Note: Descriptions are shown in the official language in which they were submitted.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
TITLE
4,4-DISUBSTITUTED-3,4-DIHYDRO-2(1H)-QUINAZOLINONES USEFUL AS
HIV REVERSE TRANSCRIPTASE INHIBITORS
FIELD OF THE INVENTION
This invention relates generally to 4,4-disubstituted-
3,4-dihydro-2(1H)-quinazolinones which are useful as
inhibitors of HIV reverse transcriptase, pharmaceutical
compositions and diagnostic kits comprising the same, methods
of using the same for treating viral infection or as assay
standards or reagents, and intermediates and processes for
making the same.
BACKGROUND OF THE INVENTION
Two distinct retroviruses, human immunodeficiency virus
(HIV) type-1 (HIV-1) or type-2 (HIV-2), have been
etiologically linked to the immunosuppressive disease,
acquired immunodeficiency syndrome (AIDS). HIV seropositive
individuals are initially asymptomatic but typically develop
AIDS related complex (ARC) followed by AIDS. Affected
individuals exhibit severe immunosuppression which
predisposes them to debilitating and ultimately fatal
opportunistic infections.
The disease AIDS is the end result of an HIV-1 or HIV-2
virus following its own complex life cycle. The virion life
cycle begins with the virion attaching itself to the host
human T-4 lymphocyte immune cell through the bonding of a
glycoprotein on the surface of the virion's protective coat
with the CD4 glycoprotein on the lymphocyte cell. Once
attached, the virion sheds its giycoprotein coat, penetrates
into the membrane of the host cell, and uncoats its RNA. The
virion enzyme, reverse transcriptase, directs the process of
transcribing the RNA into single-stranded DNA. The viral RNA
is degraded and a second DNA strand is created. The now
double-stranded DNA is integrated into the human cell's genes
and those genes are used for virus reproduction.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
At this point, RNA polymerise transcribes the integrated
DNA into viral RNA. The viral RNA is translated into the
precursor gag-pot fusion polyprotein. The polyprotein is
then cleaved by the HIV protease enzyme to yield the mature
viral proteins. Thus, HIV protease is responsible for
regulating a cascade of cleavage events that lead to the
virus particle's maturing into a virus that is capable of
full infectivity.
The typical human immune system response, killing the
invading virion, is taxed because the virus infects and kills
the immune system's T cells. In addition, viral reverse
transcriptase, the enzyme used in making a new virion
particle, is not very specific, and causes transcription
mistakes that result in continually changed glycoproteins on
the surface of the viral protective coat. This lack of
specificity decreases the immune system's effectiveness
because antibodies specifically produced against one
glycoprotein may be useless against another, hence reducing
the number of antibodies available to fight the virus. The
virus continues to reproduce while the immune response system
continues to weaken. Eventually, the HIV largely holds free
reign over the body's immune system, allowing opportunistic
infections to set in and without the administration of
antiviral agents, immunomodulators, or both, death may
result.
There are at least three critical points in the virus's
life cycle which have been identified as possible targets for
antiviral drugs: (1) the initial attachment of the virion to
the T-4 lymphocyte or macrophage site, (2) the transcription
of viral RNA to viral DNA (reverse transcriptase, RT), and
(3) the processing of gag-pol protein by HIV protease.
Inhibition.of the virus at the second critical point,
the viral RNA to viral DNA transcription process, has
provided a number of the current therapies used in treading
AIDS. This transcription must occur for the virion to
reproduce because the virion's genes are encoded in RNA and
the host cell reads only DNA. By introducing drugs that
2
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
block the reverse transcriptase from completing the formation
of viral DNA, HIV-1 replication can be stopped.
A number of compounds that interfere with viral
replication have been developed to treat AIDS. For example,
nucleoside analogs, such as 3'-azido-3'-deoxythymidine (AZT),
. 2',3'-dideoxycytidine (ddC), 2',3'-dideoxythymidinene (d4T),
2',3'-dideoxyinosine (ddI), and 2',3'-dideoxy-3'-thia-
cytidine (3TC) have been shown to be relatively effective in
halting HIV replication at the reverse transcriptase (RT)
stage.
An active area of research is in the discovery of non-
nucleoside HIV reverse transcriptase inhibitors. As an
example, it has been found that certain benzoxazinones and
quinazolinones are active in the inhibition of HIV reverse
transcriptase, the prevention or treatment of infection by
HIV and the treatment of AIDS.
U.S. 5,519,021 describe reverse transcriptase inhibitors
which are benzoxazinones of the formula:
X1 R
X
O
\ N~Z
H
wherein X is a halogen, Z may be 0.
EP 0,530,994 and w0 93/04047 describe HIV reverse
transcriptase inhibitors which are quinazolinones of the
formula A:
R1 Rz
R3
w Ni
n \ ~
N' ' Z
R4
A
wherein G is a variety of groups, R3 and R4 may be H, Z may be
O, R2 may be unsubstituted alkyl, unsubstituted alkenyl,
unsubstituted alkynyl, unsubstituted cycloalkyl,
unsubstituted heterocycle, and optionally substituted aryl,
and R1 may be a variety of groups including substituted alkyl.
3
CA 02284996 1999-09-27
WO 9814527b PCT/US98106733
WO 95/12583 also describes HIV reverse transcriptase
inhibitors of formula A. In this publication, G is a variety
of groups, R3 and R4 may be H, Z may be O, R2 is substituted
alkenyl or substituted alkynyl, and R1 is cycloalkyi, alkynyl,
alkenyl, or cyano. WO 95/13273 illustrates the asymmetric
synthesis of one of the compounds of WO 95/12583, (S)-(-)-6-
chloro-4-cyclopropyl-3,4-dihydro-4((2-pyridy)ethynyl)-2(1H)-
quinazolinone.
Synthetic procedures for making quinazolinones like
those described above are detailed in the following
references: Houpis et al, Tetr. Lett. 1994, 35(37), 6811-
6814; Tucker et aI, J. Med. Chem. 1994, 37, 2437-2444; and,
Huffman et al, J. Org. Chem. 1995, 60, 1590-2594.
DE 4,320,347 illustrates quinazolinones of the formula:
R R3
/Y ~R2
~N
R1
N- 'X
H
wherein R is a phenyl, carbocyclic ring, or a heterocyclic
ring. Compounds of this sort are not considered to be part
of the present invention.
Even with the current success of reverse transcriptase
inhibitors, it has been found that HIV patients can become
resistant to a single inhibitor. Thus, it is desirable to
develop additional inhibitors to further combat HIV
infection.
SUMMARY OF THE INVENTION
Accordingly, one object of the present invention is to
provide novel reverse transcriptase inhibitors.
It is another object of the present invention to provide
a novel method for treating HIV infection which comprises
administering to a host in need of such treatment a
therapeutically effective amount of at least one of the
compounds of the present invention or a pharmaceutically
acceptable salt form thereof.
It is another object of the present invention to provide
a novel method for treating HIV infection which comprises
4
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
administering to a host in need thereof a therapeutically
effective combination of (a) one of the compounds of the
present invention and (b) one or more compounds selected form
the group consisting of HIV reverse transcriptase inhibitors
and HIV protease inhibitors.
It is another object of the present invention to provide
pharmaceutical compositions with reverse transcriptase
inhibiting activity comprising a pharmaceutically acceptable
carrier and a therapeutically effective amount of at least
one of the compounds of the present invention or a
pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide
a method of inhibiting HIV present in a body fluid sample
which comprises treating the body fluid sample with an
effective amount of a compound of the present invention.
It is another object of the present invention to provide
a kit or container containing at least one of the compounds
of the present invention in an amount effective for use as a
standard or reagent in a test or assay for determining the
ability of a potential pharmaceutical to inhibit HIV reverse
transcriptase, HIV growth, or both.
These and other objects, which will become apparent
during the following detailed description, have been achieved
by the inventors' discovery that compounds of formula (I):
_z
R8
~ N'~O
H
I
wherein Rl, R2, R3, and R$ are defined below, stereoisomeric
forms, mixtures of stereoisomeric forms, or pharmaceutically
acceptable salt forms thereof, are effective reverse
" transcriptase inhibitors.
DETAILED DESCRTP'1'TON OF PREFERRED EMBODIMENTS
I1] Thus, in a first embodiment, the present invention
provides a novel compound of formula I:
5
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
R1 R2
R8
~N~
~ N ~O
H
I
or a stereoisomer or pharmaceutically acceptable salt
thereof, wherein:
R1 is C1_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1_5 alkyl substituted with 1-2 R4, C2-5
alkenyl substituted with 1-2 R4, and C2_5 alkynyl
substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_4
alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR5R5a, N02, CN,
C ( O ) R6 , NHC ( O ) R7 , and NHC ( O ) NRSRSa ;
alternatively, if two R3's are present and are attached to
adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3,
phenyl substituted with 0-5 R3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected
from O, N, and S, substituted with 0-2 R3;
R~ and R5a are independently selected from H and C1_3 alkyl;
R6 is selected from H, OH, C1_4 alkyl, C~_g alkoxy, and NRSRSa;
R7 is selected from C~_3 alkyl and C1_3 alkoxy;
R8 is selected from H, C3-5 cycloalkyl, and C1_3 alkyl; and,
n is selected from 0, 1, 2, 3, and 4.
6
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
(2] In a preferred embodiment, the present invention
provides a novel compound of formula I, wherein:
v R1 is C1_3 alkyl substituted with 1-7 halogen;
R2 is selected from C1_5 alkyl substituted with 1 R4, C2_5
alkenyl substituted with 1 R4, and C2_5 alkynyl
substituted with 1 R4;
R3, at each occurrence, is independently selected from C1_4
alkyl, OH, C1_4 alkoxy, F, C1, Br, I, NR5R5a, N02, CN,
C(O)RE, NHC(O)R~, and NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to
adjacent carbons, then they may combine to form -OCHzO-,
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3,
phenyl substituted with 0-2 R3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected
from O, N, and S, substituted with 0-1 R3;
R5 and RSa are independently selected from H, CH3 and C2H5;
RE is selected from H, OH, CH3, CzHS, OCH3, OC2H5, and NR5R5a.
R~ is selected from CH3, C2H5, OCH3, and OCzHS;
RB is selected from H, cyclopropyl, CH3 and C2H5; and,
n is selected from 0, 1, 2, and 3.
[3] In a more preferred embodiment, the present invention
provides a novel compound of formula I, wherein:
R1 is selected from CF3, and C2F5;
7
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
R2 is selected from C1_3 alkyl substituted with 1 R4, CZ-3
alkenyl substituted with 2 R4, and CZ_3 alkynyl
substituted with 1 R4;
R3, at each occurrence, is independently selected from CI_3
alkyl, OH, C1_3 alkoxy, F, C1, Br, I, NR5R5a, N02, CN,
C(0)R6, NHC(0)R7, arid NHC(O)NR5R5a;
alternatively, if two R3's are present and are attached to
adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from C3_5 cycloalkyl substituted with 0-2 R3,
phenyl substituted with 0-2 R3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected
from 0, N, and S, substituted with 0-1 R3;
R5 and RSa are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, CZHS, OCH3, OC2H5, and NRSRSa;
R~ is selected from CH3, CzHS, OCH3, and OC2H5;
Re is selected from H, CH3 and C2H5; and,
n is selected from 0, 1, and 2.
[4] In an even more preferred embodiment, the present
invention provides a novel compound of formula I, wherein:
R3 is CF3;
R2 is selected from C1_3 alkyl substituted with 1 R4, C2_3
alkenyl substituted with 1 R4, and C2_3 alkynyl
substituted with 1 R4;
8
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
R3, at each occurrence, is independently selected from C1_3
alkyl, OH, C1_3 alkoxy, F, Cl, NR5R5a, N02, CN, C(O)R6,
NHC(0)R~, and NHC(0)NR5R5a;
alternatively, if two R3's are present and are attached to
adjacent carbons, then they may combine to form -OCH20-;
R4 is selected from cyclopropyl substituted with 0-1 R3,
phenyl substituted with 0-2 R3, and a 5-6 membered
heterocyclic system containing 1-3 heteroatoms selected
from 0, N, and S, substituted with 0-1 R3, wherein the
heterocyclic system is selected from 2-pyridyl, 3-
pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-
thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, and 2-
imidazolyl;
R5 and R5a are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR5R5a;
R~ is selected from CH3, C2H5, OCH3, and OC2H5;
R$ is selected from H, CH3 and C2H5; and,
n is selected from 1 and 2.
[5] In a further preferred embodiment, wherein the compound
is of formula Ia
1 R2
\ :~N~Ra
~ N' 'O
Ia.
[5] In a further preferred embodiment, wherein the compound
is of formula Ib:
9
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
R' R2
R8
\R
~N O
H
Ib .
[7] In a further preferred embodiment, the compound of
formula I is selected from:
(+/-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-
2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-5-Methoxy-4-phenylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-
3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-(2-pyridyl)ethynyl-4-trifluaromethyl-
3,4-dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-phenylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
(+/-)-4-Cyclopropylethynyl-6-fluoro-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethynyl-4-trifluoromethyl-3,4-dihydro-
2(1H)-quina2olinone;
(+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-phenylethyl-4-trifluoromethyl-3,4-dihydro-
2(1H)-quinazolinone;
(-)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+)-6-Chloro-4-cyclopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(-)-4-Cyclopropylethynyl-5,6-difluoro-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+)-4-E-Cyclopropylethenyl-5,6-difluoro-4-trifluoromethyl-
3,4-dihydro-2(1H)-quinazolinone; and,
(-)-6-Chloro-4-E-cyclopropylethenyl-4-trifluorornethyl-3,4-
dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
[8] In a second embodiment, the present invention provides a
novel compound of formula II:
11
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
CF3 R2
Ra
w
\R3 n~
N O
H
II
or a stereoisomer or pharmaceutically acceptable salt
thereof, wherein:
R2 is C=C-R4a;
R3 is selected from C1_q alkyl, OH, C1_4 alkoxy, F, C1, Br, I,
NR'RSa, N02, CN, C (O) R6, NHC (O) R7, and NHC (O) NR5R5a;
R4a is selected from methyl, ethyl, n-propyl, i-propyl,
i-butyl, t-butyl, and i-pentyl;
R5 and R5a are independently selected from H arid C1_3 alkyl;
R6 is selected from H, OH, C1_q alkyl, C1_4 alkoxy, and NR5R5a;
R7 is selected from C1_3 alkyl and C1_3 alkoxy;
R8 is selected from H, C3_5 cycloalkyl, and C~_3 alkyl; and,
n is selected from 0, 1, 2, 3, and 4.
[9] In another preferred embodiment, the present invention
provides a novel compound of formula II, wherein:
R2 is C=C-R4a;
R3 is selected from C1_4 alkyl, OH, C1-4 alkoxy, F, C1, Br, I,
NRSR~a, N02, CN, C (O) R6, and NHC (O) R7;
R4a is selected from methyl, ethyl, n-propyl, i-propyl,
i-butyl, t-butyl, and i-pentyl;
12
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
RS and Rsa are independently selected from H, CH3 and C2H5;
R6 is selected from H, OH, CH3, C2H5, OCH3, OC2H5, and NR~RSa;
R~ is selected from CH3, C2H5, OCH3, and OCZHS;
R8 is selected from H, cyclopropyl, CH3 and C2H5; and,
n is selected from 0, 1, and 2.
[10] In a further preferred embodiment, wherein the compound
is of formula IIa
CF3 R2
,R8
CR ~
~N O
H
IIa.
[11] In a further preferred embodiment, wherein the compound
is of forniula IIb:
CFg R2
N~Rs
\R h' / N
H
IIb.
[12] In another more preferred embodiment, the compound of
formula II is selected from:
(+/-)-6-Chloro-4-isopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Chloro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-
2(1H)-quinazolinone;
13
CA 02284996 1999-09-27
WO 98!45276 PCT/US98/06733
(+/-)-4-Isopropylethynyl-6-methoxy-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-guinazolinone;
(+/-)-5,6-Difluoro-4-isopentyl-4-trifluoromethyl-3,4-dihydro-
2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+/-)-6-Fluoro-4-ethylethynyl-4-trifluoromethyl-3,4-dihydro-
2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(+)-5,6-Difluoro-4-isopropylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
(-)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone; and,
(+)-5,6-Difluoro-4-ethylethynyl-4-trifluoromethyl-3,4-
dihydro-2(1H)-quinazolinone;
or a pharmaceutically acceptable salt thereof.
In a third embodiment, the present invention provides a
novel pharmaceutical composition comprising a
pharmaceutically acceptable carrier and a therapeutically
effective amount of a compound of formula I or II or
pharmaceutically acceptable salt form thereof.
14
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
In a fourth embodiment, the present invention provides a
novel method for treating HIV infection which comprises
S administering to a host in need of such treatment a
therapeutically effective amount of a compound of formula I
or II or pharmaceutically acceptable salt form thereof.
In a fifth embodiment, the present invention provides a
novel method of treating HIV infection which comprises
administering, in combination, to a host in need thereof a
therapeutically effective amount of:
(a) a compound of formula I or II; and,
(b) at least one compound selected from the group
consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors.
In another preferred embodiment, the reverse
transcriptase inhibitor is selected from AZT, 3TC, ddI, ddC,
d4T, delavirdine, TIBO derivatives, BI-RG-587, nevirapine, L-
697,661, LY 73497, Ro 18,893, loviride, trovirdine, MKC-442,
and HBY 097, and the protease inhibitor is selected from
saquinavir, ritonavir, indinavir, VX-478, nelfinavir, KNI-
272, CGP-61755, U-140690, and ABT-378.
In an even more preferred embodiment, the reverse
transcriptase inhibitor is selected from AZT and 3TC and the
protease inhibitor is selected from saquinavir, ritonavir,
nelfinavir, and .indinavir.
In a still further preferred ebodiment, the reverse
transcriptase inhibitor is AZT.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
In another still further preferred embodiment, the
protease inhibitor is indinavir.
In a sixth embodiment, the present invention provides a
pharmaceutical kit useful for the treatment of HIV infection,
which comprises a therapeutically effective amount of:
(a) a compound of formula I or II; and,
(b) at least one compound selected from the group
consisting of HIV reverse transcriptase inhibitors and HIV
protease inhibitors, in one or more sterile containers.
In a seventh embodiment, the present invention provides
a novel method of inhibiting HIV present in a body fluid
sample which comprises treating the body fluid sample with an
effective amount of a compound of formula I or II.
In a eighth embodiment, the present invention to
provides a novel a kit or container comprising a compound of
formula I or II in an amount effective for use as a standard
or reagent in a test or assay for determining the ability of
a potential pharmaceutical to inhibit HIV reverse
transcriptase, HIV growth, or both.
DEFINITIONS
As used herein, the following terms and expressions have
the indicated meanings. It will be appreciated that the
compounds of the present invention contain an asymmetrically
substituted carbon atom, and may be isolated in optically
active or racemic forms. It is well known in the art how to
prepare optically active forms, such as by resolution of
racemic forms or by synthesis, from optically active starting
materials. All chiral, diastereomeric, racemic forms and all
geometric isomeric forms of a structure are intended, unless
the specific stereochemistry or isomer form is specifically
indicated.
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
The processes of the present invention are contemplated
to be practiced on at least a multigram scale, kilogram
scale, multikilogram scale, or industrial scale. Multigram
scale, as used herein, is preferably the scale wherein at
least one starting material is present in 10 grams or mare,
more preferably at least 50 grams or more, even more
preferably at least 100 grams or more. Multikilogram scale,
as used herein, is intended to mean the scale wherein more
than one kilogram of at least one starting material is used.
Industrial scale as used herein is intended to mean a scale
which is other than a laboratory scale and which is
sufficient to supply product sufficient for either clinical
tests or distribution to consumers.
As used herein, "alkyl" is intended to include both
branched and straight-chain saturated aliphatic hydrocarbon
groups having the specified number of carbon atoms. Examples
of alkyl include, but are not limited to, methyl, ethyl, n-
propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s-
pentyl. "Haloalkyl" is intended to include both branched and
straight-chain saturated aliphatic hydrocarbon groups having
the specified number of carbon atoms, substituted with 1 or
more halogen (for example -CVFW where v = 1 to 3 and w = 1 to
(2v+1)). Examples of haloalkyi include, but are not limited
to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and
pentachloroethyl. "Alkoxy" represents an alkyl group as
defined above with the indicated number of carbon atoms
attached through an oxygen bridge. Examples of alkoxy
include, but are not limited to, methoxy, ethoxy, n-propoxy,
i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-
pentoxy. "Cycloalkyi" is intended to include saturated ring
groups, such as cyclopropyl, cyclobutyl, or cyclopentyl.
Alkenyl" is intended to include hydrocarbon chains of either
a straight or branched configuration and one or more
unsaturated carbon-carbon bonds which may occur in any stable
point along the chain, such as ethenyl, propenyl and the
like. "Alkynyl" is intended to include hydrocarbon chains of
either a straight or branched configuration and one or more
triple carbon-carbon bonds which may occur in any stable
17
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
point along the chain, such as ethynyl, propynyl and the
like.
"Halo" or "halogen" as used herein refers to fluoro,
chloro, bromo and iodo. "Counterion" is used to represent a
small, negatively charged species such as chloride, bromide,
hydroxide, acetate, sulfate and the like.
As used herein, "aryl" or "aromatic residue" is intended
to mean an aromatic moiety containing the specified number of
carbon atoms, such as phenyl or naphthyl. As used herein,
"carbocycle" or "carbocyclic residue" is intended to mean any
stable 3- to 5- membered monocyclic ring, which may be
saturated or partially unsaturated. Examples of such
carbocyles include, but are not limited to, cyclopropyl,
cyclopentyl, cyclohexyl, phenyl, biphenyl, naphthyl, indanyl,
adamantyl, or tetrahydronaphthyl (tetralin).
As used herein, the term "heterocycle" or "heterocyclic
system" is intended to mean a stab7,e 5- to 6- membered
monocyclic heterocyclic ring which is saturated partially
unsaturated or unsaturated (aromatic), and which consists of
carbon atoms and from 1 to 3 heteroatoms independently
selected from the group consisting of N, O and S. The
nitrogen and sulfur heteroatoms may optionally be oxidized.
The heterocyclic ring may be attached to its pendant group at
any heteroatom or carbon atom which results in a stable
structure. The heterocyclic rings described herein may be
substituted on carbon or on a nitrogen atom if the resulting
compound is stable. If specifically noted, a nitrogen in the
heterocycle may optionally be quaternized. It is preferred
that when the total number of S and O atoms in the
heterocycle exceeds 1, then these heteroatoms are not
adjacent to one another. It is preferred that the total
number of S and.0 atoms in the heterocycle is not more than
1. As used herein, the term "aromatic heterocyclic system"
is intended to mean a stable 5- to 6- membered monocyclic
heterocyclic aromatic ring which consists of carbon atoms and
from 1 to 3 heterotams independently selected from the group
consisting of N, O and S. It is preferred that the total
18
CA 02284996 1999-09-27
WD 98145276 PCT/US98106733
number of S and O atoms in the aromatic heterocycle is not
more than 1.
Examples of heterocycles include, but are not limited
to, 2-pyrrolidonyl, 2H-pyrrolyl, 4-piperidonyl, 6H-1,2,5-
thiadiazinyl, 2H,6H-1,5,2-dithiazinyl, furanyl, furazanyl,
imidazolidinyl, imidazolinyl, imidazolyl, isoxazolyl,
morpholinyl, oxadiazolyl, 2,2,3-oxadiazolyl, 1,2,4-
oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl,
oxazolidinyl., oxazolyl, piperazinyl, piperidinyl,
20 pteridinyl, piperidonyl, 4-piperidonyl, pteridinyl, purinyl,
pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl,
pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl,
pyrrolinyl, pyrrolyl, tetrahydrofuranyl, 6H-1,2,5-
thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-
thiadiazolyl, 1,3,4-thiadiazolyl, thiazolyl, thienyl,
thienothiazolyl, thienooxazolyl, thienoimidazolyl,
thiophenyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl,
1,2,5-triazolyl, and 1,3,4-triazolyl. Preferred heterocycles
include, but are not limited to, pyridinyl, furanyl, thienyl,
pyrrolyl, pyrazolyl, imidazolyl, and oxazolidinyl. Also
included are fused ring and spiro compounds containing, for
example, the above heterocycles.
As used herein, "HIV reverse transcriptase inhibitor" is
intended to refer to both nucleoside and non-nucleoside
inhibitors of HIV reverse transcriptase (RT). Examples of
nucleoside RT inhibitors include, but are not limited to,
AZT, ddC, ddI, d4T, and 3TC. Examples of non-nucleoside RT
inhibitors include, but are no limited to, delavirdine
(Pharmacia and Upjohn U901525), TIBO derivatives, BI-RG-587,
nevirapine (Boehringer Ingelheim), L-697,661, LY 73497, Ro
18,893 (Roche), loviride (Janssen), trovirdine (Lilly), MKC-
442 (Triangle), .and HBY 097 (Hoechst).
. As used herein, "HIV protease inhibitor" is intended to
refer to compounds which inhibit HIV protease. Examples
include, but are not limited, saquinavir (Roche, Ro31-8959),
ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), VX-
478 (Vertex/Glaxo wellcome), nelfinavir (Agouron, AG-1343),
KNI-272 (Japan Energy), CGP-61755 (Ciba-Geigy), U-140690
I9
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
(Pharmacia and Upjohn), and ABT-378. Additional examples
include the cyclic protease inhibitors disclosed in
W093/07128, WO 94/19329, WO 94/22840, and PCT Application
Number US96/03426.
As used herein, "pharmaceutically acceptable salts"
refer to derivatives of the disclosed compounds wherein the
parent compound is modified by making acid or base salts
thereof. Examples of pharmaceutically acceptable salts
include, but are not limited to, mineral or organic acid
salts of basic residues such as amines; alkali or organic
salts of acidic residues such as carboxylic acids; and the
like. The pharmaceutically acceptable salts include the
conventional non-toxic salts or the quaternary ammonium salts
of the parent compound formed, for example, from non-toxic
inorganic or organic acids. For example, such conventional
non-toxic salts include those derived from inorganic acids
such as hydrochloric, hydrobromic, sulfuric, sulfamic,
phosphoric, nitric and the like; and the salts prepared from
organic acids such as acetic, propionic, succinic, glycolic,
stearic, lactic, malic, tartaric, citric, ascorbic, pamoic,
malefic, hydroxymaleic, phenylacetic, giutamic, benzoic,
salicylic, sulfanilic, 2-acetoxybenzoic, fumaric,
toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic,
isethionic, and the like.
The pharmaceutically acceptable salts of the present
invention can be synthesized from the parent compound which
contains a basic or acidic moiety by conventional chemical
methods. Generally, such salts can be prepared by reacting
the free acid or base forms of these compounds with a
stoichiometric amount of the appropriate base or acid in
water or in an organic solvent, or in a mixture of the two;
generally, nonaqueous media like ether, ethyl acetate,
ethanol, isopropanol, or acetonitrile are preferred. Lists
of suitable salts are found in Remington's Pharmaceutical
Sciences, 17th ed., Mack Publishing Company, Easton, PA,
1985, p. 1418, the disclosure of which is hereby incorporated
by reference.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
The phrase "pharmaceutically acceptable" is employed
herein to refer to those compounds, materials, compositions,
and/or dosage forms which are, within the scope of sound
medical judgment, suitable for use in contact with the
tissues of human beings and animals without excessive
toxicity, irritation, allergic response, or other problem or
complication commensurate with a reasonable benefit/risk
ratio.
"Prodrugs" are intended to include any covalently bonded
carriers which release the active parent drug according to
formula (I) or other formulas or compounds of the present
invention in vivo when such prodrug is administered to a
mammalian subject. Prodrugs of a compound of the present
invention, for example formula (I), are prepared by modifying
functional groups present in the compound in such a way that
the modifications are cleaved, either in routine manipulation
or in vivo, to the parent compound. Prodrugs include
compounds of the present invention wherein the hydroxy or
amino group is bonded to any group that, when the prodrug is
administered to a mammalian subject, cleaves to form a free
hydroxyl or free amino, respectively. Examples of prodrugs
include, but are not limited to, acetate, forrnate and
benzoate derivatives of alcohol and amine functional groups
in the compounds of the present invention, and the like.
"Stable compound" and "stable structure" are meant to
indicate a compound that is sufficiently robust to survive
isolation to a useful degree of purity from a reaction
mixture, and formulation into an efficacious therapeutic
agent. Only stable compounds are contempleted by the present
invention.
"Substituted" is intended to indicate that one or more
hydrogens on the atom indicated in the expression using
"substituted" is replaced with a selection from the indicated
group(s), provided that the indicated atom's normal valency
is not exceeded, and that the substitution results in a
stable compound. When a substituent is keto (i.e., =O)
group, then 2 hydrogens on the atom are replaced.
21
CA 02284996 1999-09-27
WO 98/4527b PCT/US98/06733
"Therapeutically effective amount" is intended to
include an amount of a compound of the present invention or
an amount of the combination of compounds claimed effective
to inhibit HIV infection or treat the symptoms of HIV
infection in a host. The combination of compounds is
preferably a synergistic combination. Synergy, as described
for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55
(1984), occurs when the effect (in this case, inhibition of
HIV replication) of the compounds when administered in
combination is greater than the additive effect of the
compounds when administered alone as a single agent. In
general, a synergistic effect is most clearly demonstrated at
suboptimal concentrations of the compounds. Synergy can be
in terms of lower cytotoxicity, increased antiviral effect,
or some other beneficial effect of the combination compared
with the individual components.
SYNTHESIS
The compounds of the present invention can be prepared
in a number of ways well known to one skilled in the art of
organic synthesis. The compounds of the present invention
can be synthesized using the methods described below,
together with synthetic methods known in the art of synthetic
organic chemistry, or variations thereon as appreciated by
those skilled in the art. Preferred methods include but are
not limited to those methods described below. Each of the
references cited below are hereby incorporated herein by
reference.
22
CA 02284996 1999-09-27
WO 98/45276 PCTlUS98/06733
SCHEME 2
R3~\ COOH ~ ~CH3) OCH3 R\ \ V N..OCH3
CH3
NHZ
TMSC1, base
R1 MgX
R3 O
R1
2
Scheme 1 illustrates a method of preparing keto-anilines
from an appropriately substituted 2-aminobenzoic acid. The
acid is converted to its N-methoxy-N-methyl amide derivative
which can then be displaced to obtain the R1-substituted
ketone. The keto-anilines are useful intermediates for the
presently claimed compounds.
SCHEME 2
R3 R3
3
R\ I Me3CCOC1
I2 , NaHC03 \\
NaI-iC03
I ~ I / ~ NH
~2 ~2
O
R3 O R3 O
n-BuLi I \ CF3 6N-HCl ~\ CF3
CF3 COZ Et ~ / NH2
O
Scheme 2 describes another method of preparing keto-
anilines, this time from an appropriately substituted
aniline. After iodination and amine protection, a group such
as trifluoromethyl can be introduced using a strong base and
ethyl trifluoroacetate. Deprotection provides the keto-
aniline. Additional means of preparing keto-anilines are
known to one of skill in the art, e.g, Houpis et al, Tetr.
Lett. 1994, 35(37), 6811-6814, the contents of which are
24 hereby incorporated herein by reference.
23
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
SCHEME 3
3 R
R~~ COOH HN ( CH3 ) OCH3 ~~~ CON ( OCH3 ) CH3
NH
2 NHz
R3 3
TrBr, DIPEA ~~ CON (OCH3 ) CH3 R~~ CHO
reduction
CH C1 /
z z N(H)Tr N(H)Tr
CF3 3 O
CF3TMS, TBAF R\~ OH oxidation R\~ CF
3
THF / N(H)Tr / N(H)Tr
Another method of making 2-trifluoroacetylanilines is
shown in Scheme 3. After forming the protected aniline, the
amide is then reduced and the trifluoromethyl group added.
Oxidation with an oxidant, such as Mn02, provides the useful
intermediate.
SCHEME 4
0 R1 OH
a) TMSNCO 3 4 ~ mol.
DMAP/THF
vn
R1 b) TBAF/T F ~ \ sieves
/ NH2 ~ ~ 0
1 2
- R1
3
R\ ~ ~ a. n-BuLi/HCCR4/THF
N b. BF3 ~OEtz
N~O
H
3
1
R3
Ei2 , Pd/C
NH
N~O
H
5_
Using the general method detailed in Scheme 4, one can
prepare compounds of the present invention. Keto-aniline _1,
24
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
which may be prepared by the methods desribed in Schemes 1
and 2, is treated with trimethylsilyl isocyanate in dry
tetrahydofuran in the presence of dimethylaminopyridine
followed by tetrabutylammonium fluoride to give the hydroxy-
S urea 2. The hydroxy-urea 2 is then dehydrated with a
dehydrating agent such as 4~1 molecular sieves in refluxing
toluene or xylenes to give the ketimine 3. A substituted
acetylenic R2 group is added by treating the ketimine 3 with
a lithium acetylide, which is prepared in a separate vessel
by reacting the corresponding substituted acetylene with n-
butyllithium in dry tetrahydrofuran, to give the 4,4-
disubstituted 3,4-dihydro-2(1H)-quinazolinone 4_, a compound
of formula I. The acetylenic bond of the compound 4 may be
reduced, e.g., by catalytic hydrogenation, to give the
corresponding alkenyl group (not shown) or the saturated
compound 5_.
Other R2 groups may also be introduced by directly
reacting the imine 3_ with a lithiate RZLi or a Grignard
reagent R2MgX in the presence or absence of Lewis acid
catalyst, such as BF3 etherate. See also Huffman et al, J.
Org. Chem. 1995, 60, 1590-1594, the contents of which are
hereby incorporated herein by reference.
In certain instances, one enantiomer of a compound of
Formula I or II may display superior activity compared with
the other. inlhen required, separation of the racemic material
can be achieved by HPLC using a chiral column as exemplified
in Examples 27-34 (Scheme 4) or by a resolution using a
resolving agent such as camphonic chloride as in Thomas J.
Tucker, et al, J. Med. Chem. 1994, 3 7, 2437-2444. A chiral
compound of Formula I may also be directly synthesized using
a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman,
et al, J. Org. Chem. 1995, 60, 1590-1594.
Other features of the invention will become apparent in
the course of the following descriptions of exemplary
embodiments which are given for illustration of the invention
and are not intended to be limiting thereof.
CA 02284996 1999-09-27
WO 9$/45276 PCTIUS98/06733
Examples
Abbreviations used in the Examples are defined as
follows: "°C" for degrees Celsius, "d" for doublet, "dd" for
doublet of doublets, "eq" for equivalent or equivalents, "g"
for gram or grams, "mg" for milligram or milligrams, "mL" for
milliliter or milliliters, "H" for hydrogen or hydrogens,
"hr" for hour or hours, "m" for multiplet, "M" for molar,
"min" for minute or minutes, "MHz" for megahertz, "MS" for
mass spectroscopy, "nmr" or "NMR" for nuclear magnetic
resonance spectroscopy, "t" for triplet, "TLC" for thin layer
chromatography, "EDAC" for 1-(3-dimethylaminopropyl)-3-
ethylcarbodiimide hydrochloride, "DIPEA" for
diisopropylethylamine, "TBAF" for tetrabutylammonium
fluoride, "LAH" for lithium aluminium hydride, and "TEA" for
triethylamine.
Examvle 1
Prepration of (+/-)-6-Chloro-4-cyclopropylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Rd _
Cyclopropyl)
O a) TMSNCO CF3 OH
C1 DMAP/THF C1 PhCH3 T.1.
\CF3 b) TBAF/THF ~ \ \NH 4 A mol. sieves
NH2 ~ ~~ o
I-a II-a R4
Fg CF3 ~~
C1 a. THF/n-BuLi/HCCR4 C1
\ ~N b. BF3~OEtZ ~ \
N' '_ O
O H
III-a IV-a
Step 1. Synthesis of II-a from I-a.
To a solution of compound I-a (4.55 g, 20.2 mmol) in
anhydrous THF (40 mL) was added dimethylaminopyridine (0.25
g, 2.02 mmol) and trimethylsilyl isocyanate (6.05 g, 7.11 mL,
52.5 mmol). The mixture was stirred at room temperature for
26
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
approximately 16 hours, then tetrabutylammonium fluoride (21
mL of 1 M solution in THF) was added. The thick slurry was
diluted with additional THF (20 mL) and stirred at room
temperature for 0.5 hours. The THF was removed under reduced
S pressure, the residue was taken up in EtOAc (100 mL) and
washed sequentially with I N HC1 (70 mL), saturated aqueous
NaHC03 (70 mL) and saturated aqueous NaCl (50 mL). The
organic phase was dried over MgS04, filtered and concentrated
under reduced pressure to afford a light yellow solid. The
yellow color was removed upon trituration with hexanes to
afford IIa (5.09 g, 94~) as a white solid: 1H NMR (300 MHz,
acetone-ds) 8 9.06 (br s, 1 H), 7.48 (s, 1 H), 7.40 (br s, 1
H), 7.34 (dd, J = 8.8, 2.6 Hz, 1 H), 6.97 (d, J = 8.8 Hz, 1
H); ~9F NMR (282 MHz, acetone-d6) 8 -86.33, -86.35; IR (KBr
Pellet) 1724, 1678, 1398, 1198, 1174 cm-1; MS (CI) m/e 266
( MH+ , 10 0 ) .
Step 2. Synthesis of III-a from II-a.
A suspension of II-a (5.09 g, 19.1 mmol) in toluene (150
mL) containing 4 ~ molecular sieves (approximately 100 mg)
was heated at reflex for 16 hours. The resulting clear
yellow solution was cooled to room temperature, the
precipitated solids were dissolved in acetone and the
molecular sieves were removed by vacuum filtration. The
filtrate was concentrated under reduced pressure, and
triturated with hexanes to afford III-a (4.25 g, 89g) as a
yellow solid: 1H NN~ (300 N~iz, acetone-d6) 8 7.86-7.82 (m, 2
H), 7.61 (d, J = 8.8 Hz, 1 H); 19F NMR (282 MHz, acetone-d6) $
-67.88.
Step 3. Synthesis of IV-a from IIIa.
A solution of cyclopropylacetylene (13.0 mL of 30 wt~
solution in toluene/THF/hexanes, 59.0 mmol) in anhydrous THF
(118 mL) was cooled to -78 °C, treated with n-BuLi (32.8 mL
of 1.6 M solution in hexanes, 52.4 mmol), warmed to 0 °C in
an ice bath, and aged for 0.5 h. To a solution of III-a
27
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
(3.12 g, 12.6 mmol) in anhydrous THF (66 mL) at -78 °C was
added the lithium acetylide over approximately 10 minutes.
To this was added boron trifluoride etherate (0.89 g, 0.80
mL, 6.28 rnmol), followed by removal of the cooling bath. The
reaction was allowed to reach room temperature and stirred at
room temperature for 4 hours before quenching with 1 M citric
acid (100 mL). The mixture was concentrated under reduced
pressure to 1/2 original volume, diluted with EtOAc (200 mL),
the aqueous phase was removed and the organic phase was
sequentially washed with saturated aqueous NaHC03 (100 mL),
and saturated aqueous NaCl (100 mL). The organic phase was
dried over MgS04, filtered and concentrated under reduced
pressure. The crude material was purified by flash
chromatography (3~ MeOH/CH2C12) to afford a thick yellow oil
from which was obtained crystalline IV-a (R4 = cyclopropyl)
(3.85 g, 97~) as a white solid: mp 86.6-88 °C; 1H NMR (300
MHz, acetone-d6) b 8.95 (br s, 1 H), 7.51 (br s, 1 H), 7.43
(br s, 1 H), 7.40 (dd, J = 8.8, 2.4 Hz, 1 H), 7.02 (d, J =
8.8 Hz, 1 H), 1.49-1.41 (m, 1 H), 0.93-0.82 (m, 1 H), 0.77-
0.74 (m, 1 H); 19F NMR (282 MHz, acetone-d6) S -82.96; IR
(KBr Pellet) 1696, 1272 cm-1; MS (CI) m/e calc'd for
C14H1oC1F3N20: 315.051201, found 315.051626; 315 (MH+, 51),
332 (M+NH4+, 100) ; Analysis calc'd for C14H10N2CIF30~0.25 H20:
C, 52.68; H, 3.32; N, 8.78; found: C, 52.61; H, 3.35;
N, 8.28.
Example 2
Preparation of (+/-)-6-Chloro-4-isopropylethynyl-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 -
Isopropyl)
A solution of III-a (50 mg, 0.201 mmol) was treated with
the lithium acetylide derived from 3-methyl-1-butyne (62 mg,
93 mL, 0.905 mmol) according to the procedure of Step 3 of
Example 1. The resulting crude material was purified by
flash chromatography (35~ EtOAc/hexanes) to afford 26mg (41$)
of the desired product: 1H NMR (300 MHz, ) 8 9.08 (br s, 1
H), 7.59 (br s, 1 H), 7.53 (br s, 1 H), 7.40 (dd, J = 8.4,
28
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
2.2 Hz, 1 H), 7.02 (d, J = 8.8 Hz, 1 H), 2.81-2.68 (m, 1 H),
1.20 (dd, J = 6.6 Hz, 6H); 19F NMR (282 MHz, acetone-ds) b
-83.05; MS (CI) m/e calc'd for C14H12C1F3N20: 317.066851,
found 317.069433; 317 (MH+, 43), 334 (M+NH4+, 100).
Example 3
Preparation of (+/-)-5-Chloro-4-(2-pyridyl)ethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4
2-Pyridyl)
A solution of III-a (100 mg, 0.402 mmol) was treated
with the the lithium acetylide derived from 2-ethynylpyridine
(0.19 g, 1.81 mmol) according to the procedure of Step 3 of
Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 85 mg (60~) of the desired
product: mp 105 °C dec.; 1H NMR (300 MHz, acetone-d6) 8 9.14
(br s, 1 H), 8.64-8.61 (m, 1 H), 7.89-7.84 (m, 2 H), 7.70-
7.66 (m, 2 H), 7.48-7.43 (m, 2 H), 7.09 (d, J = 8.8 Hz, 1 H);
19F NMR (282 MHz, acetone-d6) 8 -82.48; IR (KBr Pellet) 1704,
1430, 1286 cm 1; MS (CI) m/e calc'd for ClgHIoC1F3N30:
352.046450, found 352.046956; 352 (MH+, 100); Analysis
calc'd for Cl6HgC1F3N30~0.125 H20: C, 54.3; H, 2.56; N,
11.9; found: C, 54.71; H, 3.03; N, 11.3.
Examule 4
Preparation of (+/-)-6-Chloro-4-ethylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazoliaone (R4 _
Ethyl)
A solution of III-a (100 mg, 0.402 mmol) was treated
with the the lithium acetylide derived from 1-butyne (109 mg,
2.01 mmol) according to the procedure of Step 3 of Example 2.
The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 79 mg (65~) of the desired product: 1H
NMR (300 MHz, acetone-d6) 8 9.05 (br s, 1 H), 7.54 (br s, 2
H), 7.41-7.39 (m, 1 H), 7.02 (d, J = 8.4 Hz, 1 H), 2.36-2.32
(m, 2 H), 2.18-1.23 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8
29
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
-82.99; MS (CI) m/e calc'd for C13H1oC1F3N20: 303.051201,
found 303.051882; 303 (MH+, 55), 320 (M+NH4+, 100).
Example 5
Preparation of (+/-)-6-Chloro-4-phenylethynyl-4-
trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 _
Phenyl)
A solution of III-a (100 mg, 0.402 mmol) was treated
with the the lithium acetylide derived from phenylacetylene
(185 mg, 1.81 mmol) according to the procedure of Step 3 of
Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 54 mg (38~) of the desired
product: 1H NMR (300 MHz, acetone-d6) 8 9.07 (br s, 1 H),
7.74 (br s, 1 H), 7.67 (br s, 1 H), 7.62-7.58 (m, 2 H), 7.48-
7.40 (m, 4H), 7.08 (d, J = 8.4 Hz, 1 H); 19F NMR (282 MHz,
acetone-d6) S -82.67; IR (KBr Pellet) 1696, 1186 cm-1; MS
(CI) m/e calc'd for C17H11C1F3N20: 351.051201, found
351.051704; 351 (MH+, 51), 368 (M+NH4+,100); Analysis calc'd
for Cl~HIpC1F3N20~0.25 H20: C, 57.48; H, 2.98; N, 7.89;
found: C, 57.00; H, 3.03; N, 7.48.
Example 6
Preparation of (+/-)-4-Cyclopropylethynyl-6-methoxy-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Ra _
Cyclopropyl)
O F3 OH
Me ~ a ) TMSNCO Me PhCH3 T.~
~CF3 DMpP/,hHF~ ~ ~ ~ 4 ~. mol. sieves
b) TBAF/THF
NHz N O
H R°
V-a VI-a
CF3 F3 ~~
Me ~ ~ a. THF/n-BuLi/HCCR4 Me
N b. BFg~OEtz
'O
H~ O
VII-a VIII-a
Step 1. Synthesis of VI-a from V-a.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
A solution of V-a (0.50 g, 2.28 mmol) was treated with
dimethylaminopyridine and trimethylsilyl isocyanate as
described in Step 1 of Example 1 to afford 0.58 g (97~) of
the desired product: 1H NMR (300 MHz, acetone-d6) b 8.81 (br
s, 1 H), 7.17 (br s, 1 H), 7.11 (br s, 1 H), 7.00-5.92 (m, 2
H), 6.83 (s, 1 H), 3.76 (s, 3 H); ~9F NMR (282 MHz, acetone-
d6) S -85.99.
Step 2. Synthesis of VII-a from VI-a.
A solution of VI-a (0.58 g, 2.21 mmol) was heated in
toluene at reflux as described in Step 2 of Example 1 to
afford 0.50 g (93~) of the desired product: 1H NMR (300 MHz,
acetone-d6) 8 7.52 (br s, 2 H), 7.27 (s, 1 H), 3.90 (s, 3 H);
19F NMR (282 MHz, acetone-d6) 8 -68.08.
Step 3. Synthesis of VIII-a from VII-a.
A solution of VII-a (100 mg, 0.410 mmol) was treated
with the the lithium acetylide derived from
cyclopropylacetylene (0.41 mL of 30 wt~ solution in
toluene/THF/hexanes, 1.85 mmol) according to the procedure of
Step 3 of Example 1. The resulting crude material was
purified by HPLC (2.5~ MeOH/CH2C12) to afford 103 mg (81~) of
the desired product: 1H NNgt (300 MHz, acetone-d6) 8 8.77 (br
s, 1 H), 7.29 (br s, 1 H), 7.06 (br s, 1 H), 6.99-6.90 (m, 2
H), 3.77 (s, 3 H), 1.46-1.38 (m, 1 H), 0.91-0.85 (m, 2 H),
0.79-0.72 (m, 2 H); I9F NMR (282 MHz, acetone-d6) 8 -82.61;
MS (CI) mle calc'd for C15H14F3N2~2: 311.100738, found
311.099970; 311 (MH+, 100).
31
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Example 7
Preparation of (+/-)-4-Isopropyiethynyl-6-methoxy-4
trifluoromethyl-3,4-dihydro-2(2H)-quinazolinone (R4 _
Isopropyl)
A solution of VII-a (100 mg, 0.410 mmol) was treated
with the the lithium acetylide derived from 3-methyl-1-butyne
(126 mg, 0.29 mL, 1.85 mmol) according to the procedure of
Step 3 of Example 1. The resulting crude material was
purified by flash chromatography (2.5~ MeOH/CHZC12) to afford
30 mg (24~) of the desired product: mp 228-229 °C; 1H NMR
(300 MHz, acetone-ds) S 8.72 (br s, 1 H), 7.27 (br s, 1 H),
7.10 (br s, 1 H), 7.00-6.91 (m, 2 H), 3.77 (s, 3 H), 2.73-
2.67 (m, 1 H), 1.20 (dd, J = 7.0, 1.5 Hz, 6 H); 19F NMR (282
MHz, acetone-d6) 8 -82.71; IR (KBr Pellet) 1696, 1428, 1190,
1176 cm'I; MS (CI) m/e calc'd for C15H1sF3N2O2: 313.116388,
found 313.115871; 313 (MH~~ 100), 330 (M+NH4+, 15); Analysis
calc'd for C15H15F3N2O2: C, 57.69; H, 4.84; N, 8.97;
found: C, 57.74; H, 5.01; N, 8.57.
Example 8
1
Preparation of (+/-)-6-Methoxy-4-(2-pyridyl)ethynyl-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4
2-Pyridyl)
A solution of VII-a (100 mg, 0.410 mmol) was treated
with the the lithium acetylide derived from 2-ethynylpyridine
(0.19 g, 1.85 mmol) according to the procedure of Step 3 of
Example 1. The resulting crude material was purified by
flash chromatography (2.5~ MeOH/CH2C12) to afford 56 mg (39~)
of the desired product: 1H NMR (300 MHz, acetone-d6) 8 8.81
(br s, 1 H), 8.6.1 (d, J = 4.8 Hz, 1 H), 7.88-7.82 (m, 1 H),
7.66 (d, J = 7.7 Hz, 1 H), 7.61 (br s, 1 H), 7.46-7.42 (m, 1
H), 7.23 (br s, 1 H), 7.06-6.97 (m, 2 H), 3.79 (s, 3 H); 19F
NMR (282 MHz, acetone-d6) 8 -82.13; IR (KBr Pellet) 1698,
1518, 1464, 1430, 1244, 1208, 1184 cm-1; MS (CI) mle calc'd
for C17H13F3N302: 348.095987, found 348.095629; 348 (MEIt,
32
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
100); Analysis calc'd for C1~H12F3N302~0.25 C3H60: C, 58.92;
H, 3.76; N, 11.61; found: C, 59.38; H, 4.04; N, 11.35.
Example 9
Preparation of (+/-)-6-Methoxy-4-phenylethynyl-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinoae (Rd -
Phenyl)
A solution of VII-a (100 mg, 0.410 mmol) was treated
30 with the the lithium acetylide derived from phenylacetylene
(0.19 g, 1.85 mmol) according to the procedure of Step 3 of
Example 1. The resulting crude material was purified by
flash chromatography (2.5~ MeOH/CH2C12) to afford 34 mg (24~)
of the desired product. mp 206.2-207.7 °C; 1H NMR (300 MHz,
acetone-d6) 8 8.85 (br s, 1 H), 7.60-7.57 (m, 3 H), 7.49-7.39
(m, 3 H), 7.21 (br s, 1 H), 7.05-6.96 (m, 2H), 3.79 (s, 3 H);
19F NMR (282 MHz, acetone-d6) b -82.32; IR (KBr Pellet) 1696,
1516, 1430, 1236, 1204, 11$4, 1128 cm-1; MS (CI) m/e calc'd
for ClgH~4F3N202: 347.100738, found 347.101482; 347 (Ngi+,
100), 364 (M+NH4+, 48); Analysis calc'd for C1gH13F3N202: C,
62.43; H, 3.78; N, 8.10; found: C, 62.35; H, 3.58; N,
7.83.
33
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Example 10
Preparation of (+/-)-4-Cyclopropylethynyl-5,6
difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)
quiaazolinoae (R4 - Cyclopropyl)
F O F F3 OH F CF3
a) TMSNCO F ~ Xylenes T.~ F
F ~NH N
W
\CF3 DMAP/THF
b) TBAF/THF ~ / N~ O
NH2 H ~~ O
IX-a X-a
XI-a
R4
a. THF/n-BuLi/HCCR' 10$ Pd/C F F3
b. BF3~OEtz F EtOH/EtOAc) F I ~ NH
N_ '_ O
H
XIII-a
XII-a
Step 1. Synthesis of X-a from IX-a.
A solution of IX-a (6.46 g, 28.7 mmol) was treated with
dimethylaminopyridine and trimethylsilyl isocyanate as
described in Step 1 of Example 1 to afford 6.74 g (88~) of
the desired product: 1H NMR (300 MHz, acetone-d6) 8 9.13 (br
s, 1 H), 7.45-7.32 (m, 2 H), 7.18 (br s, 1 H), 6.85-6.80 (m,
1 H); 19F NMR (282 MHz, acetone-d6) 8 -86.6 (d, 17.2, 3),
-137.52-137.68 (m, 1), -148.47-148.59 (m, 1).
Step 2. Synthesis of XI-a from X-a.
A solution of X-a (6.74 g, 25.1 mmol) was heated in
xylenes at reflux as described in Step 2 of Example 1,
substituting xylenes for toluene, to afford 6.3 g (100$) of
the desired product: 1H NMR (300 MHz, acetone-d6) b 7.92-7.83
(m, 1 H), 7.46-7.44 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8
-70.7 (d, 38.7, 3), -136.72 (s, 1), -246.47-146.57 (m, 1).
Step 3. Synthesis of XII-a from XI-a.
34
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
A solution of XI-a (6.28 g, 25.1 mmol) was treated with
the the lithium acetylide derived from cyclopropylacetylene
(24.9 mL of 30 wt~ solution in toluene/THF/hexanes, 0.113
mol) according to the procedure of Step 3 of Example 1. The
resulting crude yellow oil was dissolved in acetone and
concentrated under reduced pressure to deliver a yellow
solid. Crystallization from acetone afforded 5.98 g (75~) of
the desired material: mp 86.5-88.5 °C; 1H NMR (300 MHz,
acetone-d6) 8 9.01 (br s, 1 H), 7.46 (br s, 1 H), 7.44-7.35
(m, 1 H), 6.86-6.8I (m, 1 H), 1.41-1.37 (m, 1 H), 0.90-0.83
(m, 1 H), 0.74-0.69 (m, 1 H); 1gF NI~ (282 MHz, acetone-d6) $
-83.3 (d, J = 12.9, 1), -136.04-136.23 (m, 1), -148.14-148.26
(m, 1); IR (KBr Pellet) 1706, 1516, 1442, 1246, 1214, 1196
cm-1; MS (CI) rrtle calc'd for Cl4H~pF5NZ0: 317.071329, found
317.070836; 317 (MH+, 100), 334 (M+NH4+, 62); Analysis
calc'd for C14H9F5N20: C, 53.17; H, 2.88; N, 8.87; found:
C, 53.30; H, 3.16; N, 8.53.
Example 11
Preparation of (+/-y-5,6-Difluoro-4-isopropylethynyl
4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4
- Isopropyl)
A solution of XI-a (7.24 g, 28.9 mmol) was treated with
the the lithium acetylide derived from 3-methyl-1-butyne
(8.87 g, 13.3 mL, 0.130 mol) according to the procedure of
Step 3 of Example 1. The resulting crude material was
purified by flash chromatography (2.5~ MeCH/CH2C12) to afford
a yellow oil. Crystallization from acetone afforded 6.77 g
(74~) of the desired product: mp 79-80 °C; 1H NMR (300 MHz,
acetone-d6) $ 9.02 (br s, 1 H), 7.50 (br s, 1 H), 7.44-7.35
(m, 1 H), 6.87-6.82 (m, 1 H), 2.69-2.65 (m, 1 H), 1.17 (d, J
- 7.0 Hz, 6H); 19F NMR (282 MHz, acetone-d6) 8 -83.4 (d, J =
12.9, 1), -135.79-135.94 (m, 1), -148.14-148.26 (m, 1); MS
(CI) m/e calc'd for C14H12F5N20: 319.086979, found
319.087376; 319 (MH+, 100), 336 (M+NH4+, 76).
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Exam~Le I2
Preparation of (+/-)-5,6-Difluoro-4-(2
pyridyl)ethynyl-4-trifluoromethyl-3,4-dihydro-2(1H)
quinazoliaone (R4 - 2-Pyridyl)
A solution of XI-a (100 mg, 0.400 mmol) was treated with
the the lithium acetylide derived from 2-ethynylpyridine
(0.19 g, 1.80 mmol) according to the procedure of Step 3 of
Example 1. The resulting crude material was purified by flash
chromatography (4~ MeOH/CHZC12) to afford 83 mg (59g) of the
desired product: rnp 219-220 °C; 1H NMR (300 MHz, acetone-d6)
8 9.15 (br s, 1 H), 8.61 (d, J = 4.4 Hz, 1 H), 7.88-7.82 (m,
2H), 7.63 (dd, J = 7.0, 1.1 Hz, 1 H), 7.47-7.42 (m, 2H),
6.94-6.88 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -82.8 (d,
J = 12.9, 3), -135.78-135.93 (m, 1), -147.86-147.98 (m, 1);
IR (KBr Pellet) 1712, 1470, 1450, 1430, 1416, 1264, 1238,
1226, 1198, 1186 cm-1; MS (CI) m/e calc'd for ClgHgF5N30:
354.066578, found 354.067821; 354 (MH+, 100).
Examble 13
Preparation of (+/-)-5,6-Difluoro-4-ethylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _
2-Ethyl)
A solution of XI-a (100 mg, 0.400 mmol) was treated with
the the lithium acetylide derived from 1-butyne (97 mg, 1.80
mmol) according to the procedure of Step 3 of Example 1. The
resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 69 mg (57~) of the desired product: mp
191-194 °C; 1H NMR (300 MHz, acetone-d6) 8 9.03 (br s, 1 H),
7.50 (br s, 1 H), 7.45-7.35 (m, 1 H), 6.87-6.82 (m, 1 H),
2.34-2.27 (m, 2H), 1.20-1.15 (m, 3 H); 19F NMR (282 MHz,
acetone-d6) 8 -83.3 (d, J = 12.9, 3), -135.79-135.98 (m, 1),
-148.16-148.29 (m, 1); IR (KBr Pellet) 1704, 1686, 1518,
1444, 1244, 1210, 1192, 1172 cm-1; MS (CI) m/e calc'd for
C13H1oF5N2~~ 305.071329, found 305.071146; 305 (MH+, 100);
Analysis calc'd for Cl3HgF5N20: C, 51.33; H, 2.98; N, 9.22;
found: C, 52.00; H, 2.79; N, 8.99.
36
CA 02284996 1999-09-27
WO 98/45276 PCTlUS98/06733
~:xamnle 14
Preparation of (+/-)-5,6-Difluoro-4-phenylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quiaazolinone (Ra
Phenyl)
A solution of XI-a (100 mg, 0.400 mmol) was treated with
the the lithium acetylide derived from phenylacetylene (0.18
g, 0.20 mL, 1.80 mmol) according to the procedure of Step 3
of Example 1. The resulting crude material was purified by
HPLC (2.5~ MeOH/CH2C12) to afford 92 mg (65~) of the desired
product: 1H NMR (300 MHz, acetone-d6) S 9.14 (br s, 1 H),
7.80 (br s, 1 H), 7.57-7.54 (m, 2H), 7.49-7.40 (m, 4H), 6.92-
6.87 (m, 1 H); 19F NMR (282 MHz, acetone-d6) 8 -83.0 (d, J =
12.9, 3), -136.08-136.27 (m, 1), -147.87-148.00 (m, 1); MS
(CI) m/e calc'd for Cl~HIpF5N20: 353.071329, found
353.071716; 353 (MH+, 42), 370 (M+NH4+, 100).
Examflle 15
Preparation of (+/-)-5,6-Difluoro-4-isopentyl-4-
trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 -
Isopropyl)
Synthesis of XIII-a from XII-a.
A solution of XIII-a (R4 = isopropyl) (26 mg, 82 mmol)
in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd
on carbon (35 mg) under H2 (1 atm) for 16 hours. The catalyst
was removed by vacuum filtration through Celite and the
filter cake was washed with EtOAc. The combined filtrates
were concentrated under reduced pressure to afford 26 mg
(1000 of the desired material. No further purification was
necessary: 1H NMR (300 MHz, acetone-d6) 8 8.88 (br s, 1 H),
7.41-7.31 (m, 1 H), 6.89-6.81 (m, 2H), 2.55-2.50 (m, 1 H),
1.64-1.45 (m, 2H), 1.06-1.02 (m, 1 H), 0.89 (dd, J = 6.6, 2.2
Hz, 6H); 19F NMR (282 MHz, acetone-d6) 8 -83.22 (d, J = 12.1,
3), -138.97-139.13 (m, 1), -148.46-148.58 (m, 1); IR (KBr
Pellet) 1700, 1678, 1518, 1438, 1252, 1188, 1172 cm-I; MS
37
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
(CI) mle calc'd for C14H1sF5N2~: 323.118280, found
323.116703; 323 (MH+, 100), 340 (M+NH4+, 57).
Example 16
Preparation of (+/-)-4-Butyl-5,6-difluoro-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 -
Ethyl)
A solution of XIII-a (R4 = ethyl) (20 mg, 66 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on
carbon under H2 according to the procedure of Example 15.
Purification by HPLC (2.5~ MeOH/CH2C12) afforded 12 mg (56~)
of the desired product: 1H NMft (300 MHz, acetone-d6) b 8.89
(br s, 1 H), 7.41-7.32 (m, 1 H), 6.86-6.81 (m, 2H), 2.57-2.47
(m, 1 H) , 1.56-1.15 (m, 5H) , 0.88 (t, J = 7.3 Hz, 3 H) ; 19F
NMR (282 MHz, acetone-d6) 8 -83.19-83.24 (m, 1), -139.14 (s,
1), -148.49-148.62 (m, 1); MS (CI) m/e calc'd for
C~3H14F5N20: 309.102629, found 309.103555; 309 (MH+, 100),
326 (M+NH4+, 62).
38
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Example 17
Preparation of (+/-)-4-Cyclopropylethynyl-6-fluoro-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4
Cyclopropyl)
O F3 OH CF3
F a) TMSNCO F F
DMAP/THF
Toluene T~. ~ _N
CFA /
/ NH b ~ TBAF / THF / N/~ O ~ 0
z H
XIV-a XV-a XVI-a
Ra
F3
a. THF/n-HuLi/HCCR° F3 10$ Pd/C
b. BF3-OEtz F ~ EtOH/EtOAc) F
/ ~ ~ O
0
XVIII-a
XVII-a
R4
F3
THF/CH3CCR4 F
n-BuLi/0 °C ~ \ \ NH
XVI-a ~
/ NI '-O
H
XIX-a
Step 1. Synthesis of XV-a from XIV-a.
A solution of XIII-a (3.07 g, I4.8 mmol) was treated
with dimethylaminopyridine and trimethylsilyl isocyanate as
described in Step 1 of Example 1 to afford 2.81 g (76~) of
the desired product.
Step 2. Synthesis of XVI-a from XV-a.
A solution of XV-a (6.74 g, 25.1 mmol) was heated in
toluene at reflex as described in Step 2 of Example 1 to
afford 0.73 g (94~) of the desired product.
Step 3. Synthesis of XVII-a from XVI-a.
39
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
A solution of XVI-a (100 mg, 0.431 mmol) was treated
with the the lithium acetylide derived from
cyclopropylacetylene (1.43 mL of 30 wt~ solution in
toluene/THF/hexanes, 1.94 mmol) according to the procedure of
Step 3 of Example 1. The resulting crude material was
purified by HPLC (2.5~ MeOH/CHZC12) to afford 44 mg (34~) of
the des fired produc t : mp 15 5 °C ; 1H NMR ( 3 0 0 Ng-iz , acetone-d6
)
8 8.86 (br s, 2 H), 7.36 (br s, 1 H), 7.30-7.27 (m, 1 H),
7.22-7.15 (m, 1 H), 7.04-6.99 (m, 1 H), 1.47-1.42 (m, 1 H),
0.90-0.87 (m, 2 H), 0.76-0.75 (m, 2 H); 19F NMR (282 MHz,
acetone-d6) S -82.86, -123.36-123.44; MS (CI) m/e calc'd for
C14H11F4N20: 299.080751, found 299.079976; 299 (MH+, 100).
Example I8
Preparation of (+/-)-6-Fluoro-4-isopropylethynyl-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _
Isopropyl)
A solution of XVI-a (100 mg, 0.431 mmol) was treated
with the the lithium acetylide derived from 3-methyl-1-butyne
(0.13 g, 0.20 mL, 1.94 mmol) according to the procedure of
Step 3 of Example 1. The resulting crude material was
purified by HPLC (2.5~ MeOH/CH2C12) to afford 24 mg (18~) of
the desired product: mp 158 °C; 1H NMR (300 MHz, acetone-d6)
S 9.07 (br s, 1 H), 7.60 (br s, 1 H), 7.32-7.30 (m, 1 H),
7.24-7.16 (m, 1 H), 7.05-6.99 (m, 1 H), 2.77-2.67 (m, 1 H),
1.20 (dd, J = 7.0, 2.6 Hz, 6H); 19F NMR (282 MHz, acetone-d6)
b -82.95, -123.41-123.49; MS (301) m/e calc'd for
ClqH~3F4N20: 301.096401, found 301.096235; 301 (MH+, 100).
Examale 19
Preparation of (+/-)-6-Fluoro-4-(2-pyridyl)ethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (Ra _
2-Pyridyl)
A solution of XVI-a (100 mg, 0.431 mmol) was treated
with the the lithium acetylide derived from 2-ethynylpyridine
(0.20 g, 1.94 mmol) according to the procedure of Step 3 of
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Example 1. The resulting crude material was purified by HPLC
(2.5~ MeOH/CH2C12) to afford 65 mg (45~) of the desired
product: rnp 155 °C; 1H NMR (300 MHz, acetone-d6) 8 9.02 (br
s, 1 H), 8.60 (d, J = 4.0 Hz, 1 H), 7.8?-7.78 (m, 2 H), 7.66
(d, J = 7.7 Hz, 1 H), 7.45-7.41 (m, 2 H), 7.26-7.20 (m, 1 H),
7.09-7.05 (m, 1 H); ~9F NMR (282 MHz, acetone-dg) b -82.36,
-122.94-123.02; MS (CI) m/e calc'd for C16H1oF4N30~
336.076000, found 336.074156; 336 (MH+, 25).
Example 20
Preparation of (+/-)-6-Fluoro-4-ethylethynyl-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4
Ethyl)
A solution of XVI-a (100 mg, 0.431 mmol) was treated
with the the lithium acetylide derived from 1-butyne (0.10 g,
1.94 mmol) according to the procedure of Step 3 of Example 1.
The resulting crude material was purified by HPLC (2.5~
MeOH/CH2C12) to afford 40 mg (33~) of the desired product: mp
190 °C; 1H NMR (300 MHz, acetone-d6) b 8.86 (br s, 1 H), 7.38
(br s, 1 H), 7.34-7.31 (m, 1 H), 7.22-7.16 (m, 1 H), 7.05-
7.00 (m, 1 H), 2.04-2.01 (m, 2 H), 1.19-1.14 (m, 3 H); 19F
IVMR (282 MHz, acetone-d6) 8 -75.392, -123.42-123.50; MS (CI)
m/e calc'd for C13H11F4N20~ 287.080751, found 287.080740;
287 (MH+, 100) .
Examvle 21
Preparation of (+/-)-6-Fluoro-4-phenylethynyl-4-
trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (R4 _
Phenyl)
A solution.of XVI-a (100 mg, 0.431 mmol) was treated
with the the lithium acetylide derived from phenylacetylene
(0.20 g, 0.21 mL, 1.94 mmol) according to the procedure of
Step 3 of Example 1. The resulting crude material was
purified by HPLC (2.5~ MeOH/CH2C12) to afford 41 mg (28~) of
the desired product: mp 107 °C; 1H NMR (300 MHz, acetone-d6)
8 9.00 (br s, 1 H), 7.69 (br s, I H), 7.63-7.59 (m, 2 H),
41
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
7.50-7.40 (m, 4H), 7.27-7.20 (m, 1 H), 7.10-7.05 (m, 1 H);
19F NMR (282 MHz, acetone-d6) 8 -82.56, -122.99-123.07; MS
(CI) m/e calc'd for C17H11F4N2O: 335.080751, found
335.082057; 335 (MH+, 74), 352 (M+NH4+, 100).
Example 22
Preparation of (+/-)-6-Fluoro-4-isopentyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _
Isopropyl)
Synthesis of XVIII-a from XVII-a.
A solution of XVII-a (R4 = isopropyl) (26 mg, 87 mmol)
in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 20~ Pd
on carbon under HZ according to the procedure of Example 15 to
afford 15 mg (58~) of the desired product. No further
purification was necessary: mp 179 °C; 1H NMR (300 Ngiz,
acetone-d6) 8 7.02-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18-
2.09 (m, 2 H), 1.92-1.82 (m, 2 H), 1.52-1.45 (m, 1 H), 0.88-
0.79 (m, 6 H); 19F NMR (282 MHz, acetone-d6) 8 -82.60,
-123.72-123.84; MS (CI) m/e calc'd for C14H1~F4N20:
305.127707, found 305.126790; 305 (MH+, 100).
Examale 23
Preparation of (+/-)-6-Fluoro-4-(2'-2-pyridyl)ethyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _
2-Pyridyl)
A solution of XVII-a (R~ = 2-pyridyl) (33 mg, 99 mmol)
in ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10$ Pd
on carbon under H2 according to the procedure of Example 15 to
afford 10 mg (30.x) of the desired product. No further
purification was necessary: mp 88 °C; 1H NMR {300 MHz,
acetone-d6) 8 8.35 (d, J = 4.4 Hz, 1 H), 7.63 (dt, J = 7.7,
1.5 Hz, 1 H), 7.20-7.13 (m, 3 H), 7.04-6.98 {m, 1 H), 6.83-
6.79 (m, 1 H), 2.84-2.78 (m, 1 H), 2.68-2.48 (m, 2 H), 2.27-
2.06 (m, 1 H); 29F NMR (282 MHz, acetone-d6) 8 -82.58,
42
CA 02284996 1999-09-27
WO 98/4527b PCT/US98/06733
-123.26-123.34; MS (CI) m/e calc'd for C16H14F'4N3~=
340.107300, found 340.107719; 340 (MH+, 100).
Examflle 24
Preparation of (+/-)-4-Hutyl-fi-fluoro-4-
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone (R4 _
Ethyl)
A solution of XVII-a (R4 = ethyl) (24 mg, 84 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on
carbon under H2 according to the procedure of Example 15 to
afford 24 mg (1000 of the desired product. No further
purification was necessary: mp 198 °C; 1H NMR (300 MHz,
acetone-d6) 8 7.03-6.97 (m, 2 H), 6.80-6.76 (m, 1 H), 2.18-
2.11 (m, 1 H), 1.90-1.81 (m, 1 H), 1.30-1.19 (m, 3 H), 0.97-
0.80 (m, 4 H); 19F NMR (282 MHz, acetone-d6) b -82.692,
-123.78-123.86; MS (CI) m/e calc'd for C13H15F4N2O:
291.112051, found 291.112227; 291 (MH+, 100).
Example 25
Preparation of (+/-)-6-Fluoro-4-pheaylethyl-4
trifluoromethyl-3,4-dihydro-2(iH)-quinazolinone (Ra _
Phenyl)
A solution of XVII-a (R4 = phenyl) (30 mg, 90 mmol) in
ethanol (1 mL) and EtOAc (0.5 mL) was treated with 10~ Pd on
carbon under H2 according to the procedure of Example 15 to
afford 20 mg (67~) of the desired product. No further
purification was necessary: mp 98 °C; 1H NMR (300 MHz,
acetone-d6) 8 7.18-6.99 (m, 7H), 6.84-6.79 (m, 1 H), 2.68-2.60
(m, 1 H), 2.48-2.12 (m, 3 H); 19F NMR (282 MHz, acetone-d6) 8
-82.67, -123.24-.123.32; MS (CI) m/e calc'd for C1~H~5F4N20:
339.112051, found 339.110781; 339 (MH+, 100).
43
CA 02284996 1999-09-27
WO 98!45276 PCT/US98/06733
Examvle 26
Preparation of (+/-)-f-Fluoro-4-methylpropargyl-4
trifluoromethyl-3,4-dihydro-2(2Fi)-quinazolinone (R4 _
Methyl)
Synthesis of XIX-a from XVI-a.
A solution of 2-butyne (94 mg, 1.75 mmol) in anhydrous
THF (3.5 mL) was cooled to 0 °C, treated with n-BuLi (0.97 mL
of 1.6 M solution in hexanes, 1.55 mmol), and aged for 0.5 h.
To a solution of XVI-a (90 mg, 0.388 mmol) in anhydrous THF
(1.9 mL) at -78 °C was added the lithium anion over 5
minutes, followed by boron trifluoride etherate (25 mL, 0.194
mmol). The cooling bath was removed and the mixture was
allowed to warm to room temperature. After 16 h at room
temperature, quench by addition of 1 M citric acid (10 mL),
dilute with EtOAc (50 mL), separate phases and wash the
organic phase sequentially with saturated aqueous NaHC03 (20
mL) and saturated aqueous NaCl (20 mL). The resulting
material was purified by HPLC (2.5~ MeOH/CH2C12) to afford 10
mg (9~) of the desired product: mp 181 °C; 1H NMR (300 Ngiz,
acetone-d6) $ 8.91 (br s, 2 H), 7.27 (d, 8.4H), 7.18-7.08 (m,
1 H), 7.02-6.97 (m, 2 H), 3.29 (dd, J = 16.8, 2.6 Hz, 1 H),
3.00 (dd, J = 16.8, 2.2 Hz, 1 H), 1.61-1.59 (m, 3 H); 19F NMR
(282 MHz, acetone-d6) S -81.86, -123.69-123.70; MS (CI) m/e
calc'd for C13H11F4N20: 287.080751, found 287.080340; 287
(MH+, 75) , 304 (M+N~i4+, 100) .
44
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
SCHEME 4: Chiral Resolution
Q4 p4
CF3 'i CF3 :~ CF3
Chiral HPLC 3 ' 3
\ ~ Separation ~\ ~ ~\
. ( / N' ' O I / N' '_ 0 I / N' ' 0
H H H
Combound ~3- Compound ~3- Compound
6-C1 IV-a 6-C1 IV-b 6-C1 IV-c
6-Me0 VIII-a 6-Me0 VIII-b 6-Me0 VIII-c
5,6-diF XII-a 5,6-diF XII-b 5,6-diF XII-c
6-F XVII-a 6-F XVII-b 6-F XVII-c
Examples 27 and 28
Preparation of (-)-6-Chloro-4-cyclopropylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 27) and (+)-6-Chloro-4-cyclopropylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 28)
Resolution of IV-b,c from IV-a (R4 = Cyclopropyl).
Chiral HPLC utilizing a Chiralcel OD column, 3~
isopropanol, 5~ CH2C12 and 92~ hexanes at ambient temperature
with a 1.0 mL/min flow rate and detection at 250 nm afforded
seperation of IV-b from IV-c with enantiomeric excesses of
99~ and 99.4$, respectively. IV-b: mp 106-109 °C; [a]D25
-50.34° (c=0.274, MeOH) . IV-c: mp105-107 °C; [oc]D25
+58.33°
(c=0.288, MeOH).
Examples 29 aad 30
Preparation of (+)-4-Cyclopropylethynyl-5,6-difluoro-
4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 29) aad (-)-4-Cyclopropylethynyl-5,6-
difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)
quiaazolinone (Example 30)
Resolution of XII-b,c from XII-a (R4 = Cyclopropyl).
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Chiral HPLC utilizing a Chiralpak AD column, 5$ water
and 95~ methanol at ambient temperature with a 0.8 mL/min
flow rate and detection at 250 nm afforded seperation of XII-
b from XII-c with enantiomeric excesses of 100 and 99~,
respectively. XII-b: mp 187 °C; [a]D25 +1.46° (c=0.274,
MeOH). XII-c: mp 187.5-188.8 °C; [a]D25 _1,45° (c=0.278,
MeOH).
Examvies 31 and 32
Preparation of (-)-5,6-Difluoro-4-isopropylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinoae
(Example 31) and (+)-5,6-Difluoro-4-isopropylethynyl
4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 32)
Resolution of XII-b,c frorn XII-a (R4 = Isopropyl).
Chiral HPLC utilizing a Chiralpak AD column, 5$ water
and 95~ methanol at ambient temperature with a 0.5 mL/min
flow rate and detection at 250 nm afforded seperation of XII-
b from XII-c with enantiomeric excesses of 100 and 99~,
respectively. XII-b: mp 155 °C; [oC]~25 -2.14° (c=0.280,
MeOH) . XII-c: 98 °C; (o6)D25 +4.45° (c=0.292, MeOH) .
Examvles 33 and 34
Preparation of (-)-5,6-Difluoro-4-ethylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 33) and (+)-5,6-Difluoro-4-ethylethynyl-4
trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 34)
Resolution of XII-b,c from XII-a (R4 = Ethyl}.
Chiral HPLC utilizing a AS column, 20~ ethanol and 80$
hexanes at ambient temperature with a 1.0 mL/min flow rate
and detection at 250 nm afforded seperation of XII-b from
46
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
XII-c with enantiomeric excesses of 100 and 99~,
respectively. XII-b: mp 165-167 °C. XII-c: mp 157-159 °C.
E~caa~p 1 a s 3 5 and 3 6
Preparation of 5,6-Dif luoro-4-(2-hydroxyethyl)ethynyl-
4-trifluoromethyl-3,4-dihydro-2(1H)-quinazolinone
(Example 35) and 5,6-Difluoro-4-(1-
hydroxyethyl)ethynyl-4-trifluoromethyl-3,4-dihydro
2(1H)-quinazolinone (Example 36)
LiC=CCH2CH20TBS R
or
3 F
F LiC=CCH(OTBS)CH3F 3
F ~ \ N THF/BF3 ~OEt2 ~ ~NH
N O
0 H
C'~mr~ound R
Ex. 35 CH2CH20TBS
Ex. 36 CH(OTBS)CH3
F3
TBAF
THF ""
N 0
H
Compound R
Ex. 35 CHzCH20H
Ex. 36 CH(OH)CH3
To a slurry of ketimine (300 mg, 1.20 mmol) in anhyd.
THF (11 mL) at -78 °C was sequentially added a precooled (0
°C) solution of the silyl protected lithium acetylide (5.40
mmol) and BF3.OEt2 (0.60 mmol). The resulting mixture was
stirred at rt overnight. The reaction was quenched by the
addition of 1 M citric acid and diluted with EtOAc. The
phases were separated, the organic phase was washed with
water, sat. aq. NaHC03 arid sat. aq. NaCl. The organic
extracts were dried over MgS04, filtered and concentrated.
47
CA 02284996 1999-09-27
WO 98!45276 PCT/US98/06733
The material was purified by regular phase HPLC
chromatography (41.4 mrn Rainin Dynamax~ column using 60
silica @ 25 mL/min): 2.5~ MeOH/CH2C12 for 24 min, increase to
30~ MeOH/CH2C12 over 4 min, 30~ MeOH/CHZC12 for 10 min, and
ramp back to 2.5~ MeOH/CH2C12 over 2 min. The yield of the
protected intermediates was 47~ and 32~, respectively.
Example 35-intermediate. Mp 62.9-64 °C; 1H NMR (300
MHz, acetone-d6) b 8.98 (br s, 1H), 7.41-7.32 (m, 2H), 6.83
6.78 (m, 1H), 3.74 (t, J = 6.6 Hz, 2H), 2.47 (t, J = 6.6 Hz,
2H), 0.81 (s, 9H), 0.00 (s, 6H); ~9F NMR (282 MHz, acetone
d6) 8 -83.17, -135.16--135.31, -148.09--148.22; MS (CI)
calc'd for C19H24F5N202Si: m/2 435.152723, found 435.151149;
435 (N~i+, 94), 452 (M+NH4+, 100); Analysis calc'd for
C1gH23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C,
52.65; H, 5.29; N, 6.31.
Example 36-intermediate. 1H NMR (300 MHz, acetone-d~) S
8.96 (br s, 1H), 7.50 (br s, 1H), 7.37-7.28 (m, 1H), 6.79-
6.74 (m, 1H), 4.61 (q, J = 13.2, 6.6 Hz, 1H), 1.30 (d, J =
6.6 Hz, 3H), 0.78 (s, 9H), 0.01 (s, 6H); 1gF NMR (282 MHz,
acetone-ds) d -82.88--82.95, -135.20--135.42, -248.06--148.23;
MS (CI) calc'd for C19H24F5N202Si: m/z 435.152723, found
435.152927; 435 (MH+, 51), 452 (M+NH4+, 100); Analysis calc'd
for C19H23F5N202Si: C, 52.52; H, 5.35; N, 6.46; found: C,
52.54; H, 5.34; N, 6.69.
To a solution of the protected intermediate for Example
(0.56 mmol) in THF (1.1 mL) was added TBAF (0.62 mL of 1.0
M solution in THF). The resulting mixture was stirred at rt
for 1 h, diluted with EtOAc, washed with 1 N HC1, sat. aq.
NaHC03, and sat. aq. NaCl. The organic extract was dried over
30 MgS04, filtered and concentrated. The material was purified by
regular phase HPLC chromatography (41.4 mm Rainin Dynamax~
column using 60 $r silica @ 25 mL/min): 2.5~ MeOH/CH2C12 for
24 min, increase to 30~ MeOH/CH2C12 over 4 min, 30~
MeOH/CH2C12 for 10 min, and ramp back to 2.5~ MeOH/CH2C12 over
35 2 min. Example 35 was isolated in 82~ yield.
Example 35. Mp 190-192 °C; 1H NMR (300 N~iz, acetone-d6)
8 9.05 (br s, 1H), 7.53 (br s, 1H), 7.45-7.36 (m, 1H), 6.88-
6.83 (m, IH), 4.01-3.98 (m, 1H), 3.68-3.64 (m, 2H), 2.50 (t,
48
CA 02284996 1999-09-27
WO 98145276 PCT/US98J06733
J = 6.6 Hz, 2H); 1gF NMR (282 MHz, acetone-d6) 8 -83.3,
-135.68--135.88, -148.10--148.22; MS (CI) calc'd for
C~3H1pF5N202: m/z 321.066244, found 321.066479; 321 (MH+,
100); Analysis calc'd for Cl3HgF5N202: C, 48.76; H, 2.83; N,
8.76; found: C, 49.05; H, 3.23; N, 8.38.
. Example 36 was synthesized in an analogous manner to
deliver the title compound in 88~ yield. Mp 190-191 °C; 1H
NMR (300 MHz, acetone-d6) 8 9.06 (br s, 1H), 7.56 (br s, 1H),
7.46-7.37 (m, 1H), 6.88-6.83 (m, 1H), 4.58-4.57 (m, 2H), 1.39
(d, J = 5.5 Hz, 3H); 19F NMR (282 MHz, acetone-d6) 8 -83.15,
-135.40, -135.60, -148.08--148.20; MS (CI) calc'd for
C13H10F5N202- m/z 321.066244, found 321.065983; 321 (MH+,
58), 338 (M+NH4+, 100); Analysis calc'd for C13H9F5N202: C,
48.76; H, 2.83; N, 8.76; found: C, 48.84; H, 2.76; N, 8.63.
Example 37
Preparation of (+)-4-E-Cyclopropylethenyl-5,6
difluoro-4-trifluoromethyl-3,4-dihydro-2(1H)
guinazolinone
To a solution of XII-b (200 mg, 0.632 mmol) in anhyd.
THF (1.3 mL) at rt was added a solution of lithium aluminium
hydride (1.3 mL of 1.0 M solution in THF). The resulting
mixture was stirred at rt overnight. The reaction was
quenched by addition of 10~ NaOH (3 mL) and water (3 mL).
The mixture was diluted with EtOAc (30 mL) and the phases
were separated. The organic phase was washed with sat. aq.
NaCl, dried over MgS04, filtered and concentrated. The title
compound was purified by regular phase HPLC (41.4 mm Rainin
Dynamaxt~ column using 60 ~ silica): 2.5~ MeOH/CH2C12 for 24
min, increase to 30$ MeOH/CH2C12 over 4 min, 30~ MeOH/CHZC12
for 10 min, and ramp back to 2.5~ MeOH/CHzCl2 over 2 min. Mp
80-83 °C; 1H NMR (300 MHz, acetone-d6) d 9.07 (br s, 1H),
7.33 (q, J=8.8 Hz, 1H), 6.94 (br s, 1H), 6.84-6.79 (m, 1H),
6.27 (dd, J = 15.6, 7.5 Hz, 1H), 5.67 (dd, J = 15.2, 9.4 Hz,
1H), 1.65-1.56 (m, 1H), 0.80-0.71 (m, 2H), 0.50-0.42 (m, 2H);
i9F NMR (282 MHz, acetone-d6) d -82.68, -3.35.05, -148.49; MS
(CI) calc'd for C14H12FSNZ0: m/z 319.086979, found
49
CA 02284996 1999-09-27
WO 98!45276 PCT/US98/06733
319.087755; 319 (MH+, 100); [oc)D2o +72.77° (c=0.382, MeOH);
Analysis calc'd for C14H12F5N20: C, 52.84; H, 3.48; N,
8.80; found: C, 53.02; H, 3.48; N, 8.61.
Exatnn l a 3 8
Preparation of (-)-6-Chloro-4-E-cyclopropylethenyl-4
trifluoromethyl-3,4-dihydro-2(1A)-quinazolinone
The title compound was prepared as described for Example
37 (starting from IV-b), except that it was purified using a
Chiralcel OD column at 1.5 mL/min in 0.5~ EtOH/20~
CH2C12/79.5~ hexanes. Mp 87-89 °C; 1H NMR (300 MHz, acetone-
d6) d 9.08 (br s, 1H), 7.40-7.25 (m, 2H), 7.04-6.90 (m, 2H),
6.28-6.18 (m, 1H), 5.64-5.52 (m, 1H), 1.68-1.55 (m, 1H),
0.83-0.71 (m, 2H), 0.53-0.41 (rn, 2H); 1gF NMR (282 MHz,
acetone-d6) d -81.67; MS (CI) calc'd for C14H13C1F3N20: m/z
317.066851, found 317.065857; 317 (Ng3+, 100); [a]D2o _6. g1°
(c=0.382, MeOH); Analysis calc'd for C14H12C1F3N20 . 0.27
C3H60: C, 53.52; H, 4.13; N, 8.43; found: C, 53.90; H,
4.07; N, 8.80.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Table 1*
i z
.,Ra
'R n ~ ~ N'~O
H
Ex.# R3 RI RZ R8 m.p. Mass Spec
(C)
1 6-C1 CF3 C~-cycPr H 86.6- 332
88 (M+NH4+)
2 6-C1 CF3 C-C-iPr H 180 334
( M+NH4 +
)
3 6-C1 CF3 C~-2-Pyridyl H 105 352 (Ngi+)
4 6-Cl CF3 C~-Et H 217- 303 (MH+)
219
6-C1 CF3 C~-Ph H 104- 368
107 (M+NFi4+)
6 6-Me0 CF3 C~-cycPr H 208 311 (MH+)
7 6-Me0 CF3 C-C-iPr H 228- 313 (MH+)
229
8 6-Me0 CF3 C~-2-Pyridyl H 97'98 348 (MH+)
9 6-Me0 CF3 C=C-Ph H 206.2- 347 (rg.~+)
207.7
5, 6-diFCF3 C~-cycPr H 101 317 (~+)
dec.
11 5,6-diF CF3 C-C-iPr H 79-80 319 (MH+)
12 5,6-diF CF3 C~-2-Pyridyl H 219- 354 (MH+)
220
13 5,6-diF CF3 C~-Et H 191- 305 (MH+)
194
14 5,6-diF CF3 C=C-Ph H 215- 370
217 (M+NH4+)
5,6-diF CF3 CH2CH2CH(CH3)2 H 192- 323 (MH+)
193
16 5,6-diF CF3 CH2CHZCHZCH3 H 309 (~+)
17 6-F CF3 CSC-cycPr H 155 29g (~+)
18 6-F CF3 C-C-iPr H 158 301 (MH+)
19 6-F CF3 C~-2-Pyridyl H 155 336 (MH+)
6-F CF3 C~-Et H 190 287 (MH+)
21 6-F CF3 C-C-Ph H 107 352
(M+NH4+)
22 6-F CF3 CH2CH2CH (CH3 H 179 305 (MH+)
) 2
S1
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
23 6-F CF3 CH2CH2-2-PyridylH 88 340 (MH+)
24 6-F CF3 CH2CH2CHZCH3 H 198 291 0+)
25 6-F CF3 CH2CH2Ph H 98 339 (MH+)
26 6-F CF3 CH2C---C-CH3 H 181 304
( M+NH4+
)
27 6-C1 CF3 C~-cycPr H 106- 313 (M-)
(-) 109
28(+) 6-C1 CF3 C~-cycPr H 105- 313 (M-)
107
29 5, 6-diFCF3 C~-cycPr H 187 315 (M-)
(+)
30(-) 5,6-diF CF3 C~-cycPr H 188- 315 (M-)
ls9
31(-) 5,6-diF CF3 C=c-iPr H 155 317 (M')
32 5, 6-diFCF3 C~-iPr H 98 317 (M-)
(+)
33(-) 5,6-diF CF3 C=c-Et H 165- 303 (M-)
167
34 5, 6-diFCF3 C~-Et H 157- 303 (M')
(+) 159
35 5,6-diF CF3 C~CH2CH20H H 190- 321 (MH+)
192
36 5,6-diF CF3 C~-CH(OH)Me H 190- 338
191 (M+NH4+)
37(+) 5,6-diF CF3 C~-cycPr (E) H 80-83 319 (MH+)
38 6-C1 CF3 C~-cycPr (E) H 87-89 317 (MH+)
(-)
*Unless otherwise indicated, stereochemisty is (+/-).
52
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Table 2*
,Re
~R ~ ~ ~ _'~O
F.~c. R3 Rz R2 R8
#
1 6-C1 CF3 C-CCH2CH20H H
2 6-C1 CF3 C=C-CH(OH)Me H
3 6-C1 CF3 C-C-(2-C1)Ph
4 6-C1 CF3 C=C-(3-C1)Ph H
6-C1 CF3 C-C-(4-C1)Ph H
6 6-C1 CF3 C=C-(2-F)Ph H
7 6-C1 CF3 C=C-(3-F)Ph H
8 6-C1 CF3 C=C-(4-F)Ph H
9 6-C1 CF3 C=C-(2-OH)Ph H
6-C1 CF3 C=C-(3-OH)Ph H
11 6-C1 CF3 C=C-(4-OH)Ph H
12 6-C1 CF3 Cue- (2-OMe) Ph H
13 6-CI CF3 Cue- ( 3 -OMe ) Ph H
14 6-C1 CF3 C=C-(4-OMe)Ph H
6-C1 CF3 C=C-(2-CN)Ph H
16 6-C1 CF3 C=C-(3-CN)Ph H
17 6-C1 CF3 C-C-(4-CN)Ph H
18 6-C1 CF3 C=C-(2-N02)Ph H
19 6-C1 CF3 Cue- ( 3-N02 ) Ph H
6-C1 CF3 C=C-(4-N02)Ph H
21 6-C1 CF3 C~-(2-NH2)Ph H
22 6-C1 CF3 C=C-(3-NH2)Ph H
23 6-C1 CF3 Cue- ( 4-NHZ ) Ph H
24 6-C1 CF3 C=C-(2-NMe2)Ph H
6-C1 CF3 C-C-(3-NMe2)Ph H
26 6-C1 CF3 C=C-(4-NMe2)Ph H
27 6-C1 CF3 C~-3-Pyridyl H
28 6-C1 CF3 C~-4-Pyridyl H
53
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
29 6-C1 CF3 C=C-2-furanyl
30 6-C1 CF3 C~-3-furanyl H
31 6-C1 CF3 C~-2-thienyl H
32 6-C1 CF3 C~-3-thienyl H
33 6-C1 CF3 C=C-2-oxazolyl H
34 6-C1 CF3 C=C-2-thiazolyl H
35 6-C1 CF3 C~-4-isoxazolyl H
36 6-C1 CF3 C=C-2-imidazolyl H
37 6-C1 CF3 C=CCHzCHZOH H
38 6-C1 CF3 C=C-CH(OH)Me H
39 6-Cl CF3 C-C-(2-C1)Ph H
40 6-Cl CF3 C-C-(3-C1)Ph H
41 6-C1 CF3 C-C-(4-C1)Ph H
42 6-C1 CF3 C-C-(2-F)Ph H
43 6-C1 CF3 C-C-(3-F)Ph H
44 6-C1 CF3 C-C-(4-F)Ph H
45 6-C1 CF3 Cue- (2-OH) Ph H
46 6-C1 CF3 C=C-(3-OH)Ph H
47 6-CI CF3 C=C-(4-OH)Ph H
48 6-C1 CF3 C=C-(2-OMe)Ph H
49 6-C1 CF3 C=C-(3-OMe)Ph H
50 6-C1 CF3 C=C-(4-OMe)Ph H
51 6-C1 CF3 C=C-(2-CN)Ph H
52 6-C1 CF3 C=C-(3-CN)Ph H
53 6-C1 CF3 C=C-(4-CN)Ph H
54 6-C1 CF3 C=C-(2-N02)Ph H
55 6-C1 CF3 C=C-(3-N02)Ph H
56 6-CI CF3 C=C-(4-N02)Ph H
57 6-C1 CF3 C=C- ( 2-NH2 ) Ph H
58 6-C1 CF3 C=C-(3-NHZ)Ph H
59 6-C1 CF3 C=C-(4-NH2)Ph H
60 6-C1 CF3 C=C-(2-NMe2)Ph H
61 6-C1 CF3 C=C- ( 3 -NMe2 ) H
Ph
62 6-C1 CF3 C=C-(4-NMe2)Ph H
54
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
63 6-C1 CF3 C=C-3-Pyridyl H
64 6-C1 CF3 C=C-4-Pyridyl H
65 6-C1 CF3 C=C-2-furanyl H
66 6-Cl CF3 C=C-3-furanyi H
67 6-C1 CF3 C=C-2-thienyl H
68 6-C1 CF3 C=C-3-thienyl H
69 6-C1 CF3 C=C-2-oxazolyl H
70 6-C1 CF3 C=C-2-thiazolyl H
71 6-C1 CF3 C=C-4-isoxazolyl H
72 6-C1 CF3 C~-2-imidazolyl H
73 6-C1 CF3 CH2CHZ-cycPr H
74 6-C1 CF3 CH2CH2CH2CH20H H
75 6-C1 CF3 CH2CH2-CH(OH)Me H
76 6-C1 CF3 CH2CH2-Ph H
77 6-Cl CF3 CH2CH2-(2-C1)Ph H
78 6-C1 CF3 CH2CH2-(3-C1)Ph H
79 6-C1 CF3 CHZCHZ-(4-C1)Ph H
80 6-C1 CF3 CH2CH2-(2-F)Ph H
81 6-C1 CF3 CH2CH2-(3-F)Ph H
82 6-C1 CF3 CH2CH2-(4-F)Ph H
83 6-C1 CF3 CH2CH2-(2-OH)Ph H
84 6-C1 CF3 CH2CH2-(3-OH)Ph H
85 6-C1 CF3 CH2CH2-(4-OH}Ph H
86 6-C1 CF3 CH2CH2-(2-OMe)Ph H
87 6-C1 CF3 CH2CH2-(3-OMe)Ph H
88 6-C1 CF3 CH2CH2-(4-OMe)Ph H
89 6-C1 CF3 CH2CH2-(2-CN)Ph H
90 6-C1 CF3 CHZCH2-(3-CN)Ph H
91 6-C1 CF3 CH2CH2-(4-CN)Ph H
92 6-C1 CF3 CH2CH2-(2-N02)Ph H
93 6-C1 CF3 CH2CH2-(3-N02)Ph H
94 6-Cl CF3 CH2CH2-(4-N02)Ph H
95 6-Cl CF3 CH2CH2-(2-NH2}Ph H
96 6-C1 CF3 CH2CH2-(3-NH2)Ph H
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
97 6-C1 CF3 CH2CH2-(4-NH2}Ph H
98 6-C1 CF3 CH2CH2-(2-NMe2)Ph H
99 6-C1 CF3 CHZCHZ- ( 3 -NMe2 H
) Ph
100 6-C1 CF3 CHZCH2-(4-NMe2)Ph H
101 6-Cl CF3 CH2CHZ-2-Pyridyl H
102 6-C1 CF3 CH2CH2-3-Pyridyl H
103 6-C1 CF3 CH2CH2-4-Pyridyl H
104 6-C1 CF3 CH2CH2-2-furanyl H
105 6-C1 CF3 CH2CH2-3-furanyl H
106 6-C1 CF3 CH2CH2-4-furanyl H
107 6-C1 CF3 CH2CH2-3-thienyl H
108 6-C1 CF3 CH2CH2-2-oxazolyl H
109 6-C1 CF3 CH2CH2-2-thiazolyl H
110 6-CI CF3 CH2CH2-4-isoxazolyl H
111 6-Cl CF3 CH2CH2-2-imidazolyl H
112 6-C1 CF3 C~-cycPr CH3
113 6-C1 CF3 C~-Ph CH3
114 6-C1 CF3 C~-2-Pyridyl CH3
115 6-C1 CF3 C~-3-Pyridyl CH3
116 6-C1 CF3 C~-4-Pyridyl CH3
117 6-C1 CF3 C~-2-furanyl CH3
118 6-C1 CF3 C~-3-furanyl CH3
219 6-C1 CF3 C-C-2-thienyl CH3
120 6-C1 CF3 C~-3-thienyl CH3
121 6-C1 CF3 C=C-cycPr CH3
I22 6-C1 CF3 C=C-Ph CH3
123 6-C1 CF3 C=C-2-Pyridyl CH3
124 6-C1 CF3 C=C-3-Pyridyl CH3
125 6-C1 CF3 C=C-4-Pyridyl CH3
126 6-C1 CF3 C=C-2-furanyl CH3
227 6-C1 CF3 C=C-3-furanyl CH3
128 6-C1 CF3 C=C-2-thienyl CH3
129 6-C1 CF3 C=C-3-thienyl CH3
130 6-C1 CF3 CH2CH2-cycPr CH3
56
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
131 6-C1 CF3 CH2CH2-Ph CH3
132 6-Cl CF3 CH2CH2-2-Pyridyl CH3
133 6-C1 CF3 CH2CH2-3-Pyridyl CH3
134 6-C1 CF3 CHZCH2-4-Pyridyl CH3
135 6-C1 CF3 CHZCH2-2-furanyl CH3
136 6-C1 CF3 CHZCH2-3-furanyl CH3
137 6-C1 CF3 CHZCHZ-2-thienyl CH3
138 6-C1 CF3 CHZCH2-3-thienyl CH3
139 6-C1 CF3 C~-cycPr CH2CH3
140 6-C1 CF3 C-C-Ph CH2CH3
141 6-C1 CF3 C~-2-Pyridyl CH2CH3
142 6-C1 CF3 C~-3-Pyridyl CH2CH3
143 6-C1 CF3 C~-4-Pyridyl CH2CH3
144 6-C1 CF3 C=C-2-furanyl CH2CH3
145 6-C1 CF3 C~-3-furanyl CH2CH3
146 6-C1 CF3 C~-2-thienyl CH2CH3
147 6-C1 CF3 C~-3-thienyl CH2CH3
148 6-C1 CF3 C=C-cycPr CH2CH3
149 6-C1 CF3 C=C-Ph CH2CH3
150 6-C1 CF3 C=C-2-Pyridyl CH2CH3
151 6-C1 CF3 C=C-3-Pyridyl CH2CH3
152 6-C1 CF3 C=C-4-Pyridyl CH2CH3
153 6-C1 CF3 C=C-2-furanyl CH2CH3
154 6-C1 CF3 C=C-3-furanyl CH2CH3
155 6-C1 CF3 C=C-2-thienyl CH2CH3
156 6-C1 CF3 C=C-3-thienyl CHZCH3
157 6-C1 CF3 CH2CH2-cycPr CH2CH3
158 6-C1 CF3 CH2CH2-Ph CH2CH3
159 6-Cl CF3 CHZCHZ-2-Pyridyl CH2CH3
160 6-C1 CF3 CH2CH2-3-Pyridyl CH2CH3
161 6-C1 CF3 CH2CHZ-4-Pyridyl CH2CH3
162 6-C1 CF3 CH2CH2-2-furanyl CH2CH3
163 6-C1 CF3 CH2CH2-3-furanyl CH2CH3
164 6-C1 CF3 CH2CH2-2-thienyl CH2CH3
57
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
165 6-Cl CF3 CH2CH2-3-thienyl CH2CH3
166 6-Me0 CF3 C=CCH2CH20H H
167 6-Me0 CF3 C=C-CH(OH)Me H
168 6-Me0 CF3 C-C-(2-C1)Ph H
169 6-Me0 CF3 C=C-(3-C1)Ph H
170 6-Me0 CF3 C=C-(4-C1)Ph H
171 6-Me0 CF3 C=C-(2-F)Ph
172 6-Me0 CF3 C=C-(3-F)Ph H
173 6-Me0 CF3 C-C-(4-F)Ph H
174 6-Me0 CF3 C=C-(2-OH)Ph
175 6-Me0 CF3 C=C-(3-OH)Ph
176 6-Me0 CF3 C=C-(4-OH)Ph H
177 6-Me0 CF3 Cue- ( 2 -OMe ) H
Ph
178 6-Me0 CF3 C=C-(3-OMe)Ph H
179 6-Me0 CF3 C~-(4-OMe)Ph H
180 6-Me0 CF3 C=C-(2-CN)Ph H
181 6-Me0 CF3 C=C-(3-CN)Ph
182 6-Me0 CF3 C=C-(4-CN)Ph
183 6-Me0 CF3 C=C-(2-N02)Ph H
184 6-Me0 CF3 C-C-(3-N02)Ph
185 6-Me0 CF3 C-C-(4-N02)Ph
186 6-Me0 CF3 C=C-(2-NH2)Ph H
187 6-Me0 CF3 C=C-(3-NHZ)Ph
188 6-Me0 CF3 C=C-(4-NH2)Ph H
189 6-Me0 CF3 C-_--C- ( 2 -NMe2 H
) Ph
190 6-Me0 CF3 C_=C-(3-NMe2)Ph
191 6-Me0 CF3 C=C-(4-NMe2)Ph H
192 6-Me0 CF3 C~-3-Pyridyl H
193 6-Me0 CF3 C~-4-Pyridyl H
194 6-Me0 CF3 C=C-2-furanyl H
195 6-Me0 CF3 C~-3-furanyl H
196 6-Me0 CF3 C~-2-thienyl H
197 6-Me0 CF3 C=C-3-thienyl
198 6-Me0 CF3 C~-2-oxazolyl H
58
r , .
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
199 6-Me0 CF3 C=C-2-thiazolyl H
200 6-Me0 CF3 C=C-4-isoxazolyl H
201 6-Me0 CF3 C=C-2-imidazolyl H
202 6-Me0 CF3 C=CCH2CH20H H
203 6-Me0 CF3 C=C-CH(OH)Me H
204 6-Me0 CF3 C=C-(2-Cl)Ph H
205 6-Me0 CF3 C=C-(3-C1)Ph H
206 6-Me0 CF3 C=C-(4-C1)Ph H
207 6-Me0 CF3 C=C-(2-F)Ph H
208 6-Me0 CF3 C=C-(3-F)Ph H
209 6-Me0 CF3 C=C-(4-F)Ph H
210 6-Me0 CF3 C=C-(2-OH)Ph H
211 6-Me0 CF3 C=C-(3-OH)Ph H
212 6-Me0 CF3 C=C-(4-OH)Ph H
213 6-Me0 CF3 C=C-(2-OMe)Ph H
214 6-Me0 CF3 C=C-(3-OMe)Ph H
215 6-Me0 CF3 C=C-(4-OMe)Ph H
216 6-MeO CF3 C=C-(2-CN)Ph H
217 6-Me0 CF3 C=C-(3-CN)Ph H
218 6-Me0 CF3 C=C-(4-CN)Ph H
219 6-Me0 CF3 C=C-(2-N02)Ph H
220 6-Me0 CF3 C=C-(3-N02)Ph H
221 6-Me0 CF3 C=C-(4-N02)Ph H
222 6-Me0 CF3 C=C-(2-NH2)Ph H
223 6-Me0 CF3 C=C-(3-NH2)Ph H
224 6-Me0 CF3 C=C-(4-NH2)Ph H
225 6-Me0 CF3 C=C-(2-NMe2)Ph H
226 6-Me0 CF3 C=C-(3-NMe2)Ph H
227 6-Me0 CF3 C=C-(4-NMe2)Ph H
228 6-Me0 CF3 C=C-3-Pyridyl H
229 6-Me0 CF3 C=C-4-Pyridyl H
230 6-Me0 CF3 C=C-2-furanyl H
231 6-Me0 CF3 C=C-3-furanyl H
232 6-Me0 CF3 C=C-2-thienyl H
59
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
233 6-Me0 CF3 C=C-3-thienyl H
234 6-Me0 CF3 C=C-2-oxazolyl H
235 6-Me0 CF3 C=C-2-thiazolyl H
236 6-Me0 CF3 C=C-4-isoxazolyl H
237 6-Me0 CF3 C=C-2-imidazolyl H
238 6-Me0 CF3 CH2CH2-cycPr H
239 6-Me0 CF3 CH2CH2CH2CHZOH H
240 6-Me0 CF3 CH2CH2-CH(OH)Me H
241 6-Me0 CF3 CH2CH2-Ph H
242 6-Me0 CF3 CH2CH2-(2-C1)Ph H
243 6-Me0 CF3 CHZCH2-(3-C1)Ph H
244 6-Me0 CF3 CH2CH2-(4-C1)Ph H
245 6-Me0 CF3 CH2CH2-(2-F)Ph H
246 6-Me0 CF3 CH2CH2-(3-F)Ph H
247 6-Me0 CF3 CH2CH2-(4-F)Ph H
248 6-Me0 CF3 CH2CH2-(2-OH)Ph H
249 6-Me0 CF3 CH2CH2-(3-OH)Ph H
250 6-Me0 CF3 CH2CH2-(4-OH)Ph H
251 6-Me0 CF3 CH2CH2-(2-OMe)Ph H
252 6-Me0 CF3 CH2CH2-(3-OMe)Ph H
253 6-Me0 CF3 CH2CH2-{4-OMe)Ph H
254 6-Me0 CF3 CHZCH2-(2-CN)Ph H
255 6-Me0 CF3 CHZCHZ-(3-CN)Ph H
256 6-Me0 CF3 CH2CH2-(4-CN)Ph H
257 6-Me0 CF3 CH2CH2-(2-N02)Ph H
258 6-Me0 CF3 CHZCHZ-(3-NOZ)Ph H
259 6-Me0 CF3 CH2CH2-{4-NOz)Ph H
260 6-Me0 CF3 CH2CH2-(2-NH2)Ph H
261 6-Me0 CF3 CHZCH2-(3-NH2)Ph H
262 6-Me0 CF3 CH2CH2-(4-NH2)Ph H
263 6-Me0 CF3 CH2CH2-(2-NMe2)Ph H
264 6-Me0 CF3 CH2CH2-(3-NMe2)Ph H
265 6-Me0 CF3 CH2CH2-(4-NMe2)Ph H
266 6-Me0 CF3 CH2CH2-2-Pyridyl H
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
267 6-Me0 CF3 CH2CH2-3-Pyridyl H
268 6-Me0 CF3 CH2CH2-4-Pyridyl H
269 6-Me0 CF3 CH2CH2-2-furanyl H
270 6-Me0 CF3 CH2CH2-3-furanyl H
271 6-Me0 CF3 CHZCH2-4-furanyl H
272 6-Me0 CF3 CHZCH2-3-thienyl H
273 6-Me0 CF3 CH2CHz-2-oxazolyl H
274 6-Me0 CF3 CH2CH2-2-thiazolyl H
275 6-Me0 CF3 CHZCH2-4-isoxazolyl H
276 6-Me0 CF3 CH2CH2-2-imidazolyl H
277 6-Me0 CF3 C~-cycPr CH3
278 6-Me0 CF3 C=C-Ph CH3
279 6-Me0 CF3 C~-2-Pyridyl CH3
280 6-Me0 CF3 C~-3-Pyridyl CH3
281 6-Me0 CF3 C~-4-Pyridyl CH3
282 6-Me0 CF3 C~-2-furanyl CH3
283 6-Me0 CF3 C~ 3-furanyl CH3
284 6-Me0 CF3 C~-2-thienyl CH3
285 6-Me0 CF3 C~-3-thienyl CH3
286 6-Me0 CF3 C=C-cycPr CH3
287 6-Me0 CF3 C=C-Ph CH3
288 6-Me0 CF3 C=C-2-Pyridyl CH3
289 6-Me0 CF3 C=C-3-Pyridyl CH3
290 6-Me0 CF3 C=C-4-Pyridyl CH3
291 6-Me0 CF3 C=C-2-furanyl CH3
292 6-Me0 CF3 C=C-3-furanyl CH3
293 6-Me0 CF3 C=C-2-thienyl CH3
294 6-Me0 CF3 C=C-3-thienyl CH3
295 6-Me0 CF3 CH2CH2-cycPr CH3
296 6-Me0 CF3 CH2CH2-Ph CH3
297 6-Me0 CFg CH2CH2-2-Pyridyl CH3
298 6-Me0 CF3 CH2CH2-3-Pyridyl CH3
299 6-Me0 CF3 CH2CH2-4-Pyridyl CH3
300 6-Me0 CF3 CH2CH2-2-furanyl CH3
61
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
301 6-Me0 CF3 CHZCHZ-3-furanyl CH3
302 6-Me0 CF3 CH2CH2-2-thienyl CH3
303 6-Me0 CF3 CH2CH2-3-thienyl CH3
304 6-Me0 CF3 C~-cycPr CH2CH3
305 6-Me0 CF3 C=C-ph CH2CH3
306 6-Me0 CF3 C~-2-Pyridyl CH2CH3
307 6-Me0 CF3 C~-3-Pyridyl CH2CH3
308 6-Me0 CF3 C~-4-Pyridyl CH2CH3
309 6-Me0 CF3 C~-2-furanyl CH2CH3
310 6-Me0 CF3 C~-3 -furanyl CH2CH3
311 6-Me0 CF3 C~-2-thienyl CH2CH3
312 6-Me0 CF3 C~-3-thienyl CH2CH3
313 6-Me0 CF3 C=C-cycPr CHZCH3
314 6-Me0 CF3 C=C-Ph CH2CH3
315 6-Me0 CF3 C=C-2-Pyridyl CH2CH3
3I6 6-Me0 CF3 C=C-3-Pyridyl CH2CH3
317 6-Me0 CF3 C=C-4-Pyridyl CH2CH3
318 6-Me0 CF3 C=C-2-furanyl CH2CH3
319 6-Me0 CF3 C=C-3-furanyl CH2CH3
320 6-Me0 CF3 C=C-2-thienyl CHZCH3
321 6-Me0 CF3 C=C-3-thienyl CH2CH3
322 6-Me0 CF3 CHZCH2-cycPr CH2CH3
323 6-M'e0 CF3 CH2CH2-Ph CH2CH3
324 6-Me0 CF3 CH2CH2-2-Pyridyl CH2CH3
325 6-Me0 CF3 CH2CH2-3-Pyridyl CHZCH3
326 6-Me0 CF3 CH2CH2-4-Pyridyl CH2CH3
327 6-Me0 CF3 CH2CH2-2-furanyl CH2CH3
328 6-Me0 CF3 CH2CH2-3-furanyl CH2CH3
329 6-Me0 CF3 CH2CH2-2-thienyl CH2CH3
330 6-Me0 CF3 CH2CH2-3-thienyl CH2CH3
331 5,6-diF CF3 C=C-(2-C1)Ph H
332 5, 6-diF CF3 C~-(3-C1) Ph H
333 5,6-diF CF3 C=C-(4-C1)Ph H
334 5,6-diF CF3 C-C-(2-F)Ph H
62
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
335 5,6-diF CF3 C=C-(3-F)Ph H
336 5,6-diF CF3 C-C-(4-F)Ph H
337 5,6-diF CF3 C=C-(2-OH)Ph H
338 5,6-diF CF3 C=C-(3-OH)Ph H
339 5,6-diF CF3 C=C-(4-OH)Ph H
340 5, 6-diF CF3 Cue- (2-OMe) Ph H
341 5 , 6-diF CF3 Cue- ( 3 -OMe ) Ph H
3 42 5 , 6-diF CF3 Cue- ( 4 -OMe ) Ph H
343 5, 6-diF CF3 Cue- ( 2-CN) Ph H
344 5, 6-diF CF3 C~-(3-CN) Ph H
345 5, 6-diF CF3 Cue- (4-CN) Ph H
3 46 5 , 6 -diF CF3 Cue- ( 2 -N02 ) Ph H
347 5,6-diF CF3 C=C-(3-NOz)Ph H
348 5,6-diF CF3 C~-(4-N02)Ph H
3 4 5 , 6 -diF CF3 Cue- ( 2 -NH2 ) Ph H
9
350 5,6-diF CF3 C~-(3-NH2)Ph H
351 5,6-diF CF3 C~-(4-NH2)Ph H
352 5,6-diF CF3 C~-(2-NMe2)Ph H
3 53 5 , 6 -diF CF3 Cue- ( 3 -NMe2 ) Ph H
354 5,6-diF CF3 C=C-(4-NMe2)Ph H
355 5,6-diF CF3 C=C-3-Pyridyl H
356 5,6-diF CF3 C~-4-Pyridyl H
357 5,6-diF CF3 C~-2-furanyl H
358 5,6-diF CF3 C~-3-furanyl H
359 5,6-diF CF3 C~-2-thienyl H
360 5,6-diF CF3 C~-3-thienyl H
361 5,6-diF CF3 C~-2-oxazolyl H
362 5,6-diF CF3 C=C-2-thiazolyl H
363 5,6-diF CF3 CrC-4-isoxazolyl H
364 5,6-diF CF3 C=C-2-imidazolyl H
365 5,6-diF CF3 C=C-(2-C1)Ph H
366 5,6-diF CF3 C=C-(3-C1)Ph H
367 5,6-diF CF3 C=C-(4-C1)Ph H
368 5,6-diF CF3 C=C-(2-F)Ph H
63
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
369 5,6-diF CF3 C=C-(3-F)Ph H
370 5,6-diF CF3 C=C-(4-F)Ph H
371 5,6-diF CF3 C=C-{2-OH)Ph H
372 5,6-diF CF3 C=C-{3-OH)Ph H
373 5,6-diF CF3 C=C-{4-OH)Ph H
374 5,6-diF CF3 C=C-(2-OMe)Ph H
375 5,6-diF CF3 C=C-(3-OMe)Ph H
376 5,6-diF CF3 C=C-(4-OMe)Ph H
377 5,6-diF CF3 C=C-(2-CN)Ph H
378 5,6-diF CF3 C=C-(3-CN)Ph H
379 5,6-diF CF3 C=C-(4-CN)Ph H
380 5,6-diF CF3 C=C-(2-N02)Ph H
381 5,6-diF CF3 C=C-(3-N02)Ph H
382 5,6-diF CF3 C=C-{4-N02)Ph H
383 5,6-diF CF3 C=C-(2-NH2)Ph H
384 5,6-diF CF3 C=C-(3-NH2)Ph H
385 5,6-diF CF3 C=C-(4-NH2)Ph H
386 5,6-diF CF3 C=C-(2-NMe2)Ph H
3 8? 5 , 6-diF CF3 C=C- ( 3 -NMe2 ) H
Ph
388 5,6-diF CF3 C=C-(4-NMe2)Ph H
389 5,6-diF CF3 C=C-3-Pyridyl H
390 5,6-diF CF3 C=C-4-Pyridyl H
391 5,6-diF CF3 C=C-2-furanyl H
392 5,6-diF CF3 C=C-3-furanyl H
393 5,6-diF CF3 C=C-2-thienyl H
394 5,6-diF CF3 C=C-3-thienyl H
395 5,6-diF CF3 C=C-2-oxazolyl H
396 5,6-diF CF3 C=C-2-thiazolyl H
397 5,6-diF CF3 C=C-4-isoxazolyl H
398 5,6-diF CF3 C=C-2-imidazolyl H
399 5,6-diF CF3 CH2CH2-cycPr H
400 5,6-diF CF3 CH2CH2CH2CH20H H
401 5,6-diF CF3 CH2CH2-CH(OH)Me H
402 5,6-diF CF3 CH2CH2-Ph H
64
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
403 5,6-diF CF3 CH2CHZ-(2-C1)Ph H
404 5,6-diF CF3 CH2CH2-(3-C1)Ph H
405 5,6-diF CF3 CH2CH2-(4-Cl)Ph H
406 5,6-diF CF3 CHZCH2-(2-F)Ph H
407 5,6-diF CF3 CH2CH2-(3-F)Ph H
408 5,6-diF CF3 CH2CH2-(4-F)Ph H
409 5,6-diF CF3 CH2CH2-(2-OH)Ph H
410 5,6-diF CF3 CH2CH2-(3-OH)Ph H
411 5,6-diF CF3 CHZCH2-(4-OH)Ph H
412 5,6-diF CF3 CH2CH2-(2-OMe)Ph H
413 5,6-diF CF3 CHzCH2-(3-OMe)Ph H
414 5,6-diF CF3 CH2CH2-(4-OMe)Ph H
415 5,6-diF CF3 CHZCH2-(2-CN)Ph H
416 5,6-diF CF3 CH2CHZ-(3-CN)Ph H
417 5,6-diF CF3 CH2CH2-(4-CN)Ph H
418 5,6-diF CF3 CHZCH2-(2-N02)Ph H
419 5,6-diF CF3 CH2CH2-(3-N02)Ph H
420 5,6-diF CF3 CH2CH2-(4-N02)Ph H
421 5,6-diF CF3 CH2CH2-(2-NH2~Ph H
422 5,6-diF CF3 CH2CH2-(3-NH2)Ph H
423 5,6-diF CF3 CH2CH2-(4-NH2)Ph H
424 5,6-diF CF3 CHZCH2-(2-NMe2)Ph H
425 5,6-diF CF3 CHZCH2-(3-NMe2)Ph H
426 5,6-diF CF3 CH2CH2-(4-NMe2)Ph H
427 5,6-diF CF3 CH2CH2-2-Pyridyl H
428 5,6-diF CF3 CH2CH2-3-Pyridyl H
429 5,6-diF CF3 CH2CH2-4-Pyridyl H
430 5,6-diF CF3 CH2CH2-2-furanyl H
431 5,6-diF CF3 CH2CH2-3-furanyl H
432 5,6-diF CF3 CHZCH2-2-thienyl H
433 5,6-diF CF3 CH2CH2-3-thienyl H
434 5,6-diF CF3 CH2CHZ-2-oxazolyl H
435 5,6-diF CF3 CH2CH2-2-thiazolyl H
436 5,6-diF CF3 CH2CH2-4-isoxazolyl H
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
437 5,6-diF CF3 CH2CH2-2-imidazolyl H
438 5,6-diF CF3 C~-cycPr CH3
439 5,6-diF CF3 C~-2-Pyridyl CH3
440 5,6-diF CF3 C~-3-Pyridyl CH3
441 5 , 6-diF CF3 C~-4 CH
-Pyridyl 3
442 5,6-diF CF3 C~-2-furanyl CH3
443 5,6-diF CF3 C~-3-furanyl CH3
444 5,6-diF CF3 C~-2-thienyl CH3
445 5,6-diF CF3 C~-3-thienyl CH3
446 5,6-diF CF3 C=C-cycPr CH3
447 5,6-diF CF3 C=C-2-Pyridyl CH3
448 5,6-diF CF3 C=C-3-Pyridyl CH3
449 5,6-diF CF3 C=C-4-Pyridyl CH3
450 5,6-diF CF3 C=C-2-furanyl CH3
451 5,6-diF CF3 C=C-3-furanyl CH3
452 5,6-diF CF3 C=C-2-thienyl CH3
453 5,6-diF CF3 C=C-3-thienyl CHI
454 5,6-diF CF3 CH2CH2-cycPr CH3
455 5,6-diF CF3 CH2CH2-Ph CH3
456 5,6-diF CF3 CH2CH2-2-Pyridyl CH3
457 5,6-diF CF3 CHZCH2-3-Pyridyl CH3
458 5,6-diF CF3 CH2CH2-4-Pyridyl CH3
459 5,6-diF CF3 CH2CH2-2-furanyl CH3
460 5,6-diF CF3 CH2CH2-3-furanyl CH3
461 5,6-diF CF3 CHZCH2-2-thienyl CH3
462 5,6-diF CF3 CHZCH2-3-thienyl CH3
463 5,6-diF CF3 C~-cycPr CH2CH3
464 5,6-diF CF3 C-C-Ph CH2CH3
465 5,6-diF CF3 C~-2-Pyridyl CH2CH3
466 5,6-diF CF3 C~-3-Pyridyl CH2CH3
467 5,6-diF CF3 C~-4-Pyridyl CH2CH3
468 5, 6-diF CF3 C~-2-furanyl CH2CH3
469 5,6-diF CF3 C~-3-furanyl CH2CH3
470 5,6-diF CF3 C~-2-thienyl CH2CH3
66
CA 02284996 1999-09-27
WO 98/45276 PCT/US98I06733
471 5,6-diF CF3 C~-3-thienyl CH2CH3
472 5,6-diF CF3 C=C-cycPr CH2CH3
473 5,6-diF CF3 C=C-Ph CH2CH3
474 5,6-diF CF3 C=C-2-Pyridyl CH2CH3
475 5,6-diF CF3 C=C-3-Pyridyl CHZCH3
476 5,6-diF CF3 C=C-4-Pyridyl CHZCH3
477 5,6-diF CF3 C=C-2-furanyl CH2CH3
478 5,6-diF CF3 C=C-3-furanyl CH2CH3
479 5,6-diF CF3 C=C-2-thienyl CH2CH3
480 5,6-diF CF3 C=C-3-thienyl CH2CH3
481 5,6-diF CF3 CH2CH2-cycPr CH2CH3
482 5,6-diF CF3 CH2CH2-Ph CH2CH3
483 5,6-diF CF3 CH2CHZ-2-Pyridyl CH2CH3
484 5,6-diF CF3 CHZCH2-3-Pyridyl CH2CH3
485 5,6-diF CF3 CH2CH2-4-Pyridyl CH2CH3
486 5,6-diF CF3 CH2CH2-2-furanyl CH2CH3
487 5,6-diF CF3 CH2CH2-3-furanyl CHZCH3
488 5,6-diF CF3 CH2CH2-2-thienyl CH2CH3
489 5,6-diF CF3 CHZCH2-3-thienyl CH2CH3
490 5, 6-diCl CF3 Cue- (2-C1) Ph H
491 5 , 6-diCl CF3 Cue- ( 3 -C1 ) Ph H
492 5,6-diCl CF3 C~-(4-C1)Ph H
493 5, 6-diCl CF3 Cue- (2-F) Ph H
494 5, 6-diCl CF3 C~-(3-F) Ph H
495 5 , 6-diCl CF3 Cue- ( 4-F ) Ph H
496 5, 6-diCl CF3 C~-(2-OH) Ph H
497 5, 6-diCl CF3 C~-(3-OH) Ph H
498 5 , 6-diCl CF3 Cue- ( 4-OH) Ph H
499 5,6-diCl CF
Cue- ( 2 -OMe ) H
Ph
500 5,6-diCl CF
Cue- ( 3 -OMe ) H
Ph
501 5,6-diCl CF3 C~-(4-OMe)Ph H
502 5, 6-diCl CF3 C~-(2-CN) Ph H
503 5, 6-diCl CF3 C~-(3-CN) Ph H
504 5 , 6-diCl CF3 Cue- ( 4-CN) Ph H
67
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98106733
505 5,6-diCl CF3 C-C-(2-N02)Ph H
506 5,6-diCl CF3 C-C-(3-NOZ}Ph H
507 5,6-diCl CF3 CSC-(4-N02)Ph H
508 5,6-diCl CF3 C=C-(2-NHz)Ph H
509 5,6-diCl CF3 C=C-(3-NH2)Ph H
510 5,6-diCl CF3 C=C-(4-NH2)Ph H
511 5,6-diCl CF3 C=C-(2-NMe2)Ph H
512 5 , 6-diCl CF3 C=C- ( 3 -NMe2 ) H
Ph
513 S,6-diCl CF3 C-C-(4-NMe2)Ph H
514 5,6-diCl CF3 C~-3-Pyridyl H
515 5,6-diCl CF3 C~-4-Pyridyl H
516 5,6-diCl CF3 C~-2-furanyl H
517 5,6-diCl CF3 C~-3-furanyl H
518 5,6-diCl CF3 C~-2-thienyl H
519 5,6-diCl CF3 C~-3-thienyl H
520 5,6-diCl CF3 C~-2-oxazolyl H
521 5,6-diCl CF3 C=C-2-thiazolyl H
522 5,6-diCl CF3 C~-4-isoxazolyl H
523 5,6-diCl CF3 C~-2-imidazolyl H
524 5,6-diCl CF3 C=C-(2-C1)Ph H
525 5,6-diCl CF3 C=C-(3-Cl)Ph H
526 5,6-diCl CF3 C=C-(4-C1)Ph H
527 5,6-diCl CF3 C=C-(2-F)Ph H
528 5,6-diCl CF3 C=C-(3-F)Ph H
529 5,6-diCl CF3 C=C-(4-F)Ph H
530 5,6-diCl CF3 C=C-(2-OH)Ph H
531 5,6-diCl CF3 C=C-(3-OH)Ph H
532 5,6-diCl CF3 C=C-(4-OH)Ph H
533 5,6-diCl CF3 C=C-(2-OMe)Ph H
534 5,6-diCl CF3 C=C-(3-OMe)Ph H
535 5,6-diCl CF3 C=C-(4-OMe)Ph H
536 5,6-diCl CF3 C=C-(2-CN)Ph H
537 5,6-diCl CF3 C=C-(3-CN)Ph H
538 5,6-diCl CF3 C=C-(4-CN}Ph H
68
, i
CA 02284996 1999-09-27
WO 98145276 PCT/US98106733
539 5,6-diCl CF3 C=C-(2-NOz)Ph H
540 5,6-diCl CF3 C=C-(3-N02)Ph H
541 5,6-diCl CF3 C=C-(4-N02)Ph H
542 5,6-diCl CF3 C=C-(2-NH2)Ph H
543 5,6-diCl CF3 C=C-(3-NH2)Ph H
544 5,6-diCl CF3 C=C-(4-NH2)Ph H
545 5,6-diCl CF3 C=C-(2-NMe2)Ph H
546 5,6-diCl CF3 C=C-(3-NMe2)Ph H
547 5,6-diCl CF3 C=C-(4-NMe2)Ph H
548 5,6-diCl CF3 C=C-3-Pyridyl H
549 5,6-diCl CF3 C=C-4-Pyridyl H
550 5,6-diCl CF3 C=C-2-furanyl H
551 5,6-diCl CF3 C=C-3-furanyl H
552 5,6-diCl CF3 C=C-2-thienyl H
553 5,6-diCl CF3 C=C-3-thienyl H
554 5,6-diCl CF3 C=C-2-oxazolyl H
555 5,6-diCl CF3 C=C-2-thiazolyl H
556 5,6-diCl CF3 C=C-4-isoxazolyl H
557 5,6-diCl CF3 C=C-2-imidazolyl H
558 5,6-diCl CF3 CH2CH2-cycPr H
559 5,6-diCl CFA CH2CH2CH2CH20H H
560 5,6-diCl CF3 CHZCH2-CH(OH)Me H
561 5,6-diCl CF3 CH2CH2-Ph H
562 5,6-diCl CF3 CH2CH2-(2-C1)Ph H
563 5,6-diCl CF3 CHZCH2-(3-C1)Ph H
564 5,6-diCl CF3 CH2CH2-(4-C1)Ph H
565 5,6-diCl CF3 CHZCH2-(2-F)Ph H
566 5,6-diCl CF3 CH2CH2-(3-F)Ph H
567 5,6-diCl CF3 CH2CH2-(4-F)Ph H
568 5,6-diCl CF3 CH2CH2-(2-OH)Ph H
569 5,6-diCl CF3 CHZCH2-(3-OH)Ph H
570 5,6-diCl CF3 CHZCH2-(4-OH)Ph H
571 5,6-diCl CF3 CH2CH2-(2-OMe)Ph H
572 5,6-diCl CF3 CH2CH2-(3-OMe)Ph H
69
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
573 5,6-diCl CF3 CH2CH2-(4-OMe)Ph H
574 5,6-diCl CF3 CHZCH2-(2-CN)Ph H
575 5,6-diCl CF3 CH2CH2-(3-CN)Ph H
576 5,6-diCl CF3 CH2CH2-(4-CN)Ph H
577 5,6-diCl CF3 CH2CH2-(2-NOZ)Ph H
578 5,6-diCl CF3 CH2CH2-(3-N02)Ph H
579 5,6-diCl CF3 CH2CH2-(4-N02)Ph H
580 5,6-diCl CF3 CH2CH2-(2-NH2?Ph H
581 5 , 6-diCl CF3 CH2CH2- ( 3 -NH2 H
) Ph
582 5,6-diCl CF3 CH2CH2-(4-NH2)Ph H
583 5,6-diCl CF3 CH2CH2-(2-NMe2)Ph H
584 5,6-diCl CF3 CH2CH2-(3-NMe2)Ph H
585 5,6-diCl CF3 CHZCH2-(4-NMe2)Ph H
586 5,6-diCl CF3 CH2CH2-2-Pyridyl H
587 5,6-diCl CF3 CH2CH2-3-Pyridyl H
588 5,6-diCl CF3 CH2CH2-4-Pyridyl H
589 5,6-diCl CF3 CH2CH2-2-furanyl H
590 5,6-diCl CF3 CH2CH2-3-furanyl H
591 5,6-diCl CF3 CH2CH2-2-thienyl H
592 5,6-diCl CF3 CH2CH2-3-thienyl H
593 5,6-diCl CF3 CH2CH2-2-oxazolyl H
594 5,6-diCl CF3 CHZCH2-2-thiazolyl H
595 5,6-diCl CF3 CH2CH2-4-isoxazolyl H
596 5,6-diCl CF3 CH2CH2-2-imidazolyl H
597 5 , 6-diCl CF3 C~-cycPr CH3
598 5,6-diCl CF3 C~-2-Pyridyl CH3
599 5,6-diCl CF3 C~-3-Pyridyl CH3
600 5,6-diCl CF3 C~-4-Pyridyl CH3
601 5, 6-diCl CF3 C~-2-furanyl CH3
602 5,6-diCl CF3 C~-3-furanyl CH3
603 5,6-diCl CF3 C~-2-thienyl CH3
604 5,6-diCl CF3 C~-3-thienyl CH3
605 5,6-diCl CF3 C=C-cycPr CH3
606 5,6-diCl CF3 C=C-2-Pyridyl CH3
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
607 5,6-diCl CF3 C=C-3-Pyridyl CH3
608 5,6-diCl CF3 C=C-4-Pyridyl CH3
609 5,6-diCl CF3 C=C-2-furanyl CH3
610 5,6-diCl CF3 C=C-3-furanyl CH3
611 5,6-diCl CF3 C=C-2-thienyl CH3
612 5,6-diCl CF3 C=C-3-thienyl CH3
613 5,6-diCl CF3 CH2CH2-cycPr CH3
614 5,6-diCl CF3 CHZCH2-Ph CH3
615 5,6-diCl CF3 CH2CH2-2-Pyridyl CH3
616 5,6-diCl CF3 CH2CH2-3-Pyridyl CH3
617 5,6-diCl CF3 CH2CH2-4-Pyridyl CH3
618 5,6-diCl CF3 CH2CH2-2-furanyl CH3
619 5,6-diCl CF3 CH2CH2-3-furanyl CH3
620 5,6-diCl CF3 CH2CH2-2-thienyl CH3
621 5,6-diCl CF3 CH2CH2-3-thienyl CH3
622 5,6-diCl CF3 C~-cycPr CH2CH3
623 5,6-diCl CF3 C~-Ph CHZCH3
624 5,6-diCl CF3 C~-2-Pyridyl CH2CH3
625 5,6-diCl CF3 C~-3-Pyridyl CH2CH3
626 5,6-diCl CF3 C~-4-Pyridyl CH2CH3
627 5,6-diCl CF3 C~-2-furanyl CH2CH3
628 5,6-diCl CF3 C~-3-furanyl CH2CH3
629 5,6-diCl CF3 C~-2-thienyl CH2CH3
630 5,6-diCl CF3 C~-3-thienyl CHZCH3
631 5,6-diCl CF3 C=C-cycPr CH2CH3
632 5,6-diCl CF3 C=C-Ph CH2CH3
633 5,6-diCl CF3 C=C-2-Pyridyl CH2CH3
634 5,6-diCl CF3 C=C-3-Pyridyl CH2CH3
635 5,6-diCl CF3 C=C-4-Pyridyl CH2CH3
636 5,6-diCl CF3 C=C-2-furanyl CH2CH3
637 5,6-diCl CF3 C=C-3-furanyl CH2CH3
638 5,6-diCl CF3 C=C-2-thienyl CH2CH3
639 5,6-diCl CF3 C=C-3-thienyl CH2CH3
640 5,6-diCl CF3 CH2CH2-cycPr CH2CH3
71
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
641 5,6-di.Cl CF3 CH2CH2-Ph CH2CH3
642 5,6-diCl CF3 CH2CH2-2-Pyridyl CH2CH3
643 5,6-diCl CF3 CH2CH2-3-Pyridyl CH2CH3
644 5,6-diCl CF3 CH2CH2-4-Pyridyl CH2CH3
645 5,6-diCl CF3 CH2CH2-2-furanyl CHzCH3
646 5,6-diCl CF3 CH2CH2-3-furanyl CH2CH3
647 5,6-diCl CF3 CH2CH2-2-thienyl CH2CH3
648 5,6-diCl CF3 CH2CH2-3-thienyl CH2CH3
649 6-F CF3 C~CH2CH20H H
650 6-F CF3 C~-CH(OH)Me H
651 6-F CF3 C~-(2-C1)Ph H
652 6-F CF3 Cue- ( 3-C1 ) Ph H
653 6-F CF3 C~-(4-CI)Ph H
654 6-F CF3 Cue- (2-F) Ph H
655 6-F CF3 Cue- ( 3 -F ) Ph H
656 6-F CFg C~-(4-F)Ph H
657 6-F CF3 Cue- ( 2-OH) Ph H
658 6-F CF3 C~-(3-OH)Ph H
659 6-F CF3 C~-(4-OH)Ph H
660 6-F CF3 Cue- (2-OMe) Ph H
661 6-F CF3 Cue- ( 3 -OMe ) H
Ph
662 6-F CF3 C~-(4-OMe)Ph H
663 6-F CF3 Cue- (2-CN) Ph H
6 6 6 -F CF3 Cue- ( 3 -CN ) H
4 Ph
665 6-F CF3 Cue- ( 4-CN) Ph H
666 6-F CF3 Cue- ( 2-N02 ) H
Ph
667 6-F CF3 C~-(3-N02)Ph H
668 6-F CF3 Cue- ( 4-N02 ) H
Ph
669 6-F CF3 Cue- ( 2-NH2 ) H
Ph
670 6-F CF3 Cue- ( 3-NH2 ) H
Ph
671 6-F CF3 Cue- ( 4-NH2 ) H
Ph
672 6-F CF3 Cue- ( 2-NMe2 ) H
Ph
673 6-F CF3 Cue- ( 3 -NMe2 H
) Ph
674 6-F CF3 Cue- ( 4-NMe2 ) H
Ph
72
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
675 6-F CF3 C-C-3-Pyridyl H
676 6-F CF3 C~-4-Pyridyl H
677 6-F CF3 C~-2-furanyl H
' 678 6-F CF3 C~-3-furanyl H
679 6-F CF3 C~-2-thienyl H
680 6-F CF3 C~-3-thienyl H
681 6-F CF3 C~-2-oxazolyl H
682 6-F CF3 C=C-2-thiazolyl H
683 6-F CF3 C=C-4-isoxazolyl H
684 6-F CF3 C=C-2-imidazolyl H
685 6-F CF3 C=CCH2CHzOH H
686 6-F CF3 C=C-CH(OH)Me H
687 6-F CF3 C=C-(2-C1)Ph H
688 6-F CF3 C=C-(3-C1)Ph H
689 6-F CF3 C=C-(4-C1)Ph H
690 6-F CF3 C=C-(2-F)Ph H
691 6-F CF3 C=C-(3-F)Ph H
692 6-F CF3 C=C-(4-F)Ph H
693 6-F CF3 C=C-(2-OH)Ph H
694 6-F CF3 C=C-(3-OH)Ph H
695 6-F CF3 C=C-(4-OH)Ph H
696 6-F CF3 C=C-(2-OMe)Ph H
697 6-F CF3 C=C-(3-OMe)Ph H
698 6-F CF3 C=C-(4-OMe)Ph H
699 6-F CF3 C=C-(2-CN)Ph H
700 6-F CF3 C=C-(3-CN)Ph H
701 6-F CF3 C=C-(4-CN)Ph H
702 6-F CF3 C=C-(2-N02)Ph H
703 6-F CF3 C=C- ( 3-N02 ) Ph H
704 6-F CF3 C=C-(4-N02)Ph H
705 6-F CF3 C=C- ( 2-NH2 ) Ph H
706 6-F CF3 C=C-(3-NH2)Ph H
707 6-F CF3 C=C-(4-NHZ)Ph H
708 6-F CF3 C=C-(2-NMe2)Ph H
73
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
7 09 6-F CF3 C=C- ( 3 -NMe2 ) H
Ph
710 6-F CF3 C=C-(4-NMe2)Ph H
711 6-F CF3 C=C-3-Pyridyl H
712 6-F CF3 C=C-4-Pyridyl H
713 6-F CF3 C=C-2-furanyl H
714 6-F CF3 C=C-3-furanyl H
715 6-F CF3 C=C-2-thienyl H
716 6-F CF3 C=C-3-thienyl H
717 6-F CF3 C=C-2-oxazolyl H
718 6-F CF3 C=C-2-thiazolyl H
719 6-F CF3 C=C-4-isoxazolyl H
720 6-F CF3 C=C-2-imidazolyl H
721 6-F CF3 CH2CH2-cycPr H
722 6-F CF3 CH2CH2CH2CHZOH H
723 6-F CF3 CH2CH2-CH(OH)Me H
724 6-F CF3 CH2CH2-(2-C1)Ph H
725 6-F CF3 CH2CH2-(3-C1)Ph H
726 6-F CF3 CHZCHZ-(4-C1)Ph H
727 6-F CF3 CH2CH2-(2-F)Ph H
728 6-F CF3 CH2CH2-(3-F)Ph H
729 6-F CF3 CH2CH2-(4-F)Ph H
730 6-F CF3 CH2CH2-(2-OH)Ph H
731 6-F CF3 CH2CH2-(3-OH)Ph H
732 6-F CF3 CH2CHZ-(4-OH)Ph H
733 6-F CF3 CH2CH2-(2-OMe)Ph H
734 6-F CF3 CH2CH2-(3-OMe)Ph H
735 6-F CF3 CH2CH2-(4-OMe)Ph H
736 6-F CF3 CH2CH2-(2-CN)Ph H
737 6-F CF3 CHZCH2-(3-CN)Ph H
738 6-F CF3 CH2CH2-(4-CN)Ph H
739 6-F CF3 CH2CH2-(2-N02)Ph H
740 6-F CF3 CH2CH2- ( 3 -N02 H
) Ph
741 6-F CF3 CH2CH2-(4-N02)Ph H
742 6-F CF3 CH2CH2-(2-NHZ)Ph H
74
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
743 6-F CF3 CHZCHZ-(3-NH2)Ph H
744 6-F CF3 CH2CH2-(4-NH2)Ph H
745 6-F CF3 CH2CH2-(2-NMe2)Ph H
746 6-F CF3 CH2CH2- ( 3 -NMe2 H
) Ph
747 6-F CF3 CH2CH2-(4-NMe2)Ph H
748 6-F CF3 CH2CHz-3-Pyridyl H
749 6-F CF3 CH2CH2-4-Pyridyl H
750 6-F CF3 CH2CH2-2-furanyl H
751 6-F CF3 CHZCH2-3-furanyl H
752 6-F CF3 CH2CH2-2-thienyl H
753 6-F CF3 CH2CH2-3-thienyl H
754 6-F CF3 CHZCH2-2-oxazolyl H
755 6-F CF3 CH2CH2-2-thiazolyl H
756 6-F CF3 CH2CH2-4-isoxazolyl H
757 6-F CF3 CH2CH2-2-imidazolyl H
758 6-F CF3 C~-cycPr CH3
759 6-F CF3 C~-iPr CH3
760 6-F CF3 C~-Pr CH3
7 61 6-F CF3 C~-Bu CH3
7 62 6-F CF3 C~-iBu CH3
763 6-F CF3 C=C-tBu CH3
764 6-F CF3 C=C-Et CH3
765 6-F CF3 C=C-Me CH3
766 6-F CF3 C=_C-Ph CH3
76? 6-F CF3 C~-2-Pyridyl CH3
768 6-F CF3 C~-3-Pyridyl CH3
769 6-F CF3 C~-4-Pyridyl CH3
770 6-F CF3 C~-2-furanyl CH3
771 6-F CF3 C~-3-furanyl CH3
772 6-F CF3 C~-2-thienyl CH3
773 6-F CF3 C~-3-thienyl CH3
774 6-F CF3 C=C-cycPr CH3
775 6-F CF3 C=C-iPr CH3
776 6-F CF3 C=C-Pr CH3
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
777 6-F CF3 C=C-Bu CH3
778 6-F CF3 C=C-iBu CH3
779 6-F CF3 C=C-tBu CH3
780 6-F CF3 C=C-Et CH3
781 6-F CF3 C=C-Me CH3
782 6-F CF3 C=C-Ph CH3
783 6-F CF3 C=C-2-Pyridyl CH3
784 6-F CF3 C=C-3-Pyridyl CH3
785 6-F CF3 C=C-4-Pyridyl CH3
786 6-F CF3 C=C-2-furanyl CH3
787 6-F CF3 C=C-3-furanyl CH3
788 6-F CF3 C=C-2-thienyl CH3
789 6-F CF3 C=C-3-thienyl CH3
790 6-F CF3 CH2CH2-cycPr CH3
791 6-F CF3 CH2CH2-Ph CH3
792 6-F CF3 CH2CH2-2-Pyridyl CH3
793 6-F CF3 CH2CH2-3-Pyridyl CH3
794 6-F CF3 CHZCH2-4-Pyridyl CHg
795 6-F CF3 CH2CH2-2-furanyl CH3
796 6-F CF3 CH2CH2-3-furanyl CH3
797 6-F CF3 CH2CH2-2-thienyl CH3
798 6-F CF3 CH2CH2-3-thienyl CH3
799 6-F CF3 C~-cycPr CH2CH3
800 6-F CF3 C=C-Ph CH2CH3
801 6-F CF3 C~-2-Pyridyl CH2CH3
802 6-F CF3 C~-3-Pyridyl CH2CH3
803 6-F CF3 C~-4-Pyridyl CH2CH3
804 S-F CF3 C~-2-furanyl CH2CH3
805 6-F CF3 C~-3-furanyl CH2CH3
806 6-F CF3 C~-2-thienyl CH2CH3
807 6-F CF3 C~-3-thienyl CH2CH3
808 6-F CF3 C=C-cycPr CH2CH3
809 6-F CF3 C=C-Ph CH2CH3
810 6-F CF3 C=C-2-Pyridyl CH2CH3
76
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
811 6-F CF3 C=C-3-Pyridyl CH2CH3
812 6-F CF3 C=C-4-Pyridyi CH2CH3
813 6-F CF3 C=C-2-furanyl CH2CH3
814 6-F CF3 C=C-3-furanyl CH2CH3
815 6-F CF3 C=C-2-thienyl CH2CH3
816 6-F CF3 C=C-3-thienyl CH2CH3
817 6-F CF3 CH2CH2-cycPr CH2CH3
818 6-F CF3 CHzCH2-Ph CH2CH3
819 6-F CF3 CH2CH2-2-Pyridyl CHZCH3
820 6-F CF3 CH2CH2-3-Pyridyl CHZCH3
821 6-F CF3 CH2CH2-4-Pyridyl CH2CH3
822 6-F CF3 CH2CH2-2-furanyl CH2CH3
823 6-F CF3 CH2CHz-3-furanyl CH2CH3
824 6-F CF3 CHZCH2-2-thienyl CH2CH3
825 6-F CF3 CH2CH2-3-thienyl CH2CH3
826 S-C1 CF3 C~-cycPr H
827 S-C1 CF3 C~CH2CHZOH H
828 S-C1 CF3 C=C-CH(OH)Me H
829 5-C1 CF3 C-C-Ph H
830 5-CI CF3 C~-(2-C1)Ph H
831 5-C1 CF3 C~-(3-C1)Ph H
832 5-C1 CF3 C~-(4-CI)Ph H
833 5-C1 CF3 C~-(2-F)Ph H
834 5-Cl CF3 C~-(3-F)Ph
835 S-C1 CF3 C~-(4-F)Ph H
836 5-C1 CF3 C~-(2-OH)Ph H
837 5-CI CF3 C~-(3-OH)Ph H
838 5-C1 CF3 C~-(4-OH)Ph H
839 5-C1 CF3 Cue- (2-OMe) Ph H
840 5-C1 CF3 C~-(3-OMe)Ph H
841 5-C1 CF3 Cue- ( 4-OMe ) Ph H
842 5-Cl CF3 Cue- ( 2-CN) Ph H
843 5-Cl CF3 Cue- ( 3 -CN) Ph H
844 5-C1 CF3 C~-(4-CN)Ph H
77
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
845 5-C1 CF3 C=C-(2-N02)Ph H
846 5-Cl CF3 C-C-(3-N02)Ph H
847 5-C1 CF3 C=C-(4-N02)Ph H
848 5-C1 CF3 Cue- ( 2-NHZ ) Ph H
849 5-C1 CF3 C-C-(3-NH2)Ph H
850 5-C1 CF3 C-C-(4-NH2)Ph H
851 5-C1 CF3 C-C-(2-NMe2)Ph H
852 5-C1 CF3 C=C-(3-NMe2)Ph H
853 5-C1 CF3 C-C-(4-NMez)Ph H
854 5-C1 CF
C~-2-Pyridyl H
855 5-Cl CF3 C~-2-Pyridyl H
856 5-C1 CF3 C~-3 H
-Pyridyl
857 5-C1 CF3 C~-4 H
-Pyridyl
858 5-C1 CF3 C~-2-furanyl H
859 5-C1 CF3 C~-3-furanyl H
860 5-C1 CF3 C~-2-thienyl H
861 5-C1 CF3 C=C-3-thienyl H
862 5-C1 CF3 C=C-2-oxazolyl H
863 5-C1 CF3 C~-2-thiazolyl H
864 5-C1 CF3 C~-4-isoxazolyl H
865 5-CI CF3 C=C-2-imidazolyl H
866 5-C1 CF3 C=C-cycPr H
867 5-C1 CF3 C=CCH2CH20H H
868 5-C1 CF3 C=C-CH(OH)Me H
869 5-C1 CF3 C=C-Ph H
870 5-C1 CF3 C=C-(2-C1)Ph H
871 5-C1 CF3 C=C- ( 3 -C1 ) Ph H
872 5-C1 CF3 C=C-(4-C1)Ph H
873 5-C1 CF3 C=C-(2-F)Ph H
874 5-C1 CF3 C=C-(3-F)Ph H
875 5-C1 CF3 C=C-(4-F)Ph H
876 5-C1 CF3 C=C-(2-OH)Ph H
877 5-C1 CF3 C=C- ( 3 -OH ) Ph H
878 5-Cl CF3 C=C-(4-OH)Ph H
78
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
879 5-Cl CF3 C=C-(2-OMe)Ph H
880 5-C1 CF3 C=C-(3-OMe)Ph H
881 5-C1 CF3 C=C-(4-OMe)Ph H
882 5-C1 CF3 C=C-(2-CN)Ph H
883 5-C1 CF3 C=C-(3-CN)Ph H
884 5-C1 CF3 C=C-(4-CN)Ph H
885 5-C1 CFg C=C-(2-NOZ)Ph H
886 5-C1 CF3 C=C-(3-N02)Ph H
887 5-C1 CF3 C=C-(4-N02)Ph H
888 5-C1 CF3 C=C-(2-NH2)Ph H
889 5-C1 CF3 C=C-(3-NHZ)Ph H
890 5-CI CF3 C=C-(4-NH2)Ph H
891 5-C1 CF3 C=C-(2-NMe2)Ph H
892 5-C1 CF3 C=C-(3-NMe2)Ph H
893 5-C1 CF3 C=C-(4-NMe2)Ph H
894 5-C1 CF3 C=C-2-Pyridyl H
895 5-C1 CF3 C=C-2-Pyridyl H
896 5-C1 CF3 C=C-3-Pyridyl H
897 5-C1 CF3 C=C-4-Pyridyl H
898 5-C1 CF3 C=C-2-furanyl H
899 5-C1 CF3 C=C-3-furanyl H
900 5-C1 CF3 C=C-2-thieriyl H
901 5-C1 CF3 C=C-3-thienyl H
902 5-C1 CF3 C=C-2-oxazolyl H
903 5-C1 CF3 C=C-2-thiazolyl H
904 5-C1 CF3 C=C-4-isoxazolyl H
905 5-C1 CF3 C=C-2-imidazolyl H
906 5-C1 CF3 CH2CH2-cycPr H
907 5-C1. CF3 CH2CH2CH2CH20H H
908 5-C1 CF3 CH2CH2-CH(OH)Me H
909 5-CI CF3 CH2CHZPh H
910 5-Cl CF3 CH2CH2-(2-C1)Ph H
911 5-C1 CF3 CH2CH2-(3-Cl)Ph H
912 5-C1 CF3 CH2CH2-(4-C1)Ph H
79
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
913 5-Cl CF3 CH2CH2-(2-F)Ph H
914 5-C1 CF3 CH2CH2-(3-F)Ph H
915 5-C1 CF3 CH2CH2-(4-F)Ph H
916 5-C1 CF3 CH2CH2-(2-OH)Ph H
917 5-C1 CF3 CH2CH2-(3-OH)Ph H
918 5-C1 CF3 CH2CH2-(4-OH)Ph H
919 5-C1 CF3 CH2CHz-(2-OMe)Ph H
920 5-C1 CF3 CH2CH2-(3-OMe)Ph H
921 5-C1 CF3 CHZCH2-(4-OMe)Ph H
922 5-CI CF3 CH2CH2-(2-CN)Ph H
923 5-C1 CF3 CH2CH2-{3-CN)Ph H
924 5-C1 CF3 CH2CH2-(4-CN)Ph H
925 5-Cl CF3 CH2CH2-(2-N02)Ph H
926 5-C1 CF3 CH2CH2-(3-N02)Ph H
927 5-C1 CF3 CH2CH2-(4-N02)Ph H
928 5-C1 CF3 CH2CH2- {2-NH2 ) H
Ph
929 5-C1 CF3 CH2CH2-(3-NH2)Ph H
930 5-C1 CF3 CH2CH2-(4-NH2)Ph H
931 5-C1 CF3 CH2CH2-(2-NMe2)Ph H
932 5-C1 CF3 CH2CH2-{3-NMe2)Ph H
933 5-Cl CF3 CHZCH2-(4-NMe2)Ph H
934 5-C1 CF3 CH2CH2-2-Pyridyl H
935 5-C1 CF3 CH2CH2-3-Pyridyl H
936 5-C1 CF3 CH2CH2-4-Pyridyl H
937 5-C1 CF3 CH2CH2-2-furanyl H
938 5-C1 CF3 CH2CHZ-3-furanyl H
939 5-CZ CF3 CH2CH2-2-thienyl H
940 5-C1 CF3 CH2CH2-3-thienyl H
941 5-C1 CF3 CH2CH2-2-oxazolyl H
942 5-C1 CF3 CH2CH2-2-thiazolyl H
943 5-C1 CF3 CH2CH2-4-isoxazolyl H
944 5-Cl CF3 CH2CHZ-2-imidazolyl H
945 5-C1 CF3 C~-cycPr CH3
946 5-Cl CF3 C---.C-Ph CH3
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
947 5-Cl CF3 C=~-2-Pyridyl CH3
948 5-C1 CF3 C~-3-Pyridyl CH3
949 5-Cl CF3 C~-4-Pyridyl CH3
950 5-C1 CF3 C~-2-furanyl CH3
951 5-Cl CF3 C--_-C-3-furanyl CH3
952 5-Cl CF3 C-_.C-2-thienyl CH3
953 5-C1 CF3 C~-3-thienyl CH3
954 5-Cl CF3 C=C-cycPr CH3
955 5-C1 CF3 C=C-Ph CH3
956 5-C1 CF3 C=C-2-Pyridyl CH3
957 5-C1 CF3 C=C-3-Pyridyl CH3
958 5-C1 CF3 C=C-4-Pyridyl CH3
959 5-C1 CF3 C=C-2-furanyl CH3
960 5-Cl CF3 C=C-3-furanyl CH3
961 5-C1 CF3 C=C-2-thienyl CH3
962 5-C1 CF3 C=C-3-thienyl CH3
963 5-C1 CF3 CHZCHZ-cycPr CH3
964 5-C1 CF3 CH2CHZ-Ph CH3
965 5-C1 CF3 CH2CHZ-2-Pyridyl CH3
966 5-C1 CF3 CH2CHZ-3-Pyridyl CH3
967 5-C1 CF3 CH2CHZ-4-Pyridyl CH3
968 5-C1 CF3 CH2CH2-2-furanyl CH3
969 5-Cl CF3 CH2CHZ-3-furanyl CH3
970 5-C1 CF3 CH2CHZ-2-thienyl CH3
971 5-C1 CF3 CH2CHZ-3-thienyl CHg
972 5-C1 CF3 C~-cycPr CHZCH3
973 5-C1 CF3 C~-Ph CHZCH3
974 5-Cl CF3 C~-2-Pyridyl CH2CH3
975 5-C1 CF3 C~-3-Pyridyl CH2CH3
976 5-C1 CF3 C~-4-Pyridyl CH2CH3
977 5-C1 CF3 C~-2-furanyl CH2CH3
978 5-C1 CF3 C~-3-furanyl CH2CH3
979 5-C1 CF3 C~-2-thienyl CH2CH3
980 5-C1 CF3 C=C-3-thienyl CH2CH3
81
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
981 5-C1 CF3 C=C-cycPr CH2CH3
982 5-C1 CF3 C=C-Ph CHZCH3
983 5-C1 CF3 C=C-2-Pyridyl CH2CH3
984 5-C1 CF3 C=C-3-Pyridyl CH2CH3
985 5-C1 CF3 C=C-4-Pyridyl CH2CHg
986 5-C1 CF3 C=C-2-furanyl CH2CH3
987 5-C1 CF3 C=C-3-furanyl CH2CH3
988 5-C1 CF3 C=C-2-thienyl CH2CH3
989 5-C1 CF3 C=C-3-thienyl CH2CH3
990 5-C1 CF3 CH2CH2-cycPr CH2CH3
991 5-C1 CF3 CH2CH2-Ph CHZCH3
992 5-C1 CF3 CH2CH2-2-Pyridyl CH2CH3
993 5-C1 CF3 CH2CH2-3-Pyridyl CH2CH3
994 5-C1 CF3 CH2CH2-4-Pyridyl CH2CH3
995 5-C1 CF3 CH2CH2-2-furanyl CHZCH3
996 5-CI CFg CH2CH2-3-furanyl CH2CH3
997 5-C1 CF3 CH2CH2-2-thienyl CH2CH3
998 5-C1 CF3 CHZCH2-3-thienyl CH2CH3
999 5-F CF3 C~-cycPr H
1000 5-F CF3 C=_CCH2CH20H H
1001 5-F CF3 C~-CH(OH)Me H
1002 5-F CF3 C=C-Ph H
1003 5-F CF3 C~-(2-C1)Ph H
1004 5-F CF3 C~-(3-C1) Ph H
1005 5-F CF3 Cue- ( 4-C1 ) Ph H
1006 5-F CF3 C~-(2-F) Ph H
1007 5-F CF3 C~-(3-F)Ph H
1008 5-F CF3 C~-(4-F)Ph H
1009 5-F CF3 C~-(2-OH)Ph H
1010 5 -F CF3 Cue- ( 3 -OH ) Ph H
1011 5-F CF3 Cue- ( 4-OH) Ph H
1012 5-F CF3 C~-(2-OMe)Ph H
1013 5-F CF3 Cue- ( 3 -OMe ) H
Ph
1014 5-F CF3 C~-(4-OMe)Ph H
82
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
1015 5-F CF3 C=C-(2-CN)Ph H
1016 5-F CF3 C-C-(3-CN)Ph
1017 5-F CF3 C=C-(4-CN)Ph H
1018 5-F CF3 C=C-(2-NOZ)Ph H
1019 5-F CF3 C=C-(3-N02)Ph H
1020 S-F CF3 C=C-(4-N02)Ph H
1021 5-F CF3 C=C-(2-NHZ)Ph H
1022 5-F CF3 C=C- ( 3 -NH2 ) Ph H
1023 5-F CF3 C=C-(4-NHZ)Ph H
1024 5-F CF3 C=C-(2-NMe2)Ph H
1025 5-F CF3 C=C-(3-NMe2)Ph H
1026 5-F CF3 C=C-(4-NMe2)Ph H
1027 5-F CF3 C~-2-Pyridyl H
1028 5-F CF3 C~-2-Pyridyl H
1029 5-F CFg C~-3-Pyridyl H
1030 5-F CF3 C~-4-Pyridyl H
1031 5-F CF3 C~-2-furanyl H
1032 5-F CF3 C~-3-furanyl H
1033 5-F CF3 C~-2-thienyl H
1034 5-F CF3 C~-3-thienyl H
1035 5-F CF3 C=C-2-oxazolyi H
1036 5-F CF3 CSC-2-thiazolyl H
1037 5-F CF3 C=C-4-isoxazolyl H
1038 5-F CF3 C=C-2-imidazolyl H
1039 5-F CF3 C=C-cycPr H
1040 5-F CF3 C=CCHZCH20H H
1041 5-F CF3 C=C-CH(OH)Me H
1042 5-F CF3 C=C-Ph H
1043 S-P' CF3 C=C-(2-C1)Ph H
1044 5-F CF3 C=C-(3-C1)Ph H
1045 5-F CF3 C=C-(4-C1)Ph H
1046 5-F CF3 C=C-(2-F) Ph H
1047 5-F CF3 C=C-(3-F)Ph H
1048 5-F CF3 C=C-(4-F)Ph H
83
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1049 5-F CF3 C=C-(2-OH)Ph H
1050 5-F CF3 C=C-(3-OH)Ph H
1051 5-F CF3 C=C-(4-OH)Ph H
1052 5-F CF3 C=C-(2-OMe)Ph H
1053 5-F CF3 C=C-(3-OMe)Ph H
1054 5-F CF3 C=C-{4-OMe)Ph H
1055 5-F CF3 C=C-(2-CN)Ph H
1056 5-F CF3 C=C-(3-CN)Ph H
1057 5-F CF3 C=C-(4-CN)Ph H
1058 5-F CF3 C=C-{2-N02)Ph H
1059 5-F CF3 C=C-(3-N02)Ph H
1060 5-F CF3 C=C-(4-N02)Ph H
1061 5-F CF3 C=C- ( 2-NH2 ) Ph H
1062 5-F CF3 C=C-(3-NH2)Ph H
1063 5-F CF3 C=C-(4-NH2)Ph H
1064 5-F CF3 C=C-{2-NMe2)Ph H
1065 5-F CF3 C=C-(3-NMe2)Ph H
1066 5-F CF3 C=C-(4-NMe2)Ph H
1067 5-F CF3 C=C-2-Pyridyl H
1068 5-F CF3 C=C-2-Pyridyl H
1069 5-F CF3 C=C-3-Pyridyl H
1070 5-F CF3 C=C-4-Pyridyl H
1071 5-F CF3 C=C-2-furanyl H
1072 5-F CF3 C=C-3-furanyl H
1073 5-F CF3 C=C-2-thienyl H
1074 5-F CF3 C=C-3-thienyl H
1075 5-F CF3 C=C-2-oxazolyl H
1076 5-F CF3 C=C-2-thiazolyl H
2077 5-F CF3 C=C-4-isoxazolyl H
1078 5-F CF3 C=C-2-imidazolyl H
1079 5-F CF3 CH2CH2-cycPr H
1080 5-F CF3 CH2CH2CH2CH20H H
1081 5-F CF3 CH2CH2-CH(OH)Me H
1082 5-F CF3 CH2CH2Ph H
84
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1083 5-F CF3 CH2CH2-(2-C1}Ph H
1084 5-F CF3 CH2CH2- ( 3 -C1 ) Ph
H
1085 5-F CF3 CH2CH2-(4-C1)Ph H
1086 5-F CF3 CHZCH2-(2-F)Ph H
1087 5-F CF3 CHZCHZ-(3-F)Ph H
1088 5-F CF3 CHZCH2-(4-F)Ph H
1089 5-F CF3 CH2CH2-(2-OH)Ph H
1090 5-F CF3 CH2CH2-(3-OH)Ph H
1091 5-F CF3 CH2CH2-(4-OH)Ph H
1092 5-F CF3 CH2CH2-(2-OMe)Ph H
1093 5-F CF3 CH2CH2-(3-OMe)Ph H
1094 5-F CF3 CHZCH2-(4-OMe)Ph H
1095 5-F CF3 CH2CH2-(2-CN)Ph H
1096 5-F CF3 CH2CH2-(3-CN)Ph H
1097 5-F CF3 CH2CH2-(4-CN)Ph H
1098 5-F CF3 CH2CH2-(2-N02)Ph H
1099 5-F CF3 CH2CH2-(3-N02)Ph H
1100 5-F CF3 CH2CH2-(4-N02)Ph H
1101 5-F CF3 CH2CH2-(2-NH2)Ph H
1102 5-F CF3 CH2CH2-(3-NH2)Ph H
1103 5-F CF3 CH2CH2-(4-NH2)Ph H
1104 5-F CF3 CH2CH2-(2-NMe2)Ph H
1105 5-F CF3 CH2CH2-(3-NMe2)Ph H
1106 5-F CF3 CH2CH2-(4-NMe2)Ph H
1107 5-F CF3 CH2CH2-2-Pyridyl H
1108 5-F CF3 CH2CH2-3-Pyridyl H
1109 5-F CF3 CH2CH2-4-Pyridyl H
1110 5-F CF3 CH2CH2-2-furanyl H
1111 5-F CF3 CH2CH2-3-furanyl H
1112 5-F CF3 CH2CH2-2-thienyl H
1113 5-F CF3 CH2CH2-3-thienyl H
1114 5-F CF3 CH2CH2-2-oxazolyl H
1115 5-F CF3 CH2CH2-2-thiazolyl H
1116 5-F CF3 CH2CH2-4-isoxazolyl H
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
1117 5-F CF3 CH2CH2-2-imidazolyl H
1118 5-F CF3 C-C-cycPr CH3
1119 5-F CF3 C=C-Ph CH3
1120 5-F CF3 C-C-2-Pyridyl CH3
1121 5-F CF3 C~-3-Pyridyl CH3
1122 5-F CF3 C~-4-Pyridyl CH3
1123 5-F CF3 C~-2-furanyl CH3
1124 5-F CF3 C~-3-furanyl CH3
1125 5-F CF3 C~-2-thienyl CH3
1126 5-F CF3 C~-3-thienyl CH3
1127 5-F CF3 C=C-cycPr CH3
1128 5-F CF3 C=C-Ph CH3
1129 5-F CF3 C=C-2-Pyridyl CH3
1130 5-F CF3 C=C-3-Pyridyl CH3
1131 5-F CF3 C=C-4-Pyridyl CH3
1132 5-F CF3 C=C-2-furanyl CH3
1133 5-F CF3 C=C-3-furanyl CH3
1134 5-F CF3 C=C-2-thienyl CH3
1135 5-F CF3 C=C-3-thienyl CH3
1136 5-F CF3 CH2CH2-cycPr CH3
1137 5-F CF3 CH2CH2-Ph CH3
1138 5-F CF3 CH2CH2-2-Pyridyl CH3
1139 5-F CF3 CHZCH2-3-Pyridyl CH3
1140 5-F CF3 CH2CH2-4-Pyridyl CH3
2141 5-F CF3 CH2CH2-2-furanyl CH3
1142 5-F CF3 CH2CHz-3-furanyl CH3
1143 5-F CF3 CH2CH2-2-thienyl CH3
1144 5-F CF3 CH2CH2-3-thienyl CH3
1145 5-F CF3 C~-cycPr CH2CH3
1146 5-F CF3 C----C-Ph CH2CH3
1147 5-F CF3 C~-2-Pyridyl CH2CH3
1148 5-F CF3 C~-3-Pyridyl CH2CH3
1149 5-F CF3 C~-4-Pyridyl CH2CH3
1150 5-F CF3 C=C-2-furanyl CH2CH3
86
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1151 5-F CF3 C=C-3-furanyl CHZCH3
1152 5-F CF3 C-C-2-thienyl CH2CH3
1153 5-F CF3 C~-3-thienyl CH2CH3
1154 5-F CF3 C=C-cycPr CHZCH3
1155 5-F CF3 C=C-Ph CH2CH3
1156 5-F CF3 C=C-2-Pyridyl CH2CH3
1157 5-F CF3 C=C-3-Pyridyl CH2CH3
1158 5-F CF3 C=C-4-Pyridyl CH2CH3
1159 5-F CF3 C=C-2-furanyl CH2CH3
1160 5-F CF3 C=C-3-furanyl CH2CH3
1161 5-F CF3 C=C-2-thienyl CH2CH3
1162 5-F CF3 C=C-3-thienyl CH2CH3
1163 5-F CF3 CH2CH2-cycPr CH2CH3
1164 5-F CF3 CH2CH2-Ph CHZCH3
1165 5-F CF3 CH2CH2-2-Pyridyl CH2CH3
1166 5-F CF3 CHZCH2-3-Pyridyl CH2CH3
1167 5-F CF3 CH2CH2-4-Pyridyl CH2CH3
1168 5-F CF3 CH2CH2-2-furanyl CH2CH3
1169 5-F CF3 CH2CH2-3-furanyl CH2CH3
1170 5-F CF3 CH2CH2-2-thienyl CH2CH3
1171 5-F CF3 CH2CH2-3-thienyl CHZCH3
1172 5-C1,6-F CF3 C~-cycPr H
1173 5-C1,6-F CF3 C~-Ph H
1174 5-C1,6-F CF3 C~-2-Pyridyl H
1175 5-C1,6-F CF3 H
C~-3 -Pyridyl
1176 5-C1,6-F CF3 C=C-4-Pyridyl H
1177 5-C1,6-F CF3 C~-2-furanyl H
1178 5-C1,6-F CF3 C~-3-furanyl H
1179 5-C1,6-F CF3 C~-2-thienyl H
1180 5-C1,6-F CF3 C~-3-thienyl H
1181 5-C1,6-F CF3 C=C-cycPr H
1182 5-C1,6-F CF3 C=C-Ph H
1183 5-C1,6-F CF3 C=C-2-Pyridyl H
1184 5-C1,6-F CF3 C=C-3-Pyridyl H
87
CA 02284996 1999-09-27
WO 98/45296 PCT/US98/06733
1185 5-C1,6-F CF3 C=C-4-Pyridyl H
1186 5-C1,6-F CF3 C=C-2-furanyl H
1187 5-C1,6-F CF3 C=C-3-furanyl H
1188 5-C1,6-F CF3 C=C-2-thienyl H
1189 5-C1,6-F CF3 C=C-3-thienyl H
1190 5-C1,6-F CF3 CH2CH2-cycPr H
1191 5-C1,6-F CF3 CH2CH2-Ph H
1192 5-C1,6-F CF3 CHZCHz-2-Pyridyl H
1193 5-C1,6-F CF3 CH2CH2-3-Pyridyl H
1194 5-C1,6-F CF3 CH2CH2-4-Pyridyl H
1195 5-C1,6-F CF3 CH2CH2-2-furanyl H
1196 5-C1,6-F CF3 CH2CH2-3-furanyl H
1197 5-C1,6-F CF3 CH2CH2-2-thienyl H
1198 5-C1,6-F CF3 CH2CH2-3-thienyl H
1199 5-C1, 6-F CF3 C~-cycPr CH3
1200 5-C1,6-F CF3 C~-Ph CH3
2201 5-C1,6-F CF3 C~-2-Pyridyl CH3
1202 5-C1,6-F CF3 C~-3-Pyridyl CH3
1203 5-C1,6-F CF3 C~-4-Pyridyl CH3
1204 5-C1,6-F CF3 C~-2-furanyl CH3
1205 5-C1,6-F CF3 C~-3-furanyl CH3
1206 5-C1,6-F CF3 C~-2-thienyl CH3
1207 5-C1,6-F CF3 C~-3-thienyl CH3
1208 5-C1,6-F CF3 C=C-cycPr CH3
1209 5-C1,6-F CF3 C=C-Ph CH3
1210 5-C1,6-F CF3 C=C-2-Pyridyl CH3
1211 5-C1,6-F CF3 C=C-3-Pyridyl CH3
1212 5-C1,6-F CF3 C=C-4-Pyridyl CH3
1213 5-C1,6-F CF3 C=C-2-furanyl CH3
1214 5-C1,6-F CF3 C=C-3-furanyl CH3
1215 5-C1,6-F CF3 C=C-2-thienyl CH3
1216 5-C1,6-F CF3 C=C-3-thienyl CH3
1217 5-C1,6-F CF3 CH2CH2-cycPr CH3
1218 5-C1,6-F CF3 CH2CH2-Ph CH3
88
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98106733
1219 5-C1,6-F CF3 CHZCH2-2-Pyridyl CH3
1220 5-C1,6-F CF3 CH2CH2-3-Pyridyl CH3
1221 5-C1,6-F CF3 CH2CH2-4-Pyridyl CH3
1222 5-C1,6-F CF3 CH2CH2-2-furanyl CH3
1223 5-C1,6-F CF3 CHZCHz-3-furanyl CH3
1224 5-C1,6-F CF3 CHZCH2-2-thienyl CH3
1225 5-C1,6-F CF3 CH2CH2-3-thienyl CH3
2226 5-F,6-C1 CF3 C~-cycPr H
1227 5-F, 6-C1 CF3 C~-Ph H
1228 5-F,6-C1 CF3 C~-2-Pyridyl H
1229 5-F,6-C1 CF3 C~-3-Pyridyl
1230 5-F,6-C1 CF3 C=c-4-Pyridyl H
1231 5-F,6-C1 CF3 CSC-2-furanyl H
1232 5-F,6-C1 CF3 C~-3-furanyl H
1233 5-F,6-C1 CF3 C~-2-thienyl H
1234 5-F,6-C1 CF3 C~-3-thienyl H
1235 5-F,6-C1 CF3 C=C-cycPr H
1236 5-F,6-C1 CF3 C=C-Ph H
1237 5-F,6-C1 CF3 C=C-2-Pyridyl H
1238 5-F,6-C1 CF3 C=C-3-Pyridyl H
1239 5-F,6-C1 CF3 C=C-4-Pyridyl H
1240 5-F,6-C1 CF3 C=C-2-furanyl H
1241 5-F,6-C1 CF3 C=C-3-furanyl H
1242 5-F,6-C1 CF3 C=C-2-thienyl H
1243 5-F,6-C1 CF3 C=C-3-thienyl H
1244 5-F,6-C1 CF3 CH2CH2-cycPr H
1245 5-F,6-C1 CF3 CH2CH2-Ph H
1246 5-F,6-C1 CF3 CH2CH2-2-Pyridyl H
1247 5-F,6'-C1 CF3 CH2CH2-3-Pyridyl H
1248 5-F,6-C1 CF3 CH2CH2-4-Pyridyl H
1249 5-F,6-C1 CF3 CH2CH2-2-furanyl H
1250 5-F,6-C1 CF3 CH2CH2-3-furanyl H
1251 5-F,6-C1 CF3 CH2CH2-2-thienyl H
1252 5-F,6-C1 CF3 CH2CH2-3-thienyl H
89
CA 02284996 1999-09-27
WO 98/45276 PCT/ETS98/06733
1253 5-F,6-C1 CF3 C~-cycPr CH3
1254 5-F,6-C1 CF3 C=C-Ph CH3
1255 5-F,6-C1 CF3 C=C-2-Pyridyl CH3
1256 5-F,6-C1 CF3 C=C-3-Pyridyl CH3
1257 5-F,6-C1 CF3 C=C-4-Pyridyl CH3
1258 5-F,6-C1 CF3 C-C-2-furanyl CH3
1259 5-F,6-C1 CF3 C-C-3-furanyl CH3
1260 5-F,6-C1 CF3 C=_C-2-thienyl CH3
1261 5-F,6-C1 CF3 C~-3-thienyl CH3
1262 5-F,6-C1 CF3 C=C-cycPr CH3
1263 5-F,6-C1 CF3 C=C-Ph CH3
1264 5-F,6-C1 CF3 C=C-2-Pyridyl CH3
1265 5-F,6-C1 CF3 C=C-3-Pyridyl CH3
1266 5-F,6-Cl CF3 C=C-4-Pyridyl CH3
1267 5-F,6-C1 CF3 C=C-2-furanyl CH3
1268 5-F,6-C1 CF3 C=C-3-furanyl CH3
1269 5-F,6-C1 CF3 C=C-2-thienyl CH3
1270 5-F,6-C1 CF3 C=C-3-thienyl CH3
1271 5-F,6-C1 CF3 CH2CH2-cycPr CH3
1272 5-F,6-C1 CF3 CH2CH2-Ph CHg
1273 5-F,6-CI CF3 CH2CH2-2-Pyridyl CH3
1274 5-F,6-CI CF3 CHZCH2-3-Pyridyl CH3
1275 5-F,6-C1 CF3 CHZCH2-4-Pyridyl CH3
1276 5-F,6-C1 CF3 CH2CH2-2-furanyl CH3
1277 5-F,6-C1 CF3 CH2CH2-3-furanyl CH3
1278 5-F,6-Cl CF3 CH2CH2-2-thienyl CH3
1279 5-F,6-C1 CF3 CH2CH2-3-thienyl CH3
1280 6-C1,8-F CF3 C~-cycPr H
1281 6-C1,8-F CF3 C=C-Ph H
1282 6-C1,8-F CF3 C~-2-Pyridyl H
1283 6-C1,8-F CF3 C~-3-Pyridyl H
1284 6-C1,8-F CF3 C~-4-Pyridyl H
1285 6-C1,8-F CF3 C~-2-furanyl H
1286 6-C1,8-F CF3 C~-3-furanyl H
,.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1287 6-C1,8-F CF3 C~-2-thienyl H
1288 6-C1,8-F CF3 C~-3-thienyl H
1289 6-C1,8-F CF3 C=C-cycPr H
' 1290 6-C1,8-F CF3 C=C-Ph H
1291 6-C1,8-F CF3 C=C-2-Pyridyl H
1292 6-C1,8-F CF3 C=C-3-Pyridyl H
1293 6-C1,8-F CF3 C=C-4-Pyridyl H
1294 6-C1,8-F CF3 C=C-2-furanyl H
1295 6-C1,8-F CF3 C=C-3-furanyl H
1296 6-C1,8-F CF3 C=C-2-thienyl H
1297 6-C1,8-F CF3 C=C-3-thienyl H
1298 6-C1,8-F CF3 CH2CH2-cycPr H
1299 6-C1,8-F CF3 CH2CH2-Ph H
1300 6-C1,8-F CF3 CH2CH2-2-Pyridyl H
1301 6-C1,8-F CF3 CHZCH2-3-Pyridyl H
1302 6-C1,8-F CF3 CH2CH2-4-Pyridyl H
1303 6-C1,8-F CF3 CH2CH2-2-furanyl H
1304 6-C1,8-F CF3 CH2CH2-3-furanyl H
1305 6-C1,8-F CF3 CH2CH2-2-thienyl H
1306 6-C1,8-F CF3 CH2CH2-3-thienyl H
1307 6-C1,8-F CF3 C~-cycPr CH3
1308 6-C1,8-F CF3 C=C-Ph CH3
1309 6-C1,8-F CF3 C~-2-Pyridyl CH3
1310 6-C1,8-F CF3 C~-3-Pyridyl CH3
1311 6-C1,8-F CF3 C~-4-Pyridyl CH3
1312 6-C1,8-F CF3 C~-2-furanyl CH3
1313 6-C1,8-F CF3 C~-3-furanyl CH3
1314 6-CI,B-F CF3 C~-2-thienyl CH3
1315 6-C1,8-F CF3 C~-3-thienyl CH3
1316 6-C1,8-F CF3 C=C-cycPr CH3
1317 6-C1,8-F CF3 C=C-Ph CH3
1318 6-C1,8-F CF3 C=C-2-Pyridyl CH3
1319 6-C1,8-F CF3 C=C-3-Pyridyl CH3
1320 6-C1,8-F CF3 C=C-4-Pyridyl CH3
91
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
1321 6-C1,8-F CF3 C=C-2-furanyl CH3
1322 6-C1,8-F CF3 C=C-3-furanyl CH3
1323 6-C1,8-F CF3 C=C-2-thienyl CH3
1324 6-C1,8-F CF3 C=C-3-thienyl CH3
1325 6-C1,8-F CF3 CHZCH2-cycPr CH3
1326 6-C1,8-F CF3 CH2CH2-Ph CH3
1327 6-C1,8-F CF3 CH2CH2-2-Pyridyl CH3
1328 6-C1,8-F CF3 CH2CH2-3-Pyridyl CH3
1329 6-C1,8-F CF3 CH2CH2-4-Pyridyl CH3
1330 6-C1,8-F CF3 CH2CH2-2-furanyl CH3
1331 6-C1,8-F CF3 CH2CH2-3-furanyl CH3
1332 6-C1,8-F CF3 CH2CH2-2-thienyl CH3
1333 6-C1,8-F CF3 CH2CH2-3-thienyl CH3
1334 6-CH3 CF3 C~-cycPr H
1335 6-CH3 CF3 C~-Ph H
1336 6-CH3 CF3 C~-2-Pyridyl H
1337 6-CH3 CF3 C~-3-Pyridyl H
1338 6-CH3 CF3 C~-4-Pyridyl H
1339 6-CH3 CF3 C~-2-furanyl H
1340 6-CH3 CF3 C~-3-furanyl H
1341 6-CH3 CF3 C~-2-thienyl H
1342 6-CH3 CF3 C~-3-thienyl H
1343 6-CH3 CF3 C=C-cycPr H
1344 6-CH3 CF3 C=C-Ph H
1345 6-CH3 CF3 C=C-2-Pyridyl H
1346 6-CH3 CF3 C=C-3-Pyridyl H
1347 6-CH3 CF3 C=C-4-Pyridyl H
1348 6-CH3 CF3 C=C-2-furanyl H
1349 6-CH3 CF3 C=C-3-furanyl H
1350 6-CH3 CF3 C=C-2-thienyl H
1351 6-CH3 CF3 C=C-3-thienyl H
1352 6-CH3 CF3 CH2CH2-cycPr H
1353 6-CH3 CF3 CH2CH2-Ph H
1354 6-CH3 CF3 CH2CH2-2-Pyridyl H
92
CA 02284996 1999-09-27
WO 98145276 PCT/US98/06733
1355 5-CH3 CF3 CHZCH2-3-Pyridyl H
1356 6-CH3 CF3 CH2CH2-4-Pyridyl H
1357 6-CH3 CF3 CHZCH2-2-furanyl H
1358 6-CH3 CF3 CH2CH2-3-furanyl H
1359 6-CH3 CF3 CH2CH2-2-thienyl H
1360 6-CH3 CF3 CH2CH2-3-thienyl H
1361 6-CH3 CF3 C--_.C-cycPr CH3
1362 6-CH3 CF9 C=C-Ph CH3
1363 6-CH3 CF3 CSC-2-Pyridyl CH3
1364 6-CH3 CF3 C~-3-Pyridyl CH3
1365 6-CH3 CF3 C~-4-Pyridyl CH3
1366 6-CH3 CF3 C~-2-furanyl CH3
1367 6-CH3 CF3 C~-3-furanyl CH3
1368 6-CH3 CF3 C~-2-thienyl CH3
1369 6-CH3 CF3 C~-3-thienyl CH3
1370 6-CH3 CF3 C=C-cycPr CH3
1371 6-CH3 CF3 C=C-Ph CH3
1372 6-CH3 CF3 C=C-2-Pyridyl CH3
1373 6-CH3 CF3 C=C-3-Pyridyl CH3
1374 6-CH3 CF3 C=C-4-Pyridyl CH3
1375 6-CH3 CF3 C=C-2-furanyl CH3
1376 6-CH3 CF3 C=C-3-furanyl CH3
1377 6-CH3 CF3 C=C-2-thienyl CH3
1378 6-CH3 CF3 C=C-3-thienyl CHg
1379 6-CH3 CF3 CH2CH2-cycPr CH3
1380 6-CH3 CF3 CH2CH2-Ph CH3
1381 6-CH3 CF3 CH2CH2-2-Pyridyl CH3
1382 6-CH3 CF3 CHZCH2-3-Pyridyl CH3
1383 6-CH3 CF3 CHZCH2-4-Pyridyl CH3
1384 6-CH3 CF3 CH2CH2-2-furanyl CH3
1385 6-CH3 CF3 CH2CH2-3-furanyl CH3
1386 6-CH3 CF3 CH2CH2-2-thienyl CH3
1387 6-CH3 CF3 CH2CH2-3-thienyl CH3
1388 6-COCH3 CF3 C=C-cycPr H
93
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1389 6-COCH3 CF3 C=C-Ph H
1390 6-COCH3 CF3 C=C-2-Pyridyl H
1391 6-COCH3 CF3 C~-3-Pyridyl H
1392 6-COCH3 CF3 C~-4-Pyridyl H
1393 6-COCH3 CF3 C=C-2-furanyl H
1394 6-COCH3 CF3 C~-3-furanyl H
1395 6-COCH3 CF3 C~-2-thienyl H
1396 6-COCH3 CF3 C~-3-thienyl H
1397 6-NH2 CF3 C~-cycPr H
1398 6-NH2 CF3 C-C-Ph H
1399 6-NH2 CF3 C~-2-Pyridyl H
1400 6-NH2 CF3 CSC-3-Pyridyl H
1401 6-NH2 CF3 C=C-4-Pyridyl H
1402 6-NH2 CF3 C~-2-furanyl H
1403 6-NH2 CF3 C=C-3-furanyl H
1404 6-NH2 CF3 C~-2-thienyl H
1405 6-NH2 CF3 C~-3-thienyl H
1406 6-NMe2 CF3 C~-cycPr H
1407 6-NMe2 CF3 C=C-Ph H
1408 6-NMe2 CF3 C~-2-Pyridyl H
2409 6-NMe2 CF3 CSC-3-Pyridyl H
1410 6-NMe2 CF3 C~-4-Pyridyl H
1411 6-NMe2 CF3 C~-2-furanyl H
1412 6-NMe2 CF3 C~-3 -furanyl H
1413 6-NMe2 CF3 C~-2-thienyl H
1414 6-NMe2 CF3 C~-3-thienyl H
1415 7-C1 CF3 C~-cycPr H
1416 7-C1 CF3 C=-C-Ph H
1417 7-C3 CF3 C~-2-Pyridyl H
1418 7-C1 CF3 C~-3-Pyridyl H
1419 7-C1 CF3 C~-4-pyridyl H
1420 7-C1 CF3 C~-2-furanyl H
1421 7-C1 CF3 C=C-3-furanyl H
1422 7-C1 CF3 C=C-2-thienyl H
94
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1423 7-C1 CF3 C~-3-thienyl
1424 5,6-OCH20- CF3 C~-cycPr H
1425 5,6-OCH20- CF3 C-CCHZCHZOH H
1426 5,6-OCH20- CF3 C=C-CH(OH)Me H
1427 5,6-OCH20- CF3 C=C-Ph H
1428 5,6-OCH20- CF3 C=C-(2-C1)Ph H
1429 5,6-OCH20- CF3 C=C-(3-C1)Ph H
1430 5,6-OCH20- CF3 C-C-(4-C1)Ph H
1431 5 , 6-OCH20- CF3 Cue- ( 2 -F ) Ph H
1432 5,6-OCH20- CF3 C~-(3-F)Ph H
1433 5,6-OCH20- CF3 C~-(4-F)Ph H
1434 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1435 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1436 5,6-OCH20- CF3 C~-(4-OH)Ph H
1437 5,6-OCH20- CF3 C~-(2-OMe)Ph H
1438 5,6-OCH20- CF3 C~-(3-OMe)Ph H
1439 5,6-OCH20- CF3 C~-(4-OMe)Ph H
1440 5,6-OCH20- CF3 C~-(2-CN)Ph H
1441 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1442 5,6-OCH20- CF3 C~-(4-CN)Ph H
1443 5 , 6-OCH20- CF3 Cue- ( 2-N02 ) Ph H
1444 5 , 6-OCH20- CF3 Cue- ( 3 -N02 ) H
Ph
1445 5,6-OCH20- CF3 C~-(4-N02)Ph H
1446 5 , 6-OCH20- CF3 C=C_ ( 2 _~2 ) ph H
1447 5 , 6-OCH20- CF3 Cue- ( 3 -NH2 )
Ph
1448 5,6-OCH20- CF3 C~-(4-NH2)Ph H
1449 5,6-OCH20- CF3 C~-(2-NMe2)Ph H
1450 5,6-OCH20- CF3 C-C-(3-NMe2)Ph H
1451 5,6-OCH20- CF3 C-C-(4-NMe2)Ph H
1452 5,6-OCH20- CF3 C~-2-Pyridyl H
1453 5,6-OCH20- CF3 C~-2-pyridyl H
1454 5,6-OCH20- CF3 C~-3-Pyridyl H
1455 5,6-OCH20- CF3 C~-4-Pyridyl H
1456 5,6-OCH20- CF3 C~-2-furanyl H
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1457 5,6-OCH20- CF3 C-C-3-furanyl H
1458 5,6-OCH20- CF3 C=C-2-thienyl H
1459 5,6-OCHZO- CF3 C-C-3-thienyl H
1460 5,6-OCH20- CF3 C~-2-oxazolyl H
1461 5,6-OCH20- CF3 C=C-2-thiazolyl H
1462 5,6-OCH20- CF3 C_C-4-isoxazolyl H
1463 5, 6-OCH20- CF3 C~-2-imidazolyl H
1464 6-COCH3 CF3 C=C-cycPr H
1465 6-COCH3 CF3 C=C-Ph H
1466 6-COCH3 CF3 C=C-2-Pyridyl H
1467 6-COCH3 CF3 C=C-3-Pyridyl H
1468 6-COCH3 CF3 C=C-4-Pyridyl H
1469 6-COCH3 CF3 C=C-2-furanyl H
1470 6-COCH3 CF3 C=C-3-furanyl H
1471 6-COCH3 CF3 C=C-2-thienyl H
1472 6-COCH3 CF3 C=C-3-thienyl H
1473 6-NH2 CF3 C=C-cycPr H
1474 6-NH2 CF3 C=C-Ph H
1475 6-NHZ CF3 C=C-2-Pyridyl H
1476 6-NHZ CF3 C=C-3-Pyridyl H
1477 6-NH2 CF3 C=C-4-Pyridyl H
1478 6-NH2 CF3 C=C-2-furanyl H
1479 6-NH2 CF3 C=C-3-furanyl H
1480 6-NH2 CF3 C=C-2-thienyl H
1481 6-NH2 CF3 C=C-3-thienyl H
1482 6-NMe2 CF3 C=C-cycPr H
1483 6-NMe2 CF3 C=C-Ph H
1484 6-NMe2 CF3 C=C-2-Pyridyl H
1485 6-NMe2 CF3 C=C-3-Pyridyl H
1486 6-NMe2 CF3 C=C-4-Pyridyl H
1487 6-NMe2 CF3 C=C-2-furanyl H
1488 6-NMe2 CF3 C=C-3-furanyl H
1489 6-NMe2 CF3 C=C-2-thienyl H
1490 6-NMe2 CF3 C=C-3-thienyl H
96
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1491 7-C1 CF3 C=C-cycPr H
1492 7-C1 CF3 C=C-Ph H
1493 7-Cl CF3 C=C-2-Pyridyl H
1494 7-CI CF3 C=C-3-Pyridyl H
1495 7-C1 CF3 C=C-4-Pyridyl H
1496 7-C1 CF3 C=C-2-furanyl H
1497 7-C1 CF3 C=C-3-furanyl H
1498 7-C1 CF3 C=C-2-thienyl H
1499 7-C1 CF3 C=C-3-thienyl H
1500 5,6-OCH20- CF3 C=C-cycPr H
1501 5,6-OCH20- CF3 C=CCH2CHZOH H
1502 5,6-OCH20- CF3 C=C-CH(OH)Me H
1503 5,6-OCH20- CF3 C=C-Ph H
1504 5,6-OCH20- CF3 C=C-(2-C1}Ph H
1505 5,6-OCH20- CF3 C=C-(3-C1)Ph H
1506 5,6-OCH20- CF3 C=C-(4-C1)Ph H
1507 5,6-OCH20- CF3 C=C-(2-F)Ph H
1508 5,6-OCH20- CF3 C=C-(3-F)Ph H
1509 5,6-OCH20- CF3 C=C-(4-F)Ph H
1510 5,6-OCH20- CF3 C=C-(2-OH)Ph H
1511 5,6-OCH20- CF3 C=C-(3-OH)Ph H
1512 5,6-OCH20- CF3 C=C-(4-OH)Ph H
1513 5,6-OCH20- CF3 C=C-(2-OMe)Ph H
1514 5,6-OCH20- CF3 C=C-(3-OMe)Ph H
1515 5,6-OCH20- CF3 C=C-(4-OMe)Ph H
1516 5,6-OCH20- CF3 C=C-(2-CN)Ph H
1517 5,6-OCH20- CF3 C=C-(3-CN)Ph H
1518 5,6-OCH20- CF3 C=C-(4-CN)Ph H
1519 5,6-OCH20- CF3 C=C-(2-N02)Ph H
1520 5,6-OCH20- CF3 C=C-(3-N02)Ph H
1521 5,6-OCH20- CF3 C=C-(4-N02)Ph H
1522 5,6-OCH20- CF3 C=C-(2-NH2)Ph H
1523 5,6-OCH20- CF3 C=C-(3-NH2)Ph H
1524 5,6-OCH20- CF3 C=C-(4-NH2)Ph H
97
CA 02284996 1999-09-27
WO 98/45276 PCT/CJS98/06733
1525 5,6-OCH20- CF3 C=C-(2-NMe2)Ph H
1526 5,6-OCH20- CF3 C=C-(3-NMe2)Ph H
1527 5,6-OCH20- CF3 C=C-(4-NMe2)Ph H
1528 5,6-OCH20- CF3 C=C-2-Pyridyl H
1529 5,6-OCH20- CF3 C=C-2-Pyridyl H
1530 5,6-OCH20- CF3 C=C-3-Pyridyl H
1531 5,6-OCH20- CF3 C=C-4-Pyridyl H
1532 5,6-OCH20- CF3 C=C-2-furanyl H
1533 5,6-OCH20- CF3 C=C-3-furanyl H
1534 5,6-OCH20- CF3 C=C-2-thienyl H
1535 5,6-OCH20- CF3 C=C-3-thienyl H
1536 5,6-OCH20- CF3 C=C-2-oxazolyl H
1537 5,6-OCH20- CF3 C=C-2-thiazolyl H
1538 5,6-OCH20- CF3 C=C-4-isoxazolyl H
1539 5,6-OCH20- CF3 C=C-2-imidazolyl H
1540 5,6-OCH20- CF3 CHZCH2-cycPr H
1541 5,6-OCH20- CF3 CH2CH2CH2CH20H H
1542 5,6-OCH20- CF3 CH2CH2-CH(OH)Me H
1543 5,6-OCH20- CF3 CH2CH2Ph H
1544 5,6-OCH20- CF3 CH2CH2-(2-C1)Ph H
1545 5,6-OCH20- CF3 CH2CH2-(3-C1)Ph H
1546 5,6-OCH20- CF3 CH2CH2-(4-C1}Ph H
1547 5,6-OCH20- CF3 CH2CH2-(2-F)Ph H
1548 5,6-OCH20- CF3 CH2CH2-(3-F)Ph H
1549 5,6-OCHZO- CF3 CH2CH2-(4-F)Ph H
1550 5, 6-OCHZO- CF3 CH2CH2- (2-OH} Ph H
1551 5,6-OCH20- CF3 CH2CH2-(3-OH)Ph H
1552 5,6-OCH20- CF3 CH2CH2-(4-OH}Ph H
1553 5,6-OCH20- CF3 CH2CH2-(2-OMe)Ph H
1554 5,6-OCH20- CF3 CH2CH2-(3-OMe)Ph H
1555 5,6-OCH20- CF3 CH2CH2-(4-OMe)Ph H
1556 5,6-OCH20- CFg CH2CH2-(2-CN)Ph H
1557 5,6-OCH20- CF3 CH2CH2-(3-CN)Ph H
1558 5,6-OCH2O- CF3 CH2CH2-(4-CN)Ph H
98
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1559 5,6-OCH20- CF3 CH2CH2-(2-N02)Ph H
1560 5,6-OCH20- CF3 CH2CH2-(3-N02)Ph H
1561 5,6-OCH20- CF3 CH2CH2-(4-N02)Ph H
1562 5,6-OCH20- CF3 CHZCH2-(2-NH2)Ph H
1563 5,6-OCH20- CF3 CH2CH2-(3-NH2)Ph H
1564 5,6-OCH20- CF3 CH2CH2-(4-NH2)Ph H
1565 5,6-OCH20- CF3 CHZCH2-(2-NMe2)Ph H
1566 5,6-OCH20- CF3 CH2CH2-(3-NMe2)Ph H
1567 5,6-OCH20- CF3 CH2CH2-(4-NMe2)Ph H
1568 5,6-OCH20- CF3 CH2CH2-2-Pyridyl H
1569 5,6-OCH20- CF3 CH2CH2-3-Pyridyl H
1570 5,6-OCH20- CF3 CH2CH2-4-Pyridyl H
1571 5,6-OCH20- CF3 CH2CH2-2-furanyl H
15?2 5,6-OCH20- CF3 CH2CH2-3-furanyl H
1573 5,6-OCH20- CF3 CH2CH2-2-thienyl H
1574 5,6-OCH20- CF3 CH2CH2-3-thienyl H
1575 5,6-OCH20- CF3 CHZCHz-2-oxazolyl H
1576 5,6-OCH20- CF3 CH2CH2-2-thiazolyl H
1577 5,6-OCH20- CF3 CH2CH2-4-isoxazolyl H
1578 5,6-OCH20- CF3 CH2CH2-2-imidazolyl H
1579 5,6-OCH20- CF3 C~-cycPr CH3
1580 5,6-OCH20- CF3 C=C-Ph CH3
15$1 5,6-OCH O CF
2 - 3 C~-2-Pyridyl CH3
1582 5,6-OCH20- CF3 C~-3-Pyridyl CH3
1583 5,6-OCH20- CF3 C~-4-Pyridyl CH3
1584 5, 6-OCH20- CF3 C~-2-furanyl CH3
1585 5,6-OCH20- CF3 C~-3-furanyl CH3
1586 5,6-OCH20- CF3 C~-2-thienyl CH3
1587 5,6-OCH20- CF3 C~-3-thienyl CH3
1588 5,6-OCH20- CF3 C=C-cycPr CH3
1589 5,6-OCH20- CF3 C=C-Ph CH3
1590 5,6-OCH20- CF3 C=C-2-Pyridyl CH3
1591 5,6-OCH20- CF3 C=C-3-Pyridyl CH3
1592 5,6-OCH20- CF3 C=C-4-Pyridyl CH3
99
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
1593 5,6-OCH20- CF3 C=C-2-furanyl CEi3
1594 5,6-OCHZO- CF3 C=C-3-furanyl CH3
1595 5,6-OCH20- CF3 C=C-2-thienyl CH3
1596 5,6-OCH20- CF3 C=C-3-thienyl CH3
1597 5,6-OCH20- CF3 CH2CH2-cycPr CH3
1598 5,6-OCH20- CF3 CH2CH2-Ph CH3
1599 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH3
2600 5,6-OCH20- CF3 CH2CH2-3-Pyridyl CH3
1601 5,6-OCHZO- CF3 CH2CH2-4-Pyridyl CH3
1602 5,6-OCH20- CF3 CH2CHZ-2-furanyl CH3
1603 5,6-OCH20- CF3 CH2CH2-3-furanyl CH3
1604 5,6-OCH20- CF3 CH2CH2-2-thienyl CH3
1605 5,6-OCH20- CF3 CH2CH2-3-thienyl CH3
1606 5,6-OCH20- CF3 C~-cycPr CH2CH3
1607 5,6-OCH20- CF3 C~-Ph CH2CH3
1608 5,6-OCH20- CF3 C~-2-Pyridyl CH2CH3
1609 5,6-OCH20- CF3 C~-3-Pyridyl CH2CH3
1610 5 , 6-OCH20- CF3 C~-4-Pyridyl CH2CH3
1611 5,6-OCH20- CF3 C~-2-furanyl CH2CH3
1612 5,6-OCH20- CF3 C~-3-furanyl CH2CH3
1613 5,6-OCH20- CF3 C~-2-thienyl CH2CH3
1614 5,6-OCH20- CF3 C~-3-thienyl CH2CH3
1615 5,6-OCH20- CF3 C=C-cycPr CH2CH3
1616 5,6-OCHZO- CF3 C=C-Ph CHZCH3
1617 5,6-OCH20- CF3 C=C-2-Pyridyl CH2CH3
1618 5,6-OCH20- CF3 C=C-3-Pyridyl CHZCH3
1619 5,6-OCH20- CF3 C=C-4-Pyridyl CH2CH3
1620 5,6-OCH20- CF3 C=C-2-furanyl CH2CH3
1621 5,6-OCHZO- CF3 C=C-3-furanyl CH2CH3
1622 5,6-OCH20- CF3 C=C-2-thienyl CHZCH3
1623 5,6-OCH20- CF3 C=C-3-thienyl CH2CH3
1624 5,6-OCH20- CF3 CH2CH2-cycPr CH2CH3
1625 5,6-OCH20- CF3 CH2CH2-Ph CH2CH3
1626 5,6-OCH20- CF3 CH2CH2-2-Pyridyl CH2CH3
100
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
1627 5,6-OCH20- CF3 CH2CH2-3-Pyridyl CH2CH3
1628 5,6-OCH20- CF3 CHZCH2-4-Pyridyl CH2CH3
1629 5,6-OCH20- CF3 CH2CH2-2-furanyl CHZCH3
1630 5,6-OCH20- CF3 CH2CH2-3-furanyl CH2CH3
1631 5,6-OCH20- CF3 CH2CH2-2-thienyl CH2CH3
1632 5,6-OCH20- CF3 CH2CH2-3-thienyl CHZCH3
*Unless otherwise indicated, stereochemisty is (+/-).
101
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
Table 3*
i z
R ~ w N,Rs
~ N ~O
H
Ex. R3 R1 R2 R8
#
1 6-C1 CF3 C~-Pr H
2 6-C1 CF3 C=C-Bu H
3 6-C1 CF3 C=c-iBu H
4 6-C1 CF3 C~-tBu H
6-C1 CF3 C~-Me H
6 6-CI CF3 CH2CH2CH2CHZCH3 H
7 6-C1 CF3 CH2CH2CH(CH3)2 H
8 6-C1 CF3 CHZCH2CH2CH3 H
9 6-C1 CF3 CH2CH2CH3 H
6-C1 CF3 CH2CH2-tBu H
11 6-C1 CF3 CH2C=C-CH3 H
12 6-C1 CF3 CHIC---C-CH2CH3 H
13 6-C1 CF3 C~-iPr CH3
14 6-C1 CF3 CSC-Pr CH3
6-C1 CF3 C~-Bu CH3
16 6-C1 CF3 C=C-iBu CH3
17 6-C1 CF3 C~-tBu CH3
18 6-C1 CF3 C---C-Et CH3
19 6-CI CF3 C~-Me CH3
6-Cl CF3 CH2C=C-CH3 CH3
21 6-C1 CF3 CH2C---C--CH2CH3 CH3
22 6-C1 CF3 CH2CH2CH(CH3)2 CHg
23 6-C1 CF3 CH2CH2CHZCH3 CH3
24 6-C1 CF3 CH2CH2CH3 CH3
6-C1 CF3 CH2CH2-tBu CH3
26 6-C1 CF3 C.=C-iPr CH2CH3
27 6-C1 CF3 C=C-Pr CH2CH3
28 6-CZ CF3 C~-Bu CH2CH3
102
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
29 6-CZ CF3 C=C-iBu CH2CH3
30 6-C1 CF3 C-C-tBu CH2CH3
31 6-C1 CF3 C=C-Et CH2CH3
32 6-CI CF3 C---C-Me CHZCH3
33 6-C1 CF3 CH2C---C-CH3 CH2CH3
34 6-C1 CF3 CH2C=C-CH2CH3 CH2CH3
35 6-C1 CF3 CH2CHZCH(CH3)2 CHzCH3
36 6-C1 CF3 CH2CH2CH2CH3 CH2CH3
37 6-C1 CF3 CH2CH2CH3 CH2CH3
38 6-C1 CF3 CH2CH2-tBu CH2CH3
39 6-Me0 CF3 C---C-Pr H
40 6-Me0 CF3 C=C-Bu H
41 6-Me0 CF3 C=C-iBu H
42 6-Me0 CF3 C~-tBu H
43 6-Me0 CF3 C=C-Et H
44 6-Me0 CF3 C=C-Me H
45 6-Me0 CF3 CH2C-C-CH3 H
46 6-Me0 CF3 CH2C=C-CH2CH3 H
47 6-Me0 CF3 CH2CH2CH2CH2CH3 H
48 6-Me0 CF3 CH2CH2CH(CH3)2 H
49 6-Me0 CF3 CH2CH2CH2CH3 H
50 6-Me0 CF3 CH2CHZCH3 H
51 6-Me0 CF3 CHZCH2-tBu H
52 6-Me0 CF3 CH2C=C-CH3 H
53 6-Me0 CF3 CH2C~-CH2CH3 H
54 6-Me0 CF3 C=C-iPr CH3
55 6-Me0 CF3 C=~-pr CH3
56 6-Me0 CF3 C~-Bu CH3
57 6-Me0 CF3 C-C-iBu CH3
58 6-Me0 CF3 C=C-tBu CH3
59 6-Me0 CF3 C=C-Et CH3
60 6-Me0 CF3 CSC-Me CH3
61 6-Me0 CF3 CH2C=C-CH3 CH3
62 6-Me0 CF3 CH2C=C-CHZCH3 CH3
103
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
63 6-Me0 CF3 CH2CH2CH(CH3)2 CH3
64 6-Me0 CF3 CHZCH2CH2CH3 CH3
65 6-Me0 CF3 CH2CH2CH3 CH3
66 6-Me0 CF3 CH2CH2-tBu CH3
67 6-Me0 CF3 C=C-iPr CH2CH3
68 6-Me0 CF3 C~-Pr CH2CH3
69 6-Me0 CF3 C-C-Bu CH2CH3
70 6-Me0 CF3 C~-iBu CH2CH3
71 6-Me0 CF3 C~-tBu CH2CH3
72 6-Me0 CF3 C~-Et CH2CH3
73 6-Me0 CF3 C~-Me CH2CH3
74 6-Me0 CFg CHIC-C-CH3 CH2CH3
75 6-Me0 CF3 CH2C=C-CH2CH3 CH2CH3
76 6-Me0 CF3 CH2CH2CH(CH3)2 CH2CH3
77 6-Me0 CFg CH2CHZCH2CH3 CH2CH3
78 6-Me0 CF3 CH2CHZCH3 CH2CH3
79 6-Me0 CF3 CH2CH2-tBu CH2CH3
84 5,6-diF CF3 C=_C-Pr H
81 5 , 6-diF CF3 C~-Bu H
82 5 , 6-diF CF3 C~-iBu H
83 5,6-diF CF3 C-C-tBu H
84 5,6-diF CF3 C=C-Me H
85 5,6-diF CF3 CH2C=C-CH3 H
86 5,6-diF CF3 CH2C=C-CH2CH3 H
87 5,6-diF CF3 CH2CH2CH2CH2CH3 H
88 5,6-diF CF3 CH2CHZCH3 H
89 5,6-diF CF3 CH2CH2-tBu H
90 5,6-diF CF3 C~-iPr CH3
91 5,6-diF CF3 C~-Pr CH3
92 5,6-diF CF3 C~-Bu CH3
93 5,6-diF CF3 C~-iBu CH3
94 5,6-diF CF3 C~-tBu CH3
95 5,6-diF CF3 C~-Et CH3
96 5,6-diF CF3 C=C-Me CH3
104
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
97 5,6-diF CF3_ C=C-Ph CH3
98 5,6-diF CF3 CH2C=C-CH3 CH3
99 5,6-diF CF3 CH2C=C-CH2CH3 CH3
100 5,6-diF CF3 CH2CH2CH(CH3)2 CH3
101 5,6-diF CF3 CH2CH2CHZCH3 CH3
102 5,6-diF CF3 CHZCH2CH3 CH3
103 5,6-diF CF3 CH2CH2-tBu CH3
104 5,6-diF CF3 C=C-iPr CH2CH3
105 5,6-diF CF3 C~-Pr CH2CH3
106 5,6-diF CF3 C=C-Bu CH2CH3
107 5,6-diF CF3 C--_C-iBu CH2CH3
108 5,6-diF CF3 C=C-tBu CH2CH3
109 5,6-diF CF3 C=C-Et CH2CH3
110 5,6-diF CF3 C=C-Me CH2CH3
111 5,6-diF CF3 CHIC=C-CH3 CH2CH3
112 5,6-diF CF3 CH2C=C-CH2CH3 CH2CH3
113 5,6-diF CF3 CH2CH2CH(CH3)2 CHZCH3
114 5,6-diF CF3 CH2CH2CH2CH3 CH2CH3
115 5,6-diF CF3 CH2CH2CH3 CH2CH3
116 5,6-diF CF3 CH2CH2-tBu CH2CH3
117 6-F CF3 C=C-Pr H
118 6-F CF3 C~-Bu H
119 6-F CF3 C=C-iBu H
120 6-F CF3 C=_C-tBu H
121 6-F CF3 C=C-Me H
122 6-F CF3 CHIC---C-CH2CH3 H
123 6-F CF3 CH2CH2CHZCH2CH3 H
124 6-F CF3 CH2CHZCH3 H
125 6-F CF3 CH2CH2-tBu H
126 6-F CF3 C~-iPr CH3
127 6-F CF3 C~-Pr CH3
128 6-F CF3 C~-Bu CH3
129 6-F CF3 C=C-iBu CH3
130 6-F CF3 C=_C-tBu CH3
105
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
131 6-F CF3 C=C-Et CH3
132 6-F CF3 C=C-Me CH3
133 6-F CF3 CH2C---C-CH3 CH3
134 6-F CF3 CHIC=C-CH2CH3 CH3
135 6-F CF3 CH2CH2CH(CH3)2 CH3
136 6-F CF3 CH2CH2CH2CH3 CH3
137 6-F CF3 CH2CH2CH3 CH3
138 6-F CF3 CH2CH2-tBu CH3
139 6-F CF3 C~-iPr CH2CH3
140 6-F CF3 C~-Pr CH2CH3
141 6-F CF3 C=C-Bu CH2CH3
I42 6-F CF3 C=C-iBu CH2CH3
143 6-F CF3 CSC-tBu CH2CH3
244 6-F CF3 C=C-Et CH2CH3
145 6-F CF3 C=C-Me CH2CH3
146 6-F CF3 CHIC=C-CH3 CH2CH3
147 6-F CF3 CH2C=C-CH2CH3 CH2CH3
148 6-F CF3 CH2CH2CH(CH3)2 CH2CH3
149 6-F CF3 CH2CHZCH2CH3 CH2CH3
150 6-F CF3 CH2CH2CH3 CH2CH3
151 6-F CF3 CH2CH2-tBu CH2CH3
152 5-C1 CF3 C~-iPr H
153 5-C1 CF3 C~-Pr H
154 5-C1 CF3 C~-Bu H
155 5-C1 CF3 C--_.C-iBu H
156 5-C1 CF3 C~-tBu H
I57 5-C1 CF3 C=-C-Et H
158 5-Cl CF3 C~-Me H
159 5-C1 CF3 CH2C=C-CH3 H
160 5-Cl CF3 CH2C=C-CH2CH3 H
161 5-C1 CF3 CH2CH2CH2CHZCH3 H
162 5-C1 CF3 CH2CH2CH(CH3)2 H
163 5-C1 CF3 CH2CH2CH2CH3 H
164 5-C1 CF3 CHZCH2CH3 H
106
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
165 5-C1 CF3 CHZCH2-tBu H
166 5-C1 CF3 C=C-iPr CH3
167 5-C1 CF3 C=C-Pr CH3
268 5-C1 CF3 C-C-Bu CH3
169 5-C1 CF3 C-C-iBu CH3
170 5-C1 CF3 C=C-tBu CH3
171 5-C1 CF3 C=C-Et CH3
172 5-C1 CF3 C~-Me CH3
173 5-C1 CF3 CHIC=C-CH3 CH3
174 5-C1 CF3 CHZC--_C-CHZCH3 CH3
175 5-C1 CF3 CH2CH2CH(CH3)2 CH3
176 5-CI CF3 CH2CH2CH2CH3 CH3
177 5-C1 CF3 CH2CH2CH3 CH3
178 5-C1 CF3 CH2CH2-tBu CH3
179 5-C1 CF3 C~-iPr CH2CH3
180 5-C1 CF3 C~-Pr CH2CH3
181 5-C1 CF3 C~-Bu CH2CH3
182 5-C1 CF3 C~-iBu CH2CH3
183 5-C1 CF3 C~-tBu CH2CH3
184 5-C1 CF3 C~-Et CH2CH3
185 5-C1 CF3 C~-Me CH2CH3
186 5-C1 CF3 CH2C---C-CH3 CH2CH3
187 5-C1 CF3 CH2C---C-CH2CH3 CH2CH3
188 5-C1 CF3 CH2CH2CH(CH3)2 CH2CH3
189 5-C1 CF3 CH2CHZCH2CHg CH2CH3
190 5-C1 CF3 CH2CH2CH3 CH2CH3
191 5-C1 CF3 CH2CH2-tBu CH2CH3
192 5-F CF3 C~-iPr H
193 5-F CF3 C~-Pr H
194 5-F CF3 C~-Bu H
195 5-F CF3 C=C-iBu H
296 5-F CF3 C=C-tBu H
197 5-F CF3 C~-Et H
198 5-F CF3 C~-Me H
107
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/Ob733
199 5-F CF3 CH2C---C-CH3 H
200 5-F CF3 CH2C=C-CH2CH3 H
201 5-F CF3 CHZCH2CH2CH2CH3 H
202 5-F CF3 CH2CH2CH(CH3)2 H
203 5-F CF3 CH2CH2CH2CH3 H
204 5-F CF3 CH2CH2CH3 H
205 5-F CF3 CH2CH2-tBu H
206 5-F CF3 C=C-iPr CH3
207 5-F CF3 C-C-Pr CH3
208 5-F CF3 C=_C-Bu CH3
209 5-F CF3 C~-iBu CH3
210 5-F CF3 C-C-tBu CH3
211 5-F CF3 C=C-Et CH3
212 5-F CF3 C=C-Me CH3
213 5-F CF3 CHIC=C-CH3 CH3
214 5-F CF3 CH2C=C-CH2CH3 CH3
215 5-F CF3 CH2CH2CH(CH3)2 CH3
216 5-F CF3 CH2CH2CH2CH3 CH3
217 5-F CF3 CH2CH2CH3 CH3
218 5-F CF3 CH2CH2-tBu CH3
219 5-F CF3 C=C-iPr CH2CH3
220 5-F CF3 C=C-Pr CH2CH3
221 5-F CF3 C=C-Bu CH2CH3
222 5-F CF3 C=C-iBu CH2CH3
223 5-F CF3 C=C-tBu CHZCH3
224 5-F CF3 C~-Et CH2CH3
225 5-F CF3 C~-Me CH2CH3
226 5-F CF3 CH2C=C-CH3 CH2CH3
227 5-F CF3 CHIC---C-CH2CH3 CH2CH3
228 5-F CF3 CH2CH2CH(CH3)2 CH2CH3
229 5-F CF3 CH2CH2CH2CH3 CH2CH3
230 5-F CF3 CHZCH2CH3 CH2CH3
231 5-F CF3 CH2CH2-tBu CH2CH3
232 5-C1,6-F CF3 C=_C-iPr H
108
r ,.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
233 5-C1,6-F CF3 C=C-Pr H
234 5-C1,6-F CF3 C---C-Bu H
235 5-C1,6-F CF3 C-C-iBu H
236 5-C1,6-F CF3 C=_C-tBu H
237 5-C1,6-F CF3 C=C-Et H
238 5-C1,6-F CF3 C=C-Me H
239 5-C1,6-F CF3 CH2C---C-CH3 H
240 5-C1,6-F CF3 CH2C=C-CH2CH3 H
241 5-C1,6-F CF3 CH2CH2CH(CH3?2 H
242 5-C1,6-F CF3 CH2CHZCH2CH3 H
243 5-C1,6-F CF3 CH2CH2CH3 H
244 5-C1,6-F CF3 CH2CH2-tBu H
245 5-C1,6-F CF3 C~-iPr CH3
246 5-C1,6-F CF3 C=-C-Pr CH3
247 5-C1,6-F CF3 C~-Bu CH3
248 5-C1,6-F CF3 C=C-iBu CH3
249 5-C1,6-F CF3 C~-tBu CH3
250 5-C1,6-F CF3 C---C-Et CH3
251 5-C1,6-F CF3 ~-Me CH3
252 5-C1,6-F CF3 CH2C=C-CH3 CH3
253 5-C1,6-F CF3 CH2C=C-CH2CH3 CH3
254 5-C1,6-F CF3 CH2CH2CH(CH3)2 CH3
255 5-C1,6-F CF3 CH2CH2CH2CH3 CH3
256 5-C1,6-F CF3 CH2CH2CH3 CH3
257 5-C1,6-F CF3 CH2CH2-tBu CH3
258 6-C1,8-F CF3 C-C-iPr H
259 6-C1,8-F CF3 C=C-Pr H
260 6-C1,8-F CF3 C=C-Bu H
261 6-C1,8-F CF3 C~-iBu H
262 6-C1,8-F CF3 C-C-tBu H
263 6-C1,8-F CF3 C-C-Et H
264 6-C1,8-F CF3 C~-Me H
265 6-C1,8-F CF3 CHIC=C-CH3 H
266 6-C1,8-F CF3 CH2C=C-CH2CH3 H
109
CA 02284996 1999-09-27
WO 98/45276 PCTIUS98/06733
267 6-C1,8-F CF3 CHZCH2CH(CH3)2 H
268 6-C1,8-F CF3 CH2CHZCH2CH3 H
269 6-C1,8-F CF3 CHZCH2CH3 H
270 6-C1,8-F CF3 CH2CH2-tBu H
271 6-C1,8-F CF3 C=C-iPr CH3
272 6-C1,8-F CF3 C--_C-Pr CH3
273 6-C1,8-F CF3 C=C-Bu CH3
274 6-C1,8-F CF3 C~-iBu CH3
275 6-C1,8-F CF3 C~-tBu CH3
276 6-C1.8-F CF3 C=C-Et CH3
277 6-C1,8-F CF3 C~-Me CH3
278 6-C1.8-F CF3 CH2C=C-CH3 CH3
279 6-C1,8-F CF3 CH2C=C-CH2CH3 CH3
280 6-C1,8-F CF3 CH2CH2CH(CH3)2 CH3
281 6-C1,8-F CF3 CH2CHZCH2CH3 CH3
282 6-C1,8-F CF3 CH2CH2CH3 CH3
283 6-C1,8-F CF3 CH2CH2-tBu CH3
284 6-CH3 CF3 C~-iPr H
285 6-CH3 CF3 C-C-Pr H
286 6-CH3 CF3 C~-Bu H
287 6-CH3 CF3 C=C-iBu H
288 6-CH3 CF3 C=C-tBu H
289 6-CH3 CF3 C~-Et H
290 6-CH3 CF3 C=C-Me H
291 6-CH3 CF3 CH2C=C-CH3 H
292 6-CH3 CF3 CH2C=C-CHZCH3 H
293 6-CH3 CF3 CH2CH2CH(CH3)z H
294 6-CH3 CF3 CH2CH2CH2CH3 H
295 6-CH3 CF3 CH2CH2CH3 H
296 6-CH3 CF3 CHZCH2-tBu H
297 6-CH3 CF3 C~-iPr CH3
298 6-CH3 CF3 C=C-Pr CH3
299 6-CH3 CF3 C-C-Bu CH3
300 6-CH3 CF3 C~-iBu CH3
110
CA 02284996 1999-09-27
WO 98/45276 PCTlUS98/06733
301 6-CH3 CF3 C-C-tBu CH3
302 6-CH3 CF3 C=C-Et CH3
303 6-CH3 CF3 C=C-Me CH3
304 6-CH3 CF3 CH2C=C-CH3 CH3
305 6-CH3 CF3 CH2C---C-CH2CH3 CH3
306 6-CH3 CF3 CH2CH2CH(CH3)2 CH3
307 6-CH3 CF3 CH2CH2CHZCH3 CH3
308 6-CH3 CF3 CH2CH2CH3 CH3
309 6-CH3 CF3 CH2CH2-tBu CH3
310 6-COCH3 CF3 C=C-iPr H
311 6-COCH3 CF3 C~-Pr H
312 6-COCH3 CF3 C---C-Bu H
313 6-COCH3 CF3 C=C-iBu H
314 6-COCH3 CF3 C=C-tBu H
315 6-COCH3 CF3 C~-Et H
316 6-COCH3 CF3 C=C-Me H
317 6-NH2 CF3 C=C-iPr H
318 6-NH2 CF3 C~-Pr H
319 6-NH2 CF3 C~-Bu H
320 6-NHZ CF3 C~-iBu H
321 6-NH2 CF3 C=C-tBu H
322 6-NHZ CF3 C~-Et H
323 6-NH2 CF3 C=C-Me H
324 6-NMe2 CF3 C=C-iPr H
325 6-NMe2 CF3 C~-Pr H
326 6-NMe2 CF3 C~-Bu H
327 6-NMe2 CF3 C~-iHu H
328 6-NMe2 CF3 C~-tBu H
329 6-NMe2 CF3 C =C-Et H
330 6-NMe2 CF3 C~-Me H
331 7-C1 CF3 C=C-iPr H
332 7-C1 CF3 C~-Pr H
333 7-C1 CF3 C=C-Bu H
334 7-C1 CF3 C=C-iBu H
111
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
335 7-C1 CF3 C-C-tBu
336 7-C1 CF3 C=C-Et
337 7-C1 CF3 C=C-Me
*Unless othenaise indicated, stereochemisty is (+/-).
112
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
Utility
The compounds of this invention possess reverse
transcriptase inhibitory activity, in particular, HIV
inhibitory efficacy. The compounds of formula (I) possess
HIV reverse transcriptase inhibitory activity and are
therefore useful as antiviral agents for the treatment of HIV
infection and associated diseases. The compounds of formula
(I) possess HIV reverse transcriptase inhibitory activity and
are effective as inhibitors of HIV growth. The ability of
the compounds of the present invention to inhibit viral
growth or infectivity is demonstrated in standard assay of
viral growth or infectivity, for example, using the assay
described below.
The compounds of formula (I) of the present invention
are also useful for the inhibition of HIV in an ex vivo
sample containing HIV or expected to be exposed to HIV.
Thus, the compounds of the present invention may be used to
inhibit HIV present in a body fluid sample (for example, a
serum or semen sample) which contains or is suspected to
contain or be exposed to HIV.
The compounds provided by this invention are also useful
as standard or reference compounds for use in tests or assays
for determining the ability of an agent to inhibit viral
clone replication and/or HIV reverse transcriptase, for
example in a pharmaceutical research program. Thus, the
compounds of the present invention may be used as a control
or reference compound in such assays and as a quality control
standard. The compounds of the present invention may be
provided in a commercial kit or container for use as such
standard or reference compound.
Since the compounds of the present invention exhibit
specificity for HIV reverse transcriptase, the compounds of
the present invention may also be useful as diagnostic
reagents in diagnostic assays for the detection of HIV
. 35 reverse transcriptase. Thus, inhibition of the reverse
transcriptase activity in an assay (such as the assays
described herein) by a compound of the present invention
113
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
would be indicative of the presence of HIV reverse
transcriptase and HIV virus.
As used herein "~tg" denotes microgram, "mg" denotes
milligram, "g" denotes gram, "~L" denotes microliter, "mL"
S denotes milliliter, "L" denotes liter, "nM" denotes
nanomolar, "E.~M" denotes micromolar, "mM" denotes millimolar,
"M" denotes molar and "nm" denotes nanometer. "Sigma" stands
for the Sigma-Aldrich Corp. of St. Louis, MO.
HIV RNA Assav
DNA Plasmids and in vitro RNA transcri,~ts:
Plasmid pDAB 72 containing both gag and pol sequences of
BH10 (bp 113-1816) cloned into PTZ 19R was prepared according
to Erickson-Viitanen et al. AIDS Research arid Human
Retroviruses 1989, 5, 577. The plasmid was linearized with
Bam HI prior to the generation of in vitro RNA transcripts
using the Riboprobe Gemini system II kit (Promega) with T?
RNA polymerase. Synthesized RNA was purified by treatment
with RNase free DNAse (Promega), phenol-chloroform
extraction, and ethanol precipitation. RNA transcripts were
dissolved in water, and stored at -70°C. The concentration
of RNA was determined from the A260
2S Probes
Biotinylated capture probes were purified by HPLC after
synthesis on an Applied Biosystems (Foster City, CA) DNA
synthesizer by addition of biotin to the 5' terminal end of
the oligonucleotide, using the biotin-phosphoramidite reagent
of Cocuzza, Tet. Lett. 1989, 30, 6287. The gag biotinylated
capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was
complementary to nucleotides 889-912 of HXB2 and the pol
biotinylated capture probe (S'-biotin -CCCTATCATTTTTGGTTTCCAT
3' ) was complementary to nucleotides 2374-2395 of HXB2.
Alkaline phosphatase conjugated oligonucleotides used as
reporter probes were prepared by Syngene (San Diego, CA.).
The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was
complementary to nucleotides 2403-2425 of HXB2. The gag
114
r ,.
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was
complementary to nucleotides 950-973 of HXB2. All nucleotide
positions are those of the GenBank Genetic Sequence Data Bank
as accessed through the Genetics Computer Group Sequence
Analysis Software Package (Devereau Nucleic Acids Research
1984, 12, 387). The reporter probes were prepared as 0.5 ~1.M
stocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M
Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes
were prepared as 100 ~tM stocks in water.
Streptavidin coated pl es:
Streptavidin coated plates were obtained from Du Pont
Biotechnology Systems (Boston, MA).
c~e7 ~ s and virus stocks:
MT-2 and MT-4 cells were maintained in RPMI 1640
supplemented with 5~ fetal calf serum (FCS) for MT-2 cells or
10~ FCS for MT-4 cells, 2 mM z-glutamine and 50 ~1g/mL
gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4
cells in the same medium. Virus stocks were prepared
approximately 10 days after acute infection of MT-4 cells and
stored as aliquots at -70°C. Infectious titers of HIV-1(RF)
stocks were 1-3 x 107 PFU (plaque forming units)/mL as
measured by plaque assay on MT-2 cells (see below). Each
aliquot of virus stock used for infection was thawed only
once.
For evaluation of antiviral efficacy, cells to be
infected were subcultured one day prior to infection. On the
day of infection, cells were resuspended at 5 x 105 cells/mL
in RPMI 1640, 5~ FCS for bulk infections or at 2 x 106/mL in
Dulbecco's modified Eagles medium with 5~ FCS for infection
in microtiter plates. Virus was added and culture continued
for 3 days at 37°C.
HIV RNA assav:
Cell lysates or purified RNA in 3 M or 5 M GED were
mixed with 5 M GED and capture probe to a final guanidinium
isothiocyanate concentration of 3 M and a final biotin
115
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
oligonucleotide concentration of 30 nM. Hybridization was
carried out in sealed U bottom 96 well tissue culture plates
(Nunc or Costar) for 16-20 hours at 37°C. RNA hybridization
reactions were diluted three-fold with deionized water to a
final guanidinium isothiocyanate concentration of 1 M and
aliquots (150 ~tL) were transferred to streptavidin coated
microtiter plates wells. Binding of capture probe and
capture probe-RNA hybrid to the immobilized streptavidin was
allowed to proceed for 2 hours at room temperature, after
which the plates were washed 6 times with DuPont ELISA plate
wash buffer (phosphate buffered saline(PBS), 0.05 Tween 20.)
A second hybridization of reporter probe to the in~unobilized
complex of capture probe and hybridized target RNA was
carried out in the washed streptavidin coated well by
addition of I20 ~.1 of a hybridization cocktail containing 4 X
SSC, 0.66 Triton X 100, 6.66 deionized formamide, 1 mg/mL
BSA and 5 nM reporter probe. After hybridization for one
hour at 37°C, the plate was again washed 6 times.
Immobilized alkaline phosphatase activity was detected by
addition of 100 N.L of 0.2 mM 4-methylumbelliferyl phosphate
(MUBP, JBL Scientific) in buffer 8(2.5 M diethanolamine pH 8.9
(JBL Scientific), 10 mM MgCl2, 5 mM zinc acetate dihydrate
and 5 mM N-hydroxyethyl-ethylene-diamine-triacetic acid).
The plates were incubated at 37°C. Fluorescence at 450 nM
was measured using a microplate fluorometer (Dynateck)
exciting at 365 nM.
Mi~rot~late based compound evaluation in HIV-1 infected MT-2
c 1 s:
Compounds to be evaluated were dissolved in DMSO and
diluted in culture medium to twice the highest concentration
to be tested and a maximum DMSO concentration of 2~. Further
three-fold serial dilutions of the compound in culture medium
were performed directly in U bottom microtiter plates (Nunc).
After compound dilution, MT-2 cells (SO N,L) were added to a
final concentration of 5 x 105 per mL (1 x 105 per well).
Cells were incubated with compounds for 30 minutes at 37°C in
a C02 incubator. For evaluation of antiviral potency, an
116
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
appropriate dilution of HIV-1 (RF) virus stock (50 ~,L) was
added to culture wells containing cells and dilutions of the
test compounds. The final volume in each well was 200 ~.L.
. Eight wells per plate were left uninfected with 50 ~1L of
medium added in place of virus, while eight wells were
infected in the absence of any antiviral compound. For
evaluation of compound toxicity, parallel plates were
cultured without virus infection.
After 3 days of culture at 37°C in a humidified chamber
inside a C02 incubator, all but 25 ~,L of medium/well was
removed from the HIV infected plates. Thirty seven ~.L of 5 M
GED containing biotinylated capture probe was added to the
settled cells and remaining medium in each well to a final
concentration of 3 M GED and 30 nM capture probe.
Hybridization of the capture probe to HIV RNA in the cell
lysate was carried out in the same microplate well used for
virus culture by sealing the plate with a plate sealer
(Costar), and incubating for 16-20 hrs in a 37°C incubator.
Distilled water was then added to each well to dilute the
hybridization reaction three-fold and 150 ~.L of this diluted
mixture was transferred to a streptavidin coated microtiter
plate. HIV RNA was quantitated as described above. A
standard curve, prepared by adding known amounts of pDAB 72
in vitro RNA transcript to wells containing lysed uninfected
cells, was run on each microtiter plate in order to determine
the amount of viral RNA made during the infection.
In order to standardize the virus inoculum used in the
evaluation of compounds for antiviral activity, dilutions of
virus were selected which resulted in an IC90 value
(concentration of compound required to reduce the HIV RNA
level by 90$) for dideoxycytidine (ddC) of 0.2 ~,g/mL. IC90
values of other antiviral compounds, both more and less
potent than ddC, were reproducible using several stocks of
HIV-1 (RF) when this procedure was followed. This
concentration of virus corresponded to -3 x 105 PFU (measured
by plaque assay on MT-2 cells) per assay well and typically
produced approximately 75~k of the maximum viral RNA level
achievable at any virus inoculum. For the HIV RNA assay,
117
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
ICgO values were determined from the percent reduction of net
signal (signal from infected cell samples minus signal from
uninfected cell samples) in the RNA assay relative to the net
signal from infected, untreated cells on the same culture
plate (average of eight wells). Valid performance of
individual infection and RNA assay tests was judged according
to three criteria. It was required that the virus infection
should result in an RNA assay signal equal to or greater than
the signal generated from 2 ng of pDAB 72 in vitro RNA
transcript. The IC9p for ddC, determined in each assay run,
should be between 0.1 and 0.3 E.tg/mL. Finally, the plateau
level of viral RNA produced by an effective reverse
transcriptase inhibitor should be less than 10~ of the level
achieved in an uninhibited infection. A compound was
considered active if its ICgQ was found to be less than 20~.tM.
For antiviral potency tests, all manipulations in
microtiter plates, following the initial addition of 2X
concentrated compound solution to a single row of wells, were
performed using a Perkin Elmer/Cetus ProPette.
as
Protein Binding and Mutant Resistance
In order to characterize NNRTI analogs for their
clinical efficacy potential the effect of plasma proteins on
antiviral potency and measurements of antiviral potency
against wild type and mutant variants of HIV which carry
amino acid changes in the known binding site for NNRTIs were
examined. The rationale for this testing strategy is two
fold:
1. Many drugs are extensively bound to plasma proteins.
Although the binding affinity for most drugs for the major
components of human plasma, namely, human serum albumin (HSA)
or alpha-1-acid glycoprotein (AAG), is low, these major
components are present in high concentration in the blood.
Only free or unbound drug is available to cross the infected
cell membrane for interaction with the target site (i.e.,
HIV-1 reverse transcriptase, HIV-1 RT?. Therefore, the
effect of added HSA+AAG on the antiviral potency in tissue
culture more closely reflects the potency of a given compound
118
CA 02284996 1999-09-27
WO 98/45276 PCT1US98/06733
in the clinical setting. The concentration of compound
required for 90~ inhibition of virus replication as measured
in a sensitive viral RNA-based detection method is designated
the IC90. The fold increase in apparent IC90 for test
compounds in the presence or added levels of HSA and AAG that
reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG)
was then calculated. The lower the fold increase, the more
compound will be available to interact with the target site.
2. The combination of the high rate of virus
replication in the infected individual and the poor fidelity
of the viral RT results in the production of a quasi-species
or mixtures of HIV species in the infected individual. These
species will include a majority wild type species, but also
mutant variants of HIV and the proportion of a given mutant
will reflect its relative fitness and replication rate.
Because mutant variants including mutants with changes in the
amino acid sequence of the viral RT likely pre-exist in the
infected individual's quasi-species, the overall potency
observed in the clinical setting will reflect the ability of
a drug to inhibit not only wild type HIV-1, but mutant
variants as well. We thus have constructed, in a known
genetic background, mutant variants of HIV-1 which carry
amino acid substitutions at positions thought to be involved
in NNRTI binding, and measured the ability of test compounds
to inhibit replication of these mutant viruses. The
concentration of compound required for 90~ inhibition of
virus replication as measured in a sensitive viral RNA-based
detection method is designated the IC90. It is desirable to
have a compound which has high activity against a variety of
mutants.
Dosaae and Formulation '
The antiviral compounds of this invention can be
administered as treatment for viral infections by any means
that produces contact of the active agent with the agent's
site of action, i.e., the viral reverse transcriptase, in the
body of a mammal. They can be administered by any
conventional means available for use in conjunction with
119
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
pharmaceuticals, either as individual therapeutic agents or
in a combination of therapeutic agents. They can be
administered alone, but preferably are administered with a
pharmaceutical carrier selected on the basis of the chosen
route of administration and standard pharmaceutical practice.
The dosage administered will, of course, vary depending
upon known factors, such as the pharmacodynamic
characteristics of the particular agent and its mode and
route of administration; the age, health and weight of the
recipient; the nature and extent of the symptoms; the kind of
concurrent treatment; the frequency of treatment; and the
effect desired. A daily dosage of active ingredient can be
expected to be about 0.001 to about 1000 milligrams per
kilogram of body weight, with the preferred dose being about
0.1 to about 30 mg/kg.
Dosage forms of compositions suitable for administration
contain from about 1 mg to about 100 mg of active ingredient
per unit. In these pharmaceutical compositions the active
ingredient will ordinarily be present in an amount of about
0.5-95~ by weight based on the total weight of the
composition. The active ingredient can be administered
orally in solid dosage forms, such as capsules, tablets and
powders, or in liquid dosage forms, such as elixirs, syrups
and suspensions. It can also be administered parenterally,
in sterile liquid dosage forms.
Gelatin capsules contain the active ingredient and
powdered carriers, such as lactose, starch, cellulose
derivatives, magnesium stearate, stearic acid, and the like.
Similar diluents can be used to make compressed tablets.
Both tablets and capsules can be manufactured as sustained
release products to provide for continuous release of
medication over.a period of hours. Compressed tablets can be
sugar coated or film coated to mask any unpleasant taste and
protect the tablet from the atmosphere, or enteric coated for
selective disintegration in the gastrointestinal tract.
Liquid dosage forms for oral administration can contain
coloring and flavoring to increase patient acceptance.
120
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
In general, water, a suitable oil, saline, aqueous
dextrose (glucose), and related sugar solutions and glycols
such as propylene glycol or polyethylene glycols are suitable
carriers for parenteral solutions. Solutions for parenteral
S administration preferably contain a water soluble salt of the
active ingredient, suitable stabilizing agents, and if
necessary, buffer substances. Antioxidizing agents such as
sodium bisulfite, sodium sulfite, or ascorbic acid, either
alone or combined, are suitable stabilizing agents. Also
used are citric acid and its salts, and sodium EDTA. In
addition, parenteral solutions can contain preservatives,
such as benzalkonium chloride, methyl- or propyl-paraben and
chlorobutanol. Suitable pharmaceutical carriers are
described in Rernington's Pharmaceutical Sciences, supra, a
standard reference text in this field.
Useful pharmaceutical dosage-forms for administration of
the compounds of this invention can be illustrated as
follows:
Capsules
A large number of unit capsules can be prepared by
filling standard two-piece hard gelatin capsules each with
100 mg of powdered active ingredient, I50 mg of lactose, 50
mg of cellulose, and 6 mg magnesium stearic.
Soft Gelatin Capsules
A mixture of active ingredient in a digestible oil such
as soybean oil, cottonseed oil or olive oil can be prepared
and injected by means of a positive displacement pump into
gelatin to form soft gelatin capsules containing 100 mg of
the active ingredient. The capsules should then be washed
and dried.
T a
A large number of tablets can be prepared by
conventional procedures so that the dosage unit is 100 mg of
active ingredient, 0.2 mg of colloidal silicon dioxide, 5
milligrams of magnesium stearate, 275 mg of microcrystalline
121
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
cellulose, 11 mg of starch and 98.8 mg of lactose.
Appropriate coatings may be applied to increase palatability
or delay absorption.
Sust~ension
An aqueous suspension can be prepared for oral
administration so that each 5 mL contain 25 mg of finely
divided active ingredient, 200 mg of sodium carboxymethyl
cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol
solution, U.S.P., and 0.025 mg of vanillin.
In~ectable
A parenteral composition suitable for administration by
injection can be prepared by stirring 1.5~ by weight of
active ingredient in 10~ by volume propylene glycol and
water. The solution is sterilized by commonly used
techniques.
C9mbination of components (a1 and lb)
Each therapeutic agent component of this invention can
independently be in any dosage form, such as those described
above, and can also be administered in various ways, as
described above. In the following description component (b)
is to be understood to represent one or more agents as
described previously. Thus, if components (a) and (b) are to
be treated the same or independently, each agent of component
(b) may also be treated the same or independently.
Components (a) and (b) of the present invention may be
formulated together, in a single dosage unit (that is,
combined together in one capsule, tablet, powder, or liquid,
etc.) as a combination product. Vdhen component (a) and (b)
are not formulated together in a single dosage unit, the
component (a) may be administered at the same time as
component (b) or in any order; for example component (a) of
this invention may be administered first, followed by
administration of component (b), or they may be administered
in the revserse order. If component (b) contains more that
one agent, e.g., one RT inhibitor and one protease inhibitor,
122
r i
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
these agents may be administered together or in any order.
V~Then not administered at the same time, preferably the
administration of component (a) and (b) occurs less than
about one hour apart. Preferably, the route of
administration of component (a) and (b) is oral. The terms
oral agent, oral inhibitor, oral compound, or the like, as
used herein, denote compounds which may be orally
administered. Although it is preferable that component (a)
and component (b) both be administered by the same route
(that is, for example, both orally) or dosage form, if
desired, they may each be administered by different routes
(that is, for example, one component of the combination
product may be administered orally, and another component may
be administered intravenously) or dosage forms.
As is appreciated by a medical practitioner skilled in
the art, the dosage of the combination therapy of the
invention may vary depending upon various factors such as the
pharmacodynamic characteristics of the particular agent and
its mode and route of administration, the age, health and
weight of the recipient, the nature and extent of the
symptoms, the kind of concurrent treatment, the frequency of
treatment, and the effect desired, as described above.
The proper dosage of components (a) and (b) of the
present invention will be readily ascertainable by a medical
practitioner skilled in the art, based upon the present
disclosure. By way of general guidance, typically a daily
dosage may be about 100 milligrams to about 1.5 grams of each
component. If component (b) represents more than one
compound, then typically a daily dosage may be about 100
milligrams to about 1.5 grams of each agent of component (b).
By way of general guidance, when the compounds of component
(a) and component (b) are administered in combination, the
dosage amount of each component may be reduced by about 70-
80~ relative to the usual dosage of the component when it is
administered alone as a single agent for the treatment of HIV
infection, in view of the synergistic effect of the
combination.
123
CA 02284996 1999-09-27
WO 98/45276 PCT/US98/06733
The combination products of this invention may be
formulated such that, although the active ingredients are
combined in a single dosage unit, the physical contact
between the active ingredients is minimized. In order to
minimize contact, for example, where the product is orally
administered, one active ingredient may be enteric coated.
By enteric coating one of the active ingredients, it is
possible not only to minimize the contact between the
combined active ingredients, but also, it is possible to
control the release of one of these components in the
gastrointestinal tract such that one of these components is
not released in the stomach but rather is released in the
intestines. Another embodiment of this invention where oral
administration is desired provides for a combination product
wherein one of the active ingredients is coated with a
sustained-release material which effects a sustained-release
throughout the gastrointestinal tract and also serves to
minimize physical contact between the combined active
ingredients. Furthermore, the sustained-released component
can be additionally enteric coated such that the release of
this component occurs only in the intestine. Still another
approach would involve the formulation of a combination
product in which the one component is coated with a sustained
and/or enteric release polymer, and the other component is
also coated with a polymer such as a lowviscosity grade of
hydroxypropyl methylcellulose or other appropriate materials
as known in the art, in order to further separate the active
components. The polymer coating serves to form an additional
barrier to interaction with the other component. In each
forniulation wherein contact is prevented between components
(a) and (b) via a coating or some other material, contact may
also be prevented between the individual agents of component
(b) .
Dosage forms of the combination products of the present
invention wherein one active ingredient is enteric coated can
be in the form of tablets such that the enteric coated
component and the other active ingredient are blended
together and then compressed into a tablet or such that the
124
r
CA 02284996 1999-09-27
WO 98145276 PCTIUS98106733
enteric coated component is compressed into one tablet layer
and the other active ingredient is compressed into an
additional layer. Optionally, in order to further separate
the two layers, one or more placebo layers may be present
such that the placebo layer is between the layers of active
ingredients. In addition, dosage forms of the present
invention can be in the form of capsules wherein one active
ingredient is compressed into a tablet or in the form of a
plurality of microtablets, particles, granules or non-perils,
which are then enteric coated. These enteric coated
microtablets, particles, granules or non-perils are then
placed into a capsule or compressed into a capsule along with
a granulation of the other active ingredient.
These as well as other ways of minimizing contact
between the components of combination products of the present
invention, whether administered in a single dosage form or
administered in separate forms but at the same time or
concurrently by the same manner, will be readily apparent to
those skilled in the art, based on the present disclosure.
Pharmaceutical kits useful for the treatment of HIV
infection, which comprise a therapeutically effective amount
of a pharmaceutical composition comprising a compound of
component (a) and one or more compounds of component (b), in
one or more sterile containers, are also within the ambit of
the present invention. Sterilization of the container may be
carried out using conventional sterilization methodology well
known to those skilled in the art. Component (a) and
component (b) may be in the same sterile container or in
separate sterile containers. The sterile containers of
materials may comprise separate containers, or one or more
multi-part containers, as desired. Component (a) and
component (b), may be separate, or physically combined into a
single dosage form or unit as described above. Such kits may
further include, if desired, one or more of various
conventional pharmaceutical kit components, such as for
example, one or more pharmaceutically acceptable carriers,
additional vials for mixing the components, etc., as will be
readily apparent to those skilled in the art. Instructions,
125
CA 02284996 1999-09-27
WO 98/45276 PCT/US98106733
either as inserts or as labels, indicating quantities of the
components to be administered, guidelines for administration,
and/or guidelines for mixing the components, may also be
included in the kit.
S Obviously, numerous modifications and variations of the
present invention are possible in light of the above
teachings. It is therefore to be understood that within the
scope of the appended claims, the invention may be practiced
othervuise than as specifically described herein.
126
