Note: Descriptions are shown in the official language in which they were submitted.
CA 02306444 2000-04-14
WO 99119496 PCTIUS98/21880
-1-
INHIBITION OF HUMAN IMMLTNODEFICIENCY VIRUS
(HIV-1) REPLICATION
Reference to Government Grants
The invention described herein was made, in part. in the course of
v~ork supported by (.united States Public Health Service Grant RO1-AI3476~.
The
government has certain rights in this invention.
Field of the Invention
This invention relates to intracellular immunization methods and
compositions for inhibiting the replication of human imrrtunodeficiencv virus
a HIV j. and for treating HIV infection and acquired immunodeficiency syndrome
~ AIDS).
Background of the Invention
:~) HIV and AIDS
Human immunodeficiencv virus lHIV) is the etiolosic anent of
acquired imrttunodeficiency syndrome (AIDS. Although much has been learned
about the molecular characteristics of HIV and the progress of AIDS, the
development of efficacious therapeutic or prophylactic treatment regimens has
been beset with obstacles.
B 1 Treatment of HIV infection and AIDS
''0 At the present time, there are no suitable vaccinations or cures for
HIV infection or AIDS. Current strategies against HIV infection and AIDS.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
_7_
including nucleoside analogues and protease inhibitors, have limited
effectiveness
as evidenced by the evolution of resistant retroviral strains.
Until recently, the predominant treatment for HIV infection
consisted of the 2',3'dideoxynucleoside analogues, which act as potent reverse
S transcriptase inhibitors. These compounds can significantly reduce the
levels of
HIV virions in infected individuals, but, due to the low fidelity of HIV
reverse
transcriptase, can also aid in the selection of resistant viral strains.
The development of HIV protease inhibitors and nonnucleaside
reverse transcriptase inhibitors expanded therapeutic options, permitting
10 combination therapies which target multiple stages in the HIV life cycle.
However. these anti-retroviral compounds have diverse side effects which often
lead to complications and cessation of drug therapy. In addition, long-term
studies have not been completed to assess the degree of retroviral mutation
associated with combination therapies in vivo (Moyle et al. , Quart. J. Med.
15 86:155-63 (1993)). Another difficulty with present methods is cost. Annual
costs for the treatment of AIDS with triple combinations of reverse
transcriptase
and protease inhibitors are staggering, and such therapies may need to be
continued indefinitely.
There is a need for additional therapeutic approaches which can
20 control HIV infection, lower the effective dosage of antiviral drugs,
decrease the
associated toxicities, and reduce the development of resistant strains in HIV
infected individuals.
C) Interferon and Interferon Inducible Genes
Interferons are hormone-like proteins involved in the defense
25 mechanism of cells against viral infection and tumors. Type I interferons
have
the capacity to induce a series of antiviral gene products, through signal
transduction pathways, which can interfere with viral infection. Included
within
the family of induced genes are three double-stranded RNA dependent enzymes:
the 2',5'-oligoadenylate synthetase, adenosine deaminase, and the
CA 02306444 2000-04-14
WO 99/19496 PCT/US98I21880
-3-
dsRNA-dependent, interferon-inducible protein kinase, PKR (Baglioni. Cell
17:255-264 (1979); Patterson et al., Virology 210:508-511 (1995)). The p68
protein kinase (PKR) and the 2' ,5'-oligoadenylate synthetase (2-SOAS)/RNase L
pathways inhibit viral replication through the inhibition of protein synthesis
and
degradation of single stranded RNA, respectively.
A serinelthreonine kinase, PKR (which has also been called DAI,
p68, dsl, P1 kinase, and PKds} has been highly conserved in evolution.
Homologous enzymes are present in mammals, yeast, and plants (Chen et al. ,
Proc. Natl. Acad. Sci. USA 88:7729-7733 ( 1991 ); Kostura et al. . Mol. Cell
Biol.
9:1576-1586 (1989); Langland et al., J. Biol. Chem. 271:4539-4544 (1996)).
The human cDNA for PKR encodes a 2.5 kb RNA, which is translated into a 550
amino acid protein (Meurs et al. , Cell 62:379-390 (1990}). The binding of two
molecules of this 68 kDa PKR about a single dsRNA molecule initiates an
autophosphorylation event which is followed by phosphorylation of the a
subunit
of eukaryotic initiation factor 2, preventing a GDP-for-GTP recycling reaction
and leading to inhibition of protein synthesis initiation (Lee et al. ,
Viroloy
193:1037-1041 ((1993); Matthews et al. , J. Virol. 63:5657-5662 ( 1991 );
Pathak
et al., Mol. Cell Biol. 8:993-995 (1988)). Additional substrates for PKR
phosphorylation, including Ix-Ba. and the HIV-1 Tat transactivation proteins.
have recently been identified (Brand et al. , J. Biol. Chem. 272: 8388-8395 (
1997);
Maran et al. , Science 265:789-792 ( 1994); McMillan et al. , Virology 213:413-
424 (1995)). It has been reported that PKR can be activated in vitro by dsRNA
structures located within the 3' untranslated mRNA region of human
a-tropomyosin (Davis et al. , Proc. Natl. Acad. Sci. USA 93:508-513 ( 1996)).
Many eukaryotic viruses, including influenza virus, poliovirus,
Epstein-Barr virus, human T cell leukemia virus type I, adenovirus, and
vaccinia
virus, have developed strategies to down-regulate PKR protein andlor activity,
demonstrating an evolutionary requirement to circumvent this antiviral system
in
order to efficiently replicate (Katze. Seminars Virol. 4:259-268 (1993};
Mathews
et al. , J. Virol. 65:5657-5662 (1991 ); Mordechai et al. , Virology 206:913-
922
CA 02306444 2000-04-14
WO 99/1949b PCTIUS98/21880
-4-
(1995)). PKR has been demonstrated to effectively prevent infection of
eukaryotic cells by encephalomyocarditis and vaccinia viruses (Lee et al. ,
Virology 193:1037-1041 (1993)).
HIV-1 has also devised strategies to interfere with the enzymatic
activities of PKR. It has been reported that HIV-1 infection leads to a
significant
decline in the amount of intracellular PKR protein levels (Roy et al. ,
Science
247:1216-1219 ( 1990)), and that HIV-1 TAR RNA has an optimal PKR activation
concentration and conforms with a bell-shaped activation curve (Maitra et al.
,
Virology 204:823-827 (1994>; Mathews, Seminars Virol. 4:247-257 (1993);
Mordechai et al., Virology- 206:913-922 (1995); Samuel, J. Biol. Chem.
268:7603-7306 (1993)).
The 2', 5' - oligoadenylate synthetase (2-50AS) is another
interferon induced enzyme in the cellular dsRNA-dependent antiviral response.
When activated by dsRNA, the 2-SOAS converts ATP into 2', 5' - oligoadenylate
(2-SA). The 2-5A synthesized by 2-SOAS binds and activates ribonuclease L,
which hydrolyzes both cellular and viral mRNA. In cells infected with HIV-1,
the level of 2-SA is inversely correlated with HIV-1 virion production. In the
initial stage of infection there is a transient activation of 2-50AS, which
leads to
a strong increase in the level of 2-SA. During later stages of infection HIV-1
virion production increases as 2-SA levels decline. It has been reported that
a
high 2-SA level correlates with a low capacity of HIV infected cells to
produce
virus (Schroder er al. , J. Biol. Chern. 264: 5669-73 ( 1989) ), and that the
production of HIV-1 can be inhibited by interferon, which is able to induce 2-
SOAS (Ho et al., Lancet I(8429):602-04 (1985). It has also been reported that
antisense RNA to 2-50AS can result in the loss of protection by interferon
from
viral infection lDeBenedetti et al. , Proc. Natl. Acad. Sci USA 84:658-62 (
1987)).
CA 02306444 2000-04-14
WO 99/19496 PCTNS98I21880
-S-
D) Intracellular Immunization
Intracellular immunization is the regulated expression of a
molecular species designed to interfere with and prevent viral replication.
The
concept and name "intracellular immunization" were proposed by David
Baltimore in 1988 (Nature 335:395-396 (29 September 1988)). Baltimore
proposed that cells could be genetically engineered to express a protein which
would make them resistant to viral infection. Baltimore mentioned that, in the
case of HIV, retroviral vectors could be used to transduce hematopoietic stem
cells with the desired recombinant construct.
In order to be effective, a gene introduced for the purposes of
intracellular immunization must be {i) stably expressed in sufficient
quantities to
interfere with viral replication, (ii) non-toxic to the cell. and (iii>
transferred to
the target cell population in a highly efficient, non-toxic manner (along et
al. ,
Curr. Top. Microbiol. Irnmunol. 179:159-174 ( 1992)).
In one application of intracellular immunization. the desired gene
is introduced into cells under control of the HIV long terminal repeat (LTR).
The
hybrid gene can then be trans-activated by the Tat gene product or by HIV
infection. The Tat protein acts on a cis-acting element of the HIV LTR, known
as the TAR region, to increase expression from the LTR (Arva et al.. Science
229:69-73 (1985))'. The Tat protein is believed to regulate gene expression at
both the transcriptional and translational levels. Initially, the majority of
transcripts which are initiated from within an HIV-1 LTR are incomplete and
the
resulting RNA is prematurely short. with an average length of sixty to eighty
ribonucleotides. The HIV-1 encoded 15 kDa Tat protein has been proposed to
interact with this nascent short message and, in conjunction with cellular
cofactors, bind to a stable RNA stem-loop structure within the HIV-1 LTR. TAR
(Kashanchi et al.. Nature (London) 367:295-299 (1994)). This protein:RNA
interaction is thought to increase RNA elongation efficiency, leading to high-
level
production of full-length mRNAs t Foon et al. . J. Biol. Chem. 271:4201-4208
CA 02306444 2000-04-14
WO 99/19496 PGTIUS98I21880
-6-
(1996); MavankaI et al. , Proc. Natl. Acad. Sci. USA 93:2089-2094 (1996)). It
has been reported that the Tat protein can induce uninfected quiescent T cells
to
become highly permissive for productive HIV-1 infection (Li et al. . Proc.
Natl.
Acad. Sci. USA 94:8116-20 (July 1997)).
5 The Tat protein can also stimulate expression of heterologous
genes placed 3' to a TAR region (Tong-Starksen et al. , Proc. Natl. Acad. Sci.
USA 80:6845-49 (1987)), a property which can be exploited in intracellular
immunization protocols.
U.S. Patent No. 5,554,528 is directed to constructs and methods
10 of intracellular immunization in which a chimeric diphtheria toxin gene is
placed
under the regulatory control of an HIV LTR. The HIV-regulated toxin gene is
stably introduced into HIV susceptible cells using a retroviral (or other)
vector
system, and transformed cells commit suicide in response to HIV infection.
U.S.
Patent No. 5,554,528 discloses a prophetic example in which SCID mice are
15 reconstituted with peripheral blood monocytic cells or bone marrow cells
which
have been transfected with the HIV-regulated diphtheria toxin gene.
Bednarik et al. (Pros. Natl. Acad. Sci. USA 86:4958-4962 (July
1989)) have reported constructs and methods of intracellular immunization in
which an a~-interferon gene is placed under the regulatory control of an HIV-1
20 LTR. Retroviral vectors were used to introduce the HIV-regulated interferon
gene into cells, and the transduced cells exhibited resistance to HIV
infection.
Schroder et al. (FASEB Joatrnal 4:3124-3130 (October 1990); Int.
J. Biochern. 24( 1 ):55-63 ( 1992)) have reported constructs and methods of
intracellular immunization in which a 2-SOAS gene is placed under the
regulatory
25 control of an HIV-1 LTR. A plasmid vector was used to stably transfect HeLa-
T4- cells with the HIV-regulated 2-SOAS gene. Tat-induced activation of the
LTR sequence within the HIV-1 LTR-2-SA synthetase plasmids ted to a transient
increase in 2-SOAS levels and activity, and a delay in the release of mature
HIV-1 virions.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98I21880
_7_
There remains a great need for efficacious therapeutic andlor
prophylactic treatment regimens for the control of HIV infection and AIDS.
Summary of the Invention
The present invention provides constructs and methods for stably
S introducing an antiviral enzyme into target cells, using a construct wherein
antiviral gene expression is activated in the presence of an HIV trans-acting
factor. Upon HIV infection of the target cells, antiviral gene expression is
activated and viral replication is inhibited. This intracellular immunization
approach can generate a reservoir of self-renewing cells which are unable to
10 support HIV replication. The intracellular immunization approach can also
be
used in combination with other antiviral agents (single or multiple
combinations
of drugs such as nucleoside analogs andlor protease inhibitors), resulting in
improved methods for prevention of and treatment for HIV infection and AIDS.
Activation of the antiviral enzyme PKR results in the death of HIV-
15 1 infected cells, thus preventing further viral replication and the
subsequent
infection of neighboring cells. The inventors constructed retroviral vectors
capable of transferring a PKR coding region, under HIV-1 transcriptional
regulation, into target Sup T1 lymphoblastoid cells. The target cells were
then
challenged with HIV-1. HIV replication. as measured by syncytia formation, was
20 inhibited up to 93 % in the transduced cells. The specific blockade of PKR
activity. by treatment of the HIV-1 LTR-PKR cDNA transduced cell lines with
the PKR inhibitor 2-aminopurine, reversed this antiviral effect. Whereas the
expression and activity of PKR in untransduced SupTl cells and in parental
vector transduced clones (N2-20P) were down-regulated 48 hours after HIV-1
25 infection. HIV-1 LTR-PKR cDNA transduced clones showed PKR expression
through 96 hours post-infection, concomitant with maintenance of PKR
autophosphorylation activity. One of the HIV-1 LTR-PKR cDNA transduced
clones. when supplemented with 93 % less 3'-azido-3'-deoxythymidine than N2-
?OP controls, reduced syncytia formation by 90%~. The inventors have also
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98/21880
_g_
shown that intracellular immunization using a 2-5 OAS gene can be used to
control HIV infection.
One embodiment of the present invention provides a recombinant
nucleic acid comprising:
S (a:? a PKR coding region, and
(b) a regulatory element;
wherein the PKR coding region and regulatory element are operatively linked
such that PKR expression is activated in the presence of an HIV traps-acting
factor. In a preferred embodiment the regulatory element comprises all or part
of an HIV LTR. In another preferred embodiment the HIV traps-acting factor is
an HIV Tat protein.
The invention further provides a vector comprising a recombinant
nucleic acid according to the invention. In a preferred embodiment the vector
is
a viral vector. In a more preferred embodiment the vector is a retroviral
vector.
15 In a most preferred embodiment the vector comprises M-MuLV sequences. In
some embodiments the retroviral vector has essentially the characteristics of
pMEA105 or pMEA106.
The invention also provides a viral vector comprising:
(a> a 2-SOAS coding region, and
(b) a regulatory element;
wherein the 2-50AS coding region and regulatory element are operatively linked
such that 2-SOAS expression is activated in the presence of HIV traps-acting
factors. In a preferred embodiment the regulatory element comprises all or
part
of an HIV LTR. In another preferred embodiment the HIV traps-acting factor is
25 an H1V Tat protein. In a most preferred embodiment the viral vector
comprises
M-MuL'' sequences. In some embodiments the viral vector comprises 5' and 3'
M-MuLV LTRs and a neomycin resistance gene. In some embodiments the viral
vector has essentially the characteristics of pMEA109 or pMEA110.
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98/21880
-9-
Another aspect of the invention is a cell comprising a nucleic acid
according to the invention, or a cell which has been transduced or transformed
with a viral vector according to the invention.
In a preferred embodiment the cell is a prokaryotic cell. In another
5 preferred embodiment the cell is a eukaryotic cell. In some preferred
embodiments the cell is a stem cell. In a most preferred embodiment the cell
is
a CD34-expressing cell. In some preferred embodiments the cell is a CD4-
expressing cell. In some embodiments the cell is a retroviral packaging cell
or
a retroviral producer cell. In some embodiments the nucleic acid is stably
10 integrated into the cellular genome in such a way that PKR expression is
activated
by HIV infection. In some embodiments the 2-SOAS coding region and
regulatory element are stably integrated into the cellular genome in such a
way
that the 2-SOAS expression is activated by HIV infection.
The invention also provides a method of inhibiting the replication
15 of HIV comprising introducing a nucleic acid or a vector according to the
invention into a cell which is susceptible to HIV infection. In a preferred
embodiment a PKR coding region operatively linked to a regulatory element is
stably integrated into the cellular genome, such that PKR expression is
activated
by HIV infection. In another preferred embodiment a 2-SOAS coding region
20 operatively linked to a regulatory element is stably integrated into the
cellular
genome, such thaf 2-SOAS expression is activated by HIV infection.
Another aspect of the invention is a method of inhibiting HIV
replication in a patient in need of such treatment comprising introducing a
nucleic
acid or a vector according to the invention into cells from the patient. In a
?5 preferred embodiment at least one chemotherapeutic agent is also
administered
to the patient. In a more preferred embodiment the chemotherapeutic agent is
selected from the group consisting of nucleoside analogs and protease
inhibitors.
In a most preferred embodiment the chemotherapeutic agent is AZT. In some
embodiments the nucleic acid or vector is introduced into the cells ex vivo.
In
30 some embodiments the nucleic acid or vector is introduced into the cells
irr vivo.
CA 02306444 2000-04-14
WO 99119496 PCT/US98/21880
- 10-
In some embodiments the nucleic acid or vector specifically targets stem
cells.
In a most preferred embodiment, the nucleic acid or vector specifically
targets
CD34-expressing cells. In some embodiments the nucleic acid or vector
specifically targets CD4-expressing cells. In some embodiments of the method
5 a PKR coding region operatively linked to a regulatory element is stably
integrated into the cellular genome, such that PKR expression is activated by
HIV
infection. In some embodiments a 2-SOAS coding region operatively linked to
a regulatory element is stably integrated into the cellular genome, such that
2-
SOAS expression is activated by HIV infection.
10 The invention further constitutes a method of preventing HIV
replication in a human host comprising introducing a nucleic acid or a vector
according to the invention into cells from the host. In some embodiments the
nucleic acid or vector is introduced into the cells ex vivo. In some
embodiments
the nucleic acid or vector is introduced into the cells in vivo.
15 The invention also constitutes the use of a nucleic acid or a vector
according to the invention for the preparation of a medicament to inhibit or
prevent HIV replication in a patient or human host.
Other aspects and advantages of the present invention are described
in the drawings and in the following detailed description of the preferred
20 embodiments thereof.
DescriQtion of the Drawings
Figures lA and 1B show the construction and genomic integration
of the HIV-1 LTR-PKR cDNA constructs. Figure lA shows the HIV-I
LTR-PKR cDNA-poly(A} sequence cloned in forward f pMEA 105) and reverse
25 (pMEA106) orientations into the pN2 retroviral vector. Figure 1B shows the
genomic integration of these constructs into the GP+envAml2 retroviral
producer
cell line. The location of XbaI sites in pN2 (N2-20), pMEA105 (105-10}, and
pMEA106 (106-4), and the size of the fragments which contain sequences
complementary to the [3'P]-neo probe are shown. The poly(A} sequence is
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98121880
-11-
depicted as an asterisk (*) 3' to the PKR cDNA sequence. Figure 1C shows a
Southern blot of XbaI digested genomic DNA from the indicated cel! sources.
Lanes 1-3: GP+envAml2 cells supplemented with 10, 1, and 0.1 ng pMEA106
(2681 bp); lane 4: N2-20 retroviral producing cells (3283 bp), lane 5: N2-20
transduced, 6418 selected SupTl cells (3283 bp); lane 6: 106-4 retroviral
producing cells (2681 bp); lane 7: 106-4 transduced, 6418 selected SupTI cells
(2681 bp). Arrows depict the migration of the expected 3283 and 2681 by
fragments. The migration of fragments from a lambda HindIII digest is
indicated.
Figure 2 shows a challenge of HIV-1 LTR-PKR transduced SupTl
cells with HIV-1 IIIB. Clones were infected with HIV-1 IIIB at an m.o.i. of
0.1
and syncytia were scored in quadruplicate at multiple dilutions. A single
syncytia
score was calculated as described in Example 5. A control in which HIV-1 was
incubated with media alone prior to serial dilution and addition of SupTI
indicator
cells yielded no syncytia 96 hours after infection. The solid and open bars
represent 0 and 10 mM 2-aminopurine, respectively. Results represent the mean
~ S.E. of two independent experiments.
Figures 3A-3F show photographs (magnification x 100) of syncytia
generated by HIV-1 IIIB infection. Transduced, selected clones ( 1 x 10"
cells)
were infected with HIV-1 IIIB for 2 h at a m.o.i. of 0.1. Cells were washed
and
20 replated at 5 x 10' cells/m! in RPMI 1640 supplemented with 10%
heat-inactivated FBS. Photographs were taken 96 hours p.i. with an Olympus
inverted research microscope. Figure 3A = SupTl; Figure 3B = N2-20P;
Figure 3C = 105-10:27; Figure 3D = 105-10:239; Figure 3E = 106-4:560:
Figure 3F = 106-4:582.
25 Figures 4A-4F show a Western blot analysis of PKR expression
during HIV-I IIIB infection. Protein levels of PKR were monitored by Western
blot following HIV-1 infection at 24 h intervals. PKR was calculated to be 68
kDa as determined by migration alongside bovine serum albumin (65 kDa,
contained within the rainbow molecular weight markers, Amersham). "U"
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98/21880
-12-
denotes uninfected cells. Results are representative of two independent
experiments. Figure 4A = SupTl; Figure 4B = N2-20P; Figure 4C =
105-10:27; Figure 4D = 105-10:239; Figure 4E = 106-4:560; Figure 4F =
106-4:582.
5 Figures SA and SB show PKR autophosphorylation levels
throughout HIV-1 IIIB infection in HIV-1 LTR-PKR cDNA transduced clones.
Cells were collected at the indicated times after infection with HIV-I IIIB.
Following protein extraction and immunoprecipitation, autophosphorylation
assays were performed. Extracts were supplemented with 0 (Figure SA> or 0.1
10 oglml (Figure 5B) of poly(rI)-poly(rC) during the enzymatic assay. Results
were
quantitated by analysis on a Fuji BAS2000 phosphorimager. For each sample.
the bars from left to right represent 0, 24, 48, 72, and 96 hours
postinfection,
respectively.
Figure 6 shows NF-xB activation in HIV-1 LTR-PKR cDNA
15 transduced clones infected with HIV-1 IIIB. Nuclear extracts from HIV-I
IIIB
infected (+) and uninfected (-) SupTl cells were prepared 72 hours after
infection. Five micrograms of nuclear extract protein were incubated with a
0.0375 pmole [y-3zP] ATP end-labeled KB oligonucleotide probe and resolved on
a non-denaturing 4%a TBE acrylamide gel.
20 Figure 7 shows treatment of HIV-I LTR-PKR cDNA transduced
clones with 3'-azido-3'-deoxythymidine. Each clone (2 x 105 cells) was
incubated
with the indicated concentration of AZT 1 hour prior to infection with HIV-1
IIIB. Forty-eight hours p.i., the cells were serially diluted and 2 x 105
SupTl
indicator cells were added to each well. Syncytia scores were calculated 96
hours
25 p.i. ~ = SupTl. ~ = N2-20P, ~ = 105-10:27, x = 105-10:239, ~ _
106-4:560, ~ = 106-4:582. Results represent the mean ~ S.E. of three
independent experiments.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98I21880
-13-
Detailed Description of the Invention
The present invention relates to the discovery of constructs and
methods for inhibiting the replication of HIV in a cell which is susceptible
to HIV
infection, and for the control of HIV infection and AIDS.
The inventors placed the enzyme PKR under the transcriptional
control of an essential HIV-1 transcriptional element and introduced this
construct
into HIV-1 receptive cells utilizing a Moloney murine leukemia virus (M-MuLV)
retroviral-mediated shuttle system. SupTl lymphoblastoid cell lines transduced
with the HIV-1 LTR-PKR cDNA constructs exhibited a significant decrease in
syncytia formation when challenged with HIV-1 IIIB. In contrast to control
cell
lines, the protein and enzymatic levels of PKR in the transduced cell Lines
remained elevated following retroviral challenge. These results suggested an
anti-HIV-1 therapeutic approach involving the supplementation of endogenous
PKR levels produced via the interferon signaling pathway, with PKR protein
produced from the HIV-1 induced Tat trans-activation of TAR. Under this
approach the intracellular concentration of PKR would be increased in infected
cells, thereby elevating the concentration of HIV-I TAR RNA required for PKR
enzymatic inhibition.
A) Definitions
The following definitions, of terms used throughout the
specification, are intended as an aid to understanding the scope and practice
of the
present mventton.
"Intracellular immunization" is a gene therapeutic approach to
the treatment of viral infection, in which susceptible cells are genetically
modified
to express a product which interferes with infection or viral replication.
A "regulatory element" is any nucleic acid sequence which is
capable of regulating gene expression.
"Operatively linked regulatory element" means that a
polypeptide coding region is connected to a regulatory element in such a way
that
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98/21880
- 14-
the regulatory element can permit expression of the polypeptide when
appropriate
molecules (such as activator proteins and polymerases) are present in a cell
or cell
free system.
"Gene expression" means the realization of genetic information
encoded by a nucleic acid to produce a functional RNA or protein.
"Homology" means similarity of sequence reflecting a common
evolutionary origin. Proteins are said to have homology, or similarity, if a
substantial number of their amino acids are either (1) identical, or (2)
characterized by conservative amino acid substitutions.
"Conservative amino acid substitutions" are substitutions with
an amino acid which has a related side chain R. Amino acids are typically
classified into seven groups on the basis of the side chain R: (1) aliphatic
side
chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains
containing sulfur atoms, (4) side chains containing an acidic or amide group,
(5)
side chains containing a basic group, (6) side chains containing an aromatic
ring,
and (7) proline, an imino acid in which the side chain is fused to the amino
group.
"Substantial amino acid sequence homology" means an amino
acid sequence homology greater than about 30 percent, preferably greater than
about 600, more preferably greater than about 80%, and most preferably greater
than about 90 percent.
A "biologically active fragment" of a protein is a fragment
derived from the protein which retains at least one biological activity of the
protein.
A "biologically active derivative" of a protein is any analogue,
variant, derivative, or mutant which is derived from the protein, which has
substantial amino acid sequence homology with the protein, and which retains
at
least one biological property of the protein.
A "nucleic acid" is a polymeric compound comprised of covalently
linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid
IRNA) and polydeoxyribonucleic acid (DNA), both of which may be single-
CA 02306444 2000-04-14
WO 99/19496 PCT/US98121880
-15-
stranded or double-stranded. DNA includes cDNA, genomic DNA, synthetic
DNA, and semi-synthetic DNA.
A "recombinant nucleic acid" is a nucleic acid molecule in which
sequences which are not contiguous in a native context are placed next to each
other by experimental manipulation.
A "veetar" is any means for the transfer of a nucleic acid into a
host cell. The term vector includes both viral and nonviral means for
introducing
the nucleic acid into a prokaryotic cell in vitro, ex. vivo, or in vivo. Non-
viral
vectors include but are not limited to plasmids, liposomes, electrically
charged
10 lipids (such as cytofectins), DNA-protein complexes, and biopolymers. Viral
vectors include but are not limited to vectors derived from retrovirus, adeno-
associated virus, pox viruses, baculovirus, vaccinia virus, herpes simplex
virus,
Epstein-Barr virus, adenovirus and hybrids of two or more viral vector types.
In
addition to an antiviral construct according to the invention, a vector may
contain
15 one or more regulatory regions, and/or selectable markers useful in
selecting,
measuring, and monitoring nucleic acid transfer results (transfer to which
tissues,
duration of expression, etc. ).
The term "cell" includes higher eukaryotic cells such as
mammalian cells, lower eukaryotic cells such as yeast cells, prokaryotic
cells, and
20 archaebacterial cells.
"Pharmaceutically acceptable carrier" includes diluents and
fillers which are pharmaceutically acceptable for method of administration,
are
sterile, and may be aqueous or oleaginous suspensions formulated using
suitable
dispersing or wetting agents and suspending agents. The particular
25 pharmaceutically acceptable carrier and the ratio of active compound to
carrier
are determined by the solubility and chemical properties of the composition,
the
particular mode of administration, and standard pharmaceutical practice.
B) Abbreviations
The following abbreviations are used in this specification.
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98I218$0
- 16-
2-SA 2',5'-oligoadenylate
2-SOAS 2',5'-oligoadenylate synthetase
AIDS acquired immunodeficiency syndrome
AZT 3'-azido-3'deoxythymidine
DMEM Dulbecco's modified Eagle's medium
D10G media composed of 89% DMEM supplemented
with 2 mM L-glutamine, 10% calf serum, and 1 %
penicillin (10,000 units/ml)/streptomycin (10
mglml) antibiotic mixture
dsRNA double-stranded RNA
eIF-2a a subunit of eukaryotic initiation factor 2
FACS fluorescence activated cell sorting
GEMSA gel electrophoretic mobility shift assay
HIV human immunodeficiency virus
HIV-1 human imrnunodeficiency virus, type
one
HIV-2 human immunodeficiency virus, type
two
i.p. intraperitoneal injection
LTR long terminal repeat
m.o.i. multiplicity of infection
M-MuLV Moloney murine leukemia virus
PBMC peripheral blood monocytic cells
p. i. post infection
PKR dsRNA-dependent. IFN-inducible protein
kinase
SCID severe combined immunodeficiency,
characterized
by the loss of both T and B cell
immunity
SDS sodium dodecyl sulfate
SDS-PAGE SDS-polyacrylamide gel electrophoresis
SIV simian immunodeficiency virus
TPA 12-O-tetradecanoylphorboll3-acetate
VSV vesicular stomatitis virus
CA 02306444 2000-04-14
WO 99/I9496 PCTIUS98/21880
- 17-
C) Proteins
The constructs and methods according to the invention make use
of nucleic acids encoding PKR or 2-SOAS. The native human PKR and 2-SOAS
genes, have been cloned and sequenced (Mory et al., J. Interferon Research
9:295-304 (1980); Wathelet et al. , FEBSLetters 196:113-20 (I986); Meurs et
al. .
Cell 62:379-90 (1990)).
Different variants of a given protein may exist in nature. These
variants may be allelic variations characterized by differences in the
nucleotide
sequences of the structural gene coding for the protein, or may involve
i0 differential splicing or post-translational modification. The skilled
artisan can
produce derivatives of a protein having single or multiple amino acid
substitutions, deletions, additions, or replacements. These derivatives may
include, inter alias (a) derivatives in which one or more amino acid residues
are
substituted with conservative or non-conservative amino acids, (b) derivatives
in
which one or more amino acids are added to the protein, lc) derivatives in
which
one or more of the amino acids includes a substituent group, and (d)
derivatives
in which the protein is fused with another peptide. The techniques for
obtaining
these derivatives, including genetic (suppressions. deletions, mutations, etc.
).
chemical, and enzymatic techniques, are known to persons having ordinary skill
in the art.
Biologically active fragments and biologically active derivatives
of PKR and 2-SOAS are intended to be included within the scope of the
invention.
D) Nucleic Acids
The techniques of recombinant DNA technology are known to
those of ordinary skill in the art. General methods for the cloning and
expression
of recombinant molecules are described in Maniatis (Molecular Cloning. Cold
Spring Harbor Laboratories. 1982 ), and in Ausubel (Current Protocols in
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
-18-
Molecular Biology, Wiley and sons, I987), which are incorporated herein by
reference.
E) Regulatory Elements
In the methods and constructs according to the invention, the PKR
5 coding region or 2-50AS coding region is operatively linked to a regulatory
element such that the expression of PKR or 2-50AS is activated in the presence
of HIV traps-acting factors.
In a most preferred embodiment, the regulatory element comprises
all or part of an HIV LTR and the HIV traps-acting factor is an HIV Tat
protein.
The foil length HIV LTR as well as any fragments thereof which retain the
ability
to respond to traps-activation by the Tat protein are all intended to be
encompassed by the invention.
Other regulatory elements can also be used in the methods and
constructs of the invention. One example that may be mentioned is the Rev/RRE
system.
The HIV Rev protein can traps-activate the expression of
heterologous genes which contain the negative cis-acting repressive sequences
(crs) and a correctly oriented Rev responsive element (RRE) (Rosen et al. .
Proc.
Natl. Acad. Sci. USA 85:2071-75 (1988)>.
It is further understood that the art may discover other regulatory
elements and traps-activating factors which can facilitate the HIV-regulated
expression of chimeric constructs. The skilled artisan can also add other
known
regulatory elements to mediate inducible gene expression, such as regulatory
sequences which respond to an environmental signal such as heat, cold, or a
chemical compound.
CA 02306444 2000-04-14
WO 99119496 PCT/US98/21880
-19-
F) Vectors and Methods of Gene Transfer
In a preferred embodiment of the invention, the protein coding
region and regulatory element are introduced into a cell using a vector. In a
most
preferred embodiment, the protein coding region and regulatory element become
stably integrated into the cellular genome.
Non-viral vectors may be transferred into cells using any of the
methods known in the art, including calcium phosphate coprecipitation.
lipofection (synthetic anionic and cationic liposomes), receptor-mediated gene
delivery, naked DNA injection, electroporation and bioballistic or particle
acceleration. Viral vectors may be transferred into cells using any method
known
in the art, including infection and transfection.
In a most preferred embodiment, a retroviral vector is used to
introduce the protein coding region and regulatory element into a cell which
is
susceptible to HIV infection.
Retroviruses are integrating viruses which generally infect dividing
cells. The retrovirus genome includes two LTRs, an encapsidation sequence and
three coding regions (gag, pol and envy. The construction of recombinant
retroviral vectors is known to those of skill in the art.
In recombinant retroviral vectors, the gag, pol, and env genes are
generally deleted. in whole or in part, and replaced with a heterologous
nucleic
acid sequence of interest. These vectors can be constructed from different
types
of retrovirus, such as M-MuLV, MSV (murine Moloney sarcoma virus). HaSV
(Harvey sarcoma virus), SNV (spleen necrosis virusj. RSV (Rous sarcoma virus)
and Friend virus.
In general, in order to construct recombinant retroviruses
containing a sequence according to the invention, a plasmid is constructed
which
contains the LTRs, the encapsidation sequence and the coding sequence. This
construct is used to transfect a packaging cell line, which cell line is able
to
supply in traps the retrovirai functions which are deficient in the plasmid.
In
general, the packaging cell lines are thus able to express the gag, pol and
env
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
-20-
genes. Such packaging cell lines have been described in the prior art. In
particular the cell line PA317 (US 4,861,719), the PsiCRIP cell line
(W090/02806), and the GP+envAm-12 cell line (W089107150) may be
mentioned. Recombinant retroviral vectors are purified by standard techniques
known to those having ordinary skill in the art.
Retroviral vectors derived from lentiviruses such as HIV-1. HIV-2.
and SIV can be used for delivery to nondividing cells. These viruses can be
pseudotyped with the surface glycoproteins of other viruses, such as M-MuLV
or vesicular stomatitis virus (VSVj. The production of high titer HIV-1
10 pseudotyped with VSV glycoprotein has been disclosed by Bartz and Vodicka
(Methods 12(4):337-42 (August 1997)), and multiply attenuated lentiviral
vectors
have been disclosed by Zufferey et al. (Nature Biotechnology 15:871-7S
(September 1997)). Such lentiviral vectors can infect nondividing cells, have
a
broad host range, and can be concentrated to high titers by
ultracentrifugation.
1S Chimeric adenoviral/retroviral vector systems can also be used to
achieve efficient gene delivery and long term gene expression. A chimeric
viral
system in which adenoviral vectors are used to produce transient retroviral
producer cells in vivo, such that progeny retroviral particles infect
neighboring
cells has been described by Feng et al. (Nature Biotechnology 15:866-70
20 (September 1997)).
M-MuLV can also be pseudotyped with HIV envelope
glycoproteins to generate a retroviral vector with specificity for CD4-
expressing
cells, as disclosed by Schnierle et al. (Proc. Natl. Acad. Sci. USA 94:8640-4S
(August 1997)).
2S G) Cells
The recombinant constructs according to the invention may be
transferred into hematopoietic progenitor and stem cells or into
differentiated cells
which are susceptible to HIV infection.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98121880
-21-
Stem cells are a special class of cells which have the capacity to
replicate themselves as well as the capacity to generate lineage restricted
progenitors which further differentiate and expand into specific Iineages.
Stem
cells may be totipotent (germ line stem cells), pleuripotent (e.g. CD34+
hematopoietic stem cells), or unipotent (e.g. lymphoid progenitor cells).
In a preferred embodiment, the constructs are introduced into
human hematopoietic progenitor and stem cells. These primitive cells, which
can
be isolated from sources including bone marrow, peripheral blood, and cord
blood, are capable of giving rise to progeny in all hematopoietic lineages. By
targeting pleuripotent stem cells, the introduction of an HIV-1 regulated
antiviral
enzyme such as PKR or 2-SOAS only needs to be performed a single time to
provide protection for differentiated cells receptive to macrophage-tropic and
T-
cell-tropic strains of HIV (Rana et al., J. of Virol. 71:3219-3227 (1997)).
Primitive human hernatopoietic progenitors and stem cells are
15 characterized, inter alia, by the expression of the CD34 cell surface
glycoprotein.
Methods of enriching for CD34' cells using anti-CD34 antibodies, including
immunosorption, immunomagnetic separation and fluorescence activated cell
sorting (FACS), are known in the art. Cells expressing a specific CD34 subtype
andlor cells expressing other lineage specific markers may be selected using
similar techniques. Cells expressing nonlineage markers may be removed by
immunomagnetic depletion, immunoadsorption, or FACS. Differential
centrifugation methods may also be used, generally in combination with
positive
and negative antibody selection, to enrich for a desired cell population. The
transfection of progenitor and stem cells with constructs according to the
invention can generate a reservoir of immunocompetent HIV resistant cells
which
can differentiate into more mature components of the hematopoietic system.
including CD4+ and macrophage descendants. It is important to select for high
titer producers, as described in Example 3, and to transduce a large
proportion
of the target cells, in order to generate an adequate reservoir of resistant
cells.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98I21880
-22-
Methods for isolating, identifying, separating, and culturing
hematopoietic stem cells are disclosed in U.S. 5,635,387 and U.S. 5,643,741
which are incorporated herein by reference. Hematopoietic stem cells may be
expanded in vitro, in the presence or absence of various cytokines, either
before
S or after retroviral transduction. Methods and compositions for retroviral
transduction of hematopoietic stem cells are disclosed in W096133281 which is
incorporated herein by reference.
In another preferred embodiment, the constructs are introduced
into more mature human hematopoietic cells which are already susceptible to
infection by HIV. Because these differentiated cells have a finite life span,
it may
be necessary to repeat the introduction of HIV-1 regulated antiviral
constructs
into targeted cells two or more (including many) times. In some embodiments.
the antiviral constructs are introduced into both stem cells and
differentiated cells.
15 HIV-1 infects T cells through CD4 and chemokine coreceptors.
CD4-expressing lymphocytes are the primary targets of HIV, and represent one
of the main sources of viral replication. CD4+ cells may be selected from
sources
including peripheral blood monocytic cells, using anti-CD4 antibodies (for
positive selection) and other antibodies (for negative selection? in methods
including invnunosorption, immunomagnetic separation, and FACS. The
transfection of CD4' lymphocytes with constructs according to the invention
can
reduce the virus load in the peripheral blood and/or lymph nodes of patients
infected with HIV.
H) Methods of Treatment
25 Patient selection: The methods and constructs according to the
present invention mediate the killing of HIV-infected cells, and therefore
prevent
the release of progeny virus and the spread of infection within a patient.
The methods and constructs according to the invention may be used
to treat individuals who are already infected with HIV. This approach
generates
CA 02306444 2000-04-14
WO 99119496 PC'TIUS98/21880
-23-
a reservoir of (otherwise susceptible) cells which are not susceptible to
infection,
and can prevent or ameliorate the symptoms associated with AIDS. The methods
and constructs according to the invention are particularly useful for the
treatment
of HIV-1 infected individuals who are resistant to one or more inhibitors of
HIV
protease andlor reverse transcriptase.
The methods and constructs according to the present invention may
be used to treat uninfected individuals who are at high risk for HIV infection
and
AIDS, due to sexual conduct, intravenous drug use, medical condition,
employment, or other significant risk. This approach can be used to prevent
HIV
infection as well as deleterious sequelae.
The recombinant constructs according to the invention may be
transferred into human cells for clinical applications, using either ex vivo
or in
vivo approaches.
In the ex vivo approach, cells are removed from the patient,
enriched, cultured, and infected or transfected with the recombinant
construct,
then reintroduced back into the patient. Methods for ex vivo gene therapy have
been disclosed by Blaese et al. (Science 270:475-80 (1995)), Kohn et al.
(Nature
Medicine 1(10):1017-23 (October 1995)), and Ferrari et al. (Blood 80:1120-24
( 1992)), all of which are incorporated by reference.
For ex vivo administration, cells are typically transduced at a
multiplicity of infection (m.o.i.) of about 0.1 to about 100, preferably about
0.1
to about 10, and most preferably about 0.1 to about 1.0 infectious recombinant
retroviral particles per cell. In some protocols 2-5 colony forming units
(CFU)
are used per target cell. Gene modified cells may be reintroduced into the
patient
by parenteral methods including intravenous infusion and direct injection into
the
bone marrow. Gene modified cells are reintroduced into the patient in a saline
solution or other pharmaceutically acceptable carrier. The number of cells to
be
reintroduced depends on the purity of the cell population. but a typical
dosage is
in the range of about 105 to about 10& cells per kilogram of patient body
weight.
For example, when CD34+ cells are selected before er vivo transduction, about
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98l21880
-24-
146 to about I08 cells are typically reintroduced into the patient. For more
highly
enriched cell populations, correspondingly fewer cells need to be reintroduced
into the patient. Due to the differing antiviral potentials observed among
different
clones, a prescreening step to verify proper expression and activation of PKR
in
the presence of Tat protein may be incorporated into the gene therapeutic
strategy.
In the in vivo approach, recombinant vectors are injected directly
into the patient. The vectors are constructed so as to preferentially be
incorporated into target (e.g., CD34+ stem cells or CD4y lymphocytes) cells.
10 For example. the pseudotyping of M-MuLV virus with truncated HIV envelope
glycoproteins can generate a retroviral vector which specifically infects CD4"
cells (Schnierle et al. , Proc. Natl. Acad. Sci. USA 94:8640-45 (August
1997)).
For in vivo administration, about 10$ to about 105 vectors are infused by a
parenteral method such as intravenous infusion or direct injection into the
bone
marrow.
The methods and constructs according to the present invention can
be used in combination with other antiviral drugs such as AZT, ddI, ddC,
protease inhibitors, and combinations thereof. The intracellular immunization
approach allows for a significant reduction in antiviral drugs, the
maintenance of
?0 HIV-I in a true latent state while maintaining an intact immune system, and
decreased side effects.
SCID mice which have been reconstituted with human cells are
used as an animal model to study HIV infection and AIDS, and to optimize
treatment protocols before their use in human subjects. SCID mice are
reconstituted with peripheral blood monocytic cells or bone marrow cells
transfected, using retroviral vectors, with the HIV-regulated constructs
according
to the invention. The animals are subsequently exposed to HIV and their
susceptibility to infection is monitored.
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98/21880
- 2S -
Examples
The following examples illustrate the invention. These examples
are illustrative only, and do not limit the scope of the invention.
EXAMPLE 1
Materials and Methods
A> Olieonucleotides
The following oligonucleotides were used for the experiments
described herein:
( 1 j SEQ ID NO: 1 , HIV-1 LTR primer
[S'-d(CTGGCTAGCTAGGGAAC)-3'] complementary to nucleotides 68S to 701
in pMEA001;
(2) SEQ ID N0:2, polyA( 1 ) 6S-mer
[S'd(CGATAGATCTAATAAAAGACCGCGGGCCCTTAAGGCCTTGTGT
1 S GTTGGTTTTTTGTGTGCTCGAG)-3' ] ;
(3) SEQ ID N0:3, complementary polyA(2) 63-mer
[S'-d(CTCGAGCACACAAAAAACCAACACACAAGGCCTTAAGGGCCC
GCGGTCTTTTATTAGATCTAT)-3']; and
4) SEQ ID N0:4. sense probe oligonucleotide corresponding to the
NF-KB binding site S'-ACAAGGGACTTTCCGCTGGGGACTTTCCA
GGGA-3' .
B) Cell Culture and Virus Preparation
NIH/3T3 cells were obtained from the American Type Culture
Collection (Rockville, MD). Molt4 cells chronically infected with HIV-1 IIIB
?S (Molt 4 IIIB) and SupTl cells were obtained from the NIH AIDS Research
Reference and Reagent Program. and were grown at 37'C, S% CO, in RPMI
1640 (GIBCO) containing 10% heat-inactivated donor calf serum supplemented
with 100 unitslml penicillin-streptomycin (R10) (Biofluids, Inc.). The
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
-26-
amphotrophic retroviral packaging cell line GP+envAml2 was provided by Dr.
Arthur Bank (Columbia University, New York).
NIHl3T3 cells and the GP+envAml2 cell line were maintained in
Dulbecco's modified Eagle's medium (DMEM) containing 10% heat-inactivated
S calf serum supplemented with 2 mM glutarnine and 100 unitslml penicillin-
streptomycin (D10G). Culture supernatants from Molt4 IIIB cells were used as
the source of infectious virus. The supernatant was cleared by centrifugation
(S00
x g. S min. 4°C) and stored in 10 ml aliquots at -70°C until
use. HIV-1 IIIB titer
was calculated by infection of SupTl cells, serial dilution, and scoring of
syncytia
formation in quadruplicate.
EXAMPLE 2
Construction of Plasmids Containing PKR cDNA
An HIV-1 LTR-PKR cDNA-poly(A) cassette was cloned in
forward (pMEAIOS) and reverse (pMEAI06) orientations into the pN2 retroviral
1S vector, as illustrated in Figure lA. This retroviral vector was chosen
because it
can be used to effect the stable integration of the HIV-1 LTR-PKR
cDNA-poly(A) cassette into target cells, using replication-incompetent MMuLV
particles. This retroviral-mediated intracellular immunization approach was
designed to provide (i) an efficient and well-characterized delivery system,
('ii)
20 specificity in that the PKR cDNA constructs are transcribed and activated
at high
levels only upon HIV-1 infection, and (iii) a system which is tightly
regulated and
silent in uninfected cells due to its dependency on dsRNA for allosteric
activation.
A) Construction of pMEA001
To construct pMEA001, the p68-pcDNAIlNEO plasmid (provided
2S by Dr. Glen Barber, University of Washington, Seattle) containing the wild-
type
PKR cDNA was amplified by standard bacterial culture protocols and digested
with HindIII. PstI, and Hhal to yield 36 fragments (Meurs et al. , Cell 62:379-
390
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
_27-
( 1990)). An 1826 nucleotide HindIII/PstI fragment containing the wt PKR cDNA
was purified using DEAE-cellulose. The pHIVa~IFN plasmid (provided by Dr.
Daniel P. Bednarik, Human Genome Sciences, Rockville, MD) was digested with
XhoI and HindIII, releasing a 727 by fragment containing portions of the U3
and
R regions and an additional 195 nucleotides of viral DNA located in the HIV-1
LTR. (Bednarik et al. , Proc. Natl. Acad. Sci. USA 86:4958-4962 (1989); Rosen
et al. , Cell 41:813-823 (1985); Sodroski et al. , Science 225:381-385
(1984)).
To serve as the backbone plasmid, a pSP72 vector (Prornega) was
digested within its multiple cloning region with XhoI and PstI; the larger
2434 by
nucleotide fragment was isolated and a triple Iigation was performed to create
the
plasmids which contain the HIV-1 LTR controlling the expression of wt PKR
cDNA. Restriction mapping and DNA sequencing were utilized to identify
bacterial colonies carrying the desired plasmid construct.
B) Construction of pMEA101
The pMEA001 plasmid was created without a downstream
polyadenylation signal following the cDNA insert. Although a polyadenylation
signal would be provided by the 3' MMuLV LTR to sequences cloned in the
forward orientation, for efficient reverse orientation posttranscriptional
processing prior, a synthetic 65-mer oligonucleotide, polyA(l), was
synthesized
to contain the upstream AATAAA polyadenylation signal. a 23 nucleotide spacer
region, the downstream polyadenylation (GT)~(T)~ sequences from rabbit (3-
globin
mRNA, and an additional XhoI site at the 3' end (Chen et al. , Nucleic Acids
Res.
12:1767-1768 (1984j; Gil et al., Cell 49:399-406 (1987); Levitt et al., Genes
&
Dev. 3:1019-1025 (1989); McDevitt et al. , EMBO J. 5:2907-2913 (1986)j.
When annealed with its complementary synthetic oligonucleotide (polyA(2)], the
5' Clal overhang and a 3' blunt end permitted the opportunity for insertion
into
CIallHpal digests of pMEA001 to create pMEAI01.
CA 02306444 2000-04-14
WO 99/19496 PCTNS98/21880
_~8_
C) Construction of pMEA105 and pMEA106
The XhoI-HiV-I LTR- PKR cDNA--poly(A)-XhoI fragment was
directly subcloned in two orientations into the pN2 vector. It has been
reported
that the host can use methylation patterns to inactivate transcription
initiation
from proviral inserts. The inappropriate expression of an antiproliferative
gene
by readthrough transcripts originating from the M-MuLV 5' LTR in constructs
cloned in the forward orientation might precipitate this type of host
repression
(Bednarik et al., Proc. Natl. Acad. Sci. USA 86:4958-4962 (1989)). Following
ligation and transformation of DHSa cells and selection with 50 ~g/ml
ampicillin
and 10 uglml tetracycline, the pMEA105 and pMEA106 plasmids were isolated
and analyzed by restriction mapping (Figure lAl. The region of the poly(A)
site
was sequenced for final confirmation of the plasmid identity.
EXAMPLE 3
Production of Retroviral Producer Cell Lines
The plasmids constructed in Example 2 (encoding PKR under the
control of an HIV LTR) were transferred into retroviral packaging cell lines
in
order to produce recombinant virus.
A) Transfection of GP+envAml2 cells
The GP+envAml2 cell line is a packaging cell line for the
production of amphotropic retroviruses. The cell line was constructed by
introducing gag and pol helper functions on one piasmid, and the env helper
function on a separate plasmid. The cloned helper functions do not contain
packaging signals or 3'-LTR sequences. The structure of the helper functions
insures that replication competent viruses (RCRs. a major concern in the area
of
gene therapy) are not produced. Using this system, three independent
recombination events would be required in order to generate replication
competent virus.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
-29-
Following transfection of the plasmids by standard
calcium-phosphate coprecipitation techniques ( 10 ug of plasmid per 2 x 105
GP+envAml2 cells) for 12 h at 37°C, 5% CO~, the transfection media
was
aspirated and replaced with 5 ml fresh D10G. Twelve hours later, the D10G was
aspirated, the cells rinsed with 2 ml PBS, and aspirated again. Trypsin
solution
(500 pi, 0.25%) was added to each well followed by a S min incubation at
37°C,
5 % CO,. The cells were resuspended in 5 ml D l OG and diluted to 10-3 in D
lOG
containing 1 mglml 6418. Fourteen days later, coinciding with a complete loss
of viability of mock-transfected controls as measured by Trypan blue
exclusion,
individual 6418 resistant colonies were isolated by mini-trypsinization in
cloning
wells. The isolated colonies were expanded for titering and further
characterization.
B) Determination of recombinant retroviral titer by infection of NIHI3T3 cells
NIH3T3 cells (1 x l0ij were seeded in individual 60 mm' plates
and permitted to adhere to the plate surface overnight at 37°C, 5%a
CO,.
Infections were performed at multiple dilutions in duplicate. Viral
supernatants
were harvested from nearly confluent 6418-resistant amphotrophic retroviral
producer cells expanded in 100 mm' tissue culture plates and frozen at -
70°C.
The viral supernatants were thawed by incubation at 37'~C with gentle
agitation,
placed on ice. and diluted up to 1 x 10-'' in D10G containing 10 ~~glml
potybrene.
The spent medium from the NIH/3T3 cell plates was aspirated and replaced with
500 ,ul of the appropriate viral supernatant dilution. The plates were
incubated
at 37°C, 5% C02 for 2 hours with gentle rocking once every 20 minutes.
The
media containing diluted virus was aspirated and 5 ml of D lOG were added.
After 16 h incubation, this media was replaced with 5 ml of D lOG containing 1
mg/ml 6418. Viable colonies were scored 10 to 14 days later and the viral
titer
was calculated.
Following calcium-phosphate mediated transfection of the pN2,
pMEAl05, and pMEA106 plasmids into GP+envAml2 cells, pooled
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
-30-
6418-selected clones yielded titers of 10' - 10z cfu/m! as determined by the
transduction of NIHI3T3 cells.
The isolation of individual clones following plasmid transfection
increased the titer of the retroviral producer cell lines. The N2-20, 105-10,
and
106-4 lines were titered at 1.7 ~ 0.4 x 10', 1.1 ~ 0.1 X 10~. and 1.2 + 0.4 x
10', respectively.
EXAMPLE 4
Retroviral-Mediated Transduction of SupTl Cells
Sup T 1 lymphoblastoid cells were transduced by cocultivation with
the producer cell lines of Example 3.
A) Retroviral-mediated Transduction
Producer cell lines N2-20, 105-10, and 106-4 (2.0 x 10') were
seeded into 100 mm' cell culture plates m a total volume of 10 ml D10G.
Twelve hours later, the media was aspirated, the cells were washed with 10 ml
PBS. and 5 ml of D10G containing 1 x 10'' SupTl cells and 4 ~eglml polybrene
was added to the producer cells. At 24 h intervals, an additional 5 ml of D10G
containing 4 ,uglml polybrene was added. Ninety-six hours after the initiation
ot~
the transduction, the cocultivation was terminated by gentle agitation and
removal
of the resuspended cells. The producer cells were rinsed twice with PBS and
the
20 mediaIPBS suspensions were pooled. Cells were centrifuged (350 x g,
4°C, 5
min), washed with 10 ml PBS and resuspended in 3 ml of R10 containing 500
uglml 6418. 100 ,ul aliquots were seeded into ninety-six well tissue culture
plates in duplicate. Cells were serially-diluted up to 1:2187 in R10
containing
500 ,uglml 6418. Antibiotic selection of transduced cell lines typically
required
14 days and was complete when all of the SupTI cells cocultured with the
GP+envAml2 cell lines (negative control) were non-viable.
CA 02306444 2000-04-14
WO 99/19496 PC'TIUS98/21880
-31 -
B) Southern blot analysis of genomic DNA
After trypsinization, approximately 5 x 10' 6418 selected,
transduced cells and control cells were centrifuged (350 x g, 4°C, 15
min).
Genomic DNA was isolated according to standard procedures. To create a neo
specific probe common to all proviral inserts, the pN2 vector was digested
with
PstI and a 923 by fragment was isolated and radiolabeled by denaturation and
incubation in the presence of Kienow fragment, unlabeled nucleotides (30 ~cM
each of dCTP, dGTP, and dATP), [a-"-PJ-dTTP (50 uCi, 3000 Cilmmol), and
reaction buffer containing 50 mM Tris-HCI fpH 8.0), 5 mM MgCh, 2 mM DTT.
200 mM HEPES (pH 6.6), and S A260 U/ml random hexadeoxyribonucleotides.
A probe with a specific activity of I.2 x 109 dpm/~g was recovered. For the
hybridization solution, 2 x 10° dpm/ml hybridization buffer was
utilized. Ten
micrograms of genomic DNA from each clone was digested with XbaI. Positive
controls consisted of genomic DNA from GP+envAml2 cells augmented with 10.
1. or 0.1 ng of pMEA106 plasmid DNA. The digested genomic DNA was
electrophoresed through a 0.8 % agarose gel at 20 volts overnight and,
following
denaturation and neutralization, vacuum transferred to a nylon membrane at 80
lbslinch= pressure for 1 hour The DNA was crosslinked to the nylon membrane
with a UV Stratalinker. Following a 3 hour prehybridization, 2 x 10' dpm of
the
neo probe was incubated with the blot at 68'C overnight. The membrane was
washed with varying concentrations of SSC and SDS, dried, and analyzed with
a Fuji BAS2000 phosphorimager.
The integrated N2-20, 105-10, and 106-4 sequences with regions
complementary to the neo probe are indicated in Figure 1B. Southern blot
analysis demonstrated the integration of the calcium-phosphate transfected
plasmid DNA into the genomic DNA of the GP+envAml2 cells (pN2,
pMEA106: Figure 1C, lanes 4 and 6). In addition to generation of 6418-
resistant
clones through the transduction of NIHI3T3 and SupTl cells via supernatant and
co-cultivation procedures, respectively, integration of the provirus for N2-20
and
CA 02306444 2000-04-14
WO 99/19496 PCT/US98l21880
-32-
106-4 transduced SupT 1 cells following 6418 selection was verified by
Southern
blot analysis (Figure 1C, lanes 5 and 7).
C) Growth curve analysis of transduced 6418 selected SupTl cells.
Transduced SupTl cells and controls (1 x 10') were seeded into twelve-well
tissue
culture plates in 2 ml RPMI 1640 media. One ml of RPMI 1640 was added after
4 days. Cell counts and viability were determined in duplicate by Trypan blue
exclusion for up to 200 h after cell seeding. Viability exceeded 95 % .
Examination of the growth curve of the HIV-1 LTR-PKR cDNA
transduced clones by Trypan blue exclusion revealed that total cell number did
not differ significantly from SupTl and N2-2U controls up to 8 days after the
initiation of the assay. Therefore, although PKR is constitutively expressed
in the
106-4 reverse orientation clones in the absence of HIV-1 infection, it does
not
slow cell growth (Figure 4, panels a and f, uninfected).
EYaMPLE 5
Challenge of HIV-1 LTR-PKR Transduced SupTl Celts With HIV-1 IIIB
SupTl T lymphoblastoid cell lines were transduced such that PKR
would be overexpressed following infection with HIV-1. HIV-1 replication was
measured by syncytia formation. Syncytia are fused T lymphocytes, having
multiple nuclei and sharing a common membrane, which result from HIV
infection. The SupTl parental cell line (CD4+ T lymphocytes) provided a
control for cellular PKR expression. The N2-20P clones (T cells transduced
with
neomycin selectable marker but not a PKR cDNA) provided a control for
expression of cellular PKR and M-MuLV LTR driven retroviral transcripts
without the HIV-1 LTR controlled PKR cDNA sequences.
?5 A) HIV-1 infection of retrovirally transduced, 6418 selected SupTl cells
Following determination of cell number and viability, transduced
cells and SupTl controls were challenged with HIV-I IIIB at a m.o.i. of 0.1
for
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
-33-
2 h at 37°C. 5% CO~ with gentle agitation. The infected cells were
washed with
volumes of R10 to remove unincorporated virus. An aliquot of 2 x 10' infected
cel1s/200 ,ul were seeded into the wells of a 96-well plate. Forty-eight hours
post-infection (p.i.), the cells were serially-diluted through 1:27, and ' x
10'
5 SupTl indicator cells were added to each well (final volume = 300 ,ul).
Syncytia
were scored by microscopic examination 96 hours p.i.
A single syncytia score from triplicate assays was calculated by
correcting for each dilution factor and averaging of the three values, i.e. a
total
of nine wells were scored to obtain a single syncytia score. Virus added to
media
i
10 alone, which was serially-diluted and mixed with indicator cells, yielded
no
syncytia. demonstrating the short halflife of the virion and that syncytia
observed
were not due to the direct infection of the indicator cells
When the HIV-1 LTR driven PKR cDNA retroviral-transduced
SupTl clones were pooled during 6418 selection, the reduction in syncytia
15 formation averaged 20-30% compared to identical infections of the parental
SupTl and the N2-20P transduced. 6418-selected SupTl cell lines. Growth
inhibitory effects are associated with even a low level of inappropriate PKR
activation, and integration of the transduced constrt!ct near strong cis
activation
or repressor transcriptional elements could potentially modulate expression of
20 PKR under HIV-1 LTR control, resulting in inappropriate expression or a
loss
of expression in the presence of Tat.
In contrast to pooled. transduced cells, individually selected clones
obtained by limiting dilution exhibited more dramatic decreases in syncytia
formation [Figures 2(a), 3, and 7]. HIV-1 challenge of the reverse-orientation
clone, 106-4:560, resulted in the greatest decrease in syncytia formation (93
% )
compared with the N2-20P control (Figure 2, solid bars). Challenge of the
105-10:27. 105-10:239, and 106-4:582 clones with HIV-1 resulted in 54, 54. and
80% decreases in syncytia formation, respectively, compared with the N2-20P
control [Figures 2 (solid bars) and 3]. The antiviral effect observed in the
reverse
30 orientation clones, 106-4:560 and 1064:582, was 84 and 56% greater.
CA 02306444 2000-04-14
WO 99/19496 PCTNS98/21880
-34-
respectively, than that observed for the forward orientation clones, 105-10:27
and
105-10:239 (Figure 2, solid bars). Host-dependent hypermethylation of the CpG
sites within the HIV-1 LTR has been reported to inactivate Tat-induced
transcription and could have contributed to the differences observed in anti-
HIV-1
S activity between clonal lines transduced with identical retroviral
constructs
(Gutekunst et al., J. AIDS 6:541-549 (1993)). Gross rearrangements of
integrated DNA, which have been reported with M-MuLV after a single round
of replication, were not observed.
In agreement with inhibition of HIV-I induced syncytia formation,
HIV-1 reverse transcriptase activity in SupTl and N2-20P control cells at 9b
hours p.i. increased 3.6- and 4.0-fold over uninfected controls, while HIV-1
reverse transcriptase activity in all of the HIV-I LTR-PKR cDNA transduced
cell
lines increased by less than 1.9-fold. The inhibition of syncytia formation
observed in the HIV-1 LTR-PKR cDNA transduced clones was reversed by
treatment of the cells with 2-aminopurine prior to infection (Figure 2, open
bars ).
There was a statistically significant difference in syncytia formation in the
105-i0
and 106-4 clones (p < 0.003, 0.001 and p < 0.002, 0.00006, respectively) in
the presence and absence of 2-aminopurine, but not in the SupTl controls (p <
0.090).
B) Reversibility of the anti-HIV-1 effect
The reversibility of the anti-HIV-1 effect observed in the H1V-1
LTR-PKR cDNA clones was demonstrated by treatment with 2-aminopurine
prior to HIV-1 infection, as shown in Figure 2, open bars. The compond
2-aminopurine is an ATP analog that inhibits PKR autophosphorylation both in
vitro and in vivo, but does not affect the dsRNA binding capacity of PKR (Hu
et
al. , J. Interferon Res. 13:323-328 (I993)).
For studies examining the inhibition of PKR enzymatic activity by
2-aminopurine, triplicate assays were prepared by infection of 2 x 105 cells
in the
presence or absence of 10 mM 2-aminopurine (added I hour prior to infection)
CA 02306444 2000-04-14
WO 99/19496 PG"T/US98I21880
-35-
with HIV-1 IIIB at a m.o.i. of 0.1. Twenty-four hours after infection, the
infected
cells were serially diluted up to 1:27 and 2 x 105 SupTl indicator cells were
added to each well. Viability assays of SupTl cells treated with 10 mM
2-aminopurine in the absence of HIV-1 infection revealed a decrease in cell
S growth and an increase in cytotoxicity after prolonged incubation (91 %
viable
after 24 h, 54% viable after 48 h); 2-aminopurine-treated cells were therefore
serially diluted at 24 hours p.i. to maintain viability. Ninety-six hours
p.i.,
syncytia formation was scored as described above.
Three of four clones demonstrated a statistically significant
increase in syncytia formation in the presence of 2-aminopurine when compared
to both SupTl and N2-20P controls (105-10:27: p < 0.00001 and 0.0008:
I05-10:239: p < 0.004 and 0.03: 106-4:582: p < 0.002 and 0.01).
EXAMPLE 6
PKR Expression and Activity During HIV Infection
A) PKR expression during HIV-1 IIIB infection
Although PKR protein levels in SupTl and N2-20P controls were
undetectable 72 h p.i., Western blot analysis demonstrated that PKR expression
was maintained through 96 h p.i. in the four HIV-I LTR-PKR cDNA clones
examined ( Figure 4) .
Protein preparations were obtained by lysing suspension cells (2
x 106 at the time of infection) with two cell volumes of NP-40 lysis buffer
[20
mM HEPES (pH 7.5), 5 mM MgCh, 120 mM KCI, 10% glycerol. 0.5% NP-40].
Fifty micrograms of protein was separated by 10% SDS-PAGE. After
equilibration in 25 rnM Tris-HC1 (pH 8.3), 192 mM glycine, 20% methanol for
20 minutes, the proteins were transferred to nitrocellulose for one hour at 25
volts
at room temperature, using a BioRad Trans-Blot SD Semi-Dry Transfer cell.
Following a 16 hour incubation in 7.6 % dry skim milk blocking solution
prepared
in TBS-T (20 mM Tris-HCI (pH 7.6), 137 mM NaCI, 0.1 %
CA 02306444 2000-04-14
WO 9911949b PCTIUS98/21880
-36-
poiyoxyethylene-sorbitan monolaurate (Tween 20, Sigma)] on a slow shake at
.I°C, the blot was rinsed 5 times (twice quickly, 1 x 15 min., 2 x 5
min) in a
large volume of TBS-T on a slow shake at room temperature. The blot was then
incubated with a 1:1000 dilution of rabbit polyclonal anti-PKR antibody in I5
ml
of TBS-T for 1 hour. The polyclonal anti-PKR antibody was provided by Dr.
Charles E. Samuel (University of California at Santa Barbara). The blot was
removed from the antibody solution and washed with TBS-T as described above,
then incubated for 1 hour with a 1:2500 dilution of horseradish
peroxidase-conjugated mouse anti-rabbit serum (Pierce) on a slow shake.
10 Following washing with TBS-T, the blot was developed with a
chemiluminescent
solution fECL, Amershamj, following the instructions of the manufacturer.
Exposures on X-OMAT film (Kodak) were developed and quantified utilizing
image analysis software (Macintosh NIH Image program, version 1.60).
In the absence of HIV-1 infection, the two reverse orientation
15 clones, 106-4:560 and 106-4:582, exhibited elevated PKR protein levels (3.4-
and
3.3-fold. respectively) when compared with the N2-20P control (Figure 4,
panels
a. e, and f, uninfected cells). These clones exhibited normal rates of
cellular
proliferation. suggesting that PKR is in the inactive state. Increased PKR
protein
levels in the HIV-1 LTR-PKR cDNA transduced clones could also result from
20 increased protein stability rather than increased expression levels.
The levels of PKR in the transduced clones were noticeably lower
at 72 and 96 hours p.i., perhaps due to lower levels of available Tat protein
to
drive the system from a lack of productive infection. The expression of
chloramphenicol acetyltransferase under HIV-1 LTR control has been reported
25 to be elevated 322- and 278-fold in HIV-I infected H9 and L8460D Jurkat
cells.
respectively (Sodroski et al., Science 225:381-385 (1984); Thomis et al..
Proc.
Natl. Acad. Sci. USA 89:10837-10841 (1992)). The overexpression of PKR to
these levels was not observed in the studies reported here, but such levels
were
not expected for several reasons. First, wild-type PKR protein overexpression
30 in eukaryotic systems has proven difficult due to its antiproliferative and
CA 02306444 2000-04-14
WO 99/19496 PCTIUS98I21880
-37-
autoregulatory properties (London et al. , Proc. Natl. Acad. Sci. USA 90:4616-
4620 (1993)). Second, high levels of cytoplasmic, enzymatically active PKR are
not achievable because the quantities of eIF-2B are in limiting intracellular
concentrations. When 30% of eIF-2a is modified to its phosphorylated state,
all
protein translation initiation is inhibited (Hershey, J. Biol. Chem. 2b4:
20823-26
(1989)). Third, the levels of PKR mRNA in IFN-treated SupTl and HeLa cells
as measured by RNase protection assays increased 4.5- and 5. 8-fold,
respectively,
but the protein levels increased approximately 2-fold.
B) PKR autophosphorylation levels during HIV-1 IIIB infection in HIV-1
LTR-PKR cDNA transduced clones
NP-40 extracts (30 ~g protein) prepared at the indicated times p. i.
were diluted to a total volume of 300 ~I with buffer A [20 mM Tris-HC1 (pH
7.6), SO mM KCI, 400 mM NaCI. 5 mM 2-mercaptoethanol, 1 % Triton X-100.
1 mM EDTA, IO ~g/ml aprotinin, 0.2 mM PMSF, 20% (vol/vol) glycerol]. Ten
ul of anti-human PKR rabbit antiserum was added to each sample and the samples
were incubated on ice for 60 minutes. Protein A Sepharose CL-4B
(Phamacia) [50 ~l of a 50% (vollvol> suspension in buffer A] was added to each
tube followed by incubation with continuous rotation for 30 minutes at 4"C.
The
Sepharose was pelleted (420 x g, 4°C, S min) and washed 4 times with
300 ~1
''0 buffer B [20 mM Tris-HCI (pH 7.6), 100 mM KCI, 0.1 mM EDTA, 10 c~g/ml
aprotinin. 20% (vol/voi) glycerol) and twice with buffer C (buffer B with 2 mM
MnCh and 2 mM MgCI,). Following removal of the last wash, the Sepharose
was resuspended in ~0 ~cl of buffer C containing 0 or 0.1 ~g/ml poly(rI)-
poly(rC)
and 2.5 uCi (y"-P]ATP ( > 7000 Ci/mmol>. Samples were incubated for 10 min
'S at 30°C. SDS sample buffer (4X) was added to each sample, and the
samples
were heated at 95 °C for 3 minutes. Proteins were separated by 8.5 %
SDSPAGE
and gels were dried and analyzed by autoradiography.
PKR autophosphorylation of the HIV-1 LTR-PKR cDNA
transduced clones and controls was examined at 24 hour intervals following
CA 02306444 2000-04-14
WO 99119496 PCTIUS98I21880
-38-
HIV-1 IIIB infection without or with 0.1 ~g poly(rl)-poly(rC) (Figure S). It
has
been reported that there is a direct relationship between the levels of PKR
autophosphorylation'and the quantity of eIF-2a phosphorylation (Mordechai et
al. , Virology 206:913-22 ( 1995); Suhadolnik et al. , Cancer Res. 43:5462-66
5 (1983)). PKR autophosphorylation levels in N2-20 extracts of untreated SupTl
and N2-20P control lines were lower than that observed for the HIV-1 LTR-PKR
cDNA clones. Addition of 0.1 ~glml poly(rI)-poly(rC) shifted PKR activation
levels to the right on the bell-shaped activation curve. Comparison of the 0.1
,ug/ml poly(rl) poly(rC)-treated SupT 1 and N2-20P extracts with the
10 corresponding untreated extracts revealed that most. if not all, of the PKR
is
inhibited. Clone 106-4:560 at 24 hours p.i. had increasing amounts of PKR
autophosphorylation at 0, 0.1, and 1.0 ,uglml poly(rI)-poly(rC) (243, 374, and
492 phosphorimager units, respectively). These results suggest that PKR is not
inhibited by the intracellular concentration of TAR RNA resulting from the HIV-
I
15 infection. The presence of the HIV-1 LTR-PKR cDNA sequences prevents the
inhibition of PKR activity observed in SupTl and N2-20P controls and
contributes to the antiviral activity observed upon HIV-1 challenge.
C) NF-KB gel electrophoretic mobility shift assays
Nuclear extracts were prepared from HIV-1 infected and
20 mock-infected clones (4 x 10° cells; m.o.i. = 0.1) at 72 hours
p.i.as described
(Schreiber et al., Nucleic Acids Res. 17:6419, (1989)). SupTl cells treated
with
or 50 ng/ml 12-O-tetradecanoylphorbol 13-acetate (TPA) for 30 minutes were
used as the positive control. Complementary, synthetic oligonucleotides
corresponding to the NF-xB binding site (SEQ ID N0:4) were annealed and
end-labeled with [y-'2PJATP utilizing T4 polynucleotide kinase. Specific
activity
of the probe was calculated to be 1.6 x 10~ dpml~g. A gel electrophoretic
mobility shift assay (GEMSA) was performed utilizing 5 ~g of nuclear extract
as
described (Bachelerie et al. , Nature 350:709-12 ( 1991 )). Specificity of NF-
xB for
its DNA oligonucleotide sequence was demonstrated by incubation of up to a
CA 02306444 2000-04-14
WO 99119496 PCTNS98/21880
-39-
50-fold molar excess of the 65-mer poly(A) annealed oiigonucleotides and
through competition in the presence of a 40-fold molar excess of radioinert,
annealed KB oligonucleotides added 20 minutes prior to incubation with the
[''-P]-labeled probe.
The capacity of PKR to phosphorylate IK-Ba was investigated by
examination of NF-xB binding levels in nuclear extracts from the HIV-I
LTR-PKR cDNA transduced clones. Ix-Ba is a cytoplasmic protein which
complexes with NF-xB and acts to repress its transcriptional enhancer
properties.
Upon phosphorylation, Ix-Ba undergoes a conformational change which releases
NF-xB to translocate into the nucleus and transactivate promoter elements
containing the xB binding site such as Ix-Ba, NF-xB, IFN-(3, cytokines.
imrrmnomodulators, and viral genes (Tzen et al. E.r. Cell Res. 211:12-16 (
1994)).
Treatment of SupTl cells with the NF-KB activator TPA (50 ng/ml), resulted in
72 and 79% stimulation of p50:p65 and p~0:p50 NF-KB DNA binding activity,
respectively. The specificity of the GEMSA assay was demonstrated by
competition for radioactive xB oligonucleotide binding with a 40- and 80-fold
excess of radioinert oligonucleotide and an inability to abrogate binding in
the
presence of a 5- to 54-fold molar excess of a radioinert, unrelated DNA
competitor. The levels of pS0:p50 and p50:p65 NF-xB DNA binding activity
were not significantly modulated in the 105-10 and 106-4 transduced clones
following infection with HIV-1 IIIB (Figure 6). These data suggest that PKR is
not acting through this alternative pathway in SupTI cells to increase IFN-~3
levels, nor is transcription initiation from the HIV-1 LTR indirectly
stimulated
by PKR activation. The constitutive activity of NF-xB observed in the absence
25 of infection by a mechanism unrelated to PKR may contribute to the ability
of
HIV-1 to replicate efficiently in this cell line through interactions with the
multiple NF-xB binding sites located within the HIV-1 LTR (Nabel et al. ,
Nature
(London) 326:711-713 (1987)}.
CA 02306444 2000-04-14
WO 99!19496 PCT/US98/21880
- 40 _
EXAMPLE 7
Inhibition of HIV-1 IIIB Infection in HIV-1 LTR-PKR cDNA
Transduced Clones Treated With AZT
The intracellular immunization approach was used in combination
with a traditional antiviral drug chemotherapeutic approach.
Control cells and the transduced clones were treated with the
reverse transcriptase inhibitor. 3'-azido-3'-deoxythymidine (AZT) prior to HIV-
I
infection to investigate a combinatory in vitro effect between the HIV-1 LTR
driven PKR cDNA sequences and the AZT. AZT was added 1 hour prior to
infection at a final concentration of 0, 5, I0, 50, 100, or 1000 nM.
A 90 % inhibition of syncytia formation in the control N2-20P cells
(~) was achievable with a calculated 313.3 nM AZT (Figure 7). In contrast,
90 % inhibition of syncytia formation in the 105-10:27 ( ~ ) and 105-10:239 (
x )
cell lines was achieved with a calculated 55.8 nM AZT, which is a decrease of
82 % . The lOb-582 (~) cell line required a calculated 23.3 nM AZT (a decrease
of 93~ ) for 90% syncytia inhibition. In contrast, syneytia formation in the
106-4:560 ( ~ ) cell line was reduced 93 % in the absence of AZT and was not
further enhanced by AZT supplementation.
EXAMPLE $
20 Ability of HIV-1 LTR-PKR cDNA Clones to Inhibit Reactivation of HIV-1
in Latently Infected Cells
Cell lines containing integrated copies of the HIV provirus were
used to demonstrate the ability of HIV-1 LTR-PKR cDNA clones to inhibit viral
reactivation in a chronically infected system.
ACH-2 is a lyrnphocytic cell line containing one copy of the HIV
provirus in the genome (Pomerantz et al., Cell 61:1271-76 (1990)). U1 is a
CA 02306444 2000-04-14
WO 99J19496 PCTJUS98I21880
-41 -
promonocytic cell line containing two integrated copies of the HIV provirus in
the
genome (Folks et al. , Science 238:800-02 (1987)).
The chronically infected cell lines, ACH-2 and Ui, were
transduced with the HIV-1 LTR-PKR cDNA constructs using the retroviral
5 supernatants of the retroviral producer cell lines as described in Example
4. HIV
expression was induced by treatment with tumor necrosis factor alpha (TNF-a.
50 ng/ml) (Folks et al. , Proc. Natl. Acad. Sci. USA $6:2365-b8 (1989)). Cells
were maintained in culture. The HIV-1 LTR.-PKR cDNA-transduced Ul and
ACH-2 inhibited HIV-1-induced syncytia formation 99 i~ and 99%, respectively.
Western analysis as described by Kon et al. (J. Biol. Chem. 271:19983-90
( 1996)) showed an increase in PKR expression through 96 hour post-induction
in
the transduced U1 cells.
EXA1VIPLE 9
Animal Model of AIDS
15 SCID mice reconstituted with human peripheral blood monocytic
cells (PBMC) are used as a model system (Markham et al.. J. Virol. 70(10):6947-
54 fOct. 1996); Rizza et al., J. Virol. 70:7958-64 (Nov. 1996)) to demonstrate
the in vivo efficacy of the claimed methods and compositions, and to optimize
treatment protocols before their use in human subjects.
20 PBMC are obtained by hemapheresis from healthy HIV-
seronegative donors, and purified by Ficoll-Paque density gradient
contrifugation.
CB17 scidlscid mice (SLID mice) between 4 and 6 weeks of age
are maintained under specific-pathogen-free conditions, with all food, water,
and
bedding being autoclaved before use.
25 PBMC are transduced by cocultivation with recombinant virus
producer lines, as described in Example 4, or by direct infection with a
retroviral
supernatant or a more concentrated retroviral preparation. Cells are selected
for
neomycin (G418) resistance, as in Example 3A. SCID mice are reconstituted by
intraperitoneal (i.p.) injection of ?x10' transduced PBMC.
CA 02306444 2000-04-14
WO 99/19496 PCT/US98I21880
-42-
Reconstituted (hu-PBL-SCID) mice are infected with HIV-1 strain
IIIB at two hours, at eight days, or at two weeks after reconstitution. For
infection, serial tenfold dilutions of 105 to 10z tissue culture infective
doses of
HIV-I are injected i.p. into the reconstituted mice. HIV infection is
monitored
over time by virus-specific PCR, by p24 assays, and by cocultivation assays
using
cells obtained by peritoneal lavage.
EXAMPLE 10
Intracellular Immunization Using a 2-SOAS Gene
Previous studies have demonstrated that the level of 2-SA is
inversely correlated with HIV-1 virion production: during the later stages of
infection HIV-1 virion production increases as 2-SA levels decline. Plasmid
constructs placing the expression of the 40 kDa 2-SOAS cDNA under the control
of the HIV-1 LTR were constructed and introduced into T lymphocytic cells via
a retroviral delivery system. The cells were then challenged with HIV-I strain
IIIB.
The pMEA002 plasmid was used as a backbone vector upon which
to build pMEA003, in which the cDNA encoding PKR was removed and replaced
with a cDNA encoding 2-SOAS. The pMEA002 plasmid was digested with
HindIII then blunt ended by treatment with Klenow DNA polymerase in the
presence of deoxynucleoside triphosphates. A subsequent digestion with EcoRl
released the PKR cDNA from the 3127 by blunt ended EcoRIpSP72-HIV-1 LTR
fragment, and this fragment was purified using DEAE cellulose. The 2-SOAS
cDNA was obtained froth pNK04, which has been used for the expression of
milligram quantities of 2-50AS (Kon and Suhadolnik. J. Biol. Chern.271:19983-
90 (1996)). The pNK04 DNA was digested with Ndel. filled in with Klenow
fragment, and digested with EcoRl to release a 1242 by fragment containing the
entire 2-SOAS cDNA. This fragment was purified using DEAE-cellulose.
The purified cDNA and vector fragments were ligated together (via
the EcoRl cohesive ends and blunt ends) to produce a 4374 by fragment in which
CA 02306444 2000-04-14
WO 99/19496 PCT/US98/21880
- 43 -
the HindIII restriction site was regenerated. The ligation mixture was used to
transform E. coli DHSa cells. DNA from 20 colonies was isolated using a
plasmid DNA boiling miniprep method. Plasmid structure was analyzed by
restriction analysis and by Sanger dideoxynucleotide sequencing, using T7, HIV
5 1 LTR. and SP6 primers.
In order to create the pMEA 103 vector, pMEA003 was digested
with HpaI and CIaI and the synthetic oIigonucleotide containing the
polyadenylation sequences utilized in the construction of the pMEA101 was
inserted downstream of the 2-50AS cDNA sequence. The XhoI-HIV-1 LTR-2-
10 SOAS-poly(A)-XhoI sequence was excised, purified. and inserted in the
forward
and reverse orientation into the XhoI site of pN2 to create pMEA109 and
pMEA110. respectively.
The plasmids encoding 2-SOAS under the control of an HIV LTR
were transferred into retroviral packaging cell lines in order to generate
retroviral
15 producer cell lines and recombinant virus, using the methods described in
Exampie 3. Recombinant retrovirus was transduced into T lymphocytic cells as
described in Example 4, and the transduced cells were challenged with HIV-1
strain IIIB as described in Example S.
Several of the transduced clones demonstrated a greater than 70
.°~o
20 decrease in HIV-1 virion production compared to infected T lyrnphocytic
controls. as determined by syncytia scoring. Several of these clones were
selected for further characterization. One clone, I09-20:5, has consistently
demonstrated 90% inhibition of syncytia formation as well as prolonged
expression of 2-SOAS through 96 hours p.i.
25 These studies indicate that intracellular immunization using a 2-
~OAS gene, alone or in combination with other chemotherapeutic agents, is a
potential long term treatment for the control of HIV infection.
All references discussed herein are incorporated by reference.
One skilled in the art will readily appreciate that the present
CA 02306444 2000-04-14
WO 99/19496 pCTIUS98I21880
-44-
invention is well adapted to carry out the objects and obtain the ends and
advantages mentioned, as well as those inherent therein. The present invention
may be embodied in other specific forms without departing from the spirit or
essential attributes thereof and, accordingly, reference should be made to the
appended claims, rather than to the foregoing specification, as indicating the
scope of the invention.
CA 02306444 2000-04-14
WO 99119496 PCTIUS98/21880
SEQUENCE LISTING
<110> Suhadolnik, Robert J.
Adelson, Martin E.
Iacono, Kathryn T.
Temple University - Of The Commonwealth System of
Higher Education
<120> Inhibition of Human Immunodeficiency Virus (HIV-1)
Replication
<130> 6056-240 PC
<190>
<141>
<150> 60/061,981
<151> 1997-10-16
<160> 9
<170> Patentln Ver. 2.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Seauence:HIV-1 LTR
Drimer
<400> i
~tgactagct agggaac 17
<210> 2
<211> 65
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Art~.ficial Sequence: contains
upstream polyadenylation signal, 23 nucleotide
spacer region, downstream polyadenylation beta
signal and XhoI site
<900> 2
cgatagatct aataaaagac cgcgggccct taaggccttg tgtgttggtt ttttgtgtgc 60
1
CA 02306444 2000-04-14
WO 99119496 PCT/US98I2188U
tcgag 65
<210> 3
<211> 63
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:complemtary to
SEQ ID NO: 2
<400> 3
ctcgagcaca caaaaaacca acacacaagg ccttaagggc ccgcggtctt ttattagatc 60
tat 63
<210> 4
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: sense probe
oligonucleotide corresponding to NF-kappa beta
binding site
<400> 9
acaagggact ttccgctggg gactttccag gga 33
2
