Note: Descriptions are shown in the official language in which they were submitted.
CA 02287525 1999-11-12
Methods for Production and Purification
of Nucleic Acid Molecules
FIELD OF THE INVENTION
The present invention is in the fields of molecular and cellular biology.
The invention is particularly directed to methods useful for the production
and
isolation of nucleic acid molecules. In particular, the invention concerns
isolation
of mRNA molecules and the production and isolation of cDNA libraries (single-
and double-stranded). Additionally, the invention concerns selection and
isolation
of particular nucleic acid molecules of interest from a sample which may
contain
a population of molecules. Specifscally, the invention concerns the use of
afllnity-
labeled primer adapter molecules which allow improved isolation and production
of such nucleic acid molecules, increasing both product recovery and speed of
isolation.
BACKGROUND OF THE INVENTION
cDNA and cDNA Libraries
In examining the structure and physiology of an organism, tissue or cell,
it is often desirable to determine its genetic content. The genetic framework
of an
organism is encoded in the double-stranded sequence of nucleotide bases in the
deoxyribonucleic acid (DNA) which is contained in the somatic and germ cells
of
the organism. The genetic content of a particular segment of DNA, or gene, is
only manifested upon production of the protein which the gene encodes. In
order
to produce a protein, a complementary copy of one strand of the DNA double
helix (the "coding" strand) is produced by polymerase enzymes, resulting in a
specific sequence of ribonucleic acid (RNA). This particular type of RNA,
since
it contains the genetic message from the DNA for production of a protein, is
called
messenger RNA (mRNA).
CA 02287525 1999-11-12
-2-
Within a given cell, tissue or organism, there exist myriad mRNA species,
each encoding a separate and specific protein. This fact provides a powerful
tool
to investigators interested in studying genetic expression in a tissue or cell
--
mRNA molecules may be isolated and further manipulated by various molecular
biological techniques, thereby allowing the elucidation of the full functional
genetic content of a cell, tissue or organism.
One common approach to the study of gene expression is the production
of complementary DNA (cDNA) clones. In this technique, the mRNA molecules
from an organism are isolated from an extract of the cells or tissues of the
organism. This isolation often employs solid chromatography matrices, such as
cellulose or Sepharose, to which oligomers of thymidine (T) have been
complexed.
Since the 3' termini on all eukaryotic mRNA molecules contain a string of
adenosine (A) bases, and since A binds to T, the mRNA molecules can be rapidly
purified from other molecules and substances in the tissue or cell extract.
From
these purified mRNA molecules, cDNA copies may be made using an enzyme
having reverse transcriptase (RT) activity, which results in the production of
single-stranded cDNA molecules complementary to all or a portion of the mRNA
templates. Incubating the single-stranded cDNA under appropriate conditions
allows synthesis of double-stranded DNA which may then be inserted into a
plasmid or a vector.
This entire process, from isolation ofmRNA to insertion ofthe cDNA into
a plasmid or vector to growth of host cell populations containing the isolated
gene, is termed "cDNA cloning." If cDNAs are prepared from a number of
different mRNAs, the resulting set of cDNAs is called a "cDNA library," an
appropriate term since the set of cDNAs represents the different populations
of
functional genetic information (genes) present in the source cell, tissue or
organism. Genotypic analysis of these cDNA libraries can yield much
information
on the structure and function of the organisms from which they were derived.
CA 02287525 1999-11-12
_3_
In traditional production methods, the cDNA molecules must be size
fractionated and multiple phenol/chloroform extractions and ethanol
precipitations
performed. Each of these requirements has inherent disadvantages, such as
product loss and limitations in cDNA yield due to multiple
extractions/precipitations (Lambent, K.N., and Williamson, V.M., Nucl.
AcidrRes.
21(3):775-776 (1993)).
These disadvantages have been partially addressed in the literature. For
example, several investigators have reported methods for the isolation of
polyA+
mRNA from cell and tissue samples by binding the mRNA to latex or
paramagnetic beads coupled with oligo(dT); single-stranded cDNA molecules may
then be produced by reverse transcription of these immobilized mRNA molecules
(Lambent, K.N., and Williamson, V.M., Nucl. Acidr Re.s. 21(3):775-776 (1993);
Kuribayashi-Ohta, K., el al., Biochim. Biophys. Ac~tcr 116:204-212 (1993);
Sasaki, Y.F., et al., Nucl. Acids Re.s. 22(6):987-992 (1994); Meszaros, M.,
and
Morton, D.B., BioTechnidues 20(3):413-419 (1996); Fellman, F., et al.,
Bin7echnique.s 21(5):766-770 (1996)). Such solid phase synthesis methods are
less prone to the yield limitations resulting from the
extraction/precipitation steps
of the traditional methods.
However, these methods still have several important limitations. For
example, each of these methods relies on PCR amplification prior to cloning
ofthe
cDNA molecules, often resulting in biased cDNA libraries (i.e., highly
expressed
sequences predominate over those that are expressed in lower quantities). In
addition, these methods often are less effcient than conventional cDNA
synthesis
methods which use solution hybridization of the primer-adapter to the template
(i. e. , rotational diffusion is required for increased hybridization rates;
see Schmitz,
K.S., and Schurr, J.M.,.I. Phys. Chenz 76:534-545 (1972); Ness, J.V., and
Hahn,
W.E., Nrrcl. AcidrRes. l0(2~J):8061-8077 (1982)). Finally, the above-described
techniques use heat or chemical denaturation to release the nascent cDNA
CA 02287525 1999-11-12 ;
-4-
molecules from the solid phase for further processing, which can result in
product
loss and/or damage.
Thus, a need exists in the art for methods that provide for rapid, high yield
synthesis, isolation and manipulation of nucleic acid molecules from small
quantities of RNA (total RNA or poly A+ mRNA). The present invention
provides such methods.
SUMMARY OF THE INVENTION
The present invention is directed to methods useful for the production and
isolation of nucleic acid molecules (single- and double-stranded) from small
amounts ofinput nucleic acid molecules. More particularly, the invention
provides
methods for the production of a cDNA molecule (single- or double-stranded)
from
an RNA template (e.g., single-stranded mRNA or polyA+ RIvTA) by using ligand-
coupled primer-adapter molecules. Such primer-adapter molecules may also be
used in accordance with the invention to isolate mRNA or polyA+ RNA molecules
from an RNA-containing sample.
Specifically, the invention is directed to a method for producing a nucleic
acid molecule comprising mixing a nucleic acid template, preferably a mRNA or
a polyA+ ~A molecule, with a polypeptide having polymerase and/or reverse
transcriptase activity and a primer-adapter nucleic acid molecule, wherein the
primer-adapter nucleic acid molecule comprises one or more ligand molecules
and
one or more cleavage sites (preferably a restriction endonuclease cleavage
site or
an endonuclease cleavage site). This primer-adapter may be designed to
hybridize
to any portion of the template. Upon incubation under appropriate conditions,
a
first nucleic acid molecule (e.g., a single-stranded cDNA) complementary to
all or
a portion of the template is made. This first nucleic acid molecule contains
the
primer-adapter (preferably at or near its termini) which facilitates isolation
of the
first nucleic acid molecule and/or any nucleic acid molecule hybridized to the
first
CA 02287525 1999-11-12
_5_
nucleic acid molecule. Thus, if the first nucleic acid molecule (e.g., single-
stranded cDNA) serves as a template to make a second nucleic acid molecule
(c~.g., forming a double-stranded molecule such as a double-stranded cDNA),
the
double-stranded molecule can be isolated using the primer-adapter contained in
the molecule. Likewise, the template-first nucleic acid hybrid formed during
synthesis of the f rst nucleic acid molecule can be isolated. If desired, the
primer
adapter may be included at any step or at multiple steps during nucleic acid
svntlZesis. For example, primer-adapter molecules may be added during the
first,
second, third, fourth, etc., synthesis step {the first synthesis step making a
nucleic
acid molecule complementary to all or a portion of the template) or can be
added
in multiple or all such synthesis steps. Multiple synthesis with primer-
adapter
molecules may result in a synthesized nucleic acid molecule having more than
one
primer-adapter.
To isolate mRNA or polyA+ RNA from RNA-containing samples, one or
more mRNA- or polyA+ ~A-specific primer-adapters is used. Such a primer-
adapter is hybridized to the mRNA and/or polyA+ RNA to form a primer-
adapter/polyA+ RNA hybrid. The primer-adapter can then facilitate isolation of
the mRNA and/or polyA+ RNA from a sample. In this aspect of the invention,
since the primer-adapter is hybridized to the molecule of interest and can be
removed by denaturation, cleavage sites in the primer-adapter are not needed.
The primer-adapter molecules of the invention may also be used to isolate
specific nucleic acid sequences. By using one or more target-specific primer-
adapters capable of hybridizing to one or more sequences of interest, the
invention
allows selection and isolation of specific nucleic acid molecules (e.g., genes
or
portions thereof) from a population of nucleic acid molecules. In accordance
with
the invention, the use of two or more such target-specific primer-adapters
(each
directed to a dif~'erent sequence) allows selection of more than one different
sequence of interest. Alternatively, two or more target-specific primer-
adapters
directed to different portions of a sequence of interest facilitates selection
of such
CA 02287525 1999-11-12
-6-
sequences by reducing background contamination. Because. in this aspect of the
invention, the target-specific primer-adapter hybridizes to the desired
molecule
and can be removed by denaturation, cleavage sites in the target-specific
primer-
adapter are not needed.
In accordance with the invention, the primer-adapter molecules facilitate
isolation of molecules comprising such primer-adapters by relying on the
ligand
portion of the primer-adapter. After the primer-adapter is bound (hybridized
or
incorporated during synthesis) to the nucleic acid molecule, the ligand
portion of
the primer-adapter allows selective isolation of the molecule containing the
primer-adapter. Such isolation may be accomplished by ligand-hapten
interactions, where the hapten is bound to, for example, a solid support. Once
bound to the solid support, the molecules of interest (primer-adapter
containing
nucleic acid molecules) can be separated from contaminating nucleic acids and
proteins by washing the support matrix with a solution, preferably a buffer or
water. Cleavage of one or more of the cleavage sites within the primer-adapter
then allows for removal of the nucleic acid molecule of interest from the
solid
support, leaving the ligand bound to the hapten of the solid support.
Alternatively,
where the primer-adapter is hybridized to the nucleic acid molecule of
interest,
isolation can be accomplished by denaturation of the primer-adapter from the
desired molecules and/or by cleavage of the cleavage site: within the primer-
adapter molecule.
Preferred solid supports for use in the invention include, but are not
limited to, nitrocellulose, diazocellulose, glass, polystyrene,
polyvinylchloride,
polypropylene, polyethylene, dextran, Sepharose, agar, starch, nylon, latex
beads,
magnetic beads, paramagnetic beads, superparamagnetic beads or microtitre
plates
and most preferably a magnetic bead, a paramagnetic bead or a
superparamagnetic
bead, that comprises one or more hapten molecules specifically recognizing and
binding to the ligand molecule.
CA 02287525 1999-11-12 ;
Particularly preferred hapten molecules according to this aspect of the
invention include without limitation: (i) avidin and streptavidin; (ii)
protein A,
protein G, a cell-surface Fc receptor or an antibody- specific antigen; (iii)
an
enzyme-specific substrate; (iv) polymyxin B or endotoxin-neutralizing protein
(ENP); (v) Fe++'; (vi) a transferrin receptor; (vii) an insulin receptor;
(viii) a
cytokine (e.g., growth factor, interleukin or colony-stimulating factor)
receptor;
(ix) CD4; (x) spectrin or fodrin; (xi) ICAM-1 or ICAM-2; (xii) C3bi,
fibrinogen
or Factor X; (xiii) ankyrin; (xiv) integrins a,(3,, a2~3,, a3(3,, a~~i,, a~~3,
and a~(3s ;
(xv) integrins a,~3,, a2~3,, a,~3, and a"~3j; (xvi) integrins aj~3,, a4~3,,
a~~3,, as~3,,
a~.(3,, al~E,(33, a"~33 and a~~3~,; (xvii) integrins a~~i, and a~~33; (xviii)
vitronectin;
(xix) fibronectin; (xx) collagen; (xxi) laminin; (xxii) glycophorin; (xxiii)
Mac-l;
(xxiv) LFA-l; (xxv) (3-actin; (xxvi) gp120; (xxvii) cytokines (growth factors,
interleukins or colony-stimulating factors); (xxviii) insulin; (xxix)
ferrotransferrin;
(xxx} apotransferrin; (xxxi) lipopolysaccharide; (xxxii) an enzyme; (xxxiii)
an
antibody; and (xxxiv) biotin.
Particularly preferred ligand molecules for use according to the invention,
which correspond in order to the above-described hapten molecules, include
without limitation: (i) biotin; (ii) an antibody; (iii) an enzyme;
iv) lipopolysaccharide; (v) apotransferrin; (vi} ferrotransferrin; (vii)
insulin;
(viii) cytokines (growth factors, interleukins or colony-stimulating factors);
(ix) gp120; (x) ~3-actin; (xi) LFA-l; (xii) Mac-l; (xiii) glycophorin; (xiv)
laminin;
(a-~~) collagen; (xvi) fibronectin; (xvii) vitronectin; (xviii) integrins
a~~i, and a"~3;
(xix} integrins a3~3,, a4~3,, a4(3~, as(3,, a"~i,, a~~3~, a"(3~ and a~,~36;
(xx) integrins
a,(3,, a2~3,, a3~3, and a"~3~; (xxi) integrins a,~i,, a2~i,, a;~3,, ab(3,,
a,~3, and a~~3s;
(xxii) ankyrin; (xxiii) C3bi, fibrinogen or Factor X; (xxiv) ICAM-1 or ICAM-2;
(xxv) spectrin or fodrin; (xxvi) CD4; (xxvii) a cytokine (e.g., growth factor,
interleukin or colony-stimulating factor) receptor; (xxviii) an insulin
receptor;
(xxix) a transferrin receptor; (xxx) Fe+'+; (xxxi) polymyxin B or endotoxin-
neutralizing protein (ENP); (xxxii) an enzyme-specific substrate; (xxxiii)
protein
CA 02287525 1999-11-12
-8_
A, protein G, a cell-surface Fc receptor or an antibody-specific antigen; and
,
(xxxiv) avidin and streptavidin.
The invention thus relates to a method for making a nucleic acid molecule
comprising
(a) mixing a polypeptide having polymerase and/or reverse
transcriptase activity with a nucleic acid template and a primer-adapter of
the
invention; and
(b) incubating the mixture under conditions sufficient to make a first
nucleic acid molecule which comprises the primer-adapter (preferably at or
near
its s' or 3' termini) and which is complementary to all or a portion of the
template.
[ If a DNA poiymerase is used in accordance with the invention. the primer-
adapter
mad- be located at or near the 3' terminus, while if a reverse transcriptase
is used
the primer-adapter may be located at or near the 5' terminus of the
synthesized
nucleic acid molecule. In accordance with the invention, the first nucleic
acid
molecule may be used as a template to make a second nucleic acid molecule
complementary to all or a portion of the first nucleic acid molecule. If a
primer-
adapter is used in this synthesis, a double-stranded nucleic acid molecule is
produced which comprises a primer-adapter at or near each terminus, although
on
different strands of the molecule. However, the primer-adapter may be omitted
from this second synthesis thereby providing for a double-stranded nucleic
acid
molecule having a primer-adapter at one terminus.
If desired, the primer-adapters of the invention may be used in methods for
amplifying a nucleic acid molecule. Such methods comprise
(a) contacting a polypeptide having polymerase and/or reverse
transcriptase activity with a nucleic acid template and two or more primer-
adapters; and
(b) incubating the mixture under conditions sufficient to amplify a
nucleic acid molecule complementary to all or a portion of the template.
Such amplification methods may specifically comprise
CA 02287525 1999-11-12
-9-
(a) contacting a double-stranded nucleic acid molecule to be amplified
with a polypeptide having polymerase and/or reverse transcriptase activity, a
first
primer-adapter complementary to a portion of the first strand of the double-
stranded molecule and a second primer-adapter complementary to a portion ofthe
second strand of the double-stranded molecule;
(b) incubating the mixture under conditions suf~'~cient to make a third
strand nucleic acid molecule comprising the first primer-adapter and which is
complementary to all or a portion of the first strand, and a fourth strand
nucleic
acid molecule comprising the second primer-adapter and which is complementary
to all or a portion of the second strand;
(c) denaturing the second and fourth, and the first and third, strands
to form single-stranded nucleic acid molecules; and
(d) repeating steps (a)-(c) one or more times.
In this aspect of the invention, the first primer-adapter or the second primer-
adapter may be replaced with any oligonucleotide primer to prime synthesis of
a
nucleic acid molecule.
In a preferred aspect ofthe invention, RNA (e.g., mRNA or polyA+RNA)
is used as a template for DNA synthesis. This preferred method comprises
mixing
the RNA template with one or more polypeptides having reverse transcriptase
activity and a primer and incubating the mixture under conditions sufficient
to
make a DNA (e.g., a cDNA) molecule complementary to all or a portion of the
RNA template. The synthesized DNA molecule may then be used as a template
for additional DNA synthesis or DNA amplification. In accordance with this
aspect of the invention, a cDNA library may be produced when using a
population
of RNA molecules (for example, RNA isolated from a cell or tissue).
For isolating mRNA or polyA+ RNA in accordance with the invention, the
method may specifically comprise:
(a) obtaining a sample containing (or thought to contain) mRNA
and/or polyA+ RNA;
CA 02287525 1999-11-12
- l 0-
(b) contacting the sample with one or more primer-adapters capable
of selectively binding to mRNA and/or polyA+ RNA; and
(c) isolating the mRNA and/or polyA+ RNA from the sample.
For isolating specific or desired nucleic acid molecules, the invention may
specifically comprise:
(a) obtaining a sample containing (or thought to contain) one or more
desired nucleic acid molecules;
(b) contacting the sample with one or more primer-adapters capable
of selectively binding to one or more of the desired nucleic acid molecules;
and
(c) isolating the desired nucleic acid molecules from the sample.
In a preferred aspect, the sample containing the desired molecules is a
population of double-stranded or single-stranded cDNA molecules. Thus, the
invention relates to a method of isolating one or more desired nucleic acid
molecules comprising:
IS (a) obtaining a sample containing a population of cDNA molecules
which contain (or are thought to contain) one or more desired cDNA molecules;
(b) contacting the sample with one or more target-specific primer
adapters capable of specifically binding to one or more of the desired cDNA
molecules; and
(c) isolating the desired cDNA molecules from the sample.
In accordance with the invention, the target-specific primer-adapters may
be used in selection of a specific cDNA molecule after the cDNA molecule is
synthesized from the RNA template (binding to the RNA/cDNA double-stranded
molecule or binding to the single-stranded cDNA molecule after removing the
RNA strand). Alternatively, the target-specific primer-adapters may be used to
bind the double-stranded cDNA molecule. Such target-specific primer-adapters
may also be used in accordance with the invention to select one or more
desired
molecules from a population of amplified nucleic acid molecules.
CA 02287525 1999-11-12
_l l_
The invention is also directed to vectors, including expression vectors,
comprising the cDNA molecules or nucleic acid molecules produced in accordance
with the invention, and to host cells comprising these cDNA molecules, nucleic
acid molecules or vectors. The invention also provides methods for producing a
recombinant polypeptide comprising culturing these host cells under conditions
favoring the expression of a recombinant polypeptide and isolating the
polypeptide, and provides recombinant polypeptides produced according to these
methods.
In other preferred aspects, the invention is directed to kits for the
production of a nucleic acid molecule or a cDNA molecule comprising a carrier
means such as a box, carton, or the like being compartmentalized to receive in
close confinement therein one or more containers, such as tubes, vials,
bottles,
ampules and the like, wherein a first container comprises a primer-adapter
molecule comprising one or~more ligand molecules, preferably biotin, and which
comprises one or more cleavage sites, preferably one or more restriction
endonuclease cleavage sites. The invention is also directed to such kits
comprising
additional containers which may contain one or more polypeptides having
reverse
transcriptase activity and/or polymerise activity. Accordin, to the invention,
more than one polypeptide may be included in the same or different containers.
The invention is also directed to kits comprising additional containers which
may
contain a solid support having one or more haptens capable of specifically
binding
the ligand or ligands of the primer-adapters ofthe invention. The invention is
also
directed to kits comprising additional containers which may contain one or
more
endonucleases which recognize and cleave the cleavage sites in the primer-
adapters of the invention.
Other preferred embodiments of the present invention will be apparent to
one of ordinary skill in light of the following drawings and description of
the
invention, and of the claims.
CA 02287525 1999-11-12
- I 2-
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a depiction of the production and isolation of a double-
stranded cDNA molecule and its ligation into a plasmid vector (pCMVSPORT),
according to the methods of the present invention. "B" denotes biotin
molecules
(and thus sites ofbiotinylation ofthe cDNA molecule), and "RE" denotes
location
of restriction endonuclease cleavage sites used to facilitate removal of the
cDNA
from the solid phase support following isolation.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is particularly suited for the rapid production and
isolation of cDNA libraries from small amounts of poly A+ R~IA or mRNA in a
high-throughout manner. In a preferred aspect of the invention, a population
of
single-stranded poly A+ RNA or mRNA is hybridized in solution with a ligand-
coupled primer adapter (non-specific or gene-specific). As used herein, the
term
"primer-adapter" refers to a nucleic acid molecule which is capable of
specifically
binding (e.g., hybridizing) to a template nucleic acid molecule (e.g., a mRNA
or
poly.a,+ RNA molecule). In a particularly preferred embodiment of the
invention,
the primer-adapter allows priming of the transcription, reverse transcription,
polymerization or elongation of a nucleic acid molecule complementary to all
or
a portion of the template nucleic acid molecule.
According to the invention, the first and second strand cDNA reactions are
preferably performed in one tube, introducing the ligand at or near the 3' end
of
the double-stranded cDNA produced. The ligand-coupled cDNA may then be
isolated by binding to a solid support coupled with a hapten to which the cDNA
will bind through ligand-hapten interactions, thereby allowing the
concentration
of the cDNA and exchange of the buffer without organic extraction and
precipitation. Subsequently, the bound cDNA is released from the solid phase
CA 02287525 1999-11-12
-13-
support by restriction enzyme digestion. This asymmetric cDNA is then cloned
directionally into a vector that contains the appropriate termini (one
terminus
matches the restriction site used to release the cDNA and the other terminus
is
blunt ended). Subsequent or prior to cloning into a vector, specif c cDNA
sequences (e.g. , genes or gene fragments) may be selectively isolated using
target-
specific primer-adapters ofthe invention. In addition to the elimination of
multiple
time-consuming extractions and precipitations, the methods of the invention
eliminate the need for DNA adapters and cDNA fractionation (normally a
necessary step to remove excess unligated adapters). The invention thus
facilitates
rapid production and isolation of larger amounts of cDNA and the construction
of cDNA libraries from nanogram amounts of poly A+ RNA or mRNA without
the need for PCR amplification. The invention also provides a simple selection
technique which allows isolation of desired genes or gene fragments from the
constructed cDNA library.
Sources of Nucleic Acid Template Molecules
Using the methods of the invention, nucleic acid molecules and in
particular cDNA molecules may be prepared from a variety of nucleic acid
template molecules. Preferred nucleic acid molecules for use in the present
invention include single-stranded or double-stranded RNA. More preferred
nucleic acid molecules include polyadenylated RNA (polyA+ RNA), messenger
RNA (mRNA), transfer RNA (tRNA) and ribosomal RNA (rRNA) molecules, and
most preferred are mRNA and polyA+ RNA molecules.
The nucleic acid template molecules that are used to prepare nucleic acid
or cDNA molecules according to the methods of the present invention may be
prepared synthetically according to standard organic chemical synthesis
methods
that will be familiar to one of ordinary skill. More preferably, the nucleic
acid
template molecules may be obtained from natural sources, such as a variety of
cells, tissues, organs or organisms. Cells that may be used as sources of
nucleic
CA 02287525 1999-11-12
- l 4-
acid molecules may be prokaryotic (bacterial cells, including those of species
of
the genera Escherichia, Bacillus, Serratia, Salmonella, Staphylococcr~s,
Streptococcus, Clostridium, Chlantydicr, Neisseria, Treponema, Mycoplasma,
BorreLia, Legionella, Pseudomonas, Mycobacterium, Helicobactclr, Etlvinia,
A~wobacteritim, Rhizobium, and Streptonryce.s) or eukaryotic (including fungi
(especially yeasts), plants, protozoans and other parasites, and animals
including
insects (particularly Dro.sophila spp. cells), nematodes (particularly
Caenorhabditi.s elegan.s cells), and mammals (particularly human cells)).
Mammalian somatic cells that may be used as sources of nucleic acids
include blood cells (reticulocytes and leukocytes}, endothelial cells,
epithelial cells,
neuronal cells (from the central or peripheral nervous systems), muscle cells
(including myocytes and myoblasts from skeletal, smooth or cardiac muscle),
connective tissue cells (including fibroblasts, adipocytes, chondrocytes,
chondroblasts, osteocytes and osteoblasts) and other stromal cells (e.g.,
macrophages, dendritic cells, Schwann cells). Mammalian germ cells
(spermatocytes and oocytes) may also be used as sources of nucleic acids for
use
in the invention, as may the progenitors, precursors and stem cells that give
rise
to the above somatic and germ cells. Also suitable for use as nucleic acid
sources
are mammalian tissues or organs such as those derived from brain, kidney,
liver,
pancreas, blood, bone marrow, muscle, nervous, skin, genitourinary,
circulatory,
lymphoid, gastrointestinal and connective tissue sources, as well as those
derived
from a mammalian (including human) embryo or fetus.
Any of the above prokaryotic or eukaryotic cells, tissues and organs may
be normal, diseased, transformed, established, progenitors, precursors, fetal
or
embryonic. Diseased cells may, for example, include those involved in
infectious
diseases (caused by bacteria, fungi or yeast, viruses (including AIDS} or
parasites), in genetic or biochemical pathologies (e.g., cystic fibrosis,
hemophilia,
Alzheimer's disease, muscular dystrophy or multiple sclerosis) or in cancerous
processes. Transformed or established animal cell lines may include, for
example,
CA 02287525 1999-11-12
-I S-
COS cells, CHO cells, VERO cells, BHK cells, HeLa cells, HepG2 cells, KS62
cells, F9 cells and the like. Other cells, cell lines, tissues, organs and
organisms
suitable as sources of nucleic acids for use in the present invention will be
apparent
to one of ordinary skill in the art.
Once the starting cells, tissues, organs or other samples are obtained,
nucleic acid molecules (such as mRNA) may be isolated therefrom by methods
that are well-known in the art (See, e.g., Maniatis, T., et al., Cell 1:687-
70I
( 1978); Okayama, H., and Berg, P., Mod. Cell. Biol. 2:161-170 ( 1982);
Gubler,
U., and Hoffman, B.J., Gene 2:263-269 (1983)). As discussed, the invention
provides an improvement in isolating mRNA and/or polyA+ R_'v;A from samples.
The use of the primer-adapters of the invention, which specifically recognize
and
bind polyA+ RNA or mRNA, allows for such selection. Preferably, the primer-
adapter recognizes and hybridizes to the polyA tail of the mRl~r.~ or polyA+
~A.
Such primer-adapters may include an primer-adapters comprising oligo(dT). Once
bound, use of the ligand portion of the primer-adapter allows isolation of the
desired RNA molecule. The polyA+ ~A or mRNA molecules thus isolated may
then be used to prepare cDNA molecules and cDNA libraries using the methods
of the present invention.
Synthesis of Nucleic Acid Molecules
In the practice of the invention, nucleic acid molecules and in particular
cDN.A molecules or cDNA libraries comprising one or more ligand molecules are
produced by mixing a nucleic acid template obtained as described above, which
is preferably a mRNA molecule or a polyA+ RNA molecule. with one or more
polypeptides having polymerise activity and/or reverse transcriptase activity
and
with a one or more primer-adapters of the invention. Under conditions favoring
the reverse transcription and/or polymerization ofthe input nucleic acid
molecule,
synthesis of a nucleic acid molecule complementary to all or a portion of the
template is accomplished. Preferred polypeptides (e.g., enzymes} having
reverse
CA 02287525 1999-11-12
-1 G-
transcriptase and/or polymerise activity to be used in the present invention
include, but are not limited to, Moloney Murine Leukemia Virus (M-MLV)
reverse transcriptase, Rous Sarcoma Virus (RSV) reverse transcriptase, Avian
Myeloblastosis Virus (AMV) reverse transcriptase, Rous Associated Virus (RAV)
S reverse transcriptase, Myeloblastosis Associated Virus (MAV) reverse
transcriptase, Human Immunodeficiency Virus (HIV) reverse transcriptase,
retroviral reverse transcriptase, retrotransposon reverse transcriptase,
hepatitis B
reverse transcriptase, cauliflower mosaic virus reverse transcriptase,
bacterial
reverse transcriptase, Thcrmus Ihermophihr.s (Tth) DNA polymerise, Thernaus
ac~rraticns (T'aq) DNA polymerise, ThermoJoga nevpulitana (Tne) DNA
polymerise, Thermolo~a naar itinacr (Thra) DNA polymerise, Thermococcus
litoralis (Tli or VENTTM) DNA polymerise, Pyrncnccrr.s firriosus (Pfu or
DEEPVENTTM) DNA polymerise, Pyrococcu.v WclcJ.slr (Pwo) DNA polymerise,
Bacillus sterothermophilus (Bst) DNA polymerise, Srrlfolobus acidoccrldarius
(Sac) DNA polymerise, Thermoplasma acidophilarm (Tic) DNA polymerise,
Thernar.r.s _fZavcr.s (TfTlTrrb) DNA polymerise, 7lrermu.s rubes (Tru) DNA
polymerise, 7hermus brockianLrs (DYNAZ1'METM) DNA polymerise,
~Llethannbaclerirrnr thermoautvlrophicrrm (Mth) DNA polymerise, and mutants,
variants and derivatives thereof. Particularly preferred for use in the
invention are
the variants of these enzymes that are substantially reduced in RNase H
activity.
By an enzyme "substantially reduced in RNase H activity" is meant that the
enzyme has less than about 20%, more preferably less than about 15%, 10% or
5%, and most preferably less than about 2%, of the RNase H activity of a
wildtype
or "RNase H+" enzyme such as wildtype M-MLV or AMV reverse transcriptases.
The RNase H activity of any enzyme may be determined by a variety of assays,
such as those described, for example, in U.S. Patent No. 5,244,797, in
Kotewicz,
M.L., et al., Nrrcl. Acids Res. 16:265 (1988) and in Gerard, G.F., e! al.,
FOCUS
I~(~):91 (1992), the disclosures of all of which are fully incorporated herein
by
reference.
CA 02287525 1999-11-12
_ 1 7_
Any ligand to which a hapten molecule will bind may be used to form the
ligand-coupled primer-adapter molecule used in the present methods. Suitable
li';ands for this purpose include, but are not limited to: (i) biotin; (ii) an
antibody;
(iii) an enzyme; (iv) lipopolysaccharide; (v) apotransferrin; (vi)
ferrotransferrin;
(vii) insulin; (viii) cytokines (growth factors, interleukins or colony-
stimulating
factors); (ix) gp 120; (x) ~3-actin; (xi) LFA-1; (xii) Mac-1; (xiii)
glycophorin; (xiv)
Iaminin; (xv) collagen; (xvi) fibronectin; (xvii) vitronectin; (xviii)
integrins a~~i~ and
a,_~3~; (xix) integrins a3(3~, a4(3,, aa~3~, asy, a~y> aIIb~3~ a"(~3 and
a~~3~;
(xx) integrins a~(3~, az~3l, a;~3, and a~(3~; (xxi) integrins a,~3,, a,(3,,
a3~3~, a~(3,, a~~3~
and a~(i5; (xxii) ankyrin; (xxiii) C3bi, fibrinogen or Factor X; (xxiv) 1CAM-I
or
ICAM-2; (xxv) spectrin or fodrin; (xxvi) CD4; (xxvii) a cytokine (e.g., growth
factor, interleukin or colony-stimulating factor) receptor; (xxviii) an
insulin
receptor; (xxix) a transferrin receptor; (xxx) Fe+~'; (xxxi) polymyxin B or
endotoxin-neutralizing protein (ENP); (xxxii) an enzyme-specific substrate;
(xxxiii) protein A, protein G, a cell-surface Fc receptor or an antibody-
specific
antigen; and (xxxiv) avidin and streptavidin. Most preferred for use in the
methods ofthe invention is biotin. The ligand-coupled primer-adapter nucleic
acid
molecules, in which one or more ligand molecules are attached (preferably
covalently) to one or more nucleotides of the primer-adapter molecule (see,
for
example, Figure I ), may be produced using conventional organic synthesis
methods that are familiar to one of ordinary skill in the art. For example,
the
oligonucleotide may be biotinylated at the 5' terminus by first producing 5'
amino
(\'HZ) groups followed by Cab-NHS ester addition (Langer, P.R., et al., Proc.
Fall. Acac~ Sci. USA 78:6633 (1981)). In a particularly preferred aspect of
the
invention, a primer-adapter molecule comprising one or more, two or more,
three
or more or four or more ligand molecules, most preferably biotin molecules, is
prepared.
In addition to the ligand molecules, the primer-adapter molecule also
preferably comprises one or more endonuclease cleavage sites, preferably
CA 02287525 1999-11-12
- I 8-
restriction endonuclease cleavage sites. These sites facilitate the release of
the
newly synthesized nucleic acid molecule comprising the primer-adapter from the
hapten-coupled solid support. Examples of endonucleases which can be used in
accordance with the invention include, but are not limited to, Genell.
Examples
S of restriction endonucleases which can be used in accordance with the
invention
include, but are not limited to, AlarI, Eco47 III, EcoRV, FspI, Hpcrl, MscI,
NrrrI,
PvuII, Rsal, S'caI, SnraI, S.spl, Stul, Thal, AvaI, BanaHI, BanII, BgIII,
CIaI,
EcoRI, HirrdIII, HpaII, KprrI, M.sel, NcoI, Ndel, NolI, Pstl, PmrI, SacIlSstI,
SaII,
Xhcrl, XhoI and I-CerrI.
The restriction endonuclease sites engineered into the primer-adapter
molecule are preferably chosen to result in either blunt ends or sticky ends.
Examples of blunt-end restriction enzymes, the recognition sites for which may
be
engineered into the primer-adapter molecules of the invention, include without
(imitation AIuI, Eco47 III, EcoRV, FspI, HpaI, MscI, NruI, PvuII, RsaI, Scal,
SnraI, SSpI, SIarI and Thai.
Examples of sticky-end restriction enzymes, the recognition sites for which
may be engineered into the primer-adapter molecules of the invention, include
without limitation A vaI, BamHI, BanII, BgIII, CIaI, EcoRI, HirrdIII, HpaII,
KpnI,
MseI, Ncol, NdeI, NotI, Pstl, Pvrrl, SacI/Sstl, SaII, Xba, XhoI and I-CeuI.
In a particularly preferred aspect of the invention, the primer-adapter
molecule is engineered to contain a site recognized by rare cutting
restriction
endonucleases, for example, those recognizing 8 or more bases (e.g. , a 8-
basepair
cutter, etc.). Such restriction sites may include a Notl restriction site, a I-
CeuI
restriction site, a PI-P.spI restriction site, an 1-PpoI restriction site, a
PI-TIiI
restriction site and a PI-FceI restriction site. The above-mentioned
restriction
enzymes, and others that may be equivalently used in the methods of the
present
invention, are available commercially, for example from Life Technologies,
Inc.
(Rockville, MD). See also Roberts, R.J., Nrrcl. Acids Re.s. 17(Suppl.):r347-
r387
( 1989), far other examples of restriction enzymes and their cleavage sites.
CA 02287525 1999-11-12
-I 9-
Once the ligand-coupled primer-adapter molecule has been obtained, it is
used to produce nucleic acid molecules from the input nucleic acid using any
of
a number of well-known techniques. Such synthetic techniques involve
hybridization of the primer-adapter to the nucleic acid template and extending
the
primer-adapter to make a nucleic acid molecule complementary to all or a
portion
of the template. Such synthesis is accomplished in the presence of nucleotides
le.g., aeoxyrmonucleoside tnphosphates (dN l~Ys), d~deoxyribonucleoside
triphosphates (ddNTPs) or derivatives thereof) and one or more polypeptides
having polymerase and/or reverse transcriptase activity. The primer-adapters
of
the invention may be used in any nucleic acid synthesis reaction including
cDNA
synthesis, nucleic acid amplification and nucleic acid sequencing, using well-
known techniques. For synthesis of cDNA, the primer-adapter molecules of the
invention may be used in conjunction with methods of cDNA synthesis such as
those described in Example 1 below, or others that are well-known in the art
(see,
IS e.g., Gubler, U., and Hoffman, B.J., Gene 25:263-269 (1983): Krug, M.S.,
and
Berger, S.L., Meth. Errzymol. 1.52:316-325 (1987); Sambrook, J., et al.,
Nloleculcrr C.'lvniny A Laboratory Manual, 2nd ed., Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press, pp. 8.60-8.63 (1987)), to produce cDNA
molecules or libraries.
Alternatively, the primer adapter molecules of the invention may be used
in single-tube synthesis of cDNA molecules according to the invention. In this
approach, the input nucleic acid molecule (preferably a mRNA or polyA+ RNA
molecule) is hybridized in solution with the primer-adapter molecule of the
invention, and the hybridized complex is contacted with a polypeptide (e.g.,
an
enzyme) having reverse transcriptase activity (which is preferably any of
those
described above) in the presence of dNTPs and cofactors needed for cDNA
synthesis. Following first strand synthesis, the second cDNA strand may then
be
synthesized in the same reaction vessel by a modified Gubler-Hoffman reaction
(D'.4lessio, J.M., e! al., Focus 9: I (1987)). Other techniques of cDNA
synthesis
CA 02287525 1999-11-12
-20-
in which the methods of the invention may be advantageously used will be
readily
apparent to one of ordinary skill in the art.
Isolation of Nucleic Acid Molecules
According to the present methods, single-stranded or double-stranded
nucleic acid molecules (e.g., cDNA molecules or cDNA libraries) comprising one
or more primer-adapters will be produced. Such nucleic acid molecules or
libraries may then be rapidly isolated from solution by binding the nucleic
acid
molecules to a solid support comprising one or more hapten molecules that will
bind the ligands.
In the practice of the invention, any solid support to which a ligand-
specific hapten molecule can be bound may be used. Preferred such solid phase
supports include, but are not limited to, nitrocellulose, diazocellulose,
glass,
polystyrene, polyvinylchloride, polypropylene, polyethylene, dextran,
Sepharose,
agar, starch, nylon, beads and microtitre plates. Preferred are beads made
ofglass,
latex or a magnetic material, and particularly preferred are magnetic,
paramagnetic or superparamagnetic beads. Linkage ofthe hapten molecule to the
solid support can be accomplished by any method of hapten coupling such as
covalent, hydrophobic or ionic coupling (including coating) that will be
familiar
to one of ordinary skill in the art.
According to the invention, any hapten molecule having the capability of
binding the ligand molecule that is coupled to the primer-adapter molecule
(and
that therefore is contained in the nucleic acid molecules produced by the
present
methods) may be used. Particularly preferred hapten molecules for use in the
invention (which correspond in order to the ligand molecules listed above)
include
without limitation: (i) avidin and streptavidin; (ii) protein A, protein G, a
cell-
surface Fc receptor or an antibody- specific antigen; (iii) an enzyme-specific
substrate; (iv) polymyxin B or endotoxin-neutralizing protein (ENP); (v)
Fe+++;
(vi) a transferrin receptor; (vii) an insulin receptor; (viii) a cytokine
(e.g., growth
CA 02287525 1999-11-12
-2 I -
factor, interleukin or colony-stimulating factor) receptor; (ix) CD4; (x)
spectrin
or fodrin; (xi) ICAM-1 or ICAM-2; (xii) C3bi, fibrinogen or Factor X;
(xiii) ankyrin; (xiv) integrins a,~3~, az~3,, a3(3,, a~(3,, a.,(3, and a~(35 ;
(xv) integrins
a,~~, az~,, a3~, and a"~33; (xvi) integrins a3(3,, a4~~., aa~,, ash,, a"~,,
anb~3, a"~3
and a~~i~; (xvii) integrins a~(3, and a~(3~; (xviii) vitronectin; {xix)
fibronectin;
(xx) collagen; (xxi) laminin; (xxii) glycophorin; (xxiii) Mac-1; (xxiv) LFA-l;
(xxv) ~3-actin; (xxvi) gp 120; (xxvii) cytokines (growth factors, interleukins
or
colony-stimulating factors); (xxviii) insulin; (xxix) ferrotransferrin;
(xxx) apotransferrin; (xxxi) lipopolysaccharide; (xxxii) an enzyme; (xxxiii)
an
antibody; and (xxxiv) biotin.
For example, in a preferred aspect of the invention where the primer-
adapter molecule and the newly synthesized nucleic acid molecules comprise
biotin, a biotin-binding hapten such as avidin or streptavidin may be linked
to the
solid support. In a particularly preferred such aspect, the solid support used
is
avidin- or streptavidin-coupled magnetic, paramagnetic or superparamagnetic
beads which are commercially available, for example, from Dynal A.S. (Oslo,
Norway) or from Sigma (St. Louis, Missouri). Of course, the choice of hapten
will depend upon the choice of ligand used in the production of the primer-
adapter
molecule; appropriate haptens for use in the methods of the invention will
thus be
familiar to one of ordinary skill in the art.
To isolate the nucleic acid molecules produced by the methods of the
invention, the solution comprising the nucleic acid molecules which comprise
the
primer-adapters of the invention is contacted with the hapten-coupled solid
support under conditions favoring binding of the ligand by the hapten.
Typically,
these conditions include incubation in a buffered salt solution, preferably a
TRIS-,
phosphate-, HEPES- or carbonate-buffered sodium chloride solution, more
preferably a TRIS-buffered sodium chloride solution, still more preferably a
solution comprising about 10-100 mM TRIS-HCl and about 300-2000 mM NaCI,
and most preferably a solution comprising about 10 mM TRIS-HCI and about 1 M
CA 02287525 1999-11-12
-22-
NaCI, at a pH of about 6-9, more preferably a pH of about 7-8, still more
preferably a pH of about 7.2-7.6, and most preferably a pH of about 7.5.
Incubation is preferably conducted at 0 ° C to about 25 ° C, and
most preferably at
about 25 °C, for about 30-120 minutes, preferably about 45-90 minutes,
and most
preferably about 60 minutes, to allow the binding of the ligand-coupled
nucleic
acid molecules to the hapten-coupled solid support.
Once the nucleic acid molecules have been bound to the solid phase
support, unwanted or contaminant materials (such as buffers and enzymes from
first and second strand synthesis reactions, untranscribed input RNA
molecules,
etc.) may be eliminated by simply removing them in the supernatants. For
example, in a preferred aspect in which biotinylated cDNA molecules are bound
v
to a avidin- or streptavidin-coupled solid phase, the contaminants may be
removed
by gently aspirating and discarding the supernatants. In a particularly
preferred
such aspect in which avidin- or streptavidin-coupled magnetic, paramagnetic or
superparamagnetic beads are used as the solid support, the nucleic acid (e.g.,
cDNA)-containing beads are segregated from the supernatants using a magnet
(such as a Magna-Sep Magnetic Particle Separator; Life Technologies, Inc.) and
the supernatants are withdrawn using a pipette. Prior to their release from
the
solid support, the immobilized nucleic acid molecules are preferably washed
one
or more times, for example with one of the buffered salt solutions described
above, to more fully remove unwanted materials.
Once the contaminants have been fully removed, the nucleic acid (e.g.,
cDNA) molecules may be released from the solid support by contacting the
support with an endonuclease, which may be a restriction endonuclease, that
specifically recognizes the sequence engineered into the primer-adapter
molecule
as described above, under conditions favoring the cleavage of the recognition
sequence. In a particularly preferred such aspect of the invention in which a
Notl
and/or I-Cer~I recognition sequence is engineered into the primer-adapter
molecule
(and is thus contained in the newly synthesized nucleic acid (e.g., cDNA)
CA 02287525 1999-11-12
-23-
molecules), the solid support is contacted with a solution comprising NotI
and/or
I-CeuI. Of course, the choice of restriction enzyme used to release the
nucleic
acid molecules from the solid support will depend upon the specific
recognition
site engineered into the primer-adapter molecule and the possibility of that
recognition site being present in the nucleic acid molecules. Preferred
conditions
for release ofthe nucleic acid molecules (e.g., cDNA or cDNA libraries) from
the
solid support include incubation at about 20°C to about 40°C,
preferably at about
25°C to about 39°C, more preferably about 30°C to about
37°C, and most
preferably about 37°C, for about 30-180 minutes, preferably about 60-
150
I O minutes, and most preferably about 120 minutes. Following their release
from the
solid support, the nucleic acid molecules (e.g., cDNA molecules or cDNA
libraries) may be processed and further purified in accordance with the
invention,
or by techniques that are well-known in the literature (see, e.g., Gubler, U.,
and
Hoffman, B.J., Gene 25:263-269 (1983); Krug, M.S., and Berger, S.L., Meth.
Ermymol. h2:316-325 (1987); Sambrook, J., el al., Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press, pp. 8.60-8.63 ( 1987)), and others that will be familiar to
one of
ordinary skill in the art.
kits
The present invention also provides kits for use in production and isolation
of nucleic acid molecules (e.g., cDNA molecules or libraries). Kits according
to
this aspect of the invention comprise a carrier means, such as a box, carton,
tube
or the like, having in close confinement therein one or more containers, such
as
vials, tubes, ampules, bottles and the like, wherein a first container
contains one
or more primer-adapter nucleic acid molecules, which are preferably
biotinylated
primer-adapter nucleic acid molecules. In other aspects, the kits of the
invention
may further comprise one or more additional containers containing a hapten-
coupled solid support, which may be any of the above-described solid supports
CA 02287525 1999-11-12
-24-
and which is most preferably avidin- or streptavidin-coupled magnetic,
paramagnetic or superparamagnetic beads. In additional aspects, the kits of
the
invention may further comprise one or more additional containers containing,
for
example, one or more nucleotides {e.g., dNTPs, ddNTPs or derivatives thereof)
or one or more polypeptides (e.g., enzymes) having reverse transcriptase
activity
and/or polymerase activity, preferably any of those enzymes described above.
Such nucleotides or derivatives thereofmay include, but are not limited to,
dUTP,
dATP, dTTP, dCTP, dGTP, dITP, 7-deaza-dGTP, a-thio-dATP, a.-thio-dTTP,
a-thio-dGTP, a,-thin-dCTP, ddUTP, ddATP, ddTTP, ddCTP, ddGTP, ddITP, 7-
deaza-ddGTP, a-thio-ddATP, oc-thin-ddTTP, a.-thio-ddGTP, a.-thio-ddCTP or
derivatives thereof, all ofwhich are available commercially from sources
including
Life Technologies, Inc. (Rockville, Maryland), New England BioLabs (Beverly,
Massachusetts) and Sigma Chemical Company (Saint Louis, Missouri).
Additional kits according to the invention may comprise one or more additional
containers containing one or more endonucleases or restriction enzymes used
for
release of the nucleic acid molecules (e.g., cDNA molecules or cDNA libraries)
from the solid support. The kits encompassed by this aspect of the present
invention may further comprise additional reagents (e.g., suitable buffers)
and
compounds necessary for carrying out nucleic acid reverse transcription and/or
polymerization protocols.
Uses
The present invention can be used in a variety of applications requiring
rapid production and isolation of nucleic acid molecules. The invention is
particularly suited for isolation of mRNA or polyA+ RNA molecules, for
isolation
of desired nucleic acid molecules from a population of nucleic acid molecules,
and
for production of nucleic acid molecules (particularly full-length cDNA
molecules
from small amounts of mRNA).
CA 02287525 1999-11-12
-25-
The invention is also directed to methods for the amplification of a nucleic
acid molecule, and to nucleic acid molecules amplified by to these methods.
According to this aspect ofthe invention, a nucleic acid molecule may be
amplified
(i.e., additional copies of the nucleic acid molecule prepared) by amplifying
the
nucleic acid molecule (e.~., a cDNA molecules) of the invention according to
any
amplification method that is known in the art. Particularly preferred
amplification
methods according to this aspect of the invention include PCR (U. S. Patent
Nos.
4,683,195 and 4,683,202), Strand Displacement Amplification (SDA; U. S. Patent
No. 5,455,166; EP 0 684 315), and Nucleic Acid Sequence-Based Amplification
(NASBA; U.S. Patent No. 5,409,818; EP 0 329 822). Most preferred are those
methods comprising one or more PCR amplifications.
The invention is also directed to methods that may be used to prepare
recombinant vectors which comprise the nucleic acid molecules or amplified
nucleic acid molecules ofthe present invention, to host cells which comprise
these
recombinant vectors, to methods for the production of a recombinant
polypeptide
using these vectors and host cells, and to recombinant polypeptides produced
using these methods.
Recombinant vectors may be produced according to this aspect of the
invention by inserting, using methods that are well-known in the art, one or
more
of the nucleic acid molecules or amplified nucleic acid molecules prepared
according to the present methods into a vector (see Figure 1 }. The vector
used in
this aspect of the invention may be, for example, a phage or a plasmid, and is
preferably a plasmid. Preferred are vectors comprising cir-acting control
regions
to the nucleic acid encoding the polypeptide of interest. Appropriate trams-
acting
factors may be supplied by the host, supplied by a complementing vector or
supplied by the vector itself upon introduction into the host.
In certain preferred embodiments in this regard, the vectors are expression
vectors that provide for specific expression of the cDNA molecule or nucleic
acid
molecule of the invention, which vectors may be inducible and/or cell
CA 02287525 1999-11-12
-26-
type-specific. Particularly preferred among such vectors are those inducible
by
environmental factors that are easy to manipulate, such as temperature and
nutrient additives.
Expression vectors useful in the present invention include chromosomal-,
episomal- and virus-derived vectors, e.g., vectors derived from bacterial
plasmids
or bacteriophages, and vectors derived from combinations thereof, such as
cosmids and phagemids, and will preferably include at least one selectable
marker
such as a tetracycline or ampicillin resistance gene for culturing in a
bacterial host
cell. Prior to insertion into such an expression vector, the nucleic acid
molecules
(e.g., cDNA molecules) or amplified nucleic acid molecules of the invention
should be operatively linked to an appropriate promoter, such as the phage
lambda
PL promoter, the E. toll lac, ty and tat promoters. Other suitable promoters
will
be known to the skilled artisan.
Among vectors preferred for use in the present invention include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors,
Bluescript vectors, pNHBA, pNHl6a, pNHl8A, pNH46A, available from
Stratagene; pcDNA3 available from Invitrogen; pGEX, pTrxfus, pTrc99a, pET-5,
pET-9, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia; and
pSPORTI, pSPORT2 and pSV~SPORT1, available from Life Technologies, Inc.
Other suitable vectors will be readily apparent to the skilled artisan.
Representative host cells that may be used according to the invention
include, but are not limited to, bacterial cells, yeast cells, plant cells and
animal
cells. Preferred bacterial host cells include Escherichia spp. cells
(particularly
E. toll cells and most particularly E. toll strains DH l OB and Stbl2),
Bacillus spp.
cells (particularly B. subdilis and B. nregaterium cells), S~reptamyces spp.
cells,
En,~inia spp. cells, Klebsiella spp. cells and Salmonella spp. cells
(particularly
S. tvphinrnriuna cells). Preferred animal host cells include insect cells
(most
particularly Spodoptera finsgiperda Sf9 and SfZ 1 cells and Trichoplusa High-
Five
cells) and mammalian cells (most particularly CHO, COS, VERO, BHK and
CA 02287525 1999-11-12
-27-
human cells). These and other suitable host cells are available commercially,
for
example from Life Technologies, Inc., American Type Culture Collection and
Invitrogen.
In addition, the invention provides methods for producing a recombinant
polypeptide, and polypeptides produced by these methods. According to this
aspect of the invention, a recombinant polypeptide may be produced by
culturing
any of the above recombinant host cells under conditions favoring production
of
a polypeptide therefrom, and isolation ofthe polypeptide. Methods for
culturing
recombinant host cells, and for production and isolation of polypeptides
therefrom, are well-known to one of ordinary skill in the art.
In other applications, the methods of the invention may be used to generate
a gene-specific cDNA library from a complex population of poly A+ ~A, The
methods of the invention, in combination with polymorphism analysis methods
such as AFLP, also facilitate rapid and direct identification of
transcriptional
differences between two different DNA populations. Additionally, the primer-
adapter used in the invention can be designed to contain a regulatory
sequence,
such as a promoter, enhancer or other regulatory. region. In one such aspect,
a
promoter for T7 or SP6 RNA polymerase may be engineered into the primer-
adapter, thereby enabling the production of additional copies of the original
mRNA for use in amplification or subtraction. Furthermore, the methods of the
invention can be used to isolate poly A+ RNA from total RNA, such as from
cells,
tissues, organs or organisms, or to generate a cDNA library directly from
total
RNA. In the latter application, the invention is particularly useful when the
mRNA of interest represents only a minute fraction of the total RNA; by the
invention, this low-level mRNA may be rapidly and e~ciently isolated from the
background of total RNA and may then be rapidly and efficiently reverse
transcribed into single-stranded or double-stranded cDNA molecules for a
variety
of purposes such as cloning and/or amplification.
CA 02287525 1999-11-12
-28-
It will be readily apparent to one of ordinary skill in the relevant arts that
other suitable modifications and adaptations to the methods and applications
described herein are obvious and may be made without departing from the scope
of the invention or any embodiment thereof. Having now described the present
invention in detail, the same will be more clearly understood by reference to
the
following examples, which are included herewith for purposes of illustration
only
and are not intended to be limiting of the invention.
Example 1: Prndrection r~n~l I,colation of cDNA Molecules
First and second strand cDNA synthesis reaction: were conducted as
described in the instruction manual for the SUPERSCRIPT Plasmid System (Life
Technologies, Inc., Rockville, Maryland), except that 50-5000 ng of mRNA was
used as starting material to produce a library of > 10~ clones. The primer-
adapter
used in cDNA synthesis contained four biotin (B} residues:
B-GACT (-B) AGT (-B)T(-B)CTAGATCGCGAGCGGCCGCCC(T,5) (SEQ ID
NO:1 ).
Briefly, 1 pg of the biotinylated primer-adapter was used to prime first
strand synthesis for 60 minutes, in a solution containinU 50 mM TRIS-HCl
(pH 8.3), 75 mM KCI, 3 mM MgCl2, 10 mM DTT, 500 pM each of dATP, dCTP,
dGTP and dTTP, 50 pM/ml Bio-p-A and 10,000 to 50,000 units/ml Superscript II
reverse transcriptase (Life Technologies, Ine.). Second strand synthesis was
performed for two hours at 16°C using methods described previously
(Okayama,
H., and Berg, P., Mol. Cell. Biol. 2:161 (1982); Gubler, C;.. and Hoffman,
B.J.,
Gene ~~:263 (1983); D'Alessio, J.M., et al., FOCUS 9:1 ( 1987)), in a solution
containing 25 mN1 TRIS-HCl (pH 7.5), 100 mM KCI, 5 mM MgCl2, 10 mM
(NH;)~SOa, 0.15 mM B-NAD+, 250 ~M each of dATP, dCTP, dGTP and dTTP,
1.2 mM DTT, 65 units/ml DNA ligase, 250 units/ml DNA polymerase I and 13
units/ml RNase H.
CA 02287525 1999-11-12
-29-
During the final 30 min of the two-hour second strand cDNA synthesis
reaction, streptavidin paramagnetic beads were prepared. Briefly, paramagnetic
beads (Life Technologies, Inc.) were resuspended and 150 pl of bead suspension
was placed into a microcentrifuge tube for each reaction. The tubes were the
placed into a Magna-Sep Magnetic particle Separator (magnet) for two minutes,
and supernatant removed by aspiration. The beads were then washed by adding
l00 pl of TE buffer (10 mM TRIS-HCl (pH 7.5), I mM EDTA) to each tube,
resuspending beads, and removing supernatant after two minutes as described
above. Following washing, the beads were resuspended in 160 pl of Binding
Buffer (10 mM Tris-HC1 (pH 7.5), 1 mM EDTA, 1 M NaCI) and held at
25°C
until use in isolating cDNA.
After incubating the second strand cDNA synthesis reaction mixtures with
T4 DNA polymerase, the tubes were placed on ice and the reaction terminated by
the addition to each tube of 10 ~1 of 0.5 M EDTA. The biotinylated cDNA
molecules were then isolated by contacting the solution with the streptavidin-
coupled paramagnetic beads. Briefly, 160 pl of the beads prepared as described
above were added to the cDNA reaction mixture tubes, and the tubes gently
mixed
and incubated for 60 minutes at room temperature. Tubes were then inserted
into
the magnet for two minutes, after which supernatants were removed and
discarded. The beads were then washed by gentle resuspension with 100 gl of
~.vash buffer ( I 0 mM TRIS-HCl (pH 7. S), I mM EDTA, S00 rrLM NaCI), followed
by re-insertion into the magnet. After two minutes, supernatants were removed
and discarded and the washing step repeated. Following the second wash, beads
were resuspended in 100 ul of wash buffer, transferred into fresh tubes, and
washed twice as above (with five minute exposures to the magnet).
Following the second five-minute wash, supernatant was removed and
discarded and cDNA molecules were removed from the beads by incubation with
NotI. Briefly, 50 gl of NotI solution (41 ~.I of autoclaved distilled water, 5
pl of
REact 3 buffer (500 mM TRIS-HCl (pH 8.0), 100 mM MgCI~, I M NaCI) and
CA 02287525 1999-11-12
-3 0-
4 pl of Not I) were added to each reaction tube and tubes mixed by gentle
pipetting. Tubes were incubated for two hours at 37°C, then inserted
into the
magnet for two minutes. Supernatants containing the cDNA molecules were
withdrawn into a fresh tube, and the beads gently resuspended in 20 pl of TE
S buffer, re-inserted into the magnet for two minutes, and supernatants from
this
wash combined with those containing the cDNA molecules from above. To each
tube containing pooled supernatants, 70 pl ofphenol:chloroform:isoamyl alcohol
(25:24:1 ) was added and the tubes vortexed thoroughly and centrifuged at room
temperature for five minutes at 14,000 x g. Following centrifugation, 65 pl of
the
upper, aqueous layer were removed from each tube and transferred into fresh
microcentrifuge tubes, and 32 pl of 7.5 M ammonium acetate, I pl (20 pg) of
Glycogen and 250 pl of cold (-20°C) absolute ethanol were added to each
tube.
Tubes were then mixed and stored on dry ice or at -70°C for 15 minutes,
then
centrifuged for 30 minutes at 14,000 x g at 4°C. Supernatants were
removed and
discarded, 100 ul of 70% ethanol were added to the pellets and the tubes were
centrifuged for two minutes at 14,000 x g at room temperature. Supernatants
were removed and discarded, and the pellets were dried in a speed-vac and then
dissolved in TE buffer (10 pl for SO-200 ng of input mRNA, or 100 pi for 200
5000 ng of input mRNA). Final cDNA yields were determined by Cerenkov
counting.
Example 2: Vector Ligation of cDNA ~cn~l Introduction into Host Cells
From 10 to 50 ng of the cDNA was ligated into a vector (e.g.,
pCMVSPORT) and this ligation introduced into E. cnli by transformation as
described in the SUPERSCRIPT Plasmid System manual (Life Technologies,
Inc.), except the cloning vector was pre-digested with Notl and SmaI. In one
such
ligation, 50 ng of vector was ligated to the cDNA in a 1.5 ml microcentrifuge
tube
with 4 pl of 5X T4 DNA ligase buffer (250 mM TRIS-HCl (pH 7.6), SO mM
CA 02287525 1999-11-12
-31-
MgClz, 5 mM ATP, 5 mM DTT, 25% (w/v) PEG-8000) and I ul of T4 lipase
( 1 unit) at 4 ° C for 16 hours.
Example 3: cDNA Yiel~l Comparisons
To examine the efficiency and yield of cDNA synthesis by the methods of
the invention, cDNA was produced as described above and the amounts produced
were compared to those obtained using an alternative commercially available
system (SUPERSCRIPT Plasmid System; Life Technologies, lnc., Rockville,
Maryland}. Briefly, after introducing the pCMV~SPORT-cDNA ligations into
MAX EFFTCIENCY DHSaTM and EL.EC'rROMAX~ DHIOB cells, the cells were
plated onto ampicillin-containing plates to determine transformation
efficiencies.
The cDNA inserts were sized by using the SP6 and T7 promoter primers and 40
cycles of PCR on 48 randomly chosen colonies for each experiment.
Table 1 shows a comparison of the cDNA yields obtained by the methods
of the present invention to those obtained using the Superscript Plasmid
System.
CA 02287525 1999-11-12
-3 2-
Tablc 1. Comparison of the Invention to the SUPERSCRIPT Plasmid
System.
System Input mRNA Yield TransformantsAvg.
of
Tested per reaction cDNA per ligation Insert
(ng) (ng) (MAX Size,
EFFICIENCY basepairs
DHSaTh~) Ran e)
1000 1 17 1.6 x 10'' 1210
Present (580-2040)
Invention
5000 619 2.5 x 104 1030
(220-1810)
SUPER- 1000 27 1.8 x 104 840
SCRIPT (450-1400)
Plasmid
System 5000 23I 2.0 x 10; 1280
(240-2080)
These results demonstrate that the present invention produces about three-
to four-fold greater yields of cDNA than the SUPERSCRIPT Plasmid System.
Furthermore, the present invention demonstrates approximately equivalent
transformation e~ciencies and average insert sizes to those obtained with the
SUPERSCRIPT Plasmid System. Thus, the present invention provides methods
for the rapid and efficient production of full-length cDNA molecules without
the
use of time-consuming and yield-reducing cDNA size fractionation steps.
Example 4: Production anal Isolation of cDNA Usinfi T~ar~ing Amounts of
Input mRNA
Having demonstrated that the methods of the invention produce cDNA
rapidly and efficiently, the efficacy of the invention in producing cDNA from
varying amounts of input mRNA was examined. In these studies, the amount of
CA 02287525 1999-11-12
-33-
input mRNA was varied from S ng to 1 pg and the cDNA yield, transformation
efficiency and average insert size determined as above. Results are shown in
Table 2.
Tahlc 2. Yield of cDNA Using Different Amounts of Input mRNA.
S Input mRNA Yield of Transformants Avg. Insert
Size,
per reaction cDNA (ng) per ligation basepairs (Range)
(ng) (ELECTItoMAX~ I
DHIOB)
S 2 2.7 x 105 600
(200-2000)
SO 11 S.1 x 10' 6S0
(280-1600)
200 SS 8.0 x 10G 930
(340-2200)
1000 389 7.S x 10' 1300
( I SO-2900)
These results demonstrate that the present invention is capable of
producing large cDNA libraries (i.e., >105 clones) from as little as S ng of
input
mRNA. Previously, PCR (a process that biases the cDNA library) was the only
IS method that would have enabled the production of cDNA libraries from this
small
amount of RNA. Together with those above, these results indicate that the
invention is capable of rapidly and efficiently producing high-quality, full-
length
cDNA molecules from varying quantities of input mRNA, including those that
show a low level of expression and thus represent only a small fraction of the
polyA+ or total RNA pools.
Having now fully described the present invention in some detail by way
of illustration and example for purposes of clarity of understanding, it will
be
CA 02287525 1999-11-12
-34-
obvious to one of ordinary skill in the art that the same can be performed by
modifying or changing the invention within a wide and equivalent range of
conditions, formulations and other parameters without affecting the scope of
the
invention or any specific embodiment thereof, and that such modifications or
changes are intended to be encompassed within the scope of the appended
claims.
All publications, patents and patent applications mentioned in this
specification are indicative of the level of skill of those skilled in the art
to which
this invention pertains, and are herein incorporated by reference to the same
extent
as if each individual publication, patent or patent application was specif
cally and
individually indicated to be incorporated by reference.
CA 02287525 1999-11-12
-3 S-
SEQUENCE LISTING
(1) GENER_~L INFORMATION:
(i) APPLICANT:
(A) NAME: Life Technologies, Inc.
S (B) STREET: 9800 Medical Center Drive
(C) CITY: Rockville
(D) STATE: Maryland
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 20850
1~ (ii) TITLE OF INVENTION: Methods for Production anc Purification
of Nucleic Acid Molecules
(iii) NUMBER OF SEQUENCES: 1
(iv) COMPUTER READABLE FORM:
IS (A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (EPO)
(v) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: (To be assigned)
(B) FILING DATE: (Herewith)
(C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA:
- (A) APPLICATION NUMBER: US 60/046,219
ZS (B) FILING DATE: 12-MAY-1997
(C) CLASSIFICATION:
( 2 ) INFO:ct~'IATION FOR SEQ ID N0: 1
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 44 base pairs
30 (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
3S (A) NAME/KEY: modified_base
(B) LOCATION: 1
(D) OTHER INFORMATION: /mod base= OTHER
/note= "Guanidine at position 1 is biotinylated"
CA 02287525 1999-11-12
-3 6-
(ix) FEATURE:
(A) NAME/KEY: modified_base
(B) LOCATION: 4
(D) OTHER INFORMATION: /mod base= OTHER
$ /not.--.-._ "Thymidine at position 4 is biotinylated"
( -x. ) FEATURE
(A) NAME/KEY: modified_base
(B) LOCATION: 7
(D) OTHER INFORMATION: /mod base= OTHER
l~ /note= "Thymidine at position 7 is biotinylated"
i x. ) FEATURE
(A) NAME/KEY: modified_base
(Bi LOCATION: 8
(D) OTHER INFORMATION: /mod base= OTHER
IS /note= "Thymidine at position 8 is biotinylated"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: l:
GACTAG:'TCT AGATCGCGAG CGGCCGCCCT TTTTTTTTTT TTTT
