Note: Descriptions are shown in the official language in which they were submitted.
CA 02297490 2000-O1-20
WO 991Q6562 PCTlUS98115794
METHOD ENABLING READMINISTRATION OF AAV VECTOR VIA IMMUNOSUPPRESSION OF HOST
BACKGROUND
A. Field of the Invention
The present invention is directed to a method for providing a
somatic gene therapy. In particular, the present invention is directed to a
method
for somatic gene therapy, particularly in humans, that comprises administering
an
adeno-associated viral vector encoding the gene of interest and an
immunosuppressant. The present method is useful because it allows for
expression of a gene encoded by the AAV vector without inducing a neutralizing
immunoresponse.
B. Background of the Invention
All of the viruses proposed for gene therapy, including for example,
retroviruses, adenoviruses, herpes viruses and adeno-associated viruses,
express
proteins recognized as foreign in their mammalian hosts. However, some viral
vectors express more foreign proteins than others and are thus, more
antigenic.
For example, a retroviral vector is an integrating RNA-based vector, which
requires expression of both a wild-type reverse transcriptase and integrase to
obtain ultimate expression of the recombinant gene. An adenoviral vector is a
non-integrating DNA-based vector. However, it still requires the expression of
many of its proteins in order to obtain expression of the recombinant gene.
Thus,
in a patient previously exposed to the wild-type virus of the viral vector, an
immune response is generated that would destroy any cells infected by the
viral
vector. To circumvent this problem, some viral vectors are prepared by
modifying a wild-type virus that is selectively pathogenic to a species other
than
its intended target. For example, the envelope protein of wild-type Moloney
murine leukemia virus (MoMLV), whose normal host is a mouse, has been
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
2 -
modified to be amphotropic, and thus capable of infecting other non-mammalian
species. Such modifications of viral envelope proteins are extremely
laborious.
Accordingly, it would be desirable to provide an alternative method of gene
therapy that does not require genetic alteration of the specificity of a
species
specific virus.
Viral vectors can be either integrating (i.e., requires integration into
the host cell DNA to be expressed) or non-integrating. An integrating viral
vector
provides the prospect for long term gene expression. In contrast, a non-
integrating vector provides for short-term gene expression. Accordingly, it is
an
object of the present invention to provide a method for somatic gene therapy
to a
patient, wherein the vector integrates into the DNA of the patient's host cell
to
provide long term somatic gene expression
AAV vectors are single-stranded linear DNA integrating vectors
that are non-pathogenic and can infect both dividing and non-dividing cells.
The
AAV genome, as exemplified by AAV-2, contains two inverted terminal repeats
(ITRs) at opposing ends of the virus that are 145 by long. Gerry et al.,
(1973) J.
Mol. Biol.79: 207-225; Kozcot et al., (1973) PNAS USA 70: 215-219; and Lusby,
et al., {1980) J. Virol. 34: 402-409. Each repeat can form a T-shaped hairpin
structure which is composed of two small palindromes flanked by a larger
palindrome. The AAV coding region, which is between the two ITRs, is divided
into three regions: rep, tip and cap. The function of the rep region is to
encode
for four non-structural proteins that regulate of AAV DNA replication and
expression. The function of the cap region is to code for the three structural
proteins: VPI, VP2 and VP3 of the capsid. AAV preparations are stable and can
be produced at high titers ( > 10'2 particles/ml). See for example, Flotte &
Carter
(1995) Gene Ther.2, 357-362 and Samulski, (1989) J. Virol. 63, 3822-3828.
There are recent reports demonstrating long term expression of transgenes
following delivery of AAV vectors into lung, liver, muscle, heart and brain.
See
Flotte, {1993) Proc. Natl. Acad. Sci. USA 90, 10613-10617; Koeberl, (1997)
*rB
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
3
Proc. Natl. Acad. Sci. USA 94, 1426-1431; Fisher, (1997) Nat. Med. 3, 306-312;
Xiao, (1996) J. Virol. 70, 8098-8108; Kaplitt, (1994) Nat. Genet. 8, 148-154;
and
Kaplitt, (1996) Ann. Thorac. Sur. 62, 1669-1676. Likewise, injection of rAAV
vector into skeletal muscle has been shown to lead to persistent, high level
S expression of transgenes. See Fisher, (1997) Nat. Med. 3, 306-312 and Xiao,
(1996) J. Virol. 70, 8098-8108.
Unfortunately, however, numerous experiments have demonstrated
that after a single intramuscular injection of a rAAV vector, readministration
of
the rAAV vector does not lead to expression of the recombinant protein, even
if it
encodes a different recombinant protein. Gene delivery experiments performed
with AAV vectors demonstrate that the intracellularly expressed AAV proteins
elicit strong cell-mediated immune responses that eliminates the transduced
cells.
Even when a replication-defective AAV virion lacks all virally encoded genes,
the
virion is encapsulated in the AAV capsid proteins that are responsible for the
entry
into the cell and transport of the packaged DNA to the nucleus. Because AAV
viruses are relatively ubiquitous and non-pathogenic, a majority of the
population
of animals and humans has been exposed to one or more of the seven serotypes
of
AAV and has developed an immune response thereto. This response would
neutralize any attempted gene therapy that employed an AAV vector of the same
serotype as the immunizing strain. Accordingly, it is an object of the present
invention to develop a method for administering an AAV vector to a patient in
need of somatic gene therapy, wherein protein expression would not be
neutralized
by the patients' immune system.
CA 02297490 2000-O1-20
WO 99/065b2 PCT/US98115794
4
SUMMARY OF THE INVENTION
The Applicants have discovered that a patient that has developed an
immune response to one or more adeno-associated viruses (AAV) may none the
less be recipient for AAV vector-mediated gene therapy, if prior to, during or
within a short time after the time of administering an rAAV vector particle,
the
humoral arm of the immune system of the patient is transiently
immunosuppressed. Thus in one aspect, the present invention is directed to a
method for obtaining in vivo expression in a patient of a therapeutic agent
encoded
by a gene contained within an AAV vector, the patient suspected of having an
immune response to AAV, the method comprising administering to the patient in
need of the therapeutic agent a replication defective recombinant AAV particle
(virion) having a gene encoding the therapeutic agent; and before, during or
within
a short period after administering the AAV vector, transiently
immunosuppressing
the humoral immune response of the patient to obtain expression of the
therapeutic
agent. In the above method, the therapeutic agent is a protein, polypeptide,
antisense RNA or a ribozyme. Preferably, the therapeutic agent is a protein or
a
polypeptide.
By the phrase "transiently immunosuppressed" or "transient
immunosuppression," as used herein, is meant that the patients' humoral
(antibody
producing) immune response has been reduced when compared to the patient's
immune response in the absence of the immunosuppressive treatment. The
transient immunosuppression of the patient's humoral immune system is
accomplished by administering to the patient a pharmaceutical composition
comprising For other art recognized humoral immunosuppressive agent or a
combination thereof. Preferably, the immune system of the patient is
transiently
immunosuppressed by administering to the patient a pharmaceutical composition
comprising an antibody that is an anti-CD4, anti-CD40 (antagonistic), anti-
CD40L, anti-B7-1 or anti-B7-2 antibody.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
Thus, in another aspect, the invention provides a method for
delivering to a mammalian patient, preferably a human patient, multiple
administrations of a rAAV virion encoding a therapeutic protein comprising (a)
administering to the patient a therapeutically effective amount of rAAV
virions
5 encoding the therapeutic protein; (b) prior to, along with immediately after
administering the rAAV virion, transiently immunosuppressing the humoral
immune system of the patient to obtain expression of the therapeutic protein;
and
at a later date, repeating steps (a) and (b). Preferably, the immune system of
the
patient is transiently immunosuppressed both prior to and following the first
administration of the rAAV virions. The administering step of the present
invention is performed using one of the many conventional techniques known to
the art for administering a medicament. Preferably, these techniques include
intramuscular administration, intranasal administration, intra-arterial
administration and subcutaneous administration.
In yet another aspect, the invention is directed to a pharmaceutical
composition comprising in combination an effective amount of an rAAV virion
encoding a therapeutic protein, preferably a human therapeutic protein, and an
effective amount of an immunosuppressant suitable for transiently
immunosuppressing a mammalian patient, preferably a human, in a
pharmaceutically acceptable carrier.
In one embodiment, the pharmaceutical composition is in the form
of an aerosol suitable for administration by inhalation. The solution may
comprise
about 106 to about 10'6 particles of rAAV virion and a humoral
immunosupressant
in a sterile solution of about 0.9% sodium chloride. The aerosol may be
contained
in a sterile pneumatic aerosol generator reservoir, such that an aerosol of
the
solution is produced at the rate of about 8 to 12 liters per minute at about
30 to 50
psi of compressed air. In another embodiment, the pharmaceutical may be in
lyophilized form, which needs reconstitution with a suitable carrier such as
0.9 %
saline, D50 water, R.inger's lactate and the like.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
6
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA and B disclose leptin expression by rAAV vectors.
Figure lA is a representation of the Western Blot analysis of leptin
expression in
vitro from supernatant harvested from human 293 cells infected with 1X109 AAV-
leptin (lane 1); 1X10'° AAV-leptin particles (lane 2); mock infected
cells (lane 3);
or cells transfected with 2 pg of pCMVKm201-leptin (lane 4). Quantitation of
leptin expression for lanes 1-3 of Figure lA as reported in p,g leptin/I06
cellslday
by radioimmunoassay is shown in Figure 1B.
Figures 2A and 2B show the effect of rAAV-leptin treatment on
body weight and food intake, respectively, in oblob mice which received
subcutaneous injections of either 10" particles of rAAV-leptin (O) or saline
(0)
and weights were monitored three times weekly. The mean ~SEM of ten mice in
each group was measured. For simplicity in Figures 2A and 2B, only one time
point is shown for each week.
Figure 3 is a photograph showing the physical appearance of mice
following rAAV-leptin treatment. Mice were photographed six weeks after being
treated with rAAV-leptin (left) or saline vehicle (right).
Figure 4 shows the results of measurement of circulating leptin
levels (ng/rnl) at weeks 5-14 post rAAV-leptin administration in ob/ob mice
(dotted bars), relative to ob/ob mice receiving saline (solid bars), and C57
mice
(striped bar).
Figures 5A-SC show the results of measurement of the effects of
rAAV-leptin on glucose metabolism and insulin secretion in treated and
untreated
oblob mice. Mice were fasted for eighteen hours and bled for determination of
fasting glucose (Fig. 5A) and insulin (Fig. SB), six weeks post-injection. The
values presented are the mean ~SEM of five mice. Values are the mean + of
three mice in each group. Tests were performed on fasted mice, eight weeks
post-
injection.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
7
Figure 6 is a bar graph showing ELISA assay results from Example
4 of erythropoietin ("Epo") expression (mIU/106 cellslday) by HT1080 cells
infected with rAAV-Epo Sx109 particles; 1x109 particles; 2x108 particles;
leptin
rAAV (control) and uninfected HT1080 cells (control).
S Figures 7A and 7B show the results of in vivo administration of
rAAV-Epo virions (particles) to mice. Figure 7A is a graph showing the plasma
Epo concentration in mIUlml as a function of time (weeks) in mice administered
rAAV-Epo as measured by ELISA. Figure 7B is a corresponding graph showing
the hematocrits of four mice administered either rAAV-Epo (squares) or saline
(circles)as a function of time (weeks) relative to injection.
Figure 8 shows the results of the ELISA assay using sera from
rAAV treated mice and saline treated mice.
Figures 9A and 9B show the results of in vivo administration of
rAAV-Epo virions (particles) to baboons. Figure 9A is a graph showing the
1S plasma Epo concentration in mIU/ml as a function of time (weeks) in baboons
administered rAAV-Epo as measured by ELISA. Figure 9B is a corresponding
graph showing the hematocrits of two baboons administered rAAV-Epo as a
function of time (weeks) relative to injection.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
8
DETAILED DESCRIPTION
The present invention has multiple aspects. In its broadest aspect,
the present invention is directed to a method for obtaining in vivo expression
in a
patient of a therapeutic agent encoded by a gene contained within an AAV
vector,
the patient suspected of having an immune response to AAV, the method
comprising the steps of:
(a) administering to a patient in need of the therapeutic agent a
replication defective recombinant AAV particle (virion) having a gene encoding
the therapeutic agent; and
(b) before, during or within a short period after administering
the AAV vector, transiently immunosuppressing the humoral immune system of
the patient to obtain expression of the protein.
In this embodiment, every patient is "suspected of having an
immune response to AAV" because the ubiquitous nature of AAV makes it likely
that most patients already have an immune response. Thus, rather than
prescreen
every patient, which would be expensive and dilatory, the vector and a humorai
immunosuppressive agent (also referred to herein as "immunosuppressant") are
administered in combination to any patient in need of a therapeutic agent.
The method of the present invention is particularly useful when a
patient in need of a therapeutic protein requires multiple or ongoing
treatments
over a period of years. The Applicants' invention allows for multiple
administrations to the same patient of the same replication-defective
recombinant
AAV particles having a gene encoding a therapeutic protein needed by the
patient,
and provides for expression of the desired recombinant protein even if the
patient
has developed an immunity to the AAV of the vector particle. Thus, in this
second aspect, the invention provides a method for delivering to a mammalian
patient, preferably a human patient, multiple administrations of a rAAV virion
encoding a therapeutic protein comprising the steps of:
CA 02297490 2000-O1-20
WO 99106562 PCT/US98/15794
.. 9
(a) administering to the patient a therapeutically effective
amount of rAAV virions encoding the therapeutic protein;
(b) prior to, during or within a short time after administering
the rAAV virion, transiently immunosuppressing the humoral immune system of
the patient to obtain expression of the therapeutic protein; and
(c) at a later date, repeating steps (a) and (b).
In an embodiment of the above described methods (collectively "method"), the
immune system of the patient is transiently immunosuppressed both prior to and
following the first administration of the rAAV virions.
The therapeutic agents that are expressed within the method of the
present invention include proteins, polypeptides, antisense RNA and ribozymes.
Preferably, the therapeutic agents are proteins or polypeptides. Because AAV
has
a broad cell and host range, the method of the present invention is able to
transform the cells of any patient to express one of the above described
therapeutic
agents therein. The present invention is particularly useful for those
patients that
require or that would benefit from a therapeutic agent on a continuous or
bolus
basis .
To determine which arm of the host immune response was
responsible for the inability to readminister rAAV vectors, readministration
experiments were carried out in class I, class II and CD40 ligand deficient
mice as
described in Example 9. The results in Example 9 demonstrated that the humoral
arm of the immune system played a key role in mounting an immune response to
the AAV transfected cells and caused their destruction before the recombinant
protein could be expressed. By transiently immunosuppressing the humoral arm
of the immune system of the host at the time of first administration of an AAV
vector, it is possible to readminister the rAAV virions as described in
Example 9.
Agents that are used to achieve transient humoral immunosuppression of the
patient's immune system include anti-B7-I or B7-2 antibodies, anti-CD40
(antagonistic) antibodies or CD40 ligand antibodies or a combination thereof.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
.- 10
Methods for making and using many of these antibodies, and antigen binding
fragments thereof, are disclosed in U.S. Patent Application Serial No.
08/015,147
(now allowed), U.S. Patent 5,397,703, U.S. Patent No. 5,677,165, U.S. Patent
5,747,034, U.S. Serial No. 081469,015, U.S. Serial No. 08/463,893, and U.S.
Serial No. 08/606,293, all of which are expressly incorporated herein by
reference. Other agents, which are useful for transiently immunosuppressing
the
humoral immune response in a patient, include cyclophosphamide and
deoxyspergualin. See, Smith, Gene Therapy 3 (1996) 496-502. Still other agents
which are useful to transiently immunosuppress the humoral immune response in
a
patient include anti-CD3 (OKT3) antibodies, CTLA4Ig (Bristol Myers) and anti
CD4 antibodies and FK506. Preferably, the humoral immune response of a
patient is transiently immunosuppressed by administering to the patient a
pharmaceutical composition comprising an antibody that is an anti-CD4, anti
CD40 (antagonistic), anti-CD40L, anti-B7-1 or anti-B7-2 antibody, or a
combination thereof.
The replication-defective AAV vectors and virions utilized in the
method and pharmaceutical compositions of the present invention are prepared
using conventional methods of virology, molecular biology, microbiology and
recombinant DNA techniques. Such techniques are well known and explained
fully in the literature, including, for example, in Sambrook, Molecular
Cloning:
A Laboratory Manual (Current Ed.); DNA Cloning: A Practical Approach (D.
Glover, ed.); Oligonucleotide Synthesis {Current Ed., N. Gait, ed.); Nucleic
Acid
Hybridization (Current Ed., B. Homes and S. Higgins, eds.); Transcription and
Translation (Current Ed., B. Homes and S. Higgins, eds.); CRC Handbook of
Parvoviruses (P. Tijessen, ed.); Fundamental Virology, 2d Edition (B.N. Fields
and D.M. Knipe, eds.); Current Protocols in Human Genetics, Vol. 1 (N.
Dracopoli, ed.). These publications and all other publications referenced
throughout this specification are expressly incorporated herein by reference.
CA 02297490 2000-O1-20
WO 99!06562 PCT/US98/15794
11
Gene transfer, gene therapy or gene delivery refer to methods,
techniques or systems for reliably inserting into a host cell a heterologous
or a
foreign DNA or a DNA not normally expressed. The resultant insertion can be by
integration of transferred genetic material into the host cell genomic DNA, by
extrachromosomal replication and expression of transferred replicons or in a
non-
integrated manner.
Vector means any genetic element that is capable of replication
when associated with the proper control elements and that can transfer DNA or
RNA sequences between cells. Examples include plasmids, phages, transposons,
IO cosmids, chromosomes, viruses, and virions and include cloning and
expression
vehicles and viral vectors.
The AAV vectors and replication-defective AAV virions utilized
herein comprise a DNA encoding a therapeutic protein operably positioned
between a pair of adeno-associated virus inverted terminal repeats ("AAV
ITRs").
AAV ITRs are art-recognized regions found at each end of the AAV genome that
function together in cis as recognition signals for DNA replication and for
packaging the AAV vector into an AAV coat. The nucleotide sequences of the
AAV ITR regions for the various AAV serotypes (i.e., AAV-1 to AAV-7) are
known in the art and vary in size with the serotpe. Typically, the AAV ITRs
range in size from about 125-145 bp. See for example, Kotin, Human Gene
Therapy 5 (I994) 693-801 and Berns "Parvoviridae and their Replication" in
Fundamental Virology, 2d Edition (B.N. Fields and D.M. Knipe, eds.). As used
here, the AAV ITRs of Applicants' recombinant replication-defective
retrovirion
need not be identical to the nucleotide sequence of the native, i. e. , wild-
type,
sequence, but may be altered by insertion, deletion or substitution of
nucleotides.
Further, the two AAV ITRs may be derived from any of the AAV serotypes, for
example AAV-1, AAV-2, AAV-3, AAV-4, AAV-5 and AAV-7, and need not be
identical to or derived from the same serotype, so long as they permit
integration
CA 02297490 2000-O1-20
WO 99/U6562 PCTIUS98I15794
12
of the heterologous sequence of interest into the recipient cell genome when
AAV
rep gene products are present in the cell.
The AAV rep coding region is the art-recognized region of the
AAV genome that encodes the proteins required for replication of the viral
genome and for insertion of the viral genome into a host genome during latent
infection. The rep coding region includes at least the four genes encoding the
two
long forms of rep (rep 78 and rep 68) and the two short forms of rep (rep 52
and
rep 40). For more details see, for example, Muzyczka, Current Topics in
Microbiol. 158 (1992) 97-129 and Kotin, Human Gene Therapy 5 (1994) 793-801.
The rep coding region may be derived from any AAV serotype or from a
functional homologue such as the human herpes virus 6 rep gene. The region
need not include all of the native sequence, but may be altered by insertion,
deletion or substitution of nucleotides, so long as the sequence that is
present
provides for sufficient integration when expressed in a suitable recipient
cell.
Preferably, the AAV vector and virions utilized in the present invention lack
one
or more of the rep proteins so as to render it replication- defective. More
preferably, the AAV vector of the present invention lacks all four of the rep
proteins.
The AAV cap coding region is the art-recognized region of the
AAV genome that encodes the capsid or coat proteins, VP1, VP2 and VP3, that
package the viral genome. For more details, see, for example, Muzyczka,
Current Topics in Microbiol. 158 (1992) 97-129 and Kotin, Human Gene Therapy
S (1994) 793-801. The cap coding region may be derived from any AAV serotype
or from a functional homologue. The cap coding region may be altered by
insertion, deletion or substitution of nucleotides, so long as the sequence
present
provide for sufficient packaging when expressed in a suitable recipient cell.
Although the cap coding region is preferably not included in the AAV vectors
and
the replication-defective AAV virions employed in the present invention, it
needs
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98115794
13 _
to be included in a helper vector that is expressed in a packaging cell that
recognizes and packages the ITRs and the genes) positioned therebetween.
Thus, the term "AAV vector," as used herein means a vector
derived from an adeno-associated virus seratype that includes at least those
sequences required in cis for replication and packaging, for example, a pair
of
functional ITRs flanking a heterologous (i.e., non-AAV) nucleotide sequence.
With this criterion, any AAV vector of any serotype can be employed in the
method of this invention. Examples of vectors for use in this invention are
the
AAV-2 based vectors disclosed in Srivastava, PCT Patent Publication WO
IO 93109239 or simply a pair of AAV-7 ITRs having one or more genes
operatively
positioned therebetween.
The AAV ITRs employed in the vectors and virions of the present
invention may be the native (wild-type)AAV ITRs or they may be modified. If
the
ITRs are modified, they are preferably modified at their D-sequences. The
native
D-sequences of the AAV ITRs are sequences of twenty consecutive nucleotides in
each AAV ITR (i. e., there is one sequence at each end) which are not involved
in
HP formation. The D-sequences of the ITRs are modified by the substitution of
nucleotides, such that 5-18 native nucleotides, preferably 10-18 native
nucleotides,
most preferably 10 native nucleotides, are retained and the remaining
nucleotides
of the D-sequence are deleted or replaced with non-native, i.e., exogenous,
nucleotides. One preferred sequence of five native nucleotides that are
retained is
5' CTCCA 3'. The exogenous or non-native replacement nucleotide may be any
nucleotide other than the nucleotide found in the native D-sequence at the
same
position. For example, appropriate replacement nucleotides for native D-
sequence
nucleotide C are A, T and G, and appropriate replacement nucleotides for
native
D-sequence nucleotide A are T, G and C. The construction of four such AAV
vectors is disclosed in United States Serial No. 081921,467, filed September
2,
1997. Other employable exemplary vectors are pWP-19 and pWN-1, both of
which are disclosed in Nahreini, Gene 124 (1993) 257-62. Another example of
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
14
such an AAV vector is psub201 as disclosed in Samulski, J. Virol. 61 (1987)
3096.
Other suitable AAV vectors are the Double-D ITR vector. Methods
for making the double-D ITR vectors are disclosed in U.S. Patent No.
5,478,745.
Still other suitable AAV vectors are those disclosed in U.S. Patent No.
4,797,368
(Carter) and U.S. Patent No. 5,139,941 (Muzyczka), U.S. Patent No. 5,474,935
(Chartejee) and PCT Patent Publication WO 94/28157 (Kotin). Yet a further
example of an AAV vector employable in the methods of this invention is
SSV9AFABTKneo, which contains the a-fetoprotein (AFP) enhancer and albumin
promoter and directs expression of the herpes simplex thymidine kinase (TK)
gene
predominantly in the liver. Its structure and method for making are disclosed
in
Su, Human Gene Therapy 7 (1996) 463-70).
The replication-defective AAV vectors are packaged into empty
AAV capsids to produce the replication-defective AAV virions helper viruses
employed in the methods of the present invention. To package the replication
defective AAV vectors, which are typically one or more genes positioned
between
a pair of ITRs, one employs a helper construct or helper virus that has AAV-
derived coding sequences that function in trans to enable AAV replication, and
that include the AAV rep and cap sequences. The helper virus has AAV coding
sequences but lacks the AAV ITRs and thus are not packaged in the capsids that
are produced. This helper virus then provides for transient expression of the
AAV
rep and cap genes missing from the AAV vector. For greater details, including
exemplary AAV helper constructs, see, for example, Samulski, J. Virol. 63
(1989)
3822-28; McCarty, J. Virol 65 (1991) 2936-45 and U.S. Patent No. 5,139,941.
One such AAV helper construct comprises pKS repl cap, which contains the genes
encoding the AAV-2 rep and cap polypeptide sequences. Additional examples of
helper viruses, constructs and functions that can be employed include the
plasmids
pAAVIAd and pIM29+45 (see Samulski, J. Virol. 63 (1989) 3822-28 and
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
McCarthy, J. Virol 65 (1991) 2936-45) and those disclosed in U.S. Patent No.
5,622,856.
Accessory functions and accessory function vectors are non-AAV
derived functions and vectors containing sequences encoding such functions
upon
5 which AAV is dependent for its replication. Such accessory functions can be
derived or obtained from any of the known helper viruses, such as adenovirus,
herpesvirus (except herpes simplex virus type-1) and vaccinia virus and
include
moieties and/or sequences involved in activation of gene transcription, DNA
replication, synthesis of cap expression products and cagsid assembly. See,
for
10 example, Carter, "Adeno-Associated Virus Helper Functions" in CRC handbook
of Parvoviruses, Vol. I (1990) (P. Tijssen, ed.); Muzyczka, Current Topics in
Microbiol. 158 (1992) 97-129; Janik, Proc. Natl. Acad Sci 78 (1981) 1925-29;
Young, Prog. Med Virol. 25 (1979) 1213 and Schlehofer, Virology 152 (1986)
110-17.
15 The heterologous nucleotide sequences) that are inserted into the
replication-defective AAV vectors and virions of the present invention encode
one
or more therapeutic agents that include a therapeutic protein, polypeptide,
antisense RNA or a ribozyme, or a combination thereof. Typically, the vectors
or
virions contain from one to two therapeutic agents that are native or non-
native to
the recipient cell but which have a desired biological or therapeutic effect.
As disclosed above, the heterologous nucleotide sequences that are
introduced into the replication-defective AAV vectors and virions of the
present
invention include a gene that encodes a therapeutic protein or polypeptide,
preferably a human protein or polypeptide. Examples of therapeutic proteins
and
polypeptides that would be suitable for expression in the methods of the
present
invention include the LDL receptor, Factor VIII, Factor IX, phenylalanine
hydroxyiase, ornithine transcarbamylase, or al-antitrypsin; a cytokine, such
as
interleukin (IL)-1, IL-2 IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-
11, IL-
12, IL-13, IL-14 and IL-15, a-interferon, (3-interferon, the y-interferons,
tumor
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
16
necrosis factor CD3, ICAM-1, LFA-1, or LFA-3, a chemokine including
RANTES la, or MIP-lei (see Cocci, Science 70 (1996) 1811-15); a colony
stimulating factor, such as G-CSF, GM-CSF and M-CSF; growtr~ factors such as
IGF-1 and IGF-2; human hormones such as growth hormone, insulin, calcitonin,
prolactin, follicle stimulating hormone, luteinizing hormone, chorionic
gonadotropin or thyroid stimulating hormone; any one of the hepatitis genes;
thrombopoietin, erythropoietin, or leptin or a combination of the above. The
nucleotide coding sequences for these proteins and polypeptides are already
known
in the art. Even more sequences expressible in the methods and compositions of
the invention include Protein S and Gas6, thrombin, Coagulation Factor Xa,
acidic
fibroblast growth factor (FGF-1), basic FGF (FGF-2), keratinocyte growth
factor
(KGF), TGF, platelet derived growth factor (PDGF), epidermal growth factor
(EGF), hepatocyte growth factor (HGF) and HGF activators, PSA, nerve cell
growth factor {NCGF), glial cell derived nerve growth factor (GDNF), vascular
endothelial growth factor (VEGF), Arg-vasopressin, thyroid hormones
asoxymethane, triodothyronine, LIF, amphiregulin, soluble thrombomodulin, stem
cell factor, osteogenic protein 1, the bone morphogenic proteins, MFG, MGSA,
heregulins and melanotropin. Preferred proteins include but are not limited to
erythropoietin, thrombopoietin (G-CSF), Factor VIII, Factor IX, Factor Xa,
human growth hormone, leptin and IL-2, the DNA sequences of which are all
known in the art, particularly the human DNA sequences. The in vivo expression
of two typical proteins, erythropoietin ("Epo") and leptin from rAAV-Epo and
rAAV-leptin, respectively, using the methods of the present invention are
disclosed in the examples herein.
An antisense sequence that is expressible by the replication-
defective AAV vectors and virions of the present invention is an RNA sequence
that can prevent or limit the expression of over-produced, defective, or
otherwise
undesirable molecules by being sufficiently complementary in sequence to the
target sequence that binds to the target sequence. For example, the target
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
17
sequence can be part of the mRNA that encodes a protein, and the antisense RNA
would bind to the mRNA and prevent translation. The target sequence can be
part
of a gene that is essential for transcription, and the antisense RNA would
bind to
the gene segment and prevent or limit transcription. For example, group C
adenoviruses Ad2 and Ad5 have a 19 kilo Dalton glycoprotein (gp 19) encoded in
the E3 region of the virus that binds to class 1 MHC molecules in the
endoplasmic
reticulum of cells and prevents terminal glycosylation and translation of the
molecule to the cell surface. Prior to liver transplantation, the liver cells
may be
infected with gpl9-encoding AAV vectors or virions which upon expression of
the
gpl9 inhibit the surface expression of class 1 MHC transplantation antigens.
These donor cells may be transplanted with low risk of graft rejection and may
require a minimal immunosuppressive regimen for the patient. It may also
permit
a donor-recipient state to exist with fewer complications.
The ribozymes that are expressed by the replication-defective AAV
vectors and virions in the method of the present invention are useful in
treating
various diseases and conditions. Ribozymes are RNA polynucleotides capable of
catalyzing RNA cleavage at a specific sequence and hence useful for attacking
particular mRNA molecules. In chronic myelogenous leukemia for example, the
"Philadelphia chromosomal translocation" causes expression of a bcr-abl fusion
protein and abnormal function of the abl oncoprotein. Because the fusion mRNA
occurs only in cells that have undergone the chromosome translocation and
because the fusion transcript contains only two possible sequences at the
splice
junction, a ribozyme specific for either of the two bcr-abl fusion mRNA splice
junctions can inhibit expression of the oncoprotein. Exemplary ribozymes
include
ribozymes to hepatitis A, hepatitis B and hepatitis C. See Christoffersen and
Marr, J. Med Chem 38 ( 1995) 2023-37 and Baarpoiome, J. Hepatol 22 ( 1995) 57-
64. See U.S. provisional Patent Application Serial No. 60/025,616 flied
September 06, 1996, and herein incorporated by reference.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98I15794
18
In another embodiment of the present invention, the protein or
polypeptide encoded by the genes inserted into the replication-defective AAV
vectors and virions of the present invention provide one or more antigens from
pathogenic agents that may be used to immunize the patient. In this
embodiment,
the rAAV vectors or virions are administered in accordance with the methods of
the present invention, but are employed as vaccines as described in U.S.
Patent
Application Serial No. 09/096,966, filed June 12, 1998 and herein incorporated
by
reference. Preferred antigens are HCV antigens, such as HCV NS3, NS4, El, E2
and/or E2a. Also preferred are H. Pylori antigens VacA (cytotoxin), heat shock
protein, CagA (cai antigen} and urease B. Specific examples of other antigens
useful in this invention include HSV (herpes simplex virus), gD, gB and other
glycoproteins, HIV gp 120, p24 and other proteins, CMV (cytomegalovirus} gB or
gH glycoproteins, hepatitis D virus (HDV) deita antigen, hepatitis A virus
(HAV)
antigens, EBV (Epstein Barr virus), MMR and VZV (Varicella Zoster virus)
antigens, influenza antigens, rabies antigens and bacterial antigens from
Bordetella
pertussia, Neiserria meningitides (A, B, C, Y 135). The nucleotide sequences
encoding these antigens or antigenically active fragments thereof are well
known
to those of ordinary skill in the art.
By the term "active fragment," as used herein, is meant a
polypeptide containing less than a full-length sequence that retains
sufficient
biological activity to be used in the methods of the invention. By the term
"analog," as used herein, is meant a truncated form, splice variant, mutein
with
amino acid substitutions, deletions or additions, an allele, or derivative of
the
mature protein or polypeptide which possess one or more of the native
bioactivities of the full length protein or polypeptide. Thus, polypeptides
that are
identical or contain at least 60 % , preferably 70 % , more preferably 80 %
and most
preferably 90 % amino acid sequence homology to the amino acid sequence of the
mature protein wherever derived, from human or non-human sources are included
within this definition.
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
19 _
In addition to the AAV ITRs and the above-described nucleotide
sequences, the replication-defective AAV vectors and virions employed in the
present methods and composition may also include control sequences, such as
promoters and polyadenylation sites, selectable markers, reporter genes,
enhancers
and other control elements permitting for transcription induction andlor
selection.
The insertion of these sequences and sites is performed using conventional
techniques that are well known in the art.
To produce the replication-defective AAV virions of the present
invention, the AAV helper construct is used to complement AAV functions
missing from the AAV vector which are necessary for the production of AAV
virions, in particular, the rep and cap functions. Suitable helper constructs
having
complementing functions are well known in the art. The AAV vector, helper
construct and adenoplasmid accessory (helper) construct are introduced into
the
host cell either simultaneously or sequentially, using any of the well known,
art
recognized transfection techniques, for example by calcium phosphate
coprecipitation. Culture conditions include incubation in the range of
33° to 39°C,
preferably 37°C for approximately 48 to 120 hours. The cells are
collected and
lysate produced using three freeze/thaw cycles by sonication. The lysates are
then
centrifuged to remove cell debris and the rAAV virions purified by cesium
chloride equilibrium gradient centrifugation. Any residual adenoviral
particles can
be inactivated by heating the purified rAAV preparation to at least
56°C for 20-30
minutes. Alternatively, the rAAV virions can be purified by sulfonated
cellulose
column chromatography following the protocol described in Tamaose, Human
Gene Therapy, 7 (1996) 507-13.
The AAV virions of the invention are employed in pharmaceutical
compositions for the treatment of diseases and/or conditions in which systemic
administration of a therapeutic substance, for example, a secretory protein is
desired or for preventing infections by the organism whose antigen is
incorporated
into the AAV vector. The pharmaceutical compositions comprising an effective
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
zo
amount of the AAV virions of the invention in admixture with a
pharmaceutically
acceptable carrier, for example, a sterile, non-immunogenic solution (such as
0.9 % NaCI, D50 water, Ringer's lactate, or phosphate buffered saline) or with
an
adjuvant/antigen presentation system (such as alum). Other adjuvant/antigen
presentation systems, for example, MF59 (Chiron Corp.), QS-21 (Cambridge
Biotech Corp.), 3-DMPL (3-Deacyl-Monophosphoryl Lipid A) (RibiImmnochem
Research Inc.), clinical grade incomplete Freund's adjuvant (IFA), fusogenic
liposomes, water soluble polymers or Iscoms (Immune stimulating complexes)
may also be used. A mucosal adjuvant for preparation of intro-nasal
formulations
as described in PCT Patent Publication W095117211, published June 29, 1995
(Biocine Application Number PCTIIB95/00013) is preferably employed.
In another aspect, the present invention is directed to a
pharmaceutical composition comprising a therapeutically effective amount of a
replication-defective AAV virion having a gene encoding a therapeutic agent,
preferably a protein, in combination with an effective amount of a humoral
immune suppressant, and in a pharmaceutically acceptable carrier.
The pharmaceutical compositions that carry the vectors and virions
of the present methods are administered using conventional techniques known to
the art for administering any medicament. Preferably, the pharmaceutical
compositions employed in the present invention are administered intranasally,
intramuscularly, subcutaneously, intravenously or intraarterially.
Formulations
and modes of administration are discussed in greater detail below.
Formulations and Modes of Administering AAV Vectors
A. Intranasal Administration
The nasal cavity offers an important route of administration for the
recombinant AAV virions of the present invention. The human nasal cavities
have
a total surface area of approximately 150 cm2 and are covered by a highly
vascular
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
21
mucosal layer. A respiratory epithelium comprised of columnar cells, goblet
cells
and ciliary cuboidal cells line most of the nasal cavity. See Chien, Crit Rev.
in
Therap Drug Car sys 4 (1987) 67-194. The subepithelia contains a dense
vascular
network and the venous blood from he nose passes directly into the systemic
circulation, avoiding first-pass metabolism in the liver. By avoiding first-
pass
metabolism, delivery to the upper region of the nasal cavity may result in
slower
clearance and increased bioavailability. The absence of cilia in this area is
an
important factor in the increased effectiveness of nasal sprays as compared to
drops. The addition of viscosity-building agents, such as methycellulose can
change the pattern of deposition and clearance of intra nasal applications.
Additionally, bioadhesives can be used as a means to prolong residence time in
the
nasal cavity. Various formulations comprising sprays, drops and powders, with
or
without the addition of absorptive enhancers, have been investigated. See, for
example, Wearley, Crit Rev in Therap Drug Car Sys 8 (1991) 331-94.
It is advantageous to administer rAAV via the intra-nasal route.
Intra-nasal administration is easy and convenient, economical, safe (an
overdose
is, in most instances, treatable) and does not require medical personnel. the
nasal
route has been shown to be effective for the administration of a number of
molecules due to the extensive network of capillaries located under the nasal
mucosa. this facilitates effective systemic absorption and when the drug is
administered with absorption promoters, absorption occurs rapidly with high
bioavailability (see Gizurarwon, Acta Phann 2 (1990) 105). However, when
adenoviral vectors are administered intra-nasally, cellular, humoral and
mucosaI
CTL responses result. Additionally, it is also advantageous to be able to
readminister rAAV via the intra-nasal route.
The preparation of such intra-nasal solutions, having due regard to
pH, isotonicity, stability and the like is within the skill in the art.
Exemplary
formulations of the AAV vector containing lactose, trehalose or mannitol for
intramuscular or subcutaneous administration can be prepared by combining one
CA 02297490 2000-O1-20
WO 99106562 PCT/US98I15794
22 _
part 2x formulation buffer to one part purified rAAV The lactose buffer and
the
trehalose buffer each contains 25 mM trimethamine 70 mM NaCl,2 mglml
arginine, 10 mg/ml human serum albumin (HSA) and either 100 mg/ml lactose or
100 mglml trehalose in a final volume of 100 mls at a pH of 7.4. The mannitol
buffer contains 25 mM tromethamine, 35 mM NaCI, 2 mglml arginine, 10 mg/ml
HSA and 80 mg/ml mannitol in a final volume of 100 ml at a pH of 7.4.
The dosage regimen will be determined by the attending physician
considering various factors known to modify the action of drugs such as
physician
condition, body weight, sex, diet, severity of the condition, time of
administration
and other clinical factors. Exemplary dosage ranges comprise between 10' to
104
particles, preferably 106 to 10'6 particles, more preferably 10$ to
10'° particles,
most preferably 10'° to 10'1 particles.
Several types of drug delivery devices for the nasal cavity exist (see
Chein, Crit. Rev. Therap. Drug Carr. Sys. 4 (1987) 67). These systems include
nasal spray, nose drips, saturated cotton pledget, aerosol spray and
insuffiator.
The meter-dose nebulizer can deliver a predetermined volume of the formulation
t
the nasal cavity. One such nebulizer is the Ultravent, which is available from
Mallinckrodt.
The desired formulation of rAAV virion is placed in the reservoir
of the Ultravent pneumatic aerosol generator. The generator is driven with
compressed air at about 30-50 psi, preferably 40 psi, generating 10 liters/min
(at
40 psi) of aerosol. Using one-way valves, nose clips and mouth piece, this
system
is closed and ail gas is inspired or expired through a filter.
B. Intramuscular Administration
Prior to intramuscularly administering the replication defective
rAAV virions, the muscle tissue may be injected with a cell proliferating
agent.
See U.S. Patent 5,593,972. Preferably, the cell proliferating agent is
bupivacaine.
CA 02297490 2000-O1-20
WO 99/Ob562 PCT/US98/15794
23
The bupivacaine may be injected up to about twenty-four hours prior to
injection
of the rAAV virions. About SOUI to about 2 ml of 0.5 % bupivacaine-HCI and
0.1 % methylparaben in isotonic NaCI may be administered to the site where the
rAAV virions is to be administered. The cell proliferation agent may be
included
in the formulation with the rAAV virions. Preferably, SOpI to about 1500p1,
more preferably about 1 ml of the agent may be included.
C. Subcutaneous Administration
Any of the above-described formulations are administered
subcutaneously using standard techniques known even to technicians in the art.
For example, a pharmaceutical composition comprising a therapeutically
effective
amount of the replication-defective AAV virions of the invention, alone or in
combination with a humoral immunosuppressant, and in a pharmaceutically
acceptable liquid carrier (e.g., 0.9% sterile saline) is taken up in a sterile
syringe
with a 22 gauge needle and injected under the skin on the forearm of the
patient in
need of treatment. Optionally, this administration is followed up with the
administration of a one or more doses of a humoral immunosuppressant, using
the
manufacturers recommendations as a guideline with due consideration for the
age,
health, sex, and size of the patient.
D. Arterial Administration
The same liquid pharmaceutical compositions as described above
are used to administer a dose of the replication-defective AAV vectors or
virions
to a patient via an artery. The intraarterial administration is perforrr~ed
using
standard techniques that are known to the art, including the use catheters,
which
can be threaded through an artery to deposit the dose at a preferred tissue
site. The
use of such catheterization techniques are employed extensively in cardiac
visualization and are readily available to those skilled in the art. A
specific
krB
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
24
example of administering the replication-defective AAV virions to a renal
artery of
a patient is disclosed in Example 10 herein.
In Examples 1 through 4, we generated a rAAV vector carrying the
mouse leptin cDNA and demonstrated the ability of this vector to express
leptin in
vitro and in vivo. Leptin protein is a satiety factor responsible for
controlling food
intake in mammals. The oblob mouse lacks functional leptin; continuous
delivery
of the recombinant leptin protein corrects the deficiency and leads to weight
loss.
Example 1 details the construction of the rAAV-leptin construct. Example 2
describes the preparation and titering of rAAV-leptin particles. Example 3
details
the in vitro analysis of rAAV-leptin and Example 4 discloses the in vivo
administration of the construct in mice. We demonstrated that intramuscular
injection of rAAV vector carrying leptin into oblob mice, which lack a
functional
Ieptin gene, leads to long term correction (>80 days) of all metabolic
abnormalities
tested, including obesity and diabetes.
It is also interesting to note that the weight loss in the treated
animals is much more gradual than noticed in experiments where a bolus or
recombinant protein is administered. This is reflective of the kinetics of
gene
expression by rAAV vectors. Expression of a marker gene from rAAV vectors
injected into the mouse muscle gradually increases over a period of 4-6 weeks
before stabilizing (unpublished data). In contrast, adenoviral gene delivery
results
in rapid onset of protein expression, which is extinguished within two weeks,
presumably by immune response to adenoviral proteins. See Muzzin, Proc. Natl.
Acad. Sci. USA 93, 14804-14808.
The invention is further exemplified by the administration of the
heterologous sequence encoding monkey erythropoietin (Epo), in mammals. Epo,
which is produced in the kidney of mammalian adults is a key hormone involved
in regulation of erythrocyte differentiation and the maintenance of a
physiological
level of circulating erythrocytes (red blood cells). Clinically, Epo is the
treatment
of choice for anemia associated with chronic renal failure or for the
treatment of
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
thalassemia. The biological effect of Epo gene expression is monitored by
determining hematocit levels and the circulating concentration of the hormone
is
measured standard immunoassay or by ELISA.
5 EXAMPLE 1
rAAV-Leptin Vector Construction
pKm201CMV is an AAV cloning vector in which an expression
cassette, consisting of a CMV immediate early enhancer, promoter and intron
and
10 a bovine growth hormone (BGH) polyadenyIation site, is flanked by inverted
terminal repeat (ITR) sequences from AAV-2. pKm201CMV, was derived from
pKm201, a modified AAV vector plasmid in which the ampicillin resistance gene
of pEMBL-AAV-ITR (see Srivastava, (1989) Proc. Natl. Acad. Sci. USA 86,
8078-8082) has been replaced with the gene for kanamycin resistance. The
15 expression cassette from pCMVlink, a derivative of pCMV6c (see Chapman,
(1991) Nucleic Acids Res. 19, 193-198) in which the GBH poly A site has been
substituted for the SV40 terminator, was inserted between the ITRs of pKm201
to
generate pKm201 CMV. To construct the AAV leptin expression vector
pcICMVAAV-m-leptin, a S l lbp fragment, encoding murine leptin cDNA (see
20 Giese, (1996) Molecular Medicine 2, 50-58) was cloned into the Xba I- Bam
H1
sites of pKm201 CMV. In addition to the CMV immediate early
promoterlenhancer and intron, the AAV vector contains a post-transcriptional
regulatory element (PRE) from hepatitis B virus. The PRE, which increases
efficiency of mRNA transport (see Huang, Mol. Cell. Bio. I5, 3864-3869), was
25 included to increase the size of the vector genome for more efficient
packaging. A
579 by fragment, from the post-transcriptional regulatory element (PRE) region
of
Hepatitis-B (HBV) (see Huang & Yen, (1995) Mol. Cell. Biol. I5, 3864-3869)
was amplified using the primer set:
5' ACATACGCGTGCTTGCGTGGAACCTTTG 3' (SEQ ID NO: 1)
and
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115?94
26 _
5' TTGTGGCGCGCCAGCTTATCGATTTCGAACCCG 3' (SEQ ID NO: 2)
The resulting fragment was digested with Ascl and Mlul and inserted into an
MIuI
site between the leptin coding region and the GH poly A site. Inclusion of the
coding region for mouse leptin into this construct results in a 3.4 kb
packageable
vector genome. This vector plasmid was packaged using standard methods, and a
purified stock of 1.25x10'Zparticleslml was obtained.
AAV helper plasmid pKSreplcap (encoding rep and cap protein)
was constructed by cloning the AAV-2 genome, without the ITRs (AAV-2
nucleotides 192 through 4493) into pBluescript II KS+ (Stratagene, La Jolla,
CA).
EXAMPLE 2
Preparation and Titering of
Recombinant AAV-Leptin Particles
rAAV vectors were produced by a modified transient plasmid
transfection protocol. See Zhou, (1994) J. Exp. Med. 179, 1867-1875. Briefly,
human embryonic kidney 293 cells, grown to 60 % confluence in a 15 cm dish,
were co-transfected with 12.5 pg of helper plasmid pKS repl cap and 12.5 p.g
of
vector plasmid pCMVAAV-m-leptin or pCMVAAV-lacZ using the calcium
phosphate co-precipitation method. After 8 hr, transfection medium was
replaced
with IMDM + 10 % (fetal bovine serum) FBS containing adenovirus type 5 d 1312
at a multiplicity of infection (MOI) of 2. Seventy two hours post-infection,
the
cells were harvested in HEPES buffer (2.5 ml per dish) and iysed by three
cycles
of freezing and thawing. The cell lysage was centrifuged at 12,000x g for 20
min
to remove cell debris. The packaged rAAV virus was purified through two rounds
of cesium chloride equilibrium density gradients to remove any contaminating
- proteins and heated at 56°C for 45 min to inactivate residual
adenovirus particles.
For estimation of the total number of vector particles, the vector stock was
treated
with DNAse I, and encapsidated DNA was extracted with phenol-chloroform,
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
27
precipitated with ethanol. Released DNA was compared to a known standard by
dot blot analysis.
EXAMPLE 3
In Vitro Analysis of Recombinant AAV Leptin (rAAV-leptin)
109 or 101° rAAV-leptin particles were diluted in 2 ml of
IMDM + 10 % FBS and added to 1 x 106 human embryonic kidney cells (293 cells)
plated at 50% confluence on a 6-well dish. Virus was left on cells for 24 hr.
Cells were washed and 2 ml of fresh IMDM + 10 % FBS was added. Supernatant
was collected for Western blot or RIA analysis (24-48 hour post0l-infection}.
See
Figs. lA and 1B.
As a control, supernatant was harvested from cells transfected with
2lzg of the pCMVAAV-m-leptin packaging plasmid. For transfections, 2~g of
IS pCMV-AAV-m-leptin plasmid was incubated with l0ul of transfection reagent
LT1 (Panvera Inc., Madison WI) and added to Sx105 human embryonic kidney
cells (293 cells) seeded on six well dishes. Complexes were incubated with
cells
for four hours and refed with 2 ml of media. Cell supernatant was collected 48
hr
post-transfection and analyzed by Western blot or RIA.
For the Western blot, lOp.l of supernatant from infected or
transfected cells was mixed with Spl of 3x Laemmli buffer and boiled to
denature
proteins. Denatured supernatants were electrophorically separated on 14 % SDS-
PAGE (Novex, San Diego, CA) and transferred onto nitrocellulose. Blots were
probed overnight at 4°C with a 1:5,000 dilution of rabbit anti-leptin
antibody
(Giese, (1996) Molecular Medicine 2, 50-58) in PBS, containing 0.1 % Tween and
0.2 % nonfat dry milk. Following extensive washing, a horseradish peroxidase
conjugate of goat anti-rabbit IgG (Boehringer Mannheim, Indianapolis, IN) was
added. Following a one hour incubation and further washing, immunoreactive
bands were visualized by chemiluminescence (ECL kit, Amersham,
Buckinghamshire, England).
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
28
Western analysis, using a rabbit anti-mouse leptin antibody,
revealed a single immunoreactive protein in the supernatant from transfected
cells
and cells infected with 10'° particles. The secreted leptin protein
migrates at the
expected size of 16 kDa. No band was visible in the supernatant from cells
infected with 109 particles or mock transfected cells. See Fig. lA.
The level of leptin expression was quantitated using a sensitive
RIA. While mock infected cells released no detectable leptin into media, cells
infected with 109 and 10'° particles released 47 and 290 ng of leptin
per 24 hr/106
cells, respectively. See Fig. 1B. Interestingly, we found that the packaging
capability of the rAAV vector is sensitive to the size of the vector genome
packaged. Inclusion of PRE sequence to increase the size of the vector from
2840
to 3430 by helped in improving the functional titer (data not shown). This
result
is consistent with the findings of Dong et al. (1996) Human Gene Ther. 7, 2101-
2112, who have demonstrated a direct correlation between genome size and titer
of recombinant AAV vectors.
EXAMPLE 4
In Vivo Administration of rAAV-Leptin
Earlier reports using recombinant leptin protein have demonstrated
that the protein can be delivered by either i.p. or i.v. routes of
administration.
Reports which demonstrated the delivery of rodent leptin by gene therapy
utilized
adenoviral based delivery (i.v.) and the expression of the transgene
presumably
occurred in the liver. See Muzzin, (1996) Proc. Natl. Acad. Sci. U.S.A. 93,
14804-14808 and Chen, (1996) Proc. Natl. Acad. Sci. USA 93, 14878-14882.
We administered the rAAV vector by the intramuscular route and monitored food
intake and weight gain over a period of ten weeks, as follows.
Twenty four to six week old female C57BLI6J-oblob mice were
obtained from The Jackson Laboratory (Bar Harbor, ME). The weights of ten
rAAV-leptin treated mice were compared with ten mice treated with 0.9 % saline
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
29 _
vehicle on a weekly basis. Following anesthesia with a mixture of ketamine and
xylazine, 501 of normal saline or normal sale orlxl0" rAAV particles was
injected into the tibialis anterior (TA) muscle. In some experiments, both
legs
were injected on two successive days, while in other experiments twice as many
particles were injected on one day.
The results are summarize din Figure 2A. The effects of rAAV
leptin administration were gradual. Treated mice continued to gain weight for
the
first three weeks, but at a rate that was significantly less than the saline-
treated
controls (FIGURE 2A). (p=.004 for week 2 and .005 for week 3). During the
fourth week following administration of vector, the rAAV-injected mice began
to
lose weight while the sale-treated mice continued to gain weight. During
weeks,
5, 6 and 7, the treated mice continued to lose weight at a relatively constant
rate
(average of 2.3, 2.4 and 2.0 glanimal/week respectively). Weight loss in the
treated mice continued through weeks 8, 9, 10, 11 although the rate of loss
declined (1.4, 0.59 and 0.35, 1.02 glanimal/wk respectively}. There was a
slight
increase in the average weight of 0.2g during week 12. The saline-injected
mice
continued to gain weight from week 5-12, albeit at a slightly reduced rate. By
week 8, the average weight of leptin treated mice was less than half of the
control
(saline treated) oblob mice (25.9 vs. 52.1 g) (Fig. 3). Statistics were
calculated
using a Mann-Whitney two sample test. Calculations were performed one the
InSTAT software program. From week 4 onward the weight difference between
the two groups was statistically significant with p<.0005. The treated mice
were
observed to be much more physically active than saline treated oblob mice.
In sum, in comparison to saline treated mice, rAAV-leptin treated
mice gained significantly less weight starting from week 1 until the end of
the
- observation period. Treated animals began losing weight by week 4 and
continued
to lose weight until week 8 at which time weight began to stabilize. At week
8,
the average weight of these animals is much closer to the age matched C57
control
mice than to untreated oblob mice.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98I15794
Monitoring of food intake was begun in the third week following
injection. Pre-weighed standard mouse food was added to cages (containing five
mice) each evening and the amount of food consumed was measured the following
day. The reduction in food intake of treated mice corresponded with the extent
of
5 weight loss. As shown in Figure 2B, at the earliest time points monitored
(day
18-23) rAAV leptin treated mice ate a daily average of 3.4g of food per mouse
as
compared to an average of 5.1 g for saline treated controls. The following
week
(day 24-29) the mice ate an average 2.9 g of food per day and untreated mice
at
4.6 glday. From week 4 through week 7, the leptin treated mice consistently
10 consumed an average 1.9 g of food/day and by week 9 the consumption was ---
2.3
glday. During weeks 10 and 11 consumption, in the leptin treated mice,
plateaued
at 2.75glmouselday. Throughout this time period (weeks 4-11) the saline
controls
ate an average of 4.6 glmouse/day. This steady, low level of food intake in
treated mice coincided with a constant, gradual rate of weight loss.
15 To ensure that the observed weight loss was not due to a side-effect
of rAAV injection, a second study was performed. Tn this experiment, oblob
mice
were injected with either the rAAV-leptin vector or an rAAV-~3-galactosidase
vector as a negative control. The kinetics of weight gain for the ~i-
galactosidase
treated mice were identical to the saline treated mice in the initial
experiment (data
20 not shown). As in the first experiment, leptin treated mice gained weight
more
slowly in the early time periods and began to lose weight by week 4 (data not
shown) .
The level of circulating leptin was measured at 5, 7, 9 and 11
weeks after intramuscular delivery of rAAV-leptin. Blood was collected from
25 isofluorane anesthetized mice by retroorbital bleeds and separated into
serum. the
levels of circulating leptin were measured using a Lincomouse Leptin RIA Kit
(Linco, St. Charles, MO). At week 5, the serum leptin levels from five AAV-
leptin treated mice and five saline-treated controls were measured. Serum was
collected from mice at the indicated times and leptin levels were measured
using
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
31 _
the Linco Ria kit. Values are the average of 5 mice ~ SEM. Week 7 mice were
fasted for eighteen hours prior to serum collection. Mice tested at weeks 5> 9
and
11 were fed ad libitum prior to serum collection. Serum was not collected from
C57 mice at week 5.
As shown in Figure 4, at week 5 average leptin concentration for
the treated mice was 1.7 nglml, with a range of 1.3 - 2.34 ng/ml. The saline
treated oblob mice averaged 1.19ng/ml, with a range of 1.01 - 1.34 ng/ml. This
background may be due to reactivity with the truncated leptin protein which is
the
predicted product of the ob mutation. At week 7, the same groups of mice and
five C57 control mice were tested. The average serum leptin level of the rAAV-
leptin treated mice increased to 3.33 ng/ml (range = 2.9 - 4.56), the saline-
treated mice again measured 1.2 ng/m1 and the normal C57 mice had serum leptin
levels averaging 3.76ng/ml. Serum Ieptin levels in the rAAV leptin treated
mice
decreased to 2.46 nglml at week 9. Untreated oblob mice had circulating leptin
levels of 65 nglml and the wild-type C57 mice had levels of 4.19 ng/ml at this
timepoint. At the 11 week timepoint, the leptin concentration was 2.97 nglml
in
treated mice versus 1.03 nglml of reactive protein in the untreated oblob
mice.
This is again in the range of normal C57 black mice (2.31 nglml). P values for
treated versus untreated are .09, .0005, 007 and .0079 for weeks 5, 7, 9 and
11,
respectively.
Thus, ectopic expression of physiologic levels of leptin can prevent
onset of obesity. Interestingly, the RIA employed in this study also detects
some
activity in untreated oblob mice serum. This might be due to the presence of
endogenous inactive Ieptin secreted in this strain of mice (the ob defect is
due to
premature termination codon in the leptin coding sequence).
The oblob phenotype is characterized by insulin-resistant diabetes;
oblob mice are hyperglycemic, despite elevated levels of circulating insulin.
to
determine the effects of leptin gene therapy on diabetes, fasting blood
glucose and
insulin were measured. Mice were fasted for eighteen hours and bled for
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/15794
32 -
determination of fasting glucose (Figure SA) and insulin (Figure SB), six
weeks
post-injection. The values presented here are the mean ~ SEM of five mice.
(Figure SC) Glucose tolerance as determined in saline (~), r-AAV-leptin
treated
(O), or C57(*) mice by measuring blood glucose levels at indicated times after
intraperitoneal injection of glucose. Values are the mean ~ of three mice in
each
group. Tests were performed on fasted mice, eight weeks post-injection. At
week
6, all five saline treated mice tested were hyperglycemic (Figure SA). The
fasting
glucose levels ranged from 168-355 mg/dl (normal = 91 - 129 mg/dl) with an
average of 259.2. In contrast, all of the rAAV-leptin-treated mice were
within, or
slightly below, the normal range with a group average of 91.2 mg/dl and
arrange
of 74-125 mg/dl. The insulin levels in serum from the fasted mice, were also
measured (Figure SB). All mock-treated animals showed marked
hyperinsulinemia, with serum insulin levels between 8 and 20 ng/ml. The
average
serum insulin concentration for AAV-leptin treated animals was .54 ~ .1 ng/ml.
IS Glucose tolerance tests were performed to measure the ability of
AAV-leptin treated mice to clear glucose from circulation. At eight weeks
after
vector administration, a bolus of lmg/gm glucose was injected i.p. into fasted
mice and blood glucose was monitored over time. In control C57 mice and leptin
treated ob mice, the level of circulating glucose peaked at 30 minutes and
returned
to normal within 120 min (Figure 5C). In mock treated oblob mice, the level of
glucose was at least twofold greater than the leptin treated mice at all
timepoints.
The glucose levels in these mice did not normalize within the three hour time
course of the study.
Thus, hyperinsulinemia and insulin resistance could be corrected in
leptin treated mice. As demonstrated in Figure 5, at week 6 there was a
complete
reversal of hyperinsulinemia and hyperglycemia in treated animals. The levels
of
circulating insulin in treated animals were similar to levels reported for C57
mice
(.54 nglml versus .40 ng/ml). rAAV-leptin treated mice had a normal response
to
a glucose challenge. At week 8, control oblob mice failed to correct the
CA 02297490 2000-O1-20
WO 99/06562 PCTIUS98/I5794
33
exaggerated hyperglycemia state after a post-fast injection of glucose. In
contrast,
leptin-treated and age-matched C57BL mice corrected their hyperglycemia. this
demonstrates that insulin resistance has been corrected and that these mice
are able
to properly regulate insulin secretion in response to glucose challenge.
Thus, intramuscular administration of a rAAV vector encoding
mouse leptin can lead to total correction of the obese phenotype in oblob
mice.
Long-term correction of genetic defect by somatic gene therapy is possible by
rAAV based vectors.
EXAMPLE 5
Preparation and In vitro Analysis of rAAV-Epo Particles
pKm201CMV is an AAV cloning vector in which an expression
cassette, consisting of a CMV immediate early enhancer, promoter and intron,
and
a bovine growth hormone (bGH) polyadenylation site, is flanked by inverted
terminal repeat (ITR) sequences from AAV-2. pKm201CMV, was derived from
pKm201, a modified AAV vector plasmid in which the ampicillin resistance gene
of pEMBL-AAV-ITR (see Srivastava, (1989) Proc. Natl. Acad. Sci. USA 86,
8078-8082) has been replaced with the gene for kanamycin resistance. The
expression cassette from pCMVlink, a derivative of pCMV6c (see Chapman,
(1991) Nucleic Acids Res.l9, 193-198) in which the BGH poly A site has been
substituted for the SV40 terminator, was inserted between the ITRs of pKm201
to
generate pKm201CMV. To construct the AAV Epo expression vector
pCMVAAV-Epo, the Avr iI - BgIII fragment, which encodes the full length
monkey Epo sequence, from the cline pMKE83 {ATCC Accession Number 67545)
we cloned into the Xba I - BamH I sites of pKm201 CMV. In addition to the
CMV immediate early promoter/enhancer and intron, the AAV vector contains a
post-transcriptional regulatory element (PRE) from hepatitis B virus. The PRE,
which increases efficiency of mRNA transport (see Huang, Mol. Cell. Bio. IS,
3864-3869), was included to increase the size of the vector genome for more
CA 02297490 2000-O1-20
WO 99!06562 PCTIUS98115794
34
efficient packaging. A 579 by fragment, from the post-transcriptional
regulatory
element (PRE) region of Hepatitis-B (HBV) (see Huang & Yen, (I995) Mol. Cell.
Biol. 15, 3864-3869) was amplified using the primer set:
S'ACATACGCGTGCTTGCGTGGAACCTTTG 3' (SEQ ID NO: 1)
and
5' TTGTGGCGCGCCAGCTTATCGATTTCGAACCCG 3' (SEQ ID N0: 2)
The resulting fragment was digested with As I and Mlu I and inserted into an
MI a
I site between the leptin coding region and the BGH poly A site. Inclusion of
the
coding region for mouse leptin into this construct results in a 3.4 kb
packageable
vector genome. This vector plasmid was packaged using standard methods, and a
purified stock of 1.25x10'2 particleslml was obtained.
AAV helper plasmid pKSreplcap (encoding rep and cap protein) was constructed
by cloning the AAV-2 genome, without the ITRs (AAV-2 nucleotides 192 through
4493) into pBluescript II KS+ (Stratagene, La Jolla, CA).
Recombinant AAV-Epo particles were produced and analyzed
following the protocols in Examples 2 and 3, except that HT1080 cells (human
flbrosarcoma cells) maintained in DME+ 10% fetal calf serum (FCS), plated
(2x105 cells) on a 6 well dish the day before infection were used. The cells
were
infected with rAAV-Epo at different MOI and 48 hours later supernatant was
monitored for Epo using the R&D Quantikine ELISA kit (R&D Systems,
Minneapolis, MN). The ELISA results are shown in Fig. 2. Titers of rAAV-Epo
are indicated on the X-axis. The lane marked leptin represents background
levels
of Epo secreted from cells infected with S x I09 particles of rAAV-m-leptin.
The
results show that infection of HT1080 cells with 5 x 109 particles produced
10,800
mIUI106 cells/day, which is equivalent to 86.4 ng of Epo per day ( 1 mIU is
equivalent to ~ 8 pg of Epo), white infection with 2 x 10$ and 1 x 109
particles led
to production of 480 and 2200 mIU/106 cell/day, respectively.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
.. 35
EXAMPLE 6
ht Vivo Administration of rAAV-Epo In Mice
Seven week old female C57BL/6 mice were obtained from Charles
River Laboratories (Wilmington, MA). Recombinant AAV-Epo was administered
by injection of 501 of normal or normal saline containing 2 x 10" rAAV
particles
into the TA muscle of mice anesthetized with a mixture of ketamine and
xylazine
as described in Example 4.
Blood (200 pl) was collected by using retroorbital bleeds following
isoflurane sedation. Whole blood was used for hematocrit estimation and the
separated serum was used for detecting the Epo by ELISA. The results are shown
in Figure 7. Panel A shows serum Epo concentration (+l-S.E.M.) following
rAAV administration. At alI timepoints, the saline injected mice had
undetectable
levels of serum Epo and are not included in the Figure. Panel B shows the
average hematocrit of four mice injected with either rAAV-Epo or saline.
Although error bars are included, they are obscured by the plot symbols. The 0
week timepoints represent the average baseline hematocrit and serum Epo
concentrations for untreated C57BLI6 mice.
The results indicate that circulating levels of Epo began to rise
within one week (36.1 mIU/ml) of injection and reached a peak by week 7 (65
mIU/ml). The biological effect of rAAV-Epo was monitored by measuring the
hematocrit. Hematocrit levels closely mirrored the amounts of circulating Epo
in
the treated mice (see Fig. 7B). Hematocrits steadily rose through week 7 at
which
point red blood cells represent greater than 90% of the blood volume (Figure
7B).
Remarkably, the mice maintained this high level hematocrit through week 11
with
no apparent deleterious effect.
To determine if the EPO levels were affected by an immune
response against the foreign transgene, a bioluminescent ELISA assay was
developed to detect antibodies against Epo. Microtiter plates (Dynatech
Microlite,
Chantilly, VA) were coated with SOpI of EPOGEN~ {h-erythropoietin, Amgen,
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
36
Thousand Oaks, CA) in a lp,g/ml solution in PBS and incubated overnight at
4°C
or for one hour at 37°C. The coated wells were blocked with lx Aqualite
Streptavidin Assay Buffer (Sealite Sciences, Boggard, GA) containing 5 % goat
serum for one hour at 37°C. The plates were then washed three times
with lx
Aqualite Washing Buffer containing 1 % goat serum and 3 % Tween-20. Diluted
serum samples (50,1) were transferred onto coated plates and incubated at
37°C
for one hour, then washed six times with washing buffer. Primary antibody
(goat
anti-mouse gig from Sigma) diluted to 1:1000 was added and incubated for one
hour followed by washing six times. Streptavidin Aqualite antibody (1:500) was
added to each well and incubated at 37°C for one hour followed by
washing six
times. The luminescence was triggered by injections of SOp.I aliquots of lx
Trigger buffer and the plates were read with a Dynatech ML3000 Luminometer
(Chantilly, VA). For saline treated mice, sera was pooled prior to ELISA, sera
from rAAV treated mice were measured individually. Positive control (+
control)
represents sera from cynomolgous monkey-Epu plasmid DNA injected BALBIc
mice which had previously been shown to have anti-cm-Epo antibodies. Titer is
defined as the dilution of serum required to reduce the signal to levels
obtained in
welts containing dilution buffer alone.
The results are shown in Figure 8 while serum samples had an anti-
Epo titer of 4x105 titers in rAAV-Epo injected and in saline injected mice
were
one thousand-fold lower. These results contrast with a recently published
report
using rAAV to deliver a human Epo DNA, see Kestrel, Proc. Natl. Acad. Sci. 93
{1996) 14082-87. This report demonstrated long term expression of human Epo in
BALB/c mice, while in C57BLI6 mice, a decrease in circulating reticulocytes
and
fatal anemia were observed. In contrast, our results demonstrate long term
expression of monkey Epo in C57BLI6 mice following intramuscular delivery.
We were unable to detect significant amount of antibodies against monkey Epo
in
the serum of the C57BL/6 mice.
*rB
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
37
EXAMPLE 7
In vivo Administration of rAAV-Epo In Baboons
Two one year old female baboons weighing between 3.5 and 4.0
kilograms (150-200 times larger than C57BLI6 mice) were used. Prior to
injection, the baboons were monitored for two months to determine the baseline
values for circulating serum Epo and hematocrit. Animals were sedated with 10
mg/kg ketamine and 0.5 ml of a 2 x 1012 particles/ml stock of rAAV-Epo was
injected into the TA of both legs (tenfold more than mice). As a control, two
baboon received similar amounts of rAAV vector encoding ~i-galactosidase.
2.5 ml of blood was collected from each baboon for performing
hematocrit and ELISA assays. The levels of Epo were determined from monkey
plasma or mouse serum using the R&D Systems Quantikine kit (R&D Systems,
Minneapolis, MN).
The results are shown in Figs. 9A-9B. Fig. 9A shows the plasma
Epo levels as measured by ELISA. Fig. 9B shows the hematocrits of two baboons
at time pre-injection (negative numbers) and post-injection. To prevent
stroke, 34
or 40 ml of blood was removed from Baboon 2 at weeks 11 and 13. As shown in
Figure 9A, pre-injection values for serum Epo ranged from 1.5 - 3.3 mIUlml,
with minor week to week variation. One week following the injection, Epo
levels
had increased to 4.5 mIU/ml for Baboon I and to over mIU/ml for Baboon 2. By
week 4, values had increased to 11.8 mlU/ml for Baboon 1 and to 11.3 mIU/ml
for Baboon 2. Values peaked at weeks 8-10, at which time Baboon I had
circulating levels of 35.9 mIU/ml and Baboon 2 had circulating levels of 41.6
mlUlml.
Prior to treatment, the hematocrit of Baboon 1 ranged from 35.7 to
40% and the hematocrit of Baboon 2 ranged from 38.7 to 42.3 % . Despite the
presence of elevated serum Epo levels, the hematocrits of both baboons did not
increase significantly during the first week. This probably reflects the lag
between
exposure to Epo and differentiation of precursor cells into erythrocytes. By
week
CA 02297490 2000-O1-20
WO 99!06562 PCT/US98l15794
38
4, the hematacrits of both baboons had increased above the range seen prior to
injection. Hematocrits continued to increase until week 10, at which time both
baboons showed at least 25 point increases over their pre-treatment levels.
The
hematocrit of Baboon 2 exceeded 70 % ; and thus, this animal was phlebotomized
o
reduce the risk of thrombosis. Following phlebotomy, in which 34 ml of blood
was drawn, hematocrit levels in this monkey continued to rise through week 13.
The monkey was against phlebotomized at week I3, only to recover to
prephlebotomy levels by week 14. The hematocrit level of Baboon 1 reached a
maximum of 61.6 at week 10 and remained at this level between weeks 10 and 16.
The hematocrit levels stabilized in Baboon 1 and this stabilization occurred
despite high levels of circulating Epo. Animals injected with control rAAV-
LacZ
virus did not show any increase in serum Epo levels (data not shown).
EXAMPLE 8
Formulation and Intra-Nasal Administration of rAAV Virians
To generate an aerosol containing the rAAV virions carrying Epo,
50 pl of a solution of rAAV-Epo virions at a concentration of 1 x IO'Z in 0.9
NaCI is placed in the reservoir of a Ultravent nebulizer (Mallinckrodt). The
nebulizer is driven at 40 psi with compressed air. The size distribution of
aerosol
droplets is determined by laser particle-size analysis and the relative
proportion of
the virion preparation is evaluated by collecting the aerosolized droplets in
phosphate buffered saline, pH 7.4, as described in Hubbard, Proc. Natl. Acad
Sci
86, (1989) 680-684.
Seven week old female C57BL16 mice are obtained from Charles
River Laboratories (Wilmington, MA). After anesthetization with a mixture of
ketamine and xylazine and baseline bronchoalveolar lavage fluid, blood, and
lung
samples are obtained, 50 ul of normal saline containing dosages ranging from 1
x
I06 to 1 x 10'2 particles of rAAV-Epo is administered via intra-nasal
instillation
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
39
using an Ultravent (Mallinckrodt) aerosol nebulizer in accordance with the
manufacturer's instructions.
Blood (200p1) is collected by using retro-orbital bleeds following
isoflurane edition. Whole blood is used for hematocrit estimation and
separated
serum is used for detecting the Epo by ELISA.
To determine if the Epo levels are affected by an immune response
against this foreign transgene, a bioluminescent ELISA assay can be employed
to
detect antibodies against Epo. Microtiter plates (Dynatech Microlite,
Chantilly,
VA) are coated with 50,1 of EPOGEN~ (h-erythropoietin, Amgen, Thousand
Oaks, CA) in a 1 ~sg/ml solution in PBS and incubated overnight at 4°C
or for one
hour at 37°C. The coated wells are blocked with lx Aqualite
Streptavidin Assay
Buffer (Sealite Sciences, Boggard, GA) containing 5 % goat serum for one hour
at
37°C. The plates are then washed three times with 1 x Aqualite Washing
Buffer
containing 1 % goat serum and 3 % Tween-20. Diluted serum samples (SOUL) ate
transferred onto coated plates and incubated at 37°C for one hour, then
washed six
times with washing buffer. Primary antibody {goat anti-mouse IgG from Sigma)
diluted to 1:1000 is added and incubated for one hour followed by washing six
times. Streptavidin Aqualite antibody (1:500) is added to each well and
incubated
at 37°C for one hour followed by washing six times. The luminescence is
triggered by injections of 50 pl aliquots of 1 x Trigger buffer and the fates
are
read with a Dynatech ML3000 Luminometer (Chantilly, VA). Titer is defined as
the dilution of serum required to reduce the signal to levels obtained in
wells
containing dilution buffer alone.
For administration in humans, equivalent human dosages by weight
should be used, for example from 1 x 10' to 1 x 10'6 particles in 50 ~1
volumes.
The published clinical protocol approved by the NHLBI Institutional Clinical
Review Subpanel on September 21, 1992, the NIH Biosafety Committee on
August 21, 1992, the RAC on December 3, 1992 and the FDA on April 16, 1993
relating to the administration of an adenovirus containing the human CFTR cDNA
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
and available from the Office of Recombinant DNA Activities, Building 31, Room
4B11, The National Institutes of Health, 9000 Rockville Pike, Bethesda,
Maryland, USA 20892 may be followed.
Infra-nasal formulations of rAAV virions carrying other
5 heterologous sequences can be made in accordance with the methods disclosed
herein, for example rAAV-leptin, and administered and tested as described
above
and employing art recognized methods.
Such formulations may be administered in humans in a fashion
analogous to administration in mice, for example, via infra-nasal instillation
using
10 an Ultravent (Mallinckrodt) aerosol nebulizer in accordance with the
manufacturer's instructions.
EXAMPLE 9
Transient Immunosuppression To Block
15 Humoral Immune Responses
Typically, after a single intramuscular injection of rAAV vector,
transgene expression from a second vector injection is not possible. To
determine
which arm of the host immune response is responsible for the inability to
20 readminister rAAV vectors, experiments were carried out in class I-, class
II- and
CD40L-deficient mice. Class I-deficient mice do not develop a normal
population
of CD 8++T cells and are unable to mount cellular immune responses. (See
Zijlstra, Nature 344, (1990) 742-746). Class II-deficient mice are negative
for CD
4+ T cells and are defective in humoral immune responses. (See Grusby, Science
25 253 ( 1991 ) 1417-20) .
Six week old female C57BLI6 mice were purchased from Charles
River Labs (Wilmington, MA). C57BLI6 class I deficient and C57BL/6 class II
deficient mice were purchased from Taconic Labs (Germantown, NY). CD40
ligand deficient mice and B 129 mice were purchased from Jackson Labs (Bar
30 Harbor, ME).
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
41
Vector pAAV-IacZ was constructed by cloning the LacZ expression
cassette from pCMV-~3 (Clontech, Palo Alto, CA) containing the CMV promoter,
intron, LacZ and SV40 polyadenylation signal into pEMBL-AAV-ITR. Plasmid
pkm201 is a derivative of pEMBL-AAV-ITR in which the ampicillin resistance
gene was replaced with the gene for kanamycin resistance. See Example 1.
Plasmid pAAV-Luc was constructed by cloning an expression cassette containing
the CMV promoter/intron, luciferase and the bovine growth hormone
polyadenylation signal into pKm201. Plasmid pKSreplcap was constructed by
cloning the AAV-2 genome, without the ITRs (AAV-2 nucleotides 192 through
4493) into pBluescript II KS+ (Strategene, La Jolla, CA). See Example 1.
Recombinant AAV particles were produced as disclosed in Example
2. Residual adenovirus contamination was inactivated by heating at 56°C
for 45
min. To estimate total number of rAAV particles, the stock was treated with
DNAse I and encapsidated DNA was extracted with phenol-chloroform and
precipitated with ethanol. DNA dot blot analysis against a known standard was
used to determine titer. To assay for adenovirus contamination, 293 cells were
infected with lOpl of purified rAAV stock and followed for any signs of
cytopathic effect. All stocks were negative, indicating that adenovirus
contamination was less than 100 pfu/ml.
The rAAV particles were diluted in 0.9% saline and a final volume
of SOp,I was injected into the tibialis anterior (TA) muscle. On day 0, groups
of
five class I knockout, class II knockout or C57BL/6 mice were injected with 1
x
10'° particles rAAV-LacZ in the right TA. At four weeks after the first
injection,
the mice were bled for serum and injected with either 1 x 10'°
particles rAAV-
LacZ (three animals) or 1 x 10'° particles of rAAV-Luc (two animals) in
the left
TA. At six weeks, the mice were bled again, sacrificed and muscles were
collected and immediately frozen in liquid nitrogen for either LacZ staining
or
luciferase assay.
CA 02297490 2000-O1-20
WO 99/Ob5b2 PCT/US98/15794
42
For transient immuosuppression by anti-CD4 antibody, mice were
injected with 1001zg rat anti-mouse CD4 (clone GK1.5, Pharmingen, San Diego,
CA) by intraperitoneal injection at days -3, 0 and +3 relative to the first
injection
(at day 0) of rAAV. For anti-mouse CD40 ligand treatment, mice received 100~,g
of antibody (clone MRI, Pharmingen, San Diego, CA) by intraperitoneal
injection
at days -3, 0 and +3 and +6 relative to the first injection of rAAV. Mice
treated
with cyclosporin A (Sandimmune, Sandoz) received intraperitoneal injections of
mglkg drug every five days from one week before the first injection of rAAV
until the termination of the experiment.
10 For the luciferase assay, the frozen muscles were ground in a pre-
chilled mortar and pestle, transferred to a 1.5 ml microfuge tube and
resuspended
in 5001 ix reporter Iysis buffer (Promega, Madison, WI). The tubes were
vortexed for fifteen minutes at room temperature and then freeze/thawed three
times. Lysates were cleared by centrifuging at maximum speed in a microfuge
for
ten minutes and then stored at -80°C until assayed. Luciferase assays
were
performed using the manufacturer's protocol (Promega, Madison, WI) and read on
a Dynatech ML3000 (Chantilly, VA) plate luminometer. Protein concentration of
each of the lysates were assayed by BCA protein assay (Pierce, Rockford, IL)
and
Iuciferase activities were expressed as picograms of luciferase per mg
protein.
Cryosections (8p,m) were fixed for five minutes at room
temperatures in 10 mM phosphate buffered saline (PBS) containing 1
paraformaldehyde. The fixed sections were stained with X-gal solution (PBS
containing 1 mg/ml S-bromo-4-chloro-3-indoyl-~i-galactopyranoside, 1 mM
MgCl2, 5 mM K3Fe(CN)6, and 5 mM K4Fe(CN)6) for sixteen hours at
37°C.
Sections were counterstained with Nuclear Fast Red.
To perform the AAV capsid ELISA, microtiter plates were coated
overnight at 4°C with 109 rAAV-LacZ particles/well in PBS. The
following day,
the plates were washed and then blocked for thirty minutes at 37°C with
PBS
containing 1 % goat serum and 0.3 % Tween 20. Serial three-fold dilutions of
CA 02297490 2000-O1-20
WO 99/06562 PCTlUS98/15794
43 -
sample and control sera were loaded onto the plate starting at 1:75 (control
sera
was from mice which had received multiple injections of AAV). The microtiter
plates were then incubated for one hour at 37°C. Plates were washed and
incubated at 37°C for thirty minutes with goat anti-mouse Ig-HRP
(immunoglobulin labeled with horseradish peroxidase) at 1:2000 {Dako,
Carpenteria, CA). O-phenylenediamine substrate was used to develop the plates.
Plates were read at 492 nm with a cut-off of 0.2 OD.
To perform the AAV neutralizing antibody assay, 293 cells were
plated at 3x10' cellslwell in a 96 well microtiter plate. The following day,
pre
bleed, positive control and sample sera were inactivated at 56°C for
thirty
minutes. Three-fold serial dilutions of sera in IMDM without fetal calf serum
(FCS) (Biowhittaker, MD} were then incubated with 108 particles of rAAV-Luc at
37°C for one hour. The media was removed from the 293 cells and diluted
sera
plus virus was added and incubated for one hour at 37°C. After this
incubation,
I5 the plates were washed, and fresh IMDM containing 10 % FCS was added.
Twenty-four hours later, cells were rinsed with PBS and lysed in reporter
Lysis
Buffer (Promega, Madison, WI) . Cells were then harvested and assayed for
iuciferase activity. The AAV neutralizing antibody titer was defined as the
dilution of serum required to see 50% of the luciferase activity in 293 cells
infected with rAAV-Luc pre-incubated with negative control serum.
The results are shown in Table 1 below in which + indicates 1 -
10 % , + + indicates 10-50 % , + + + indicates 50-90 % and + + + + indicates
90-
100% . NA stands for not applicable.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
44
TABLE 1
rAAV Mediated Transgene Expression After Readministration
in Class I and Class II Deficient Mice
~V
LacZ LuciferaseAnti-AA neutralizing
V
Strain staining activity titer titer
And (2 wks (2 weeks (time of (time of
2d 2d
AnimalTreatment post-2d) post 2d) injection)injection)
1" 2 injctnright
injcrn left
left
C57BL16
1 LacZ LacZ + + - 2434 2500
NA
2 LacZ LacZ + + - 3355 6000
NA
3 LacZ LacZ + + - 3220 3500
NA
4 LacZ Luc + + + 5548 5000
+ - 158
5 LacZ Luc + NA 50 2673 5500
Class
I
Neg
1 LacZ LacZ + + + 542 900
+ + +
NA
2 LacZ LacZ + + + 395 700
+ + NA
3 LacZ LacZ + + + 339 750
+ NA
4 LacZ Luc + + + 580 700
NA 581
5 LacZ Luc + + + 734 900
NA 825
Glass
II
Neg
1 LacZ LacZ + + + <75 < 15
+ + +
+ + NA
2 LacZ LacZ + + + <75 < 15
+ + NA
3 LacZ LacZ + + + <75 < 15
+ + +
NA
4 LacZ Luc + + + <75 <15
+ NA
2744
5 LacZ Luc + + + <75 < 15
NA 8450
As shown in Table 1, no luciferase expression was found in C57BL16 mice
previously injected with rAAV-LacZ. High levels of luciferase expression were
found in the muscles of Class II deficient mice and intermediate levels were
found
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
in the muscles of Class I deficient mice. Results were similar when the second
injection was rAAV-LacZ. Antibody titers to AAV capsids were determined by
ELISA and are shown in Table 1 above. The control C57BLI6 mice had high
ELISA and neutralizing titers. As expected, the Class II deficient mice did
not
5 develop antibody titers, ELISA or neutralizing, against AAV. Antibody titers
in
the Class I deficient mice were lower than that found in the control mice and
resulted in an intermediate level of luciferase or lacZ expression.
To further establish the role of the humoral immune response in
readministration, experiments in CD40L (CD40 ligand) deficient mice. CD40L is
10 expressed on activated CD4+ T cells and is critical for their ability to
provide
help to B cells. (See Durie, Immunol. Today 15 {1994) 406-11; Xu, Immunity I
(1994) 423-31 and Yang, Science 272 (1996b) 1862-67). CD40 ligand deficient
mice are known to be deficient in humoral immune responses. An experiment
identical to the experiment described above was performed in CD40 ligand
i5 deficient mice, except that in all mice the second injection was rAAV-Luc
and
B129 mice were used as the control. The results are shown in Table 2 below.
NA stands for not applicable, and ND stands for not determined.
As shown in Table 2, readministration of rAAV was not possible in
the wild type control mice (B129) due to the high anti-AAV titers, but
possible in
20 the CD40 ligand deficient mice. The ability to obtain recombinant protein
(i.e.,
luciferase) expression upon vector readministration correlated inversely with
anti-
AAV antibody titer and AAV neutralizing antibody titer.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98115794
46
TABLE 2
Readministration of rAAV in CD44 Ligand Deficient Mice
~v
Strain Luciferase anti-AAV neutralizing
Treatment activity titer titer
And (time of (time oj2d(time of
Animal 2d injection)2d
injection)) injection)
1" injctn
2"
injctn
B 129
1 NothingLuc 14 ND ND
2 NothingLuc 17
3 NothingLuc NA 3220 3500
4 NothingLuc 158 5548 5000
NothingLuc 50 2673 5500
B 129
1 LacZ Luc 0 2515 10,000
2 LacZ Luc 0 5179 20,000
3 LacZ Luc 0 502 1500
4 LacZ Luc 0 316 1500
5 LacZ Luc 0 3097 7500
CD40L
neg
1 NothingLuc 267 ND ND
2 NothingLuc 15 ND ND
3 NothingLuc 105 ND ND
4 NothingLuc 233 ND ND
5 NothingLuc 159 ND ND
CD40L
neg
1 LacZ Luc 200 <75 <15
2 LacZ Luc 533 <75 <15
3 LacZ Luc 25 <75 <15
4 LacZ Luc 19 <75 <15
5 LacZ Luc 20 <75 <15
To determine whether the dose of the first injection affected the
5 efficacy of the second injection, groups of five C57BL/6 mice were injected
with
escalating doses of rAAV-LacZ in the right tail artery (TA) and then injected
with
1 x 10'° particles rAAV-Luc in the left TA four weeks after the first
injection.
The results are shown in Table 3 below. ND stands for not determined.
CA 02297490 2000-O1-20
WO 99/06562 PCTIU898/15794
47
TABLE 3
Effect of First Injection Dose On the Efficacy of Second Injection
Luciferase ~V
AA V activity anti AAV neutralizing
Animal Treatment (2 wks posttiter titer
particlessecond (time (time of
l" injctn)) of 2d 2d
injctn injection)injection)
1" injctn
2"
injctn
C57BL6
1 nothingLuc none 4195 ND ND
2 nothingLuc none 1488 ND ND
3 nothingLuc none 2000 ND ND
4 nothingLuc none 1386 ND ND
nothingLuc none 2212 ND ND
C57BL6
1 LacZ Luc 10' 1200 101 <15
2 LacZ Luc 10 2520 112 <15
3 LacZ Luc 10' 2356 129 <15
4 LacZ Luc 10' 2723 74 <IS
5 LacZ Luc 10' 3194 248 <15
C57BL6
1 LacZ Luc 10 160b ND < 15
2 LacZ Luc 10 2272 159 <15
3 LacZ Luc 10 2491 47 <15
4 LacZ Luc 105 1717 144 <15
5 LacZ Luc 10 744 98 <15
C57BL6
1 LacZ Luc 10 133 103 <15
2 LacZ Luc 10 557 I76 <15
3 LacZ Luc 10 89 193 <15
4 LacZ Luc 10 31 168 70
5 LacZ Luc 10 9 439 70
C57BL6
1 LacZ Luc 10 0 1337 70
2 LacZ Luc 10' 0 4000 35
3 LacZ Luc 10' 0 2902 250
4 LacZ Luc 10' 0 659 1000
5 LacZ Luc 10' 4 3028 2500
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
48
As shown in Table 3, the groups that received the lower doses (104, 105), were
as
efficiently re-injected as the native controls. These same groups of mice also
did
not demonstrate neutralizing antibody responses to AAV indicating that the
amount of antigen in these doses may have been too low to elicit an immune
response. In fact, the right TA muscles of these mice were all negative for
lacZ
expression (data not shown). The group that received 108 particles of rAAV-
lacZ
mounted a weak antibody response to AV. This lower antibody response resulted
in an intermediate level of luciferase expression from the second injection.
In this
group, one of the two animals with measurable neutralizing antibody titers
showed
the lowest luciferase expression. The group receiving 10'° particles
demonstrated
a robust antibody response to AV and second administration was not successful.
Based on the results of the previous experiments, we attempted to
reduce the host's antibody response to rAAV by transient immunosuppression.
Mice treated with anti-CD4 antibody at the time of first injection were able
to be
re-injected with rAAV-Luc. Formulation and injection protocols were as
previously described. All injections were 1 x 10'° particles rAAV
unless
otherwise noted. Luciferase activity was measured and expressed in picograms
luciferase per mg protein. The results are shown in Table 4 below. ND stands
for not determined.
CA 02297490 2000-O1-20
WO 99106562 PCT/US98115794
49
TABLE 4
EFFECT OF TRANSIENT llVIMUNOSUPPRESSION
ON TRANSGENE EXPRESSION IN C57BL16 MICE
FOLLOWIrIG READMIrISITRATION OF rAAV
Luciferase
activity anti-AAV neutralizing
titer
(2 wks post (time titer
of 2d
second injection)(time of
2d
Animal TreatmentTreatment injection)) injection)
1" injctn2" injctn
I Nothing Luc 107 ND NO
2 Nothing Luc 486 ND ND
3 Nothing Luc 605 ND ND
4 Nothing Luc 220 ND N1~
Nothing Luc 4671 ND NO
6 Nothing Luc 800 ND NL~
7 Nothing Luc 1188
1 LacZ Luc 28 3908 6000
2 ~cZ Luc 6 932b 2000
3 LacZ Luc 14 4564 1000
4 ~cZ Luc 5 7014 2500
LacZ Luc 6 1597 1250
aCD4
treated
2 124 800
1 LacZ Luc
2 LacZ Luc 2 43 <15
3 LacZ Luc 575 121 70
4 LacZ Luc 317 47 <15
LacZ Luc 3 2932 1500
6 LacZ Luc 356 <15 <15
7 LacZ Luc 920 <IS <15
g LacZ Luc 772 60 <15
9 LacZ Luc 1064 <15 <IS
LacZ Luc 19 408 550
aCD40
Ligand
Treated
1 LacZ Luc 94 489 500
2 LacZ Luc 31 477 900
3 ~cZ Luc 4 2035 1000
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
. SO
Luciferase AAV
activity anti-AAV neutralizing
titer
(2 wks post (time titer
of 2d
second injection)(time of
2d
Animal Treatment Treatment injection)) injection)
Cyclo-
sporin
treated
1 LacZ Luc 0 10,911 8,000
2 LacZ Luc 0 2,497 5,500
3 LacZ Luc 0 10,394 20,000
4 LacZ Luc 0 11,827 10,000
~ LacZ Luc 0 ~ 6,777 10,000
~
Blood was collected from all anti-CD4 antibody-treated mice one
day after the last dose of anti-CD4 antibody (a-CD4) and subjected to FACS
analysis. All mice showed greater than 99% reduction in the numbers of
S CD3'~CD4'" T cells (data not shown) and had normal numbers of CD3+CD8+ T
cells. As shown in Table 4, there was some variability in the level of
luciferase
expression achieved in the a-CD4-treated mice and four of ten showed little or
no
luciferase expression. As was seen in the previous experiments, the level of
luciferase expression correlated inversely with the AAV antibody titers. In
the
anti-CD40 ligand antibody experiment, only one of three animals was
efficiently
re-injected, indicating that anti-CD40 ligand antibody treatment alone is
probably
not an optimal treatment for readministration. Treatment with cyclosporin
alone
had no effect on the ability to re-inject rAAV. Both the anti-CD4 and anti-
CD40
ligand antibody experiments were repeated with similar results.
The results with Class I and Class II deficient animals demonstrates
that the humoralarm of the immune playsa role in preventing
system key
readministration.As the mouse haplotypemay affectthe capability
of
readministration,the experiments with I ClassII knock-out
Class and mice
included the appropriate wild-type background mice as controls (C57BL/6). To
further establish the role of the humoral arm of the immune system in
readministration, experiments were performed in CD40L knock-olit mice. CD40L
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98I15794
S1
is expressed on activated CD4+ T cells and is critical for their ability to
provide
help to B cells. Thus, the CD40L knock out mice should mimic the responses
seen in the Class II knock out mice. The results demonstrated that, as in the
Class
II deficient mice, the CD40L deficient mice could be effectively
readministered
with the second dose of virus. It is interesting to note that the rAAV
mediated
transgene expression levels in this strain of control mice (B 129) was much
lower
than in the C57B116 control mice, demonstrating that mouse haplotype can also
influence the expression levels mediated by rAAV vectors.
These preliminary in vivo results demonstrate that blocking the
humoral response during the primary administration of vector will allow
efficient
readministration.
EXAMPLE 10
Formulation and Direct Administration of rAAV Virions
into the Renal Artery
Seven week old female C57BL/6 mice are obtained from Charles
River Laboratories (Cambridge, MA). After anesthetization with a mixture of
ketamine and xylazine and baseline blood samples are obtained, a mid-abdomen
incision is made and the ureter and uretropelvic junction are freed of
connective
tissues and vascular structures to expose the left renal artery, which is then
clamped. An aliquot of 50 p,l of a 5 % Dextrose solution containing 10g to
10''
particles of rAAV-Epo or of rAAV-leptin, produced as described in Examples 1-4
above, is directly infused into the left renal artery using a 30 gauge needle
within
1 minute. The renal blood flow is then re-established, S minutes after
injection by
removal of the clamp. The incision is closed and the animals allowed to
recover.
See Lai, Gene Therapy 4 (1997) 426-31 and Yamada, J Clin Invest 96 (1995)1230-
37.
CA 02297490 2000-O1-20
WO 99/06562 PCTNS98115794
.. 52
Three days after injection, blood samples are collected for analysis.
Whole blood is used for hematocrit estimation and separated serum is used for
detecting the Epo by ELISA.
To determine if the Epo levels are affected by an immune response
against this foreign transgene, a bioluminescent ELISA assay can be employed
to
detect antibodies against Epo. Microtiter plates (Dynatech Microlite,
Chantilly,
VA) are coated with SOUI of Epogen (Epotin, Amgen, Thousand Oaks, CA) in a 1
pg/ml solution in PBS and incubated overnight at 4°C or for 1 hour at
37 °C. The
coated wells are blocked with lx Aqualite Streptavidin Assay Buffer (Sealite
Sciences, Boggard, GA) containing 5 % goat serum for 1 hour at 37
°C. The
plates are then washed 3 time with lx Aqualite Washing Buffer containing 1
goat serum and 3 % Tween-20. Diluted serum samples (50 pi) are transferred
onto
coated plates and incubated at 37 °C for one hour, then washed 6 times
with
washing buffer. Primary antibody (goat antimouse IgG from Sigma) diluted to
IS 1:1000 is added and incubated for 1 hours followed by washing 6 times.
Streptavidin Aqualite antibody (1:500) is added to each well and incubated at
37
°C for one hour followed by washing 6 times. The luminescence is
triggered by
injections of 50 gel aliquots of Ix Trigger buffer and the plates are read
with a
Dynatech ML3000 Luminometer (Chantilly, VA). Titer is defined as the dilution
of serum required to reduce the signal to levels obtained in wells containing
dilution buffer alone.
For mice infused with rAAV-leptin, the animals are fasted for 18
hours and blood collected from the tail vein to determine fasting glucose
levels.
The mice then receive 1 mglg body weight of a sterile glucose solution by i.p.
injection. The mice are anesthetized with isoflurane and blood samples are
collected via retroorbital bleeds at 15, 30, 60, 120 and 180 min following the
injection. Circulating glucose is measured using the Lifescan One Touch
monitor
(Life Scan, Milpitas, CA). Insulin levels are measured with the Linco Rat
Insulin
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
53
RIA kit (Linco Research Immunoassay, St. Charles, MO). Leptin levels are
measured with the Lincomouse Leptin RIA kit.
Formulations of rAAV virions for direct injection into the renal
artery carrying other heterologous sequences can be made in accordance with
the
methods disclosed here and administered and tested as described above and
employing art recognized methods. Formulations of rAAV virions for human
administration via direct injection into the renal artery are made and
administered
in a manner similar to that described above. Human doses equivalent (by
weight)
to the doses employed in mice can be used. Administration can be effected by
modification of the medical technique of angiography. As is well known in the
art, in angiography a catheter is inserted into the femoral artery of the
patient and
dye injected in order to visualize the kidney. To administer rAAV virions
directly
into the renal artery in humans, a catheter is inserted into the femoral
artery and a
pharmaceutical composition comprising a sterile solution containing an
effective
amount of a rAAV virion in admixture with a pharmaceutically acceptable
carrier
is injected. The protocol described in Diseases of the Kidney, Sth ed., Ch 14:
Diagnostic and Therapeutic Angiography of the Renal Circulation, pages 465-83
(R. Schrier and C. Gottschalk, eds. 1993) can be employed.
All patents, patent publications and scientific publications cited in
this specification are hereby incorporated herein by reference. The invention
now
being fully described, it will be apparent to one of ordinary skill in the art
that
many changes and modifications can be made thereto without departing from the
spirit or scope of the appended claims.
CA 02297490 2000-O1-20
WO 99/06562 PCT/US98/15794
SEQUENCE hISTING
<110> Dwarki, Varavani
Zhou, Shangzhen
Murphy, John E.
Manning, William C.
Escobedo, Jaime
<120> METHOD FOR OBTAINING IN VIVO EXPRESSION OF A
HETEROLOGOUS GENE CONTAINED WITHIN AN AAV VECTOR
<130> 1296/12120US02
<140>
<141>
<150> 60/054,318
<151> 1997-07-29
<160> 2
<170> PatentIn Ver. 2.0
<210> 1
<211> 28
<212> DNA
<213> Hepatitis B virus
<400> 1
acatacgcgt gcttgcgtgg aacctttg 2B
<210> 2
<211> 33
<212> DNA
<213> Hepatitis B virus
<400> 2
ttgtggcgcg ccagcttatc gatttcgaac ccg 33
1
