Note: Descriptions are shown in the official language in which they were submitted.
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
NOVEL ADMINISTRATION OF THROMBOPOIETIN
Field of the Invention:
The present invention relates to a new method of using thrombopoietin, and
biologically active
derivatives and isoforms thereof, for the treatment of immune and/or
hematopoietic disorders including
thrombocytopenia. The use contemplates the co-administration of such materials
together with a
cytokine, especially a colony stimulating factor or interleukin. The use
includes and is included within
a method for treating a mammal having or at risk for thrombocytopenia by
administering to the
mammal in need of such treatment a therapeutically effective amount of the
material(s).
Background of the Invention:
The hematopoietic system produces the mature highly specialized blood cells
known to be
necessary for survival of all mammals. These mature cells include
erythrocytes, specialized to
transport oxygen and carbon dioxide, T- and B-lymphocytes, responsible for
cell- and antibody-
mediated immune responses, platelets or thrombocytes, specialized to form
blood clots, and
granulocytes and macrophages, specialized as scavengers and as accessory cells
to combat infection.
All of these specialized mature blood cells are derived from a single common
primitive cdll type
referred to as the pluripotent stem cell found primarily in bone marrow.
The mature highly specialized blood cells must be produced in large numbers
continuously
throughout the life of a mammal. The vast majority of these specialized blood
cells are destined to
remain functionally active for only a few hours to weeks. Thus, continuous
renewal of these mature
blood cells, the primitive stem cells themselves, as well as any intermediate
or lineage, committed
progenitor cell lines lined between the primitive and mature cells, is
necessary in order to maintain the
normal steady state blood cell needs for continued life of the mammal.
At the heart of the hematopoietic system lies the pluripotent stem cell(s).
These cells are
relatively few in number and undergo self renewal by proliferation to produce
daughter stem cells, or
they are transformed in a series of differentiation steps into increasingly
mature lineage-restricted
progenitor cells, ultimately forming the highly specialized mature blood
cell(s).
The underlying principal of the normal hematopoietic cell system appears to be
decreased
capacity for self renewal as multipotency is lost and lineage-restriction and
maturity is acquired. Thus,
at one end of the hematopoietic cell spectrum lies the pluripotent stem cell
possessing the capacity for
self renewal and differentiation into all the various lineage-specific
committed progenitor cells. At the
other end of the spectrum lie the highly lineage-restricted progenitors and
their progeny which have
lost the ability of self renewal but have acquired mature functional activity.
The proliferation and development of stem cells and lineage-restricted
progenitor cells are
carefully controlled by a variety of hematopoietic growth factors or
cytokines. Thus, hematopoietic
growth factors may influence growth and differentiation of one or more
lineages, may overlap with
CA 02288964 1999-11-O1
WO 98/52598 ,'CT/US98/10475
other growth factors in affecting a single progenitor cell-line, or may act
synergistically with other
factors.
It will be appreciated from the foregoing that novel hematopoietic growth
factors that effect
survival, proliferation, differentiation or maturation of any of the blood
cells or predecessors thereof
would be useful, especially to assist in the re-establishment of a diminished
hematopoietic system
caused by disease or after radiation- or chemo-therapy.
Platelets are critical elements of the blood clotting mechanism. Depletion of
the circulating
level of platelets, called thrombocytopenia, occurs and is manifested in
various clinical conditions and
disorders. Clinical thrombocytopenia is commonly defined as a condition
wherein the platelet count is
below about 1 SO X I 09 per liter. The major causes of thrombocytopenia can be
broadly divided into
three categories on the basis of platelet life span, namely: I ) impaired
production of platelets by the
bone marrow, e.g., thrombocytopenia brought about by chemo- and radiation-
therapy, 2) platelet
sequestration in the spleen (splenomegaly) and 3) increased destruction of
platelets in the peripheral
circulation, e.g., thrombocytopenia brought about by autoimmune disorders.
Additionally, in patients
receiving large volumes of .rapidly administered platelet-poor blood products,
thrombocytopenia may
develop due to dilution factors. A more detailed description of
thrombocytopenia and its causes, may
be found in Schafner, "Thrombocytopenia and Disorders of Platelet
Disfunction", Internal Medicine,
John J. Hutton et al. Eds., Little, Brown & Co., Boston/Toronto/L,ondon, Third
Ed. (1990) as well as
International Patent Application No. PCT/US94/14553 (International Publication
No. W095/18858).
The therapeutic approach to the treatment of patients with thrombocytopenia is
dictated by the
severity and urgency of the clinical situation. The treatment is similar for
H1V-associated and non-
HIV-related thrombocytopenia, and although a number of different therapeutic
approaches have been
used, the therapy remains clinically controversial.
It will be appreciated from the foregoing that one way to treat
thrombocytopenia would be to
obtain an agent capable of accelerating the differentiation and maturation of
megakaryocytes or
precursors thereof into the platelet-producing form. Considerable efforts have
been expended on
identifying such an agent. One commonly referred to is thrombopoietin (TPO),
the subject of the
present application. Other names for TPO commonly found in the literature at
this time include:
thrombocytopoiesis stimulating factor (TSF); megakaryocyte colony-stimulating
factor (MK-CSF),
megakaryocyte growth and development factor (MGDF), megakaryocyte stimulating
factor,
megakaryocyte potentiator and mpl ligand.
The cited International Patent Application PCT/LJS94/14553 describes the
identification,
isolation, production and use of an isolated mammalian megakaryocytopoietic
proliferation and
maturation promoting protein denominated the "MPL ligand" (ML), or more
commonly,
"thrombopoietin" (TPO), which has been found capable of stimulating
proliferation, maturation and/or
differentiation of megakaryocytes into the mature platelet-producing form.
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Attention is directed as well to International Patent Application Publications
Nos.
W095/26746, W095/21919 and W095/21920.
The PCT/US94/14553 application includes various aspects of associated
embodiments of TPO,
including a method of treating a mammal having or at risk for a hematopoietic
disorder, notably
thrombocytopenia, comprising administering a therapeutically effective amount
of TPO materials to
the mammal. Optionally, TPO is administered as such or in combination with a
cytokine, especially a
colony stimulating factor or interleukin. For purposes disclosed in the
International Patent Application,
TPO is broadly defined as including TPO itself or various variants,
derivatives or isoforms thereof,
including fragments that share at least one biological property in common with
intact TPO for the
treatment of thrombocytopenia. "Biological property", when used in conjunction
with the definition of
the various TPO materials useful as described in the patent application, means
that they have
thrombopoietic activity or an in vivo effector or antigenic function or
activity that is directly or
indirectly caused or performed by the TPO material.
With respect to the therapeutic use of thrombopoietin materials, as described
in the
International Patent Application No. PCT/US94/14553, the TPO materials are
therein described for
administration in admixture with a pharmaceutically acceptable carrier via any
of several
administrative modes. The daily regimen is described as ranging from about 0.1
to 100
microgram/kilogram body weight, preferably from about O.l to 50 microgram/kg
body weight,
preferably at an initial dosage ranging from about 1 to S microgram/kg per
day. Implicit within the
teachings of the patent application is a regimen of administering such a
dosage rate over a period of
several to many days following a projected or actual state of reduced platelet
count.
Published clinical studies of clinically administered thrombopoietin indicates
a dosage and
administration regimen consisting of the administration of thrombopoietin,
subcutaneously at dosages
of 0.03 to 5.0 microgram/kg body weight once per day over a period of ten days
for a condition marked
by thrombocytopenia. See Abstract 1977, Blood 86 (1995). See also Abstracts
1012, 1014 and 1978,
Blood 86 (1995).
A single injection of pegylated (PEG) murine megakarocyte growth and
development factor
(mMGDF) into mice is su~cient to produce a stimulation of megakaryocyte
frequency, size and
ploidization. The PEG-mMGDF was administered to mice at a dose of 25
micrograms/kg as a single
intravenous injection. Blood, Feb. 1, 1997, 89(3):823-33). The in vivo effects
of PEG-rhMGDF on
hematopoiesis in normal mice is reported in Stem Cells, Nov. 1996, 14(6):651-
60. See also Blood, Jul.
15, 1996, 88(2):511-21 and Blood, Jun. 15, 1996, 87(12):5006-I5.
The effects of rhTPO on myelosuppressive chemotherapy-induced thrombocytopenia
in
monkeys is reported in Brit. J. Haematol., Sept. 1996, 94(4):722-8. After
treatment with nimustine on
day 0, monkeys intravenously received rhTPO at a dose of 0.04, 0.2 or 1.0
microgram/kg/d.
Administration of rhTPO following nimustine treatment reduced the severity of
thrombocytopenia and
accelerated the rate of platelet recovery in a dose dependent fashion. The
thrombopoietic effects of
3
CA 02288964 1999-11-O1
WO 98/52598 PCTlUS98/10475
PEG-rhMGDF in human patients with advanced cancer are reported in Lancet, Nov.
9, 1996,
348(9037):1279-81. In this study, PEG-rhMGDF was given by subcutaneous
injection at a dose of
0.03, 0.1, 0.3 or 1.0 microgram/kg body weight before chemotherapy. Further,
the effects of PEG-
rhMGDF on platelet counts after chemotherapy for lung cancer are reported in
New Engl. J. Med., Feb.
6, 1997, 336(6):404-9 and the effects of this compound injected subcutaneously
into rhesus macaques
receiving intense marrow suppression by hepsulfam treatment is reported in
Blood, Jan. 1, 1997,
89( 1 ):1 S 565.
Likewise, the compound epoetin alfa, which is a given name for erythropoietin
(marketed as
EPOGEN by Amgen, Inc.), is a glycoprotein indicated for stimulation of red
blood cell production. It
IO is indicated in a dosage and administration regimen consisting of starting
doses over a range of 150 to
300 units per kg three times weekly for a period of many weeks in order to
stimulate the proliferation
of red blood cells in patients suffering from a depletion however realized.
G-CSF and GM-CSF are cytokines which induce cycling and increase proliferation
of myeloid
progenitor cells. The pharmacokinetics of these cytokines have been studied
and, different
IS administration regimens have been proposed for each of these drugs when
used in conjunction with
chemotherapy.
Filgastrium, marketed as NEUPOGEN by Amgen, Inc., is a granulocyte colony
stimulating
factor (G-CSF). Its indicated regimen is the administration of from 5 to 10
microgram/kg
subcutaneously daily for two weeks following chemotherapy. G-CSF is contra-
indicated for
20 prechemotherapy administration. Clinical trials in which G-CSF was
administered after chemotherapy
and also both before and after chemotherapy have shown that preadministration
worsened the toxic
effects of the chemotherapeutic agent on the bone marrow. J. Nat. Canc.
Inst.,1996, vol. 88, No. 19
and Exp. Hemat., 1994, 22:100-102.
GM-CSF has also been studied clinically for use in conjunction with
chemotherapy. In
25 contrast to G-CSF, GM-CSF has a relatively short effective half life.
Administration of GM-CSF is
followed by a rapid increase in the proliferative activity of the
hematopoietic precursors. However,
within 72 hours after suspension of administration, a negative feedback is
established resulting in a
reduction of the proliferative activity of the marrow to values below
baseline. The short half life of
GM-CSF has enabled this cytokine to be administered prior to chemotherapy.
Cancer, 1993, vol. 72,
30 No. 10.
The conventional regimen in administering materials for the proliferation of
red blood cells or
other primary blood cells to reverse the effects of thrombocytopenia, is
continuous administration of
therapeutically effective amounts of the biological material daily over a
period of many days to patients
in need of such therapy following chemotherapy resulting in thrombocytopenia.
While GM-CSF may
35 have limited effectiveness when administered prior to chemotherapy, G-CSF
worsens patient
thrombocytopenia when administered prior to chemotherapy. The administration
of cytokines having a
relatively long half life and which start hematopoietic progenitor cells
cycling and proliferating, prior
4
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
to treatment with radiation or a chemotherapeutic agent has generally been
contra-indicated since these
cytoreductive treatments kill not only malignant cells, but also the
proliferating progenitor cells as
well.
Another approach to the treatment of patients with thrombocytopenia or who are
at risk of
thrombocytopenia as a result of a medical procedure, e.g. radiation and/or
chemotherapy, is to rescue
the patient with an autologous hematopoietic implant. In this approach,
patients are administered a
compound which mobilizes peripheral blood hematopoietic progenitor cells prior
to the medical
treatment which will induce thrombocytopenia. The mobilized progenitor cells
are harvested by
known leukapheresis procedures and then retranspianted into the patient after
the onset of
thrombocytopenia in order to reestablish the patients autologous hematopoietic
cells in the bone
marrow. Unfortunately, many patients undergoing mobilization have very low
numbers of progenitor
cells at the time of harvest, necessitating multiple leukopheresis procedures
which is painful and
inconvenient for the patient. A method which improves the mobilization of
progenitor cells thereby
reducing the number of ieukopheresis procedures is therefore highly desirable.
For convenience to physicians and patients alike, there exists an objective of
developing
alternative dosage/administration regimens of cytokines materials that would
be advantageous and
therapeutically equivalent or superior to reverse the effects of
thrombocytopenia.
Summary of the Invention
One object of the present invention, therefore, is to provide a method of
administering a
thrombopoietin which provides improved recovery from thrombocytopenia and
overcomes the
deficiencies noted above for existing methods of administering cytokines.
Another object is to provide a method of administering a thrombopoietin to a
mammal or
patient receiving radiation and/or chemotherapy treatment which minimizes
thrombocytopenia
associated with such treatment and reduces the need for platelet transfusions
in the mammal.
These and other objects which will become apparent during the course of the
following
descriptions of exemplary embodiments have been achieved by the method of the
present invention.
The present invention is based upon the unexpected and surprising finding that
biologically
active thrombopoietin materials can produce therapeutic effect by
administering a single or low-
multiple daily dose of a therapeutically effective amount to a patient having
or in need of treatment for
thrombocytopenia. This finding is based on a finding that thrombopoietin
materials are growth factors
for and are believed to act directly on early bone marrow stem cells and
megakaryocyte progenitor
cells, in contrast to G-CSF and GM-CSF which are thought to act on progenitor
cells later in the
hematopoietic cell lineage. The materials of the invention are capable of
causing megakaryocyte
differentiation of stem cells and increasing platelet count following
administration. They induce
proliferation and differentiation of bone marrow hematopoietic cells,
increasing the number of mature
megakaryocytes, which yield increased numbers of circulating platlets.
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10~~~5
Thus, the present invention is directed to a method of treating a mammal
having or at risk for
thrombocytopenia comprising administering to a mammal in need of such
treatment a single or low-
multiple daily dose of a therapeutically effective amount of a thrombopoietin.
In one aspect, the
present invention is directed to the single administration of a
therapeutically effective amount of a
thrombopoietin to such a mammal.
In another aspect of this embodiment, the invention concerns the
administration of a
thrombopoietin to a mammal which receives at least one cycle of radiation
and/or chemotherapeutic
agent in need of such a cycle. Typically, the mammal will need one or more of
such a cycle for the
treatment of a tumor, malignancy, etc. In another aspect, the invention is
directed to a method of
reducing the number of platelet transfusions in a thrombocytopenic patient. In
a further aspect, the
invention is directed to a method of mobilizing progenitor cells by the
administration of a single or
low-multiple daily dose of an effective amount of a thrombopoietin.
Brief Description of the Drawings
Figure 1 - Animals rendered pancytopenic, by a combination of 5.0 Gy of
y-irradiation and carboplatin (1.2 mg), were injected subcutaneously with 0.1
microgram rmTPO(335)
for 1,2, 4, or 8 days. Panel A shows the platelet response to the treatment
regimens while panels B and
C represent the erythrocyte and leukocyte responses respectively over a 28 day
period. The key set
forth in panel B refers to all three panels.
Figure 2 - Animals rendered pancytopenic, by a combination of 5.0 Gy of
y-irradiation and carboplatin (1.2 mg), were injected subcutaneously with a
single dose at various
levels of rmTPO(335) 24 hours after the initiation of the experiment. Panel A
shows the platelet
response to the treatment regimens while panels B and C represent the
erythrocyte and leukocyte
responses respectively over a 28 day period. The key set forth in panel B
refers to all three panels.
Figure 3 - Log-linear representations of the platelet (panel A) and
erythrocyte (panel B)
responses to single administrations of rmTPO(335) given either subcutaneously
or intravenously in
animals rendered pancytopenic by a combination of 5.0 Gy ofy-irradiation and
carboplatin (1.2 mg).
The cell numbers plotted are those measured on day 14 after initiation of the
experiment. ~ is base line
zero level.
Figure 4 - Animals rendered pancytopenic, by a combination of 5.0 Gy of
y-irradiation and carboplatin (I .2 mg), were injected intravenously with a
single dose at various levels
of rmTPO(335) 24 hours after the initiation of the experiment. Panel A shows
the platelet response to
the treatment regimens while panels B and C represent the erythrocyte and
leukocyte responses
respectively over a 28 day period. The key set forth in panel B refers to all
three panels.
Figure 5 - Animals rendered pancytopenic, by a combination of 5.0 Gy of
y-irradiation and carboplatin (1.2 mg), were injected subcutaneously with a
single dose at 24 hours
after the initiation of the experiment with various forms of rmTPO( 153)
conjugated to polyethylene
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
glycol (peg) of either 20K or 40K molecular weight. Panel A shows the platelet
response to the
treatment regimens while panels B and C represent the erythrocyte and
leukocyte responses
respectively over a 28 day period. The key set forth in panel B refers to all
three panels.
Figure 6 - Animals rendered pancytopenic, by a combination of 5.0 Gy of
y-irradiation and carboplatin (1.2 mg), were injected subcutaneously with a
single dose at 24 hours
after the initiation of the experiment with either rmTPO(335) or rmTPO( 153)
conjugated to
polyethylene glycol (peg) of 40K molecular weight. Panel A shows the platelet
response to the
treatment regimens while panels B and C represent the erythrocyte and
leukocyte responses
respectively over a 28 day period. The key set forth in panel B refers to all
three panels.
Figure 7 - Animals rendered pancytopenic, by a combination of 5.0 Gy of
y-irradiation and carboplatin (1.2 mg), were injected intravenously with a
single dose at 24 hours after
the initiation of the experiment with either rmTPO(335) or rmTPO(153)
conjugated to polyethylene
glycol (peg) of 40K molecular weight. Panel A shows the platelet response to
the treatment regimens
while panels B and C represent the erythrocyte and leukocyte responses
respectively over a 28 day
period. The key set forth in panel B refers to all three panels.
Figure 8 - Figure 8 shows the thrombocyte level of 6 Gy irradiated mice at the
time of nadir in
placebo controls as a function of the time of administration of a single i.p.
dose (0.3 microgram) of
TPO at each of the various time points indicated in the Figure.
Figure 9 - Figure 9 shows the thrombocyte level of 6 Gy irradiated mice at the
time of nadir in
placebo controls as a function of the time of administration of a single i.p.
dose (30 microgram) of TPO
at two hours before (-2h) irradiation.
Figure 10 - In order to model a protracted form of cytoreductive treatment
very similar to
radiation or chemotherapy, total body irradiation (TBI) was given to mice in
three equal fractions of 3
Gy separated by 24 hours each. TPO was given in a total dose of 0.9 microgram
in three different
dosing regimen; 3 x 0.3 microgram at +2h from irradiation, 0.9 microgram at
+2h from irradiation, and
0.9 microgram at -2h from irradiation. The resulting thrombocyte levels are
shown vs a placebo.
Figure 11 - This Figure shows hemopoietic progenitor cell data of the femur
for the regimen of
Figure 10.
Figure 12 - This Figure shows hemopoietic progenitor cell data of the spleen
for the regimen
of Figure 10.
Figure 13 - Figure 13 shows pharmacokinetic data following three doses of 0.3
microgram or
a single dose of 0.9 microgram of TPO.
Figure 14 - Figure 14 shows median platelet counts averaged over dose levels
by study arm for
Example 7, cycle 1 (chemotherapy alone).
Figure 15 - Figure 15 shows median platelet counts averaged over dose levels
by study arm for
Example 7, cycle 2 (chemotherapy and rhTPO).
CA 02288964 1999-11-O1
WO 98/SZ598 PCT/US98/10475
Figure 16 - Figure 16 shows median platelet counts averaged over dose levels
by study arm for
Example 7, cycle 3 (chemotherapy and rhTPO).
Figure 17 - Figure 17 shows median platelet counts averaged over dose levels
by study arm for
Example 7, cycle 4 (chemotherapy and rhTPO).
Figure 18 - Figure 18 shows median platelet count by rhTPO dose level for arm
C, cycle 2 of
Example 7.
Figure 19 - Figure 19 shows median platelet count by rhTPO dose level for arm
D, cycle 2 of
Example 7.
Figure 20 - Platelet counts in mice exposed to a single inhalation of rhTPO;
see
Example 8.
Figure 21 - Platelet counts in mice exposed to multiple inhalations of rhTPO;
see Example 8.
Figure 22 - Expansion of CD34+ cells by TPO/FL/KL. In Figure 22 is shown the
expansion
of CD34+cells over 8 weeks in cultures containing TPO, Flt-3 and c-kit ligand.
An expansion of over a
10e6 fold is observed; see Example 14.
Figure 23 - Expansion of CD34+CD38- cells by TPO/KL/FL. As shown in Figure 23
the
subpopulation of CD34+CD38- cells is also expanded. At week one this
subpopulation only makes up
only 8% of the culture but by week 8 comprises 33% of the culture, indicating
a 4 fold expansion.
This demonstrates both an expansion and maintanence of a primitive progenitor
population in these
expanded cultures; see Example 14.
Figure 24 - Expansion of multilineage activity by TPO/KL/FL. In Figure 24 the
ability of the
expanded cultures to give rise to multilineage colonies in vitro is shown. The
number of colonies
generated increases porportionally with the expansion of CD34+ cells in the
culture. This indicates that
the expanded cells are maintaining their multipotential activity; see Example
14.
Definitions
As used herein, a "mammal having or at risk for thrombocytopenia" means a
mammal,
including a human, which is experiencing thrombocytopenia, that is, a platelet
count which is below
the platelet count for average normal individuals in the mammal population. In
humans,
thrombocytopenia is defined as a condition where the platelet count is below
about I50 x 109 per liter
of blood. The mammal may, however, also be at risk for thrombocytopenia,
meaning that the mammal
may forseeably experience a thrombocytopenic condition as a result of a
specific treatment which is
known to cause thrombocytopenia. For example, a mammal is at risk for
thrombocytopenia if the
mammal will be administered a radiation and/or chemotherapeutic treatment
which is known to induce
thrombocytopenia in the treated mammal. In other words, it is clearly
forseeable that the mammal is at
risk for or has a high probability of experiencing thrombocytopenia as a
result of the treatment which is
known to induce thrombocytopenia. Such mammals at risk for thrombocytopenia
may be treated with
the method of the present invention. Included within the scope of this
invention are mammals having or
8
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/104"~
at risk for thrombocytopenia as a result of a disfunctional liver, e.g. liver
cirrhosis, and mammals
undergoing progenitor cell mobilization therapy and apheresis, generally prior
to radiation and/or
chemotherapy treatment.
The term "cytokine" is a generic term for proteins released by one cell
population which act on
another cell as intercellular mediators. Examples of such cytokines are
lymphokines, monokines, and
traditional polypeptide hormones. Included among the cytokines are growth
hormone, insulin-like
growth factors, human growth hormone including N-methionyl human growth
hormone, bovine growth
hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin,
prorelaxin, glycoprotein
hormones such as follicle stimulating hormone (FSH), thyroid stimulating
hormone (TSH), and
leutinizing hormone (LH), hematopoietic growth factor, hepatic growth factor,
fibroblast growth factor,
prolactin, placental lactogen, tumor necrosis factors (TNF-a and TNF-(3),
mullerian-inhibiting
substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular
endothelial growth factor,
integrin, nerve growth factors (NGFs) such as NGF-j3, insulin-like growth
factor-I and -II,
erythropoietin (EPO), osteoinductive factors, interferons (IFNs) such as
interferon-a, -~i and -y, colony
stimulating factors (CSFs) such as macrophage-CSF (M-CSF), granulocyte-
macrophage-CSF (GM-
CSF), and granulocyte-CSF (G-CSF), interleukins (ILs) such as IL-l, IL-la, IL-
2, IL-3, IL-4, IL-5, IL-
6, IL-7, IL-8, IL-9, IL-11, IL-12 and other polypeptide factors including LIF,
SCF, FLT-3 ligand and
kit-ligand (KL). As used herein the foregoing terms are meant to include
proteins from natural sources
or from recombinant cell culture. Similarly, the terms are intended to include
biologically active
equivalents; e.g., differing in amino acid sequence by one or more amino acids
or in type or extent of
glycosylation.
The term "biologically active" when used in conjunction with a thrombopoietin
(TPO) means
thrombopoietin or a thrombopoietic polypeptide that exhibits thrombopoietic
activity or shares an
effector function of the mpl ligand isolated from aplastic porcine plasma or
expressed in recombinant
cell culture. A principal known effector function of the mpl and stimulating
the incorporation of
labeled nucleotides (3H-thymidine) into the DNA of IL-3 dependent Ba/F3 cells
transfected with
human mpl P. Another known effector function of the mpl ligand or polypeptide
herein is the ability to
stimulate the incorporation of 35S into circulating platelets in a mouse
platelet rebound assay. Yet
another known effector function of mpl ligand is the ability to stimulate in
vitro human
megakaryocytopoiesis that may be quantitated by using a radio labeled
monoclonal antibody specific to
the megakaryocyte glycoprotein GPIIbIIIa.
The terms "mpl ligand", mpl ligand polypeptide", "ML", "thrombopoietin" or
"TPO" are used
interchangeably herein and include any polypeptide that possesses the property
of binding to mpl, a
member of the cytokine receptor superfamily, and having a biological property
of mpl ligand. An
exemplary biological property is the ability to stimulate the incorporation of
labeled nucleotides (e.g.
3H-thymidine) into the DNA of IL-3 dependent Ba/F3 cells transfected with
human mpl. Another
9
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/104?5
exemplary biological property is the ability to stimulate the incorporation of
35S into circulating
platelets in a mouse platelet rebound assay. This definition encompasses a
polypeptide isolated from a
mpl ligand source such as aplastic porcine plasma described herein or from
another source, such as
another animal species, including humans, or prepared by recombinant or
synthetic methods.
S Examples include TPO(332) and rhTP0332. Also included in this definition is
the thrombopoietic
ligand described in WO 95/28907 having a molecular weight of about 31,000
daltons (3lkd) as
determined by SDS gel under reducing conditions and 28,000 daltons (28kd)
under non-reducing
conditions. The term "TPO" includes variant forms, such as fragments, alleles,
isoforms, analogues,
chimera thereof and mixtures of these forms. For convenience, all of these
ligands will be referred to
below simply as "TPO" recognizing that all individual ligands and ligand
mixtures are referred to by
this term.
Preferably, the TPO is a compound having thrombopoietic activity or being
capable of
increasing serum platelet counts in a mammal. The TPO is preferably capable of
increasing
endogenous platelet counts by at least 10%, more preferably by 50%, and most
preferably capable of
elevating platelet counts in a human to greater than about 150 X 109 per liter
of blood.
The TPO of this invention preferably has at least 70% overall sequence
identity with the amino acid
sequence of the highly purified substantially homogeneous porcine mpl ligand
polypeptide and at least
80% sequence identity with the "EPO-domain" of the porcine mpl ligand
polypeptide. Alternatively,
the TPO of this invention may be a mature human mpl ligand (hML), or a variant
or post-
transcriptionally modified form thereof or a protein having about 80% sequence
identity with mature
human mpl ligand. Alternatively, the TPO may be a fragment, especially an
amino-terminus or "EPO-
domain" fragment, of the mature human mpl ligand. Preferably, the amino
terminus fragment retains
substantially all of the human ML sequence between the first and fourth
cysteine residues but may
contain substantial additions, deletions or substitutions outside that region.
According to this
embodiment, the fragment polypeptide may be represented by the formula:
X-hTPO(7-151 )-Y
Where hTPO(7-151) represents the human TPO (hML) amino acid sequence from Cyst
through Cys151 inclusive; X represents the amino group of Cyst or one or more
of the amino-terminus
amino acid residues) of the mature TPO or amino acid residue extensions
thereto such as Met, Lys,
Tyr or amino acid substitutions thereof such as arginine to lysine or leader
sequences containing, for
example, proteolytic cleavage sites (e.g. Factor Xa or thrombin); and Y
represents the carboxy terminal
group of Cys151 or one or more carboxy-terminus amino acid residues) of the
mature TPO or
extensions thereto.
A "TPO fragment" means a portion of a naturally occurring mature full length
mpl ligand or
TPO sequence having one or more amino acid residues or carbohydrate units
deleted. The deleted
amino acid residues) may occur anywhere in the peptide including at either the
N-terminal or C-
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
terminal end or internally, so long as the fragment shares at least one
biological property in common
with mpl ligand. Mpl ligand fragments typically will have a consecutive
sequence of at least 10, 1 S, 20,
25, 30 or 40 amino acid residues that are identical to the sequences of the
mpl ligand isolated from a
mammal including the ligand isolated from aplastic porcine plasma or the human
or murine ligand,
especially the EPO-domain thereof. Representative examples of N-terminal
fragments are TPO( 153),
hML153 or TPO(Met-1 1-153).
The tenors "TPO isoform(s)" and "TPO sequence isoform(s)" or the term
"derivatives" in
association with TPO, etc. as used herein means a biologically active material
as defined below having
less than 100% sequence identity with the TPO isolated from recombinant cell
culture, aplastic porcine
plasma or the human mpl ligand. Ordinarily, a biologically active mpl ligand
or TPO isoform will have
an amino acid sequence having at least about 70% amino acid sequence identity
with the mpl
ligand/TPO isolated from aplastic porcine plasma or the mature murine, human
mpl ligand or
fragments thereof, preferably at least about 75%, more preferably at least
about 80%, still more
preferably at least about 85%, even more preferably at least about 90%, and
most preferably at least
about 95%.
In one isoform embodiment, the TPO may have the formula:
SerProAlaProProAlaCysAspLeuArgValLeuSerLysLeuLeuArgAspSer
HisValLeuHisSerArgLeuSerGlnCysProGluValHisProLeuProXaaPro
ValLeuLeuProAlaValAspXaaXaaLeuGlyGluTrpLysThrGlnMetGluGlu
ThrLysAlaGlnAspIleLeuGlyAlaValThrLeuLeuLeuGluGlyValMetAla
AlaArgGlyGlnLeuGlyProThrCysLeuSerSerLeuLeuGlyGlnLeuSerGly
GlnValArgLeuLeuLeuGlyAlaLeuGlnSerLeuLeuGlyThrGlnXaaXaaXaa
XaaGlyArgThrThrAlaHisXaaAspProAsnAlaIlePheLeuSerPheGlnHis
LeuLeuArgGlyLysValArgPheLeuMetLeuValGlyGlySerThrLeuCysVa1
ArgArgAiaProProThrThrAlaValProSerArgThrSerLeuValLeuThrLeu
AsnGluLeuProAsnArgThrSerGlyLeuLeuGluThrAsnPheThrAlaSerAla
ArgThrThrGlySerGlyLeuLeuLysXaaGlnGlnGlyPheArgAlaLysIlePro
GlyLeuLeuAsnGlnThrSerArgSerLeuAspGlnIleProGlyTyrLeuAsnArg
IleHisGluLeuLeuAsnGlyThrArgGlyLeuPheProGlyProSerArgArgThr
LeuGlyAlaProAspIleSerSerGlyThrSerASpThrGlySerLeuProProAsn
LeuGlnProGlyTyrSerProSerProThrHisProProThrGlyGlnTyrThrLeu
PheProLeuProProThrLeuProThrProValValGlnLeuHisProLeuLeuPro
AspProSerAlaProThrProThrProThrSerProLeuLeuAsnThrSerTyrThr
HisSerGlnAsnLeuSerGlnGluGly
where:
11
CA 02288964 1999-11-O1
a U 98/52598 PCT/US98/10475
Xaa at position 37 is Thr, Asp or Glu;
Xaa at position 46 is Phe, Ala, Vat, Leu, Ile, Pro, Trp, or Met;
Xaa at position 47 is Ser, Asp or Glu;
Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp, or Met;
Xaa at position 113 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr, or Asn;
Xaa at position 122 is Lys, Arg, His, Glu, or Asp;
Xaa at position 200 is Trp, Ala, Val, Leu, Ile, Pro, Phe, Met, Arg and Lys, or
His.
where from 1 to 179 amino acids can be deleted from the C-terminus and with
the proviso that at least
one of the amino acids designated by Xaa are different from the corresponding
amino acids of the
native TPO (1-332).
This embodiment also includes a TPO fragment with the following formula:
SerProAlaProProAlaCysAspLeuArgValLeuSerLysLeuLeuArgAspSer
HisValLeuHisSerArgLeuSerGlnCysProGluValHisProLeuProXaaPro
ValLeuLeuProAlaValAspXaaXaaLeuGlyGluTrpLysThrGlnMetGluGlu
ThrLysAlaGlnAspIleLeuGlyAlaValThrLeuLeuLeuGIuGlyValMetAla
AlaArgGlyGlnLeuGlyProThrCysLeuSerSerLeuLeuGlyGlnLeuSerGly
GlnValArgLeuLeuLeuGlyAlaLeuGlnSerLeuLeuGlyThrGlnXaaXaaXaa
XaaGlyArgThrThrAlaHisXaaAspProAsnAlaIlePheLeuSerPheGlnHis
LeuLeuArgGlyLysValArgPheLeuMetLeuValGlyGlySerThrLeuCysVa1
Arg
where:
Xaa at position 37 is Thr, Asp or Giu;
Xaa at position 46 is Phe, Ala, Val, Leu, Ile, Pro, Trp, or Met;
Xaa at position 47 is Ser, Asp or Glu;
Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp, or Met;
Xaa at position 113 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr, or Asn;
Xaa at position 122 is Lys, Arg, His, Glu, or Asp;
12
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
and with the proviso that at least one of the amino acids designated by Xaa is
different from the
corresponding amino acids of the native TPO (1-332). These variants may have
an improved
biological profile, such as increased proliferative activity and/or decreased
side-effects, and/or
improved physical properties, such as improved half life, stability, and/or re-
fold efficiencies. The
preparation of the polypeptides of this embodiment is described in W096/23888.
TPO "analogues" include covalent modification of TPO or mpl ligand by linking
the TPO
polypeptide to one of a variety of nonproteinaceous polymers, e.g.
polyethylene glycol, polypropylene
glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos.
4,640,835; 4,496,689;
4,301,144; 4,670,417; 4,791,192 or 4,179,337. TPO polypeptides covalently
linked to the forgoing
polymers are referred to herein as pegylated TPO.
A "chimeric polypeptide" or "chimera" as used herein is a polypeptide
containing full length
parent ligand (TPO or mpl ligand) or one or more fragments thereof fused or
bonded to a second
heterologous polypeptide or one or more fragments thereof. The chimera will
share at least one
biological property in common with TPO. The second polypeptide will typically
be a cytokine, for
example the cytokines noted above, immunoglobin or fragment thereof. The two
polypeptides may be
directly bonded together or may be bonded together through a linker, for
example a peptide linker
which may have 2-50, generally 2-20 amino acid units. Specific examples
include TPO/G-CSF,
TPO/GM-CSF, TPO/IL-3, TPO/IL-6, etc. Preparation of chimeric proteins may be
accomplished
using methods well-known in the art.
The term "biological property" when used in conjunction with either the "mpl
ligand" or
"isolated mpl ligand" or "TPO" means having thrombopoietic activity or having
an in vivo effector or
antigenic function or activity that is directly or indirectly caused or
performed by a mpl ligand or
"TPO" (whether in its native or denatured conformation) or a fragment thereof.
Effector functions
include mpl binding and any carrier binding activity, agonism or antagonism of
mpl, especially
transduction of a proliferative signal including replication, DNA regulatory
function, modulation of the
biological activity of other cytokines, receptor (especially cytokine)
activation, deactivation, up-or
down regulation, cell growth or differentiation and the like. An antigenic
function means possession of
an epitope or antigenic site that is capable of cross-reacting with antibodies
raised against the native
mpl ligand or TPO. The principal antigenic function of a mpl ligand or TPO
polypeptide is that it binds
with an affinity of at least about 106 l/mole to an antibody raised against
the mpl ligand or TPO
isolated from aplastic porcine plasma. Ordinarily, the polypeptide binds with
an affinity of at least
about 107 I/mole. Most preferably, the antigenically active mpl ligand or TPO
polypeptide is a
polypeptide that binds to an antibody raised against the mpl ligand or TPO
having one of the above
described effector functions. The antibodies used to defne "biological
property" are rabbit polyclonal
antibodies raised by formulating the mpl ligand or TPO isolated from
recombinant cell culture or
aplastic porcine plasma in Freund's complete adjuvant, subcutaneously
injecting the formulation, and
13
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98110475
boosting the immune response by intraperitoneal injection of the formulation
until the titer of mpl
ligand or TPO antibody plateaus.
"Thrombopoietic activity" is defined as biological activity characterized by
accelerating the
proliferation, differentiation and/or maturation of megakaryocytes or
megakaryocyte precursors into
the platelet producing form of these cells. This activity may be measured in
various assays including
an in vivo mouse platelet rebound synthesis assay, induction of platelet cell
surface antigen assay as
measured by an anti-platelet immunoassay (anti-GPIIbIIIa) for a human leukemia
megakaryoblastic
cell line (CMK}, and induction of polyploidization in a megakaryoblastic cell
line (DAMI).
By the term "low-multiple" in connection with the dosing is meant the
administration of
l0 multiple doses of therapeutically effective amounts over a short period of
time. A low-multiple dose
may include 2 to about 6 doses per day, preferably 2-4 doses per day. Thus,
the present invention is
directed to the mere single administration of a therapeutically effective
amount of a thrombopoietin. It
has been found that a single administration produces a therapeutic effect
equivalent to that realized
when a therapeutically effective amount of the same material is administered
over the conventional
15 multiple many day regimen suggested and taught by the art.
The tenor "treatment cycle" as used herein means a course of radiation and/or
chemotherapeutic agent administration (treatment phase) in which a mammal or
patient is treated with
radiation and/or chemotherapeutic agent, generally followed by a period of
observation and recovery
(recovery phase). The treatment phase may include a single administration of
radiation and/or
20 chemotherapeutic agent or multiple administrations, preferably separated by
a period of time which is
usually chosen so as to minimize discomfort to the mammal or patient and allow
recovery of neutrophil
and platelet counts to about pretreatment levels. The time period is generally
determined by the
tolerance of the mammal or patient for the particular radiation and/or
chemotherapeutic agent. A
typical treatment phase may run I-10 days, preferably 1-6 or 1-4 days, during
which time the radiation
25 or chemotherapeutic agent is administered continuously or portion-wise. A
typical recovery phase may
run 5-60 days, preferably 14-24 days, during which time the mammal or patient
is observed, evaluated
and allowed to recover from the treatment. Optionally, more than one treatment
cycle may be given,
typically 2 to about 6 cycles depending on the particular treatment regimen
and the purpose of the
treatment.
30 Detailed Description of the Preferred Embodiments
It has now been discovered that TPO has pharmacokinetic properties which are
suprisingly
different than the properties of cytokines such as G-CSF and GM-CSF and which
allow TPO to be
administered prior to and/or concurrently with radiation and/or chemotherapy.
Prior and/or concurrent
administration of TPO has been found to reduce the depth of the nadir of
thrombocytopenia and to
35 shorten the time for platelet titer recovery in patients receiving
radiation and/or chemotherapeutic
treatment. This difference in properties of TPO is believed to derive from the
effect of TPO on early
14
CA 02288964 1999-11-O1
WO 98/52598 1'CT/US98/10475
progenitor cells in the hematopoiet~~ lineage. This effect appears to result
in a delay in the appearance
of more mature cells in the lineage following administration of TPO, allowing
radiation and/or
chemotherapy treatments to be given with little or clinically insignificant
loss of proliferating cells
during cytoreductive treatments. The discovery of these unique properties of
TPO is part of the present
invention.
This discovery is significant since patients receiving radiation and/or
chemotherapy frequently
require platelet transfusions. Frequent platelet transfusions may result in
alloimmunization. This
results in the need for HLA-matched donors and more frequent transfusions. The
provision of platelet
transfusions is an important and often difficult medical problem. Reducing the
need and frequency of
such transfusions improves patient care and mitigates complications associated
with transfusions, such
as blood antigen incompatibilities, lack of suitable platelet donors,
contamination of donated materials,
e.g. contamination with a virus, etc. Any treatment that prevents or shortens
the duration of prolonged
thrombocytopenia represents an important medical advance. The present
invention reduces the
necessity for platelet transfusions in patients experiencing thrombocytopenia.
The method of the invention hastens the recovery of platelet titers to
baseline levels and even
to substantially elevated levels following radiation and/or chemotherapy. The
generation of elevated
platelet titers is useful in preparing a patient for subsequent cycles of
radiation and/or chemotherapy
treatment. A patient entering a subsequent cycle of treatment with elevated
platelet levels is better able
to withstand the cytoreductive effects of the treatment. The invention,
therefore, is effective to increase
patient tolerance to a radiation and/or chemotherapeutic regimen relative to
the patient tolerance for the
regimen without administration of TPO according to the invention.
The method of the invention is also useful in mobilization therapy. In
mobilization therapy,
the peripheral blood progenitor cells are mobilized from the bone marrow to
reduce or eliminate
neutropenia and/or thrombocytopenia. In the method of the invention, TPO is
administered as a single
or low-multiple daily dose to mobilize peripheral blood progenitor cells.
Typically, the mammal is a
human patient having or at risk for thrombocytpenia, for example, as a result
of radiation and/or
chemotherapy or liver disease. According to the invention, TPO is administered
to the patient prior to
or concurrent with radiation or chemotherapy treatment. Of course, TPO may
also be administered
subsequent to radiation or chemotherapy treatment to restore platelet blood
titer in conjunction with the
prior or concurrent administration noted above. The TPO may also be
administered together with
another cytokine, e.g. G-CSF, IL-3, IL-6, GM-CSF, etc. The progenitor cells
which are mobilized by
the method of the invention may be collected by standard leukapheresis,
optionally frozen, and
retransplanted into the patient after radiation and/or chemotherapy. The
additional cytokine is
generally administered in an amount similar to the amount of TPO. For example,
in mobilization
therapy the TPO might be administered in an amount from about 0.1-10
microgram/kg alone or
together with an additional cytokine in a similar amount. For heterologous
bone marrow transplants,
TPO optionally in combination with another cytokine as discussed above, may be
administered to a
CA 02288964 1999-11-O1
WO 98/x'.598 PCT/US~~B/10~75
mammal including a human patient, for the purpose of mobilizing peripheral
blood progenitor cells
which may then be harvested by leukapheresis, optionally frozen and
transplanted into a mammal
having or at risk for thrombocytopenia. The mammal or patient donating the
heterologous bone
marrow graft (progenitor cells) and the transplant recipient may be tissue-
typed according to known
procedures. The TPO and other cytokine are generally administered in the
amounts discussed above
for autologous transplants.
Additionally, it is well known that repeated cycles of radiation and/or
chemotherapy result in a
cumulative myelosuppression which limits the dose intensity of individual
chemotherapeutic agents,
particularly when used in combination therapy. Commercially available myeloid
growth factors, such
as G-CSF, have helped to reduce neutropenia; however cumulative
thrombocytopenia remains a
problem. The present invention significantly reduces neutropenia during
combination chemotherapy
thereby increasing the number of treatment cycles a patient will tolerate
during chemotherapy. A
larger number of treatment cycles or stronger doses of the chemotherapeutic
agents improves the
cancer kill rate.
The method of the invention also reduces the likelihood of formation of anti-
TPO antibodies.
Immunogenicity is reduced or eliminated due to less frequent dosing, including
single doses, relative to
continuous daily dosing known in the art. Dosing is preferably intravenous.
However, hybrid regimen
in which IV dosing is combined with SC dosing is also contemplated by this
invention. For example, it
may be desirable to administer an initial IV dose of TPO before or shortly
after treatment with
radiation and/or chemotherapy in order to reduce the platelet nadir associated
with such treatment and
to accelerate recovery of platelet titers. This initial dose of TPO might be
followed by one or more SC
doses of TPO after the treatment to maintain the platelet levels.
An alternative to parenteral or subcutaneous delivery of TPO is aerosol
delivery. The
pulmonary route of administration is an attractive alternative to intravenous
(IV) or subcutaneous (SC)
delivery because of the ease of administration and the large surface area of
the lung for absorption.
However, the barrier to absorption of proteins is formidable and the mechanism
of absorption is
unclear. Despite the potential limitations, several proteins (e.g. insulin,
hGH, BSA, and LHRH) have
been delivered successfully via the lungs to target the systemic circulation.
See Adjei et al,
International J Pharm., 61:135-144, 1990; Colthorpe et al , Pharm. Res., 9:764-
768, 1992; Folkesson et
al , Acta Physiologica Scandinavia, 139:347-54, 1990; Patton et al, Biotech.
Therapeut., 1:213-228,
1989-90; and Niven et al, Pharm. Res., 12:1343-9, 1995. The table shown below
indicates proteins
which have been tested for delivery via the lung.
16
CA 02288964 1999-11-O1
WO 98152598 PCT/US98/10475
....Protein*Molecular WeightBioavailabilityReference
(kDa) (%)
LHRH 1.067 4-18 Adjei, et al, 1990
Insulin 5.7 5.6 (IT) Colthorpe et al,
1992
Insulin 5.7 57 (aerosol) Colthorpe et al,
1992
rhG-CSF 18.8 66 Niven et al, 1995
hGH 22.0 35 Patton et al, 1989
BSA 67.0 4.3 Folkesson et al,
1990
* LHRH=Leutinizing
hormone
releasing
hormone,
rhG-CSF=recombinant
human granulocyte-colony
stimulating
factor,
hGH= human
growth
hormone,
and BSA=
bovine
serum albumin
IT= intratracheal
instillation
In an interesting embodiment of this invention, it has been discovered that a
TPO, e.g.
recombinant human thrombopoietin (rhTPO), can be administered via aerosol
inhalation to target the
systemic circulation. rhTPO is an about 80 kD glycoprotein. Therapeutic serum
concentrations can be
achieved by delivering rhTPO to the lungs as a liquid or powder aerosol.
Solutions of TPO may be
nebulized using conventional nebulizers and administered to a mammal or human
patient through the
nose or mouth as an aerosol. TPO may also be dried to a powder, e.g. by spray-
drying, and
administered using a conventional dry powder inhaler. A higher dose of rhTPO
is required to achieve a
similar therapeutic effect when given as an aerosol as compared to IV.
Generally, the dose by aerosol
should be about 100-fold higher for aerosol administration as compared to IV
administration. A
suitable dose range for aerosol administration is about 5-1000 microgram/kg,
preferably 50-750
microgram/kg, as a single inhalation dose or as multiple inhalations on a
single day or on multiple
days, preferably 2-10 or 2-6, sequential or non-sequential days.
The method of the invention may be used with any radiation and/or chemotherapy
regimen in
which a mammal or human patient is having or is at risk of thrombocytopenia.
The method may be
used with conventional chemotherapeutic agents used in conventional amounts
including, but not
limited to asparaginase, bleomycin, calcium leucovorin, carmustine,
carboplatin, cisplatin,
cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin,
doxorubicin, epirubicin,
etoposide, fluorouracil, fluoxymesterone, flutamide, hexamethylmelamine,
hydroxyurea, ifosfamide,
leuprolide, levamisole, leuprolide depot, lomustine, mechlorethamine,
melphalan, mercaptopurine,
methotrexate, methyl-CCNU (semustine), methylprednisolone, mitomycin C,
mitoxantrone,
prednisolone, prednisone, procarbazine, streptozocin, tamoxifen, thioguanine,
triethylene-
thiophosphoramide, vinblastine, vincristine, and combinations thereof. These
compounds may,
optionally, be given with a known uroprotecting compound such as mesna, etc.
where appropriate and
indicated. Mesna is commercially available and is routinely give to counteract
the urinary tract
irritation and hemorragic cystitis due to chemotherapeutic agent metabolites,
e.g. ifosfamide
17
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
metabolites. Typically, the chemotherapeutic agents are given in combination
to maximize tumor cell
kill with minimal or at least acceptable toxicity to the mammal or patient.
The method of the invention
further reduces this toxicity. Suitable non-limiting chemotherapy regimen with
which the method of the
invention may be used are listed below using conventional acronyms and
indicating specific
tumors/cancers for which the regimen is contemplated. The chemotherapeutic
agents may be
administered in conventional amounts and according to conventional treatment
times and regimen.
See, for example, "The Cerenex Handbook", Robert S. Benjamin, Ed., Cerenex
Pharmaceuticals,
Research Triangle Park, N.C. (1993); "Combination Cancer Chemotherapy
Regimens", Roger W.
Anderson and William J. Dana, Eds., Laderley Laboratories (1991). Any
cytoreductive regimen which
induces thrombocytopenia is considered to within the scope of the invention,
however.
Breast Cancer
CAF - cyclophosphamide, doxorubicin, fluorouracil
CFM - cyclophosphamide, doxorubicin, mitoxantrone
CFPT - cyclophosphamide, fluorouracil, prednisolone, tamoxifen
CMF - cyclophosphamide, methotrexate, fluorouracil
CMFP - cyclophosphamide, methotrexate, fluorouracil, prednisolone
CMFVP - cyclophosphamide, methotrexate, fluorouracil, vincristine,
prednisolone
FAC - fluorouracil, doxorubicin, cyclophosphamide
IMF - ifosfamide, methotrexate, fluorouracil, mesna
VATH - vinblastine, doxorubicin, thiotepa, fluoxymesterone
CEP - cyclophosphamide, etoposide, cisplatin
ICE - ifosfamide, cyclophosphamide, etoposide
AC - doxorubicin, cyclophosphamide
FLAC - fluorouracil, calcium Ieucovorin, doxorubicin, cyclophosphamide
Colon Cancer
F-CL - Fluorouracil, calcium leucovorin
FLe - levamisole, fluorouracil
FMV - fluorouracil, methyl-CCNU, vincristine
Gastric Cancer
FAM - fluorouracil, doxorubicin, mitomycin C
FAME - fluorouracil, doxorubicin, methyl-CCNLJ
FCE - fluorouracil, cisplatin, etoposide
Genitourinary Cancer
CAP - cisplatin, doxorubicin, cyclophosphamide
CISCA - cyclophosphamide, doxorubicin, cisplatin
CVEB - cisplatin, vinblastine, etoposide, bleomycin
FL - flutamide, leuprolide acetate or flutamide, leuprolide acetate depot
18
CA 02288964 1999-11-O1
WO 98/525~
PCT/US98/10475
L-VAM - leuprolide acetate, vinblastine, doxorubicin, mitomycin C
MVAC - methotrexate, vinblastine, doxorubicin, cisplatin
VAB - vinblastine, dactinomycin, bleomycin, cisplatin, cyclophosphamide
VB - vinblastine, methotrexate
. 5 VBP - vinblastine, bleomycin, cisplatin Gestational Trophoblastic Disease
DMC - dactinomycin, methotrexate, cyclophosphamide
Head and Neck Cancer
CF - cisplatin, fluorouracil
CFL - cisplatin, fluorouracil, calcium leucovorin
COB - cisplatin, vincristine, bleomycin
MAP - mitomycin C, doxorubicin, cisplatin
MBC - methotrexate, bleomycin, cisplatin
MF - methotrexate, fluorouracil, calcium leucovorin
Leukemias
Acute Lymphocytic Leukemia {A.L.L.)
DVP - daunorubicin, vincristine, prednisone
MM - mercaptopurine, methotrexate
AVDP - asparaginase, vincristine, daunorubicin, prednisone
Acute Myelogenous Leukemia (A.M.L.)
AA - cytarabine, doxorubicin
COAP - cyclophosphamide, vincristine, cytarabine, prednisone
MV - mitoxantrone, etoposide
Acute Non-Lymphocytic Leukemia (A.N.L.L.)
DCT - daunorubicin, cytarabine, thioguanine
MC - mitoxantrone, cytarabine
CD - cytarabine, daunorubicin
TC - thioguanine, cytarabine
Chronic Lymphatic Leukemia (C.L.L.)
CVP - cyclophosphamide, vincristine, prednisone
Lun~Cancer
Small Cell
COPE - cyclophosphamide, cisplatin, etoposide, vincristine
CV - cisplatin, etoposide
VAC - vincristine, doxorubicin, cyclophosphamide
VC - etoposide, carboplatin
ICE - ifosfamide, cyclophosphamide, etoposide
CEP - cyclophosphamide, etoposide, cisplatin
19
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Non-small Cell
BACON - bleomycin, doxorubicin, lomustine, vincristine, mechlorethamine
CAMP - cyclophosphamide, doxorubicin, methotrexate, procarbazine
CAP - cyclophosphamide, doxorubicin, cisplatin
CV - cisplatin, etoposide
CVI - cisplatin, etoposide, ifosfamide, mesna
FAM - fluorouracil, doxorubicin, mitomycin C
FOMi/CAP - fluorouracil, vincristine, mitomycin C, cyclophosphamide,
doxorubicin,
cisplatin
MACC - methotrexate, doxorubicin, cyclophosphamide, lomustine
ICE - ifosfamide, cyclophosphamide, etoposide
CEP - cyclophosphamide, etoposide, cisplatin
Lym~homa
Hodgkin's
ABVD - doxorubicin, bleomycin, vincristine, dacarbazine
B-CAVe - bleomycin, lomustine, doxorubicin, vinblastine
B-DOPA - bleomycin, dacarbazine, vincristine, prednisone, doxorubicin
CVPP - lomustine, vinblastine, procarbazine, prednisone
MOPP - mechlorethamine, vincristine, procarbazine, prednisone
MVPP - mechlorethamine, vinblastine, procarbazine, prednisone
NOVP - mitoxantrone, vinblastine, prednisone, vincristine
Non-Hodgkin's
ASHAP - doxorubicin, cisplatin, cytarabine, methylprednisolone
BACOP - bleomycin, doxorubicin, cyclophosphamide, vincristine, prednisone
CHOP - cyclophosphamide, doxorubicin, vincristine, prednisone
CHOP-Bleo - cyclophosphamide, doxorubicin, vincristine, prednisone , bleomycin
COMLA - cyclophosphamide, vincristine, methotrexate, calcium leucovorin,
cytarabine
COP - cyclophosphamide, vincristine, prednisone
COPP - cyclophosphamide, vincristine, procarbazine, prednisone
CVP - cyclophosphamide, vincristine, prednisone
E-SHAP - etoposide, cisplatin, cytarabine, methylprednisolone
IMVP-16 - ifosfamide, mesna, methotrexate, etoposide
m-BACOD - bleomycin, doxorubicin, cyclophosphamide, vincristine,
dexamethasone, methotrexate, calcium leucovorin
m-BACOS - doxorubicin, vincristine, bleomycin, cyclophosphamide, methotrexate,
calcium leucovorin
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
MINE - mesna, ifosfamide, mitoxantrone, etoposide
OPEN - etoposide, mitoxantrone, vincristine, prednisone
Pro-MACE - prednisone, methotrexate, calcium leucovorin, doxorubicin,
cyclophosphamide, etoposide
AI - doxorubicin, ifosfamide
AC - doxorubicin, cyclophosphamide
ICE - ifosfamide, cyclophosphamide, etoposide
CEP - cyclophosphamide, etoposide, cisplatin
Malignant Melanoma
BHD - carmustine, hydroxyurea, dacarbazine
DTIC-ACTD - dacarbazine, dactinomycin
VBC - vinblastine, bleomycin, cisplatin
VDP - vinblastine, dacarbazine, cisplatin
Multiple M~eloma
AC - doxorubicin, carmustine
BCP - carmustine, cyclophosphamide, prednisone
MeCP - methyl-CCNU, cyclophosphamide, prednisone
MP - melphaian, prednisone
M-2 - vincristine, carmustine, cyclophosphamide, melphalan, prednisone
VAD - vincristine, doxorubicin, dexamethasone
VBAP - vincristine, carmustine, doxorubicin, prednisone
VCAP - vincristine, cyclophosphamide, doxorubicin, prednisone
Ovarian Cancer
Epithelial
C - carboplatin
AP - doxorubicin, cisplatin
CDC - carboplatin, doxorubicin, cyclophosphamide
CHAD - cyclophosphamide, doxorubicin, cisplatin, hexamethylmelamine
CHAP - cyclophosphamide, hexamethylmelamine, doxorubicin, cisplatin
CP - cyclophosphamide, cisplatin
PAC - cisplatin, doxorubicin, cyclophosphamide
AC - doxorubicin, cyclophosphamide
ICE - ifosfamide, cyclophosphamide, etoposide
CEP - cyclophosphamide, etoposide, cisplatin
Germ Cell
VAC - vincristine, dactinomycin, cyclophosphamide
21
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/1t1475
Endometrial Cancer
C - carboplatin
AC - doxorubicin, cyclophosphamide
Pancreatic Cancer
FMS - fluorouracil, mitomycin C, streptozocin
SD - streptozocin, doxorubicin
Pediatric Tumors
A.L.L.
DVP - daunorubicin, vincristine, prednisone
VAP - daunorubicin, asparaginase, prednisone
CT - cytarabine, thioguanine
DCPM - daunorubicin, cytarabine, prednisolone, mercaptopurine
A.N.L.L.
DC - daunorubicin, cytarabine
Bony sarcoma
AC - doxorubicin, cisplatin
HDMTX - methotrexate, calcium leucovorin
T-2 - dactinomycin, doxorubicin, vincristine, cyclophosphamide
Hodgkin's disease
ACOPP - doxorubicin, cyclophosphamide, vincristine, procarbazine, prednisone
MOPP - mechlorethamine, vincristine, procarbazine, prednisone
Soft Tissue Sarcoma
VAC - vincristine, dactinomycin, cyclophosphamide
Sarcoma
Bony Sarcoma
AC - doxorubicin, cisplatin
CYVADIC - cyclophosphamide, vincristine, doxorubicin, dacarbazine
HDMTX - methotrexate, calcium leucovorin
IMAC - ifosfamide, mesna, doxorubicin, cisplatin
Soft Tissue
CYADIC - cyclophosphamide, doxorubicin, dacarbazine
CYVADIC - cyclophosphamide, vincristine, doxorubicin, dacarbazine
ID - ifosfamide, mesna, doxorubicin
VAC - vincristine, dactinomycin, cyclophosphamide
AI - ifosfamide, doxorubicin
MAID - mesna, doxorubicin, ifosfamide, dacarbazine
22
CA 02288964 1999-11-O1
W O 98/52598 PCT/US98/1 ~ i. =°5
Selected regimens particularly associated with thrombocytopenia which may be
treated with
the method of the invention include:
Regimens Malignancy
~ carboplatin/paclitaxel Ovary
NSCLC
~ FUDR/leucovorin/doxorubicin/cisplatin HBV+/HCV+ Hepatoma
~ cisplatin/alpha interferon/5-FU/ HBV+/HCV+ Hepatoma
doxorubicin
~ ifosfamide/mesna/carboplatin/etoposide NSCLC
~ cisplatin/ifosfamide/mesna/etoposide Testicle
~ High-dose carboplatin/etoposide Testicle (salvage)
~ methotrexate/vinblastine/doxorubicin/ Bladder
cisplatin
~ BCNU (carmustine) Glioblastoma
~ procarbazine/CCNU/vincristine Brain
~ cyclophaphamide/etoposide +/- Salvage Hodgkin's disease, breast,
cisplatin or carboplatin ovary, non-Hodgkin's lymphoma, head
and neck, lung, myeloma, sarcoma
~ dexamethasone/HIDAC/cisplatin salvage non-Hodgkin's lymphoma
~ mesna/ifosfamide/doxorubicin/+ DTIC Soft tissue sarcoma
~ cyclophophamide/vincristine/DTIC Soft tissue sarcoma
doxorubicin
The single or low multiple dose of the invention may be given prior to the
first treatment time
of radiation and/or chemotherapeutic agent in a treatment cycle, during or
concurrent with a treatment
time in a treatment cycle or following one or more individual treatment times
of radiation or
chemotherapeutic agent in a treatment cycle. For example, a cycle may
constitute a single treatment
time of radiation or chemotherapeutic agent. In the invention, the single or
low-multiple dose of TPO
would be administered before, during or after this treatment time.
Alternatively, the cycle may
constitute multiple treatment times, for example 2-10 or more treatment times,
of radiation or
chemotherapeutic agent. Here, the invention contemplates administering TPO
before, during or after
any one treatment time or before, during or after each individual treatment
time. For example, the
cycle may constitute three treatments with a chemotherapeutic agent. In the
method of the invention,
TPO might be administered before each of the three treatment times or might be
administered after
each of the three treatment times. Of course, the invention also includes
administration of a single
23
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
daily dose of TPO before the first treatment time of the chemotherapeutic
agent in the cycle and after
the last treatment time in the cycle.
In a preferred embodiment, the mammal receives at least one treatment cycle of
radiation
and/or chemotherapeutic agent, where the treatment cycle has a first treatment
time TO and a last
treatment time TF for administering radiation and/or chemotherapeutic agent.
The dose of TPO is
preferably administered at TO plus or minus 24 hours, more preferably TO plus
or minus 10 hours, still
more preferably TO plus or minus 6 hours, and most preferably TO plus or minus
2 hours.
In alternative embodiments, the dose is administered at TO or prior to T0, but
not more than
seven days prior to T0, preferably not more than one day prior to T0. For
single dose cycles, TO = Tp.
In another preferred embodiment, the dose is administered prior to Tp, but not
more than seven days
prior to Tp. As noted above, TPO may also be administered after Tp. When a
second dose of TPO is
administered after TF, the dose is preferably administered not more than 24
hours after Tp. The
mammal or patient may, of course, receive multiple treatment cycles, generally
2-6 cycles, but as many
cycles as is medically necessary to reduce the size of or to completely
irradicate a cancer or tumor. In
some treat regimen, a tumor is reduced in size relative to the size of the
tumor prior to radiation and/or
chemotherapy treatment, and then surgery is utilized to remove the remaining
malignant tissue of the
tumor. The method of the invention may be used in these regimen as well.
The invention also includes co-administering a therapeutically effective
amount of a cytokine,
a colony stimulating factor and an interleukin, generally after administration
of the TPO dose,
preferably after administration of the last TPO dose in a treatment cycle. The
cytokine is preferably
KL, LIF, G-CSF, GM-CSF, M-CSF, EPO, FLT-3, IL-1, IL-2, IL-3, IL-5, IL-6, IL-7,
IL-8, IL-9 or IL-
1 l, in particular, G-CSF or GM-CSF.
It has been found in accord with the present invention that the single or low
multiple
administration regimen of the present invention is effective at daily dosage
rates on the order of about
0.1 to 50, preferably about 0.1 to 10, more preferably about 1 to 5, or
preferably about 1 to 3
microgram/kg body weight of the patient. In single dosing, preferred would be
the total administration
of about 2 ~1.5 microgram/kg of body weight. In low-multiple dosing, preferred
would be the
administration of from about 0.5 to 1.5 microgram/kg body weight per dose. The
above dosages are
predicated on preferred intravenous administration. In administration via the
subcutaneous route, the
total amount administered would be in the range of about one to three times
the amount administered
via the intravenous route, preferably about two times. Further, the doses for
administration via the lung
are higher as noted above. Specific therapeutically effective dosages for
individual patients may be
determined by conventional methods.
The method of the invention also preferably provides a dose of TPO sufficient
to maintain a
blood TPO level in the mammal of 35 x 10-12 M or greater during the radiation
and/or chemotherapy
24
CA 02288964 1999-11-O1
-WO 98/52598 PCT/US98/10475
treatment cycle. Preferably, the dose is sufficient to maintain a blood TPO
level of 100 x 10 IZ M or
greater, more preferably about 35 x 10-12 M to about 3500 x 10-12 M during the
treatment cycle.
The optimal dosage rate and regimen will be determined by the attending
physician taking into
consideration various factors known to modify the action of drugs including
severity and type of
disease, body weight, sex, diet, time and route of administration, other
medications and other relevant
clinical factors.
It will be understood that although a single daily administration of a
thrombopoietin to a
patient has been found to be therapeutically effective for the treatment of
thrombocytopenia, it can be
appreciated that a low-multiple (daily) regimen may be employed. It has been
found that a single dose
stimulates the onset of therapeutic response, and although multiple dosing is
contemplated herein,
termination of dosing after a single or low-multiple administration is
independent of therapeutic
response.
The biologically active thrombopoietin materials of the present invention can
be administered,
in accord herewith, in various routes including via the nose or lung,
subcutaneously, and preferably
intravenously. In all events, depending upon the route of administration, the
biologically active
thrombopoietin materials of the present invention are preferably administered
in combination with an
appropriate pharmaceutically acceptable carrier or excipient. When
administered systemically, the
therapeutic composition should be pyrogen-free and in a parenterally
acceptable solution having due
regard for physiological pH isotonicity and stability. These conditions are
generally well known and
accepted to those of skill in the appropriate art.
Briefly, dosage formulations of the materials of the present invention are
prepared for storage
or administration by mixing the compound having the desired degree of purity
with physiologically
acceptable carriers, excipients and/or stabilizers. Such materials are non-
toxic to the recipients at the
dosages and concentrations employed and include buffers such as phosphate,
citrate, acetate and other
organic acid salts; antioxidants such as ascorbic acid; low molecular weight
peptides such as
polyarginine, proteins such as serum albumen, gelatin or immunoglobulins;
hydrophilic polymers such
as polyvinylpyrrolidinone; amino acids such as glycine, glutamic acid,
aspartic acid or arginine;
monosaccharides, disaccharides and other carbohydrates including cellulose or
its derivatives, glucose,
mannose or dextrins; chelating agents such as EDTA; sugar alcohol such as
mannitol or sorbitol;
counter-ions such as sodium; and/or non-ionic surfactants such as TWEEN,
PLURONICS or
polyethylene glycol.
The biologically active thrombopoietin materials hereof can be administered as
the free acid or
base form or as a phanmaceutically acceptable salt and are compounded with a
physiologically
acceptable vehicle, carrier, excipient, binder, preservative, stabilizer,
flavoring agent, etc. as called for
by accepted pharmaceutical practice.
CA 02288964 1999-11-O1
- WO 98/52598 PCT/US98/10475
~ter~le compositions for injection can be formulated according to conventional
pharmaceutical
or pharmacological practice. For example, dissolution or suspension of the
active material in a vehicle
such as water or naturally occurring vegetable oil like sesame, peanut, or
cottonseed oil or a synthetic
fatty vehicle like ethyl oleate or the like may be desired. Again, buffers,
preservatives, anti-oxidants
and the like can be incorporated according to accepted pharmaceutical
practice. The biologically
active thrombopoietin materials of the present invention may be employed alone
or administered in
combination with other cytokines, hematapoietins, interleukins, growth
factors, or antibodies in the
treatment of the above identified disorders and conditions marked by
thrombocytopenia. Thus, the
present active materials may be employed in combination with other protein or
peptide having
thrombopoietic activity including: G-CSF, GM-CSF, LIF, M-CSF, IL-2, IL-3,
erythropoietin (EPO),
Kit ligand, IL-6, IL-1 l, FLT-3 ligand, and so forth.
Suitable examples of sustained-release preparations include semipermeable
matrices of solid
hydrophobic polymers containing the polypeptide, which matrices are in the
form of shaped articles,
e.g. films, or microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels
(e.g. poly{2-hydroxyethyl-methacrylate) as described by Langer et al. J.
Biomed Mater. Res., 15:167-
277 (1981) and Langer, Chem. Tec., 12:98-105 (1982) or poly(vinylalcohol)),
polylactides (U.S. Patent
No. 3,779,919, EP 58,481), copolymers of Irglutamic acid and gamma ethyl-L-
glutamate (Sidman et
al.Biopolymers, 22:547-556 (1983)), non-degradable ethylene-vinyl acetate
(Langer et al., supra),
degradable lactic acid-glycolic acid copolymers such as the LUPROM DEPO'I'r
(injectable
microspheres composed of lactic acid-glycolic acid copolymer and leuprolide
acetate), and poly-D-(-)-
3-hydroxybutyric acid (EP 133,988).
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid
enable release of
molecules for over 100 days, certain hydrogels release proteins for shorter
time periods. When
encapsulated proteins remain in the body for a long time, they may denature or
aggregate as a result of
exposure to moisture at 37°C, resulting in a loss of biological
activity and possible changes in
immunogenicity. Rational strategies can be devised for protein stabilization
depending on the
mechanism involved. For example, if the aggregation mechanism is discovered to
be intermolecular S-
S bond formation through disulfide interchange, stabilization may be achieved
by modifying sulfllydryl
residues, lyophilizing from acidic solutions, controlling moisture content,
using appropriate additives,
and developing specific polymer matrix compositions.
Sustained-release thrombopoietic protein compositions also include liposomally
entrapped
megakaryocytopoietic protein. Liposomes containing megakaryocytopoietic
protein are prepared by
methods knew per se: DE, 3,218,121; Epstein et al.Proc. Natl. Acad. Sci. USA,
82:3688-3698 ( 1985);
Hwang et al.Proc. Natl. Acad Sci. USA, 77:4030-4034 (1980); EP 52,322; EP
36,676; EP 88,046; EP
143,949; EP 142,641; Japanese patent application 83-118008; U.S. Patent Nos.
4,485,045 and
4,544,545; and EP 102,324. Ordinarily the liposomes are of the small (about
200-800 Angstroms)
26
CA 02288964 1999-11-O1
WO 98/52598 PCTNS98/10475
unilamellar type in which the lipid content is greater than about 30 mol. %
cholesterol, the selected
proportion being adjusted for the optimal megakaryocytopoietic protein
therapy.
A type of covalent modification of TPO or mpl ligand comprises linking the TPO
polypeptide
to one of a variety of nonproteinaceous polymers, e.g. polyethylene glycol,
polypropylene glycol, or
polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835;
4,496,689; 4,301,144;
4,670,417; 4,791,192 or 4,179,337. TPO polypeptides covalently linked to the
forgoing polymers are
referred to herein as pegylated TPO.
It will be appreciated that some screening of the recovered TPO variant will
be needed to select
the optimal variant for binding to a mpl and having the immunological and/or
biological activity
defined above. One can screen for stability in recombinant cell culture or in
plasma (e.g., against
proteoiytic cleavage), high affinity to a mpl member, oxidative stability,
ability to be secreted in
elevated yields, and the like. For example, a change in the immunological
character of the TPO
polypeptide, such as amity for a given antibody, is measured by a competitive-
type immunoassay.
Other potential modifications of protein or polypeptide properties such as
redox or thermal stability,
hydrophobicity, or susceptibility to proteolytic degradation are assayed by
methods well known in the
art.
Methods of Making
Isolation of the Human mpl Ligand (TPO) Gene
Human genomic DNA clones of the TPO gene were isolated by screening a human
genomic
library in 8-Gem 12 with pR45, under low stringency conditions or under high
stringency conditions
with a fragment corresponding to the 3N half of human cDNA coding for the mpl
ligand. Two
overlapping lambda clones spanning 35 kb were isolated. Two overlapping
fragments (BamHI and
EcoRI) containing the entire TPO gene were subcloned and sequenced.
The structure of the human gene is composed of 6 exons within 7 kb of genomic
DNA. The
boundaries of all exon/intron junctions are consistent with the consensus
motif established for
mammalian genes (Shapiro, M.B. et al., Nucl. Acids. Res. 15:7155 (1987)). Exon
1 and exon 2 contain
5N untranslated sequence and the initial four amino acids of the signal
peptide. The remainder of the
secretory signal and the first 26 amino acids of the mature protein are
encoded within exon 3. The
entire carboxyl domain and 3N untranslated as well as ~50 amino acids of the
erthropoietin-like
domain are encoded within exon 6. The four amino acids involved in the
deletion observed within
hML-2 (hTPO-2) are encoded at the SN end of exon 6.
Analysis of human genomic DNA by Southern blot indicated the gene for TPO is
present in a
single copy. The chromosomal location of the gene was determined by
fluorescent in situ
hybridization (FISH) which mapped to chromosome 3q27-28.
27
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Expression and Purification of TPO from 293 Cells
Preparation and purification of ML or TPO from 293 cells is described in
detail in Example 1.
Briefly, cDNA corresponding to the TPO entire open reading frame was obtained
by PCR using pRKS-
hmpl I. The PCR product was purified and cloned between the restriction sites
CIaI and XbaI of the
plasmid pRKStkneo.ORF (a vector coding for the entire open reading frame).
A second vector coding for the EPO homologous domain was generated the same
but using
different PCR primers to obtain the final construct called pRKS-tkneoEPO-D.
These two constructs were transfected into human embryonic kidney cells by the
CaP04
method and neomycin resistant clones were selected and allowed to grow to
confluency. Expression of
ML 153 or ML332 in the conditioned media from these clones was assessed using
the BaIF3-mpl
proliferation assay.
Purification of rhML332 was conducted as described in Example 1. Briefly, 293-
rhML332
conditioned media was applied to a BLUE-SEPHAROSE (Pharmacia) column that was
subsequently
washed with a buffer containing 2M urea. the column was eluted with a buffer
containing 2M urea and
1M NaCI. The BLUE-SEPHAROSE elution pool was then directly applied to a WGA-
SEPHAROSE
column, washed with 10 column volumes of buffer containing 2M urea and 1M NaCI
and eluted with
the same buffer containing O.SM N-acetyl-D-glucosamine. The WGA-SEPHAROSE
eluate was
applied to a C4-HPLC column (Synchrom, Inc.) and eluted with a discontinuous
propanol gradient. By
SDS-PAGE the purified 293-fhML332 migrates as a broad band in the 68-80 kDa
region of the gel.
Purification of rhML,53 was also conducted as described in Example 1. Briefly,
293-rhML153
conditioned media was resolved on BLUE-SEPHAROSE as described for rhML332. The
BLUE-
SEPHAROSE eluate was applied directly to a mpl-affinity column as described
above. RhML153
eluted from the mpl-affinity column was purified to homogeneity using a C4-
HPLC column run under
the same conditions used for rhML332~ BY SDS-PAGE the purified rhML153
resolves into 20 major
and 2 minor bands with Mr of 18,000-22,000.
Expression and Purification of TPO from Chinese Hamster Ovary (CHO) Cells
The expression vectors used to transfect CHO cells are designated:
pSVIS.ID.LL.MLORF (full
length of TP0332), ~d pSVIS.ID.LL.MLEPO-D (truncated or TP0153)~
cDNA corresponding to the entire open reading frame of TPO was obtained by
PCR. The PCR
product was purified and cloned between two restriction sites (CIaI and SaII)
of the plasmid
pSVIS.ID.LL to obtain the vector pSVIS.ID.LL.MLORF. A second construct
corresponding to the
EPO homologous domain was generated the same way but using a different reverse
primer
(EPOD.SaI). The final construct for the vector coding for the EPO homologous
domain of TPO is
called pSVIS.ID.LL.MLEPO-D.
28
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
These two constructs were linearized with Notl and transfected into Chinese
Hamster Ovary
cells (CHO-DP12 cells, EP 307,247 published 15 March 1989) by electroporation.
107 cells were
electroporated in a BRL electroporation apparatus (350 Volts, 330 mF, low
capacitance) in the
presence of 10, 25 or 50 mg of DNA as described (Andreason, G.L. J. Tissue
Cult. Meth., 15:56
(1993)). The day following transfection, cells were split in DHFR selective
media (High glucose
DMEM-F 12 50:50 without glycine, 2mM glutamine, 2-5% dialyzed fetal calf
serum). 10 to 15 days
later individual colonies were transferred to 96 well plates and allowed to
grow to confluency.
Expression of ML153 or ML332 in the conditioned media from these clones was
assessed using the
BalF3-mpl proliferation assay.
The process for purifying and isolating TPO from harvested CHO cell culture
fluid is described
in Example 2. Briefly, harvested cell culture fluid (HCCF) is applied to a
BLUE-SEPHAROSE
column (Pharmacia) at a ratio of approximately 1 OOL of HCCF per liter of
resin. The column is then
washed with 3 to 5 column volumes of buffer followed by 3 to 5 column volumes
of a buffer
containing 2.OM urea. TPO is then eluted with 3 to 5 column volumes of buffer
containing both 2.OM
urea and 1.OM NaCI.
The BLUE-SEPHAROSE eluate pool containing TPO is then applied to a wheat germ
lectin
SEPHAROSE column (Pharmacia) equilibrated in the BLUE-SEPHAROSE eluting buffer
at a ratio of
from 8 to 16 ml of BLUE-SEPHAROSE eluate per ml of resin. The column is then
washed with 2 to 3
column volumes of equilibration buffer. TPO is then eluted with 2 to 5 column
volumes of a buffer
containing 2.OM urea and O.SM N-acetyl-D-glucosamine.
The wheat germ lectin eluate containing TPO is then acidified and Cl2Eg is
added to a final
concentration of 0.04%. The resulting pool is applied to a C4 reversed phase
column equilibrated in
O1% TFA, 0.04% Cl2Eg at a load of approximately 0.2 to 0.5 mg protein per ml
of resin.
The protein is eluted in a two phase linear gradient of acetonitrile
containing 0.1 % TFA and
0.04% Cl2Eg and a pool is made on the basis of SDS-PAGE.
The C4 Pool is then diluted and diafiltered versus approximately 6 volumes of
buffer on an
AMICON YM or like ultrafiltration membrane having a 10,000 to 30,000 Dalton
molecular weight cut-
off. The resulting diafiltrate may be then directly processed or further
concentrated by ultrafiltration.
The diafiltrate/concentrate is usually adjusted to a final concentration of
0.01% TWEEN-80.
All or a portion of the diafiltrate/concentrate equivalent to 2 to S% of the
calculated column
volume is then applied to a SEPHACRYL S-300 HR column (Pharmacia) equilibrated
in a buffer
containing 0.01% TWEEN-80 and chromatographed. The TPO containing fractions
which are free of
aggregate and proteolytic degradation products are then pooled on the basis of
SDS-PAGE. The
resulting pool is filtered and stored at 2-8°C.
29
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Methods for Transforming and Inducing TPO Synthesis in a Microorganism and
Isolating, Purifying
and Refolding TPO Made Therein
Construction of E. toll TPO expression vectors is described in detail in
Example 3. Briefly,
plasmids pMP2l, pMP151, pMP4l, pMP57 and pMP202 were all designed to express
the first 155
amino acids of TPO downstream of a small leader which varies among the
different constructs. The
leaders provide primarily for high level translation initiation and rapid
purification. The plasmids
pMP210-1, -T8, -21, 22, -24, -25 are designed to express the first 153 amino
acids of TPO downstream
of an initiation methionine and differ only in the codon usage for the first 6
amino acids of TPO, while
the plasmid pMP251 is a derivative of pMP210-1 in which the carboxy-terminal
end of TPO is
extended by two amino acids. All of the above plasmids will produce high
levels of intracellular
expression of TPO in E. toll upon induction of the tryptophan promoter
(Yansure, D. G. et al.,
Methods in Enrymology> 185:54-60 (Goeddel, D.V., Ed.) Academic Press, San
Diego (1990)). The
plasmids pMPI and pMP172 are intermediates in the construction of the above
TPO intracellular
expression plasmids. The above TPO expression plasmids were used to transform
the E. toll using the
CaCl2 heat shock method (Mandel, M. et al., J. Mol. Biol, 53:159-162, ( 1970))
and other procedures
described in Example 3. Briefly, the transformed cells were grown first at
37°C until the optical
density (600 nm) of the culture reached approximately 2-3. The culture was
then diluted and, after
growth with aeration, acid was added. The culture was then allowed to continue
growing with aeration
for another 15 hours after which time the cells were harvested by
centrifugation.
The isolation, purification and refolding procedures given below for
production of biologically active,
refolded human TPO or fragments thereof is described in Example 4 can be
applied for the recovery of
any TPO variant including N and C terminal extended forms. Other procedures
suitable for refolding
recombinant or synthetic TPO can be found in the following patents: Builder et
al., US 4,511,502;
Jones et al., US 4,512,922; Olson, US 4,518,526 and Builder et al., US
4,620,948; for a general
description of the recovery and refolding process for a variety of recombinant
proteins expressed in an
insoluble form in E. toll .
Methods for Measurement of Thrombopoietic Activity
Thrombopoietic activity may be measured in various assays including the Ba/F3
mpl ligand
assay. An in vivo mouse platelet rebound synthesis assay, induction of
platelet cell surface antigen
assay as measured by an anti-platelet immunoassay (anti-GPIIbIIIa) for a human
leukemia
megakaryoblastic cell line (CMK) (see Sato et al., Brit. J. Heamatol., 72:184-
190 (1989)) and
induction of polyploidization in a megakaryoblastic cell line (DAMI) (see
Ogura et al., Blood,
72( 1 ):49-60 ( 1988)). Maturation of megakaryocytes from immature, largely
non-DNA synthesizing
cells, to morphologically identifiable megakaryocytes involves a process that
includes appearance of
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
cytoplasmic organelles, acquisition of membrane antigens (GPIIbIIIa),
endoreplication and release of
platelets as described in the background. A lineage specific promoter (i.e.
the mpl ligand) of
megakaryocyte maturation would be expected to induce at least some of these
changes in immature
megakaryocytes leading to platelet release and alleviation of
thrombocytopenia. Thus, assays were
designed to measure the emergence of these parameters in immature
megakaryocyte cell lines, i.e.,
CMK and DAMI cells. The CMK assay measures the appearance of a specific
platelet marker,
GPIIbIIIa, and platelet shedding. The DAMI assay measures endoreplication
since increases in ploidy
are hallmarks of mature megakaryocytes. Recognizable megakaryocytes have
ploidy values of 2N, 4N,
8N, 16N, 32N, etc. Finally, the in vivo mouse platelet rebound assay is useful
in demonstrating that
administration of the test compound (here the mpl ligand) results in elevation
of platelet numbers.
Two additional in vitro assays have been developed to measure TPO activity.
The first is a
kinase receptor activation (KIRA) ELISA in which CHO cells are transfected
with a mpl-Rse chimera
and tyrosine phosphorylation of Rse is measured by ELISA after exposure of the
mpl portion of the
chimera to mpl ligand. The second is a receptor based ELISA in which ELISA
plate coated rabbit anti-
human IgG captures human chimeric receptor mpl-IgG which binds the mpl ligand
being assayed. A
biotinylated rabbit polyclonal antibody to mpl ligand (TP0155) is used to
detect bound mpl ligand
which is measured using streptavidin-peroxidase.
Therapeutic Use of Thrombopoietin Materials
The biologically active thrombopoietic protein (TPO) may be used in a sterile
pharmaceutical
preparation or formulation to stimulate megakaryocytopoietic or thrombopoietic
activity in patients
suffering from thrombocytopenia due to impaired production, sequestration, or
increased destruction of
platelets. Thrombocytopenia-associated bone marrow hypoplasia (e.g. aplastic
anemia following
chemotherapy or bone marrow transplant) may be effectively treated with the
compounds of this
invention as well as disorders such as disseminated intravascular coagulation
(DIC), immune
thrombocytopenia (including HIV-induced ITP and non HIV-induced ITP), chronic
idiopathic
thrombocytopenia, congenital thrombocytopenia, myelodysplasia, and thrombotic
thrombocytopenia.
Additionally, these megakaryocytopoietic proteins may be useful in treating
myeloproliferative
thrombocytotic diseases as well as thrombocytosis from inflammatory conditions
and in iron
deficiency.
The method of the invention is also useful to treat mammals or human patients
which have
suffered from exposure to ionizing radiation sufficient to cause
thrombocytopenia, for example,
persons exposed to nuclear accidents such as the well-known accident which
occurred at Chernobyl.
TPO is well tolerated by patients and this may justify the rapid
administration of TPO within a few
hours after a nuclear accident to all persons affected by radiation. As noted
in more detail below, the
TPO responsiveness of progenitor cells appears to be very large shortly after
exposure of a person to
31
CA 02288964 1999-11-O1
WO 9a . .:598 YLT/US98/10475
radiation and/or chemotherapy. the method of the invention may also be used as
a radioprotective
procedure by administering TPO prophylactically to a person who will be
exposed to ionizing
radiation. For example, an emergency worker may be required to enter highly
contaminated areas in
cases of a major nuclear accident. Administration of a prophylactic dose of
TPO prior to exposure
according to the dosing methods of the present invention will ensure that the
worker has high levels of
early multilineage progenitor cells in order to reduce the degree of
thrombocytopenia induced by the
exposure to radiation.
Preferred uses of the thrombocytopoietic protein (TPO) of this invention are
in: myelotoxic
chemotherapy for treatment of leukemia or solid tumors, myeloablative
chemotherapy for autologous
or allogeneic bone marrow transplant, myelodysplasia, idiopathic aplastic
anemia, congenital
thrombocytopenia, and immune thrombocytopenia.
Still other disorders usefully treated with the thrombopoietin proteins of
this invention include
defects or damage to platelets resulting from drugs, poisoning or activation
on artificial surfaces. In
these cases, the instant compounds may be employed to stimulate "shedding" or
new "undamaged"
platelets.
Examples
EXAMPLE 1 - Expression and Purification of TPO from 293 Cells
Preparation of 293 Cell Expression Vectors
A cDNA corresponding to the TPO entire open reading frame was obtained by PCR
using the
following oligonucleotides as primers:
TABLE 1
293 PCR Primers
CIa.FL.F:SN ATC GAT ATC GAT CAG CCA GAC ACC CCG GCC AG 3N
(SEQ ID NO: I )
hmpII-R: SN GCT AGC TCT AGA CAG GGA AGG GAG CTG TAC ATG AGA 3N
(SEQ ID N0:2)
prk5-Hmpl was used as a template for the reaction in the presence of pfu DNA
polymerase
(Stratagene). Initial denaturation was for 7 min. at 94°C followed by
25 cycles of amplification ( 1 min.
at 94°C, 1 min. at 55°C and 1 min. at 72°C). Final
extension was for 15 min. at 72°C. the PCR
product was purified and cloned between the restriction sites CIaI and XbaI of
the plasmid pRKStkneo,
32
CA 02288964 1999-11-O1
WO 98/52598 t~~T/US98/10475
a pRKS derived vector modified to express a neomycin resistance gene under the
control of the
thymidine kinase promote, to obtain the vector pRKStkneo.ORF. A second
construct corresponding to
the epo homologous domain was generated the same way but using CIa.FL.F as
forward primer and the
following reverse primer:
Arg. STOP.Xba: SNTCT AGA TCT AGA TCA CCT GAC GCA GAG GGT GGA CC 3N
(SEQ ID NO: 3)
The final construct is called pRKS-tkneoEPO-D. The sequence of both constructs
was verified.
Transfection of Human Embryonic Kidney cells
These 2 constructs were transfected into human embryonic kidney cells by the
CaP04 method.
24 hours after transfection selection of neomycin resistant clones was started
in the presence of 0.4
mg/ml 6418. 10 to I S days later individual colonies were transferred to 96
well plates and allowed to
grow to confluency. Expression of ML153 or ML332 (TP0153 or TPO 332) in the
conditioned media
from these clones was assessed using the BalF3-mpl proliferation assay.
Purification of rhML332
392-rhML332 conditioned media was applied to a BLUE-SEPHAROSE (Pharmacia)
column
that was equilibrated in 10 mM sodium phosphate pH 7.4 (buffer A). The column
was subsequently
washed with 10 column volumes each of buffer A and buffer A containing 2M
urea. The column was
then eluted with buffer A containing 2M urea and 1 M NaCI. The BLUE-SEPHAROSE
elution pool
was then directly applied to a WGA-SEPHAROSE column equilibrated in buffer A.
The WGA-
SEPHAROSE column was then washed with 10 column volumes of buffer A containing
2M urea and 1
M NaCI and eluted with the same buffer containing O.SM N-acetyl-D-glucosamine.
The WGA-
SEPHAROSE eluate was applied to a C4-HPLC column (Synchrom, Inc.) equilibrated
in 0.1% TFA.
The C4-HPLC column was eluted with discontinuous propanol gradient (0-25%, 25-
35%, 35-70%).
rhML332 was found to elute in the 28-30% propanol region of the gradient. by
SDS-PAGE the
purified rhML332 migrates as a broad band in the 68-8- kDa region of the gel.
Purification of rhML153
392-rhML153 conditioned media was resolved on BLUE-SEPHAROSE as described for
rhML332. The BLUE-SEPHAROSE eluate was applied directly to a mpl-affinity
column as described
above. RhML153 eluted from the mpl-affinity column was purified to homogeneity
using a C4-HPLC
33
CA 02288964 1999-11-O1
WO 98152598 PCT/US98/10475
column run under the same conditions as described for rhML332~ BY SDS-PAGE the
purified
rhML153 resolves into 2 major and 2 minor bands with Mr of 18,000-21,000.
EXAMPLE 2 - Expression and Purification of TPO from CHO
1. Description of CHO Expression Vectors
The expression vectors used in the electroporation protocols described below
have been
designated:
pSV 1 S.ID.LL.MLORF (full length or hTP0332), and
pSV 15.ID.LL.MLEPO-D (truncated or hTP0153)~
2. Preparation of CHO Expression Vectors
A cDNA corresponding to the hTPO entire open reading frame was obtained by PCR
using the
oligonucleotide primes of the following Table.
CHO Expression Vector PCR Primers
CIa.FL.F2 5' ATC GAT ATC GAT AGC CAG ACA CCC CGG CCA G 3'
(SEQ ID N0:4)
ORF.SaI 5' AGT CGA CGT CGA CGT CGG CAG TGT CTG AGA ACC 3'
(SEQ ID NO:S)
PRKS-hmpl I was used as template for the reaction in the presence of pfu DNA
polymerise
(Stratagene). Initial denaturation was for 7 min. at 94°C followed by
25 cycles of amplification (1 min.
at 94°C, 1 min. at 55°C and 1 min. at 72°C). Final
extension was for 15 min. at 72°C. The PCR
product was purified and cloned between the restriction sites Clal and Sall of
the plasmid pSV 15.ID.LL
to obtain the vector pSV 15.ID.LL.MLORF. A second construct corresponding to
the EPO homologous
domain was generated the same way but using CIa.FL.F2 as forward primer and
the following reverse
primer: EPOD.SaI 5' AGT CGA CGT CGA CTC ACC TGA CGC AGA GGG TGG ACC 3' (SEQ ID
N0:6). The fnal construct is called pSV 15.ID.LL.MLEPO-D. The sequence of both
constructs was
verified.
In essence, the coding sequences for the full length and truncated ligand were
introduced into
the multiple cloning site of the CHO expression vector pSV 1 S.ID.LL. This
vector contains the SV40
early promoter/enhancer region, a modified splice unit containing the mouse
DHFR cDNA, a multiple
cloning site for the introduction of the gene of interest (in this case the
TPO sequences described) an
34
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
SV40 polyadenylation signal and origin of replication and the beta-lactamase
gene for plasmid
selection and amplification in bacteria.
3. Methodology for Establishing Stable CHO Cell Lines Expressing Recombinant
Human TP0332 and
TP0153
a. Description of CHO parent cell line
The host CHO (Chinese Hamster Ovary) cell line used for the expression of the
TPO
molecules described herein is known as CHO-DP12 (see EP 307,247 published 15
March 1989). This
mammalian cell line was clonaily selected from a transfection ofthe parent
line (CHO-K1 DUX-B11
(DHFR-)- obtained from Dr. Frank Lee of Stanford University with the
permission of Dr. L. Chasm)
with a vector expressing preproinsulin to obtain clones with reduced insulin
requirements. These cells
are also DHFR minus and clones can be selected for the presence of DHFR cDNA
vector sequences by
growth on medium devoid of nucleoside supplements (glycine, hypoxanthine, and
thymidine). This
selection system for stably expressing CHO cell lines is commonly used.
b. Transfection method (electroporation)
TP0332 and TP0153 expressing cell lines were generated by transfecting DP12
cells via
electroporation (see e.g. Andreason, G.L. J. Tiss. Cult. Meth., 15, 56 (1993)
with linearized
pSVIS.ID.LL.MLORF or pSVIS.ID.LL.MLEPO-D plasmids respectively. Three (3)
restriction
enzyme reaction mixtures were set up for each plasmid cutting; 10 micrograms,
25 micrograms and 50
micrograms of the vector with the enzyme NOTI by standard molecular biology
methods. This
restriction site is found only once in the vector in the linearization region
3' and outside the TPO ligand
transcription units. The 100 microliter reactions were set up for overnight
incubation at 37 degrees.
The next day the mixes were phenol-chloroform-isoamyl alcohol (50:49:1 )
extracted one time and
ethanol precipitated on dry ice for approximately one hour. The precipitate
was then collected by a 15
minute microcentrifugation and dried. The linearized DNA was resuspended into
SO microliters of
Ham's DMEM-F12 I:1 medium supplemented with standard antibiotics and 2mM
glutamine.
Suspension growing DP12 cells were collected, washed one time in the medium
described for
resuspending the DNA and finally resuspended in the same medium at a
concentration of 10~ cells per
750 microliters. Aliquots of cells (750 microliters) and each linearized DNA
mix were incubated
together at room temperature for one hour and then transferred to a BRL
electroporation chamber.
Each reaction mix was then electroporated in a standard BRL electroporation
apparatus at 350 volts set
at 330 micro F and low capacitance. After electroporation, the cells were
allowed to sit in the
apparatus for 5 minutes and then on ice for an additional 10 minute incubation
period. The
electroporated cells were transferred to 60mm cell culture dishes containing 5
ml of standard, complete
growth medium for CHO cells (High glucose DMEM-F12 50:50 without glycine
supplemented with
CA 02288964 1999-11-O1
W O 98/52598 PCT/US98/10475
1X GHT, 2mM glutamine, and S% fetal calf serum) and grown overnight in a S%
C02 cell culture
incubator.
c. Selection and screening method
The next day, cells were trypsinized off the plates by standard methods and
transferred to
lSOmm tissue culture dishes containing DHFR selective medium (Ham's DMEM-F12,
l:lmedium
described above supplemented with either 2% or S% dialyzed fetal calf serum
but devoid of glycine,
hypoxanthine and thymidine this is the standard DHFR selection medium we use).
Cells from each
60mm dish were subsequently replated into S/1 SO mm dishes. Cells were then
incubated for 10 to 15
days( with one medium change) at 37 degrees/15% C02 until clones began to
appear and reached sizes
amenable to transfer to 96 well dishes. Over a period of 4-5 days, cell lines
were transferred to 96 well
dishes using sterile yellow tips on a pipettman set at 50 ml. The cells were
allowed to grow to
confluency (usually 3-S days) and then the trays were trypsinized and 2 copies
of the original tray were
reproduced. Two of these copies were short term stored in the freezer with
cells in each well diluted
into 50 microliter pf 10% FCS in DMSO. 5 day conditioned serum free medium
samples were assayed
from confluent wells in the third tray for TPO expression via the Ba/F cell
based activity assay. The
highest expressing clones based on this assay were revived from storage and
scaled up to 2 confluent
1 SOmm T-flasks for transfer to the cell culture group for suspension
adaptation, re-assay and banking.
d. Amplification Protocol
Several of the highest titer cell lines from the selection described above
were subsequently put
through a standard methotrexate amplification regime to generate higher titer
clones. CHO cell clones
are expanded and plated in l Ocm dishes at 4 concentrations of methotrexate
(i.e SO nM, 100 nM, 200
nM and 400 nM) at two or three cell numbers ( 105, 5x105, and 106 cells per
dish). These cultures are
then incubated at 37 degree/S% C02 until clones are established and amenable
to transfer to 96 well
dishes for further assay. Several high titer clones from this selection were
again subjected to greater
concentrations of methotrexate (i.e. 600 nM, 800 nM, 1000 nM and 1200 nM) and
as before resistant
clones are allowed to establish and then transferred to 96 well dishes and
assayed.
4. Culturing Stable CHO Cell Lines Expressing Recombinant Human TP0332 and
TP0153
Banked cells are thawed and the cell population is expanded by standard cell
growth methods
in either serum free or serum containing medium. After expansion to sufficient
cell density, cells are
washed to remove spent cell culture media. Cells are then cultured by any
standard method including;
batch, fed-batch or continuous culture at 2S-40°C, neutral pH, with a
dissolved 02 content of at least
S% until the constitutively secreted TPO is accumulated. Cell culture fluid is
then separated from the
cells by mechanical means such as centrifugation.
S. Purification of Recombinant Human TPO from CHO Culture Fluids
36
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98f10475
Harvested cell culture fluid (HCCF) is directly applied to a BLUE-SEPHAROSE 6
FAST
FLOW column (Phamacia) equilibrated in 0.01 M Na phosphate pH 7.4, O.15M NaCI
at a ratio of
approximately 100 L of HCCF per liter of resin and at a linear flow rate of
approximately 300
mUhr/cm2. The column is then washed with 3 to 5 column volumes of
equilibration buffer followed by
3 to 5 column volumes of 0.01 M Na phosphate pH 7.4, 2.0 M urea. T'he TPO is
then eluted with 3 to
5 column volumes of 0.01 M Na phosphate pH 7.4, 2.OM urea, 1.OM NaCI. The BLUE-
SEPHAROSE
pool containing TPO is then applied to a wheat germ lectin SEPHAROSE 6 MB
column {Pharmacia)
equilibrated in 0.01 M Na phosphate pH 7.4, 2.OM urea, and 1.OM NaC1 at a
ratio of from 8 to 16 ml of
BLUE-SEPHAROSE pool per ml of resin at flow rate of approximately SO
ml/hr/cm2. The column is
then washed with 2 to 3 column volumes of equilibration buffer. The TPO is
then eluted with 2 to 5
column volumes of 0.01 M Na phosphate pH 7.4, 2.OM urea, 0.5 M N-acetyl-D-
glucosamine.
The wheat germ lectin pool is then adjusted to a final concentration of
0.04%Cl2Eg and 0.1%
trifluroacetic acid (TFA). The resulting pool is applied to a C4 reverse phase
column (Vydac
214TP 1022) equilibrated in 0.1 % TFA, 0.04% C l2Eg at a load of approximately
0.2 to 0.5 mg protein
per ml of resin at a flow rate of 157 ml/hr/cm2.
The protein is eluted in a two phase linear gradient of acetonitrile
containing 0.1% TFA, 0.04%
Cl2Eg. The first phase is composed of a linear gradient from O to 30%
acetonitrile in 15 minutes, the
second phase is composed of a linear gradient from 30 to 60% acetonitrile in
60 minutes. The TPO
elutes at approximately 50% acetonitrile. A pool is made on the basis of SDS-
PAGE.
The C4 pool is then diluted with 2 volumes of 0.01 M Na phosphate pH 7.4, 0.15
M NaCI and
diafiltered versus approximately 6 volumes of 0.01 M Na phosphate pH 7.4, 0. I
5 M NaCI on an
AMICOM YM or like ultrafiltration membrane having a 10,000 to 30,000 Dalton
molecular weight
cut-off. The resulting diafiltrate may be then directly processed or further
concentrated by
ultrafiltration. The diafiltrate/concentrate is adjusted to a final
concentration of 0.01% TWEEN-80.
All or a portion of the diafiltrate/concentrate equivalent to 2 to 5% of the
calculated column
volume is then applied to a SEPHACRYL S-300 HR column (Pharmacia) equilibrated
in 0.01 M Na
phosphate pH 7.4, O.15M NaCI, 0.01 % TWEEN-80 and chromatographed at a flow
rate of
approximately 17 ml/hr/cm2. The TPO containing fractions which are free of
aggregate and
proteolytic degradation products are pooled on the basis of SDS-PAGE. The
resulting pool is filtered
on a 0.22 micron filter, MILLER-GV or like, and stored at 2-8°C.
EXAMPLE 3 - Transformation and Induction of TPO Protein Synthesis In E. coli
1. Construction of E. coli TPO expression vectors
The plasmids pMP2l, pMP151, pMP4l, pMP57 and pMP202 are all designed to
express the
first 155 amino acids of TPO downstream of a small leader which varies among
the different
constructs. The leaders provide primarily for high level translation
initiation and rapid purification. The
37
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
plasmids pMP210-1, -T8, -21, -22, -24, -25 are designed to express the first
153 amino acids of TPO
downstream of an initiation methionine and differ only in the codon usage for
the first 6 amino acids of
TPO, while the plasmid pMP251 is a derivative of pMP210-1 in which the carboxy
terminal end of
TPO is extended by two amino acids. All of the above plasmids will produce
high levels of
intracellular expression of TPO in E. coli upon induction of the tryptophan
promoter (Yansura, D. G.
et. al. Methods in Enrymolo~ (Goeddel, D. V., Ed.) 185:54-60, Academic Press,
San Diego ( 1990)).
The plasmids pMPI and pMP172 are intermediates in the construction ofthe above
TPO intracellular
expression plasmids.
(a) Plasmid pMPI
The plasmid pMPl is a secretion vector for the first 155 amino acids of TPO,
and was
constructed by ligating together 5 fragments of DNA. The first of these was
the vector pPho2l in
which the small Mlul-BamHI fragment had been removed. pPho21 is a derivative
of phGH 1 (Chang,
C. N. et. al., Gene 55:189-196 (1987) in which the human growth hormone gene
has been replaced
with the E. coli phoA gene, and a Mlul restriction site has been engineered
into the coding sequence
for the STII signal sequence at amino acids 20-21.
The next two fragments, a 258 base pair Hinfl-Pstl piece of DNA from pRKS-hmpl
encoding
TPO amino acids 19-103, and the following synthetic DNA encoding amino acids I-
18
5'-CGCGTATGCCAGCCCGGCTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTGCTTCG
TG (SEQ ID NO: 7)
ATACGGTCGGGCCGAGGAGGACGAACACTGGAGGCTCAGGAGTCATTTGACGAAGCACT
GA-5' (SEQ ID N0:8)
were preligated with T4-DNA ligase, and second cut with Pstl. The fourth was a
152 base pair
Pstl-HaeIII fragment from pRKShmpII encoding amino acids 104-155 of TPO. The
last was a 412
base pair Stul-BamHI fragment from pdh 108 containing the lambda to
transcriptional terminator as
previously described (Scholtissek, S. et. al., NAR 15:3185 (1987)).
(b) Plasmid pMP21
The plasmid pMP21 is designed to express the first 155 amino acids of TPO with
the aid of a
13 amino acid leader comprising part of the STII signal sequence. It was
constructed by ligating
together three (3) DNA fragments, the first of these being the vector pVEG31
in which the small
Xbal-Sphl fragment had been removed. The vector pVEG31 is a derivative of
pHGH207-1 (de Boer,
H. A. et. al., in Promoter Structure and Function (Rodriguez, R. L. and
Chamberlain, M. J., Ed), 462,
Praeger, New York (1982)) in which the human growth hormone gene has been
replaced by the gene
for vascular endothelial growth factor ( this identical vector fragment can be
obtained from this latter
plasmid).
The second part in the ligation was a synthetic DNA duplex with the following
sequence:
5'-CTAGAATTATGAAAAAGAATATCGCATTTCTTCTTAA (SEQ ID N0:9)
38
CA 02288964 1999-11-O1
W f ~ 98/52598 PCT/US98/10475
TTAATAC'>~TTTTCTTATAGCGTAAAGAAGAA~fTGCGC-5' (SEQ ID NO:10)
The last piece was a 1072 base pair Mlul-Sphl fragment from pMPI encoding 155
amino acids
of TPO.
(c) Plasmid pMP151
The plasmid pMP151 is designed to express the first 155 amino acids of TPO
downstream of a
leader comprising 7 amino acids of the STII signal sequence, 8 histidines, and
a factor Xa cleavage
site. pMPI 51 was constructed by ligating together three DNA fragments, the
first of these being the
previously described vector pVEG31 from which the small Xbat-Sphl fragment had
been removed.
The second was a synthetic DNA duplex with the following sequence:
l0 S'-CTAGAATTATGAAAAAGAATATCGCATTTCATCACCATCACCATCACCATCACATCGAA
GGTCGTAGCC (SEQ ID NO:11)
TTAATACTTTI"fCTTATAGCGTAAAGTAGTGGTAGTGGTAGTGGTAGTGTAGCTCCAGCAT-
5' (SEQ ID N0:12)
The last was a 1064 base pair BgLI-Sphl fragment from pMPl l encoding 154
amino acids of
TPO. The plasmid pMPI l is identical to pMPI with the exception of a few codon
changes in the STII
signal sequence( this fragment can be obtained from pMPI).
{d) Plasmid pMP202
The plasmid pMP202 is very similar to the expression vector pMPI 51 with the
exception that
the factor Xa cleavage site in the leader has been replaced with a thrombin
cleavage site. As shown in
Fig. 36, pMP202 was constructed by ligating together three DNA fragments. The
first of these was the
previously described pVEG31 in which the small Xbal-Sphl fragment had been
removed. The second
was a synthetic DNA duplex with the following sequence:
5'-CTAGAATTATGAAAAAGAATATCGCATTTCATCACCATCACCATCACCATCACATCGAA
CCACGTAGCC (SEQ ID N0:13)
TTAATACTTTTTCTTATAGCGTAAAGTAGTGGTAGTGGTAGTGGTAGTGTAGCTTGGTGCA
T-5' (SEQ ID N0:14)
The last piece was a 1064 base pair BgII-Sphl fragment from the previously
described plasmid
pMP l l .
(e) Plasmid pMP172
The plasmid pMP172 is a secretion vector for the first 153 amino acids of TPO,
and is an
intermediate for the construction of pMP210. pMP 172 was prepared by ligating
together three DNA
fragments, the first of which was the vector pLS321amB in which the small
EcoRI-Hindi section had
been removed. The second was a 946 base pair EcoIZI-Hgal fragment from the
previously described
plasmid pMPI 1. The last piece was a synthetic DNA duplex with the following
sequence:
5'-TCCACCCTCTGCGTCAGGT (SEQ ID NO:15)
GGAGACGCAGTCCATCGA-S' (SEQ ID N0:16)
39
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
(f) Plasmid pMP210
The plasmid pMP210 is designed to express the first 153 amino acids of TPO
after a
translational initiation methionine. This plasmid was actually made as a bank
of plasmids in which the
first 6 codons of TPO were randomized in the third position of each codon, and
was constructed by the
ligation of three DNA fragments. The first of these was the previously
described vector pVEG31 in
which the small Xbal-Sphl fragment had been removed. The second was a
synthetic DNA duplex
shown below treated first with DNA polymerase (Klenow) followed by digestion
with Xbal and Hinl,
and encoding the initiation methionine and the randomized first 6 codons of
TPO.
5'-GCAGCAGTTCTAGAATTATGTCNCCNGCNCCNCCNGCNTGTGACCTCCGAACACTGGAG
i0 GCTGTTCTCAGTAAA (SEQ ID NO:I7)
CAAGAGTCATTTGACGAAGCACTGAGGGTACAGGAAG-5' (SEQ ID N0:18)
The third was a 890 base pair Hinfl-Sphl fragment from pMP172 encoding amino
acids 19-153
of TPO.
The plasmid pMP210 bank of approximately 3700 clones was retransformed onto
high
15 tetracycline (50 microgram/ml) LB plates to select out high translational
initiation clones (Yansura,
D.G. et al., Methods: A Companion to Methods in Enrymolog~ 4:151-158 (1992)).
Of the 8 colonies
which came up on high tetracycline plates, five of the best in terms of TPO
expression were subject to
DNA sequencing.
(g) Plasmid pMP41
20 The plasmid pMP41 is designed to express the first 155 amino acids of TPO
fused to a leader
consisting of 7 amino acids of the STII signal sequence following by a factor
Xa cleavage site. The
plasmid was constructed by ligating together three pieces of DNA, the first of
which was the
previously described vector pVEG31 in which the small Xbal-Sphl fragment had
been removed. The
second was the following synthetic DNA duplex:
25 5'-CTAGAATTATGAAAAAGAATATCGCATTTATCGAAGGTCGTAGCC (SEQ ID N0:19)
TTAATACTTTTTCTTATAGCGTAAATAGCTTCCAGCAT-SN (SEQ ID N0:20)
The last piece of the ligation was the 1064 base pair Bgll-Sphl fragment from
the previously
described plasmid pMPll.
(h) Plasmid pMP57
30 The plasmid pMP57 expresses the first 155 amino acids of TPO downstream of
a leader
consisting of 9 amino acids of the Stll signal sequence and the dibasic site
Lys-Arg. This dibasic site
provides for a means of removing the leader with the protease ArgC. This
plasmid was constructed by
ligating together three DNA pieces. The first of these was the previously
described vector pVEG31 in
which the small XbaI-SphI fragment had been removed. The second was the
following synthetic DNA
35 duplex:
5'-NCTAGAATTATGAAAAAGAATATCGCATTTCTTCTTAAACGTAGCC (SEQ ID N0:21 )
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
TTAATACTTTTTCTTATAGCGTAAAGAAGAATTTGCAT-SN (SEQ ID N0:22)
The last part of the ligation was the 1064 base pair Bgil-Sphl fragment from
the previously
described plasmid pMPll.
(i) Plasmid pMP251
The plasmid pMP251 is a derivative of pMP210-1 in which two additional amino
acids of TPO
are included on the carboxy terminal end. This plasmid was constructed by
ligating together two
pieces of DNA, the first of these being the previously described pMP21 in
which the small Xbal-Apal
fragment had been removed. The second part of the ligation was a 316 base pair
Xbal-Apal fragment
from pMP210-1.
2. Transformation and Induction of E. co/i with TPO expression vectors
The above TPO expression plasmids were used to transform the E. coli strain
44C6 (w3110
tonA D rpoHts lon 0 cip 0 galE) using the CaCl2 heat shock method (Mandel, M.
et al., J. Mol. Biol.,
53:159-162, (1970)). The transformed cells were grown first at 37°C in
LB media containing 50 pg/ml
carbenicillin until the optical density (600nm) of the culture reached
approximately 2-3. The LB
culture was then diluted 20x into M9 media containing 0.49% casamino acids
(w/v) and 50 pg/ml
carbenicillin. After growth with aeration at 30°C for 1 hour, indole-3-
acrylic acid was added to a final
concentration of 50 l lg/ml. The culture was then allowed to continue growing
at 30°C with aeration
for another I 5 hours at which time the cells were harvested by
centrifugation.
EXAMPLE 4 - Production of Biologically Active TPO (Met-1 1-153) in E. coli.
The procedures given below for production of biologically active, refolded TPO
(Metl-153)
can be applied in analogy for the recovery of other TPO variants including N
and C terminal extended
forms.
1. Recovery of non-soluble TPO (Met--1 1-153)
E. coli cells expressing TPO (Met-1 1-153) encoded by the plasmid pMP210-1 are
fermented
as described above. Typically, about 100g of cells are resuspended in I (10
volumes) of cell
disruption buffer (10 mM Tris, 5 mM EDTA, pH 8) with a Polytron homogenizer
and the cells
centrifuged at 5000 x g for 30 minutes. The washed cell pellet is again
resuspended in 1 L cell
disruption buffer with the Polytron homogenizer and the cell suspension is
passed through an LH
CELL DISRUPTER (LH Inceltech, Inc.) or through a MICROFLUIDIZER (Microfluidics
International) according to the manufactures' instructions. The suspension is
centrifuged at 5,000 x g
for 30 min. and resuspended and centrifuged a second time to make a washed
refractile body pellet.
The washed pellet is used immediately or stored frozen at -70°C
2. Solubilization and purification of monomeric TPO Met-1 1-153)
41
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
solubilization of the TPO protein. High concentrations of urea (6-8M) are also
useful but generally
result in lower yields compared to guanidine. After solubilization, the
solution is centrifuged at 30,000
x g for 30 min. to produce a clear supernatant containing denatured, monomeric
TPO protein. The
supernatant is then chromatographed on a SUPERDEX 200 gel filtration column
(Pharmacia, 2.6 x 60
cm) at a flow rate of 2 ml/min. and the protein eluted with 20 mM Na
phosphate, pH 6.0, with 10 mM
DTT fractions containing monomeric, denatured TPO protein eluting between 160
and 200 ml are
pooled. The TPO protein is further purified on a semi-preparative C4 reversed
phase column (2 x 20
cm VYDAC). The sample is applied at 5 mUmin. to a column equilibrated in 0.1%
TFA(trifluoroacetic
acid) with 30% acetonitrile. The protein is eluted with a linear gradient of
acetonitrile (30-60% in 60
min.). The purified reduced protein elutes at approximately 50% acetonitrile.
This material is used for
refolding to obtain biologically active TPO variant.
3. Generation of biologically active TPO (Met-1 1-I53)
Approximately 20 mg ofmonomeric, reduced and denatured TPO protein in 40 ml
0.1%
TFA/50% acetonitrile is diluted into 360 ml of refolding buffer containing
optimally the following
I S reagents:
50 mM Tris
0.3 M NaCI
5 mM EDTA
2% CHAPS detergent
25% glycerol
5 mM oxidized glutathione
1 mM reduced glutathione
pH adjusted to 8.3
After mixing, the refolding buffer is gently stirred at 4°C for 12-48
hr to effect maximal
refolding yields of the correct disulfide-bonded form of TPO (see below). The
solution is then
acidified with TFA to a final concentration of 0.2%, filtered through a 0.45
or 0.22 micron filter, and
110 volume of acetonitriIe added. This solution is then pumped directly onto a
C4 reversed phase
column and the purified, refolded TPO (Met-1 1-153) eluted with the same
gradient program as above.
Refolded, biologically active TPO is eluted at approximately 45% acetonitrile
under these conditions.
Improper disulfide-bonded versions of TPO are eluted earlier. The final
purified TPO (Met-1 1-153) is
greater than 95% pure as assessed by SDS gels and analytical C4 reversed phase
chromatography. For
animal studies, the C4 purified material was dialyzed into physiologically
compatible buffers. Isotonic
buffers (10 mM Na acetate, pH 5.5, 10 mM Na succinate, pH 5.5 or 10 mM Na
phosphate, pH 7.4)
containing 150 mM NaCI and 0.01 % TWEEN-80 were utilized.
Because of the high potency of TPO in the Ba/F3 assay (half maximal
stimulation is achieved
at approximately 3 pgml), it is possible to obtain biologically active
material utilizing many different
42
CA 02288964 1999-11-O1
WO'98/52598 PCT/US9$i 10475
buffer, detergent and redox conditions. However, under most conditions only a
small amount of
properly folded material (<10%) is obtained. For commercial manufacturing
processes, it is desirable
to have refolding yields at least 10%, more preferably 30-50% and most
preferably >50%. Many
different detergents (TRITON X-100, dodecyl-beta-maltoside, CHAPS, CHAPSO,
SDS,
SARKOSYL, TWEEN-20 and TWEEN-80, ZWITTERGENT 3-14 and others) were assessed
for
efficiency to support high refolding yields. Of these detergents, only the
CHAPS family (CHAPS and
CHAPSO) were found to be generally useful in the refolding reaction to limit
protein aggregation and
improper disulfide formation. Levels of CHAPS greater than 1% were most
useful. Sodium chloride
was required for best yields, with the optimal levels between 0.1 M and O.SM.
The presence of EDTA
(1-5 mM) limited the amount of metal-catalyzed oxidation (and aggregation)
which was observed with
some preparations. Glycerol concentrations of greater than 1 S% produced the
optimal refolding
conditions. For maximum yields, it was essential to have both oxidized and
reduced glutathione or
oxidized and reduced cysteine as the redox reagent pair. Generally higher
yields were observed when
the mole ratio of oxidized reagent is equal to or in excess over the reduced
reagent member of the
redox pair pH values between 7.5 and about 9 were optimal for refolding of
these TPO variants.
Organic solvents (e.g. ethanol, acetonitrile, methanol) were tolerated at
concentrations of 10-15% or
lower. Higher levels of organic solvents increased the amount of improperly
folded forms. Tris and
phosphate buffers were generally useful. Incubation at 4°C also
produced higher levels of properly
folded TPO.
Refolding yields of 40-60% (based on the amount of reduced and denatured TPO
used in the
refolding reaction) are typical for preparations of TPO that have been
purified through the first C4 step.
Active material can be obtained when less pure preparations (e.g. directly
after the Superdex 200
column or after the initial refractile body extraction) although the yields
are less due to extensive
precipitation and interference of non-TPO proteins during the TPO refolding
process.
Since TPO (Met-1 1-153) contains 4 cysteine residues, it is possible to
generate three different
disulfide versions of this protein:
version 1: disulfides between cysteine residues 1-4 and 2-3
version 2: disulfides between cysteine residues 1-2 and 3-4
version 3: disulfides between cysteine residues 1-3 and 2-4.
During the initial exploration in determining refolding conditions, several
different peaks containing
the TPO protein were separated by C4 reversed phase chromatography. Only one
of these peaks had
significant biological activity as determined using the Ba/F3 assay.
Subsequently, the refolding
conditions were optimized to yield preferentially that version. Under these
conditions, the misfolded
versions are less than 10-20% of the total monomer TPO obtained.
The disulfide pattern for the biologically active TPO has been determined to
be I-4 and 2-3 by
mass spectrometry and protein sequencing (i.e. version I ). Aliquots of the
various C4-resolved peaks
43
CA 02288964 1999-11-O1
WO 98/52598 PC IUS98/I0475
(5-10 nmoles) were digested with trypsin (1:25 mole ratio oftrypsin to
protein). The digestion mixture
was analyzed by matrix assisted laser desorption mass spectrometry before and
after reduction with
DTT. After reduction, masses corresponding to most of the larger tryptic
peptides of TPO were
detected. In the un-reduced samples, some of these masses were missing and new
masses were
observed. The mass of the new peaks corresponded basically to the sum of the
individual tryptic
peptides involved in the disulfide pair. Thus it was possible to unequivocally
assign the disulfide
pattern of the refolded, recombinant, biologically active TPO to be 1-4 and 2-
3. This is consistent with
the known disulfide pattern of the related molecule erythropoietin.
D. Biological activity of recombinant, refolded TPO (met 1-153)
Refolded and purified TPO (MeY~ 1-153) has activity in both in vitro and in
vivo assays. In the
Ba/F3 assay, half maximal stimulation of thymidine incorporation into the
Ba/F3 cells was achieved at
3.3 pg /ml (0.3 pM). In the mpl receptor-based ELISA, half maximal activity
occurred at 1.9 ng/ml
(120 pM). In normal and myelosuppressed animals produced by near-lethal X-
radiation, TPO (Met-1
I-I53) was highly potent (activity was seen at doses as low as 30 ng/mouse) to
stimulate the
i 5 production of new platelets.
EXAMPLE S - Myelosuppressed (Carboplatin/Irradiation) Mouse Data
Animals
All animal studies were approved by the Institutional Care and Use Committee
of Genentech
Inc. Prior to the start of the experiment all animals were ear-tagged for
identification and a base-line
complete blood count (CBC) obtained. Groups of 10 female C57BL/6 mice were
irradiated with 5.0
Gy of gamma irradiation from a l3~Cs source. Within 6 hours, the animals were
given I .2 mg
carboplatin as a 200 microliter intraperitoneai injection.
The following are the protocols and results using recombinant murine
thrombopoietin
(rmTPO) in a standard mouse model. It will be understood that one skilled in
the art considers this
model to correlate with treatment in human beings. Human thrombopoietin has
been tested in the same
mouse model and was found to show relevant activity, albeit at a lesser level
because of the species
specificity. Therefore, the following protocol was chosen using the proper
murine TPO counterpart for
that species so that relevant effect could be demonstrated. Again, use of
human TPO in the mouse
protocol would provide similar results differing only in degree.
Procurement of Blood Samples
Prior to the experiment and at time points throughout the study, 40 microliter
of blood was
taken from the orbital sinus and immediately diluted into 10 mL of diluent to
prevent clotting. The
complete blood count (CBC) from each blood sample was measured on a SERRANO
Baker system
44
CA 02288964 1999-11-O1
Wt)'98/52598 PCT/US98/10475
9018 blood analyzer within 60 min of collection. C~~uy half of the animals in
each dose group were
bled on a given day; thus, each animal was bled on alternate time points.
Treatment Regimens
Experiment 1: In order to determine the response to recombinant murine
thrombopoietin
(rmTP0335aa) in animals rendered thrombocytopenic, groups of animals were
treated for 1, 2, 4, or 8
consecutive days with 0.1 microgram/day (5 microgram/kg/day approx.).
Treatment with rmTPO
(335aa) was started 24 hours after the initiation of the model and was given
as a daily 100 microliter
subcutaneous injection.
Experiment 2: In order to determine the nature of the dose-response
relationship for rmTPO(335} in
this model, animals were given a single injection of rmTPO (335) 24 hours
after the initiation of the
model. Groups of animals received one of 0.01, 0.03, 0.1 or 0.3 microgram of
rmTPO (335) as a single
100 microliter subcutaneous injection. In order to compare two routes of
administration, a
contemporaneous experiment used 4 groups of animals receiving identical doses
of rmTPO (335) but
I S via an intravenous route (lateral tail vein).
Experiment 3: This series of experiments was done to compare the efficacy of
various pegylated
truncated rmTPO molecules (nnTPO(153) coupled to polyethylene glycol (PEG).
i. In this experiment thrombocytopenic animals were injected (0.1 microgram
subcutaneous)
with one ofthe following pegylated rmTPO(153) molecules: no PEG, one 20K PEG
or one 40K PEG.
ii. In the final experiment there was compared the effects of administering a
single 40K PEG
rmTPO(153) molecule by giving O.lmicrogram either subcutaneously or
intravenously to animals
rendered thrombocytopenic. rmTPO(335) (0.1 microgram) was used as a positive
control.
Results
The combination of sublethal irradiation and carboplatin resulted in a
reproducible response
giving consistent thrombocytopenia in 100% of the animals. The nadir for the
thrombocytopenia
occurred at day 10 with a gradual recovery of platelet numbers by day 21 to
day 28. Accompanying
this thrombocytopenia was a pronounced anemia with the nadir occurring
slightly later on day 14 to 17
and recovery to control red blood cell counts by day 28. White blood cell
counts were also depleted
during the course of the experiment.
Experiment I : A single dose of 0.1 microgram rmTPO(335) given 24 hours after
the initiation of the
model accelerated the recovery of platelet numbers in this murine model. This
single administration of
rmTPO(335) elevated the nadir of the response from 196x103 t 33x103/microliter
on day 10 to
434x103 t 7x103/microliter on day 7. The initial rate of decline in the
platelet numbers remained
unchanged but the recovery phase was much more rapid with platelet numbers
returning to normal by
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
day 14 as opposed to day 21 in the control group. Some further improvement in
the rate of recovery
was seen by giving 0.1 microgram/day on day 1 and day 2 but this was marginal.
No further
improvement could be seen by giving rmTPO(335) for 4 or 8 consecutive days
(Fig. la). In addition to
the accelerated recovery in platelet numbers, the anemia which develops in
these animals was also
attenuated by a single dose of rmTPO(335) given on day 1. As with the platelet
counts, no further
advantage could be gained by giving nmTPO(335) more than once (Fig. lb).
rmTPO(335) had no
effect on the leukocytopenia that accompanies the falls in platelet and red
blood cell counts. (Fig. lc).
Experiment 2: The response to single subcutaneous doses of rmTPO(335) given 24
hours after the
initiation of the model was dose dependent. The lowest dose tested (0.01
microgram) had no effect on
the platelet recovery compared to controls. However, the response is almost
maximal when 0.03
microgram was given (Fig. 2a). This extremely steep dose response curve is
better appreciated when
the platelet numbers on day 14 are plotted on a log-linear plot (Fig. 3a). A
similar steep dose response
is seen for erythrocyte repopulation in this model (Fig. 3b). Intravenous
administration of rmTPO(335)
gave a similar dose dependent response. However, the lowest dose tested (0.01
microgram) was
effective when given IV, (Fig. 4a) suggesting that the dose response curve is
shifted to the left. This
increase in potency is small since the shift is less than half an order of
magnitude (Fig. 3a). What is
more important is that both routes of administration have the comparable
maxima (Fig. 3a). The
subcutaneous and intravenous route of administration also augmented the
recovery from the anemia in
a dose-dependent fashion (Figs. 2a, 3b, 4b). However, neither the subcutaneous
nor the intravenous
route of administration had an effect on the leukocytopenia over the dose
range tested (Figs. 2c,4c).
Experiment 3:
A. Pegylation of the rmTPO(153) with either a single 20K PEG or a single 40K
PEG had a
greater effect on the platelet recovery than the un-pegylated molecule. Unlike
the full-length molecule,
neither of the pegylated rmTPO(153) molecules affected the nadir of the
thrombocytopenia but greatly
accelerated the recovery phase of the model when given as a single 0.1
microgram SC dose 24 hours
after initiation of the model (Fig Sa). This is very evident on day 14 when
the platelet counts are
80x103 ~ 15x103/microliter, 268x103 ~ 67x103/microliter, 697x103 t
297x103/microliter, and
878x103 ~ 31x103lmicroliter for controls, rmTPO(153) no PEG, rmTPO(153) + 20K
PEG and
rmTPO(153) + 40K PEG respectively (Fig. Sa). The same profile was also evident
on the erythrocyte
response (Fig. Sb). None ofthese rmTPO(153)-based molecules had any effect on
the leukocytopenia
in this model. (Fig. Sc).
B. rmTPO(153) + 40K PEG (0.1 microgram) gave a consistent response when
administered as
either a single intravenous or subcutaneous injection. In this experiment, the
subcutaneous route
slightly altered the nadir on day 10 and returned platelets to control levels
by day 14 as compared to
46
CA 02288964 1999-11-O1
WO 98/52598 1'CT/US98/10475
day 28 in the control group (Fig. 6a). In the animals given the drug
intravenously, there was a similar
effect on the nadir and rate of recovery (Fig. 7a). The response to this 40K
pegylated truncated
rmTPO(153) molecule is almost identical to the response to the rmTPO(335} on
both platelet and
erythrocyte recovery when given either subcutaneously (Fig. 6b) or
intravenously (Fig. 7b). As with
all of the other experiments rmTPO( 153) + 40K PEG given either subcutaneously
or intravenously had
no effect on the circulating levels of white blood cells (Figs. 6c, 7c). In
parallel experiments, the use of
l OK-pegylated versions of this molecule did not modify the response to
rmTPO(153) on either platelet
or erythrocyte repopulation.
l0 EXAMPLE 6
The following are protocols and results using single-dose therapy with
recombinant human
thrombopoietin (rhTP0332) in human patients receiving cytotoxic chemotherapy:
Single-dose therapy with recombinant human thrombopoietin (rhTPO) in patients
receiving cytotoxic
chemotherapy.
15 PreclinicaI models of intensive chemoradiotherapy demonstrated that a
single dose of rhTPO
raises the platelet nadir and shortens the period of severe thrombocytopenia.
Interim results of two
Phase I studies in which single doses of rhTPO were administered to cancer
patients receiving
chemotherapy are presented.
20 Patients and Methods:
Both studies began with 21-day, pre-chemotherapy periods (cycle 0) for
assessment of rhTPO
safety and platelet response after single IV bolus injections of 0.3, 0.6, or
1.2 meg/kg (3 patients per
group in each study). Patients then received the same dose of rhTPO after
chemotherapy in selected
subsequent cycles. The first study population consisted of patients with
advanced malignancies who
25 received rhTPO the day following salvage thiotepa chemotherapy (65 mg/m2
q28d) in each of two
consecutive chemotherapy cycles. The second study included chemotherapy naive
patients with
sarcoma undergoing induction treatment with AI chemotherapy (doxorubicin 90
mg/m2, 10 g/m2 q2Id.
Following cycle 0, patients in this study were monitored during the first
chemotherapy cycle and
received a single rhTPO injection the day following completion of chemotherapy
(d5) during the
30 second and subsequent cycles.
Results:
14 patients have been treated to date. rhTPO was well tolerated with no
reported serious
adverse events attributed to study drug. Antibodies to rhTPO have not been
observed. In cycle 0 the
35 lowest (0.3 mcg/kg) dose was weakly active, with increased activity at
higher doses as shown below.
47
CA 02288964 1999-11-O1
WO 98/52598 ~,T/US98/10475
RhTPO PatientsMean Baseline Median Maximum Median
dose N Patients ( 1 Platelet ( 1 Increase
(mcg/kg) pl) (SD) pl) (Range)
0.3 7 339 (133) 510 (277-628) 40
0.6 S 235 (69) 486 (386-509) 103
1.2 2 203 (46) 523 (437, 608) I58
The maximum platelet count during cycle 0 occurred on median day 11 (range 7-
14). No
significant changes were found in WBC or HCT. FACS analysis of bone marrow
showed increases in
all CD34+ subsets in 2/2 patients following 0.6 mcg/kg. Increases in
peripheral blood CD34+ cells
were also seen in these patients, suggesting that TPO might have stem cell
mobilizing activity. Dose
calculation and post-chemotherapy treatment are ongoing.
Together these phase 1 studies suggest that single dose administration of
rhTPO is safe and
well tolerated. The 0.3, 0.6. and 1.2 mcg/kg. dose levels show increasing
thrombopoietic activity. The
ongoing treatment of patients at higher dose levels will test the hypotheses
that a single dose of rhTPO
is efficacious in ameliorating thrombocytopenia following intensive
chemotherapy.
EXAMPLE 7A - A Phase I Study To Determine The Safety, Tolerance,
Pharmacokinetics And
Pharmacodynamics Of Recombinant Human Thrombopoietin (rhTPO) In Subjects With
Sarcoma
Receiving Adriamycin And Ifosfamide
Treatment Plan
This was a single-center, open-label, dose-escalation, study of single and
multiple IV doses of
rhTPO with major safety endpoints. rhTPO was administered to subjects with
histologically diagnosed
sarcoma to determine whether its administration helped to prevent, delay,
ameliorate, or shorten the
duration of the known thrombocytopenic effects of doxorubicin and ifosfamide.
At present, 71 subjects have been enrolled on to this study which addresses
the safety and the
activity, of various rhTPO dosing schedule in conjuction with G-CSF and GM-
CSF. The study begins
with a 21-day pre-chemotherapy cycle (cycle 0) to assess safety, activity, and
pharmacokinetics in
patients with cancer. The data indicates a dose-dependent increase in
peripheral blood platelet counts
and bone marrow megakaryocytes in response to either a single or multiple IV
doses of rhTPO, with
doses ranging from 0.3-3.6 mg/kg. Thus rhTPO dosing regimens in which all of
the rhTPO was
administered after the completion of chemotherapy were safe, but demonstrated
only modest activity.
One patient with a normal platelet count developed an uncomplicated deep
venous thrombosis in the
leg which resolved with conservative therapy, and neutralizing antibodies have
not been observed.
Subjects had either metastatic or unresectable sarcoma.
In patients who have received a single dose of rhTPO prior to the chemotherapy
have
experienced a benefit in terms of reducing the depth and duration of the
platelet nadir when compared
48
CA 02288964 1999-11-O1
WO 98/52598 '=~'T/US98,'~~1475
to patients in other dosing arms or historical controls, and this effect has
been exhibited throughout the
six cycles of planned chemotherapy (of note, none of the historical control
patients (n=I 8) received all
six cycles, and only two received five cycles). The prechemotherapy dose has
been well-tolerated. As
dosing through chemotherapy is safe and potentially more efficacious, this
rhTPO dosing regimen is
being incorporated into the protocol.
Dose Levels
Five dose levels of rhTPO and six regimens (Arms A-F) were evaluated in this
study. Dose
levels and the number of subjects per dose level are as shown in the Table
below.
Dose Levels, Doses and Number of Subjects
LEVEL DOSE N
Dose
lA 0.3 pg/kg X 1 3
2A 0.6 pg/kg X 1 3
3A 1.2 pg/kg X 1 3
4A 2.4 pg/kg X 1 4
SA 3.6 pg/kg X 1 3
1 B 0.3 pg/kg X 2 6
2B 0.6 p,g/kg X 2 3
3B 1.2 pg/kg X 2 4
4B 2.4 pg/kg X 2 3
SB 3.6 pg/kg X 2 3
3C 1.2 pg/kg QDX7 3
4C 2.4 pg/kg QDX7 3
3D 1.2 pg/kg pre/post6
4D 2.4 pg/kg pre/post6
OBD*-Chemo 1.2 pg/kg pre/post6
OBD-TPO 1.2 wg/kg pre/post6
3E 1.2 pg/kg pre/post6
TPO +GM-CSF
3Fa 1.2 pg/kg d -1,1,6
4
+ G-CSF
3Fb 1.2 pg/kg d -1,1,6
4
+ GM-
CSF
83
*OBD--Optimal Biologic Dose
49
CA 02288964 1999-11-O1
WU 98/52598 PCT/US98/10475
Peak elevations in platelet count after single- or multiple-dose
administration in preclinical
studies have been observed within several days after initiation of dosing.
Therefore, a peak platelet
response would be expected within 7-14 days after initiation of dosing in this
study. Current clinical
experience has supported these findings.
Study Design
Subjects were assigned to one of the dose groups described in the Table above.
Study
schemata for Arms A-F are shown below. All subjects received doxorubicin and
ifosfamide in Cycle I
(Days 0, l, 2, and 3) and in additional cycles.
The rhTPO dosing regimens for this study are as follows:
Arm A
Cycle 0: rhTPO on Day 0
Cycle 1: no rhTPO
Cycle 2+: rhTPO on Day 4
Arm B
Cycle 0: rhTPO on Days 0 and 3
Cycle 1: no rhTPO
Cycle 2+: rhTPO on Days 4 and 7
Arm C
Cycle 1: no rhTPO
Cycle 2+: daily rhTPO on Days 4 through 10, or until the post-nadir platelet
count is 3100,OOO/pL
Arm D
Cycle 1: no rhTPO
Cycle 2+: rhTPO on Days DI, 4, and 7
Arm E
Cycle 1: no rhTPO
Cycle 2+: rhTPO as per Arm D regimen, but with GM-CSF replacing G-CSF
Cycle 0: This phase of the study evaluates safety, pharmacokinetics, and
pharmacodynamics
of single and multiple dosing. Subjects in Arm A received a single IV
injection of rhTPO (Day 0).
Subjects in Arm B received an IV injection of rhTPO on Days 0 and 3.
Cycle I : Subjects received doxorubicin and ifosfamide. There was no rhTPO
administered
during Cycle I . This provides a control cycle for comparison of each
subject's response to subsequent
cycles with rhTPO. This control cycle also clarifies chemotherapy-related
adverse events in the
absence of rhTPO dosing.
Cycle 2+: Subjects received doxorubicin and ifosfamide. Subjects in Arm A
received a single
IV injection of rhTPO (Day 4). Subjects in Arm B received IV injections of
rhTPO on Days 4 and 7.
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98r10475
Subjects in Arm C received up to seven daily IV injections of rhTPO on Days 4-
10, or until the
post-nadir platelet count was greater than or equal to 100,000/pL. Subjects in
Arm D received IV
injections of rhTPO on Day -1 (1 day prior to chemotherapy) and on Days 4 and
7.
To explore a possible synergistic relationship of rhTPO with GM-CSF in humans
white
minimizing subject risk, GM-CSF replaced G-CSF in Arm E. GM-CSF was
administered in Cycles 1
and 2, and in subsequent cycles where there is proven benefit. Subjects in Arm
E received rhTPO
according to the Arm D regimen.
Study Schema
ARM
A
0 21
o I z s 21
~'lll~lli~l~~i1111 _ _
0 1 2 3 4 21
2
- -
ARM
B
0 1 2 3 21
0 I 2 3 21
I,I ~~ _ _
0 I 2 3 4 5 6 7 21
2 ~~~~
ARM
C
0 1 2 3 21
I ~~~~
0 I 2 3 4 5 6 7 8 9 10 21
2
ARM
D and
E
0 1 2 3 21
-1 0 1 2 3 4 5 6 7 21
2 ~~~~~~~~~-
ARM
F
0 I 2 3 21
I~i~_
-1 0 1 2 3 4 21
2~~~~~-
. rhTPO
A Chemotherapy
51
CA 02288964 1999-11-O1
Wf) 98/52598 PCT/US°~8/t0475
Doxonrbicin
Doxorubicin was obtained from commercial sources and stored and administered
in
accordance with the manufacturer's guidelines. Doxorubicin (a total of 90
mg/m2) was given as a
continuous infusion for the first 3 days of each chemotherapy cycle (30 mg/m2
daily for 3 days, (Days
0-Z).
Ifosfamide
Ifosfamide was obtained from commercial sources and stored and administered in
accordance
with the manufacturer's guidelines. Ifosfamide (a total of 10 g/m2) was given
as four separate daily
l0 infusions during the first 4 days of each chemotherapy cycle (2.5 g/m2 over
3 hours daily for 4 days,
(Days 0-3).
Mesna
Mesna was obtained from commercial sources and stored and administered in
accordance with
the manufacturer's guidelines. Mesna (500 mg/m2 or 20% of the dose of
ifosfamide) was administered
IV over 3 hours with the initial dose of ifosfamide on Day 0 of each
chemotherapy cycle. Mesna
administration was maintained as a continuous IV infusion ( 1500 mg/m2/day for
a total of 6 g/m2)
until 24 hours after the final ifosfamide administration of each chemotherapy
cycle (Days 0-4).
2o G-CSF
G-CSF was obtained from commercial sources and stored and administered in
accordance with
the manufacturer's guidelines. G-CSF (5 pg/kg) was administered daily
beginning on Day 4 of Cycle 1
and any subsequent chemotherapy cycles. Subjects were instructed to self
administer G-CSF. All
injections of G-CSF should be administered at 8:00 p.m. Injections on the same
day as rhTPO
administration should be given ~12 hours after rhTPO administration to help
define any
injection-related phenomena. G-CSF administration continued on a daily basis
until the absolute
neutrophil count was >1500/pL for at least two consecutive measurements post-
nadir.
GM-CSF
GM-CSF is obtained from commercial sources and stored and administered in
accordance with
the manufacture's guidelines. GM-CSF (250 mg/m2) is administered
subcutaneously daily beginning
on Day 4 of Cycle 1 and any subsequent chemotherapy cycles. Subjects are
instructed to
self administer GM-CSF. All injections of GM-CSF should be administered at
8:00 p.m. Injections
on the same day as rhTPO administrations should be given ~12 hours after rhTPO
administration to
52
CA 02288964 1999-11-O1
WO 98 52598 PCT/US98/10475
help define any injection-related phenomena. GM-CSF administration continued
on a daily basis until
the post-nadir absolute neutrophil count is >1500/uL for at least two
consecutive measurements.
The results of this study are shown in Figures 14 - 19.
EXAMPLE 7B - A Phase I Trial Of Recombinant Human Thrombopoietin (rhTPO) Given
Via
Subcutaneous Injection To Subjects With Advanced Gynecologic Malignancy
Receiving Carboplatin
This study addresses the safety of rhTPO administered subcutaneously and the
activity of
rhTPO dosing in an every other day schedule. The study begins with a 21-day
pre-chemotherapy cycle
(cycle 0) to assess safety, activity, and pharmacokinetics in patients with
cancer. At present, 16
subjects have been enrolled on to this trial. The data indicates a dose-
dependent increase in peripheral
blood platelet counts in cycle 0, though the platelet responses, and the
pharmacokjinetics, are blunted
when compared to similar doses of IV rhTPO. Thus far, two antibodies to the
truncated form of rhTPO
(erythropoietin-like domain) have been observed; one was preformed, and
neither was neutralizing in a
bioassay, or clinically. Subjects had recurrent or advanced gynecologic
neoplasms and were receiving
carboplatin.
Schema
2,
, 21
_
1 2 3 4 5 6 7 8 2,
rhTPO
Carboplatfn chemotherapy
Dose Levels, Doses and Number of Subjects
DOSE
LEVEL DOSE N
I A 0.6 pg/kg QOD X4 3
2A 1.2 pg/kg QOD X4 3
3A 2.4 pg/kg QOD X4 3
4A 3.6 pg/kg QOD X4 3
Control* 1.2 pg/kg QOD X4 6
18
*Control--patients receive rhTPO only in cycles after experiencing a platelet
count <
30/000/x:1 in the preceding cycle
53
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
EXAMPLE 8
Animals: 76 CD-1 female mice BW= 19.7-26.3 g
Aerosol Exposure:
Mice were exposed to rhTPO in a nose-only inhalation (CH Technologies) with
simultaneous
measurement of breathing pattern (body plethysmograph) for a total duration of
60 minutes. A PAR1-
IS2 nebulizer was used to aerosolize rhTPO at 22 psi and a flow rate of 5.1
LPM. Filter samples were
taken to estimate the aerosol concentration for each exposure. A vehicle
control group and 3 different
concentrations (0.05, 0.5, and 5.0 mg/ml rhTPO) were nebulized. The dose
groups are expressed as the
estimated amount per kg that deposited in the mouse lungs for each group. Half
of the animals were
exposed only once (Single exposure) while the other half were exposed to rhTPO
3 times on days 0, 2
and 6. Anti-rhTPO antibodies were measured in only the highest dose group, but
these antibodies were
not neutralizing. The dose groups are shown in the table below.
Dose groups:
(rhTPO) Nebulized (mg/ml)n Estimated Lung Dose
(mg/kg)
0 I7 0
0.05 17 6.4
0.5 17 64
5.0 16 640
Data Endpoints:
Serum and blood were collected at -4, 3, 6, 8, 10, 14, 21, 30, and 43 days
post aerosol
inhalation for hematology (platelet counts) and measurement of serum anti-TPO
antibodies.
Estimation of Deposited rhTPO Lung Dose:
Deposited dose (pg/kg)= Chamber concentration (pglml) x Minute volume (ml/min)
x time of
exposure (min) x Deposition fraction / BW (kg)
where: Chamber concentration = 0.000839, 0.00839, or 0.0839 lcg/ml
Minute volume = 30 ml/min
Time of exposure = 60 min
Deposition fraction = O.I
Body weight = .023 kg
Deposited dose = 6.4, 64, or 640 ug/kg (for 0.05, 0.5, or 5 mg/ml solutions).
Platelet counts for mice
exposed to a single inhalation (dose) of rhTPO are shown in Figure 20.
Platelet counts for mice
exposed to multiple inhalations (dose) of rhTPO are shown in Figure 21.
54
CA 02288964 1999-11-O1
WO 98/52598 PCTNS98/10475
EXAMPLE 9
Animals: Female (C57BLxCBA)F1 (BCBA) mice approximately 12 weeks old were bred
at
the Experimental Animal Facility of the Erasmus University, Rotterdam, The
Netherlands, and
maintained under SPF conditions. Housing, experiments and all other conditions
were approved by an
ethical committee in accordance with legal regulations in The Netherlands.
Experimental setup: TBI was given at day 0 using a two opposing l3~Cs sources
(Gammacell
40, Atomic Energy of Canada, Ottawa, Canada) at a dose rate between 0.92 and
0.94 Gy/min. Doses
used were 6 Gy for the single dose irradiation and a total dose of 9 Gy was
split in three doses of 3 Gy
given with 24 hour intervals. For each data point groups of three mice were
killed. All parameters
were collected for individual mice.
Test Drug: Recombinant full length murine TPO produced by CHO cells (Genentech
Inc.,
South San Francisco, CA was used throughout the experiments, diluted in
PBS/0.01 % TWEEN-20 and
administered intraperitoneally in a volume of 0.5 ml.
TPO levels: Data for characterization plasma TPO pharmacokinetics were
generated at
Genentech, Inc. as previously described. In short, mice were injected i.p.
with 1251-rmTPO either with
a single dose of 0.9 microgram/mouse (ca 45 microgram/kg) or with three doses
of 0.3
microgram/mouse (ca 15 microgram/kg) separated by 24 hours. Citrated blood was
collected
immediately after dosing and at intervals thereafter (n=3 mice per timepoint),
centrifugated at 2950 x g
for 10 minutes, plasma harvested, and TCA- precipitable radioactivity
determined. Pharmacokinetic
parameters were estimated after converting TCA-precipitable cpm/mL and fitting
the concentration
versus time data to a two-compartment model with first order absorption using
nonlinear least-squares
regression analysis (WIN-NONLIN; Statistical Consultants, Lexington, KY). Area
under the
concentration time curves (AUC), maximum concentration (Cmax), terminal half
lives (tl/2), and
clearance (mL/hr/kg) were calculated using coefficients and exponents obtained
from the model fits.
Hematological examinations: After either-anesthesia the mice were bled by
retro-orbital
puncture and killed by cervical dislocation. Blood was collected in EDTA
tubes. Complete blood cell
counts were measured using a SYSMEX F-800 hematology analyzer (Toa Medical
Electronics Co.,
LTD., Kobe, Japan). Differential white blood cell counts were performed after
May-Grunwald-
Giemsa staining.
Colony assays: Serum free methylcellulose cultures were used in this study.
Appropriate
numbers of bone marrow cells were suspended in Dulbecco's modified Eagle's
medium (Dulbecco's
MEM) obtained from GIBCO (Life Technologies LTD, Paisley, Scotland)
supplemented with the
amino acids L-alanine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic
acid and L-proline
(Sigma), vitamin B12, biotin, Na-pyruvate, glucose, NaHC03, and antibiotics
(penicillin and
streptomycin) at an osmolarity of 300 mOsm/1 (x-medium). Appropriate numbers
of cells in oc-
medium containing 0.8% methylcellulose (Methocel A4M Premium Grade, Dow
Chemical Co.,
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Barendrecht, The Netherlands), 1% bovine serum albumin (BSA, fraction V,
Sigma), 2x10-6 mol/1
iron saturated human transferrin (Intergen Company N.Y., NY), 10-~ mol/I
N2Se03 (Merck), I 0-4
mol/1 ~3-mercapto-ethanol (Merck, iinoleic acid (Merck), and Cholesterol
(Sigma) at a final
concentration between 7.5 x 10-6 mol/1 and I.5 x 10-5 mol/I for both,
depending on the kind of
progenitor cell colony cultured and 10-3 g/I nucleosides (cytidine, adenosine,
uridine, guanosine, 2'-
deoxycytidine, 2'-deoxyadenosine, thymidine and 2'-deoxyguanosine obtained
from Sigma) were
plated in 35 mm Falcon 1008 Petri dishes (Bercton Dickinson Labware) in I ml.
aliquots.
Granulocyte/macrophage colony formation was stimulated by a saturating
concentration of M-
CSF purified from pregnant mouse uteri extract (PMUE) essentially as described
before, supplemented
with 100 ng/ml murine stem cell factor (SCF, a kind gift from Immunex
Corporation, Seattle, WA) and
10 ng/ml murine 1L-3 (R&D, Minneapolis, MN). GM-CFU colonies were counted
after 7 days of
culture.
BFU-E growth was stimulated by 100 ng/ml DCF and 4 U/ml murine erythropoietin
(EPO,
Behringwerke, Marburg, F.R.G.) purified from the serum of phenylhydrazine
treated mice, titrated to
an optimal concentration. Colonies were counted after 10 days of culture. The
culture medium of the
erythroid progenitors also contained hermine (bovine, type I, Sigma) at a
concentration of 2x 10-4
moUl.
Megakaryocyte progenitor cells (CFU-Meg) were cultured in 0.25% agar cultures.
Colony
formation was stimulated by 100 ng/ml SCF, l Ong/ml 1L-3 and 10 ng/ml murine
TPO (Genentech, Inc.,
San Francisco, CA). After 10 days colonies were dried, stained for
acetylchoiinesterase positive cells
and counted. All cultures were grown in duplicate at 37 ~C in a fully
humidified atmosphere with 10%
COZ in the air. Colony numbers represent the mean ~ standard deviation of bone
marrow samples of
individual mice.
The spleen colony assay: This assay was performed as described by Till and
McCulloch.
Briefly, mice were injected with 5 x 104 BM cells or 5 x 105 spleen cells in
HH one day after TBI.
Thirteen days later, mice were sacrificed, and spleens were excised and fixed
in Tellyesniczsky's
solution (64% ethanol, S% acetic acid and 2% formaldehyde) in H20.
Statistics: Standard deviations were calculated and are given in the text and
the figures on the
assumption of a normal distribution. The significance of a difference was
calculated by one way
analysis of variance followed by a non-paired Student's t test using STATVIEW,
Abacus Concepts
Inc., Berkeley, CA. All colony assays were done in duplicate for individual
mice. The results of the
colony assays are expressed as the means ~ ISD per femur or spleen for at
least three mice per group.
Experimental Design 1: BCBA F1 mice were subjected to 3 Gy total body
irradiation at
time 0. 0.3 microgram TPO/mouse was administered i.p. at various time points
as indicated in Figure 8
or 30 microgram TPO/mouse i.p. at -2 h.
56
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Figure 8 shows the thrombocyte level of 6 Gy irradiated mice at the time of
the nadir in the
placebo controls as a function of the time of administration of a single dose
of TPO. Based on the
kinetics observed, it appears that the peak levels of TPO reached shortly
after TPO administration were
the most relevant for efficacy. This was directly confirmed by administration
of a very high dose of
TPO 2 h before TBI (Fig. 9). The effect originated from multilineage cells, as
shown in the peripheral
blood by equivalent effects of TPO on red cells, white cells (mainly
neutrophils) and platelets. See
Table 1 below.
Table 1 - Major peripheral blood cell counts 10 days after 6 GY TBI and TPO
administration
Time TPO
relative dose (pg) N red cells white platelets
to x 1012/1 cells x 109/1
TBI x 109/1
- - 8 7.10.6 0.4f0.2 15668
+2 h 0.3 12 9.1 0.6 I .1 t 742 92
0.3
-2 h 0.3 3 9.00.1 0.70.2 53254
_.
30 3 9.00.3 0.80.2 71886
+24 h 0.3 15 7.S t 0.5 0.410.1 465 41
-
I normal - 19 10.2 0.6 5.3 1.9 1,123
mice I 89
Experiment design 2: BCBA F1 mice were subjected to 6 Gy total body
irradiation (TBI) at time -2 d,
-I d, 0 and 0.9 Microgram TPO/mouse was administered i.p. at various time
points as indicated in the
legend of Fig. 10, i.e., 2 hours before the first fraction of TBI, 2 hours
after the last fraction of TBI, or
3 fractions of 0.3 micrograms TPO 2 h after each fraction of TBI.
To simulate a protracted form of cytoreductive treatment more similar to
chemotherapy, TBI
was given in three equal fractions of 3 Gy separated by 24 h each
(experimental design 2). TPO was
given in a total dose of 0.9 microgram as indicated in the legend of Fig. 10.
The thrombocyte response
was optimal when this dose of TPO was given in three equal fractions of 0.3
microgram TPO, 2 h after
each fraction of TBI. Similar effects were shown for red cells and white
cells. Table 2 shows that in
this experimental setting also, a very high dose of TPO 2 h before the first
fraction of TBI was equally
effective. Fig. 11 and Fig. 12 show the hemopoietic progenitor cell data of
bone marrow and spleen,
respectively which demonstrate that the most optimal dose schedule for TPO,
i.e., 3 x 0.3 microgram 2
h after each fraction of TBI, also rapidly normalized progenitor cell levels
without major fluctuations
seen in the other treatment groups.
Figure 13 shows the pharmacokinetic data following three doses of 0.3
microgram of TPO or a
single dose of 0.9 microgram. Peak levels relevant occur about 2 h after i.p.
injection. An effective
level is 30 ng/ml plasma. However, the minimum effective TPO level has not yet
been determined by
titration experiments.
From the data, it can be seen that maintaining a high level of TPO during
cytoreductive
treatment results in multilineage stimulation and peripheral blood cell
recovery.
57
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98J10475
Table 2 - Major peripheral blood cell counts 10 days after 3 x 3 Gy TBI and
TPO administration
TPO time TPO dose N red cells white cellsplatelets
relative (fig) x 1012/1 x 109/1 x 109/1
to
TBI
- - 9 5.8 0.8 0.3 0.1 5 1 25
3x +2h 0.3 6 8.60.2 1.010.2 8831163
+ 2 h 0.9 3 6.610.7 0.410.1 5271 135
-2h 0.9 3 7.20.2 0.50.1 21580
-2 h 30 3 8.4 t 1.0 0.9 0.1 791 156
normal mice- 19 10.2 0.6 5.3 I 1123 89
.9
TPO appeared to be highly effective in mice exposed to a total dose of 9 Gy
TBI in three equal
fractions separated by 24 h each, if administered intraperitoneally 2 h after
each TBI fraction. TPO
administration prevented the severe reduction of thrombocyte numbers observed
in the placebo control
group, stimulated the recovery of granulocytes and also fully prevented the
development of anemia.
Similar to the 6 Gy single TBI experiments, the effect appeared to be mediated
by accelerated
reconstitution of progenitor cells of multiple blood cell differentiation
lineages. This implies that the
efficacy of TPO is dependent on residual immature multilineage cells, which
need to be stimulated by
TPO in a time window following TBI.
We approached the question as to whether immature cells were involved by
simple short-term
quantitative transplantation assay. Following transplantation of bone marrow
into lethally irradiated
1 S recipients, the number of spleen colonies at day 13 (CFU-S-13) is a
meausure for relatively immature
repopulating stem cells associated with the initial short-term wave of
hemopoietic reconstitution, which
lasts for several months. By this assay, the effect of TPO treatment on
immature progenitor cells could
be directly demonstrated. In mice exposed to 9 Gy TBI in three equal
fractions, the number of
detectable CFU-S-13 of TPO treated mice were approximately 14-fold increased
at 24 h after the last
fraction of TBI compared to the placebo control mice (Table 3). Similar
increases were observed in
progenitor cell numbers along the three iineages examined. These results
provided a strong indication
of a major effect of TPO on the most immature multilineage cells detectable by
a clonogenic assay,
consistent with the presence of TPO receptors on such immature cells.
The small time window to achieve optimal efficacy of TPO is peculiar in view
of the slow
phase of the wash-out of TPO levels, which has a terminal half life of
approximately 20 h and would
result in approximately similar levels at alI time points within the first
twelve h after administration
with the exception of the initial rise due to the distribution in plasma. This
led us to speculate that the
high levels of TPO in the first few hours after administration would be of
decisive importance. The
58
CA 02288964 1999-11-O1
WO 98/52598 'CT/US98/I0475
latter hypothesis was tested in two ways, i.e., by pharmacokinetic
measurements and by administration
of a very high dose of TPO before TBI to examine whether an efficacy could be
reached similar to that
obtained by TPO administration after each fraction of radiation. By
superimposing the
phanmacokinetic data on the efficacy data, it can be derived that effective
levels are larger than 20
ng/ml and occur approximately 2 h after i.p. administration. From the latter
observation, we concluded
that in these mice a high level of TPO approximately 4 h after TBI is required
to alleviate the radiation
induced bone marrow syndrome by stimulation of immature target cells. This was
directly tested by
administration of a dose of 30 micrograms TPO i.p. (calculated on the basis of
the initial distribution) 2
h before the first radiation fraction. The results demonstrated that indeed
such very high levels of TPO
during the fractionated TBI regime are decisive to prevent thrombocytopenia.
Thrombocyte counts 10
days after the last dose of TBI in mice treated with 30 micrograms before the
first dose of TBI were not
significantly differently from those of the mice treated with the most
effective schedule of 0.3
microgram TPO 2 h after each TBI fraction. A similar efficacy was obtained by
the high dose of TPO
2 h before a single TBI dose of 6 Gy.
Table 3: Effects of TPO treatment following 9 Gy TBI (3x3Gy, 24 hours apart)
on CFU-S day 13 and
progenitor cell content of bone man ow 24 hours after the last dose of TBI in
mice treated with TPO 2
hours after each dose of TBI vs control
CFU-S d GM-CFU BFU-E CFU-Meg
Treatment 13 /femur /femur /femur
(colonies
per
femur)
Placebo 1.9 597 229 8.3 3 22 10
TPO 3*0.3 27.3 2026 131 558 t 282 430 135
EXAMPLE 10 - Study of Patients receiving rhTPO and undergoing Autologous Bone
Marrow
Transplant (ABMT).
After harvest of the bone marrow harvest, all patients received
cyclophosphamide 180 mg/kg,
thiotepa 900 mg/m2, ~ carboplatin 600 mg/m2. After infusion of the
unmanipulated graft (day 0),
patients began IV rhTPO on day 1, either qd or q3d, until either day 21 or a
patient count _> SO k/pl (see
2S Table below). The rhTPO was administered to patients cohorts in dose-
escalating fashion. All patients
received G-CSF until the absolute neutrophil count was >_ SOO/pl. Platelets
were transfused for a
platelet count < 20 K/ul, or as clinically indicated.
Platelet recovery was defined as the frst day of an unsupported platelet count
>_ 25,000/Itl
(simple definition) or, more rigorously, the first of >_ 2 consecutive days of
untransfused platelet counts
>_ 25,000/p.l with the second count being greater than or equal to the
preceding value (stable or rising
definition). Neutrophil recovery was defined as the first of 2 consecutive
days with an absolute
S9
CA 02288964 1999-11-O1
WO 98/52598 PCTNS98/10475
neutrophil count >_ 500/p.l. Patients were compared to 15 historical controls
undergoing autologous
bone marrow transplant using the same transplant regimens.
Table
Median Number Median Median Day
Dose Level Number of Day of
(N) Platelet of PlateletNeutrophil
Transfusions Recovery Recovery
(range) (range) (>_S00/ml)
(range)
1 (0.3 p.glkg)7 6 (2-11) 18 (11-25)10.5 (9-13)
2 (0.6 pg/kg) 6 7 (3-15) 16.5 (12-40)11 (10-28)
3 (1.2 lzg/kg)7 6 (3-11) 21 (15-28)I 1 (10-13)
4 (2.4 p,g/kg)3 11 (6-16) 24.5 (16-33)15.5 (11-20)
(0.6 pg/kg) 3 6 (5-10) 17 (15-21)11 (10-11)
6(4.8 ~g/kg) 6 8 (4-18) 19 (14-34)11.5 (10-14)
All Study Patients32 6 (2-18) 18 (11-40)11 (9-28)
Historical 15 Not Available 19 10
Controls
5
rhTPO in all Dose Levels was administered Q3D with the exception of Dose Level
S where the
rhTPO was administered QD.
Thirty-three patients with a median age 49 years (23-59 years), were enrolled
in this study; all
evaluable for safety and hematoiogic response. Seven patients received rhTPO
at the 0.31tg/kg dose
level, 7 at the 0.6 pg/kg level; 7 at 1.2 p,g/kg; 3 at 2.4 pg/kg; and 6 at 4.8
pg/kg (see Table above). All
levels were safely tolerated, and rhTPO has not been associated with any study-
drug-related adverse
events. Chemotherapy-related adverse effects occurred as expected. One patient
experienced
prolonged pancytopenia due to human herpes virus-6 infection. Only two
hemorhagic episodes during
the period of thrombocytopenia, epistaxis and a subdural hematoma, were
observed, both when platelet
counts were < 25,OOOp,L. Both resolved without long-term sequelae. There were
no episodes of
thrombosis or veno-occluusive disease noted. Over the entire group of patients
in this study, the
median time to plt recovery (stable and rising definintion) was 17.5 days.
In summary, rhTPO in combination with G-CSF appears to be safe and well-
tolerated in
patients undergoing myeloablative therapy and rescue with autologous bone
marrow.
EXAMPLE 11 - Peripheral Blood Progenitor Cell (PBPC) mobilization study in
Patients with Breast
Cancer
Patients were treated in cohorts of 3 evaluable patients at a thrombopoietin
(TPO) dose of
0.6,1.2 or 2.4 p,g/kg IV with dose escalation in the successive cohorts if
toxicities related to
CA 02288964 1999-11-O1
WO 98/52598 PCT/US~la;10475
thrombopoietin did not occur. No serious toxicity related to TPO occurred. The
optimal biologic dose
is considered the lowest dose which will maximize CD34+ cells/kg/liter of
blood processed in the
PBSC collection. Secondary endpoints are the intervals to recovery of
granulocytes and platelets after
CVP and after CBT/PBPC transplant.
Treatment Remimen
CVP: Cyclophosphamide 1.5 mg/m2/d IV+ mesna; etoposide 250 mg/m2 dl-3;
cisplatin 40
mg/m2 dl-3, followed by single dose thrombpoietin 0.6-2.4 ~g/kg IV d4 G-CSF
6pg/kg ql2h.
Upon recovery of WBC > 1.0, PBPC collection by large volume apheresis 3x BV,
target >
I O 3 x 106 CD34+ cells/kg.
CBT: Cyclophosphamide2.0 gm/m2 IV, Thiotepa 240 mg/m2/d, BCNU 150 mg/m2/d days
-8,
-7, -6 with reinfusion of the cryopreserved cells on day 0.
G-CSF 5 ~g/kg/d SC until recovery of granulocytes.
Table
Independent
t-test
against
ParametersG-CSF G-CSF null
only + hypothesis
TPO no
difference
at
a.05
Apheresis
Collection
Parameters
(mean
t std)
Patient
6 patients
12 patients
~a
Population
4/6 (67%)
single
10/12
(83%)
single
collection
collections
2/6 (33%)
two 2/12
(17%)
two
collections
collections
Patient 71.5 72.5 p
t =
12.0 1 .4908
S.
I
Weight
(kg)
Blood
Processed
(L) per 13.298 13.300 p
=
1.255 1.825 .3626
Apheresis
Collectionnd 60% nd
Efficiency (median)
of
CD34 cells
Transplant
Dose (
10) per
kg (mean
t std)
CD34+ 15.268
t 18.867
34.479
32.235
p = .1999
CD34T THYT 5.653 7.267 23.417 22.41 p = .0802
I
CD34+ THYd'm 4.842 t 6.447 13.671 14.941 p = .1900
CD34T CD41'~ 2.51 i 3.107 1.592 I .345 p = . 3864
CD34 CD41 0.537 0.383 0.753 0.639 p = .4617
THY'
CD34T CD41'~ 0.444 0.364 0.450 0.372 p = . 9713
THYdim
61
CA 02288964 1999-11-O1
WO 98/52598 '~:T/US98/1-0475
Engraftment: days to reach cell target (mean ~ std)
ANC500 10 f 1 9 t 1 nd
PLT2p 11 + 2 -9 + 2 nd
PLTSp 12 t 1 ~ 12 ~ 3 I nd
Thrombopoietin was well tolerated when given with G-CSF following CVP
chemotherapy for
PBPC mobilization.
Mobilization was enhanced compared to historical controls. A median of one
apheresis was
required to reach target cell dose. Hematopoietic recovery post transplant was
rapid.
EXAMPLE 12 - PBPC Study of Patients with Breast Cancer
A phase I clinical trial was conducted to assess the feasibility and possible
efficacy of single
and repeated doses of thrombopoietin (TPO) together with G-CSF 10 microgram/kg
for peripheral
blood progenitor cell (PBPC) mobilization followed by high dose chemotherapy
(HDCT) with
cisplatin, VP-16 and cyclophosphamide (Cy) in patients with high-risk and
responsive stage IV breast
cancer.
The HDCT treatment scheme was as follows:
Day-12 Cisplatin 125 mg/m2
VP-16 30 mg/kg
Day -5 Cisplatin 125 mg/m2
VP-16 30 mg/kg
Day -3 Cy 100 mg/kg
Day -2 - 25% of PBPC (transplant)
Day 0 75% of PBPC (transplant)
The TPO dosing scheme was as follows:
Day TPO Dose # of Patients
Arm A 1 0.3 microgram/kg3
1.2 microgram/kg3
2.4 microgram/kg4
Arm B -3, -1, 0.6 microgram/kg6
1
1.2 microgram/kg0
0.3 microgram/kg3
62
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Mobilization consisted of TPO and G-CSF 10 microgram/kg (5 microgram/kg BID)
in group
A. G-CSF 10 microgram/kg once a day in group B. G-CSF 10 microgram/kg (5
microgram/kg BID)
in group C.
Apheresses were carried out processing ~ 10 liter of blood via a CS-3000
Fenwall or COBE-
Spectra cell separator. PBPC-s were cryopreserved in a solution containing 5%
DMSO and were
frozen by simple immersion into a -130 °C freezer. Group A vs B vs C
comparisons were performed
using the Kruskal-Wallis test. Group A vs B were compared using Wilcoxon rank-
sum test. Data on
PBPC apheresis, hematopoietic recovery and transfusion requirements are
presented as median (range).
Platelet (PLT) transfusions were provided for <_ 20,000 PLT/ul or as
clinically indicated.
Platelet independence is defined as the day after the last platelet
transfusion. Single pheresis products
and pooled platelet products are counted as 1 PLT transfusion.
PATIENT CHARACTERISTICS
Group A Group B Group
C
Age 46 (34-61)44 {28-62)45 (36-57)
Prior Regimens 1 (1-4) 1.5 (1-S) 1 (1-2)
Prior ChemoRx 6 (3-23) 5 (3-18) 4 (3-7)
cycles
N (/u) N (/u) N ("/u)
Stage lUlll 12 (73) 14 {54) I 1 (100)
Stage IV 7 (37) 12 (46) 0
Prior Rt 3 (16) 6 (23) 0
COMPARISON OF APHERESIS REQUIREMENTS, CD34+ and MNC YIELD
Group A B C p-value
N 19 26 11
Aphereses 2 (2) 4 (2-6) 3 {3-5) .0001
MNC* 4.1 (.5-6.5)2.3 (1.2-4.3)NA .0001
CD34T 5 (2-12.7) 0.9 (0.1-4.3)2.4 (0.4-7-7).0001
* Mononuclear cell yield in 10~/kg; + CD34 yield in 10°/kg
63
CA 02288964 1999-11-O1
WO 98152598 PCT/USyz~110475
HEMATOPOIETIC RECOVERY and TRANSFUSION REQUIREMENTS
Group A B p-value
N 14 26
AGC >_ 500/ul 7.5 (6-9) 8 (7-11) .0001
PLT independence9 (7-11) 10.5 (5-21) .0001
PLT'transfusions4 (1-l0) 6 (2-52) .002
RBC transfusions3 (2-7) 4 (2-6) .009
RBC = red blood cell; AGC =
TPO in the dose ranges tested is well tolerated. TPO in combination with G-CSF
increases the
efficacy of PBPC mobilization and CD34+ yield. TPO and G-CSF mobilized PBPC
accelerate both
platelet and granulocyte recovery.
EXAMPLE 13 - Other Embodiments
The invention specifically contemplates treatment cycles in which the
radiation or
chemotherapy agent is administered on multiple consecutive days, for example
on 4, 5, 6 or 7
consecutive days, where the TPO dose is administered prior to the first of the
consecutive days and/or
concurrent with one or more of the consecutive days of the treatment cycle.
For a treatment cycle of 5
consecutive days, TPO might be given on day -1 and on days 6, 9, I2, 15, etc.
In another example, for
a treatment cycle of 7 consecutive days, TPO might be given on day -1 and on
days 2, 4, 6, 8, 10, 12,
IS etc. or on day -1 and on days 4, 6, 8, 10, 12, etc. In another embodiment,
the radiation or
chemotherapy agent will be given on alternate days of the treatment cycle,
e.g. days 1, 3, 5. In this
embodiment, TPO might be given on day -1 and on days 2, 4, 6, 8, 10, etc.
EXAMPLE 14
A further use of TPO according to the invention is for ex vivo expansion of
progenitor cells
obtained, for example, from mammalian bone marrow, peripheral blood, or
umbilical cord blood.
Progenitors expanded in such a manner can be used for allogeneic stem cell
transplant for patients who
have been treated with chemotherapy or radiation treatment. A progenitor
population that is enriched
for stem cell activity is the CD34+ population and this population can be
father enriched by selecting
for CD34+CD38- cells. This population has the ability to generate multilineage
hematopoietic colonies
in vitro and multipotential hematopoietic engraftrnent in vivo. Progenitor
stem cells for expansion can
be obtained from peripheral blood by pheresis and from bone marrrow aspirates
by standard
techniques. Hematopoietic progenitors can also be obtained from umbilical cord
blood. Hematopoietic
stem cells having the CD34+ phenotype may then be isolated from the blood or
marrow using an
immunomagnetic enrichment column. The isolated cells may then be cultured in a
cell growth medium
64
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
containing a cocktail of the grumh factors TPO, Flt-3 and c-kit ligand in
order to expand or increase
the number of cells in the stem cell population. The growth factors are added
in amounts sufficient to
stimulate growth of the progenitor stem cells. Preferably, each of the growth
factors is added in an
amount of about 10 to about 100 ng/ml to growth media containing about 102 to
about 106 stem
cells/ml. The cells are cultured using standard culture techniques, for
example, about 35 - 40'C in
aproximately 5% C02 for about 1 - 8 weeks. The cultures are exchanged into
fresh media containing
growth factors every week. The growth media may contain other conventional
nutrients, fetal serum,
etc in standard amounts. The expanded cells are then readministered as an
allogeneic stem cell
transplant according to known procedures.
In the following table is shown the ability of the CD34+ cultures after 8
weeks expansion to
generate lymphohematopoiesis in vivo using the SCID-hu bone assay. In bone
grafts injected with
cells from the expanded cultures these cells contributed to the lymphoid,
myeloid and progenitor
hematopoietic compartments. This shows that the expanded cells maintained
their in vivo multipotent
engraftment potential.
TABLE: Engraftment of TPO/KL/FL expanded progenitors in SCID-hu mice.
ConditionStudy% of mice ~% donor % donor % donor
engrafted HLAJCD34 HLA/CD33 HLA/CD19
TPO/FL/KL1 80% 4.9 +/- 8.8 +/- 55.3 +/-
1.5 2.1 8.9
TPO/FL/KL2 100% 6.9 +/- 4.9 +/- 59.6 +/-
2.4 1.9 14.1
MATERIALS AND METHODS
Isolation of human hematopoietic stem cell population: Hematopoietic
progenitor cell
populations were isolated from human bone marrow. Briefly, the mononuclear
fraction was enriched
for CD34+ cells using animmunomagnetic enrichment column. (Miltenyi Biotech,
Auburn, CA).
Purity was routinely >90% by FACS.
Suspension culture assays: Hematopoietic stem cell populations were seeded at
2e4 cells/mL
in IMDM Gibco BRL (Grand Island, NY), plus 10 % fetal bovine serum (Gibco
BRL), 10 5 M 2-
mercaptoethanol, 10 6 M hydrocortisone , and 2 mM L-glutamine (Gibco BRL).
Growth factors were
added at the following concentrations: Flt-3 ligand (Immunex, Seattle WA) 50
ng/mL, TPO
(Genentech, S. San Francisco, CA) 50 ng/mL, and c-kit ligand (R and D Systems)
50 ng/mL. Cultures
were incubated at 37°C/5% C02 for seven days. On day 7 all wells were
harvested and ail cells were
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
counted by hemacytometer. For subsequent platings, 2e4 cells/mL were added to
fresh media and
growth factors and incubated for an additional seven days. All conditions were
done in duplicate.
Flow cytometric analysis: For FACS analysis, cells were resuspended in PBS/2%
FBS at le6
cells /mL and stained with mouse anti human CD34 FITC, CD38 PE (Becton
Dickenson). Viable cells
were selected by propidium iodide exclusion and analyzed on a FACscan (Becton
Dickenson).
Colony Assays: Methylcellulose colony assays were performed using "complete"
myeloid
methylcellulose media (Stem Cell Technologies, Vancouver, B.C.). Cells were
seeded in
methylcellulose at 1,000 cells/mL and plated in 4 x 35 mm gridded dishes.
Colonies were counted and
visually phenotyped on an inverted phase contrast microscope after 14 days in
culture.
SCID-hu mouse reconstitution assay: CB-17 scidlscid mice were implanted with
fetal bone
marrow as described previously. Mice were used so that the grafts and cells
were mismatched for
major histocompatibility complex (MHC) class I antigens. Mice received 250
rads whole body y
irradiation and then followed by injection of 30,000 cultured human bone
marrow cells into the bone
graft. Eight weeks after the injection of the cells, the bone grafts were
harvested and analyzed for
i5 donor HLA contribution to FITC conjugated anti human CD34 (progenitor),
anti human CD33
(myeloid), and anti human CD19 (lymphoid). Donor HLA positive cells were then
sorted by FACS.
Thirty thousand donor HLA positive cells were then injected into secondary
recipients in the same
manner as the primary recipients. Eight weeks after injection the secondary
bone grafts were removed
and analyzed for engraftment of CD34, CD19, and CD33.
The foregoing description details specific methods which can be employed to
practice the
present invention. Having detailed such specific methods, those skilled in the
art will well enough
know how to devise alternative reliable methods at arriving at the same
information in using the fruits
of the present invention. Thus, however detailed the foregoing may appear in
test, it should not be
construed as limiting the overall scope thereof; rather, the ambit of the
present invention is to be
determined only be the lawful construction of the appended claims. All
documents cited herein are
hereby expressly incorporated by reference.
66
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Genentech, Inc.
Cohere, Robert
Eaton, Dan L
Jones, Andrew JS
Jones, Dennie V
Powell, Michael F
Sweeney, Theresa D
Thomas, Griffith R
and Wagemacher, Gerard
(ii) TITLE OF INVENTION: Novel Administration of Thrombopoietin
(iii) NUMBER OF SEQUENCES: 24
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Genentech, Inc.
(B) STREET: 1 DNA Way
(C) CITY: South San Francisco
(D) STATE: California
(E) COUNTRY: USA
(F) ZIP: 99080
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 inch, 1.94 Mb floppy
disk
(B) COMPUTER: IBM PC compatible
(C} OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: WinPatin (Genentech)
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/859767
(B) FILING DATE: 21-May-1997
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 09/015016
(B) FILING DATE: 28-Jan-1998
50
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Schwartz, Timothy R.
(B) REGISTRATION NUMBER: 32171
(C) REFERENCE/DOCKET NUMBER: P0989P4PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 650/225-7467
(B) TELEFAX: 650/952-9881
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A} LENGTH: 32 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
67
CA 02288964 1999-11-O1
CVO 98/52598 PCT/US98/10475
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
ATCGATATCG ATCAGCCAGA CACCCCGGCC AG 32
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
IS
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
GCTAGCTCTA GACAGGGAAG GGAGCTGTAC ATGAGA 36
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
TCTAGATCTA GATCACCTGA CGCAGAGGGT GGACC 35
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
ATCGATATCG ATAGCCAGAC ACCCCGGCCA G 31
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: Nucleic Acid
{C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
AGTCGACGTC GACGTCGGCA GTGTCTGAGA ACC 33
68
CA 02288964 1999-11-O1
WO 98/52'598 PCTNS98/10475
(2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
AGTCGACGTC GACTCACCTG ACGCAGAGGG TGGACC 36
(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 62 base pairs
{B) TYPE: Nucleic Acid
{C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
CGCGTATGCC AGCCCGGCTC CTCCTGCTTG TGACCTCCGA GTCCTCAGTA 50
AACTGCTTCG TG 62
(2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 61 base pairs
(B} TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
AGTCACGAAG CAGTTTACTG AGGACTCGGA GGTCACAAGC AGGAGGAGCC 50
GGGCTGGCAT A 61
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
CTAGAATTAT GAAAAAGAAT ATCGCATTTC TTCTTAA 37
69
CA 02288964 1999-11-O1
wo 9sis2s9s PcTnls- ~ u47s
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CGCGTTAAGA AGAAATGCGA TATTCTTTTT CATAATT 37
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
CTAGAATTAT GAAAAAGAAT ATCGCATTTC ATCACCATCA CCATCACCAT 50
CACATCGAAG GTCGTA 66
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 64 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:
TACGACCTCG ATGTGATGGT GATGGTGATG GTGATGAAAT GCGATATTCT 50
TTTTCATAAT TCCG 64
(2) INFORMATION FOR SEQ ID N0:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 65 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii} MOLECULE TYPE: DNA (genomic)
SS
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:13:
CTAGAATTAT GAAAAAGAAT ATCGCATTTC ATCACCATCA CCATCACCAT 50
CACATCGAAC CACGT 65
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
(2) INFORMATION FOR SEQ ID N0:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:14:
TACGTGGTTC GATGTGATGG TGATGGTGAT GGTGATGAAA TGCGATATTC 50
TTTTTCATAA TTCCGA 66
(2) INFORMATION FOR SEQ ID N0:15:
{i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
TCCACCCTCT GCGTCAGGT 19
(2) INFORMATION FOR SEQ ID N0:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(8) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:16:
AGCTACCTGA CGCAGAGG 18
(2) INFORMATION FOR SEQ ID N0:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 62 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:17:
GCAGCAGTTC TAGAATTATG TCNCCNGCNC CNCCNGCNTG TGACCTCCGA 50
ACACTGGAGG CT 62
71
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98; ~ :~~75
(2) INFORMATION FOR SEQ ID N0:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:18:
GAAGGACATG GGAGTCACGA AGCAGTTTAC TGAGAACAAA TGACTCTTG 49
(2) INFORMATION FOR SEQ ID N0:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 95 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:19:
CTAGAATTAT GAAAAAGAAT ATCGCATTTA TCGAAGGTCG TAGCC 45
(2) INFORMATION FOR SEQ ID N0:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:
TACGACCTTC GATAAATGCG ATATTCTTTT TCATAATT 38
(2) INFORMATION FOR SEQ ID N0:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs
(B) TYPE: Nucleic Acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:21:
CTAGAATTAT GAAAAAGAAT ATCGCATTTC TTCTTAAACG TAGCC 45
(2) INFORMATION FOR SEQ ID N0:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: Nucleic Acid
72
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(ii} MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:22:
TACGTTTAAG AAGAAATGCG ATATTCTTTT TCATAATT 38
(2) INFORMATION FOR SEQ ID N0:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 332 amino acids
(B) TYPE: Amino Acid
IS (D) TOPOLOGY: Linear
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:23:
Ser Pro Ala Pxo Pro Ala Cys Asp Leu Arg Val Leu Ser Lys Leu
1 5 10 15
Leu Arg Asp Ser His Val Leu His Ser Arg Leu Ser Gln Cys Pro
20 25 30
Glu ValHisPro LeuProXaa ProValLeu LeuProAla ValAsp
35 40 45
Xaa XaaLeuGly GluTrpLys ThrGlnMet GluGluThr LysAla
50 55 60
Gln AspIleLeu GlyAlaVal ThrLeuLeu LeuGluGly ValMet
65 70 75
Ala AlaArgGly GlnLeuGly ProThrCys LeuSerSer LeuLeu
BO 85 90
Gly GlnLeuSer GlyGlnVal ArgLeuLeu LeuGlyAla LeuGln
95 100 105
Ser LeuLeuGly ThrGlnXaa XaaXaaXaa GlyArgThr ThrAla
110 115 120
His XaaAspPro AsnAlaIle PheLeuSer PheGlnHis LeuLeu
125 130 135
Arg GlyLysVal ArgPheLeu MetLeuVal GlyGlySer ThrLeu
140 145 150
Cys ValArgArg AlaProPro ThrThrAla ValProSer ArgThr
155 160 165
Ser LeuValLeu ThrLeuAsn GluLeuPro AsnArgThr SerGly
170 175 180
Leu LeuGluThr AsnPheThr AlaSerAla ArgThrThr GlySer
185 190 195
Gly LeuLeuLys XaaGlnGln GlyPheArg AlaLysIle ProGly
200 205 210
Leu LeuAsnGln ThrSerArg SerLeuAsp GlnilePro GlyTyr
73
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
215 220 225
Leu Asn Arg Ile His Glu Leu Leu Asn Gly Thr Arg Gly Leu Phe
230 235 240
Pro Gly Pro Arg Arg Leu GlyAlaPro Asp Ser
Ser Thr Ile Ser
245 250 255
Gly Thr Ser Thr Gly Leu ProProAsn Leu Pro
Asp Ser Gln Gly
ZO 260 265 270
Tyr Ser Pro Pro Thr Pro ProThrGly Gln Thr
Ser His Tyr Leu
275 280 285
Phe Pro Leu Pro Thr Pro ThrProVal Val Leu
Pro Leu Gln His
290 295 300
Pro Leu Leu Asp Pro Ala ProThrPro Thr Thr
Pro Ser Pro Ser
305 310 315
Pro Leu Leu Thr Ser Thr HisSerGln Asn Ser
Asn Tyr Leu Gln
320 325 330
Glu Gly
332
(2) INFORMATIONFOR SEQ
ID N0:24:
( i) SEQUENCECHARACTERISTICS:
(A) LENGT H: 153 acids
amino
(B) TYPE: Amino Acid
(D) TOPOLOGY:
Linear
(x i) SEQUENCEDESCRIPTION:SEQ ID N0:24:
Ser Pro Ala Pro Ala Asp LeuArgVal Leu Lys
Pro Cys Ser Leu
1 5 10 15
Leu Arg Asp Ser His Val Leu His Ser Arg Leu Ser Gln Cys Pro
20 25 30
Glu Val HisProLeu ProXaaPro ValLeuLeu ProAlaVal Asp
35 90 45
Xaa Xaa LeuGlyGlu TrpLysThr GlnMetGlu GluThrLys Ala
50 55 60
Gln Asp IleLeuGly AlaValThr LeuLeuLeu GluGlyVal Met
65 70 75
Ala Ala ArgGlyGln LeuGlyPro ThrCysLeu SerSerLeu Leu
80 85 90
Gly Gln LeuSerGly GlnValArg LeuLeuLeu GlyAlaLeu Gln
95 100 105
Ser Leu LeuGlyThr GlnXaaXaa XaaXaaGly ArgThrThr Ala
110 115 120
His Xaa AspProAsn AlaIlePhe LeuSerPhe GlnHisLeu Leu
125 130 135
74
CA 02288964 1999-11-O1
WO 98/52598 PCT/US98/10475
Arg Gly Lys Val Arg Phe Leu Met Leu Val Gly Gly Ser Thr Leu
190 145 150
Cys Val Arg
153
