Note: Descriptions are shown in the official language in which they were submitted.
CA 02301880 2000-02-25
WO 99/10525 PCT/US98I17699
TITLE OF THE INVENTION
A METHOD OF TREATING CANCER
R_ ELATED APPLICATION
The present patent application is a continuation-in-part
application of copending provisional application Serial No.
60/057,102, filed August 27,1997.
_BACKGROUND OF THE INVENTION
The present invention relates to methods of inhibiting
prenyl-protein transferases and treating cancer which utilize prenyl-
protein transferase inhibitors which inhibit the cellular processing
of both the H-Ras protein and the K4B-Ras protein. The present
invention also relates to a method of identifying such compounds.
Prenylation of proteins by intermediates of the
isoprenoid biosynthetic pathway represents a class of post-
translational modification {Glomset, J. A., Gelb, M. H., and
Farnsworth, C. C. (1990), Trends Biochem. Sci. 15, 139-142;
Maltese, W. A. {1990), FASEB J. 4, 3319-332$). This modification
typically is required for the membrane localization and function of
these proteins. Prenylated proteins share characteristic C-terminal
sequences including CAAX (C, Cys; A, an aliphatic amino acid;
X, another amino acid), XXCC, or XCXC. Three post-translational
processing steps have been described for proteins having a
C-terminal CAAX sequence: addition of either a 15 carbon
(farnesyl) or 20 carbon (geranylgeranyl) isoprenoid to the Cys
residue, proteolytic cleavage of the last 3 amino acids, and
methylation of the new C-terminal carboxylate (Cox, A. D. and Der,
C. J. (1992a), Critical Rev. Oncogenesis 3:365-400; Newman, C. M.
H. and Magee, A. I. (1993), Biochem. Biophys. Acta 1155:79-96).
Some proteins may also have a fourth modification: palmitoylation
of one or two Cys residues N-terminal to the farnesylated Cys.
While some mammalian cell proteins terminating in XCXC are
carboxymethylated, it is not clear whether carboxy methylation
- 1 -
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17b99
follows prenylation of proteins terminating with a XXCC motif
(Clarke, S. (1992). Annu. Rev. Biochem. 61, 355-386). For all of
the prenylated proteins, addition of the isoprenoid is the first step
and is required for the subsequent steps (Cox, A. D. and Der, C. J.
(1992a), Critical Rev. Oncogenesis 3:365-400; Cox, A. D. and Der,
C. J. (1992b) Current Opinion Cell Biol. 4:1008-1016).
Three enzymes have been described that catalyze protein
prenylation: farnesyl-protein transferase (FPTase), geranylgeranyl-
protein transferase type I (GGPTase-I), and geranylgeranyl-protein
. transferase type-II (GGPTase-II, also called Rab GGPTase). These
enzymes are found in both yeast and mammalian cells (Clarke, 1992;
Schafer, W. R. and Rine, J. (1992) Annu. Rev. Genet. 30:209-237).
Each of these enzymes selectively uses farnesyl diphosphate or
geranylgeranyl diphosphate as the isoprenoid donor and selectively
recognizes the protein substrate. FPTase farnesylates CAAX-
containing proteins that end with Ser, Met, Cys, Gln or Ala. For
FPTase, CAAX tetrapeptides comprise the minimum region required
for interaction of the protein substrate with the enzyme. The
enzymological characterization of these three enzymes has
demonstrated that it is possible to selectively inhibit one with little
inhibitory effect on the others (Moores, S. L., Schaber, M. D.,
Mosser, S. D., Rands, E., O'Hara, M. B., Garsky, V. M., Marshall,
M. S., Pompliano, D. L., and Gibbs, J. B., J. Biol. Chem., 266:17438
(1991), U.S. Pat. No. 5,470,832).
The prenylation reactions have been shown genetically
to be essential for the function of a variety of proteins (Clarke, 1992;
Cox and Der, 1992a; Gibbs, J. B. (1991). Cell 65: 1-4; Newman and
Magee, 1993; Schafer and Rine, 1992). This requirement often is
demonstrated by mutating the CAAX Cys acceptors so that the
proteins can no longer be prenylated. The resulting proteins are
devoid of their central biological activity. These studies provide a
genetic "proof of principle" indicating that inhibitors of prenylation
can alter the physiological responses regulated by prenylated
proteins.
-2-
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
The Ras protein is part of a signaling pathway that links
cell surface growth factor receptors to nuclear signals initiating
cellular proliferation. Biological and biochemical studies of Ras
action indicate that Ras functions like a G-regulatory protein. In the
inactive state, Ras is bound to GDP. Upon growth factor receptor
activation, Ras is induced to exchange GDP for GTP and undergoes
a conformational change. The GTP-bound form of Ras propagates
the growth stimulatory signal until the signal is terminated by the
intrinsic GTPase activity of Ras, which returns the protein to its
inactive GDP bound form (D.R. Lowy and D.M. Willumsen, Ann.
Rev. Biochem. 62:851-891 (1993)). Activation of Ras leads to
activation of multiple intracellular signal transduction pathways,
including the MAP Kinase pathway and the Rho/Rac pathway
(Joneson et al., Science 271:810-812). One consequence of activation
of the MAP I~inase pathway is activation of transcription factors, for
example Elk-1, and transcription of specific proteins (R. Treisman,
Current Opinion in Genetics and Development (1994) 4:96-101, and
references therein).
Mutated ras genes are found in many human cancers,
including colorectal carcinoma, exocrine pancreatic carcinoma, and
myeloid leukemias. The protein products of these genes are defective
in their GTPase activity and constitutively transmit a growth
stimulatory signal.
The Ras protein is one of several proteins that are
known to undergo post-translational modification. Farnesyl-protein
transferase utilizes farnesyl pyrophosphate to covalently modify the
Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss
et al., Cell, 62:81-88 (i990); Schaber et al., J. Biol. Chem.,
265:14701-14704 (1990); Schafer et al., Science, 249:1133-1139
(1990); Manne et al., Proc. Natl. Acad. Sci USA, 87:7541-7545
( 1990)).
Ras must be localized to the plasma membrane for both
normal and oncogenic functions. At least 3 post-txanslational modi-
-3-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
fications are involved with Ras membrane localization, and all 3
modifications occur at the C-terminus of Ras. The Ras C-terminus
contains a sequence motif termed a "CAAX" or "Cys-Aaa-Aaa-Xaa"
box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any
amino acid) (Willumsen et al., Nature 310:583-586 (1984)).
Depending on the specific sequence, this motif serves as a signal
sequence for the enzymes farnesyl-protein transferase or geranyl
geranyl-protein transferase, which catalyze the alkylation of the
cysteine residue of the CAAX motif with a C 15 or C2p isoprenoid,
respectively. (S. Clarke., Ann. Rev. Biochem. 61:355-386 (1992);
W.R. Schafer and J. Rine, Ann. Rev. Genetics 30:209-237 ( 1992)).
Other farnesylated proteins include the Ras-related
GTP-binding proteins such as RhoB, fungal mating factors, the
nuclear lamins, and the gamma subunit of transducin. James, et al.,
J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome
associated protein Pxf which is also farnesylated. James, et al.,
have also suggested that there are farnesylated proteins of
unknown structure and function in addition to those listed above.
Inhibitors of farnesyl-protein transferase (FPTase)
have been described in two general classes. The first class includes
analogs of farnesyl diphosphate (FPP), while the second is related to
protein substrates (e.g., Ras) for the enzyme. The peptide derived
inhibitors that have been described are generally cysteine containing
molecules that are related to the CAAX motif that is the signal for
protein prenylation. (Schaber et al., ibid; Reiss et. al., ibid; Reiss
et al., PNAS, 88:732-736 (1991)). Such inhibitors may inhibit
protein prenylation while serving as alternate substrates for the
farnesyl-protein transferase enzyme, or may be purely competitive
inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl
et al., Science, 2b0:1934-1937 (1993); Graham, et al., J. Med.
Chem., 37, 725 (1994)).
Mammalian cells express four types of Ras proteins
(H-, N-, K4A-, and K4B-Ras) among which K4B-Ras is the most
frequently mutated form of Ras in human cancers. The genes that
-4-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
encode these proteins are abbreviated H-ras, N-ras , K4A-ras and
K4B-ras respectively. H-ras is an abbreviation for Harvey-ras. K4A-
ras and K4B-ras are abbreviations fox the Kirsten splice variants of
ras that contain the 4A and 4B exons, respectively. Inhibition of
farnesyl-protein transferase has been shown to block the growth of
H-ras-transformed cells in soft agar and to modify other aspects of
their transformed phenotype. It has also been demonstrated that
certain inhibitors of farnesyl-protein transferase selectively block
the processing of the H-Ras oncoprotein intracellularly (N.E. Kohl
et al., Science, 260:1934-1937 (1993) and G.L. James et al., Science,
2b0:1937-1942 (1993). Recently, it has been shown that an inhibitor
of farnesyl-protein transferase blocks the growth of H-ras-dependent
tumors in nude mice (N.E. Kohl et al., Proc. Natd. Acad. Sci U.S.A.,
91:9141-9145 (1994) and induces regression of mammary and
salivary carcinomas in H-ras transgenic mice (N.E. Kohl et al.,
Nature Medicine, 1:792-797 (1995).
Indirect inhibition of farnesyl-protein transferase in
vivo has been demonstrated with lovastatin (Merck & Co., Rahway,
NJ) and compactin (Hancock et al., ibid; Casey et al., ibid; Schafer
et al., Science 245:379 (1989)). These drugs inhibit HMG-CoA
reductase, the rate limiting enzyme for the production of polyiso-
prenoids including farnesyl pyrophosphate. Inhibition of farnesyl
pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks
Ras membrane localization in cultured cells.
It has been disclosed that the lysine-rich region and
terminal CVIM sequence of the C-terminus of K4B-Ras confer
resistance to inhibition of the cellular processing of that protein by
certain selective FPTase inhibitors. (James, et al., J. Biol. Chem.
270, 6221 (1995)) Those FPTase inhibitors were effective in
inhibiting the processing of H-Ras proteins. James et al., suggested
that prenylation of the K4B-Ras protein by GGTase contributed to
the resistance to the selective FPTase inhibitors. (Zhang et al, J. Biol.
Chem. 272 :10232-239 (1997); Rowell et al, J. Biol. Chem. 272
-5-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
:14093-14097 (1997); Whyte et al, J. Biol. Chem. 272 :14459-14464
(1997)).
Several groups of scientists have recently disclosed
compounds that are non-selective FPTase/GGTase inhibitors.
(Nagasu et al. Cancer Research, 55:5310-5314 (1995); PCT
application WO 95/25086).
Recently, an assay useful to identify inhibitors of FPTase
which incorporates all or part of the K4B-Ras protein substrate has
been disclosed (PCT Appln. WO 96/34113).
It is the object of the present invention to provide
a method of inhibiting prenyl-protein transferase which utilizes
compounds that are prenyi-protein transferase inhibitors and which
inhibit cellular processing of the H-Ras and K4B-Ras proteins.
A composition which comprises such an inhibitor
compound is also used in the present invention to treat cancer.
It is also the object of the instant invention to provide a
method for identifying a prenyl-protein transferase inhibitor which
is an inhibitor of cellular processing of the H-Ras and K4B-Ras
proteins.
SUMMARY OF THE INVENTION
The instant invention provides for a method of
inhibiting prenyl-protein transferases and treating cancer which
comprises administering to a mammal a prenyl-protein transferase
inhibitor which is an inhibitor of cellular processing of the H-Ras
and K4B-Ras proteins. The invention in particular provides for a
method of inhibiting farnesyl-protein transferase and
geranylgeranyl-protein transferase type I by administering a
compound that is a dual inhibitor of both of those prenyl-protein
transferases. The instant invention also provides for a method of
identifying such a compound, the method comprising an assay whose
readout is a consequence of the biological activity or inhibition of
that activity of the Ras protein, thus providing convenient identifica-
-6-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
tion of compounds that inhibit cellular processing of the H-Ras and
K4B-Ras proteins.
BRIEF DESCRIPTION OF THE FIGURES
FIGURE 1: Schematic Diagram of the SEAP Assay:
A schematic drawing of the MAPK signal transduction
pathway and activation of the transcription factor Elkl leading to
activation of the fos promoter/reporter construct and expression of
secreted alkaline phosphatase (SEAP).
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a method of inhibiting
prenyl-protein transferases which comprises administering to a
mammal in need thereof a pharmaceutically effective amount of
a compound which has certain characteristics that are indicative of
in vivo efficacy as an inhibitor of the growth of cancer cells. In
particular the compound is characterized by:
a) an inhibitory activity (IC50) of less than 12 ~.M against
K4B-Ras dependent activation of MAP kinases in cells.
Preferably, the compound utilized in the instant method
is characterized by:
a) an inhibitory activity (IC50) of less than 5 ~M against
K4B-Ras dependent activation of MAP kinases in cells.
The compound may be further characterized by one or
more of the following:
b) an inhibitory activity (IC50) against K4B-Ras dependent
activation of MAP kinases in cells greater than 5 fold lower
than the inhibitory activity (ICSp) against Myr-Ras dependent
activation of MAP kinases in cells;
c) an inhibitory activity (IC50) against H-ras-CVLL dependent
activation of MAP kinases in cells greater than 5 fold lower
_7_
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
than the inhibitory activity (IC50) against Myr-Ras dependent
activation of MAP kinases in cells;
d) an inhibitory activity (ICSp) against H-Ras dependent activation
of MAP kinases in cells greater than 2 fold lower but less than
20,000 fold lower than the inhibitory activity (ICSp) against
H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP
kinases in cells;
d) an inhibitory activity (IC$0) against H-ras-CVLL dependent
activation of MAP kinases in cells greater than 5 fold lower than
the inhibitory activity (IC50) against expression of the SEAP
protein in cells transfected with the pCMV-SEAP plasmid that
constitutively expresses the SEAP protein; and
e) an inhibitory activity (IC50) against K4B-Ras dependent
activation of MAP kinases in cells greater than 5 fold lower than
the inhibitory activity (IC50) against expression of the SEAP
protein in cells transfected with the pCMV-SEAP plasmid that
constitutively expresses the SEAP protein.
Preferably, the compound is further characterized by:
c) inhibitory activity (IC50) of < 10 nM against H-Ras dependent
activation of MAP kinases in cells.
Preferably, the prenyl-protein transferases that are
being inhibited by the instant method are both farnesyl-protein
transferase and geranylgeranyl-protein transferase type I.
Preferably the compound that is being administered is a dual
inhibitor of farnesyl-protein transferase and geranylgeranyl-protein
transferase type I.
It has been surprisingly found that such a potent dual
inhibitor is particularly useful as an in vavo inhibitor of the growth
of cancer cells, particularly those cancers characterized by a mutated
K4B-Ras protein, at concentrations of inhibitor that do not cause
mechanism based toxicity. Mechanism-based toxicity of farnesyl-
_g_
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
protein transferase inhibitors can be anticipated in rapidly
proliferating tissues, for example, the bone marrow.
The present invention further relates to a method of
identifying a prenyl-protein transferase inhibitor which is efficacious
in vivo as an inhibitor of cancer cell growth. The instant method
comprises a novel in vitro assay (described in detail below) whose
readout is a consequence of the biological activity of the Ras protein
(or its inhibition) instead of a determination of the physical state
of the Ras protein (whether or not the protein has been processed).
This assay differs from previously disclosed assays that measure
the extent of inhibition of Ras processing in cells because the
determination of the extent of processing may be performed with a
high through-put luminometer and does not depend on time-intensive
use of polyacrylamide gel electrophoresis. Compounds that inhibit
the processing of the Ras protein but do not inhibit its biological
activity may be improperly identified by previously disclosed assays
of Ras processing in cells which merely measure the extent to which
the protein was processed.
The instant assay that is useful in the identification of
the prenyl-protein transferase inhibitors of the instant invention,
comprises the steps of:
a) co-transfecting cells with an expression plasmid for a ras gene
and an expression plasmid for a reporter construct that encodes
the product of a reporter gene;
b) incubating the cells in the presence of test compound; and
c) analyzing an aliquot of the assay medium or a lysate of the cells
for the presence of the product of the reporter gene.
Preferably, the product of the reporter gene is secreted
alkaline phosphatase. When secreted alkaline phosphatase is used
as a reporter the assay is termed the SEAP assay. In the methods
described herein below, use of the SEAP assay is described.
However, one of ordinary skill in the art would readily appreciate
that other reporter systems can be utilized, including but not limited
_g_
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
to: luciferase, j3-galactosidase, chloramphenicol acetyl transferase
and (3-glucuronidase.
Preferably, the expression of the reporter gene is
controlled by a transcription factor which is activated by MAP
kinases. The term MAP kinases includes but is not limited to ERK-1
(Extracellular-Regulated protein Kinase), ERK-2, SAPK/JNK (stress
activated protein kinase/C jun N-terminal kinase) and p38.
Plasmids that incorporate the SEAP reporter construct
include but are not limited to those described by D. Defeo-Jones
et al. (Mol. Cell. Biol. 11:2307-2310 (1991)), R. E. Jones et al.
(Oncogene, 6:745-751 (1991)) and J. Berger et al. (J. Biol. Chem.,
263:10016-10021 (1988)). The SEAP reporter plasmids pDSE100
and pDSE101 described in Example 15 hereinbelow is also useful in
the instant assay. The SEAP reporter plasmid pCMV is also useful in
the methods of the instant invention as a control plasmid to identify
non-mechanism based toxicity of a test compound.
The term ras gene includes the H-ras , N-ras , K4B-ras ,
Myr-ras and H-ras -CVLL genes.
Expression plasmids for a ras gene of the instant
invention include but are not limited to pZIP-rasH, pZIP-rash,
pZIP-rasK4B, pSMS600, pSMS601, pSMS620, pSMS621, pSMS622,
pSMS630, pSMS640, pSMS650, pBW1423 (B.W. Williamsen et al.
Mol. Cell. Biol., 11:6026-6033 (1991)), pRcCMV-H-ras-V 12 and
pRcCMV-H-ras-v12,L189 (G.L. James et al. J. Biol.
Chem.,269:27705-27714 (1994)).
Alternate expression vectors that can be utilized to
create expression plasmids for a ras gene include, but are not limited
to, pCI, pSI, pSporr (Promega), pBK-CMV, pBK-RSV (Stratagene),
pEUK-C 1 (Clonetech), pCMV-L 1 C (Pharmingen) and
pcDNAl.I/Amp (Invitrogen).
The assay medium used in the instant assay may be
selected from medium useful for maintaining transiently transfected
cells. Preferably, the medium will lack phenol red and will be low
in serum. Preferably the assay medium comprises phenol red free
-10-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
DMEM, 2% mammalian serum, Pen/Strep, glutamine and
nonessential amino acids (NEAA).
It is contemplated that virtually any of the commonly
employed transfectable host cells that arrest in low serum growth
media can be used in connection with the instant assay. Examples
include cell lines typically employed for eukaryotic expression such
as C33a (ATCC: HTB-31), Ratl and 3T3 cell lines. A preferred line
for use in the instant assay has been found to be the human cell line
C33a.
Preferably the cancer cells are isolated after being
co-transfected with the expression plasmids.
In a first embodiment of the instant invention, the
method of identifying a prenyl-protein transferase inhibitor
comprises the steps of:
a) evaluating the test compound in the instant assay wherein the ras
gene is K-ras ;
b) evaluating the test compound in the instant assay wherein the ras
gene is Myr-ras ; and
c) comparing the activity of the test compound against Myr-Ras
dependent activation of MAP kinases in the instant assay with the
activity of the test compound against K- Ras dependent
activation of MAP kinases in the instant assay.
Preferably, the K-ras gene utilized in the instant method
is the K4B-ras gene, although it is envisaged that the K4A-ras gene
could also be utilized.
Preferably, in the first embodiment of the method of the
instant invention comprises one or both of the additional steps of:
d) evaluating the test compound in the instant assay wherein the ras
gene is H-ras ; and
e) evaluating the test compound in the instant assay wherein the ras
gene is H-ras-CVLL.
In a second embodiment of the instant invention, the
method of identifying a prenyi-protein transferase inhibitor
comprises the steps of:
-11-
CA 02301880 2000-02-25
WO 99/10525 PCT1US98/17699
a) evaluating the test compound in the instant assay wherein the ras
gene is H-ras ;
b) evaluating the test compound in the instant assay wherein the ras
gene is H-ras-CVLL;
c) evaluating the test compound in the instant assay wherein the ras
gene is Myr-ras ; and
d) comparing the activity of the test compound against Myr- Ras
dependent activation of MAP kinases in the instant assay with the
activity of the test compound against H- Ras dependent activation
of MAP kinases in the instant assay and H-Ras-CVLL dependent
activation of MAP kinases in the instant assay.
In a third embodiment of the instant invention, the method
of identifying a prenyl-protein transferase inhibitor comprises the steps
of:
a) evaluating the test compound in the instant assay wherein the Ras
gene is N-ras ;
b) evaluating the test compound in the instant assay wherein the Ras
gene is Myr-ras ; and
c) comparing the activity of the test compound against Myr- Ras
dependent activation of MAP kinases in the instant assay with the
activity of the test compound against N- Ras dependent
activation of MAP kinases in the instant assay.
In a forth embodiment of the instant invention, the
method of identifying a prenyl-protein transferase inhibitor
comprises the steps of:
a) evaluating the test compound in the instant assay wherein the ras
gene is H-ras ;
b) evaluating the test compound in the instant assay wherein the ras
gene is H-ras-CVLL;
c) evaluating the test compound in the instant assay wherein the
cells have been transfected with a pCMV-SEAP plasmid in the
absence of transfection with a rasgene; and
d) comparing the activity of the test compound against H-Ras-
CVLL dependent activation of MAP kinases in the instant assay
-12-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
with the activity of the test compound against H- Ras dependent
activation of MAP kinases in the instant assay and the activity of
the test compound against SEAP expression in part c) of this
method.
Preferably the assay utilized in the above methods of
identifying inhibitors is the SEAP assay.
Preferably, the pCMV-SEAP plasmid used in the instant
assay is the pCMV-SEAP-A plasmid.
The inhibitor compounds identified by the instant
method are useful in the inhibition of prenyl-protein transferase
and the treatment of cancer and other proliferative disorders in
mammals in need thereof. The above methods of identifying a single
compound that is a prenyl-protein transferase inhibitor or a dual
inhibitor of farnesyl-protein transferase and geranylgeranyl -protein
transferase-type I may also be used to identify optimal ratios of the
active components in a combination of a selective farnesyl-protein
transferase inhibitor and a selective geranylgeranyl-protein
transferase-type I inhibitor.
Preferably, the compounds of the invention have
inhibitory concentrations {IC50) of < 100 nM against H-Ras
dependent activation of MAP kinases in cells in the SEAP assay.
More preferably, the compounds of the invention have inhibitory
concentrations (IC50) of < 10 nM against H-Ras dependent activation
of MAP kinases in cells in the SEAP assay. Preferably, the ratio of
inhibitory activity (IC50) against K-Ras4B dependent activation to
inhibitory activity against H-Ras dependent activation is <2000.
Preferably, the compounds of the invention' have
inhibitory concentrations (IC50) of < 10 ~.M against H-Ras-CVLL
dependent activation of MAP kinases in cells in the SEAP assay.
More preferably, the compounds of the invention have inhibitory
concentrations (IC50) of < 1 ~.M against H-Ras-CVLL dependent
activation of MAP kinases in cells in the SEAP assay. Preferably,
-13-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
the ratio of inhibitory activity (IC50) against H-Ras-CVLL dependent
activation to inhibitory activity against H-Ras dependent activation
is from about 2 to about 20,000. More preferably, the ratio of
inhibitory activity (IC50) against H-Ras-CVLL dependent activation
to inhibitory activity (IC50) against H-Ras dependent activation is
from about 20 to about 2,000.
Preferably, the compounds of the invention have
inhibitory concentrations (ICSp) of < 5 ~.M against cellular
N-Ras dependent activation of MAP kinases in the SEAP assay.
More preferably, the compounds of the invention have inhibitory
concentrations (IC50) of < 1 ~,M against cellular N-Ras dependent
activation of MAP kinases in the SEAP assay.
It is preferred that the compounds of the invention
selectively inhibit processing of a Ras protein, and therefore inhibit
the growth of cells transformed by a ras oncogene. In the instant
method of identifying a prenyl-protein transferase inhibitor, the step
of evaluating the activity of the test compound in the instant assay
wherein the SEAP plasmid is selected from the mutated ras gene
designated Myr-ras assesses whether the test compound inhibits signal
transduction independent of inhibiting Ras prenylation, since the
mutated gene Myr-ras enables the protein to bypass the requirement
of prenylation for cellular activity (J. E. Buss et al. Science,
243:1600-1603 (1989)). If the ICSp of the test compound against
cellular Myr-Ras dependent activation of MAP kinases in the instant
assay is close in value to the IC50 of the test compound against
K4B-Ras dependent activation of MAP kinases in the same assay
it is difficult to determine the true effect of the test compound in
inhibiting Ras prenylation. Such inhibition may represent non-
specific cytotoxicity rather than selective inhibition of Ras
prenylation.
Alternatively, non-specific cytotoxicity of a test
compound may be evaluated by incubating a cell that has been
-14-
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
transfected with the pCMV-SEAP plasmid and analyzing the assay
medium for the presence of the SEAP protein.
In an embodiment of the instant invention, it is therefore
preferable that the ratio of the activity (as an IC50) of the test com-
pound against cellular Myr-Ras dependent activation of MAP kinases
in the SEAP assay to the activity {as an IC$p) of the test compound
against K4B-Ras dependent activation of MAP kinases in the SEAP
assay is greater than 1. Most preferably, the ratio of inhibitory
activity (IC50) against Myr- Ras dependent activation of MAP
kinases (as measured in the SEAP assay} to the inhibitory activity
(IC50) against K4B-Ras dependent activation of MAP kinases is >5.
It is understood that the phrase "an inhibitory activity
(IC50) against K4B-Ras dependent activation of MAP kinases in cells
greater than 5 fold lower than the inhibitory activity (IC50) against
Myr-Ras dependent activation of MAP kinases in cells" (and similar
phrases directed to other comparisons) has the same meaning as the
phrase "the ratio of inhibitory activity (ICgO) against Myr- Ras
dependent activation of MAP kinases (as measured in the SEAP
assay) to the inhibitory activity (ICSp) against K4B-Ras dependent
activation of MAP kinases is >5" (and other like phrases).
It is also preferable that the ratio of the activity (as an
IC50) of the test compound against cellular Myr- Ras dependent
activation of MAP kinases in the SEAP assay to the activity (as
an IC50) of the test compound against H-Ras-CVLL dependent
activation of MAP kinases in the SEAP assay is greater than 1.
Most preferably, the ratio of inhibitory activity against Myr- Ras
dependent activation of MAP kinases (as measured in the SEAP
assay) to the inhibitory activity against H-Ras-CVLL dependent
activation of MAP kinases is >5.
It is further preferable that the ratio of the activity (as
an IC50) of the test compound against cellular Myr- Ras dependent
activation of MAP kinases in the SEAP assay to the activity (as an
ICSO) of the test compound against N-Ras dependent activation of
MAP kinases in the SEAP assay is greater than 5. Most preferably,
-15-
CA 02301880 2000-02-25
WO 99!10525 PCT/US98/17699
the ratio of inhibitory activity against Myr-Ras dependent activation
of MAP kinases (as measured in the SEAP assay) to the inhibitory
activity against N-Ras dependent activation of MAP kinases is >20.
In another embodiment of the instant invention, it is
preferable that the ratio of the activity (as an IC50) of the test
compound against expression of the SEAP protein in cells transfected
with the pCMV-SEAP plasmid to the activity (as an IC50) of the test
compound against H-Ras-CVLL dependent activation of MAP kinases
in the SEAP assay is greater than 1. Most preferably, the ratio of
inhibitory activity against expression of the SEAP protein in cells
transfected with the pCMV-SEAP plasmid to the activity (as an IC50)
of the test compound against H-Ras-CVLL dependent activation of
MAP kinases in the SEAP assay is >5.
When a particular Ras protein is referred to herein
by a term such as "K4B-Ras", "N-Ras", "H-Ras" and the like, such
a term represents both the protein arising from expression of the
corresponding wild type ras gene and various proteins arising from
expression of ras genes containing various point mutations. When a
particular ras gene is referred to herein by a term such as "K4B-
ras", "N-ras", "H-ras" and the like, such a term represents both the
wild type ras gene and ras genes containing various point mutations.
The term prenyl-protein transferase inhibiting
compound refers to compounds which antagonize, inhibit or
counteract the activity of the genes coding farnesyl-protein
transferase and geranylgeranyl-protein transferase type I or
the proteins produced in response thereto.
The term selective as used herein refers to the inhibitory
activity of the particular compound against one biological activity
(such as inhibition of prenyl-protein transferases) when compared
to the inhibitory activity of the compound against another biological
activity. It is understood that the greater the selectivity of a prenyl-
protein transferase inhibitor, the more preferred such a compound is
for the methods of treatment described.
-16-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
For example, when discussing the combination of a
selective inhibitor of geranylgeranyl -protein transferase-type I and
a selective inibitor of farnesyl-protein transferase, a compound is
considered a selective inhibitor of geranylgeranyl -protein
transferase-type I, when its in vitro activity, as assessed by the assay
described in Example 11, is at least l0~times greater that the in vitro
activity of the same compound against farnesyl-protein transferase in
the assay described in Example 10. A compound is considered a
selective inhibitor of farnesyl-protein transferase, for example, when
its in vitro farnesyl-protein transferase inhibitory activity, as assessed
by the assay described in Example 10, is at least 10 times greater that
the in vitro activity of the same compound against geranylgeranyl-
protein transferase-type I in the assay described in Example 11.
Preferably, a selective compound exhibits at least 20 times greater
activity against one of the enzymatic activities when comparing
geranylgeranyl-protein transferase-type I inhibition and farnesyl-
protein transferase inhibition. More preferably the selectivity is at
least 100 times or more. It is understood that the greater the
selectivity of a geranylgeranyl-protein transferase-type I inhibitor or
farnesyl-protein transferase inhibitor, the more preferred such a
compound is in the such a combination.
The preferred therapeutic effect provided by the
instant composition is the treatment of cancer and specifically the
inhibition of cancerous tumor growth and/or the regression of
cancerous tumors. Cancers which are treatable in accordance
with the invention described herein include cancers of the brain,
breast, colon, genitourinary tract, prostate, skin, lymphatic
system, pancreas, rectum, stomach, larynx, liver and lung.
More particularly, such cancers include histiocytic lymphoma, lung
adenocarcinoma, pancreatic carcinoma, colo-rectal carcinoma, small
cell lung cancers, bladder cancers, head and neck cancers, acute and
chronic leukemias, melanomas, and neurological tumors.
The composition of this invention is also useful for
inhibiting other proliferative diseases, both benign and malignant,
-17-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
wherein Ras proteins are aberrantly activated as a result of oncogenic
mutation in other genes (i.e., the ras gene itself is not activated by
mutation to an oncogenic form) with said inhibition being
accomplished by the administration of an effective amount of
the instant composition to a mammal in need of such treatment.
For example, the composition is useful in the treatment of
neurofibromatosis, which is a benign proliferative disorder.
The composition of the instant invention is also useful in
the prevention of restenosis after percutaneous transluminal coronary
angioplasty by inhibiting neointimal formation (C. Indolfi et al.
Nature medicine, 1:541-545(1995).
The instant composition may also be useful in the
treatment and prevention of polycystic kidney disease (D.L.
Schaffner et al. American Journal of Pathology, 142:1051-1060
(1993) and B. Cowley, Jr. et al. FASEB Journal, 2:A3160 (1988)).
The instant compounds may also inhibit tumor angio-
genesis, thereby affecting the growth of tumors (J. Rak et al. Cancer
Research, 55:4575-4580 (1995)). Such anti-angiogenesis properties
of the instant compounds may also be useful in the treatment of
certain forms of vision deficit related to retinal vascularization.
The instant compounds may also be useful in the
treatment of certain viral infections, in particular in the treatment
of hepatitis delta and related viruses {J.S. Glenn et al. Science,
256:1331-1333 (1992).
The instant compounds may also be useful as inhibitors
of proliferation of vascular smooth muscle cells and therefore useful
in the prevention and therapy of arteriosclerosis and diabetic
vascular pathologies.
The compounds of this invention may be administered
to mammals, preferably humans, either alone or, preferably, in
combination with pharmaceutically acceptable carriers, excipients
or diluents, in a pharmaceutical composition, according to standard
pharmaceutical practice. The compounds can be administered orally
or parenterally, including the intravenous, intramuscular,
-18-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
intraperitoneal, subcutaneous, rectal and topical routes of
administration.
The pharmaceutical compositions containing the active
ingredient may be in a form suitable for oral use, for example, as
tablets, troches, lozenges, aqueous or oily suspensions, dispersible
powders or granules, emulsions, hard or soft capsules, or syrups
or elixirs. Compositions intended for oral use may be prepared
according to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions may contain one
or more agents selected from the group consisting of sweetening
agents, flavoring agents, coloring agents and preserving agents in
order to provide pharmaceutically elegant and palatable preparations.
Tablets contain the active ingredient in admixture with non-toxic
pharmaceutically acceptable excipients which are suitable for the
manufacture of tablets. These excipients may be for example,
inert diluents, such as calcium carbonate, sodium carbonate,
lactose, calcium phosphate or sodium phosphate; granulating and
disintegrating agents, for example, microcrystalline cellulose,
sodium crosscarmellose, corn starch, or alginic acid; binding agents,
for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and
lubricating agents, for example, magnesium stearate, stearic acid
or talc. The tablets may be uncoated or they may be coated by
known techniques to mask the unpleasant taste of the drug or delay
disintegration and absorption in the gastrointestinal tract and thereby
provide a sustained action over a longer period. For example,
a water soluble taste masking material such as hydroxypropylmethyl-
cellulose or hydroxypropylcellulose, or a time delay material such as
ethyl cellulose, cellulose acetate buryrate may be employed.
Formulations for oral use may also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an inert
solid diluent, for example, calcium carbonate, calcium phosphate or
kaolin, or as soft gelatin capsules wherein the active ingredient is
mixed with water soluble carrier such as polyethyleneglycol or an
oil medium, for example peanut oil, liquid paraffin, or olive oil.
-19-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17b99
Aqueous suspensions contain the active material in
admixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose, hydroxypropyl-
methyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum
tragacanth and gum acacia; dispersing or wetting agents may be
a naturally-occurring phosphatide, for example lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethylene-oxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol such
as polyoxyethylene sorbitol monooleate, or condensation products of
ethylene oxide with partial esters derived from fatty acids and hexitol
anhydrides, for example polyethylene sorbitan monooleate. The
aqueous suspensions may also contain one or more preservatives,
for example ethyl, or n-propyl p-hydroxybenzoate, one or more
coloring agents, one or more flavoring agents, and one or more
sweetening agents, such as sucrose, saccharin or aspartame.
Oily suspensions may be formulated by suspending the
active ingredient in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
The oily suspensions may contain a thickening agent, for example
beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as
those set forth above, and flavoring agents may be added to provide a
palatable oral preparation. These compositions may be preserved by
the addition of an anti-oxidant such as butylated hydroxyanisol or
alpha-tocopherol.
Dispersible powders and granules suitable for
preparation of an aqueous suspension by the addition of water
provide the active ingredient in admixture with a dispersing or
wetting agent, suspending agent and one or more preservatives.
Suitable dispersing or wetting agents and suspending agents are
exemplified by those already mentioned above. Additional
-20-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
excipients, for example sweetening, flavoring and coloring agents,
may also be present. These compositions may be preserved by the
addition of an anti-oxidant such as ascorbic acid.
The pharmaceutical compositions of the invention may
also be in the form of an oil-in-water emulsions. The oily phase may
be a vegetable oil, for example olive oil or arachis oil, or a mineral
oil, for example liquid paraffin or mixtures of these. Suitable
emulsifying agents may be naturally-occurring phosphatides, for
example soy bean lecithin, and esters or partial esters derived from
fatty acids and hexitol anhydrides, for example sorbitan monooleate,
and condensation products of the said partial esters with ethylene
oxide, for example polyoxyethylene sorbitan monooleate. The
emulsions may also contain sweetening, flavouring agents,
preservatives and antioxidants.
Syrups and elixirs may be formulated with sweetening
agents, for example glycerol, propylene glycol, sorbitol or sucrose.
Such formulations may also contain a demulcent, a preservative,
flavoring and coloring agents and antioxidant.
The pharmaceutical compositions may be in the form of
a sterile injectable aqueous solutions. Among the acceptable vehicles
and solvents that may be employed are water, Ringer's solution and
isotonic sodium chloride solution.
The sterile injectabie preparation may also be a sterile
injectable oil-in-water microemulsion where the active ingredient is
dissolved in the oily phase. For example, the active ingredient may
be first dissolved in a mixture of soybean oil and lecithin. The oil
solution then introduced into ~a water and glycerol mixture and
processed to form a microemulation.
The injectable solutions or microemulsions may be
introduced into a patient's blood-stream by local bolus injection.
Alternatively, it may be advantageous to administer the solution or
microemulsion in such a way as to maintain a constant circulating
concentration of the instant compound. In order to maintain such
-21-
CA 02301880 2000-02-25
W0.99/10525 PCT/US98/17699
a constant concentration, a continuous intravenous delivery device
may be utilized. An example of such a device is the Deltec CADD-
PLUSTM model 5400 intravenous pump.
The pharmaceutical compositions may be in the
form of a sterile injectable aqueous or oleagenous suspension for
intramuscular and subcutaneous administration. This suspension
may be formulated according to the known art using those suitable
dispersing or wetting agents and suspending agents which have been
mentioned above. The sterile injectable preparation may also be a
sterile injectable solution or suspension in a non-toxic parenterally-
acceptable diluent or solvent, for example as a solution in 1,3-butane
diol. In addition, sterile, fixed oils are conventionally employed as
a solvent or suspending medium. For this purpose any bland fixed
oil may be employed including synthetic mono- or diglycerides. In
addition, fatty acids such as oleic acid find use in the preparation of
injectables.
Compounds of Formula A may also be administered in
the form of a suppositories for rectal administration of the drug.
These compositions can be prepared by mixing the drug with a
suitable non-irritating excipient which is solid at ordinary
temperatures but liquid at the rectal temperature and will therefore
melt in the rectum to release the drug. Such materials include cocoa
butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of
polyethylene glycols of various molecular weights and fatty acid
esters of polyethylene glycol.
For topical use, creams, ointments, jellies, solutions
or suspensions, etc., containing the compound of Formula A are
employed. (For purposes of this application, topical application
shall include mouth washes and gargles.)
The compounds for the present invention can be
administered in intranasal form via topical use of suitable intranasal
vehicles and delivery devices, or via transdermal routes, using those
forms of transdermal skin patches well known to those of ordinary
skill in the art. To be administered in the form of a transdermal
-22-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
delivery system, the dosage administration will, of course, be
continuous rather than intermittent throughout the dosage regimen.
As used herein, the term "composition" is intended to
encompass a product comprising the specified ingredients in the
specific amounts, as well as any product which results, directly or
indirectly, from combination of the specific ingredients in the
specified amounts.
The compounds identified by the instant method may
also be co-administered with other well known therapeutic agents
that are selected for their particular usefulness against the condition
that is being treated. For example, the instant compounds may be
useful in combination with known anti-cancer and cytotoxic agents.
Similarly, the instant compounds may be useful in combination with
agents that are effective in the treatment and prevention of neuro-
fibromatosis, restinosis, polycystic kidney disease, infections of
hepatitis delta and related viruses and fungal infections. The instant
compounds may also be useful in combination with other inhibitors
of parts of the signaling pathway that links cell surface growth factor
receptors to nuclear signals initiating cellular proliferation.
The instant compounds may be utilized in combination
with farnesyl pyrophosphate competitive inhibitors of the activity
of farnesyl-protein transferase or in combination with a compound
which has Raf antagonist activity. The instant compounds may also
be co-administered with compounds that are selective inhibitors of
geranylgeranyl protein transferase or selective inhibitors of farnesyl-
protein transferase.
The compounds of the instant invention may also be
co-administered with other well known cancer therapeutic agents that
are selected for their particular usefulness against the condition that
is being treated. Included in such combinations of therapeutic agents
are combinations of the instant prenyl-protein transferase inhibitors
and an antineoplastic agent. It is also understood that the instant
combination of antineoplastic agent and inhibitor of prenyl-protein
transferase may be used in conjunction with other methods of
-23-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
treating cancer and/or tumors, including radiation therapy and
surgery.
If formulated as a fixed dose, such combination products
employ the combinations of this invention within the dosage range
described below and the other pharmaceutically active agents)
within its approved dosage range. Combinations of the instant
invention may alternatively be used sequentially with known
pharmaceutically acceptable agents) when a multiple combination
formulation is inappropriate.
Radiation therapy, including x-rays or gamma rays
which are delivered from either an externally applied beam or
by implantation of tiny radioactive sources, may also be used in
combination with an inhibitor of prenyl-protein transferase alone
to treat cancer.
Additionally, compounds of the instant invention may
also be useful as radiation sensitizers, as described in WO 97/38697,
published on October 23, 1997, and herein incorporated by
reference.
The instant compounds may also be useful in
combination with other inhibitors of parts of the signaling pathway
that links cell surface growth factor receptors to nuclear signals
initiating cellular proliferation. Thus, the instant compounds may
be utilized in combination with farnesyl pyrophosphate competitive
inhibitors of
the activity of farnesyl-protein transferase or in combination with a
compound which has Raf antagonist activity.
The instant compounds may also be useful in
combination with an integrin antagonist for the treatment of cancer,
as described in U.S. Ser. No. 09/055,487, filed April 6, 1998, which
is incorporated herein by reference.
As used herein the term an integrin antagonist refers
to compounds which selectively antagonize, inhibit or counteract
binding of a physiological ligand to an integrin(s) that is involved
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
in the regulation of angiogenisis, or in the growth and invasiveness
of tumor cells. In particular, the term refers to compounds which
selectively antagonize, inhibit or counteract binding of a physio-
logical ligand to the av(33 integrin, which selectively antagonize,
inhibit or counteract binding of a physiological ligand to the av~i5
integrin, which antagonize, inhibit or counteract binding of a
physiological ligand to both the av~33 integrin and the av~i5 integrin,
or which antagonize, inhibit or counteract the activity of the
particular integrin(s) expressed on capillary endothelial cells. The
term also refers to antagonists of the av (36, av ~i 8, a 1 (31, a2 X31,
a5~31, a6(31 and a6(34 integrins. The term also refers to antagonists
of any combination of av~33, av~i5, av(36, av~i8, aril, a2(31,
a5(31, a6(31 and a6(34 integrins. The instant compounds may also be
useful with other agents that inhibit angiogenisis and thereby inhibit
the growth and invasiveness of tumor cells, including, but not limited
to angiostatin and endostatin.
When a composition according to this invention is
administered into a human subject, the daily dosage will normally be
determined by the prescribing physician with the dosage generally
varying according to the age, weight, and response of the individual
patient, as well as the severity of the patient's symptoms.
In one exemplary application, a suitable amount of a
prenyl-protein transferase inhibitor are administered to a mammal
undergoing treatment for cancer. Administration occurs in an
amount of each type of inhibitor of between about 0.1 mg/kg of body
weight to about 60 mg/kg of body weight per day, preferably of
between 0.5 mg/kg of body weight to about 40 mg/kg of body weight
per day. A particular therapeutic dosage that comprises the instant
composition includes from about O.Olmg to about 1000mg of a
prenyl-protein transferase inhibitor. Preferably, the dosage
comprises from about lmg to about 1000mg of a prenyl-protein
transferase inhibitor.
Examples of an antineoplastic agent include, in
-25-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
general, microtubule-stabilising agents ( such as paclitaxel (also
known as Taxol~), docetaxel (also known as Taxotere~), or their
derivatives); alkylating agents, anti-metabolites; epidophyllotoxin;
an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine;
mitoxantrone; platinum coordination complexes; biological response
modifiers and growth inhibitors; hormonal/anti-hormonal
therapeutic agents and haematopoietic growth factors.
Example classes of antineoplastic agents include, for
example, the anthracycline family of drugs, the vinca drugs, the
mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes,
the epothilones, discodermolide, the pteridine family of drugs,
diynenes and the podophyllotoxins. Particularly useful members
of those classes include, for example, doxorubicin, carminomycin,
daunorubicin, aminopterin, methotrexate, methopterin, dichloro-
methotrexate, mitomycin C, porfiromycin, 5-fluorouracil,
6-mercaptopurine, gemcitabine, cytosine arabinoside,
podophyllotoxin or podo-phyllotoxin derivatives such as etoposide,
etoposide phosphate or teniposide, melphalan, vinblastine,
vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like.
Other useful antineoplastic agents include estramustine, cisplatin,
carboplatin, cyclophosphamide, bleomycin, gemcitibine, ifosamide,
melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate,
trimetrexate, dacarbazine, L-asparaginase, camptothecin, CPT-11,
topotecan, ara-C, bicalutamide, flutamide, leuprolide,
pyridobenzoindole derivatives, interferons and interleukins.
Compounds of the instant invention that are identified by
the properties described hereinabove include:
(a) a compound represented by formula I:
(RB~r N~Rsa R2
V - A~ (CR~a2)nA2(CR~a2)n ~'~N ~N\. _ %v Z
(C Rl b2)p
R R
-26-
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
wherein:
Rla is selected from:.hydrogen or C1-C( alkyl;
Rlb is independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C(
alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, cycloalkyl, alkenyl, 8100-, or -N(R10)2;
R3 and R4 selected from H and CH3;
R2 is selected from H; unsubstituted or substituted aryl,
unsubstituted or substituted heteroaryl,
NR6R~.
or C1-5 alkyl, unbranched or branched, unsubstituted or
substituted with one or more of:
1 ) aryl,
2) heterocycle,
3) OR6,
4) SR6a, S02R6a, or
5) ~ NR6R~
O
and R2 and R3 are optionally attached to the same carbon
atom;
R6 and R~ are independently selected from:
H; C1-4 alkyl, C3_6 cycloalkyl, aryl, heterocycle,
unsubstituted or substituted with:
a) C 1-4 alkoxy,
b) halogen,
c) perfluoro-C1-4 alkyl, or
-27-
CA 02301880 2000-02-25
WO 99/10525 PCT/US981i7699
d) aryl or heterocycle;
R6a is selected from:
C 1 _4 alkyl or C3-( cycloalkyl,
unsubstituted or substituted with:
a) C1-4 alkoxy,
b) halogen, or
c) aryl or heterocycle;
Rg is independently selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C( alkenyl, C2-C( alkynyl, C1-C(
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10)_~ R10C(p)_~ _N{R10)2~ or
RllpC{O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, 8100-,
R10C(O)NR10_~ (R10)2N-C{NR10)-~ R10C{p)-
-N(R10)2, or R110C(O)NR10_;
R9a is hydrogen or methyl;
R10 is independently selected from hydrogen, C1-C( alkyl, C1-C(
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R11 is independently selected from C1-C( alkyl and aryl;
A 1 and A2 are independently selected from: a bond, -CH=CH-,
-C=C-
-C(O)-, -C{O)NR10_~ p~ _N{R10)_~ or S(O)m;
V is selected from:
a) hydrogen,
-28-
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
b) heterocycle selected from pyrrolidinyl, imidazolyl,
pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl,
quinolinyl, isoquinolinyl, and thienyl,
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C2p alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not
hydrogen if A1 is a bond, n is 0 and A2 is S(O)m;
X is -CH2- or -C(=O)-;
Z is selected from:
1 ) a unsubstituted or substituted group selected from aryl,
heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl,
heteroarylsulfonyl, wherein the substituted group is
substituted with one or more of the following:
a) Cl-4 alkyl, unsubstituted or substituted with:
C 1-4 alkoxy, NR6R~, C3-6 cycloalkyl,
unsubstituted or substituted aryl, heterocycle,
HO, -S(O}mR6a, or -C(O)NR6R~,
b) aryl or heterocycle,
c) halogen,
d) OR6,
e) NR6R~
f } CN,
g) N02
h) CF3;
i) -S(O)mR6a,
j) -C(O)NR6R~, or
k) C3-C( cycloalkyl; or
2) unsubstituted C1-C6 alkyl, substituted Cl-C6 alkyl,
unsubstituted C3-C( cycloalkyl or substituted C3-C(
cycloalkyl, wherein the substituted Cl-C( alkyl and substituted
-29-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
C3-C( cycloalkyl is substituted with one or two of the
following:
a) C1-4 alkoxy,
b) NR6R~,
c) C3_( cycloalkyl,
d) -NR6C(O)R~,
e) HO,
~ _S{p)mR6a~
g) halogen, or
h) perfluoroalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4; and
r is 0 to 5, provided that r is 0 when V is hydrogen;
provided that the substituent (R8)r- V - A1{CRla2)nA2(CRla2)n -
is not H;
b) the inhibitors of farnesyl-protein transferase are
illustrated by the formula II:
~Rs)r N~Rsa R2 R3
la ~ ,N ~ Y
V - A~tCR~a2)nA2~CR 2)n ~' N
(CRlb2)p X~ ~'~ X1-(CR~°2)v
R
wherein:
Rla is selected from: hydrogen or C1-C6 alkyl;
Rlb is independently selected from:
a) hydrogen,
-30-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98117699
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C6
alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by unsubstituted or
substituted aryl, heterocycle, cycloalkyl, alkenyl, 8100-, or
-N(R10)2~
R 1 c is selected from:
a) hydrogen,
b) unsubstituted or substituted C1-C( alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocyclic, C3-C10
cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl, 8100-,
R11S(O)m-~ R10C(O)NR10_~ (R10)2N_C(O)-, CN,
(R10)2N_C(NR10)_~ R10C(p)_~ RlOpC(O)_, N3~
-N(R10)2, and R110C(O)-NR10_, and
c) unsubstituted or substituted aryl;
R3 and R4 independently selected from H and CH3;
R2 is selected from H; OR10;
NR6R~,
O ~ or C 1-5 alkyl, unbranched or branched, unsubstituted
or substituted with one or more of:
1 ) aryl,
2) heterocycle,
3 ) OR6,
4) SR6a, S02R6a, or
~NR6R~
IIO
and R2, R3 and R4 are optionally attached to the same carbon
atom;
-31-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
R6 and R~ are independently selected from: H; C1-4 alkyl, C3-6
cycloalkyl, aryl, heterocycle, unsubstituted or substituted with:
a) C1-4 alkoxy,
b) halogen, or
c) aryl or heterocycle;
R6a is selected from:
C 1 _q. alkyl or C3-( cycloalkyl,
unsubstituted or substituted with:
a) C1-q. alkoxy,
b) halogen, or
c) aryl or heterocycle;
Rg is independently selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C( alkenyl, C2-C( alkynyl, C1-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
{R10)2N_C(NR10)-~ R10C(O)_~ _N(R10)2, or
R110C(O)NR10-, and
c) C1-C( alkyl substituted by C1-C( perfluoroalkyl, 8100-,
R10C{O)NR10_, (R10)2N-C(NR10)-, R10C(O)-,
-N{R10)2, or R110C(O)NR10_;
R9a is hydrogen or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R11 is independently selected from C1-C( alkyl and aryl;
R12 is selected from: H; unsubstituted or substituted C1-g alkyl,
unsubstituted or substituted aryl or unsubstituted or substituted heterocycle,
wherein the substituted alkyl, substituted aryl or substituted
heterocycle is substituted with one or more of:
-32-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
1 ) aryl or heterocycle, unsubstituted or substituted
with:
a) C 1 _4 alkyl,
b) (CHZ)pOR6,
c) (CH2)pNR6R~~
d) halogen,
e) CN,
fj aryl or heteroaryl,
g) perfluoro-C1-4 alkyl,
h) SR6a, S(O)R6a, SOZR6a,
2) C3_6 cycloalkyl,
3) ORb,
4) SR6a, S(O)R6a,
or S02R6a,
5) -NRsR~ ,
Rs
6) -N~ R~
O
7) Rs
-N NR~R~a
-33-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
8) -O II NRsR7
O
9) -O~ORs ,
O
10) ~ NRsR~ ,
O
11) -g02-NRsR~ ,
Rs
12) -N-S02 Rsa '
13) ~ Rs ,
I IO
14) ~ORs ,
O
15) N3,
16) F,
17) perfluoro-C~_4-alkyl, or
18) C1_s-alkyl;
A 1 and A2 are independently selected from: a bond, -CH=CH-,
-C=C-,
_C~p)_~ _C~p)NR10_~ _NRIOC~p)_~ p~ _N(R10)_~ or
S(a)m;
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl,
quinolinyl, isoquinolinyl, and thienyl,
-34-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
c) aryl,
d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not
hydrogen if A1 is a bond, n is 0 and A2 is S(O)m;
X is -CH2- or -C(=O)-;
X1 is a bond, -C(=O)-, -NR6C(=O)-, -NR6-, -O- or -S(=O)m-;
Y is selected from:
a) hydrogen,
b) 8100-, R11S(O)m-~ R10C(O)NR10_~ (R10)2N-C(O)-, CN,
N02, (R10)2N_C(NR10)_~ R12C(O)_~ RIOpC(O)_~ N3, F,
-N(R10)2, or R110C(O)NR10_~
c) unsubstituted or substituted C1-C( alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, 8100-, R10C(O)NR10_~
(R10)2N_C(O)_, R10C(O)- and R100C(O)-;
Z is an unsubstituted or substituted aryl, wherein the substituted
aryl is substituted with one or more of the following:
1 ) C 1-4 alkyl, unsubstituted or substituted with:
a) C1-4 alkoxy,
b) NR6R~,
c) C3_6 cycloalkyl,
d) aryl, substituted aryl or heterocycle,
e) HO,
_S(O)mR6a~ or
g) -C(O)NR6R~,
2) aryl or heterocycle,
3) halogen,
4) OR6
5 ) NR6R~
-35-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
6) CN,
7) N02,
8) CF3;
9) -S(O)mR6a,
10) -C(O)NR6R~,
or
11 ) C3-C( cycloalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4; and
r is 0 to 5, provided that r is 0 when V is hydrogen; and
v is 0, 1 or 2;
c) a compound represented by formula III:
Rs
~RB~T ~ Z
N N UR42~qA3UR52~nRE
V - A1(CR~2)nA2(CR12 n
U R22~pA4
III R3
wherein:
R 1 is independently selected from: hydrogen or C 1-C( alkyl;
R2 is independently selected from:
a) hydrogen,
b) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C3-C 10 cycloalkyl, 8100- or
C2-C( alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, C3-C 10 cycloalkyl, C2-C( alkenyl, 8100-, or
-N(R10)2~
R3 is selected from:
a) hydrogen,
-36-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
b) C 1-C( alkyl unsubstituted or substituted by
C2-C( alkenyl, 8100-, R11S(O)m-, R10C(O)NR.10_~ CN,
N3~ (R10)2N_C(NR10)_~ R10C(O)_~ _N(R10)2, or
R110C(O)NR10_,
c) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C3-C 10 cycloalkyl,
C2-C6 alkenyl, fluoro, chloro, 8120-,
R11S(O)m-~ R10C(O)NR10_, CN, N02
(R10)2N_C(NR10)_~ R10C(p)-~ N3, _N(R10)2,
or R 11 OC(O)NR 10-, and
d) C 1-C( alkyl substituted with an unsubstituted or
substituted group selected from substituted or
unsubstituted aryl, substituted or unsubstituted
heterocyclic and C3-C 10 cycloalkyl;
R4 and RS are independently selected from:
a) hydrogen,
b) C1-C( alkyl unsubstituted or substituted by
C2-C6 alkenyl, 8100-, R11S(O)m-, R10C(O)NR10_~ CN,
N3, (R10)2N_C(NR10)_~ R10C(O)_~ -N(R10)2~ or
R1 lOC(O)NR10_,
c) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C3-C 10 cycloalkyl,
C2-C( alkenyl, fluoro, chloro, 8100-,
R11S(p)m-~ R10C(O)NR10_~ CN, N02
(R10)2N_C(NR10~_~ R10C(O)_~ N3~ -N(R10)2,
or R110C(O)NR10-, and
d) C1-C( alkyl substituted with an unsubstituted or
substituted group selected from substituted or
unsubstituted aryl, substituted or unsubstituted
heterocyclic and C3-C10 cycloalkyl;
R6 is independently selected from:
-37-
CA 02301880 2000-02-25
WO 99/10525 PCTILIS98/17699
a) hydrogen,
b) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C1-C( alkyl, C2-C6 alkenyl,
C2-C( alkynyl, C1-C( perfluoroalkyl, F, Cl, R100-,
allyloxy, R10C(O)NR10-, CN, N02, (R10)2N-C(NR10)_~
R10C(O)-, -N(R10)2, (R12)2NC(O)_ or R110C(O)NR10_~
and
c) C1-C( alkyl substituted by C1-C6 perfluoroalkyl, 8100-,
R10C(O)NR10_, (R10)2N_C(NR10)_~ R10C(p)-,
-N(R10)2, or R110C(O)NR10_;
R7 is independently selected from
a) hydrogen,
b) unsubstituted or substituted aryl,
c) unsubstituted or substituted heterocycle,
d) unsubstituted or substituted cycloalkyl, and
e) C 1-C6 alkyl substituted with hydrogen or an unsubstituted
or substituted group selected from aryl, heterocycle and
cycloalkyl;
wherein heterocycle is selected from pyrrolidinyl,
imidazolyl, pyridinyl, thiazolyl, pyridonyl, indolyl,
quinolinyl, isoquinolinyl, and thienyl;
Rg is selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C( alkenyl, C2-C6 alkynyl, C1-C(
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10)_~ R10C(O)_~ RIOpC(O)_~ _N(R10)2~ or
RllpC(O)NR10_~ and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyi, 8100-,
R10C(O)NR10_~ (R10)2N_C(NR10~_~ R10C(O)-
R100C(O)-, -N(R10)2, or R110C(O)NR10_;
-38-
CA 02301880 2000-02-25
WO 99/1O5Z5 PCT/US98I17699
R9 is selected from:
a) hydrogen,
b) C2-C6 alkenyl, C2-C( alkynyl, C1-C( perfluoroalkyl, F,
Cl, R100-, R11S(O)m-, RIOC{p)NR10_~ CN, N02,
(R10)2N_C(NR10)_~ RlOC(O)_~ RIOpC(O)_~ _N(R10)2~ or
R110C(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by C1-C6
perfluoroalkyl, F, Cl, R100-, R11S(O)m-, R10C(O)NR10_~
CN, (R10)2N_C(NR10)_~ RIOC{O)_, RlOpC(O)-,
-N(R10)2, or R110C(O)NR10_;
R10 is independently selected from hydrogen, C1-C6 alkyl, C1-C(
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C6 alkyl, C1-C(
alkyl substituted with C02R10, C1-C( alkyl substituted with
aryl, C1-C( alkyl substituted with substituted aryl, C1-C( alkyl
substituted with heterocycle, C1-C6 alkyl substituted with
substituted heterocycle, aryl and substituted aryl;
A 1 and A2 are independently selected from: a bond, -CH=CH-,
-C=C-, -C(O)-, -C(O)NR~-, -NR~C(O)-, -S{O)2NR~-,
-NR~S(O)2-, O, -N(R~)-, or S(O)m;
A3 is selected from: a bond, -C(O)NR~-, -NR~C(O)-, -S(O)2NR~-,
-NR~S(O)2- or -N{R~)-;
A4 is selected from: a bond, O, -N(R~)- or S;
V is selected from:
a) hydrogen,
-39-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
b) heterocycle selected from pyrrolidinyl, imidazolyl,
pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl,
quinolinyl, isoquinolinyl, and thienyl,
c) aryl,
d) C 1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 alkenyl, and
provided that V is not hydrogen if A1 is S(O)m and V is not
hydrogen if Al is a bond, n is 0 and A2 is S{O)m;
Z is independently (R1)2 or O;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4;
q is 0 or 1; and
r is 0 to S, provided that r is 0 when V is hydrogen;
d) a compound represented by formula A:
R2a R2b
/,
R~~N-(CR~b2r ;-~/'
Rs / '~ ~ Rs
A O
wherein:
Rla is selected from: hydrogen or C1-C( alkyl;
Rib is independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C6
alkenyl,
-40-
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
c) C 1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, cycloalkyl, alkenyl, 8100-, or -N(R10)2;
R2a, R2b and R3 are independently selected from:
a) hydrogen,
b) C1-C( alkyl unsubstituted or substituted by C2-C(
alkenyl, 8100-, R11S(O)m-, R10C(O)NR10_~ CN, N3,
(R10)ZN_C(NR10)_~ R10C(O)_~ RlOpC(O)_~ _N(R10)2~ or
R110C(O)NR10_,
c) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, unsubstituted or
substituted cycloalkyl, alkenyl, 8100-,
R11S(O)m-, R10C(p)NR10_~ CN, N02,
(R10)2N_C(NR10)_, RIOC(O)_, RlOpC(p)-,
N3, -N(R10)2, halogen or R110C(O)NR10-, and
d) C 1-C( alkyl substituted with an unsubstituted or
substituted group selected from aryl, heterocyclic and
C3-Clp cycloalkyl;
R4 is
~Rs~r N~Rsa
Z
V - AIURla2)nA2~CR1a2)n ~' ~IV
tCRlb2~ ~S~
P
RS is hydrogen;
Rg is selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C6 alkenyl, C2-C( alkynyl, C1-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10)-~ R10C(O)_~ RlOpC(O)_~ _N(R10)2~ or
R110C(O)NR10_, and
-41-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
c) C 1-C6 alkyl substituted by C 1-C6 perfluoroalkyl, R 100-,
RlpC(O)NR10_~ (R10)2N_C(NR10)-, R10C(O)-,
R100C{O)-, -N(R10)2, or R1 lOC(O)NR10_;
R9a is independently selected from Cl-C( alkyl and aryl;
R 10 is independently selected from hydrogen, C 1-C( alkyl, C 1-C6
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R 11 is independently selected from C 1-C( alkyl, benzyl and aryl;
A 1 and A2 are independently selected from: a bond, -CH=CH-,
-C=C-, -C(O)-, -C(O)NR8-, -NRgC(O)-, O, -N(R8)-,
_S{O)2N{R8)_~ _N{R8)S(O)2_~ or S(O)m
V is selected from:
a) hydrogen,
b) heterocycle selected from pyrrolidinyl, imidazolyl,
pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl,
quinolinyl, isoquinolinyl, and thienyl,
c) aryl,
d) C 1-C20 alkyl wherein from 0 to 4 carbon atoms are
replaced with a heteroatom selected from O, S, and N, and
e) C2-C20 ~enyl,
provided that V is not hydrogen if A1 is S(O)m and V is not
hydrogen if A1 is a bond, n is 0 and A2 is S(O)m;
Z is H2 or O;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is independently 0, 1, 2, 3 or 4; and
r is 0 to 5, provided that r is 0 when V is hydrogen;
-42-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/I'1699
or the pharmaceutically acceptable salts thereof.
In a further embodiment of the formula I compounds
of this invention, the inhibitors of farnesyl-protein transferase are
illustrated by the formula I-a:
H
1
~N
N~= J /N N-Z
(CRlb2) X ~~ 2
R
I
~R8)r I-a
wherein:
R 1 b is independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, R 100-, -N(R 10)2 or C2-C(
alkenyl,
c) C1-C6 alkyl unsubstituted or substituted by aryl,
heterocycle, cycloalkyl, alkenyl, 8100-, or -N(R10)2;
R2 is selected from H; unsubstituted or substituted aryl or C1-5
alkyl, unbranched or branched, unsubstituted or substituted
with one or more of:
1 ) aryl,
2) heteroaryl,
3) OR6, or
4) SR6a;
R6 and R~ are independently selected from: C1-4 alkyl, aryl, and
heteroaryl, unsubstituted or substituted with:
a) C 1 _4 alkoxy,
b) halogen,
c) perfluoro-C 1-4 alkyl, or
d) aryl or heteroaryl;
-43-
CA 02301880 2000-02-25
WO 99/10525 PCT/US9$117699
R6a is selected from:
C1-q, alkyl, unsubstituted or substituted with:
a) C 1-4 alkoxy, or
b) aryl or heteroaryl;
Rg is independently selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C( alkenyl, C2-C( alkynyl, C1-C(
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10)-, R10C(O)-, _N(R10)2~ or
R11OC(O)NR10-, and
c) C 1-C6 alkyl substituted by C 1-C( perfluoroalkyl, R 100-,
R10C(O)NR10_~ (R10)2N-C(NR10)_~ R10C(O)-
-N(R10)2, or R110C(O)NR10_;
R 10 is independently selected from hydrogen, C 1-C6 alkyl, C 1-C(
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R11 is independently selected from C1-C6 alkyl and aryl;
X is -CH2- or -C(=O)-;
Z is an unsubstituted or substituted group selected from aryl,
arylmethyl and arylsulfonyl, wherein the substituted group is
substituted with one or more of the following:
a) C1_4 alkyl, unsubstituted or substituted with:
C 1 _q. alkoxy, NR6R~, C3-6 cycloalkyl,
unsubstituted or substituted aryl, heterocycle,
HO, -S(O)mR6a, or -C(O)NR6R~,
b) aryl or heterocycle,
c) halogen,
d) OR6
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
e) NR6R~
f) CN,
g) N~2
h) CF3;
i) -S(O)mR6a,
j) -C(O)NR6R~, or
k) C3-C6 cycloalkyl;
m is 0, 1 or 2; and
p is 0, 1, 2, 3 or 4; and
ris Oto3;
or the pharmaceutically acceptable salts thereof;
In another embodiment of this invention, the inhibitors
of farnesyl-protein transferase are illustrated by the formula II-a:
H
Y
N~~,~ , , ~
~CRlb2~p X -~CR 2wZ
I I-a
wherein:
Rlb is independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C6
alkenyl,
c) C1-C( alkyl unsubstituted or substituted by unsubstituted or
substituted aryl, heterocycle, cycloalkyl, alkenyl, R 100-, or
-N(R10)2~
Rlc is selected from:
a) hydrogen,
-45-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
b) unsubstituted or substituted C1-C( alkyl wherein the
substituent on the substituted C 1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocyclic, C3-C10
cycloalkyl, C2-C6 alkenyl, C2-C( alkynyl, 8100-,
Rlls(p)m-~ R10C(p)NR10_~ (R10)2N_C(p)_~ CN
(R10~2N_C(NR10)_~ RIOC(p)_~ RIOpC(p)_~ N3~
-N(R10)2, and R110C(O)-NR10_, and
c) unsubstituted or substituted aryl;
R6, R~ and Rya are independently selected from:
H; C 1 _q, alkyl, C3-6 cycloalkyl, aryl, heterocycle,
unsubstituted or substituted with:
a) C 1-4 alkoxy,
b) halogen, or
c) aryl or heterocycle;
R6a is selected from:
C1-q. alkyl or C3-6 cycloalkyl,
unsubstituted or substituted with:
a) C 1-4 alkoxy,
b) halogen, or
c) aryl or heterocycle;
R8 is independently selected from:
a) hydrogen,
b) C 1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C 1-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N-C(NR10)_~ R10C(p)_~ -N(R10)2~ or
R110C(O)NR10_, and
c) C1-C6 alkyl substituted by C1-Cg perfluoroalkyl, 8100-,
R10C(p)NR10_~ (R10)2N_C(NR10)_, R10C(p)_~
-N(R10)2, or R110C(O)NR10_;
-46-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
R10 is independently selected from hydrogen, C1-C6 alkyl, C1-C6
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R 11 is independently selected from C 1-C( alkyl and substituted or
unsubstituted aryl;
R12 is selected from: H; unsubstituted or substituted C1-g alkyl,
unsubstituted or substituted aryl or unsubstituted or substituted heterocycle,
wherein the substituted alkyl, substituted aryl or substituted
heterocycle is substituted with one or more of:
1) aryl or heterocycle, unsubstituted or substituted
with:
a) C 1 _4 alkyl,
b) halogen,
c) CN,
d) perfluoro-C 1-4 alkyl,
2) C3-( cycloalkyl,
3) OR6,
4) SR6a, S(O)R6a, or S02R6a,
5) ~ Rs ,
O
ORs
O
7)
8) F,
9) perfluoro-C~.4-alkyl, or
10) C~_s-alkyl;
X 1 is a bond, -C(=O)- or -S(=O)m-;
- 47 -
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
Y is selected from:
a) hydrogen,
b) 8100-~ Rlls(O)m-~ R10C(O)NR10-~ (R10)2N_C(O)_~ CN
N02, (RIO)2N_C(NR10)_, R12C(O)_, RlOpC(O)_, N3, F,
-N(R10)2, or R110C(O)NR10_~
c) unsubstituted or substituted C1-C6 alkyl wherein the
substituent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, 8100-, R10C(O)NR10_~
(R10)2N-C(O)-, R10C(O)- and R100C(O)-;
Z is an unsubstituted or substituted aryl, wherein the substituted
aryl is substituted
with one or more
of the following:
1 ) C 1-4 alkyl, unsubstituted or substituted
with:
a) C 1-4 alkoxy,
b) NR6R~,
c) C3-( cycloalkyl,
d) aryl, substituted aryl or heterocycle,
e) HO,
-S(O)mR6a~ or
g) -C(O)NR6R~,
2) aryl or heterocycle,
3) halogen,
4) OR6
5 ) NR6R~
6) CN,
7) N02,
8) CF3;
9) -S(O)mR6a~
10) -C(O)NR6R~, or
11 ) C3-C6 cycloalkyl;
m is 0, 1 or 2;
pis lor2;
r is 0 to 3; and
_~g-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699 -
v is 0, 1 or 2;
or a pharmaceutically acceptable salt thereof.
In a further embodiment of this invention, the inhibitors
of farnesyl-protein transferase are illustrated by the formula III-a:
H
N~ N Z ~CR42)qA3UR52)nRf
~~J
UR22)P N
~R8)r III-a R3
wherein:
R2 is independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C(
alkenyl,
c) C 1-C( alkyl unsubstituted or substituted by aryl,
heterocycle, cycloalkyl, alkenyl, 8100-, or -N(R1~)2;
R3 is selected from:
a) hydrogen,
b) C1-C6 alkyl unsubstituted or substituted by C2-C6
alkenyl, 8100-, R11S(O)m-, R10C{p)NR10_, CN, N3,
(R10)2N-C(NR10)-, R10C(O)-, -N(R1~)2, or
R11 OC(O)NR10_~
c) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C3-C10 cycloalkyl,
C2-C6 alkenyl, fluoro, chloro, 8120-,
R 11 S(O)m-, R 1 OC(O)NR 10-, CN, N02
{R10)2N_C(NR10)_~ R10C(O)_~ N3, _N(R10)2~
or R110C(O)NR10-, and
-49-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
d) C 1-C( alkyl substituted with an unsubstituted or
substituted group selected from substituted or
unsubstituted aryl, substituted or unsubstituted
heterocyclic and C3-C 10 cycloalkyl;
R4 and RS are independently selected from:
a) hydrogen,
b) C 1-C( alkyl unsubstituted or substituted by 8100- or
_N(R10)2,
c) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C3-C 10 cycloalkyl,
C2-C( alkenyl, fluoro, chloro, 8100-,
Rlls(O)m-, R10C(O)rJRIO_~ CN, N02
(R10)2N_C(NR10)_, RIOC(O)-, N3, -N(.R10)2~
or R110C(O)NR10-, and
d) C 1-C( alkyl substituted with an unsubstituted or
substituted group selected from substituted or
unsubstituted aryl, substituted or unsubstituted
heterocyclic and C3-C 10 cycloalkyl;
R6 is independently selected from:
a) hydrogen,
b) substituted or unsubstituted aryl, substituted or
unsubstituted heterocycle, C1-C6 alkyl, C2-C( alkenyl,
C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R100-,
allyloxy, R10C(O)NR10-, CN, N02, (R10)2N-C(NR10)_,
R10C(O)-, -N(R10)2, (R12)2NC(O)_ or R110C(O)NR10_~
and
c) C1-C( alkyl substituted by C1-C( perfluoroalkyl, 8100-,
R10C{O)NR10_~ (R10)2N-C(NR10)-, R10C(p)-,
-N(R10)2, or R110C(O)NR10_;
R~ is independently selected from
-50-
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
a) hydrogen,
b) unsubstituted or substituted aryl,
c) unsubstituted or substituted heterocycle,
d) unsubstituted or substituted cycloalkyl, and
e) C1-C( alkyl substituted with hydrogen or an
unsubstituted
or substituted group selected from aryl, heterocycle and
cycloalkyl;
wherein heterocycie is selected from pyrrolidinyl,
imidazolyl, pyridinyi, thiazolyl, pyridonyl, indolyl,
quinolinyl, isoquinolinyl, and thienyl;
Rg is independently selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C( alkenyl, C2-C( aikynyl, Cl-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10)_~ R10C(p)_~ _N(R10)2~ or
R110C(O)NR10_~ and
c) C1-C( alkyl substituted by C1-C6 perfluoroallcyl, 8100-,
R10C(p)NR10_~ (R10)2N_C(NR10)_~ R10C(O)->
-N(R10)2, or R110C(O)NR10_;
R 1 ~ is independently selected from hydrogen, C 1-C( alkyl, C 1-C(
perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
R 11 is independently selected from C 1-C6 alkyl and aryl;
R12 is independently selected from hydrogen, C1-C( alkyl, C1-C(
alkyl substituted with C02R10, Cl-C( alkyl substituted with
aryl, C1-C( alkyl substituted with substituted aryl, C1-C6 alkyl
substituted with heterocycle, Cl-C6 alkyl substituted with
substituted heterocycle, aryl and substituted aryl;
A3 is selected from: a bond, -C(O)NR~-, -NR~C(O)-, -S(O)2NR~-,
-51-
CA 02301880 2000-02-25
WO 99/10525 PCT/IJS98/17699
-NR~S(O)2- or -N(R~)-;
Z is independently H2 or O;
m is 0, 1 or 2; and
n is 0, 1, 2, 3 or
4;
p is 0, I, 2, 3 or
4;
q is 0 or 1; and
r is 0 to 3;
or the pharmaceutically acceptable salts thereof.
In a further embodiment of the formula A compounds
of this invention, the inhibitors of farnesyi-protein transferase are
illustrated by the formula A-i:
R2a R2b
/ /
R~,N-{CRib2~~/'
Rs
A_i O
wherein:
R 1 b is independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C(
aikenyl,
c) C 1-C( alkyl unsubstituted or substituted by aryl,
heterocycle, cycloalkyl, alkenyl, RI00-, or -N(RIO)2;
R2a and R2b are independently selected from:
a) hydrogen,
b) CI-C( alkyl unsubstituted or substituted by
C2-C( alkenyl, RI00-, R1IS(O)m-, R10C~0)NRIO_~
CN, N3, (R10)2N_C(NR10)_~ R10C(O)_~ RlOpC(O)_,
-N(RIO)2, or RI lOC(O)NRIO_~
-52-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
c) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, unsubstituted or
substituted cycloalkyl, alkenyl, 8100-,
Rlls{O)m-~ R10C(O)NR10_~ CN, N02
{R10)2N_C(NR10)_~ R10C{O)_, RlOpC(O)_~ N3~
-N(R10)2, halogen or R110C{O)NR10-, and
d) C 1-C6 alkyl substituted with an unsubstituted or
substituted group selected from aryl, heterocyclic and
C3-C 10 cycloalkyl;
R4 is
H
~N
N \~ Z
~CRIb ~ .
\ / { 2~P s
IJ
~R8)r
RS is hydrogen;
Rg is independently selected from:
a) hydrogen,
b) C1-C( alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C(
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C{NR10)_~ R10C(p)_~ _N(R10)2, or
R110C(O)NR10-, and
c) C1-C( alkyl substituted by C1-C6 perfluoroalkyl, 8100-,
R10C{O)NR10_~ (R10)2N_C{NR10)_~ R10C{O)-
-N{R10)2, or R110C(O)NR10_;
R10 is independently selected from hydrogen, C1-C( alkyl,
substituted or unsubstituted C1-C6 aralkyl and
substituted or unsubstituted aryl;
-53-
CA 02301880 2000-02-25
WO 99/10525 PC'T/US98/17699 -
R 11 is independently selected from C 1-C( alkyl, benzyl and aryl;
Z is H2 or O;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is independently 0, 1 or 2; and
r is 0 to 5;
or the pharmaceutically acceptable salts thereof.
Specific compounds which are inhibitors of prenyl-
protein transferases and are therefore useful in the present invention
include:
1-[2(R)-Amino-3-mercaptopropyl]-2(S)-[(3-pyridyl)methoxyethyl)]-
4-(1-naphthoyl)piperazine
1-[2(R)-Amino-3-mercaptopropyl]-2(S)-{benzyloxymethyl)-4-(1-
naphthoyl)piperazine
1-[2(R)-Amino-3-mercaptopropyl]-2(S)-(benzyloxymethyl)-4-[7-
(2,3-dihydrobenzofuroyl)]piperazine
1-[2(R)-Amino-3-mercaptopropyl]-2(S)-(benzamido)-4-(1-
naphthoyl)piperazine
1-[2(R)-Amino-3-mercaptopropyl]-2(S)-[4-(5-dimethylamino-1-
naphyhalenesulfonamido)-1-butyl]-4-( 1-naphthoyl)piperazine
N-[2(S)-(1-(4-Nitrophenylmethyl)-1H-imidazol-5-ylacetyl)amino-
3(S)-methylpentyl]-N-1-naphthylmethyl-glycyl-methionine
N-[2(S)-( 1-(4-Nitrophenylmethyl)-1 H-imidazol-5-ylacetyl)amino-
3(S)-methylpentyl]-N-1-naphthylmethyl-glycyl-methionine methyl
ester
-54-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
N-[2(S)-([1-(4-cyanobenzyl)-1H-imidazol-5-yl]acetylamino)-3(S)-
methylpentyl]-N-( 1-naphthylmethyl)glycyl-methionine
N-(2(S)-([ 1-(4-cyanobenzyl)-1H-imidazol-5-yl]acetylamino)-3(S)-
methylpentyl]-N-(1-naphthylmethyl)glycyl-methionine methyl ester
2(S)-n-Butyl-4-( 1-naphthoyl)-1-[ 1-(2-naphthylmethyl)imidazol-5-
ylmethyl]-piperazine
2(S)-n-Butyl-1-[1-(4-cyanobenzyl)imidazol-5-ylmethyl]-4-(1-
naphthoyl)piperazine
1- { [ 1-(4-cyanobenzyl)-1 H-imidazol-5-yl] acetyl } -2 ( S )-n-
butyl-4-(1-naphthoyl)piperazine
i5
1-(3-chlorophenyl)-4-[ 1-(4-cyanobenzyl)imidazolylmethyl]-2-
piperazinone
1-phenyl-4-[ 1-(4-cyanobenzyl)-1 H-imidazol-5-ylethyl]-piperazin-2-one
1-(3-trifluoromethylphenyl)-4- [ 1-(4-cyanobenzyl )-1 H-imidazol-5-
ylmethyl]-piperazin-2-one
1-(3-bromophenyl)-4- [ 1-(4-cyanobenzyl)-1 H-imidazol-5-ylmethyl]-
piperazin-2-one
5(S)-(2-[2,2,2-trifluoroethoxy]ethyl)-1-(3-trifluoromethylphenyl)- 4-[1-
(4-cyanobenzyl)-4-imidazolylmethyl]-piperazin-2-one
1-(5,6,7,8-tetrahydronaphthyi)-4-[1-(4-cyanobenzyl)-1H-imidazol-5-
ylmethyl]-piperazin-2-one
1-(2-methyl-3-chlorophenyl)-4- [ 1-(4-cy anobenzyl)-4-
imidazolylmethyl)]-piperazin-2-one
-55-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
2(RS)-{[1-(Naphth-2-ylmethyl)-1H-imidazol-5-yl)] acetyl}amino-3-(t-
butoxycarbonyl)amino- N-(2-methylbenzyl) propionamide
N- { 1-(4-Cyanobenzyl)-1 H-imidazol-5-ylmethyl } -4(R)-benzyloxy-2(S)-
{ N'-acetyl-N'-3-chlorobenzyl } aminomethylpyrrolidine
N-{ 1-(4-Cyanobenzyl)-1H-imidazol-5-ylethyl}-4(R)-benzyloxy-2(S)-
{ N'-acetyl-N'-3-chlorobenzyl } aminomethyl pyrrolidine
1-[1-(4-Cyanobenzyl)-1H-imidazol-5-ylacetyl] pyrrolidin-2(S)-
ylmethyl]-(N-2-methylbenzyl)-glycine N'-(3-chlorophenylmethyl) amide
1-[1-(4-Cyanobenzyl)-1H-imidazol-5-ylacetyl] pyrrolidin-2(S)-
ylmethyl]-(N-2-methylbenzyl)-glycine N'-methyl-N'-(3-
chlorophenylrnethyl) amide
(S)-2-[( 1-{4-Cyanobenzyl)-5-imidazolylmethyl)amino]-N
(benzyloxycarbonyl)-N-(3-chlorobenzyl)-4-
(methanesulfonyl)butanamine
1-(3,5-Dichlorobenzenesulfonyl)-3(S)-[N-(1-(4-cyanobenzyl) -1H-
imidazol-5-ylethyl)carbamoyl] piperidine
N- { [ 1-(4-Cyanobenzyl)-1 H-imidazol-5-yl]methyl }-4-(3-
methylphenyl)-4-hydroxy piperidine,
N-{ [1-(4-Cyanobenzyl)-1H-imidazol-5-yl]methyl}-4-(3-
chlorophenyl)-4 hydroxy piperidine,
4-[1-(4-cyanobenzyl)-5-imidazolylmethyl]-1-(2,3-dimethylphenyl)-
piperazine-2,3-dione
1-(2-(3-Trifluoromethoxyphenyl)-pyrid-5-ylmethyl)-5-{4-
cyanobenzyl)imidazole
-56-
CA 02301880 2000-02-25
WO 99/10525 PCf/US98/17699
4- { 5-[ 1-(3-Chloro-phenyl)-2-oxo-1,2-dihydro-pyridin-4-ylmethyl]-
imidazol-1-ylmethyl } -2-methoxy-benzonitrile
3(R)-3-[1-(4-Cyanobenzyl)imidazol-5-yl-ethylamino]-5-phenyl-1-
(2,2,2-trifluoroethyl)-H-benzo [e] [ 1,4] diazepine
3(S)-3-[1-(4-Cyanobenzyl) imidazol-5-yl]-ethylamino]-5-phenyl-1-
(2,2,2-trifluoroethyl)-H-benzo[e][1,4] diazepine
N-[ 1-(4-Cyanobenzyl)-1 H-imidazol-5-ylacetyl)pyrrolidin-2(S)-
ylmethyl]- N-(1-naphthylmethyl)glycyl-methionine
N-[ 1-(4-Cyanobenzyl)-1 H-imidazol-5-ylacetyl)pyrrolidin-2(S)-
ylmethyl]- N-(1-naphthylmethyl)glycyl-methionine methyl ester
N-[1-(1H-Imidazol-4-ylpropionyl)pyrrolidin-2(S)-ylmethyl]- N-(2-
methoxybenzyl)glycyl-methionine
N-[1-(1H-Imidazol-4-ylpropionyl)pyrrolidin-2(S)-ylmethyl]- N-(2-
methoxybenzyl)glycyl-methionine methyl ester
2(S)-(4-Acetamido-1-butyl)-1-[2(R)-amino-3-mercaptopropyl]-4-(1-
naphthoyl)piperazine
2(RS)-{[1-(Naphth-2-ylmethyl)-1H-imidazol-5-yl)] acetyl}amino-3-(t-
butoxycarbonyl)amino- N-cyclohexyl-propionamide
1-{ 2(R,S)-[1-(4-cyanobenzyl)-1H-imidazol-5-yl]propanoyl }-2(S)-n-
butyl-4-(1-naphthoyl)piperazine
1-[ 1-(4-cyanobenzyl)imidazol-5-ylmethyl]-4-
(diphenylmethyl)piperazine
3 5 1-(Diphenylmethyl)-3 (S )-[N-( 1-(4-cyanobenzyl)-2-methyl-1 H-
imidazol-5-ylethyl)-N-(acetyl)aminomethyl] piperidine
-57-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
N-[1-(1H-Imidazol-4-ylpropionyl)pyrrolidin-2(S)-ylmethyl]- N-(2-
chlorobenzyl)glycyl-methionine
N-[1-{1H-Imidazol-4-ylpropionyl)pyrrolidin-2(S)-ylmethyl]- N-(2-
chlorobenzyl)glycyl-methionine methyl ester
3(R)-3-[ 1-(4-Cyanobenzyl)imidazol-5-yl-methylamino]-5-phenyl-1-
(2,2,2-trifluoroethyl)-H-benzo[e] [ 1,4] diazepine
1-(3-trifluoromethoxyphenyl)-4-[1-(4-
cyanobenzyl)imidazolylmethyl]-2-piperazinone
1-(2,5-dimethylphenyl)-4-[1-{4-cyanobenzyl)imidazolylmethyl]-2-
piperazinone
1-(3-methylphenyl)-4-[ 1-(4-cyanobenzyl)imidazolylmethyl]-2-
piperazinone
1-(3-iodophenyl)-4-[ 1-(4-cyanobenzyl)imidazolylmethyl]-2-
piperazinone
30
1-(3-chlorophenyl)-4-[ 1-(4-cyano-3-
methoxybenzyl)imidazolylmethyl]-2-piperazinone
1-(3-trifluoromethoxyphenyl)-4-[ 1-(4-cyano-3-
methoxybenzyl)imidazolyl methyl]-2-piperazinone
4-[(( 1-(4-cyanobenzyl)-5-imidazolyl)methyl)amino]benzophenone
1-{1-{ [3-(4-cyano-benzyl)-3H-imidazol-4-yl]-acetyl}-pyrrolidin-
2(S)-ylmethyl)-3{S)-ethyl-pyrrolidine-2(S)-carboxylic acid 3-chloro-
benzylamide
or the pharmaceutically acceptable salt thereof.
_ ~8 _
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
Compounds within the scope of this invention previously
described as inhibitors of farnesyl-protein transferase but which have
been further identified by the instant assays as inhibitors of prenyl-
protein transferases and are therefore useful in the present invention,
and methods of synthesis thereof, can be found in the following
patents, pending applications and publications, which are herein
incorporated by reference:
U.S. Pat. No. 5,736,539 (April 7, 1998); WO 95/00497
(January 5, 1995)
U.S. Pat. No. 5,652,257 (July 29, 1997); WO 96/10034
(April 4, 1996)
WO 96/30343 (October 3, 1996); USSN 08/412,829 filed on
March 29, 1995; and USSN 08/470,690 filed on June 6, 1995; and
USSN 08/600,728 filed on February 28, 1996;
U.S. Pat. No. 5,661,161 (August 26, 1997);
U.S. Pat. No. 5,756,528 (May 6, 1998); WO 96/39137
(December 12, 1996);
WO 96/37204 (November 28, 1996); USSN 08/449,038 filed on
May 24, 1995; USSN 08/648,330 filed on May 15, 1996;
WO 97/18813 (May 29, 1997); USSN 08/749,254 filed on
November 15, 1996;
WO 97/38665 (October 23, 1997); USSN 08/831,308 filed on
April l, 1997;
WO 97/36889 (October 9, 1997); USSN 08/823,923 filed on
March 25, 1997;
WO 97/36901 (October 9, 1997); USSN 08/827,483 filed on
March 27, 1997;
WO 97/36879 (October 9, 1997); USSN 08/823,920 filed on
March 25, 1997;
WO 97/36605 (October 9, 1997); USSN 08/823,934 filed on
March 25, 1997;
WO 98/28980, (July 9, 1998); USSN 08/997,171 filed on
December 22, 1997; and
-59-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
USSN 60/014,791 filed on April 3, 1996; USSN 08/831,308,
filed on April 4, 1997.
All patents, publications and pending patent applications identified
are hereby incorporated by reference.
With respect to the compounds of formulas II-a through
II-n the following definitions apply:
The term "alkyl" refers to a monovalent alkane
(hydrocarbon) derived radical containing from 1 to 15 carbon atoms
unless otherwise defined. It may be straight, branched or cyclic.
Preferred straight or branched alkyl groups include methyl, ethyl,
propyl, isopropyl, butyl and t-butyl. Preferred cycloalkyl groups
include cyclopentyl and cyclohexyl.
When substituted alkyl is present, this refers to a
straight, branched or cyclic alkyl group as defined above, substituted
with 1-3 groups as defined with respect to each variable.
Heteroalkyl refers to an alkyl group having from 2-15
carbon atoms, and interrupted by from 1-4 heteroatoms selected
from O, S and N.
The term "alkenyl" refers to a hydrocarbon radical
straight, branched or cyclic containing from 2 to 15 carbon atoms
and at least one carbon to carbon double bond. Preferably one
carbon to carbon double bond is present, and up to four non-
aromatic (non-resonating) carbon-carbon double bonds may be
present. Examples of alkenyl groups include vinyl, allyl, iso-
propenyl, pentenyl, hexenyl, heptenyl, cyclopropenyl, cyclobutenyl,
cyclopentenyl, cyclohexenyl, 1-propenyl, 2-butenyl, 2-methyl-2-
butenyl, isoprenyl, farnesyl, geranyl, geranylgeranyl and the like.
Preferred alkenyl groups include ethenyl, propenyl, butenyl and
cyclohexenyl. As described above with respect to alkyl, the straight,
branched or cyclic portion of the alkenyl group may contain double
bonds and may be substituted when a substituted alkenyl group is
provided.
-60-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
The term "alkynyl" refers to a hydrocarbon radical
straight, branched or cyclic, containing from 2 to 15 carbon atoms
and at least one carbon to carbon triple bond. Up to three carbon-
carbon triple bonds may be present. Preferred alkynyl groups
include ethynyl, propynyl and butynyl. As described above with
respect to alkyl, the straight, branched or cyclic portion of the
alkynyl group may contain triple bonds and may be substituted
when a substituted alkynyl group is provided.
Aryl refers to aromatic rings e.g., phenyl, substituted
phenyl and like groups as well as rings which are fused, e.g.,
naphthyl and the like. Aryl thus contains at least one ring having
at least 6 atoms, with up to two such rings being present, containing
up to 10 atoms therein, with alternating (resonating) double bonds
between adjacent carbon atoms. The preferred aryl groups are
phenyl and naphthyl. Aryl groups may likewise be substituted as
defined below. Preferred substituted aryls include phenyl and
naphthyl substituted with one or two groups. With regard to the
farnesyl transferase inhibitors, "aryl" is intended to include any
stable monocyclic, bicyclic or tricyclic carbon rings) of up to 7
members in each ring, wherein at least one ring is aromatic.
Examples of aryl groups include phenyl, naphthyl, anthracenyl,
biphenyl, tetrahydronaphthyl, indanyl, phenanthrenyl and the like.
The term "heteroaryl" refers to a monocyclic aromatic
hydrocarbon group having 5 or b ring atoms, or a bicyclic aromatic
group having 8 to 10 atoms, containing at least one heteroatom,
O, S or N, in which a carbon or nitrogen atom is the point of
attachment, and in which one additional carbon atom is optionally
replaced by a heteroatom selected from O or S, and in which from
1 to 3 additional carbon atoms are optionally replaced by nitrogen
heteroatoms. The heteroaryl group is optionally substituted with
up to three groups.
Heteroaryl thus includes aromatic and partially aromatic
groups which contain one or more heteroatoms. Examples of this
type are thiophene, purine, imidazopyridine, pyridine, oxazole,
-61-
CA 02301880 2000-02-25
WO 99/10525 PC'fIUS98/17699
thiazole, oxazine, pyrazole, tetrazole, imidazole, pyridine,
pyrimidine, pyrazine and triazine. Examples of partially aromatic
groups are tetrahydroimidazo[4,5-c]pyridine, phthalidyl and
saccharinyl, as defined below.
With regard to the farnesyl transferase inhibitors, the
term heterocycle or heterocyclic, as used herein, represents a stable
5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic
or stable 11-15 membered tricyclic heterocycle ring which is either
saturated or unsaturated, and which consists of carbon atoms and
from one to four heteroatoms selected from the group consisting of
N, O, and S, and including any bicyclic group in which any of the
above-defined heterocyclic rings is fused to a benzene ring. The
heterocyclic ring may be attached at any heteroatom or carbon atom
which results in the creation of a stable structure. Examples of such
heterocyclic elements include, but are not limited to, azepinyl,
benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl,
benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl,
benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydro-
benzothienyl, dihydrobenzothiopyranyl, dihydrobenzothio-pyranyl
sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl,
indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl,
isothiazolyl, isothiazolidinyl, morpholinyl, naphthyridinyl,
oxadiazolyl, 2-oxoazepinyl, 2-oxopiperazinyl, 2-oxopiperidinyl,
2-oxopyrrolidinyl, piperidyl, piperazinyl, pyridyl, pyridyl N-oxide,
pyridonyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyrimidinyl,
pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinolinyl N-oxide,
quinoxalinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydro-
quinolinyl, thiamorpholinyl, thiarnorpholinyl sulfoxide, thiazolyl,
thiazolinyl, thienofuryl, thienothienyl, and thienyl. Preferably,
heterocycle is selected from imidazolyl, 2-oxopyrrolidinyl,
piperidyl, pyridyl and pyrrolidinyl.
With regard to the farnesyl transferase inhibitors, the
terms "substituted aryl", "substituted heterocycle" and "substituted
cycloalkyl" are intended to include the cyclic group which is
-62-
CA 02301880 2000-02-25
WO 99/10525 PGTNS98/17699
substituted with 1 or 2 substituents selected from the group which
includes but is not limited to F, Cl, Br, CF3, NH2, N(C1-C( alkyl)2,
N02, CN, (Cl-C6 alkyl)O-, -OH, (C1-C6 alkyl)S(O)m-, (C1-C(
alkyl)C(O)NH-, H2N-C(NH)-, (C1-C( alkyl)C(O)-, (C1-C(
alkyl)OC(O)-, N3,(C1-C( alkyl)OC(O)NH- and C1-C2p alkyl.
In the present method, amino acids which are disclosed
are identified both by conventional 3 letter and single letter
abbreviations as indicated below:
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic acid Asp D
Asparagine or
Aspartic acid Asx B
Cysteine Cys C
Glutamine Gln Q
Glutamic acid Glu E
Glutamine or
Glutamic acid Glx Z
Glycine Gly G
Histidine His H
Isoleucine Ile I
Leucine Leu L
Lysine Lys
Methionine Met M
Phenylalanine Phe F
Proline Pro
Serine Ser S
Threonine Thr T
Tryptophan Trp
Tyrosine Tyr
V alive V al V
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/1?699 -
With respect to the term "CAAX" the letter "A" represents an
aliphatic amino acid and is not limited to alanine.
The compounds used in the present method may have
asymmetric centers and occur as racemates, racemic mixtures, and as
individual diastereomers, with all possible isomers, including optical
isomers, being included in the present invention. Unless otherwise
specified, named amino acids are understood to have the natural "L"
stereoconfiguration
When RZ and R3 are combined to form - (CH2)u -,
cyclic moieties are formed. Examples of such cyclic moieties
include, but are not limited to:
's' 'Z; '~ 'ii,
..'. '',,
In addition, such cyclic moieties may optionally include
a heteroatom(s). Examples of such heteroatom-containing cyclic
moieties include, but are not limited to:
,,, ,,, ..,,. ..',,
J J J
O s
'.~ ~: .~ ~.
,,, ,,,
J
p~~~ N
CORIo
When R6 and R~, R~ and Rya, or are combined to form
- (CH2)u -, cyclic moieties are formed. Examples of such cyclic
moieties include, but are not limited to:
CA 02301880 2000-02-25
WO 99/10525 PCf/US98/17699
~~' ~.;
.,
The pharmaceutically acceptable salts of the compounds
of this invention include the conventional non-toxic salts of the
compounds of this invention as formed, e.g., from non-toxic
inorganic or organic acids. For example; such conventional
non-toxic salts include those derived from inorganic acids such as
hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric
and the like: and the salts prepared from organic acids such as
acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric,
citric, ascorbic, pamoic, malefic, hydroxymaleic, phenyl-acetic,
glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric,
toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic,
isethionic, trifluoroacetic and the like.
It is intended that the definition of any substituent or
variable (e.g., R10, Z, n, etc.) at a particular location in a molecule
be independent of its definitions elsewhere in that molecule. Thus,
-N(R10)2 represents -NHH, -NHCH3, -NHC2H5, etc. It is under-
stood that substituents and substitution patterns on the compounds of
the instant invention can be selected by one of ordinary skill in the
art to provide compounds that are chemically stable and that can be
readily synthesized by techniques known in the art as well as those
methods set forth below.
The pharmaceutically acceptable salts of the compounds
of this invention can be synthesized from the compounds of this
invention which contain a basic moiety by conventional chemical
methods. Generally, the salts are prepared by reacting the free base
with stoichiometric amounts or with an excess of the desired salt-
forming inorganic or organic acid in a suitable solvent or various
combinations of solvents.
-65-
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
The compounds used in the methods of the instant invention
are useful in various pharmaceutically acceptable salt forms. The term
"pharmaceutically acceptable salt" refers to those salt forms which
would be apparent to the pharma-ceutical chemist. i.e., those which are
substantially non-toxic and which provide the desired pharmacokinetic
properties, palatability, absorption, distribution, metabolism or
excretion. Other factors, more practical in nature, which are also
important in the selection, are cost of the raw materials, ease of
crystallization, yield, stability, hygroscopicity and flowability of
the resulting bulk drug. Conveniently, pharmaceutical compositions
may be prepared from the active ingredients in combination with
pharmaceutically acceptable carriers.
Pharmaceutically acceptable salts include conventional
non-toxic salts or quarternary ammonium salts formed, e.g., from
non-toxic inorganic or organic acids. Non-toxic salts include those
derived from inorganic acids such as hydrochloric, hydrobromic,
sulfuric, sulfamic, phosphoric, nitric and the like; and the salts
prepared from organic acids such as acetic, propionic, succinic,
glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic,
sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic,
methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic
and the like.
The pharmaceutically acceptable salts of the present
invention can be synthesized by conventional chemical methods.
Generally, the salts are prepared by reacting the free base or acid
with stoichiometric amounts or with an excess of the desired salt-
forming inorganic or organic acid or base, in a suitable solvent or
solvent combination.
Abbreviations used in the description of the chemistry
and in the Examples that follow are:
Ac20 Acetic anhydride;
Boc t-Butoxycarbonyl;
DBU 1,8-diazabicyclo[5.4.OJundec-7-ene;
- 66 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
DMAP 4-Dimethylaminopyridine;
DME 1,2-Dimethoxyethane;
DMF Dimethylformamide;
EDC 1-(3-dimethylaminopropyl)-3-ethyl-carbodiimide-
hydrochloride;
HOBT 1-Hydroxybenzotriazole hydrate;
Et3N Triethylamine;
EtOAc Ethyl acetate;
FAB Fast atom bombardment;
HOOBT 3-Hydroxy-1,2,2-benzotriazin-4(315n-one;
HPLC High-performance liquid chromatography;
MCPBA m-Chloroperoxybenzoic acid;
MsCI Methanesulfonyl chloride;
NaHIVmS Sodium bis(trimethylsilyl)amide;
Py Pyridine;
TFA Trifluoroacetic acid;
THF Tetrahydrofuran.
The farnesyl transferase inhibitors of formula I can be
synthesized in accordance with Schemes 1-11, in addition to other
standard manipulations such as ester hydrolysis, cleavage of protecting
groups, etc., as may be known in the literature or exemplified in the
experimental procedures. Substituents R, Ra and Rb, as shown in the
Schemes, represent the substituents R2, R3, R4, and R5 ~ however their
point of attachment to the ring is illustrative only and is not meant to be
limiting.
These reactions may be employed in a linear sequence
to provide the compounds of the invention or they may be used to
synthesize fragments which are subsequently joined by the alkylation
reactions described in the Schemes.
Svnovsis of Schemes 1-11:
The requisite intermediates are in some cases commercially
available, or can be prepared according to literature procedures, for the
most part.
- 67 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
Piperazin-5-ones can be prepared as shown in Scheme i .
Thus, the protected suitably substituted amino acid IV can be converted
to the corresponding aldehyde V by first forming the amide and then
reducing it with LAH. Reductive amination of Boc-protected amino
aldehydes V gives rise to compound VI. The intermediate VI can be
converted to a piperazinone by acylation with chloroacetyl chloride to
give VII, followed by base-induced cyclization to VIII. Deprotection,
followed by reductive alkylation with a protected imidazole carboxalde-
hyde leads to IX, which can be alkylated with an arylmethylhalide to
give the imidazolium salt X. Final removal of protecting groups by
either solvolysis with a lower alkyl alcohol, such as methanol, or
treatment with triethylsilane in methylene chloride in the presence
of trifluoroacetic acid gives the final product XI.
The intermediate VIII can be reductively alkylated with a
variety of aldehydes, such as XII. The aldehydes can be prepared by
standard procedures, such as that described by O. P. Goel, U. Krolls,
M. Stier and S. Kesten in manic Syntheses, 1988, 67, 69-75, from
the appropriate amino acid (Scheme 2). The reductive alkylation can
be accomplished at pH 5-7 with a variety of reducing agents, such as
sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent
such as dichloroethane, methanol or dimethylformamide. The product
XIII can be deprotected to give the final compounds XIV with trifluoro-
acetic acid in methylene chloride. The final product XIV is isolated
in the salt form, for example, as a trifluoroacetate, hydrochloride or
acetate salt, among others. The product diamine XIV can further be
selectively protected to obtain XV, which can subsequently be
reductively alkylated with a second aldehyde to obtain XVI. Removal
of the protecting group, and conversion to cyclized products such as the
dihydroimidazole XVII can be accomplished by literature procedures.
Alternatively, the imidazole acetic acid XVIII can be
converted to the acetate XIX by standard procedures, and XIX can be
first reacted with an alkyl halide, then treated with refluxing methanol
to provide the regiospecifically alkylated imidazole acetic acid ester XX
- 68 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
(Scheme 3). Hydrolysis and reaction with piperazinone VIII in the
presence of condensing reagents such as 1-(3-dimethylaminopropyl)-
3-ethylcarbodiimide (EDC) leads to acylated products such as XXI.
If the piperazinone VIII is reductively alkylated with an
aldehyde which also has a protected hydroxyl group, such as XXII
in Scheme 4, the protecting groups can be subsequently removed
to unmask the hydroxyl group (Schemes 4, 5). The alcohol can be
oxidized under standard conditions to e.g. an aldehyde, which can then
be reacted with a variety of organometallic reagents such as Grignard
reagents, to obtain secondary alcohols such as XXIV. In addition, the
fully deprotected amino alcohol XXV can be reductively alkylated
(under conditions described previously) with a variety of aldehydes to
obtain secondary amines, such as XXVI (Scheme 5), or tertiary amines.
The Boc protected amino alcohol XXIII can also be utilized
to synthesize 2-aziridinylmethylpiperazinones such as XXVII (Scheme
6). Treating XXIII with 1,1'-sulfonyldiimidazole and sodium hydride
in a solvent such as dimethylformamide led to the formation of aziridine
XXVII. The aziridine reacted in the presence of a nucleophile, such as a
thiol, in the presence of base to yield the ring-opened product XXVIII.
In addition, the piperazinone VIII can be reacted with
aldehydes derived from amino acids such as O-alkylated tyrosines,
according to standard procedures, to obtain compounds such as XXX
(Scheme 7). When R' is an aryl group, XXX can first be hydrogenated
to unmask the phenol, and the amine group deprotected with acid to
produce XXXI. Alternatively, the amine protecting group in XXX can
be removed, and O-alkylated phenolic amines such as XXXII produced.
Scheme 8 illustrates the use of an optionally substituted
homoserine lactose XXXIII to prepare a Boc-protected piperazinone
XXXVII. Intermediate XXXVII may be deprotected and reductively
alkylated or acylated as illustrated in the previous Schemes.
Alternatively, the hydroxyl moiety of intermediate XXXVII may be
mesylated and displaced by a suitable nucleophile, such as the sodium
salt of ethane thiol, to provide an intermediate XXXVIII. Intermediate
- 69 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
XXXVII may also be oxidized to provide the carboxylic acid on
intermediate IXL, which can be utilized form an ester or amide moiety.
N-Aralkyl-piperazin-5-ones can be prepared as shown in
Scheme 9. Reductive amination of Boc-protected amino aldehydes V
(prepared from III as described previously) gives rise to compound XL.
This is then reacted with bromoacetyl bromide under Schotten-Baumann
conditions; ring closure is effected with a base such as sodium hydride
in a polar aprotic solvent such as dimethylformamide to give XLI. The
carbamate protecting group is removed under acidic conditions such as
trifluoroacetic acid in methylene chloride, or hydrogen chloride gas in
methanol or ethyl acetate, and the resulting piperazine can then be
carried on to final products as described in Schemes 1-7.
The isomeric piperazin-3-ones can be prepared as described
in Scheme 10. The imine formed from arylcarboxamides XLII and
i 5 2-aminoglycinal diethyl acetal (XLIII) can be reduced under a variety of
conditions, including sodium triacetoxyborohydride in dichloroethane,
to give the amine XLIV. Amino acids I can be coupled to amines XLIV
under standard conditions, and the resulting amide XLV when treated
with aqueous acid in tetrahydrofuran can cyclize to the unsaturated
XLVI. Catalytic hydrogenation under standard conditions gives the
requisite intermediate XLVII, which is elaborated to final products
as described in Schemes 1-7.
Amino acids of the general formula IL which have a
sidechain not found in natural amino acids may be prepared by the
reactions illustrated in Scheme 11 starting with the readily prepared
imine XLVIII.
- 70 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 1
O Ra O Ra
OH H ~ HCI ~O~ N N(CH3)OCH3
O N CH3NHOC 3
H O EDC . HCi, HOBT H O
IV DMF, Et3N, pH 7
R R H
LAH, Et20 ~CHO ArNH2
BocNH ~ N ~Ar
BocNH NaBH(OAc)3
V CICH2CH2C1 VI
O
CI BocNH N-Ar NaH BocN N-Ar HCI
~CI --
O DMF p EtOAc
EtOAc / H20 CI
NaHC03 VII VIII
- 71 -
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
SCHEME 1 (continued)
CHO
R
R
N N-Ar
HCI~HN~ -Ar C(Ph)3
/ O
O NaBH(OAc)3 'N
CICH2CH2C1 (Ph)3C IX
VIII
pH 5-6
R
Ar-~ ~ -Ar
ArCH2X N
CH3CN ~ ~ ' ~ O
NIX
(Ph)3C
X
R
MeOH
or Ark N, N-Ar
~---~N
TFA, CH2C1 ~_ _ 1 O
(C2H5)3SIH
XI
- 72 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 2
Boc NH XII
R
Boc NH CHO
HChH~N-Ar
NaBH(OAc)3
O Et3N , CICH2CH2C1
VIII
R
N~N-Ar CFsC02H
Boc NH
CH2CI2
O
NHBoc XIII
R
Boc20
NH2 N~ -Ar -
- \\ CH2CI2
NH2 O
XIV
~ CHO
R
BocNH~N~ -Ar NaBH(OAc)3
Et3N , CICH2CH2CI
NH2 O
XV
- 73 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/1'7699
SCHEME 2 (continued
R
CF3C02H, CH2Ci2;
BocNH N N-Ar
NaHC03
NH O
XVI
R
NH2 N N-Ar ~ NC
NH O AgCN Q
R
N N-Ar
NON O
\ XVII
- 74 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 3
CH2C02H N CH2C02CH3
CH30H
HCI H ~ HCI
XIX
CH2C02CH3 1 ) ArCH2X CH3CN
(C6H5)3Cgr ~~ reflux
(C2H5)3N N 2) CH30H, reflux
DMF Tr
XIX
Ar'~N CH2C02CH3 2.5N HClaq ,
55°C
N
Ark CH2C02H
N
XX
- 75 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
~,CHEME 3 (continued)
R
Ar~N CH2C02H
HCI ~ H N N-Ar
N
O
XX
VIII
EDC ~ HCI
HOBt
DMF
Ar R
O
N N-Ar
N O
XXI
- 76 -
CA 02301880 2000-02-25
WO 99110525 PCT/US9$/17699
SCHEME 4
R NaBH(OAc)3
Et3N , CICH2CH2C1
HCI HN N-Ar
Bn0
O
VIII BocNH CHO
XXI I
R
20% Pd(OH)2 H2
BnO~N~ -Ar
CH30H
NHBoc O CH3C02H
R
CICOCOCI
HO~N~ -Ar
DMSO CH2CI2
NHBoc O (C2H5)3N
XXIII
R
R
1. R'MgX
O N N-Ar (C2H5)20 HO N, N-Ar
2. TFA R' NH2 .-.- O
H NHBoc O CH2Ci2
XXIV
_ 77 _
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
SCHEME 5
R
--1 CF3C02H
HO~ ~ -Ar
CH2CI2
NHBoc O
XXIII
R
R'CHO
HO~ ~ -Ar
NaBH(OAc)3
NH2 O CICH2CH2CI
XXV
R
HO~ ~ -Ar
~N H O
R'CH2
XXVI
_ 78 _
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 6
H
R N=~ ~= N
~N~ S.N J
HO~N~ -Ar
~..~NHBoc~O NaH, DMF 0°C
XXIII
R R
N' N-Ar R~SH R~S N. N-Ar
O ~C2Hs)sN NH O
H CH OH
s ~ XXVIII
XXVII
SCHEME 7
HO / HO
1 ) Boc20, K2C03
THF-H20
H N CO H 2) CH2N2, EtOAc
2 2 BocNH C02CH3
HO
t_iAIH4 w I R'CH2X
TH F Cs2C03
0-20°C BocNH CH20H DMF
R'CH O
R CH O / I pyridine ~ S03
''' DMSO
BocNH CH OH ~C2H5)3N BocNH CHO
20°C
- 79 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 7 (continued)
R'CH20 / R
HCI ~ HN N-Ar
BocNH CHO O
XXIX VIII
NaBH(OAc)3
CICH2CH2C1
R
N N-Ar
R'CH20
O
NHBoc
XXX HCI
ETOAc
1 ) 20% Pd(OH)2
CH30H, CH3C02H
R
2) HCI, EtOAc
N N-Ar
R'CH20
NH2 O
-- R
N N-Ar
HO
NH2 O
XXXI
XXXII
- 80 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 8
su 1~ 1. Boc20, i-Pr2EtN su \-\
O O
H2N p 2. DIBAL BocHN
OH
HCI
XXXIII OH
~/ sub
H
ArNH2 ~ N
BocNH Ar
NaBH(OAc)3
CICH2CH2CI XXXIV
H ~~ ub
O
CI.~'~CI BocNH N-Ar
EtOAc / H20
NaHC03 CIO
XXXV
H ~~ ub
Cs C03
BocN N-Ar
DMF
O
XXXVI
- 81 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 8 (continued)
H ~~ ub
BocN N-Ar
O 1. (COCI)2, Et3N
DMSO
1. MsCI, iPr2NEt XXXVI
2. NaCl02, t-BuOH
2. NaSEt, DMF 2-Me-2-butane
NaH2P04
EtS sub HO ~ ub
BocN N-Ar
Boc ~ -Ar
O O
XXXVI I I IXL
- 82 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 9
Ra ArCH2NH2
~O N H NaBH(OAc)3'
H O CICH2CH2CI
pH 6
Ra 1 ) BrCH2COBr
NHCH2Ar EtOAc, H20, NaHC03
O N
H 2) NaH, THF, DMF
XL
Ra
O ~ 1 ) TFA, CH2C12
-N N--~
--O ~---~ Ar
O
XLI
Ra
HN~ --~
Ar
O
- 83 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 10
ArCHO + NH2CH2CH(OC2H5)2 NaBH(OAc)3
XLII XLIII O Ra
~O~ N OH
NHCH CH OC H
Ar CH2 2 ( 2 5)2
I H O
XLIV EDC . HCI, HOBT
DMF, Et3N, pH 7
O Ra ~Ar 6N HCI
~O~ N N~CH(OC2H5)z THF
H 0
XLV
R ~ H2 10%PdlC
O
CH30H
N
V~
0 Ar
XLVI
Ra O
O
y--N N--~
p ~---~ Ar
XLVI1
- 84 -
CA 02301880 2000-02-25
WO 99/10525 PC'T/US98/17699
SCHEME 11
1. KOtBu, THF R2
~- C02Et R2X ~'- C02Et
_N -_ H2N
Phi 2. 5% aqueous HCI HCI
XLVI I I
1. Boc20, NaHC03 R2
~-- C02H
BocHN
2. LiAIH4, Et20
IL
Reactions used to generate the compounds of the formula
(II) are prepared by employing reactions as shown in the Schemes 16-
37, in addition to other standard manipulations such as ester hydrolysis,
cleavage of protecting groups, etc., as may be known in the literature or
exemplified in the experimental procedures. Substituents Ra and Rb, as
shown in the Schemes, represent the substituents R2, R3, R4, and R5~
substituent "sub" represents a suitable substituent on the substituent Z.
The point of attachment of such substituents to a ring is illustrative only
and is not meant to be limiting.
These reactions may be employed in a linear sequence
to provide the compounds of the invention or they may be used to
synthesize fragments which are subsequently joined by the alkylation
reactions described in the Schemes.
Svnonsis of Schemes 16-37:
The requisite intermediates utilized as starting material in
the Schemes hereinbelow are in some cases commercially available, or
can be prepared according to literature procedures. In Scheme 16, for
example, a suitably substituted Boc protected isonipecotate LI may be
- 85 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
deprotonated and then treated with a suitably substituted alkylating
group, such as a suitably substituted benzyl bromide, to provide the
gem disubstituted intermediate LIII. Deprotection and reduction
provides the hydroxymethyl piperidine LIV which can be utilized is
synthesis of compounds of the invention or which may be nitrogen-
protected and methylated to give the intermediate LV.
As shown in Scheme 17, the protected piperidine
intermediate LIII can be deprotected and reductively alkylated with
aldehydes such as 1-trityl-4-imidazolyl-carboxaldehyde or 1-trityl-
4-imidazolylacetaldehyde, to give products such as LVI. The trityl
protecting group can be removed from LVI to give LVII, or
alternatively, LVI can first be treated with an alkyl halide then
subsequently deprotected to give the alkylated imidazole LVIIi.
The deprotected intermediate LIII can also be reductively
alkylated with a variety of other aldehydes and acids as shown above in
Schemes 4-7.
An alternative synthesis of the hydroxymethyl intermediate
LIV and utilization of that intermediate in the synthesis of the instant
compounds which incorporate the preferred imidazolyl moiety is
illustrated in Scheme 18. Scheme 19 illustrates the reductive alkylation
of intermediate LIV to provide a 4-cyanobenzylimidazolyl substituted
piperidine. The cyano moiety may be selectively hydrolyzed with
sodium borate to provide the corresponding amido compound of the
instant invention.
Scheme 20 alternative preparation of the methyl ether
intermediate LV and the alkylation of LV with a suitably substituted
imidazolylmethyl chloride to provide the instant compound. Prepara-
tion of the homologous 1-(imidazolylethyl)piperidine is illustrated in
S cheme 21.
Specific substitution on the piperidine of the compounds
of the instant invention may be accomplished as illustrated in Scheme
22. Thus, metal-halogen exchange coupling of a butynyl moiety to an
isonicotinate, followed by hydrogenation, provides the 2-butylpiperidine
- 8b -
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
intermediate that can then undergo the reactions previously described to
provide the compound of the instant invention.
Incorporation of a 4-amido moiety for LV is illustrated in
Scheme 23.
Scheme 24 illustrates the synthesis of the instant
compounds wherein the moiety Z is attached directly to the piperidine
ring. Thus the piperidone LIX is treated with a suitably substituted
phenyl Grignard reagent to provide the gem disubstituted piperidine
LX. Deprotection provides the key intermediate LXI. Intermediate
LXI may be acetylated as described above to provide the instant
compound LXII {Scheme 25).
As illustrated in Scheme 26, the protected piperidine
LX may be dehydrated and then hydroborated to provide the 3-
hydroxypiperidine LXIII. This compound may be deprotected and
further derivatized to provide compounds of the instant invention
(as shown in Scheme 27) or the hydroxyl group may be alkylated,
as shown in Scheme 26, prior to deprotection and further manipulation.
The dehydration product may also be catalytically reduced
to provide the des-hydroxy intermediate LXV, as shown in Scheme 28,
which can be processed via the reactions illustrated in the previous
Schemes.
Schemes 29 and 30 illustrate further chemical manipula-
tions of the 4-carboxylic acid functionality to provide instant compounds
wherein the substituent Y is an acetylamine or sulfonamide moiety.
Scheme 31 illustrates incorporation of a nitrite moiety in
the 4-position of the piperidine of the compounds of formula II. Thus,
the hydroxyl moiety of a suitably substituted 4-hydroxypiperidine is
substituted with nitrite to provide intermediate LXVI, which can
undergo reactions previously described in Schemes 17-21.
Scheme 32 illustrates the preparation of several pyridyl
intermediates that may be utilized with the piperidine intermediates
such as compound LI in Scheme 16 to provide the instant compounds.
Scheme 33 shows a generalized reaction sequence which utilizes such
pyridyl intermediates.
_ 87 _
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
Compounds of the instant invention wherein X 1 is a
carbonyl moiety may be prepared as shown in Scheme 34. Inter-
mediate LXVII may undergo subsequent reactions as illustrated in
Schemes 17-21 to provide the instant compounds. Preparation of the
S instant compounds wherein X 1 is sulfur in its various oxidation states
is shown in Scheme 3S. Intermediates LXVIII-LXXI may undergo
the previously described reactions to provide the instant compounds.
Scheme 36 illustrated preparation of compounds of the
formula A wherein Y is hydrogen. Thus, suitably substituted
isonipecotic acid may be treated with N,O-dimethylhydroxylamine
and the intermediate LXXII reacted with a suitably substituted phenyl
Grignard reagent to provide intermediate LXXIII. That intermediate
may undergo the reactions previously described in Schemes 17-21 and
may be further modified by reduction of the phenyl ketone to provide
1 S the alcohol LXXIV .
Compounds of the instant invention wherein X 1 is an
amine moiety may be prepared as shown in Scheme 37. Thus the
N-protected 4-piperidinone may be reacted with a suitably substituted
aniline in the presence of trimethylsilylcyanide to provide the 4-cyano-
4-aminopiperidine LXXV. Intermediate LXXV may then be converted
in sequence to the corresponding amide LXXVI, ester LXXVII and
alcohol LXXVIII. Intermediates LXXVI-LXXVIII can be deprotected
and can then undergo the reactions previously described in Schemes
17-21 to provide the compounds of the instant invention.
2S
_ 88 _
*rB
CA 02301880 2000-02-25
WO 99/IOSZS PCT/US98/17699
SCHEME 16
Ra
O ~-)'~ 1. LDA, -78°C
~--N~ ~C02CH3
LI Rb /~ Br
sub LII
Ra
O ~-I C02CH3 1 HCI CH CI
~N ) ~ 2 2
O ~-I ~ ~ 2) LiAIHa
Rb
LIII sub
OH 1 ) (goc)20, Et3N
HN
2) NaH, CH31
LIV R ~ sub
a
OCH3
O
b '
LV R sub
- 89 -
CA 02301880 2000-02-25
WO 99/1OS25 PCT/US98/17b99 -
SC~~ 17
Ra 1. HCI
O '-I C02CH3 2. NaBH(OAc)3
N Et3N , CICH2CH2CI
O ~ ~ ~ (CH )nCHO
Rb \ 2
LIII sub
N
Ra Tr
I C02CH3
CH2)n~ N~
N
R J
N ~VI \ sub
Tr 1 ) Ar CH2X, CH3CN
CF3C02H, CH2CI2 2) CF3C02H, CH2C1~
(C2Hs)sSiH (C2Hs)sSiH
Ra
CO2CH3
( H2)n~ N~
N lb r v
R ~ sub
N
H LVI I
Ra
Ar--~ ( I.'12)n~ N~
N Ib
R
N LVIII sub
- 90 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 18
Ra
O ~-I NaHMDS
~--N C02Et ---
p Br
~ I
Sub
Ra
O ~-~ C02Et
N LiAlH4
O
Sub
Ra
O ~-) OH
N HCI, CH2CI2
O
Sub
R8
Ra \ C02H
OH ~ ~ N n
HCI~HN
I N
LIV Sub EDC, HOAt
Ra
O ~-~ OH
N
N ~ ~n
N Sub
- 91 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 19
Ra NC ~ ~ CHC
OH N
HCI~HN ~ \
Rs~ N
LIV Sub NaCNBH3
Ra
OH
NC ~ ~ N
Rs~ \
N Sub
Ra
OH
H2NOC ~ ~ N
\
R N
Sub
- 92 -
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
SC~;~,EME 20
Ra
O ~- OH ICFi, ~CI"'13~25~4
~-- N
o ~ ~~
Sub
Ra
O 'I OCH3
--N HCI, EtOAc
O
LV Sub
R8 _
CI
N
R~ N
Sub iPr2NEt
Ra
R8 ~-I OCH3
N
N
R1~N
Sub
- 93 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 21
Ra
O,, ~-~ C02R
-- N HCI, EtOAc
o \ ~~
R = CH3, CH3CH2 Sub
R8
Ra ~ ~ OH
C02R
HCI~HN
Sub (CF3SO2)20
Ra
R8 ~~ C02R
N
\ ~ N \-
N Sub
- 94 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98I17699
SCHEME 22
N~ ~ C02CH3 Cu(I)I N' ~ C02CH3
CI ~--=- /
Br
1. H2, Pt20 O C02CH3 ~ ~~ sub
N
2. (Boc)20 O H NaHMDS
O 1. HCI, EtOAc
iPr2NEt
O
sub R8/ ~ N CI
N
C02CH3
N
R N ~ ~7
~~ sub
N
- 95 -
CA 02301880 2000-02-25
WO 99/IOSZS PCT/US98/1'7699
SCHEME 23
Ra
1. (Boc)20
HN C02H
2. BnOH, EDC
~ a O BC
~--N
O O Sub
NaHMDS
Ra O
O /-I O \ / 1. H2, Pd/C
-N
O ~ 2. NH4C1, EDC
Sub
O
O ~-J NH2
~---N
O
Sub
- 96 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 24
sub ,
O MgBr
--N'~O
O
LIX
p OH HCI OH
\\ _ N H N
--O~ ~ i
\ ~ ~ sub
-'' sub LXI
LX
SCHEME 25
OH
H-N
LXI --_' sub
Ar N ' CH2C02H EDC ~ HCI
L HOBt
N DMF
Ar~ O
OH
N
/ \
N
-~"'''- sub
LXI I
- 97 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 26
1. POC13, pyridine
OH _
N
O 2. BH3, H2O2
NaOH
J~''- sub
LX
OH 1. NaH, CH31
sub
T~N
O 2. HCI
LXIII
OCH3
sub
H_N
LXIV
- 98 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 27
OH
O / sub HCI
N
~--O
LXIII
OH NaBH(OAc)3
sub Et3N , CICH2CH2CI
H_N
(CH2)nCHO
N
Tr
OH
sub
CH2)n+1 N "",
N
Tr
- 99 -
CA 02301880 2000-02-25
W0 99/10525 PCT/US98/17699
SCHEME 28
1. POC13, pyridine
O\\ - OH _
TN
O / ~ 2. H2, Pd/C
LX = '~ sub
0 / sub HCI
~N ~ ~
-~-O
LXV
Ar~ CH2C02H
sub
H N
EDC ~ HCI
HOBt
DMF
Ar\ O / sub
N
N
- 100 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 29
a O
O R
Ra (Boc)20 OH
Aq NaOH
~OH O N.~
HN
O R
Rb
O 1. Na HMDS
Benzyl alcohol R ~ O ~ 2. benzyl bromide
EDC, DMAP
O N
O Rb
H2
5% Pd on C
sub
O Rb
Ra HO O /
,J
O N sub
O Rb
- 101 -
CA 02301880 2000-02-25
W0 99/10525 PCT/US98/17699
SCHEME 29 fcontinuedl
HO O / DPPA
R ~ NEt3 Re NH2
\
O~N~.' sub O~N~~ sub
Rb ~ II \Rb
O
H3C NH
Ra ~ I HCI
O~N~~ sub
,Rb
O
O N (CH2)nCHO
H3C NH N
R ~ ~ ~ Tr
NaBH(OAc)3
HN~' sub Et3N , CICH2CH2CI
Rb
O
HOC
Ra NH
_-
(CH2)n+1 N~..
N
R sub
N
Tr
- 102 -
CA 02301880 2000-02-25
WO 99/1OS25 PCT/US98/17699 -
SCHEME 30
O
~~ O
Ra NH2 ~ MsCI HsC~"S~
Py R ~ NH y
O N sub
O N~\ sub
O R ~ ~ Rb
O
O
H3C~~ I/O
HCI
Ra\ NH
r\
HCI ~ HN ~ ub
s
Rb
- 103 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
Ra Ra
OH (Boc)20 O ~I OH 1. MsCI
HN ~-N
H O H 2. KCN
Ra
O ~-~ CN NaHMDS
-N
O H Br
LXV I \
Sub
O-,
HCI, EtOAc
O
Sub
Ra
CN
HCI~HN
Sub
- 104 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 32
'O
N- m-CPBA N+. 1. (CF3C02)2
H3C ~ ~ H3C
2. Na2C03, H20
CH3 CH3
HO N- SOCI2 CI N-
CH3 CH3
HO SOCI2 CI
N~ N
CH3 CH3
CI CI
LiAIH4 HO
H02C ~ ~ N ~ ~ N
CH3 CH3
CI
SOC12 CI
~N
CH3
- 105 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 32 (continued
N- LiAIH~ HO N-
H3C02C ~ /
/
CI Ci
SOC12 CI N-
/
CI
+Na'
/ \
m-CPBA
HsC N-\ HsC N
CI 'O CI
HO
H3C ~ + / 1. Ac20 ~ /
O ,~ N
O
/ ~ 2. NaOH
/
CI
SOC12 N
O
- 106 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 33
CI
o I a ~ IJ
--N C02Et Sub
O
NaHMDS
O,,
LiAIH4
O
Sub
Ra
O ~-~ OH
-N HCI, CH2CI2
O
Sub
Sub
- 107 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 34
CI
Ra \
O ~..-I O
N C02R Sub
O
NaHMDS
R = CH3, CH3CH2
Ra
O ~-I C02R
N __________
O O
LXVII Sub
Ra
R ~ ~-I C02R
\ ~ N
Rs~ ~ 0
N Sub
- 108 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 35
O NaHMDS
-- ~ ~ C02R
O
Ra S
R = CH CH H
3~ 3C 2
SUb
Ra
O '-) C02R
N LiAIH4
O S
sub
Ra
O N~-) OH ICH, CH31
O S
LXVIII I
sub
Ra
O ~-~ OCH3 Na104
-N
O S
LXIX I
sub
Ra
O ~-~ OCH3
N Oxone
O ~S
LXX ~ I
sub
Ra
O ~-~ OCH3
O O O
LXXI (
sub
- 109 -
CA 02301880 2000-02-25
WO 99/10525 PC'TNS98/17699
SCHEME 36
Ra Ra
1. (Boc)20 O ~-I O
HN C02H
2. HNCH3(OCH3), O N-O
EDC LXXII H3C CH3
BrMg Ra
o ~ H
Sub HCI, EtOAc
O ~0~~~
Sub
8
R \ CI
H ~ ~ N
HCI~HN
O R1 ~N
LXXIII Sub iPr2NEt
R$
N NaBH4
N
R~ N
Sub
a
R ~ ~-I H
N
Ho~~~
R~ N
LXXIV Sub
- 110 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
SCHEME 37
Ra
H2N Ra
\ ~I CN
N O N _
sub
H \
\ / TMSCN, HOAc \ /
l ub
LXXV
Ra
CONH2
H2S04 1. NaOH
N
H \ ~~ 2. EtOH, H+
\ / sub
LXXVI
Ra
C02Et
N LiAIH4
\ / sub
LXXV I I
Ra
OH
N H2
\ ~ Pd/C
\ / Sub
LXXVIII
Ra
R
HN
H \ ~~
LXXIX sub
- 111 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
Compounds of this invention of formula (III) are
prepared by employing the reactions shown in the following Reaction
Schemes 38-51, in addition to other standard manipulations such as ester
hydrolysis, cleavage of protecting groups, etc., as may be known in the
literature or exemplified in the experimental procedures. Some key
bond-forming and peptide modifying reactions are:
Reaction A Amide bond formation and protecting group cleavage using
standard solution or solid phase methodologies.
Reaction B Preparation of a reduced peptide subunit by reductive
alkylation of an amine by an aldehyde using sodium
cyanoborohydride or other reducing agents.
Reaction C Alkylation of a reduced peptide subunit with an alkyl or
aralkyl halide or, alternatively, reductive alkylation of a
reduced peptide subunit with an aldehyde using sodium
cyanoborohydride or other reducing agents.
Reaction D Peptide bond formation and protecting group cleavage
using standard solution or solid phase methodologies.
Reaction E Preparation of a reduced subunit by borane reduction of the
amide moiety.
These reactions may be employed in a linear sequence
to provide the compounds of the invention or they may be used to
synthesize fragments which are subsequently joined by the alkylation
reactions described in the Reaction Schemes and in Reaction Schemes
43-51 hereinbelow.
- 112 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 38
Reaction A. coupling of residues to form an amide bond
Re
O RA OR
OH + H2N
O H O O
A
EDC, HOBT R O
or HOOBT ~ ~pR
p H 1
O RB
Et3N, DMF
HCI or RA H O
TFA H2N NOR
O R~
REACTION SCHEME 39
Reaction B. Preparation of reduced peptide subunits by reductive
alkylation
O RA RB
H + OR
O H H2N
O O
A
NaCNBH3 ~ R N O
~OR
O N
H Ra
- 113 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 40
Reaction C. Alkxlation/reduct~,ve alkvlation of reduced peptide subunits
O RA H O R~X~, base
N
O H =_ OR or
RB O
RyCH, NaCNBH3
O RA R~ O
N
O N OR
H
RB
REACTION SCHEME 41
Reaction D. ~ou_plin~ of residues to form an amide bond
EDC, HOBT
O RA or HOOBT
OH + HNR°R°
O H ~ Et3N, DMF
O
O RA
NR°R° HCI or TFA
O N
H O
RA
NR~R°
H2N
O
- 114 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
FACTION SCHEME 42
Reaction E. Preparation of reduced dipentides from peptides
O RA O
BH3 THF
O H ~ _ OR
O RB
O RA H O
~N~OR
O N
H Re
where RA and RB are R2, R3 or RS as previously defined; RC and RD
are R~ or R12; XL is a leaving group, e.g., Br-, I- or Ms0-; and Ry is
defined such that R~ is generated by the reductive alkylation process.
In addition to the reactions described in Reaction Schemes
26-30, other reactions used to generate the compounds of formula (IiI)
of this invention are shown in the Reaction Schemes 43-51. All of the
substituents shown in the Reaction Schemes, represent the same substi-
tuents as defined hereinabove. The substituent "Ar" in the Reaction
Schemes represents a carbocyclic or heterocyclic, substituted or
unsubstituted aromatic ring.
1 S These reactions may be employed in a linear sequence
to provide the compounds of the invention or they may be used to
synthesize fragments which are subsequently joined by the alkylation
reactions described in the Reaction Schemes. The sequential order
whereby substituents are incorporated into the compounds is often
not critical and thus the order of reactions described in the Reaction
Schemes are illustrative only and are not limiting.
Sv" nopsis of Reaction Schemes 43-51:
The requisite intermediates are in some cases commercially
available, or can be readily prepared according to known literature
- 115 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
procedures, including those described in Reaction Schemes 38-42
hereinabove.
Reaction Scheme 43 illustrates incorporation of the cyclic
amine moiety, such as a reduced prolyl moiety, into the compounds of
the formula III of the instant invention. Reduction of the azide LXXXI
provides the amine LXXXII, which may be mono- or di-substituted
using techniques described above. As an example, incorporation of a
naphthylmethyl group and an acetyl group is illustrated.
As shown in Reaction Scheme 44, direct attachment of a
aromatic ring to a substituted amine such as LXXXIII is accomplished
by coupling with a triarylbismuth reagent, such as tris(3-chlorophenyl)
bismuth.
Reaction Scheme 4S illustrates the use of protecting groups
to prepare compounds of the instant invention wherein the cyclic amine
contains an alkoxy moiety. The hydroxy moiety of key intermediate
LXXXIVa may be further converted to a fluoro or phenoxy moiety, as
shown in Reaction Scheme 46. Intermediates LXXXV and LXXXVI
may then be further elaborated to provide the instant compounds.
Reaction Scheme 474 illustrates syntheses of instant
compounds wherein the variable -(CR42)qA3(CR52)nR6 is a suitably
substituted a-hydroxybenzyl moiety. Thus the protected intermediate
aldehyde is treated with a suitably substituted phenyl Grignard reagent
to provide the enantiomeric mixture LXXXVII. Treatment of the
mixture with 2-picolinyl chloride allows chromatographic resolution
of compounds LXXXVIII and IXC. Removal of the picolinoyl group
followed by deprotection provides the optically pure intermediate XC
which can be further processed as described hereinabove to yield the
instant compounds.
Syntheses of imidazole-containing intermediates useful in
synthesis of instant compounds wherein the variable p is 0 or 1 and Z is
H2 are shown in Reaction Scheme 48 and 49. Thus the mesylate XCI
can be utilized to alkylate a suitably substituted amine or cyclic amine,
while aldehyde XCII can be used to similarly reductively alkylate such
an amine.
- 116 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98I17699
Reaction Scheme 50 illustrates the syntheses of
imidazole-containing intermediates wherein the attachment point of the
-(CR22)p-C{Z)- moiety to W (imidazolyl) is through an imidazole ring
nitrogen. Reaction Scheme 51 illustrates the synthesis of an
intermediate wherein an R2 substituent is a methyl.
REACTION SCHEME 43
OOH OOH
(CF3C0)20 ~ MeS02Cl
H~ N . - -- N
F3C ~ N Et3
~OS02Me ~ N3
N _ H N
O i. LiN3
F3C ~ ii.NH3
MeOH
Ar~N CH2C02H
EDC ~ HCI
N HOOBT
DMF
LXXX
- 117 -
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
REACTION SCHEME 43 (continued)
N O ~ N3 H2, PdIC
N
Arw,/ N
LXXXI CHO
/ /
~NH2 \ \
~N~ O
Ark N
LXXXI I
\ I
N ~NH
O CH3C(O)CI
Ark N
i
N CH3
~N~ O i O
Ar~/N N
- 118 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 44
~O
'~ / N AcCI, NEt3
O
NH2
~O
/ N Cu(OAc)2
O O
NEt3, Bi(aryl)3
N ~CH3
H
~O~
- / ,l N O
II ____
N ~CH3
R
N \ N
~.--N O
O
N' _CH3
/ I
NC \
R
- 119 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 45
,,OH ,OH
HN HCI, MeOH CI H2N TBSCI, NEt~
O OH O OMe
O ,,,OTBS O ,,OTBS
N LiAIH N MsCI, NEt3
4
O
O OMe OH
,OTBS OTBS
O ~~ O
-N Bu4NN3 ~N H2,Pd
O O
OMs N3
,,OTBS ,,OTBS
O ,,
O
~N NaBH3CN ~N AcCI, NEt3
O R'CHO ~ O
NH2
R'
- 120 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 45 ycontinued)
,OH
OTBS O
O ,y-N
N O O
p TBAF, THF
o ~ ~-
R'
R, XXXIV
OR
O i. HCI
NaH, RX N ______________
'' O ii.EDC Coupling or
O ~ reductive amination
N or alkylation
R'
,,,OR ,,,OR
N
N~-- N N O or N~ N O etc
O
N _ N
R'
R
NC NC
- 121 -
CA 02301880 2000-02-25
WO 99/10525 PC'f/US98117699
REACTION SCHEME 46
,,O H
O~N DAST O
O// O O
N'
LXXXIV
LXXXI Ii
R R
,O H OPh
O N ~ PPh3, DEAD, Phenol O N
O ~ O
O N~ O Ni''..
LXXXV
LXXXIII
R R
- 122 -
CA 02301880 2000-02-25
WO 99/10525 PCTIUS98/17699
REACTION SCHEME 47
OTBS OTBS _R_
MgBr
S03. Py
N -.-.. N --
O
O O O
O HO
LXXXVI
OTBS
2-Picolinoyl Chloride
NEt3
LXXXVI I
OTBS OTBS
O N ; ~ + O N
0 0 ~ o O
O R ~ O R
N~ N-'
LXXXVII \ ~ \ ~ IXC
- 123 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCTlUS98/17699
REACTION SCHEME 47 lcontinued)
OTBS
LiOH
N '
O \
O O
O R
N
OTBS
OH
N ~ l.Bu4NF
O \ ~ 2 , N
O HO ~ .HC H \
R \
HO R
XC
OH
Coupling/alkylation N ~ etc
--
w
R
CN
- 124 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 48
Ar~N CH2C02CH3 NaBH4
MeOH
N
Ark CH2CH20H MeS02Cl
N
N Et3
N
Ar''~ OS02CH3
N
N
XCI
- 125 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 49
CH OH
N \ CH OH ~CsH5)sCBr N
N (C2Hs)aN N
H DMF Tr
CH20Ac 1 ) ArCH2X CH3CN
Ac20 ~~ reflux
pyridine N 2) CH30H, reflux
Tr
Ar'~ CH20Ac LiOH
N
H20, THF
N
Ar''~ CH20H SOs'pY
NEt3
N
Ar~N CHO
N
XCII
- 126 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 50
N \ I Ni(PPh3)2CI2
+ BrZnCH2Ar
N
I
Tr
~Ar TfOCH2C02CH3
I
Tr
H3C02C -'~N Ar LiOH H02C -"~
N ~Ar
N
NaBH4 XCVII
HO
N \ ~Ar
N
(MeS02)20
Et3N
Ms0
N \ ~Ar
N
XCVIII
- 127 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REACTION SCHEME 51
N CH2C02CH3 N CH(Me)C02C
i. LiHMDS, -78°C ~ ~ Hs
ii. Mel
Tr Tr
Me
Ar--1 OH
N
_______________.~ ~ ~ p
N
XCVI
The prenyl transferase inhibitors of formula (A)
can be synthesized in accordance with Reaction Scheme below, in
addition to other standard manipulations such as ester hydrolysis,
cleavage of protecting groups, etc., as may be known in the literature
or exemplified in the experimental procedures. Some key reactions
utilized to form the aminodiphenyl moiety of the instant compounds
are shown.
The reactions may be employed in a linear sequence
to provide the compounds of the invention or they may be used to
synthesize fragments which are subsequently joined by the alkylation
reactions described in the Reaction Scheme.
A method of forming the benzophenone intermediates,
illustrated in Reaction Scheme 52, is a Stille reaction with an aryl
stannane. Such amine intermediates may then be reacted as illustrated
hereinabove with a variety of aldehydes and esters/acids.
128
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
REA .TION SCHEME 52
O
R2b
02N I \ CI Br or I I '/
i/
R2a ~ Rs
Pd(PPh3)a
(n-Bu)3Sn-Sn(n-Bu)3
O R2b
02N ~ \
r
R2a i R3
Fe, HOAc
R2b
H2N
R2a R3
(CH2)nCHO
N NaBH(OAc)3
~N~ Et3N , CICH2CH2CI
Tr
R2b
CH2)n+~ tiN \
//
N 2a \Rs
R
Tr
- 129 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
EXAMPLES
Examples provided are intended to assist in a further
understanding of the invention. Particular materials employed, species
and conditions are intended to be further illustrative of the invention
and not limitative of the reasonable scope thereof.
The standard workup referred to in the examples refers
to solvent extraction and washing the organic solution with 10% citric
acid, 10% sodium bicarbonate and brine as appropriate. Solutions
were dried over sodium sulfate and evaporated in vacuo on a rotary
evaporator.
EXAMPLES 1
1-(3-Chlorophenyl)-4-[ 1-(4-cyanobenzyl)imidazolylmethyl]-2-
piperazinone dihydrochloride (Compound 1 )
Step A: Preparation of 1-triphenylmethyl-4-(hydroxymethyl)-
imidazole
To a solution of 4-(hydroxymethyl)imidazole
hydrochloride (35.0 g, 260 mmol) in 250 mL of dry DMF at room
temperature was added triethylamine {90.6 mL, 650 mmol). A white
solid precipitated from the solution. Chlorotriphenylmethane (76.1
g, 273 mmol) in 500 mL of DMF was added dropwise. The reaction
mixture was stirred for 20 hours, poured over ice, filtered, and
washed with ice water. The resulting product was slurried with cold
dioxane, filtered, and dried in vacuo to provide the titled product as
a white solid which was sufficiently pure for use in the next step.
to : Preparation of 1-triohen~methyl-4-(acetoxvmethvl)-
lmida?o a
Alcohol from Step A (260 mmol, prepared above)
was suspended in 500 mL of pyridine. Acetic anhydride (74 mL,
780 mmol) was added dropwise, and the reaction was stirred for
- 130 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
48 hours during which it became homogeneous. The solution was
poured into 2 L of EtOAc, washed with water (3 x 1 L), 5% aq. HCl
soln. (2 x 1 L), sat. aq. NaHC03, and brine, then dried (Na2S04),
filtered, and concentrated in vacuo to provide the crude product.
The acetate was isolated as a white powder which was sufficiently
pure for use in the next reaction.
Preparation of 1-(4-cyanobenzyl)-5-(acetoxymethyl)-
imidazole hvdrobromide
A solution of the product from Step B (85.8 g, 225
mmol) and a-bromo p-tolunitrile (50.1 g, 232 mmol) in 500 mL of
EtOAc was stirred at 60°C for 20 hours, during which a pale yellow
precipitate formed. The reaction was cooled to room temperature
and filtered to provide the solid imidazolium bromide salt. The
filtrate was concentrated in vacuo to a volume 200 mL, reheated at
60°C for two hours, cooled to room temperature, and filtered again.
The filtrate was concentrated in vacuo to a volume 100 mL, reheated
at 60°C for another two hours, cooled to room temperature, and
concentrated in vacuo to provide a pale yellow solid. All of the solid
material was combined, dissolved in 500 mL of methanol, and
warmed to 60°C. After two hours, the solution was reconcentrated
in vacuo to provide a white solid which was triturated with hexane
to remove soluble materials. Removal of residual solvents in vacuo
provided the titled product hydrobromide as a white solid which was
used in the next step without further purification.
to : Preparation of 1-(4-cyanobenzyl)-5-(hydroxymethyl)-
imidazole
To a solution of the acetate from Step C (50.4 g,
150 mmol) in 1.5 L of 3:1 THF/water at 0°C was added lithium
hydroxide monohydrate ( 18.9 g, 450 mmol). After one hour, the
reaction was concentrated in vacuo, diluted with EtOAc (3 L), and
washed with water, sat. aq. NaHC03 and brine. The solution was
then dried (Na2S04), filtered, and concentrated in vacuo to provide
- 131 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
the crude product as a pale yellow fluffy solid which was sufficiently
pure for use in the next step without further purification.
to E: Preparation of 1-(4-cyanobenzyl)-5-
imidazolecarboxaldeh,~r_dg
To a solution of the alcohol from Step D (21.5 g,
101 mmol) in 500 mL of DMSO at room temperature was added
triethylamine (56 mL, 402 mmol), then S03-pyridine complex (40.5
g, 254 mmol). After 45 minutes, the reaction was poured into 2.5 L
of EtOAc, washed with water (4 x 1 L) and brine, dried (Na2S04),
filtered, and concentrated in ,vacuo to provide the aldehyde as a white
powder which was sufficiently pure for use in the next step without
further purification.
Stgp F: Preparation of N-(3-chlorophenyl)ethylenediamine
hydrochloride
To a solution of 3-chloroaniline (30.0 mL, 284 mmol)
in 500 mL of dichloromethane at 0°C was added dropwise a solution
of 4 N HCl in 1,4-dioxane (80 mL, 320 mmol HCl). The solution
was warmed to room temperature, then concentrated to dryness
in vacuo to provide a white powder. A mixture of this powder
with 2-oxazolidinone (24.6 g, 282 mmol) was heated under nitrogen
atmosphere at 160°C for 10 hours, during which the solids melted,
and gas evolution was observed. The reaction was allowed to cool,
forming the crude diamine hydrochloride salt as a pale brown solid.
to : Preparation of N (tert-butoxycarbonyl)-N'-(3-
c lorop, envl)etl~Xlene ' amine
The amine hydrochloride from Step F (ca. 282 mmol,
crude material prepared above) was taken up in 500 mL of THF
and 500 mL of sat. aq. NaHC03 soin., cooled to 0°C, and di-tert-
butylpyrocarbonate (61.6 g, 282 mmol) was added. After 30 h, the
reaction was poured into EtOAc, washed with water and brine, dried
(Na2S04), filtered, and concentrated in vacuo to provide the titled
- 132 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
carbamate as a brown oil which was used in the next step without
further purification.
to H: Preparation of N-[2-(tert-butoxycarbamoyl)ethyl]-N (3-
chlorophenyl)-2-chloroacetamide
A solution of the product from Step G (77 g, ca. 282
mmol) and triethylamine (67 mL, 480 mmol) in 500 mL of CH2Cl2
was cooled to 0°C. Chloroacetyl chloride (25.5 mL, 320 mmol)
was added dropwise, and the reaction was maintained at 0°C with
IO stirring. After 3 h, another portion of chloroacetyl chloride (3.0
mL) was added dropwise. After 30 min, the reaction was poured
into EtOAc (2 L) and washed with water, sat. aq. NH4Cl soln, sat.
aq. NaHC03 soln., and brine. The solution was dried (Na2S04),
filtered, and concentrated in vacuo to provide the chloroacetamide
as a brown oil which was used in the next step without further
purification.
StepL: Preparation of 4-(tert-butoxycarbonyl)-1-(3-
chloro~henyll-2-pine~ne
To a solution of the chloroacetamide from Step H (ca.
282 mmol) in 700 mL of dry DMF was added K2C03 (88 g, 0.64
mol). The solution was heated in an oil bath at 70-75°C for 20 hrs.,
cooled to room temperature, and concentrated in vacuo to remove
ca. 500 mL of DMF. The remaining material was poured into 33%
EtOAc/hexane, washed with water and brine, dried (Na2SO4),
filtered, and concentrated in vacuo to provide the product as a brown
oil. This material was purified by silica gel chromatography (25-
50% EtOAc/hexane) to yield pure product, along with a sample of
product (ca. 65% pure by HPLC) containing a less polar impurity.
Ste : ~ Preparation of 1-(3-chloropheny~)-2-piperazinone
Through a solution of Boc-protected piperazinone
from Step I (17.19 g, 55.4 mmol) in 500 mL of EtOAc at -78°C was
bubbled anhydrous HCl gas. The saturated solution was warmed to
- 133 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
0°C, and stirred for 12 hours. Nitrogen gas was bubbled through the
reaction to remove excess HCI, and the mixture was warmed to room
temperature. The solution was concentrated in vacuo to provide the
hydrochloride as a white powder. This material was taken up in 300
mL of CH2C12 and treated with dilute aqueous NaHC03 solution.
The aqueous phase was extracted with CH2C12 (8 x 300 mL) until tlc
analysis indicated complete extraction. The combined organic
mixture was dried (Na2S04), filtered, and concentrated in vacuo to
provide the titled free amine as a pale brown oil.
Step K: Preparation of 1-(3-chlorophenyl)-4-[1-(4-
cyanobenzyl)imidazolylmethyl]-2-piperazinone
dihydrochloride
To a solution of the amine from Step J (55.4 mmol,
prepared above) in 200 mL of 1,2-dichloroethane at 0°C was added
4~ powdered molecular sieves ( 10 g), followed by sodium triacetoxy-
borohydride ( 17.7 g, 83.3 mmol). The imidazole carboxaldehyde
from Step E of Example 1 ( 11.9 g, 56.4 mmol) was added, and the
reaction was stirred at 0°C. After 26 hours, the reaction was poured
into EtOAc, washed with dilute aq. NaHC03, and the aqueous layer
was back-extracted with EtOAc. The combined organics were washed
with brine, dried (Na2S04), filtered, and concentrated in vacuo.
The resulting product was taken up in 500 mL of 5:1 benzene:CH2C12,
and propylamine (20 mL) was added. The mixture was stirred for
12 hours, then concentrated in vacuo to afford a pale yellow foam.
This material was purified by silica gel chromatography (2-7%
MeOH/CH2C12), and the resultant white foam was taken up in CH2C12
and treated with 2.1 equivalents of 1 M HCl/ether solution. After
concentrated in vacuo, the product dihydrochloride was isolated as a
white powder.
Examples 2-5 (Table 1 ) were prepared using the above protocol,
which describes the synthesis of the structurally related compound
- 134 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
1-(3-chlorophenyl)-4-[1-(4-cyanobenzyl)-imidazolylmethyl]-2-
piperazinone dihydrochloride. In Step F, the appropriately
substituted aniline was used in place of 3-chloroaniline.
Table 1: 1-Aryl-4-[1-(4-cyanobenzyl)imidazolylmethyl]-2-
pip"erazinones
~--1 ~ X
NC ~ ~ N N
N
O
N
FAB mass
spectrum CHN
Exam lei X (M+11 Analysis
2 3-OCF3 456 C23H20 F3NS02~2.OHC1~0.60H20
calcd; C, S 1.24; H, 4.34; N, 12.99.
found; C, 51.31; H, 4.33; N, 12.94.
3 2,5-(CH3)2 400 C24H25N50~2.OOHC1~0.65H20
calcd; C, 59.54; H, 5.89; N, 14.47
found; C, 59.54; H, 5.95; N, 14.12.
4 3-CH3 386 C23H23NS0~2.OHC1~0.80H20
calcd; C, 58.43; H, 5.67; N, 14.81.
found; C, 58.67; H, 6.00; N, 14.23.
S 3-I 498 C22H20N50I~2.25HC1~0.90H20
calcd; C, 44.36; H, 4.07; N, 11.76.
found; C, 44.37; H, 4.06; N, 11.42.
- 135 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
EXAMPLE 6
1-(3-chlorophenyl)-4-[1-(4-cyano-3-methoxybenzyl)imidazolylrnethyl]-
2-,piperazinone dih,~c~lQride
St_ ep A: Preparation of Methvl 4-amino-~-hydroxXbenzoate
Through a solution of 4-amino-3-hydroxybenzoic acid
(75 g, 0.49 rnol) in 2.0 L of dry methanol at room temperature was
bubbled anhydrous HCl gas until the solution was saturated. The
solution was stirred for 48 hours, then concentrated in vacuo. The
product was partitioned between EtOAc and saturated aq. NaHC03
solution, and the organic layer was washed with brine, dried
(Na2SOa), and concentrated in vacuo to provide the titled compound
(79 g, 96% yield).
St, e~,B.: 'fir naration of Meth 1~ 3;Hydroxy-4-iodobenzoate
A cloudy, dark solution of the product from Step A
(79 g, 0.47 mol), 3N HCl (750 mL), and THF (250 mL) was cooled
to 0°C. A solution of NaN02 (35.9 g, 0.52 mol) in 115 mL of water
was added over ca. 5 minutes, and the solution was stirred for
another 25 minutes. A solution of potassium iodide (312 g, 1.88
mol) in 235 mL of water was added all at once, and the reaction was
stirred for an additional 15 minutes. The mixture was poured into
EtOAc, shaken, and the layers were separated. The organic phase
was washed with water and brine, dried (Na2S04), and concentrated
in vacuo to provide the crude product (148 g). Purification by
column chromatography through silica gel (0%-50% EtOAc/hexane)
provided the titled product (96 g, 73% yield).
Ste : Preparation of Meth,~4-Cyano-3-hydroxvbenzoate
A mixture of the iodide product from Step B ( 101 g,
0.36 mol) and zinc(II)cyanide (30 g, 0.25 mol) in 400 mL of dry
DMF was degassed by bubbling argon through the solution for 20
minutes. Tetrakis(triphenylphosphine)palladium (8.5 g, 7.2 mmol)
was added, and the solution was heated to 80°C for 4 hours. The
- 136 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98117699
solution was cooled to room temperature, then stirred for an
additional 36 hours. The reaction was poured into EtOAc/water,
and the organic layer was washed with brine {4x), dried (Na2S04),
and concentrated in vacuo to provide the crude product. Purification
by column chromatography through silica gel (30%-50% EtOAc/
hexane) provided the titled product (48.8 g, 76% yield).
to D: Prepara ion of Methvl 4-Cyano-3-methoxybenzoate
Sodium hydride (9 g, 0.24 mol as 60% wt. disp. mineral
oil) was added to a solution of the phenol from Step C (36.1 g, 204
mmol) in 400 mL of dry DMF at room temperature. Iodomethane
was added (14 mL. 0.22 mol) was added, and the reaction was stirred
for 2 hours. The mixture was poured into EtOAc/water, and the
organic layer was washed with water and brine (4x), dried (Na2S04),
and concentrated in vacuo to provide the titled product (37.6 g, 96%
yield).
Step E: Preparation of 4-Cyano-3-methoxvbenzyl Alcohol
To a solution of the ester from Step D (4$.8 g, 255
mmol) in 400 mL of dry THF under argon at room temperature was
added lithium borohydride (255 mL, 510 mmol, 2M THF) over 5
minutes. After I.5 hours, the reaction was warmed to reflux for 0.5
hours, then cooled to room temperature. The solution was poured
into EtOAc/1N HCl soln. [CAUTION], and the layers were
separated. The organic layer was washed with water, sat Na2C03
soln. and brine {4x), dried (Na2S04), and concentrated in vacuo to
provide the titled product {36.3 g, 87% yield).
to F: Prgparation of 4-Cyano-3-methox~benz~l Bromide
A solution of the alcohol from Step E (35.5 g,
218 mmol) in 500 mL of dry THF was cooled to 0°C.
Triphenylphosphine was added (85.7 g, 327 mmol), followed by
carbontetrabromide (108.5 g, 327 mmol). The reaction was stirred
at 0°C for 30 minutes, then at room temperature for 21 hours. Silica
- I37
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
gel was added (ca. 300 g), and the suspension was concentrated in
vacuo. The resulting solid was loaded onto a silica gel chromato-
graphy column. Purification by flash chromatography (30%-50%
EtOAc/hexane) provided the titled product (42 g, 85% yield).
to : Preparation of 1-(4-cyano-3-methoxybenzyl)-5-
(acetoxymethXl)-imidazole hvdrobromide
The titled product was prepared by reacting the bromide
from Step F (21.7 g, 96 mmol) with the imidazole product from Step
i 0 B of Example 1 (34.9 g, 91 mmol) using the procedure outlined in
Step C of Example 1. The crude product was triturated with hexane
to provide the titled product hydrobromide (19.43 g, 88% yield).
S. tep H: Preparation of 1-(4-cyano-3-methoxybenzyl)-5-
(hv-- drox,~yl)-irnidazole
The titled product was prepared by hydrolysis of the
acetate from Step G (19.43 g, 68.1 mmol) using the procedure
outlined in Step D of Example 1. The crude titled product was
isolated in modest yield (1 i g, 66% yield). Concentration of the
aqueous extracts provided solid material (ca. i00 g) which contained
a significant quantity of the titled product , as judged by 'H NMR
spectroscopy.
to I: Preparation of 1-(4-cyano-3-methoxybenzyl)-5-
imidazo~ecarboxaldeh3rde
The titled product was prepared by oxidizing the alcohol
from Step H (11 g, 45 mmol) using the procedure outlined in Step E
of Example 1. The titled aldehyde was isolated as a white powder
(7.4 g, 68% yield) which was sufficiently pure for use in the next
step without further purification.
to J: Preparation of I -(3-chlorophenyl)-4-[ 1-(4-cyano-3-
methoxybenzyl)irnidazolylmethyl]-2-piperazinone
dihXdrochloride
- 138 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
The titled product was prepared by reductive alkylation
of the aldehyde from Step I (859 mg, 3.56 mmol) and the amine
(hydrochloride) from Step K of Example 1 (800 mg, 3.24 mmol)
using the procedure outlined in Step H of Example 1. Purification
by flash column chromatography through silica gel (50%-75%
acetone CH2C12) and conversion of the resulting white foam to its
dihydrochloride salt provided the titled product as a white powder
(743 mg, 45% yield). FAB ms (m+1) 437.
Anal. Calc. for C23H23C1N502~2.OHCl~0.35CH2C12:
C, 51.97; H, 4.80; N, 12.98.
Found: C, 52.11; H, 4.80; N, 12.21.
EXAMPLE 7
1-(3-trifluoromethoxyphenyl)-4-[ 1-{4-cyano-3-
methox,~rbenz~)imidazol~l methyll-2-piuerazinone dihydrochloride
1-(3-trifluoromethoxy-phenyl)-2-piperazinone hydro-
chloride was prepared from 3-trifluoromethoxyaniline using Steps
F-J of Example 1. This amine { 1.75 g, 5.93 mmol) was coupled to
the aldehyde from Step I of Example 6 (1.57 g, 6.52 mmol) using
the procedure outlined in Step H of Example 1. Purification by
flash column chromatography through silica gel (60%-100%
acetone CH2Cl2) and conversion of the resulting white foam to its
dihydrochloride salt provided the titled product as a white powder
{1.947 g, 59% yield). FAB ms {m+1) 486.
Anal. Calc. for C24H23F3N5~3~2.OHC1~0.60H20:
C, 50.64; H, 4.46; N, 12.30.
Found: C, 50.69; H, 4.52; N, 12.13.
EXAMPLE 8
4-[{( 1-(4-cyanobenzyl)-5-imidazolyl)methyl)amino]benzophenone
hydrochloride
The titled product was prepared by reductive alkylation
- 139 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
of the aldehyde from Step E of Example 1 (124 mg, 0.588 mmol) and
4-aminobenzophenone (116 mg, 0.588 mmol) using the procedure
outlined in Step K of Example 1. Purification by flash column
chromatography through silica gel (2-6% MeOH/CH2Cl2) and
conversion to the hydrochloride salt provided the titled product
as a white solid (126 mg, 50% yield). FAB ms (m+1) 393.11.
Anal. Calc. for C25H20N50~ 1.40HC1~0.40H20:
C, 66.62; H, 4.96; N, 12.43.
Found: C, 66.73; H, 4.94; N, 12.46.
EXAMPLE 9
N-{ 1-(4-Cyanobenzyl)-1H-imidazol-5-ylethyl}-4(R)-benzyloxy-2(S)-
~ N'-acet,~~l-N'-3-chlorobenzyl 1 aminomethxlpyrolidine
Step A: ~,R)-Hxdroxyproli~e methyl ester
A suspension of 4(R)-hydroxyproline (35.12g, 267.8
mmol) in methanol (SOOmI) was saturated with gaseous hydrochloric
acid. The resulting solution was allowed to stand for 16 hrs and the
solvent evaporated in vacuo to afford the title compound as a white
solid.
1 H NMR CD30D 8 4.60 (2H, m), 3.86(3H, s), 3.48( 1 H, dd, J=3.6
and 12.OHz), 3.23(1H, d, J=12.OHz), 2.43(1H, m) and 2.21(1H, m)
ppm.
~~te~B: N-t-Butoxycarbonyl-4(R)-hydrox~roline methyl ester
To a solution of 4(R)-hydroxyproline methyl ester
(53.Sg, 268mmo1), and triethylamine (75m1, 540mmo1), in CH2C12
(SOOmI), at 0°C, was added a solution of di-t-butyl dicarbonate
(58.4$, 268mmo1), in CH2C12 (75m1). The resulting mixture was
stirred for 48hrs at room temperature. The solution was washed
with 10% aqueous citric acid solution, saturated NaHC03 solution,
dried (Na2S04) and the solvent evaporated in vacuo. The title
- 140 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
compound was obtained as a yellow oil and used in the next step
without further purification.
1H NMR CD30D 8 4.40-4.30 (2H, m), 3.75(3H, m), 3.60-3.40(2H,
m), 2.30( 1 H, m), 2.05 ( 1 H, m) and 1.55-1.40(9H, m) ppm.
Ste : N-t-Butoxycarbonyl-4(R)-t-butyldimethylsilyloxy
proline nnethyl ester
To a solution of N-t-butoxycarbonyl-4(R)-hydroxy
proline methyl ester (65.87g, 268mmo1), and triethylamine (41m1,
294mmo1), in CH2C12 (536m1), at 0°C, was added a solution of
t-butyldimethyl silylchloide {42.49g, 282mmol), in CH2C12 (86m1).
The resulting mixture was stirred for l6hrs at room temperature.
The solution was washed with 10% aqueous citric acid solution,
saturated NaHC03 solution, dried (Na2S04) and the solvent
evaporated in vacuo: The title compound was obtained as a
yellow oil and used in the next step without furthur purification.
1H NMR CD30D s 4.60-4.40 (2H, m), 3.75(3H, m), 3.60-3.20(2H,
m), 2.30-1.90(2H, m), 1.45-1.40(9H, m), 0.90-0.85(9H, m), 0.10-
0.00(6H, m) ppm.
to : N-t-Butoxycarbonyl-4(R)-t-butyldimethylsilyloxy-2{S)-
h,~!d~oxymeth, lu~~idine
A solution of N-t-butoxycarbonyl-4-(R)-t-
butyldimethylsilyloxy proline methyl ester (86.65g, 241mmo1), in
THF ( 1 SOmI), was added over 90 minutes to a solution of lithium
aluminum hydride (247m1 of a 1M solution in THF, 247mmo1),
under argon, so that the temperature did not exceed 12°C. Stirring
was continued for 50 rains and then EtOAc (SOOmI) was added
cautiously, followed by sodium sulphate decahydrate (34g), and
the resulting mixture stirred for 16 hrs at room temperature.
Anhydrous Na2S04 (34g) was added and the mixture stirred an
additional 30 min and then filtered. The solids were washed with
EtOAc (800m1), the filtrates combined and the solvent evaporated in
- 141 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
vacuo. The title compound was obtained as a colorless oil and used
in the next step without further purification.
to : N-t-Butoxycarbonyl-4(R)-t-butyldimethylsilyloxy-2(S)-
methanesulfonylox~rmetl~,vhvrrolidine
To a solution of N-t-butoxycarbonyl-4(R)-t-
butyldimethylsilyloxy-2(S)-hydroxymethylpyrrolidine (SO.Og,
150.8mmo1) and triethylamine (42.Om1, 300 mmol) in CH2Cl2( 1 1)
was added methane sulfonyl chloride ( 12.4m1, 160mmol) over a
period of 5 minutes and stirring was continued for 1 hour. The
solvent was evaporated in vacuo diluted with EtOAc (800mL) and
washed sequentially with aqueous citric acid and NaHC03. The
organic extracts were dried (Na2S04), evaporated in vacuo and the
residue purified by chromatography (Si02, 15% EtOAc in hexanes).
The title compound was obtained as a pale yellow solid
FAB Mass spectrum, m/z = 410(M+1).
1H NMR CDCl3 8 4.60-4.00 (4H, m), 3.60-3.30(2H, m), 2.98(3H,
s), 2.05-2.00(2H, m), 1.48-1.42(9H, m),0.90-0.80(9H, m), 0.10-
0.00(6H, m) ppm.
to F: Preparation of N-t-Butoxycarbonyl-4(R)-t-
butyldimethylsilyloxv-2lS)-azidomethylnvrrolidine
In a flask protected by a safety screen, a solution of
N-t-butoxycarbonyl-4(S)-t-butyldimethylsilyloxy-2(S)-methane-
sulfonyloxy methyl pyrrolidine( 10.40g, 25.39mmol) and tetrabutyl-
ammonium azide (8.18g, 28.7mmo1) in toluene (250m1) was stirred
at 80°C for Shr. The reaction was cooled to room temperature and
diluted with EtOAc (250m1), washed with water and brine and dried
{Na2S04). The solvent was evaporated in vacuo to afford the title
compound as a yellow oil which was used in the next step without
furthur purification.
1H NMR CDC13 8 4.60-3.20 (6H, m), 2.05-1.90(2H, m), 1.47(9H,
s), 0.87(9H, s) and 0.10-0.00(6H, m) ppm.
- 142 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699 -
ate : Preparation of N-t-Butoxycarbonyl-4(R)-t-
butyldimethvlsilylox~(,~)-aminometh~nvrrolidine
A solution of N-t-butoxycarbonyl-4(R)-t-butyldimethyl-
silyloxy-2(S)-azidomethylpyrrolidine (9.06g, 25.39mmo1) in EtOAc
( 120m1) was purged with argon and 10% palladium on carbon ( 1.05
g) added. The flask was evacuated and stirred under an atmosphere
of hydrogen (49 psi) for l6hrs. The hydrogen was replaced by
argon, the catalyst removed by filtration and the solvent evaporated
in vacuo. The residue was chromatographed (SiO2, 2.5 to 5%
saturated NH40H in acetonitrile, gradient elution), to afford the
title compound as an oil.
1 H NMR(CDCl3, 400 MHz) S 4.40-2.60 (6H, s), 2.05-1.80(2H, m),
1.46(9H, s), 1.36(2H, s), 0.87(9H, s), 0.10-0.00(6H, m)ppm.
to H: Preparation of N-t-Butoxycarbonyl-4(R)-t-
butyldimethylsilyloxy-2(S)-{ N'-3-
chlorobenzyl } aminomethylpyrrolidine
To a slurry of 3-chlorobenzaldehyde ( 1.2m1,
10.6mmo1), crushed 3A molecular sieves (9.5g) and the amine from
step G (3.508, 10.6mmo1) in methanol ( 150 ml) was added sodium
cyanoborohydride ( 11.Oml of a 1 M solution in THF, 11.Ommol) at
room temperature. The pH was adjusted to 7 by the addition of
glacial acetic acid (0.68m1, l2mmol) and the reaction was stirred for
16 hrs. The reaction was filtered and the filtrate evaporated in vacuo.
The residue was partitioned between EtOAc and saturated NaHC03
solution and the organic extract washed with brine, dried (Na2S04),
and the solvent evaporated in vacuo. The residue was purified by
chromatography (Si02, 2.5% MeOH in CH2C12) to provide the title
compound as an oil.
1HNMR(CDC13, 400 MHz) 8 7.40-7.10(4H, m), 4.36(1H, s), 4.15-
3.90(2H, m), 3.90-3.30(2H, m), 2.85-2.60(2H, m), 2.05-1.90(2H,
m), 1.44(9H, s), 0.87(9H, s) and 0.06(6H, m) ppm.
- 143 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
to : Preparation of N-t-Butoxycarbonyl-4(R)-t-
butyldimethylsilyloxy-2(S)-{ N'-3-chlorobenzyl-N'-
acetyll- aminomethvlp, rr~ olidi,ne
To a solution of N-t-butoxycarbonyl-4(R)-t-
butyldimethylsilyloxy-2(S)-{N'-3-chlorobenzyl}-aminomethyl
pyrrolidine (3.80g, 8.35 mmol) in CH2C12 (85m1) and triethylamine
(2.40m1, 17.0 mmol) at 0°C was added acetyl chloride (0.60m1~ 8.44
mmol). The reaction was stirred at room temperature for lhr,
diluted with water and extracted with CH2C12. The extracts were
washed with brine, dried (Na2S04) and the solvent evaporated in
vacuo. The residue was purified by chromatography (Si02, IO to
25% EtOAc in CH2C12, gradient elution).
1 HNMR (CDC13, 400 MHz) 8 7.40-7.00(4H, m), 5.10-3,00(8H, m),
2.20-1.70(5H, m), 1.50-1.30(9H, m), 0.87(9H, s) and 0.06(6H, m)
ppm.
Ste~J~. Preparation of N-t-Butoxycarbonyl-4(R)-hydroxy-2(S~-
{N' -3-chlorobe~zwl,~N'-acetvll-aminometh,~~lpyrrolidine
To a solution of N-t-butoxycarbonyl-4(R)-t-
butyldimethylsilyloxy -2(S)-{ N'-3-chlorobenzyl-N'-acetyl }-
aminomethylpyrrolidine (4.028, 8.09 mmol) in THF (80m1) at 0°C
was added tetrabutylammonium fluoride (9.OOm1 of a 1M solution
in THF~ 9.OOmmol). The reaction was stirred at 0°C for 1 hr and then
at room temperature for 30min. The reaction was quenched by the
addition of a saturated NH4C1 solution (50m1), dilution with EtOAc.
The organic extracts were washed with brine, dried (Na2S04) and
the solvent evaporated in vacuo. The residue purified by
chromatography (Si02, 3 to 5% MeOH in CH2C12, gradient elution)
to afford the title compound as a foam.
1HNMR (CDC13, 400 MHz) 8 7.40-7.00(4H, m), 5.00-4,00(4H, m),
4.00-3.10(4H, m), 2.30-1.60(5H, m) and 1.50-1.30(9H, m) ppm.
Std N-t-Butoxycarbonyl-4(R)-benzyloxyoxy-2(S)-{ N'-
ace yl-N'-3-chlorobenzyl } aminomethvlpyrrolidine
- 144 -
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
To a solution of N-t-Butoxycarbonyl-4(S)-hydroxy -
2(S)-{N'-acetyl-N' 3-chlorobenzyl}aminomethylpyrrolidine (701mg,
1.83 mmol) in DMF (9m1) at 0°C was added sodium hydride (110mg
of a 60% dispersion in mineral oil, 2.75mmo1). After 15 min benzyl
bromide (0.435m1, 3.66mmo1), was added and the reaction stirred
at room temperature for 16 hrs. The reaction was quenched with
saturated NaHC03 solution (2m1) and extracted with ethyl acetate.
The organic extract was washed with brine and dried (Na2S04), and
the solvent evaporated in vacuo. The residue was purified by
chromatography (Si02, 25 to 50% EtOAc in CH2C12, gradient
elution) to afford the title compound as a foam.
Step L: 4(S)-Benzyloxy-2(S)-{N'-acetyl-N'-3-chlorobenzyl}
aminometh~nvrrolidine hXdrochloride
A solution of the product from step K (0.834g, 1.76
mmol) in EtOAc (25 ml) at 0°C was saturated with gaseous hydrogen
chloride. The resulting solution was allowed to stand at room
temperature for 30min. The solvent was evaporated in vacuo to
afford the title compound as a white solid.
S a : Preparation of 1 H-Imidazole-4- acetic acid methyl ester
hydrochloride
A solution of 1H-imidazole-4-acetic acid hydrochloride
(4.OOg, 24.6 mmol) in methanol ( 100 ml) was saturated with gaseous
hydrogen chloride. The resulting solution was allowed to stand at
room temperature (RT) for l8hr. The solvent was evaporated in
vacuo to afford the title compound as a white solid.
1 H NMR(CDC13, 400 MHz) 8 8.85 ( 1 H, s),7.45 ( 1 H, s), 3.89(2H, s)
and 3.75(3H, s) ppm.
to : Preparation of 1-(Triphenylmethyl)-1H-imidazol-4-
lacetic a ' d th 1 ester.
To a solution of the product from Step M (24.85g,
0.141mo1) in dimethyl formamide (DMF) (115m1) was added
triethylamine (57.2 ml, 0.412mo1) and triphenylmethyl bromide
- 145 -
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
(55.3g, 0.171mo1) and the suspension was stirred for 24hr. After this
time, the reaction mixture was diluted with ethyl acetate (EtOAc)
(1 1) and water (350 ml). The organic phase was washed with sat. aq.
NaHC03 (350 ml), dried (Na2S04) and evaporated in vacuo. The
residue was purified by flash chromatography (Si02, 0-100°Io ethyl
acetate in hexanes; gradient elution) to provide the title compound as
a white solid.
1 H NMR (CDCl3, 400 MHz) 8 7.35( 1H, s), 7.31 (9H, m), 7.22{6H,
m), 6.76(1H, s), 3.68(3H, s) and 3.60(2H, s) ppm.
Ste : Preparation of [1-(4-cyanobenzyl)-1H-imidazol-5-
1 acetic acid methXl ester.
To a solution of the product from Step N (B.OOg,
20.9mmo1) in acetonitrile (70 ml) was added bromo-p-tolunitrile
(4.lOg, 20.92 mmol) and heated at 55°C for 3 hr. After this time,
the reaction was cooled to room temperature and the resulting
imidazolium salt (white precipitate) was collected by filtration.
The filtrate was heated at 55°C for l8hr. The reaction mixture
was cooled to room temperature and evaporated in vacuo. To the
residue was added EtOAc (70 ml) and the resulting white precipitate
collected by filtration. The precipitated imidazolium salts were
combined, suspended in methanol ( 100 ml) and heated to reflux
for 30min. After this time, the solvent was removed in vacuo, the
resulting residue was suspended in EtOAc (75m1) and the solid
isolated by filtration and washed (EtOAc). The solid was treated
with sat aq NaHC03 (300m1) and CH2C12 (300m1) and stirred at
room temperature fox 2 hr. The organic layer was separated, dried
(MgS04) and evaporated in vacuo to afford the title compound as a
white solid
1HNMR(CDC13, 400 MHz) 8 7.65(1H, d, J=8Hz), 7.53(1H, s),
7.15(1H, d, J=8Hz), 7.04(1H, s), 5.24{2H, s), 3.62(3H, s) and
3.45(2H, s) ppm.
to P: Preparation of (1-(4-Cyanobenzyl)-1H-imidazol-5-yl)-
Pt__1?a_r~ol
- 146 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
To a stirred solution of the ester from step O,
(1.50g, 5.88mmo1), in methanol (20m1) at 0°C, was added sodium
borohydride (l.Og, 26.3mmo1) portionwise over 5 minutes. The
reaction was stirred at 0°C for 1 hr and then at room temperature
for an additional 1 hr. The reaction was quenched by the addition of
sat.NH4Cl solution and the methanol was evaporated in vacuo.. The
residue was partitioned between EtOAc and sat NaHC03 solution and
the organic extracts dried (MgS04), and evaporated in vacuo.. The
residue was purified by chromatography (Si02, 4 to 10% methanol
in methylene chloride, gradient elution) to afford the title compound
as a solid.
1 H NMR CDC13 8 7.64(2H, d, J=8.2Hz), 7.57 ( 1 H, s), 7.11 (2H, d,
J=8.2Hz), 6.97(1H, s), 5.23(2H, s), 3.79(2H, t, J=6.2Hz) and
2.66(2H, t, J=6.2Hz) ppm.
St : 1-(4-Cyanobenz 1)-im'dazol-5-~-ethylmethanesulfonate
A solution of (1-(4-Cyanobenzyl)-1H-imidazol-5-yl)-
ethanol (0.500 g, 2.20 mmol) in methylene chloride (6.0 ml) at 0°C
was treated with Hunig's base (0.460m1, 2.64mmol) and methane
sulfonyl chloride (0.204m1, 2.64mmol). After 2 hrs, the reaction was
quenched by addition of saturated NaHC03 solution (50m1) and the
mixture was extracted with methylene chloride (50m1), dried
(MgS04) and the solvent evaporated in vacuo. The title compound
was used without furthur purification.
1 H NMR CDC13 8 7.69 ( 1 H, s) 7 .66(2H, d, J=8.2Hz), 7 .15 (2H, d,
J=8.2Hz), 7.04( 1 H, s), 5.24(2H, s), 4.31 (2H, t, J=6.7Hz), 2.96(3H, s),
and 2.88(2H, t, J=6.6Hz)ppm.
~N { 1-(4-Cyanobenzyl)-1 H--imidazol-5-ylethyl } -4(R)-
benzyloxyoxy-2(S)-{ N'-acetyl-N'-3-
chlorobenz, lly amir~ometh~ovrrolidine
A mixture of 4(R)-benzyloxy-2(S)-{N'-acetyl-N'-3-
chlorobenzyl-aminomethyl}pyrrolidine (199mg, 0.486mmo1), the
mesylate from step Q (140mg, 0.458mmo1), potassium carbonate
- 147 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699 -
(165mg, 1.19mmol), and sodium iodide {289mg, 1.93mmo1) in DMF
(l.Sml), were heated at 55°C for 16 hrs. The cooled mixture was
diluted with EtOAc, washed with NaHC03 solution and brine , dried
(Na2S04) and the solvent evaporated in vacuo. The residue was
purified by preparative HPLC (C-18, 95:5 to 5:95 water in
acetonitrile containing 0.1% TFA, gradient elution). The title
compound was obtained as a white solid after lyophillisation.
Anal. calc'd for C34H36N5O2Cl 3.00 TFA, 0.85 H20:
C, 51.14; H, 4.37, N, 7.45.
Found: C, 51.1 S; H, 4.42; N, 6.86.
FAB HRMS exact mass calc'd for C34H37N5O2C1
582.263579(MH+),
Found: 582.263900.
EXAMPLE 10
In vitro inhibition
Transferase Assays. Isoprenyl-protein transferase
activity assays were carried out at 30°C unless noted otherwise. A
typical reaction contained {in a final volume of SO ~.L): [3H]farnesyl
diphosphate or [3H]geranylgeranyl diphosphate, Ras protein , 50 mM
HEPES, pH 7.5, 5 mM MgCl2, S mM dithiothreitol, 10 ~ZM ZnCl2, 0.1 %
polyethyleneglycol {PEG) ( 15,000-20,000 mw) and isoprenyl-protein
transferase. A modulating anion such as lOmM glycerol phosphate or
SmM ATP may also be added to the assay medium.
The FPTase employed in the assay was prepared by recombinant
expression as described in Omer, C.A., Kral, A.M., Diehl, R.E.,
Prendergast, G.C., Powers, S., Allen, C.M., Gibbs, J.B. and Kohl,
N.E..(1993) Biochemistry 32:5167-5176. The geranylgeranyl-protein
transferase-type I employed in the assay was prepared as described in
U.S. Pat. No. 5,470,832, incorporated by reference. After thermally
pre-equilibrating the assay mixture in the absence of enzyme, reactions
were initiated by the addition of isoprenyl-protein transferase and
stopped at timed intervals (typically 15 min) by the addition of 1 M HCl
- 148 -
CA 02301880 2000-02-25
W0 99/18525 PCT/US98/17699
in ethanol ( 1 mL). The quenched reactions were allowed to stand for 15
m (to complete the precipitation process). After adding 2 mL of 100%
ethanol, the reactions were vacuum-filtered through Whatman GF/C
filters. Filters were washed four times with 2 mL aliquots of 100%
ethanol, mixed with scintillation fluid { 10 mL) and then counted in a
Beckman LS3801 scintillation counter .
Fox inhibition studies, assays were run as described above,
except inhibitors were prepared as concentrated solutions in 100%
dimethyl sulfoxide and then diluted 20-fold into the enzyme assay
mixture. Substrate concentrations for inhibitor IC50 determinations
were as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 2), 100 nM
farnesyl diphosphate; GGPTase-I, 500 nM Ras-GAIL (SEQ.ID.NO.: 3),
100 nM geranylgeranyl diphosphate.
EXAMPLE 11
Modified In vitro GGTase inhibition assay
The modified geranylgeranyl-protein transferase inhibition
assay is carried out at room temperature. A typical reaction contains (in
a final volume of 50 ~.L): [3H]geranylgeranyl diphosphate, biotinylated
Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example
10 mM glycerophosphate or SrnM ATP), 7 mM MgCl2, 10 ~.M ZnCl2,
0.1 % PEG ( 15,000-20,000 mw), 2 mM dithiothreitol, and
geranylgeranyl-protein transferase type I (GGTase-I). The GGTase-
type I enzyme employed in the assay is prepared as described in U.S.
Pat. No. 5,470,832, incorporated by reference. The Ras peptide is
derived from the K4B-Ras protein and has the following sequence:
biotinyl-GKKKKKKSKTKCVIM (single amino acid code)
(SEQ.ID.NO.: 13). Reactions are initiated by the addition of GGTase
and stopped at timed intervals (typically 15 min) by the addition of 200
~,L of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation
Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4,
containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are
allowed to stand for 2 hours before analysis on a Packard TopCount
scintillation counter.
- 149 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
For inhibition studies, assays are run as described above,
except inhibitors are prepared as concentrated solutions in 100%
dimethyl sulfoxide and then diluted 25-fold into the enzyme assay
mixture. For inhibition studies with slow-binding inhibitors, GGTase
and inhibitors are preincubated for one hour and reactions are initiated
by the addition of peptide substrate, following methodology described
by J.F. Morrison, C.T. Walsh, Adv. Enzymol. & Related Areas Mol.
Biol., 61 201-301 {1988). ICSO values are determined with Ras peptide
near KM concentrations. Enzyme and substrate concentrations for
inhibitor ICSO determinations are as follows: 75 pM GGTase-I, 1.6 ~,M
Ras peptide, 100 nM geranylgeranyl diphosphate.
Alternatively, enzymologic K; values for inhibition of
GGPTase-I can be determined using the methodology described by I. H.
Segel ("Enzyme Kinetics", pages 342-345; Wiley and Sons, New York,
N.Y. (1975) and references cited therein).
EXAMPLE 13
dell-basedin vitro ras prenylation assaX
The cell lines used in this assay consist of either Ratl or
NIH3T3 cells transformed by either viral H-ras; an N-ras chimeric gene
in which the C-terminal hypervariable region of v-H-ras was substituted
with the corresponding region from the N-ras gene; or ras-CVLL
(SEQ.ID.NO.: 1), a viral-H-ras mutant in which the C-terminal exon
encodes leucine instead of serine, making the encoded protein a substrate
for geranylgeranylation by GGPTase I. The assay can also be performed
using cell lines transformed with human H-ras, N-ras or Ki4B-ras. The
assay is performed essentially as described in DeClue, J.E. et al., Cancer
Research 51:712-717, (1991). Cells in 10 cm dishes at 50-75%
confluency are treated with the test compound{s) (final concentration
of solvent, methanol or dimethyl sulfoxide, is 0.1 %). After 4 hours
at 37°C, the cells are labeled in 3 ml methionine-free DMEM supple-
mented with 10% regular DMEM, 2% fetal bovine serum, 400
~,Ci[35S]methionine (1000 Ci/mmol) and test compound(s). Cells
treated with lovastatin, a compound that blocks Ras processing in
- 150 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
cells by inhibiting the rate-limiting step in the isoprenoid biosynthetic
pathway (Hancock, J.F. et al. Cell, 57:1167 (19$9); DeClue, J.E.
et al. Cancer Res., S 1:712 ( 1991 ); Sinensky, M. et al. J. Biol. Chem.,
265:19937 ( 1990)), serve as a positive control in this assay. After an
additional 20 hours, the cells are lysed in 1 ml lysis buffer ( 1 % NP40/20
mM HEPES, pH 7.5/5 mM MgCl2/1mM DTT/10 mg/ml aprotinen/2
mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates
cleared by centrifugation at 100,000 x g for 45 min. Alternatively, four
hours after the addition of the labeling media, the media is removed, the
cells washed, and 3 ml of media containing the same or a different test
compound added. Following an additional 16 hour incubation, the lysis
is carried out as above. Aliquots of lysates containing equal numbers of
acid-precipitable counts are bought to 1 ml with IP buffer (lysis buffer
lacking DTT) and immunoprecipitated with the ras-specific monoclonal
antibody Y13-259 {Furth, M.E. et al., J. Virol. 43:294-304, (19$2)).
Following a 2 hour antibody incubation at 4°C, 200 ~.1 of a 25%
suspen-
sion of protein A-Sepharose coated with rabbit anti rat IgG is added for
45 min. The immunoprecipitates are washed four times with IP buffer
{20 nM HEPES, pH 7.5/ 1 mM EDTA/ 1 % Triton X-100Ø5 %
deoxycholate/0.1 %/SDS/0.1 M NaCI) boiled in SDS-PAGE sample
buffer and loaded on 13 % acrylamide gels. When the dye front reached
the bottom, the gel is fixed, soaked in Enlightening, dried and auto-
radiographed. The intensities of the bands corresponding to prenylated
and nonprenylated Ras proteins are compared to determine the percent
inhibition of prenyl transfer to protein.
EXA i P
Construction of SEAP reporter nlasmid pDSE100
The SEAP reporter plasmid, pDSE100 was constructed
by ligating a restriction fragment containing the SEAP coding sequence
into the plasmid pCMV-RE-AKI. The SEAP gene is derived from
the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA). The plasmid
pCMV-RE-AKI was constructed by Deborah Jones (Merck) and contains
- 151 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/1~699
sequential copies of the 'dyad symmetry response element' cloned
upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus
immediate early promoter. The plasmid also contains a bovine growth
hormone poly-A sequence.
5 The plasmid, pDSE100 was constructed as follows. A
restriction fragment encoding the SEAP coding sequence was cut out
of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and
HpaI. The ends of the linear DNA fragments were filled in with the
Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA
containing the SEAP gene was isolated by electrophoresing the digest in
an agarose gel and cutting out the 1694 base pair fragment. The vector
plasmid pCMV-RE-AKI was linearized with the restriction enzyme
Bgl-II and the ends filled in with Klenow DNA Polymerase I. The
SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI
vector and the ligation products were transformed into DHS-alpha E.
coli cells {Gibco-BRL). Transformants were screened for the proper
insert and then mapped for restriction fragment orientation. Properly
oriented recombinant constructs were sequenced across the cloning
junctions to verify the correct sequence. The resulting plasmid contains
the SEAP coding sequence downstream of the DSE and CAT-TATA
promoter elements and upstream of the BGH poly-A sequence.
Alternative Construction of SEAP reporter ~lasmid pDSE101
The SEAP repotrer plasmid, pDSE101 is also constructed
by ligating a restriction fragment containing the SEAP coding sequence
into the plasmid pCMV-RE-AKI. The SEAP gene is derived from
plasmid pGEM7zf(-)/SEAP.
The plasmid pDSE101 was constructed as follows:
A restriction fragment containing part of the SEAP gene coding
sequence was cut out of the plasmid pGEM7zf(-)/SEAP using the
restriction enzymes Apa I and KpnI. The ends of the linear DNA
fragments were chewed back with the Klenow fragment of E. coli DNA
Polymerase I. The "blunt ended" DNA containing the truncated SEAP
gene was isolated by electrophoresing the digest in an agarose gel and
- 152 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
cutting out the 1910 base pair fragment. This 1910 base pair fragment
was ligated into the plasmid pCMV-RE-AKI which had been cut with
Bgl-II and filled in with E. coli Klenow fragment DNA polymerase.
Recombinant plasmids were screened for insert orientation and
sequenced through the ligated junctions. The plasmid pCMV-RE-AKI is
derived from plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang,
M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E.
(1987) J. Virol., 6I, 1796-1807) by removing an EcoRI fragment
containing the DHFR and Neomycin markers. Five copies of the fos
promoter serum response element were inserted as described previously
(Jones, R.E., Defeo-Jones, D., McAvoy, E.M., Vuocolo, G.A.,
Wegrzyn, R.J., Haskell, K.M. and Oliff, A. ( 1991 ) Oncogene, 6,
745-751 ) to create plasmid pCMV-RE-AKI.
The plasmid pGEM7zf(-)/SEAP was constructed as follows. The SEAP
gene was PCRed, in two segments from a human placenta cDNA library
(Clontech) using the following oligos.
Sense strand N-terminal SEAP : 5'
GAGAGGGAATTCGGGCCCTTCCTGCAT
GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.N0.:4)
Antisense strand N-terminal SEAP: 5'
GAGAGAGCTCGAGGTTAACCCGGGT
GCGCGGCGTCGGTGGT 3' (SEQ.ID.N0.:5)
Sense strand C-terminal SEAP: 5'
GAGAGAGTCTAGAGTTAACCCGTGGTCC
CCGCGTTGCTTCCT 3' (SEQ.ID.N0.:6)
Antisense strand C-terminal SEAP: 5'
GAAGAGGAAGCTTGGTACCGCCACTG
GGCTGTAGGTGGTGGCT 3' (SEQ.ID.N0.:7)
- 153 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17b99
The N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used
to generate a 1560 by N-terminal PCR product that contained EcoRI
and HpaI restriction sites at the ends. The Antisense N-terminal oligo
(SEQ.ID.NO.: 5) introduces an internal translation STOP codon within
the SEAP gene along with the HpaI site. The C-terminal oligos
(SEQ.ID.NO.: 6 and SEQ.ID.NO.: 7) were used to amplify a 412 by
C-terminal PCR product containing Hpal and HindIII restriction sites.
The sense strand C-terminal oligo (SEQ.ID.NO.: 6) introduces the
internal STOP codon as well as the Hpal site. Next, the N-terminal
amplicon was digested with EcoRI and HpaI while the C-terminal
amplicon was digested with HpaI and HindIII. The two fragments
comprising each end of the SEAP gene were isolated by electro-
phoresing the digest in an agarose gel and isolating the 1560 and 412
base pair fragments. These two fragments were then co-ligated into the
vector pGEM7zf(-) (Promega) which had been restriction digested with
EcoRI and HindIII and isolated on an agarose gel. The resulting clone,
pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene
from amino acids.
Construction of a constitutivel~expressi g~SEAP lap smid
pCMV-SEAP-A
An expression plasmid constitutively expressing the SEAP
protein was created by placing the sequence encoding a truncated SEAP
gene downstream of the cytomegalovirus (CMV) IE-1 promoter. The
expression plasmid also includes the CMV intron A region 5' to the
SEAP gene as well as the 3' untranslated region of the bovine growth
hormone gene 3' to the SEAP gene.
The plasmid pCMVIE-AKI-DHFR (Whang , Y.,
Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W.,
and Kieff, E. (1987) J. Virol., 61:1796-1807) containing the CMV
immediate early promoter was cut with EcoRI generating two
fragments. The vector fragment was isolated by agarose electrophoresis
and religated. The resulting plasmid is named pCMV-AKI. Next, the
cytomegalovirus intron A nucleotide sequence was inserted downstream
- 154 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
of the CMV IE1 promter in pCMV-AKI. The intron A sequence was
isolated from a genomic clone bank and subcloned into pBR322 to
generate plasmid p 16T-286. The intron A sequence was mutated at
nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer,
R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-
3986) to remove a SacI restriction site using site directed mutagenesis.
The mutated intron A sequence was PCRed from the plasmid pl6T-287
using the following oligos.
Sense strand: 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3'
(SEQ.ID.NO.: 8)
Antisense strand: 5' GAGAGATCTCAAGGACGGTGACTGCAG 3'
(SEQ.ID.NO.: 9)
These two oligos generate a 991 base pair fragment
with a SacI site incorporated by the sense oligo and a Bgl-II fragment
incorporated by the antisense oligo. The PCR fragment is trimmed with
SacI and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI
is cut with SacI and Bgl-II and the larger vector fragment isolated by
agarose gel electrophoresis. The two gel isolated fragments are ligated
at their respective SacI and Bgl-II sites to create plasmid pCMV-AKI-
InA.
The DNA sequence encoding the truncated SEAP gene
is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the
vector. The SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP
(described above) using EcoRI and HindIII. The fragment is filled in
with Klenow DNA polymerase and the 1970 base pair fragment isolated
from the vector fragment by agarose gel electrophoresis. The pCMV-
AKI-InA vector is prepared by digesting with Bgl-II and filling in the
ends with Klenow DNA polymerase. The final construct is generated by
blunt end ligating the SEAP fragment into the pCMV-AKI-InA vector.
Transformants were screened for the proper insert and then mapped for
restriction fragment orientation. Properly oriented recombinant
- 155 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
constructs were sequenced across the cloning junctions to verify the
correct sequence. The resulting plasmid, named pCMV-SEAP-A
(deposited in the ATCC under Budapest Treaty on August 27, 1998, and
designated ATCC), contains a modified SEAP sequence downstream of
the cytomegalovirus immediately early promoter IE-1 and intron A
sequence and upstream of the bovine growth hormone poly-A sequence.
The plasmid expresses SEAP in a constitutive manner when transfected
into mammalian cells.
Alternative construction of a constitutively exn~ ressin Sg~ EAP plasmid
nCMV-SEAP-B
An expression plasmid constitutively expressing the SEAP
protein can be created by placing the sequence encoding a truncated
SEAP gene downstream of the cytomegalovirus (CMV) IE-1 promoter
and upstream of the 3' unstranslated region of the bovine growth
hormone gene.
The plasmid pCMVIE-AKI-DHFR (Whang , Y.,
Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W.,
and Kieff, E. (1987) J. Virol., 61:1796-1807) containing the CMV
immediate early promoter and bovine growth hormone poly-A sequence
can be cut with EcoRI generating two fragments. The vector fragment
can be isolated by agarose electrophoresis and religated. The resulting
plasmid is named pCMV-AKI. The DNA sequence encoding the
truncated SEAP gene can be inserted into the pCMV-AKI plasmid
at a unique Bgl-II in the vector. The SEAP gene is cut out of plasmid
pGEMzf(-)/SEAP (described above) using EcoRI and HindIII. The
fragments are filled in with Klenow DNA polymerase and the 1970
base pair fragment is isolated from the vector fragment by agarose gel
electrophoresis. The pCMV-AKI vector is prepared by digesting with
Bgl-II and filling in the ends with Klenow DNA polymerase. The final
construct is generated by blunt end ligating the SEAP fragment into the
vector and transforming the ligation reaction into E. coli DHSa cells.
Transformants can then be screened for the proper insert and mapped
for restriction fragment orientation. Properly oriented recombinant
constructs would be sequenced across the cloning junctions to verify
- 156 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699 y
the correct sequence. The resulting plasmid, named pCMV-SEAP-B
contains a modified SEAP sequence downstream of the cytomegalovirus
immediate early promoter, IE1, and upstream of a bovine growth
hormone poly-A sequence. The plasmid would express SEAP in a
constitutive nammer when transfected into mammalian cells.
Cloning of a Myristv,-dated v~j,'ral-H-ras expression plasmid pSMS600.
A DNA fragment containing viral-H-ras can be PCRed
from plasmid "HB-11 (deposited in the ATCC under Budapest Treaty
on August 27, 1997, and designated ATCC 209,218) using the following
oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAA
GGACCCCAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTG
G 3'. (SEQ.ID.NO.: 10)
Antisense:
5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3'.
(SEQ.ID.NO.:11)
A sequence encoding the first 15 aminoacids of the
v-src gene, containing a myristylation site, is incorporated into the
sense strand oligo. The sense strand oligo also optimizes the 'Kozak'
translation initiation sequence immediately 5' to the ATG start site. To
prevent prenylation at the viral-ras C-terminus, cysteine 186 would be
mutated to a serine by substituting a G residue for a C residue in the
C-terminal antisense oligo. The PCR primer oligos introduce an XhoI
site at the 5' end and a XbaI site at the 3' end. The XhoI-XbaI fragment
can be ligated into the mammalian expression plasmid pCI (Promega)
cut with XhoI and XbaI. This results in a plasmid, pSMS600, in which
the recombinant myr-viral-H-ras gene is constitutively transcribed from
the CMV promoter of the pCI vector.
loni of a viral-H-ras-CVLL expression lad smid pSMS601
- 157 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
A viral-H-ras clone with a C-terminal sequence encoding
the amino acids CVLL can be cloned from the plasmid "HB-11" by PCR
using the following oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-
3' (SEQ.ID.NO.: 12)
Antisense strand:
5' CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3'
(SEQ.ID.NO.: 13)
The sense strand oligo optimizes the 'Kozak' sequence and
adds an XhoI site. The antisense strand mutates serine 189 to leucine
and adds an XbaI site. The PCR fragment can be trimmed with XhoI
and XbaI and ligated into the XhoI-XbaI cut vector pCI (Promega).
This results in a plasmid, pSMSb0l, in which the mutated viral-H-ras-
CVLL gene is constitutively transcribed from the CMV promoter of the
pCI vector.
Cloning of cellular-H-ras-Leu61 expression ,plasmid S~-N~,
The human cellular-H-ras gene can be PCRed from a
human cerebral cortex cDNA library (Clontech) using the following
oligonucleotide primers.
Sense strand:
5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3'
(SEQ.ID.NO.: 14)
Antisgnse s ~d:
5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3'
(SEQ.ID.NO.: 1S)
The primers will amplify a c-H-Ras encoding DNA
fragment with the primers contributing an optimized 'Kozak' translation
start sequence, an EcoRI site at the N-terminus and a Sal I site at the
- 158 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
C-terminal end. After trimming the ends of the PCR product with
EcoRI and Sal I, the c-H-ras fragment can be ligated ligated into an
EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation
of glutamine-61 to a leucine can be accomplished using the
manufacturer's protocols and the following oligonucleotide:
5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.NO.: 16)
After selection and sequencing for the correct nucleotide
substitution, the mutated c-H-ras-Leu61 can be excised from the pAlter-
1 vector, using EcoRI and Sal I, and be directly ligated into the vector
pCI (Promega) which has been digested with EcoRI and Sal I. The new
recombinant plasmid, pSMS620, will constitutively transcribe c-H-ras-
Leu61 from the CMV promoter of the pCI vector.
Cloning of a c-N-ras-Val-12 e~ression plasmid pSMS630
The human c-N-ras gene can be PCRed from a human
cerebral cortex cDNA library (Clontech) using the following
oligonucleotide primers.
Sense strand:
5' -GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3'
(SEQ.ID.NO.: 17)
Antisense strand:
5' -GAGAGTCGACTTGTTACATCACCACACATGGC-3'
(SEQ.ID.NO.: 18)
The primers will amplify a c-N-Ras encoding DNA
fragment with the primers contributing an optimized 'Kozak' translation
start sequence, an EcoRI site at the N-terminus and a Sal I site at the
C-terminal end. After trimming the ends of the PCR product with
EcoRI and Sal I, the c-N-ras fragment can be ligated into an EcoRI -Sal
I cut mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to
a valine can be accomplished using the manufacturer's protocols and the
following oligonucleotide:
- 159 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
S'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 19)
After selection and sequencing for the correct nucleotide
substitution, the mutated c-N-ras-VaI-12 can be excised from the pAlter-
1 vector, using EcoRI and Sal I, and be directly ligated into the vector
pCI (Promega) which has been digested with EcoRi and Sal I. The new
recombinant plasmid, pSMS630, will constitutively transcribe c-N-ras-
Val-12 from the CMV promoter of the pCI vector.
Cloning of a c-K4B-ras-Val-12 expression plasmid pSMS640
The human c-K4B-ras gene can be PCRed from a human
cerebral cortex cDNA library (Clontech) using the following oligo-
nucleotide primers.
Sense strand:
5' -GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3'
(SEQ.ID.NO.: 20)
Antisense strand:
5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3'
(SEQ.ID.NO.: 21)
The primers will amplify a c-K4B-Ras encoding DNA
fragment with the primers contributing an optimized 'Kozak' translation
start sequence, a KpnI site at the N-terminus and a Sal I site at the
C-terminal end. After trimming the ends of the PCR product with Kpn
I and Sal I, the c-K4B-ras fragment can be ligated into a KpnI -Sal I cut
mutagenesis vector pAlter-1 (Promega). Mutation of cysteine-12 to a
valine can be accomplished using the manufacturer's protocols and the
following oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.N0.:22)
After selection and sequencing for the correct nucleotide
substitution, the mutated c-K4B-ras-Val-12 can be excised from the
pAlter-1 vector, using KpnI and Sal I, and be directly ligated into the
- 160 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
vector pCI (Promega) which has been digested with Kpnl and Sal I.
The new recombinant plasmid will constitutively transcribe c-K4B-
ras-Val-12 from the CMV promoter of the pCI vector.
Cloning of c-K-ras4A-Val-12 expression plasmid pSMS650
The human c-K4A-ras gene can be PCRed from a human
cerebral cortex cDNA library (Clontech) using the following oligo-
nucleotide primers.
Sense strand:
5' -GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3'
(SEQ.ID.NO.: 23)
Antisense strand:
5'-
CTCTGTCGACAGATTACATTATAATGCATTTTTTAATTTTCACA
C-3' (SEQ.ID.N0.:24)
The primers will amplify a c-K4A-Ras encoding DNA
fragment with the primers contributing an optimized 'Kozak' translation
start sequence, a Kpnl site at the N-terminus and a Sal I stite at the
C-terminal end. After trimming the ends of the PCR product with Kpn
I and SaI I, the c-K-ras4A fragment can be ligated into a KpnI -Sal I cut
mutagenesis vector pAlter-1 (Promega). Mutation of cysteine-12 to a
valine can be accomplished using the manufacturer's protocols and the
following oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.N0.:25)
After selection and sequencing for the correct nucleotide
substitution, the mutated c-K4A-ras-Val-12 can be excised from the
pAlter-1 vector, using KpnI and Sal I, and be directly ligated into the
vector pCI (Promega) which has been digested with KpnI and Sal I.
The new recombinant plasmid, pSMS650, will constitutively transcribe
c-K4A-ras-Val-12 from the CMV promoter of the pCI vector.
HEAP assaX
- 161 -
CA 02301880 2000-02-25
WO 99110525 PC'T/US98/17699
Human C33A cells (human epitheial carcenoma - ATTC
collection) are seeded in lOcm tissue culture plates in DMEM + 10%
fetal calf serum + 1X Pen/Strep + 1X glutamine + 1X NEAR. Cells are
grown at 37oC in a 5% C02 atmosphere until they reach 50 -80% of
confluency.
The transient transfection is performed by the CaP04
method (Sambrook et al., 1989). Thus, expression plasmids for H-ras,
N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the
DSE-SEAP reporter construct. (A ras expression plasmid is not
included when the cell is transfected with the pCMV-SEAP plasmid.)
For l Ocm plates 600.1 of CaCl2 -DNA solution is added dropwise
while vortexing to 600p,1 of 2X HBS buffer to give 1.2m1 of precipitate
solution (see recipes below). This is allowed to sit at room temperature
for 20 to 30 minutes. While the precipitate is forming, the media on
the C33A cells is replaced with DMEM (minus phenol red; Gibco cat.
No. 31053-028)+ 0.5% charcoal stripped calf serum + 1X (Pen/Strep,
Glutamine and nonessential aminoacids). The CaPOq.-DNA precipitate
is added dropwise to the cells and the plate rocked gently to distribute.
DNA uptake is allowed to proceed for 5-6 hrs at 37oC under a 5% C02
atmosphere.
Following the DNA incubation period, the cells are washed
with PBS and trypsinized with lml of 0.05% trypsin. The 1 ml of
trypsinized cells is diluted into lOml of phenol red free DMEM + 0.2%
charcoal stripped calf serum + 1X (Pen/Strep, Glutamine and NEAA ).
Transfected cells are plated in a 96 well microtiter plate ( 100~,1/well) to
which drug, diluted in media, has already been added in a volume of
100.1. The final volume per well is 200p,1 with each drug concentration
repeated in triplicate over a range of half-log steps.
Incubation of cells and drugs is for 36 hrs at 37~ under
C02. At the end of the incubation period, cells are examined micro-
scopically for evidence of cell distress. Next, 100[~l of media containing
the secreted alkaline phosphatase is removed from each well and trans-
- 162 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
ferred to a microtube array for heat treatment at 65oC for 1 hr to
inactivate endogenous alkaline phosphatases (but not the heat stable
secreted phosphatase).
The heat treated media is assayed for alkaline phosphatase
by a luminescence assay using the luminescence reagent CSPD~
(Tropix, Bedford, Mass.). A volume of 50 ~l media is combined
with 200 ~.1 of CSPD cocktail and incubated for 60 minutes at room
temperature. Luminesence is monitored using an ML2200 microplate
luminometer (Dynatech). Luminescence reflects the level of activation
of the fos reporter construct stimulated by the transiently expressed
protein.
DNA-CaPOg~recipitate for lOcm. plate of cells
Ras expression plasrnid ( 1 ~.g/~.1) 10,1
DSE-SEAP Plasmid ( 1 ~,g/~l) 2~.1
Sheared Calf Thymus DNA (l~,g/~.1) 8~1
2M CaCl2 741
dH20 5061
2X HBS Buffer
280mM NaCI
IOmM KCl
l.SmM Na2HP04 2H20
l2mM dextrose
SOmM HEPES
Final pH = 7.05
Luminese~ce Buffer (26m1)
Assay Buffer 20m1
Emerald ReagentTM (Tropix) 2.Sm1
100mM homoarginine 2.Sm1
CSPD Reagent~ (Tropix) l.Oml
Assay Buffer
- 163 -
CA 02301880 2000-02-25
WO 99110525 PCTIUS98/17699
Add O.OSM Na2C03 to O.OSM NaHC03 to obtain pH 9.5.
Make 1 mM in MgCl2
EXAMPLE 14
Alternate Expression Plasmids
S'loning of a Myristylated c-H-ras expression plasmid pSM~621
A myristylated c-H-ras-Leu-61 expression plasmid can be
cloned by PCR from plasmid pSMS620 (above) using the following
primers:
Sense strand:
5'TCTCGAATTCGCCACCATGGGGAGTAGCAAGAGCAAGCCTAA
GGACCCCAGCCAGCGCCGGATGACGGAATATAAGCTGGTGG3'
(SEQ.ID.NO.: 26).
Antisense strand:
5'-GAGAGTCGACGCGTCAGGAGAGCACAGACTTGC-3'
(SEQ.ID.N0.:27)
A sequence encoding the first 15 aminoacids of the
v-src gene, containing a myristylation site, is incorporated into the
\sense strand oligo. The sense strand oligo also optimizes the 'Kozak'
translation initiation sequence immediately 5' to the ATG start site.To
prevent prenylation at the v-Ras C-terminus, cysteine 186 would be
mutated to a serine by substituting a G residue for a C residue in the
C-terminal antisense oligo. The PCR primer oligos introduce an EcoRI
site at the 5' end and a Sal I site at the 3'end. The EcoRI-Sal I fragment
can be ligated into the mammalian expression plasmid pCI (Promega)
cut with EcoRI and Sal I. This results in a plasmid, pSMS621 in which
the recombinant myr-c-H-ras-Ser-186 gene is constitutively transcribed
from the CMV promoter of the pCI vector.
Cloning of a c-H-ras-CVLL expression ~lasmid pSMS622
- 164 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
A c-H-ras clone with a C-terminal sequence encoding the
amino acids CVLL can be cloned from the plasmid pSMS620 (above) by
PCR using the following oligos.
Sense strand:
5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3'
{SEQ.ID.NO.: 28)
Antisense strand:
5'-GAGAGTCGACGCGTCAGAGGAGCACACACTTGC-3'
(SEQ.ID.NO.: 29)
The sense strand oligo optimizes the 'Kozak' sequence and
adds an EcoRI site. The antisense strand mutates serine 189 to leucine
and adds a Sal I site. The PCR fragment can be trimmed with EcoRI
and Sal I and ligated into the EcoRI-Sal I cut vector pCI (Promega).
This results in a plasmid, pSMS622 in which the mutated c-H-ras-
Leu61-CVLL gene is constitutively transcribed from the CMV
promoter of the pCI vector.
EXAMPLE 15
In vivo tumor growth inhibition assay (nude mouse)
In vivo efficacy as an inhibitor of the growth of cancer
cells may be confirmed by several protocols well known in the art.
Examples of such in vivo efficacy studies are described by N. E. Kohl et
al. (Nature Medicine, 1:792-797 (1995)) and N. E. Kohl et al. (Proc.
Nat. Acad. Sci. U.S.A., 91:9141-9145 (1994)).
Rodent fibroblasts transformed with oncogenically mutated
human Ha-ras or Ki-ras (106 cells/animal in 1 ml of DMEM salts)
are injected subcutaneously into the left flank of 8-12 week old female
nude mice (Harlan) on day 0. The mice in each oncogene group are
randomly assigned to a vehicle, compound or combination treatment
group. Animals are dosed subcutaneousiy starting on day 1 and daily
- 165 -
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
for the duration of the experiment. Alternatively, the farnesyl-protein
transferase inhibitor may be administered by a continuous infusion
pump. Compound, compound combination or vehicle is delivered in a
total volume of 0.1 ml. Tumors are excised and weighed when all of
the vehicle-treated animals exhibited lesions of 0.5 - 1.0 cm in diameter,
typically 11-15 days after the cells were injected. The average weight
of the tumors in each treatment group for each cell line is calculated.
- 166 -
*rB
CA 02301880 2000-02-25
WO 99/10525 PCTNS98/17699
SEQUENCE LISTING
<110> Heimbrook, David C.
DeFeo-Jones, Deborah
Oliff, Allen I.
Stirdivant. Steven M.
<120> A METHOD OF TREATING CANCER
<130> 20036Y
<150> 60/057,102
<151> 1997-08-27
<160> 29
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4
<212> PRT
<213> Artificial Sequence
<400> 1
Cys Val Leu Ser
1
<210> 2
<211> 4
<212> PRT
<213> Artificial Sequence
<400> 2
Cys Ala Ile Leu
1
<210> 3
<211> 4
<212> PRT
<213> Artificial Sequence
<400> 3
Cys Val Leu Leu
1
<210> 4
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 4
gagagggaat tcgggccctt cctgcatgct gctgctgctg ctgctgctgg gc 52
<210> 5
-1-
SUSSTiTUTE SHEET (RULE 26)
CA 02301880 2000-02-25
WO 99/1OS25 PC'TNS98/17699
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 5
41
gagagagctc gaggttaacc cgggtgcgcggcgtcggtgg t
<210> 6
<211> 42
<212> DNA
<213> Artificial Sequence
<400> 6
gagagagtct agagttaacc cgtggtccccgcgttgcttc ct 42
<210> 7
<211> 43
<212> DNA
<213> Artificial Sequence
<400> 7
gaagaggaag cttggtaccg ccactgggctgtaggtggtg get 43
<210> 8
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 8
ggcagagctc gtttagtgaa ccgtcag 27
<210> 9
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 9
gagagatctc aaggacggtg actgcag 27
<210> 10
<211> 86
<212> DNA
<213> Artificial Sequence
<400> 10
tctcctcgag gccaccatgg ggagtagcaagagcaagcct aaggacccca gccagcgccg60
gatgacagaa tacaagcttg tggtgg 86
<210> 11
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 11
cacatctaga tcaggacagc acagacttgcagc 33
-2-
SUBSTITUTE SHEET (RUSE 28)
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
<210> 12
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 12
tctcctcgag gccaccatga cagaatacaa gcttgtggtg g 41
<210> 13
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 13
cactctagac tggtgtcaga gcagcacaca cttgcagc 38
<210> 14
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 14
gagagaattc gccaccatga cggaatataa gctggtgg 38
<210> 15
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 15
gagagtcgac gcgtcaggag agcacacact tgc 33
<210> 16
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 16
ccgccggcct ggaggagtac ag 22
<210> 17
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 17
gagagaattc gccaccatga ctgagtacaa actggtgg 38
<210> 18
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 18
gagagtcgac ttgttacatc accacacatg gc 32
-3-
SUBSTITUTE SHEET (RULE 26)
CA 02301880 2000-02-25
WO 99/10525 PCT/US98/17699
<210> 19
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 19
gttggagcag ttggtgttgg g 21
<210> 20
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 20
gagaggtacc gccaccatga ctgaatataaacttgtgg 38
<210> 21
<211> 36
<212> DNA
<213> Artificial Sequence
<400> 21
ctctgtcgac gtatttacat aattacacactttgtc 36
<210> 22
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 22
gtagttggag ctgttggcgt aggc 24
<210> 23
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 23
38
gagaggtacc gccaccatga ctgaatataaacttgtgg
<210> 24
<211> 45
<212> DNA
<213> Artificial Sequence
<400> 24
ctctgtcgac agattacatt ataatgcattttttaatttt cacac 45
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 25
gtagttggag ctgttggcgt aggc 24
-4-
SUBSTITUTE SHEET (RULE 2~)
CA 02301880 2000-02-25
WO 99110525 PCT/US98/17699
<210> 26
<211> 83
<212> DNA
<213> Artificial Sequence
<400> 26
tctcgaattc gccaccatgg ggagtagcaa gagcaagcct aaggacccca gccagcgccg 60
gatgacggaa tataagctgg tgg 83
<210> 27
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 27
gagagtcgac gcgtcaggag agcacagact tgc 33
<210> 28
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 28
gagagaattc gccaccatga cggaatataa gctggtgg 38
<210> 29
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 29
gagagtcgac gcgtcagagg agcacacact tgc 33
SUBSTITUTE SHEET (RULE 2~)
