well as the entire tPA
leader sequen:~e were verified by DNA. sequencing. Additionally, in
order to conform with the consensus optimized vector VlJns (=VlJneo
with an SfiI site), an SfiI restriction site was placed at the KpnI site
within the BGH terminator region of 'JlJn-tPA by blunting the KpnI site
with T4 DNA polymerase followed by :ligation with an SfiI linker
(catalogue #1138, New England Biolabs). This modification was verified
by restriction digestion and agarose gel electrophoresis.
Yet another DNA vaccine vector, V 1R, may be utilized to
practice the present invention. This Ir~NA vaccine vector is a derivative
of VlJns. This vector is useful to obt~un a minimum-sized vaccine vector
without unneeded DNA sequences, which still retained the overall
optimized heterologous gene expression characteristics and high
plasmid yields that V 1J and V lJns afford. It was determined that ( 1 )
regions within the pUC backbone comprising the E. coli origin of
replication could be removed without .affecting plasmid yield from
bacteria; (2) the 3'-region of the kanr gene following the kanamycin open
reading frame could be removed if a bacterial terminator was inserted in
its place; and, (3) -.300 by from the 3'- :half of the BGH terminator could
be removed without affecting its regulatory function (following the
original KpnI restriction enzyme site within the BGH element). V1R
was constructed by using PCR to syntl':~esize three segments of DNA
from V lJns representing the CMVintA promoterBGH terminator,
origin of replication, and kanamycin resistance elements, respectively.
Restriction enzymes unique for each segment were added to each
segment end using the PCR oligomers: SspI and XhoI for
CMVintABGH; EcoRV and BamHI for the kan r gene; and, BclI and
SalI for the on r. These enzyme sites were chosen because they allow
directional Iigation of each of the PCR-derived DNA segments with
subsequent loss of each site: EcoRV and SspI leave blunt-ended DNAs
which are compatible for ligation while BamHI and BclI leave
complementary overhangs as do SalI ~md XhoI. After obtaining these
segments by PCR each segment was digested with the appropriate
restriction enzymes indicated above and then ligated together in a single
_ 1g ..
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
reaction mixture containing all three :DNA segments. The 5'-end of the
on r was designed to include the T2 rho independent terminator
sequence that is normally found in this region so that it could provide
termination information for the kana~nycin resistance gene. The ligated
product was confirmed by restriction f~nzyme digestion (>8 enzymes) as
well as by DNA sequencing of the ligation junctions. DNA plasmid
yields and heterologous expression using viral genes within V1R appear
similar to VlJns. The net reduction in vector size achieved was 1346 by
(VlJns = 4.86 kb; V1R = 3.52 kb). PCFr~ oligomer sequences used to
synthesize V1R (restriction enzyme sites are underlined and identified
in brackets following sequence) are as follows: (1) 5'-GGTACA
AATA TTGGCTATTGGCCATTGCAT~ACG-3' (SEQ ID N0:7) [SspI]; (2)
5'-CCACAT~CGAGGAACCGGGTC.AATTCTTCAGCACC-3' (SEQ ID
N0:8) [XhoI] (for CMVintA/BGH segnnent); (3) 5'-GGTACAGAT
ATCGGAAAGCCACGTTGTGTCTCA,AAATC-3' (SEQ.ID N0:9)
[EcoRV]; (4) 5'-CACAT = =AT GTA~~TGCTCTGCCAGTGTT
ACAACC-3' (SEQ ID NO:10) [BamHI], (for kanamycin resistance gene
segment) (5) 5'-GGTACATGATCACGTAGAAAAGATCAAAGG
ATCTTCTTG-3' (SEQ ID NO:11) [BclI); (6) 5'-CCACAT,~'',GACCCG
TAAAAAGGCCGCGTTGCTGG-3' (SE~Q ID N0:12): [SalI], (for E. coli
origin of replication).
The Example sections exemplify various polynucleotide
vaccine constructs, such as a DNA plasmid vector expressing
hemagglutinin (HA), a surface glycoprotein of influenza A, the
nucleoprotein of influenza A, the HBsAg surface antigen from
hepatitis B, as well as gp 120 and gag constructs from HIV. Therefore, it
is evident that this specification gives excellent guidance to the skilled
artisan to utilize the nucleic acid formulations of the present invention
with an additional construction not expressly exemplified in the
Example sections. Therefore, it will beg within the purview of the skilled
artisan to grasp the teachings of this specification so as to use any
variation in regard to the type of nuclE;ic acid molecule used (such as
DNA plasmid, recombinant viral vectors such as adenovirus, adeno-
associated virus, retrovirus) as well as the type of viral or bacterial
antigen expressed. Examples of viral or bacterial challenges which may
be amenable to either a prophylactic or therapeutic treatment include
but are not limited to influenza, herpes simplex virus (HSV), human
- 19 -
CA 02280839 1999-08-10
WO 98/35562 PCT/LTS98/02414
immunodeficiency virus (HIV), tuberculosis, human papilloma virus,
hepatitis A, hepatitis B, and hepatitis C. It will also be within the scope
of the present invention to provide prophylactic or therapeutic treatment
for non-infectious diseases, such as cancer, autoimmune disorders, and
vari~~us allergies. This approach to vaccination will be applicable to
tumors as well as infectious agents, since the CD8+ CTL response is
important for both pathophysiological processes (Tanaka, et al., 1988,
Annu. Rev. Immunol. 6: 359). Therefore, eliciting an immune response
against a protein crucial to the transformation process may be an
effective means of cancer protection or immunotherapy. The generation
of high titer antibodies against expressed proteins after injection of viral
protein and human growth hormone DNA suggests that this is a facile
and highly effective means of making vaccines that induce, either
separately or in combination with other vectors, antibody and/or CTL
responses. The DNA vaccine formulations of the present invention will
also be useful for any number of veterinary applications, including but
not limited to rabies, distemper, foot and mouth disease, anthrax, bovine
herpes simplex and bovine tuberculosis.
An improved HSV polynucleotide vaccine formulation of the
present invention will comprise a nucleic acid vector encoding an HSV
antigen of interest, including but not limited to gB, gD, DgB (encoding
the amino-terminal 707 as of HSV-2 gB) and OgD, alone or in
combination.
The vaccine formulations of the present invention may also
be directed to the prophylactic treatment of human immunodeficiency
virus-1 (HIV-1). It is well known that HIV-1 is the etiological agent of
acquired human immune deficiency syndrome (AIDS) and related
disorders. HIV-1 is an RNA virus of the Retroviridae family and
exhibits the 5'LTR gag pol-env-LTR3' organization of all retroviruses.
In addition, HIV-1 comprises a handful of genes with regulatory or
unknown functions, including the tat and rev genes. The env gene
encodes the viral envelope glycoprotein that is translated as a 160-
kilodalton (kDa) precursor (gp160) and then cleaved by a cellular
protease to yield the external 120-kDa envelope glycoprotein (gp120) and
the transmembrane 41-kDa envelope glycoprotein (gp41). Gp120 and
gp41 remain associated and are displayed on the viral particles and the
surface of HIV-infected cells. Gp120 binds to the CD4 receptor present
_ 2p _
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
on the surface of helper T-lymphocytes,, macrophages and other target
cells. After gp120 binds to CD4, gp41 mediates the fusion event
responsible for virus entry.
Infection begins when gp120 on the viral particle binds to
the CD4 receptor on the surface of T4 lymphocytes or other target cells.
The bound virus merges with the targea cell and reverse transcribes its
RNA genome into the double-stranded DNA of the cell. The viral DNA is
incorporated into the genetic material in the cell's nucleus, where the
viral DNA directs the production of new viral RNA, viral proteins, and
new virus particles. The new particles bud from the target cell
membrane and infect other cells.
Expression of HIV late genes such as env and gag is rev-
dependent and requires that the rev response element (RRE ) be present
on the viral gene transcript. A secreted form of gp120 can be generated
in the absence of rev by substitution of the gp120 leader peptide with a
heterologous leader such as from tPA (tissue-type plasminogen
activator), and preferably by a leader peptide such as is found in highly
expressed mammalian proteins such ~~s immunoglobulin leader
peptides. A tPA-gp120 chimeric gene cloned into VlJns efficiently
expresses secreted gp120 in a transfected human rhabdomyosarcoma
cell line. Monocistronic gp160 does noi; produce any protein upon
transfection without the addition of a rev expression vector.
Representative construct components include but are not limited to tPA-
gp120~, gp160IIIB, gagIIIB: for anti-gczg CTL, tPA-gp120IIIg, tPA-
gp140, and tPA-gp160 with structural mutations: V1, V2, and/or V3 loop
deletions or substitutions.
The protective efficacy of polynucleotide HIV immunogens
against subsequent viral challenge is demonstrated by immunization
with the non-replicating plasmid DNA. This is advantageous since no
infectious agent is involved, assembly of virus particles is not required,
and determinant selection is permitted. Furthermore, because the
sequence of gag and protease and several of the other viral gene products
is conserved among various strains of HIV, protection against
subsequent challenge by a virulent strain of HIV that is homologous to,
as well as strains heterologous to the strain from which the cloned gene
is obtained, is enabled.
-21-
CA 02280839 1999-08-10
W0 98135562 PCT/ITS98102414
The i.m. injection of a DNA expression vector encoding
gp160 results in the generation of significant protective immunity
against subsequent viral challenge. In particular, gp160-specific
antibodies and primary CTLs are produced. Immune responses
directed against conserved proteins can be effective despite the antigenic
shift and drift of the variable envelope proteins. Because each of the HIV
gene products exhibit some degree of conservation, and because CTL are
generated in response to intracellular expression and MHC processing,
it is predictable that many virus genes give rise to responses analogous
to that achieved for gp160. Therefore, the DNA vaccine formulations of
the present invention offers a means to induce cross-strain protective
immunity without the need for self replicating agents.
The ease of producing and purifying DNA constructs
compares favorably with traditional methods of protein purification,
thus facilitating the generation of combination vaccines. Accordingly,
multiple constructs, for example encoding gp160, gp120, gp4l, or any
other HIV gene may be prepared, mixed and co-administered. Because
protein expression is maintained following DNA injection, the
persistence of B- and T-cell memory may be enhanced, thereby
engendering long-lived humoral and cell-mediated immunity.
It is also within the realm of the present invention to
include additional components to the nucleic acid-adjuvant comprising
vaccine formulations of the present invention. For example, HIV DNA-
adjuvant-based formulations may also comprise antigenic protein as
well as additional known adjuvants, such as saponin, to further
enhance the immune response within the vertebrate host. It is within
the purview of the skilled artisan to add such components to the vaccine
formulations of the present invention.
It is also within the scope of the present invention to use
DNA formulations which comprise DNA vaccine constructs providing
an immune response to M. tuberculosis. A preferred antigen is the
Ag85A, the Ag85B, or the Ag85C antigen. Vaccine constructs include
but are not limited to ( 1 ) a construct which contains the either the
mature Ag85A, B or C coding region fused with tPA signal sequence; (2)
a construct which contains the mature Ag85A, B, or C coding region
with no signal sequence; (3) a construct which contains Ag85A, B, or C
with its own signal sequence.
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
The vaccine formulations of the present invention are
exemplified utilizing a DNA plasmid encoding HA from the
A/Georgia/93 strain. However, the skilled artisan will be directed to the
use of additional influenza genes which encode antigens of interest.
Such genes include but in not necesssu-ily limited to human influenza
virus nucleoprotein, basic polymerase 1, nonstructural proteinl,
hemagglutinin, matrixl, basic polymE~rase 2 of human influenza virus
isolate A/PRJ8/34, the nucleoprotein of human influenza virus isolate
A/Beijing/353189, the hemagglutinin l;ene of human influenza virus
isolate A/Texas/36/91, or the hemagglutindn gene of human influenza
virus isolate B/Panama/46/90.
It will also be known to the skilled artisan that the vaccine
formulations of the present invention may comprise combinations of
DNA plasmid constructs expressing HA from other clinical strains,
including but not limited to, A/H 1N 1 (A/Texas/91 ), and B (B/Panama/90 ),
as well as DNA constructs encoding the internal conserved influenza
nucleoprotein (NP) and M1 (matrix) from both A (Beijing/89; H3N2) and
B strains may be utilized in order to provide group-common protection
against drifted and shifted antigens. The HA DNA will function by
generating HA and resulting neutralizing antibodies against HA. This
will be type-specific, with some increased breadth of protection against a
drifted strain compared to the current licensed, protein-based vaccine.
The NP and M1 constructs will result in the generation of CTL which
will provide cross-strain protection with potentially lower viral loads and
with acceleration of recovery from illness. The expected persistence of
the DNA constructs (in an episomal, non-replicating, non-integrated
form in the muscle cells) is expected to provide an increased duration of
protection compared to the current vaccine.
The present invention reJlates to methods of generating an
immune response in a vertebrate host, especially a human, wherein the
vaccine formulations are administered to the host by any means known
in the art of DNA vaccines, such as enteral and parenteral routes.
These routes of delivery include but are not limited to intramusclar
injection, intraperitoneal injection, intravenous injection, inhalation or
intranasal delivery, oral delivery, suhlingual administration,
subcutaneous administration, transdermal administration,
transcutaneous administration, perclitaneous administration or any
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
form of particle bombardment. The preferred methods of delivery are
intramuscular injection, intranasal and oral based deliveries. An
especially preferred method is intramuscular delivery. Regarding
particle bombardment, use of aluminum adjuvants or calcium
phosphate adjuvants as outlined in this specification will improve the
immune response produced by DNA delivered ballistically, on gold beads
or as compacted particles. It will be well within the purview of the
skilled artisan to deliver a formulation of the present invention as a
simultaneous ballistic delivery of the DNA coated gold beads mixed with
the aluminum or calcium adjuvant or as a subcutaneous or
intramuscular injection of the adjuvant, followed by "gene gun" delivery
of the DNA at or near the site of the adjuvant injection. The following
examples are provided to further define the invention, without limiting
the invention to the specifics of the examples.
EXAMPLE 1:
IN VITRO BINDING OF PLASMID DNA
TO ALUMINUM ADJUVANTS
An experiment was designed to test the ability of various
aluminum adjuvants to bind to plasmid DNA. Six different types of
aluminum salts were examined, including aluminum hydroxide,
aluminum hydroxyphosphate (precipitated in the presence of 3, 6, 12 or
24 mM sodium phosphate) and Adju-Phos~'. The aluminum hydroxide
(Alhydrogel~) and Adju-Phos~ were purchased from Superfos Biosector,
Denmark. The aluminum hydroxyphosphate adjuvants were prepared
by preciptiating aluminum potassium sulfate in 3mM, 6mM, l2mM and
24m.M sodium phosphate, respectively. The results of this binding study
is summarized in Table 1. FR-9502 is a VlJp based DNA plasmid vector
with the gene encoding HA (A/Georgia/93 ). The FR-9502 plasmid DNA
binds to all of the aluminum salts, except for Adju-Phos~. These results
were based on a 15 minute, 16 hour or 72 hour incubation period using
either 5 or 100 mcg/mL plasmid DNA and 450 mcg/mL of aluminum
adjuvant, at 2-8 °C. For all the adjuvants except aluminum phosphate
the binding studies were performed in saline because the presence of
phosphate will change the surface charge of the adjuvant to become
more like aluminum phosphate (Hem and White, 1995, Ch. 9, in
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
Vaccine Design: The ~ubunit and Adjuvant Approach, Eds. Powell and
Newman, Plenum Press (New York arid London). The binding studies
for aluminum phosphate were performed in PBS to allow a better
comparison with the PBS control in the subsequent animal studies
designed to examine the immune response. The samples were
centrifuged and aliquots of the supernatant were taken and applied to a
1% agarose gel. Ethidium bromide stauning of the gel following
electrophoresis revealed the amount of total plasmid in solution by
comparison to standards. It was also observed that there was no
significant change in the supercoiled content of plasmid DNA after
incubation with Adju-Phos~' . Therefore, no significant binding of
plasmid DNA to aluminum phosphate-based adjuvant such as Adju-
Phos~ was observed, even after 3 days of incubation, based on
quantitation of the supercoiled DNA bends in the gel. In contrast,
partial binding in 15 minutes and complete binding of the DNA after 3
days was observed for Alhydrogel~) arid various aluminum
hydroxyphosphate adjuvants tested.
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
TABLE 1
Binding of plasmid DNA to aluminum adjuvants at 4 °C.
Type of Adjuvanta[DNA]b IncubationResults
Al(OH)3 5 16 hrs complete binding
,. ., ,. ..
0.5A1(OH)x(P04)y
lAl(OH)x(P04)y
2A1(OH)x(P04)y,~ " .. .. .. "
4Al(OH)x(P04)y" " ., ., " .,
AIP04 " " " " no binding observed
Al(OH)3 5 & 15 min complete ~ 5/partial
100 ~ 100
0.5A1(OH)x(P04)y.. .. ,. .. .,
lAl(OH)x(P04)y.. ., .. " .,
2A1(OH)x(P04)y, " ,. ,. .,
4Al(OH)x(P04)y.. .' ,. .. ..
A1P04 " " " no binding observed
Al(OH)3 5 & 3 days complete ~ 5 and 100
100
0.5A1(OH)x(P04)y. ,~ ,. ,. .,
lAl(OH)x(P04)y,~ ,~ .,
2A1(OH)x(P04)y., " " .,
4Al(OH)x(P04)y, ,~
AiP04 " " " no binding observed
aType of adjuvant: 0.5 - 4 refer to aluminum hydroxyphosphate prepared by
precipitation in 3, 6, 12 or 24 mM sodium phosphate, respectively. The points
of zero
charge for aluminum hydroxide, aluminum hydroxyphosphate, and aluminum
phosphate are estimated to be - 11, 7 and 5). The aluminum concentration was
450
mcg/mL.
bDNA concentration is expressed as mcg/mL.
Plasmid DNA at 5 and 100 mcg/mL was incubated in the
presence and absence of 450 mcg/mL Adju-Phos in PBS buffer for 10
days at 2-8 oC. Aliquots of the DNA were then subjected to agarose
gel electrophoresis and ethidium bromide staining. Densitometry
was used to scan a negative of a photograph of the gel to determine
CA 02280839 1999-08-10
W0 98/35562 _ PCTNS98/02414
the binding state of the DNA and the amount of supercoiled, open-
circular and linear forms, by comparison to DNA standards. The
results indicated that the DNA in the .5 mcg/mL DNA samples with
and without aluminum phosphate wae~ 96% supercoiled, while the
DNA in the 100 mcg/mL DNA sampleF~ was 95% supercoiled.
Therefore, the presence of aluminum F~hosphate did not alter the
stability of the DNA over this period of time. The gel lanes containing
DNA from the 5 mcg/mL DNA samples with and without aluminum
phosphate contained 15.0 and 15.1 ng of DNA, respectively. The gel
lanes containing DNA from the 100 a~cg/mL DNA samples with and
without aluminum phosphate contained 14.9 and 13.7 ng of DNA,
respectively. Therefore, there was no apparent binding of the DNA to
the aluminum phosphate over the 10 d.ay incubation period.
EXAMPI;..E 2
INHIBITION OF NUCLEASES IN MOUSE AND HUMAN
SERA BY ALUMINUM PHOSPHATE.
This section examines the ability of aluminum phosphate to
inhibit endogenous nucleases present in mouse and human sera. Since
aluminum phosphate carries a negative surface charge one may reason
that nucleases may bind to aluminum phosphate and lengthen the
lifetime of the DNA in uiuo, after intra~muscular injection. The results
indicate that the addition of 450 mcg/mL aluminum phosphate (Adju-
Phos~) to a PBS solution containing 5 ~mcg/mL DNA and either 10%
human serum or 2.5% mouse serum resulted in a significant inhibition
of nuclease digestion of DNA. The results also suggest that in 10%
bovine serum, di$'erent proteins were hound to the DNA in the presence
of aluminum phosphate than in the absence of aluminum phosphate (as
suggested by the change in mobility in a 1% agarose gel).
Example 3, infra; shows t;he effect of aluminum phosphate
(Adju-Phos~) on the immune response in mice. To this end, these
nuclease inhibition experiments were repeated. The experimental
conditions were the same as described in the previous paragraph, except
for an evaluation of doubling the alununum phosphate concentration to
900 mcg/mL. These data verify the previous results that aluminum
_ 27 ..
CA 02280839 1999-08-10
WO 98/35562 PCT1US98/02414
phosphate inhibits nuclease activity in both human and mouse sera, and
that increasing the aluminum phosphate concentration increases the
degree of inhibition. It is also shown that lower nuclease activity was
present in the supernatant of an aluminum phosphate (Adju-Phos~) /
serum mixture. These data suggest that these nuclease proteins bind to
aluminum phosphate in PBS, resulting in an inhibition of their activity,
as evidenced by lower nuclease activity in the supernatant of an
aluminum phosphate / serum mixture.
EXAMPLE 3
EFFECTS OF ALUMINUM SALTS ON HA DNA VACCINE POTENCY
In uiuo potency studies in mice demonstrate that an
aluminum phosphate formulation of DNA is substantially more potent
(4- to 11-fold) than naked FR-9502 HA DNA in PBS, whereas HA DNA
formulated with aluminum hydroxide or aluminum hydroxyphosphate
resulted in lower responses than HA DNA in PBS (Table 2). This was
true at 4 and 8 weeks after a single administration of the two doses of FR-
9502 HA DNA tested; a limiting dose at which, based on numerous
previous experiments, not all mice seroconvert (0.5 ~tg) and a moderate
dose at which all mice seroconvert (10 fig). Importantly, this
formulation appears to be both more potent at the lower dose and to have
raised the ceiling on responses at the higher dose.
_2g_
CA 02280839 1999-08-10
W0 98/35562 PCT/US98/02414
TABLE 2
Effect of Aluminum Adjuvants on HA DNA Potency in Mice
Hemagglutination Inhibition
FormulatioDose W Xo serocon-GMT SEM SEM P* Fold
(ug) k
i
vers HI lower Inc~~ease
on
PBS 0.5 4 60 14. 5. 4.
Al(OH)3 0.5 4 0 6. 0. 0.
lz AlHyd 0.5 4 0 6. 0. 0.
AIP04 fl:5 4 lpp fig. 32. 20. 0,025 4.0
'.
PBS 10 4 100 40.- 11. 8.f
Al(OH)3 10 4 30 10. 3.9 2.9
lz AlHyd 10 4 0 6. 0. 0.
A9P04 10 4 100 343. 126. 89. 0.0000977.5
PBS 0.5 8 80 66. 46.8'27.
Al(OH)3 0.5 8 0 6. 0.0 0.0
lg AlHyd 0.5 8 0 6. 0. 0.
A1P04 0.5 8 1llU 459. 163. 120. 0.0038 7.0
PBS 10 8 100 81. 27.~
20.
Al(OH)3 10 8 60 37. 28.
16.
lx AlHyd 10 8 0 6. 0.
0.
A1P04 10 8 100 800. 348. 0.0000599.9
242.
IgG ELLSA
FormulatioDose W GMT ELISA SEM SEM P* Fold
(ug) k lower Increase
PBS 0.5 8 12800 102115680
A1P04: D.6 B I~198~5 7.386397083p8.0111I::3
,
PBS 10 8 ~~ ~9
AIPt34 10 ' g ':~1 13643989,248'O:OOi710.1
*two-sided t-test for independent samples
Female BALB/c mice (10/group) were vzoculated with FR-9502 HA DNA
(A/Georgia/93) at doses of 0.5 or 10 ~,g amd antibody titers (HI and IgG
ELISA) were determined at 4 and 8 weeks after a single administration.
Analysis of the immunoglobulin isotypes reveals that the
enhancing effects of aluminum phosphate (Adju-Phos~) do not result in
qualitative differences in the types of auitibody produced by HA DNA
(Table 3). Aluminum adjuvants tend tcf induce a strong Th2-type of
helper T cell response against co-injected protein which is often
accompanied by a predominance of IgCxl antibodies in mice.
_ 2g _
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
TABLE 3
Immunoglobulin Isotype Analysis
GMT
ELISA
FormulatioDose Wks IgGl IgG2a IgG2b IgG3 IgG2a:IgG1
(ug)
PBS 0.5 8 2,786 9,700 686 303 3.48
A1P04 0.5 8 9,051 86,10721,5261,13 9.51
PBS 10 8 3,200 25,6002,262 8.00
A1P04 10 8 29,863 221,21434,8361, 7.41
Sera taken from mice { 10/group) 8 weeks after inoculation of DNA with
and without aluminum phosphate were analyzed for immunoglobulin
isotypes by an ELISA.
Additional studies disclosed in Example Section 7 confirm
that co-administration of aluminum phosphate with plasmid DNA
encoding influenza HA enhanced the magnitude and duration of anti-
HA antibodies in mice, compared to that induced by naked HA DNA
alone. At 4, 8 and I7 weeks after a single inoculation, antibody titers, as
measured by the functional assay hemagglutination inhibition (HI),
were higher in mice vaccinated with the aluminum phosphate
formulation of HA DNA. A wide range of aluminum phosphate and
DNA doses are confirmed to be effective in mice, whether measured by
HI or an ELISA. The enhancing effects of aluminum phosphate on a
DNA construct encoding a second influenza antigen (nucleoprotein or
NP) was also tested in mice and the data is also disclosed in Example
Section 7. As before, antibody responses were enhanced 5- to 50-fold by
formulation of DNA with aluminum phosphate. In addition, it is shown
that cytotoxic T lymphocyte responses against NP in these mice were not
detrimentally affected.
- 30 -
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
EXAMPLE 4
EFFECT OF ALUMINUM PHOSPI~ATE (Adju-Phos~) ON IN VIVO
GENE EXPRESSION
An experiment to test the effect of (Adju-Phos~) on in vivo
gene expression was conducted. A pla~smid encoding secreted alkaline
phosphatase (SEAP) previously shown to express in non-human
primates was used. This experiment compared the level of SEAP in the
serum 3 days after intramuscular injection of either 1 mcg or 10 mcg of
SEAP plasmid DNA into mice, formulated in either PBS or PBS
containing 450 mcglmL aluminum phosphate. Ten mice were used in
each group. The results suggest that the presence of aluminum
phosphate did not have a significant ei~'ect on SEAP levels in the serum,
3 days post-injection. These results suggest that the increase in
immune response obtained with aluminum phosphate may not have
been the result of an overall increase i.n gene expression.
Example Sections 1-4 show that a DNA vaccine
formulation comprising an aluminum.-phosphate-based adjuvant
and HA plasmid DNA (A/Georgia/93) i.n PBS substantially increased
the humoral immune response to the .expressed HA protein in mice
(approximately 4- to 11-fold enhancement in antibody titer). In
contrast, HA DNA formulated with aluminum hydroxide or
aluminum hydroxyphosphate adjuvan~ts shown to bind DNA
inhibited the immune response to HA protein (compared to plasmid
DNA alone in PBS). In vitro binding studies of plasmid DNA to
different types of aluminum adjuvants, demonstrated that plasmid
DNA does not bind to the negatively clharged aluminum phosphate
(in PBS or in 0.9% saline). However, plasmid DNA does bind to the
more positively charged aluminum hydroxide and more positively
charged aluminum hydroxyphosphate adjuvants in saline.
Therefore, aluminum phosphate-based adjuvants tending to posses a
negative surface charge are effective n.on-binding adjuvants for DNA
vaccine formulations.
-31-
CA 02280839 1999-08-10
WO 98f35562 PCT/US98/02414
EXAMPLE 5
IN VITRO BINDING OF PLASMID DNA
TO ALUMINUM HYDROXYPHOSPHATE ADJUVANTS
Four solutions were prepared as shown below in Table 4 to
determine if plasmid DNA binding to aluminum hydroxyphosphate
could be prevented by the addition of phosphate buffer. Each solution
contained plasmid DNA at 100 mcg/mL and aluminum
hydroxyphosphate.
Table 4
i n Formulation
1 DNA in 0.9% NaCl
2 DNA in saline containing 450 mcg/mL Al
3 DNA in PBS (6 mM phosphate, 150 mM NaCl ) with
450 mcg/mL Al
4 DNA in PBS ( 12 mM phosphate, 150 mM NaCl ) with
450 mcg/mL Al
The solutions were prepared, mixed by inversion and incubated at
4°C.
After 15 minutes of incubation, the solutions were centrifuged in a
microcentrifuge for 2 minutes to pellet the adjuvant. Aliquots of the
supernatant were taken, diluted 20-fold with PBS and subjected to a UV
absorbance scan from 400 to 220 nm. The DNA concentration in the
supernatant was determined, based on the assumption that an
absorbance of 1.0 at 260 nm is produced by DNA at 50 mcg/mL. The
results are shown below in Table 5.
Table 5
Solution fDNAI in supernatant aft.~r~ ~ 5 minutes
1 96.7 mcg/mL
2 11.8 mcg/mL
100.0 mcg/mL
4 99.4 mcg/mL
- 32 -
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
The results indicate that most of the plasmid DNA bound to a ' v;minum
hydroxyphosphate within 15 minutes in 0.9% saline, but did not bind to
the adjuvant in PBS. Aliquots of the supernatants were also analyzed by
agarose gel electrophoresis after 15 aunutes and 5 days of incubation at
4°C. The results indicated that there was no detectable DNA in the
supernatant of solution 2 after 15 mir.~utes or after 5 days of incubation.
However, a comparison of the amount of DNA in the supernatants from
solutions 1, 3 and 4 indicated that thE~re was no significant binding of the
DNA to the aluminum adjuvant in either 6 or 12 mM phosphate, over 5
days at 4°C. Therefore, it will be within the purview of the skilled
artisan
to utilize an adjuvant in a DNA vaccine formulation that may, in some
formulations, substantially bind DNA. This adjuvant may be useful by
including a phosphate buffer or other buffer that results in an inability to
substantially bind DNA within this I)NA vaccine formulation.
The ability of aluminum hydroxyphosphate to enhance the
immune response generated by plasnud DNA containing the HA-
Georgia Influenza gene has been examined in two experiments,
formulated in both saline and PBS. The results (Table 6) indicate that
aluminum hydroxyphospate did not Enhance the immune response
(based on geometric mean titers to thE~ HA protein antigen) to the
Influenza DNA vaccine if it was formulated in saline, but it did enhance
the immune response if formulated in PBS. Agarose gel electrophoresis
of the supernatants of these formulations indicated that the DNA was
completely bound to the aluminum hydroxyphosphate in the saline
formulation, but was not bound in they PBS formulation. These results
show that the DNA must be in solution and not bound to the aluminum
adjuvant in order to enhance the immune response to a DNA vaccine.
_ 33 _
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
TABLE 6
Enhancement of immune responses to an Influenza DNA vaccine
in mice by aluminum adjuvants.
Experiment 4 week GMT
seroconverters 8 week
GM'f~ seroconvert
Formulation ers
I-79 10 mcg DNA 70.7 10/10 132 10/10
in PBS
I-79 10 mcg DNA 6.3 0/10 6 10/10
45 mcg
AlhydroxP
in saline
I-79 10 mcg DNA 459.5 10/10
45 mcg 1132 10/10
AIP04
in PBS
I-99 10 mcg DNA 25 8/10 ~~g0pb 10/10
in PBS
I-99 10 mcg DNA 107 9/10 512ppb 10/10
45 mcg
alhydroxP
in PBS
I-99 10 mcg DNA 2~9 10/10 33,779 10/10
45 mcg
AIP04
in PBS
a refers to the geometric mean titer to the HA protein antigen.
b 8-week GMT was determined by ELISA assay
EXAMPLE 6
EFFECT OF ALUMINZTM PHOSPHATE ON POTENCY OF
INFLUENZA DNA VACCINES
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
1. Influenza HA DNA Vaccine - Female BALB/c mice
(10/group) were inoculated with FR-9502 HA DNA (A/Georgia/93) at doses
of 0.5 ~.g or 10 ~,g and antibody titers (lHI and IgG ELISA) were
determined at 4 and 8 weeks after a single administration. Controls
included inoculation with 0.5 or 10 ~.g of HA DNA (A/Georgia/93) in PBS.
Unless indicated otherwise, AIP04 ways co-administered at 450 itg/ml
along with HA DNA. HA DNA potency in Figure lA and 1B is reported
as the production of neutralizing antibodies as measured in vitro by a
hemagglutinin inhibition (HI) assay. 'these data show that at 4 weeks
(Figure lA) and 8 weeks (Figure 1B) post-injection, a significant
enhancement of HA DNA vaccine potE~ncy is measured when utilizing a
DNA vaccine formulation comprising ~t50 ~tg /ml A1P04~ with DNA at
doses of both 0.5 itg and 10 fig. Table '7 shows a similar enhancement by
adding an aluminum phosphate adjuv~ant as measured by HA ELISA.
TAB LlE 7
Generation of Humora.l Response in Mice
DNA Ac~juvant Doses ELISA (GMT)
(u~
HA(A/Georgia/93)PBS (None) 0.5 72,800
HA(A/Georgia/93)A1P04 0.5 144,820
HA(A/Georgia/93)PBS (None) 10 25,600
HA(A/Georgia/93)A1P04 10 258,030
A HA DNA vaccine formulation comprising aluminum
phosphate as an adjuvant did not significantly alter the IgG antibody
profile. As noted supra, Table 3 shows that PBS- and A1P04- based DNA
vaccine formulations (measured at 0.5 and 10 ~.g doses at 4 and 8 weeks
post-injection) result in similar isotype profiles of IgGI, IgG2a, IgG2b
and IgG3 in response to HA DNA vaccination. In addition the profile of
the humoral response to HA DNA vaccination, the duration of the
response in mice also indicates that the rise and fall of HA neutralizing
antibodies follows a similar path, regardless of whether the formulation
contained PBS or A1P04. Data in Figure 2A (0.5 ~.g HA DNA) and Figure
2B (10 pg HA DNA) show induction of HA neutralizing antibodies at 4, 8
and 17 weeks post-infection. In both PBS- and A1P04- based DNA vaccine
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
formulations, a drop in HA antibodies is seen from 8 weeks post-injection
to 17 weeks post-injection.
Additional experiments show that the optimal effect of
A1P04 as an adjuvant to DNA vaccination procedures occurs when the
DNA and A1P04 are co-administered to the host. Table 8 compares the
ability of HA DNA to elicit neutralizing antibodies when A1P04 is either
co-injected with the DNA or administered to mice three days prior to 3
days after DNA immunization.
TABLE 8
EfFect of Co-Administration of A1P04/HA DNA on
Enhancement of HI Titer in Mice
DNA ( lOmcg) AIP04 / DNA Admin.l HI Titer (GMT)2
HA(A/Georgia/93) none (PBS) 25
HA(A/Georgia/93) A1P04 -co-injected 229
HA(A/Georgia/93) A1P04 - 3 d prior 66
HA(A/Georgia/93) A1P04 - 3 d after 35
lAlP04 at 450 mcg/ml.
2At 4 weeks post-injection.
Similar results were recorded when HA antibody production was
measured by an HA ELISA assay. These data show that the optimal time
of administering A1P04 as a DNA vaccine adjuvant is at or substantially
near the time that the DNA vaccine is administered. Therefore, the
DNA/A1P04 formulations of the present invention provide a preferred
formulation for stimulating an in uivo humoral response following DNA
vaccination.
Additional experiments show that AIP04 acts as an
adjuvant over a wide range of concentrations which may be envisioned by
the skilled artisan. Figure 3A and Figure 3B show that various A1P04
concentrations co-administered within various dose ranges of HA DNA
promote an enhanced humoral response at least 4 weeks post-injection.
It is evident from these results that a wide A1P04 dose range will be
effective in providing the DNA adjuvant effect disclosed and exemplified
within this specification. Therefore, the data presented in this Example
Section show that A1P04 acts as a adjuvant to significantly increase
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
humoral responses upon DNA vaccination. This increased humoral
response is not dependent upon specific dose combinations of adjuvant
and DNA. Instead, higher DNA doses tend to result in somewhat more
pronounced antibody production up to .about a dose of 10 ~.g DNA in mice,
whereas the adjuvant effect of A1P04 remains steady over a large dose
range. This data serves as an effective guidepost to the skilled artisan in
determining DNA and adjuvant dose ranges for the host of interest,
including but not limited to human an;dlor veterinary applications.
2. Influenza NP DNA Vaccine - Female BALB/c mice
(10/group) were inoculated with a DNA plasmid encoding nucleoprotein
(NP) from influenza virus A/PR/8/34 (H:1N1 ) at doses of 0.5 ~.g or 50 ~tg
and anti-NP titers were determined at 6 weeks after a single injection
and at 3 weeks post two injections. Ur,~less indicated otherwise, A1P04
was co-administered at 450 ~tg /ml alor,~g with NP DNA. NP DNA
potency is reported in Figure 4 as anti-NP antibodies measured as the
geometric mean ELISA titer. Serum F~amples were collected from
groups of 3 mice at the time of sacrifice for cellular immune responses.
These data show that anti-NP antibody production in response to
innoculation with a NP DNA plasmid construct is increased when
utilizing a DNA vaccine formulation comprising 450 ~.g/ml A1P04~ with
DNA at doses of both 0.5 ~g and 50 fig.
Figure 5A (IL-2), Figure 5:B (INF-Y), Figure 5C (IL-4) and
Figure 5D (IL-10) show that innoculati~~n of mice with a NP DNA
plasmid/A1P04 vaccine formulation provided no significant alteration of
cytokine secretion as compared to a Nl' DNA plasmid/PBS formulation
injected at identical doses, as measured from spleen cells pooled from 3
mice/group.
In order to show the extent of a cellular response to
innoculation with a NP DNA plasmid construct, with or without the
addition of A1P04, cytotoxic T lymphocytes were generated from mice
that had been immunized with DNA or that had recovered from
infection with A/PRJ8/34. Control cult~ires were derived from mice that
had been injected with control DNA and from uninfected mice. Single
cell suspensions were prepared from pools of 3 spleens/group, red blood
cells were removed by lysis with ammonium chloride, and spleen cells
were cultured in RPMI 1640 supplemented with 10% Fetal Bovine Serum
(FBS), 100 U/ml penicillin, 100 ~.g/ml streptomycin, 0.01 M HEPES (pH
- 37 -
CA 02280839 1999-08-10
WO 98/35562 PCT/US98102414
7.5), and 2 mM 1-glutamine. An equal number of autologous, irradiated
stimulator cells, pulsed for 60 minutes with the H-2I~d-restricted peptide
epitope NP147-155 (Thr-Tyr-Gln-Arg-Thr-Arg-Ala-Leu-Val, SEQ ID NO:
13) at 10 ~t.M or infected with influenza strain A/Victoria/73, and 10 U/ml
recombinant human IL-2 (Cellular Products, Buffalo, NY) were added
and cultures were maintained for 7 days at 37°C with 5% C02 and 100%
relative humidity. The cytotoxicity assays were performed as described
by Ulmer et al. (1993, Science 259:1745-1749). Target cells labeled with
Na51Cr0 were pulsed with synthetic peptide NP147-155 at a
concentration of 10 ~tM. The target cells were then mixed with CTL at
designated e~'ectoraarger cell ratios in 96-well plates, and incubated at
37oC for four hours in the presence of 5% C02. A 20 ~.~1 sample of
supernatant from each cell mixture was countxd to determine the
amount of 5lCr released from target cells and counted in a Betaplate
scintillation counter (LKB-Wallac, Turku, Finland). Maximal counts,
released by addition of 6M HCI, and spontaneous counts released
without CTL were determined for each target preparation. Percent
specific lysis was calculated as: [(E -S)/(M -S~ x 100, where E represents
the average cpm released from target cells in the presence of effector
cells, S is the spontaneous cpm released in the presence of media only,
and M is the maximum cpm released in the presence of 2% Triton X-100.
The results in Figure 6A, Figure 6B, Figure 6C and Figure 6D show a
minimal effect of the presence of A1P04 on induction of an CTL response
by innoculation with a NP DNA plasmid construct. In these studies
BALB/c mice were injected in the quadriceps of both legs with plasmid
DNA encoding A/PRJ8/34 (H1N1) with either 5 ~g or 50~g of plasmid
DNA, in PBS or A1P04. The level of % specific lysis was determined
through lymphocyte cultures derived from mice 6 weeks post injection.
The results show that the CTL response was similar at both doses for
both peptide-pulsed cells and flu-infected cells. Similar results were
obtained for 5 ~g or 50 ~g doses at 3 weeks post 2 injections.
_ 3g _
CA 02280839 1999-08-10
WO 98/35562 _ PCT/US98/02414
EXAMPLE 7
EFFECT OF ALUMINUM PHCISPHATE ON POTENCY OF
HEPATITIS B DIJA VACCINES
DNA Constructions - The major envelope protein (HBs)
from hepatitis B virus was subcloned into expression vectors derived
from V 1J, derived from a pUC 19 plas~mid containing the human
cytomegalovirus (CMV) immediate early promoter with its intron A
sequence, multiple restriction sites (including Bgl II) for cloning and the
bovine growth hormone polyadenylation signal sequence. The HB DNA
plasmid vector expressing the adw subtype is VlJns.S. The HB DNA
plasmid vector expressing the ayw sut~type is V1R.S, which was
prepared by subcloning the S gene fronn a pBR322 plasmid that contained
the entire HBV genome into the BglII :restriction site of the V 1R.
Expression of the S gene was confirmed in RD cells (a human myoblast
cell line) by calcium phosphate-mediated transfection using the
CellPhect kit (Pharmacia) and detection of the HBsAg using the Auzyme
EIA kit (Abbott Labs).
Anti-HBs EIA (total antibody) - A microtiter plate
modification of the AUSAB EIA kit (Abbott Labs, N. Chicago, IL) was
used to quantify antibodies to hepatitis B surface antigen (HBsAg).
Costar EIA 96-well flat bottom plates (Costar, Cambridge MA, #3591)
were coated overnight at 4°C with recombinant HBsAg (prepared e.g. ,
U.S.Patent Nos. 4,769,238; 4,935,235; and 5,196,194) at 4 ~.g/ml in Tris-
saline, pH 9.5. Plates were washed 3 tames with PBS and then blocked
with 175 ul/well of PBS/5% FCS/ 0.1% azide for 2 hours at room
temperature or overnight at 4°C. Five-fold serial dilutions were made
(in duplicate) in 8 consecutive wells of the plate for each serum sample.
The plates were then incubated overnight at 4°C. After 3 wash
cycles
with PBS (using a TiterTech plate washer [ICN, Huntsville, AL]), a
developing reagent (Abbott AUSAB EIA kit) consisting of equal volumes
of biotin-conjugated HBsAg and an ani;i-biotin-enzyme conjugate was
added to each well of the plate. After 4 hours at room temperature, the
plates were washed 6 times and then 100 ~.~1 per well of OPD substrate
(Abbott) was added to each well. The rE~action was stopped after 30
minutes with the addition of 50 ~tl per v~~ell of 1 N H2S04. Optical
densities were read at 490 nm and 650 nm using a Molecular Devices
_ 3g _
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
microplate reader (Molecular Devices, Menlo Park, CA). Anti-HBs
titers (in mIU/mL) were calculated by the Softmax computer program
(version 2.32) using a standard curve generated using a 4-parameter fit
algorithm. Since the assay is species-independent, a set of human
serum standards (Abbott quantitation kit) was used to generate the
standard curve so that titers could be quantified relative to a reference
standard in mIU/mL.
Anti-HBs EIA (isotype-specific) - Microtiter plates were
coated with HBsAg and blocked as described above. Five-fold serial
dilutions were made (in duplicate) in 8 consecutive wells of the plate for
each serum sample. The plates were then incubated overnight at 4°C.
After 3 wash cycles with PBS (using a Titer2'ech plate washer), alkaline
phosphatase-conjugated goat anti-mouse immunoglobulin reagents
specific for mouse IgG1 or mouse IgG2a isotypes (Southern
Biotechnology Associates, Birmingham, AL) were added at a final
dilution of 1:2000. After 2 hours at 37°C, the plates were washed 6
times
using a TiterTech plate washer, and then 60 ~.1 per well of the enzyme
substrate (p-nitrophenylphosphate [Sigma Chemical Co., St. Louis, MO]
dissolved at 1 mg/mL in Tris saline, pH 9.5) was added. After 30
minutes at room temperature, the reaction was stopped with the
addition of 60 ~.1/well of 3N NaOH. Optical densities were read at 405 nm
using a Molecular Devices microplate reader. Data were collected using
the Softmax computer program. A standard curve was generated using
mouse monoclonal anti-HBs antibodies of the IgGl (catalogue # 16021,
Pharmingen, San Diego, CA) or IgG2a (cat. # 16011D, Pharmingen)
isotypes.
Antibody concentrations relative to each isotype standard
were calculated as described previously (Caulfield and Shaffer, 1984,
J. Immunol. Methods 74: 205-215). Briefly, to calculate titers, an OD
value of 0.1 units was set as the endpoint. The log 5 titer (t) is
determined by interpolation using the following formula:
t=x-((0.1-L~(H-L)
where L = OD value of the first log 5 dilution giving an OD value below
0.1; H = OD value of the log 5 dilution closest to, but above the cutoff
(0.1);
x = the well number that has the OD value L.
-40_
CA 02280839 1999-08-10
WO 98/35562 PCT/ITS98/02414
The antibody concentration (c) in experimental samples is
determined by comparing the endpoini~ titer in experimental wells with
that of the standard curve by the following formula:
c = A g 5« -.~
where A = the antibody concentration a~f the standard; s = the log 5 titer of
the standard; t = the log 5 titer of the unknown. For example, if the log 5
endpoint titer of the standard (100 ng/ml) is 2.6 and the value of the
unknown is 3.4, the concentration of a»tibody in the unknown would be:
c = 100 x 5'3''' ~e~ = 362 ng/rnl.
Cytotoxic T Lymphocyte Assays (CTL assays) - The CTL
assays were performed as reported in tTlmer et al. ( 1993, Science 259:
1745-1749), and essentially as described in Example Section 6. Briefly,
BALB/c mice were injected twice with a vaccine formulation consisting
of HBV DNA plus aluminum phosphate or with naked HBV DNA. A
single cell suspension of effector cells was then prepared and cultured in
vitro with HBs peptide (28-39)-pulsed F;yngeneic stimulator cells. The cell
suspension was assayed 7 days later for CTL activity against 5'Cr-labeled
P815 cells.
The syngeneic stimulator cells were prepared as a single
cell suspension from the spleens of unimmunized BALB/c mice as
follows. After lysis of red blood cells v~rith ammonium chloride buffer
(Gibco BRL ACK buffer), the cells were washed by centrifugation for 10
minutes at 1200 rpm (Jouan centrifugE~ model CR422), resuspended in
DMEM culture medium (Gibco BRL #11965-092), and then irradiated
using a g°Co source to deliver 2,000 - 4,t)00 rads. The cells were then
pulsed with a 10 ~tM final concentration. of the H-2 Kd peptide HBs (28-39)
(Chiron Mimetopes, Clayton, Victoria, Australia) which has the
sequence Ile-Pro-Gln-Ser-Leu-Asp-Ser-Trp-Trp-Try-Ser-Leu [SEQ ID
N0:14] (Schirnabeck et al., 1994, J. Virol. 68: 1418-1425). The cells were
mixed approximately every 20 minutes for L5 - 2.5 hours and then
washed 3 times with RPMI-1640 medium. Effector cells were prepared
as single cell suspensions from spleens of immunized mice as described
and then co-cultured with an approximiately equal number of peptide-
pulsed stimulator cells for 7 days at 3?'° C (5°!o COz) in "K"
medium.
P815 (H-2a) mouse mastocytoma cells (ATCC, Rockville,
MD) were radiolabeled by overnight culture with 0.5 - 1.2 mCi b'Cr
(Amersham, cat. # CJS.4) added to ?5 cm2 culture flasks (Costar #3376)
-41-
CA 02280839 1999-08-10
W0~98/35562 PCT/US98/02414
containing ~ 5 x 105 cells per mL in a volume of 10 mL. The labeled cells
were centrifuged at 1200 rpm for 5 minutes and the supernatant
removed by aspiration. The cells were washed, counted, resuspended in
DMEM culture medium at ~ 106 cells per mL and then pulsed with 10 ~M
HBs (28-39) peptide at 37° C for 2-3 hr with frequent mixing. The
Target
cells were then washed and adjusted to 105 cells per mL for plating.
Meanwhile, effector cells from the 7 day restimulation cultures were
harvested, washed, and added to triplicate wells of V bottom microtiter
plates (Costar #3898) at 60 x 105, 30 x 106, 15 x 105, and 7.5 x 105 cells per
mL. The 5' Cr-labeled target cells were plated at 104 cells per well in
100 ~.tl "K" medium to achieve effectoraarget ratios of 60:1, 30:1, 15:1, and
7.5:1. Triplicate wells containing only target cells cultured in 0.2 mL of
medium served as controls for spontaneous 5'Cr release whereas
triplicate wells containing target cells cultured in 0.2 mL of medium
containing 1.0 % Triton X-100 detergent (Sigma #T6878) served as
controls for maximum 5'Cr release. The plates were incubated for
4 hours at 37°C in a 5% C02 incubator and then centrifuged at 1200 rpm
for 5 minutes to pellet the remaining target cells. The supernatants
(20 ~1) were then harvested using an Impact multichannel pipetor
(Matrix Technology, Lowell MA, model #6622) and then transferred to
Betaplate filter mats (Wallac #1205-402). The mats were dried and then
transferred to plastic bags which were sealed after the addition of
~11 mL of scintillation fluid. A Betaplate model 1205 scintillation
counter (Wallac) was used to quantify the radioactive 5'Cr contained in
each spot on the mat corresponding to each well of the original 96-well
plate. The % specific Iysis was determined as set forth in Example
Section 7.
Adjuuant effect of aluminum phosphate for V1R.S - A study
comparing anti-HBs antibody production in mice inoculated with (1) a
commercial hepatitis B vaccine (Recombivax HB~); (2) purified hepatitis
B surface antigen without an adjuvant, and (3) V1R.S with aluminum
phosphate and (4) V1R.S without aluminum phosphate was performed.
Animals were utilized as described in Example Section 6. Female
BALB/c mice were inoculated with the plasmid DNA construct V1R.S at
a 100 ~.g dose either in the presence of 450 ~.g /ml aluminum phosphate
or in the absence of the adjuvant. As controls, one microgram of
Recombivag HB~ and 1 ~.g of HBsAg were injected into mice and bleeds
CA 02280839 1999-08-10
WO 98/35562 PCT/LTS98/02414
were taken 21, 42 and 63 days after inoculation. Anti-HBs antibody
production is shown in Figure 7. The auitibody response to a HBV DNA
vaccine (which encodes the surface antigen from hepatitis B virus) was
enhanced approximately 100-fold by formulation with aluminum
phosphate. The adjuvanted DNA vacciine generates a response
equivalent to that induced with Recombivax HBO.
HB DNA Doseage Ractes in the Presence of A1P04 - V1R.S
DNA was formulated at three dose level'.s (1.0, 10, and 100 p.g) with a
constant (450 ~tg/ml) concentration of »luminum adjuvants (aluminum
phosphate and aluminum hydroxyphosphate) and then tested for the
ability to induce anti-HBs antibodies in mice. Figure 8 shows that 6
weeks after a single injection of vaccine, the response to a 10 ~tg dose of
HBV DNA vaccine formulated with ahl.minum phosphate was superior
to that induced with 100 ~tg of the naked DNA vaccine. Figure 9 shows
that injection of mice at day 0 and day 9:2 with DNA formulated at three
dose levels (1.0, 10, and 100 pg) with a c~~nstant (450 pg/mL)
concentration of aluminum adjuva~nts. Anti-HBs antibodies in BALB/c
mice were tested three weeks later at day 63 of the experiment. By
comparison with the data shown in Figure 7, boosting with a second
dose of DNA vaccine formulated with aluminum phosphate generated a
> 10-fold rise in anti-HBs titers. Consistent with a single dosing as
shovi~n in Figure 7, the response to a 10 p.g dose of HBV DNA vaccine
formulated with aluminum phosphate was superior to that induced
with 100 pg of the naked DNA vaccine. Formulation of DNA in saline
with aluminum hydroxide or aluminum hydroxyphosphate adjuvants
was advantageous only at the 100 p,g dose of DNA under conditions in
which the aluminum adjuvants are saturated and free DNA is present.
At lower doses of DNA where it is known that the DNA binds completely
to aluminum hydroxide or aluminum h~.ydroxyphosphate, the response
is lower than that obtained with equivalent doses of naked DNA.
HBV DNA/ALP04 Induction of CTL Response - After two
injections of the HBV DNA vaccine plus aluminum phosphate adjuvant,
spleen cells from BALB/c mice were restimulated in vitro with HBs
peptide (28-39) and then assayed 7 days :later for CTL activity against
b'Cr-labeled P815 cells. Figure 10 shows that the formulation of the HBV
DNA vaccine with or without aluminum phosphate generated
equivalent CTL responses. There was no lysis of control P815 cells not
3_
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
pulsed with the HBs peptide indicati_~g that lysis of the HBs peptide-
pulsed cells was the result of activation of specific CTLs rather than
natural killer (NK) cells that would be expected to lyse target cells
indiscriminately. Therefore, a major advantages of naked DNA
vaccination (i.e., induction of CTL responses) is preserved when the
DNA is formulated with aluminum phosphate.
EXAMPLE 8
ADJUVANT EFFECT OF ALUMINUM PHOSPHATE FOR HBs DNA
VACCINE TESTED IN LOW RESPONDER MICE
A significant proportion of humans are non-responders to a
standard 3-dose regimen of the current hepatitis B vaccines (Alper, et
al., 1989, J. Eng. J. Med. 321:708-712). This problem was addressed
using the aluminum phosphate adjuvant in a preclinical animal model.
Low responder (C3H) or high responder (BALB/c) mice were immunized
with two doses of 1.0, 10, or 100 ~tg of HBs DNA vaccine formulated with
or without aluminum phosphate. As shown in Table 9, formulation of
the DNA vaccine with aluminum phosphate enables the generation of
an anti-HBs antibody response in both high responder (BALB/c) and low
responder (C3H) mice given the 100 ~g dose of DNA that is equivalent to
the response to a 1 ~.g dose of a conventional HBs protein vaccine. It is of
note that in the absence of the aluminum adjuvant, the response to the
DNA vaccine was only 6.3 mIU/mL which is just above the detectable
limit of --1.0 mIU per mL. Thus, the aluminum phosphate adjuvant
combines the desired attributes of protein-based vaccines (i.e. the
induction of high antibody titers) with the ability of DNA vaccines to
induce cell-mediated antibody responses (see Example Section 7).
CA 02280839 1999-08-10
WO'98/35562 PCT/I1S98/02414
TABLE !)
Anti-HBs response of high vs. low responder mice to HBsDNA ~ A1P04
Anti-HBs GMT (mIU/mL)
Immunogen Dose Adjuvanat BALB/c C3H
HBsAg llag Al(OH)P04 8,045.0 91.4
HBs DNA* 1001ag none 415.0 6.3
lag 19.8 1.7
1 ~ 3.3 1.3
1001ag A1P04 4,408.0 111.5
10 lag 280.0 23.7
1 t~ 6.8 4.8
*V1R.S (ayw) (XLpl.ll) 5286-115 V44
EXAMPLh 9
EFFECT OF ALUMINUM PHOSPHATE ON POTENCY
5 OF HIV DNA VACCINES
DNA plasmid VlJns/tPA/opt gag was constructed from the
vector VlJns, described in WO 97/3115 ~~nd herein incorporated by
reference. The optimized gag sequence within VlJns was constructed
10 as follows: In order to provide an heterollogous leader peptide sequence to
secreted and/or membrane proteins, VlJn was modified to include the
human tissue-specific plasminogen activator (tPA) leader. Two
synthetic complementary oligomers were annealed and then ligated into
VlJn which had been BglII digested. These oligomers have
overhanging bases compatible for ligation to BglII-cleaved sequences.
After ligation the upstream BglII site is destroyed while the downstream
BglII is retained for subsequent ligation,s. Both the junction sites as well
as the entire tPA leader sequence were verified by DNA sequencing.
Additionally, in order to conform with our consensus optimized vector
VlJns (=VlJneo with an SfiI site), an SfiI restriction site was placed at
the KpnI site within the BGH terminator region of VlJn-tPA by blunting
the KpnI site with T4 DNA polymerase followed by ligation with an SfiI
linker (catalogue #1138, New England Biolabs). This modification was
verified by restriction digestion and agarose gel electrophoresis.
_,ø5_
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
Gene segments were converted to sequences having
identical translated sequences but with alternative codon usage as
defined by Lathe (1985, J. Mol. Biol. 183: 1-12), and described in WO
97/3115. The methodology described below to increase of expression of
HIV gag gene segments was based on the hypothesis that the known
inability to express this gene efficiently in mammalian cells is a
consequence of the overall transcript composition. Thus, using
alternative codons encoding the same protein sequence may remove the
constraints on expression of gag. The specific codon replacement
method employed may be described as follows:
frame.
1. Identify placement of codons for proper open reading
2. Compare wild type codon for observed frequency of
use by human genes.
3. If codon is not the most commonly employed, replace
it with an optimal codon for high expression in human cells.
4. Repeat this procedure until the entire gene segment
has been replaced.
5. Inspect new gene sequence for undesired sequences
generated by these codon replacements (e.g., "ATTTA" sequences,
inadvertent creation of intron splice recognition sites, unwanted
restriction enzyme sites, etc.) and substitute codons that eliminate these
sequences.
6. Assemble synthetic gene segments and test for
improved expression.
These methods were used to create the following synthetic
gene segments for HIV gag creating a gene comprised entirely of
optimal codon usage for expression. An artisan of ordinary skill in the
art will understand that similar vaccine efficacy or increased expression
of genes may be achieved by minor variations is the procedure or by
minor variations in the sequence.
DNA plasmid VlJns/tPA/gp140 optA was constructed as
described above for optimization and specifically as described in PCT
International Application No. WO 97/31115.
Female Balb/C mice (10/group) were inoculated with
VlJns/tPA/gp140optA and VlJns/tPAopt gag at doses of 10 ~,g (5 ~.g of
each construct) or 100 ~.g (50 ~tg of each construct). Aluminum
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
phosphate (A1P04 from a 2% solution), or CaP04 (27.5mg/100m1 stock)
was added at final amounts of 11 ~.g for A1P04, and 19 ~.g for CaP04.
Controls included inoculations formuloitions with adjuvant and/or no
DNA or DNA with no adjuvant.
Figure 11 shows the effects of various adjuvants with a HIV
eng/gag DNA vaccine formulation on gp120 and gag antibody responses
in inoculated mice. Antibody production was measured by ELISA. As
shown in Example 7 with HBV DNA vaccines, CTL responses with and
without A1P04 were approximately equal. Therefore, use of an
adjuvanted HIV env/gag formulation diid not decrease the ability of the
vaccine to promote a specific CTL response.
EXAMPLE 10
DOSE-RESPONSE RELATIONSHIP OF CALCIUM PHOSPHATE AS
AN ADJUVANT FOR ~A DNA VACCINE.
Calcium phosphate (at different concentrations) was
compared with a standard concentration of aluminum phosphate as an
adjuvant for HBV DNA vaccine. Three dose levels ( 10, 100, and 1000
~g/mL) of the HBV DNA vaccine were i:ormulated to contain 10, 3.3, 1.0,
or 0.3 mg/mL calcium phosphate or 0.45 mg/mL aluminum phosphate.
A total of 0.1 mL of formulated vaccines was injected into two
intramuscluar sites of BALB/c mice to achieve DNA vaccine dosages of
1.0, 10, or 100 fig. As shown in Table 10, HBV DNA formulated with the
three lower concentrations of calcium phosphate increased the anti-HBs
response to the 100 ~.g vaccine dose by approximately 10-fold. At the
highest concentration of calcium phosphate, only 7°l0 of the DNA
remained unbound to the adjuvant, and the response to this formulation
was increased by less than 2-fold. In tile cohorts of mice receiving the 10
~.g dose of HBV DNA, the aluminum phosphate had a powerful adjuvant
effect, increasing the response -.40-foldl compared with the group
receiving 10 ~g of naked DNA. By conl;rast, DNA formulated with
calcium phosphate at 10, 3.3, or 1 mg her mL induced a response that
was 10-fold lower than that to naked DNA. Only in the group receiving
the DNA vaccine formulated with the llowest concentration of calcium
phosphate (0.3 mg/mL) was an adjuvan.t effect observed for the 10 ~g dose
-47-
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
level of the DNA vaccine. An analysis of separately prepared vaccines
( 10 ~.g DNA dose) containing calcium phosphate indicated that the
percent unbound DNA was 73%, 26%, 1%, and 0% in vaccines
containing 0.3, 1.0, 3.3, and 10 mg/mL calcium phosphate, respectively.
Taken together, these results indicate that calcium phosphate can be an
effective adjuvant for a DNA vaccine only if the formulation contains a
substantial amount of free DNA. If the DNA dose is limiting or if the
calcium phosphate concentration is excessive, the antibody response to
the DNA vaccine formulation may be inhibited.
TAB LE 10
Adjuvant Effect of CaP04 vs A1P04 for HBs DNA or protein vaccines
Anti-HBs m1U /mL (Vaccine Dose)
~o unbound
Adjuvant Dose Vaccine DNA
(rr~;/mL) (1 Ng) (10 Ng) (100 p~) (~ 100 ~g dose)
pore 0 HBs DNA 1.9 111.0 313.0 n.a.
A1P04 0.45 2.6 4,303.016,375.0 --100
CaP04 10 4.0 4.5 556.0 7
3.3 1.0 1.2 4,370.0 64
1 1.0 7.2 1,782.0 92
0.3 1.4 363.0 2,091.0 -100
3.3 HBs protein n.d. n.d. n.a.
87,636.0
A1(OH)P04 0.45 n.d. n.d. n.a.
105,240.0
V1R.S Plasmid DNA
n = 10 BALB/c mice per group
Injection route: 0.05 mL in 2 intramuscular sites
Injection schedule: d. 0, 42
Assay time: d. 84
_c~g_
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
EXAMPLE 11
HBV DNA VACCINE / ALUMINUM PHOSPHATE FORMULATION
AS A PRIMING ANTIGEN
A study comparing anti-H:Bs antibody production in mice
primed with two doses of a hepatitis B IDNA vaccine (VlJns.S2.S at
100 ~.g per dose), (1) with aluminum phosphate, (2) without aluminum
phosphate, and (3) Recombivax HB~. These priming immunogens were
followed by either a boosting with either a VlJns.S2.S or
Recombivax HB~. Table 11 shows pre-troost and post-boost HBs antibody
titers. DNA/A1P04 priming followed by boosting with Recombivax HB~
results in approximately a 300-fold increase in HBs antibody when
compared to DNA priming (without aluminum phosphate) prior to
boosting with Recombivax HB~.
TABLE 11
Effective priming with HBV DNA + A1PIJ4 for a booster response to
a conventional protein vaccine
Anti-HBs GMT (mIU/mL)
Priming Adjuvant Booster pre-boost post-boost
Immunogen
(2 doses)
DNA none DNA 14 39
Protein 1~
DNA ALPO, DNA 2?9 307
Protein 39,750
Protein AI(OH)PO, Protein 11,100 106,606
DNA vaccine 100 Etg per dose): VlJns.S2.S
Protein vaccine (1 fig): ftecombivag HBO
- 49 -
CA 02280839 1999-08-10
WO 98135562 PCT/US98/02414
EXAMPLE 12
EFFECT OF ALUMINUM PHOSPHATE ON POTENCY OF
A HERPES SIMPLEX DNA VACCINE IN GUINEA PIGS
Plasmids VlJns:rD and VlJns:OgB encoding HSV-2
glycoprotein D (gD) and the amino-terminal 707 amino acids of
glucoprotein B (gB), respectively have been described in McClements et
al. ( 1996, Proc Natl Acad Sci U S A 93: 11414-11420) . The vaccines were
prepared by diluting VlJns:gD DNA and VlJns:~gB DNA into either
sterile PBS, or sterile PBS containing AdjuPhos~ at a final aluminum
concentration of 450 ~g/mL. Vaccines were thoroughly mixed by gentle
vortexing then stored at 4°C for 24 hours. Immediately prior to
injection, the vaccine formulations were subjected to gentle vortexing.
Female Duncan Hartley guinea pigs (Harlan Sprague Dawley;
Indianapolis, IN) weighing between 450-550 grams at the time of the
first immunization were injected with a total of 200 ~L ( 100 ~L per
quadriceps muscle) containing 6 ~g VlJns:gD + 20 ~g VlJns:OgB, with
or without 90 ~tg aluminum. Animals were boosted at five weeks.
Sera obtained at weeks 4 and 8 were assayed at ten-fold dilutions,
ranging from 1:30 to 1:30,000, using gD- and gB-specific ELISAs
(McClements et al, 1996, Proc Natl Acad Sci U S A 93: 11414-11420).
Endpoint titers were determined as described previously except that
serum dilutions were considered positive if the ODD signal was > 0.05
above that of the preimmune sera at the same dilution (McClements et
al, 1996, Proc Natl Acad Sci U S A 93: 11414-11420). These results are
presented in Table 12.
TABLE 12
ELISA GMT; linear values (range) and logo values ~ SEM; N=4
group 4 wk 8 wk
anti gD anti gB anti gD anti gB
DNA in PBS 1? (9-33) 53 (10-190) 53 (10-284) 5335 (2744-10370)
~2~ ~; ~, ?3 t'55 !; 1:~3 ~ '~3 3..'f~ -~ :2J..
DNA + A1P0, 30 (10-89) 949 (251-3585) 169 (17-1634) 30000 (30K-30K)*
* all strongly positive at highest dilution tested
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
EXAMPLE 13
EFFECT OF ALUMINUM PHOSPHATE ON POTENCY OF
AN INFLUENZA DNA VA(~CINE IN PRIMATES
Rhesus monkeys - Groups of 5 young adult Rhesus of either
sex were injected intramuscularly in both triceps muscles with 0.5 mL
of a solution containing 500 mcg/mL of VlJns-HA/Georgia plasmid
encoding the HA from influenza A/Georgia/03/93 (H3N2), dissolved in
phosphate-buffered saline or in phosphate-buffered saline with 500
mcg/mL or 1000 mcg/mL of aluminum phosphate adjuvant. A separate
control group received HA DNA and al'~uminum in contralateral arms.
immunizations were given at 0 time and again at 8 weeks. Animals
were bled at two week intervals and sera were tested for antibodies
against A/Georgia/03/93 by hemaggluti;nation inhibition (Figure 12A)
and by ELISA (Figure 12B). Use of aluminum phosphate adjuvant in
combination with the DNA increased antibody titers compared to
animals that received DNA alone or DrJA and adjuvant in contralateral
arms. Repeated measures analysis of variance indicated that the pooled
antibody titers of groups that received DNA mixed with aluminum were
significantly higher than the pooled antibody titers of groups that
received no aluminum or aluminum acid DNA in contralateral arms
(P<0.05).
Chimpanzee - Four adult chimpanzees of either sex were
injected intramuscularly in one triceps muscle with a volume of 1.0 mL
containing 500 mcg of VlJns-HA/Geor~;ia plasmid encoding the HA
from influenza A/Georgia/03/93 (H3N2), dissolved in phosphate-buffered
saline or in phosphate-buffered saline with 500 mcg of aluminum
phosphate adjuvant. Immunizations were given at time 0 and at 6 and
12 weeks. Sera were collected at two wE~ek intervals and were assayed for
antibodies by HI, virus neutralization, auid ELISA. Table 13 shows that
greater antibody responses were seen in the two animals given HA DNA
with aluminum adjuvant, with 1/2 in the alum group having at least
fourfold rises in HI antibody and 2/2 having fourfold rises in virus
neutralization, while 0/2 animals given HA DNA alone exhibited these
responses.
_51_
CA 02280839 1999-08-10
WO 98/35562 PCT1US98/02414
Table 13
Antibody Responses of Chimpanzees to HA DNA Vaccine ~ Alum adjuvant
A/Georgia
Hi Titer vs. A/GeorgiaVirus
Treatme Animal Week A~Georgia A/Guang- ELISA Neutraliza-
nt dong tion
HA DNA X019 0 5 5 25 20
4 5 5 50 20
6 5 5 25 10
8 5 5 25 10
10 5 5 200 20
12 5 5 200 20
14 10 5 200 40
HA DNA X131 0 5 5 400 20
4 5 5 200 20
6 10 5 200 10
8 5 5 200 20
10 10 5 200 20
12 5 5 200 20
14 10 5 200 40
HA DNA X133 0 5 5 50 10
AIP04 4 5 5 50 20
6 10 5 100 20
8 20 40 1600 160
10 10 20 800 80
12 10 20 400 80
14 2D 40 800 320
HA DNA X140 0 5 5 100 10
A1P04 4 5 5 100 5
6 5 5 200 N D
8 10 5 200 20
10 10 5 200 20
12 5 5 100 10
14 10 5 400 80
- 52 -
CA 02280839 1999-08-10
WO 98/35562 _ PCT/US98/02414
SEQUEhfCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: MERCK & CO., INC.
(ii) TITLE OF INVENTION: POLYNUCLEOTIDE VACCINE FORMULATIONS
(iii) NUMBER OF SEQUENCES: 14
(iv) CORRESPONDENCE ADDRESS:
tA) ADDRESSEE: Merck & Co., Inc.
(B) STREET: P.O. Box 2000 RY60-30
(C) CITY: Rahway
(D) STATE: NJ
(E) COUNTRY: US
(F) ZIP: 07065-0907
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release h1.0, Version ti1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Hand, J. Mark
(B) REGISTRATION NUMBER: 36,545
(C) REFERENCE/DOCKET NUMBER: 19907Y
(ix) TELECOMMUNICATION INFORMATIO1J:
(A) TELEPHONE: 732/594-3905
(B) TELEFAX: 732/594-4720
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = 'o:ligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
CTATATAAGC AGAGCTCGTT TAG 23
CA 02280839 1999-08-10
WO' 98/35562 PCT/US98/02414
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = 'oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
GTAGCAAAGA TCTAAGGACG GTGACTGCAG 30
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
GTATGTGTCT GAAAATGAGC GTGGAGATTG GGCTCGCAC 39
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = 'oligonucleotide'
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
GTGCGAGCCC AATCTCCACG CTCATTTTCA GACACATAC 39
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 78 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
CA 02280839 1999-08-10
WO 98/35562 PCT/US98/02414
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "ol.igonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ 7:D N0:5:
GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT 60
CTTCGTTTCG CCCAGCGA 7g
(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 78 bay. pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
GATCTCGCTG GGCGAAACGA AGACTGCTCC ACACP.GCAGC AGCACACAGC AGAGCCCTCT 60
CTTCATTGCA TCCATGGT 7g
(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
GGTACAAATA TTGGCTATTG GCCATTGCAT ACG 33
(2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "ol.igonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
CA 02280839 1999-08-10
WO 98/35562 PCT/I1S98/02414
CCACATCTCG AGGAACCGGG TCAATTCTTC AGCACC 36
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID No:9:
GGTACAGATA TCGGAAAGCC ACGTTGTGTC TCAAAATC 38
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:10:
CACATGGATC CGTAATGCTC TGCCAGTGTT ACAACC 36
(2) INFORMATION FOR SEQ ID N0:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = 'oligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
GGTACATGAT CACGTAGAAA AGATCAAAGG ATCTTCTTG 39
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
{A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
CA 02280839 1999-08-10
WO' 98/35562 PCT/US98/02414
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "o:ligonucleotide"
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
CCACATGTCG ACCCGTAAAA AGGCCGCGTT GCTG<
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7.3:
Thr Tyr Gln Arg Thr Arg Ala Leu Val
1 5
(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(i1) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
Ile Pro Gln Ser Leu Asp Ser Trp Trp Tyr Ser Leu
1 5 10
- 57 -
