Note: Descriptions are shown in the official language in which they were submitted.
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
AMPLIFIABLE ADENO-ASSOCIATED VIRUS (AAV)
PACKAGING CASSETTES FOR THE PRODUCTION OF RECOMBINANT AAV
VECTORS
TECHNICAL FIELD
This invention is in the field of viral constructs for gene delivery. More
specifically, the invention is in the field of recombinant DNA constructs for
use in the
production of adeno-associated virus (AAV) vectors for gene delivery.
BACKGROUND
Vectors based on adeno-associated virus (AAV) are believed to have utility for
gene therapy bt~t a significant obstacle has been the difficulty in generating
such vectors in
amounts that would be clinically useful for human gene therapy applications.
This is a
particular problem for in vivo applications such as direct delivery to the
lung. Another
important goal in the gene therapy context, discussed in more detail herein,
is the
production of vector preparations that are essentially free of replication-
competent virions.
The following description briefly summarizes studies involving adeno-
associated virus and
AAV vectors, and then describes a number of novel improvements according to
the present
invention that are useful for e~ciently generating high titer recombinant AAV
vector
{rAAV) preparations suitable for use in gene therapy.
Adeno-associated virus is a defective parvovirus that grows only in cells in
which
certain functions are provided by a co-infecting helper virus. General reviews
of AAV
may be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. I,
pp. 169-
228, and Berns, 1990, Virolo , pp. 1743-1764, Raven Press, (New York).
Examples of
co-infectir..g viruses that provide helper functions for AAV growth and
replication are
adenoviruses, herpesviruses and, in some cases, poxviruses such as vaccinia.
The nature of
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
the helper function is not entirely known but it appears that the helper virus
indirectly
renders the cell permissive for AAV replication. This belief is supported by
the
observation that AAV replication may occur at low efficiency in the absence of
helper
virus co-infection if the cells are treated with agents that are either
genotoxic or that disrupt
the cell cycle.
Although AAV may replicate to a limited extent in the absence of helper virus,
under such conditions as noted above, more generally infection of cells with
AAV in the
absence of helper functions results in the proviral AAV genome integrating
into the host
cell genome. Unlike other viruses, such as many retroviruses, it appears that
AAV
generally integrates into a unique position in the human genome. Thus, it has
been
reported that, in human cells, AAV integrates into a unique position (referred
to as an
"AAV integration site") which is located on chromosome 19. See, e.g., Weitzman
et al.
(1994) Proc. Nat'1. Acad. Sci. USA 91: 5808-5812. If host cells having an
integrated AAV
are subsequently superinfected with a helper virus such as adenovirus, the
integrated AAV
genome can be rescued and replicated to yield a burst of infectious progeny
AAV particles.
A sequence at the AAV integration site, referred to as "P 1," shares homology
with the
AAV inverted terminal repeat (ITR) sequence, exhibits activity in a cell-free
replication
system, and is believed to be involved in both the integration and rescue of
AAV. See,
e.g., Weitzman et al., id., Kotin et al. (1992) EMBO J. 11:5071-5078, and
Urcelay et al., J.
Virol. 69: 2038-2046. The fact that integration of AAV appears to be efficient
and site-
specific makes.AAV a useful vector for introducing genes into cells for uses
such as
human gene therapy.
AAV has a very broad host range without any obvious species or tissue
specificity
and can replicate in virtually any cell line of human, simian or rodent origin
provided that
an appropriate helper is present. AAV is also relatively ubiquitous and has
been isolated
from a wide variety of animal species including most mammalian and several
avian
species.
AAV is not associated with the cause of any disease. Nor is AAV a transforming
or oncogenic virus, and integration of AAV into the genetic material of human
cells
generally does not cause significant alteration of the growth properties or
morphological
characteristics of the host cells. These properties of AAV also recommend it
as a
potentially useful human gene therapy vector because most of the other viral
systems
2
CA 02308008 2000-04-13
WO 99/20779 PCT/US98I21938
proposed for this application, such as retroviruses, adenoviruses,
herpesviruses, or
poxviruses, are disease-causing.
Although various serotypes of AAV are known to exist, they are all closely
related
functionally, structurally, and at the genetic level (see, e.g., Blacklow,
1988, pp. 165-174
of Parvoviruses and Human Disease, J.R. Pattison (ed.); and Rose, 1974,
Comprehensive
Virolo 3: 1-61). For example, all AAV serotypes apparently exhibit very
similar
replication properties mediated by homologous rep genes; and all bear three
related capsid
proteins such as those expressed in AAV2. The degree of relatedness is further
suggested
by heteroduplex analysis which reveals extensive cross-hybridization between
serotypes
along the length of the genome; and the presence of analogous self annealing
segments at
the termini that correspond to inverted terminal repeats (ITRs). The similar
infectivity
patterns also suggest that the replication functions in each serotype are
under similar
regulatory control. Thus, although the AAV2 serotype was used in various
illustrations of
the present invention that are set forth in the Examples, general reference to
AAV herein
encompasses all AAV serotypes, and it is fully expected that the methods and
compositions disclosed herein will be applicable to all AAV serotypes.
AAV particles are comprised of a proteinaceous capsid having three capsid
proteins, VP1, VP2 and VP3, which enclose a DNA genome. The AAV2 DNA genome,
for example, is a linear single-stranded DNA molecule having a molecular
weight of about
1.5 x 106 daltons and a length of about 5 kb. Individual particles package
only one DNA
molecule strand, but this may be either the "plus" or "minus" strand.
Particles containing
either strand are infectious and replication occurs by conversion of the
parental infecting
single strand to a duplex form and subsequent amplification of a large pool of
duplex
molecules from which progeny single strands are displaced and packaged into
capsids.
Duplex or single-strand copies of AAV genomes can be inserted into bacterial
plasmids or
phagemids and transfected into adenovirus-infected cells; these techniques
have facilitated
the study of AAV genetics and the development of AAV vectors.
The AAV genome, which encodes proteins mediating replication and encapsidation
of the viral DNA, is generally flanked by two copies of inverted terminal
repeats (ITRs).
In the case of AAV2, for example, the ITRs are each 145 nucleotides in length,
flanking a
unique sequence region of about 4470 nucleotides that contains two main open
reading
frames for the rep and cap genes (Srivastiva et al., 1983, J. Virol., 45:555-
564; Hermonat
3
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
et al., J. Virol. 51:329-339; Tratschin et al.,1984a, J. Virol., 51:611-619).
The AAV2
unique region contains three transcription promoters p5, p19, and p40
(Laughlin et al.,
1979, Proc. Natl. Acad. Sci. USA, 76:5567-5571) that are used to express the
rep and cap
genes. The ITR sequences are required in cis and are sufficient to provide a
functional
origin of replication (ori), signals required for integration into the cell
genome, and
efficient excision and rescue from host cell chromosomes or recombinant
plasmids. It has
also been shown that the ITR can function directly as a transcription promoter
in an AAV
vector. See Flotte et al., 1993, supra; and Carter et al., U.S. Patent No.
5,587,308.
The rep and cap gene products are required in traps to provide functions for
replication and encapsidation of viral genome, respectively. Again, using AAV2
for
purposes of illustration, the rep gene is expressed from two promoters, p5 and
p19, and
produces four proteins. Transcription from p5 yields an unspliced 4.2 kb mRNA
encoding
a first Rep protein (Rep78), and a spliced 3.9 kb mRNA encoding a second Rep
protein
(Rep68). Transcription from p19 yields an unspliced mRNA encoding a third Rep
protein
(Rep52), and a~spliced 3.3 kb mRNA encoding a fourth Rep protein (Rep40).
Thus, the
four Rep proteins all comprise a common internal region sequence but differ in
their amino
and carboxyl terminal regions. Only the large Rep proteins (i.e. Rep78 and
Rep68) are
required for AAV duplex DNA replication, but the small Rep proteins (i.e.
Rep52 and
Rep40) appear to be needed for progeny, single-strand DNA accumulation
(Chejanovsky
& Carter, 1989, Virolo 173:120-128). Rep68 and Rep78 bind specifically to the
hairpin
conformation of the AAV ITR and possess several enzyme activities required for
resolving
replication at the AAV termini. Rep52 and Rep40 have none of these properties.
Reports
by C. H~3lscher et al. (1994, J. Virol. 68:7169-7177; and 1995, J. Virol.
69:6880-6885)
have suggested that expression of Rep78 or Rep 68 may in some circumstances be
sufficient for infectious particle formation.
The Rep proteins, primarily Rep78 and Rep68, also exhibit pleiotropic
regulatory
activities including positive and negative regulation of AAV genes and
expression from
some heterologous promoters, as well as inhibitory effects on cell growth
(Tratschin et al.,
1986, Mol. Cell. Biol. 6:2884-2894; Labow et al., 1987, Mol. Cell. Biol.,
7:1320-1325;
Khleif et al., 1991, Virolo , 181:738-741). The AAV p5 promoter is negatively
auto-
regulated by Rep78 or Rep68 (Tratschin et al., 1986, Mol. Cell. Biol. 6:2884-
2894). Due
to the inhibitory effects of expression of rep on cell growth, constitutive
expression of rep
4
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
in cell lines has not been readily achieved. For example, Mendelson et al.
(1988, Virolo ,
166:154-165) reported very low expression of some Rep proteins in certain cell
lines after
stable integration of AAV genomes.
The capsid proteins VP1, VP2, and VP3 share a common overlapping sequence,
but VP1 and VP2 contain additional amino terminal sequences. All three
proteins are
encoded by the. same cap gene reading frame typically expressed from a spliced
2.3 kb
mRNA transcribed from the p40 promoter. VP2 and VP3 can be generated from this
mRNA by use of alternate initiation codons. Generally, transcription from p40
yields a 2.6
kb precursor mRNA which can be spliced at.alternative sites to yield two
different
transcripts of about 2.3 kb. VP2 and VP3 can be encoded by either transcript
(using either
of the two initiation sites), whereas VP1 is encoded by only one of the
transcripts. VP3 is
the major capsid protein, typically accounting for about 90% of total virion
protein. VP1
is coded from a minor mRNA using a 3' donor site that is 30 nucleotides
upstream from the
3' donor used for the major mRNA that encodes VP2 and VP3. All three proteins
are
required for effective capsid production. Mutations which eliminate all three
proteins
(Cap-negative) prevent accumulation of single-strand progeny AAV DNA, whereas
mutations in the VP1 amino-terminus ("Lip-negative" or "Inf negative") can
permit
assembly of single-stranded DNA into particles but the infectious titer is
greatly reduced.
The genetic analysis of AAV that was highlighted above was largely based upon
mutational analysis of AAV genomes cloned into bacterial plasmids. In early
work,
molecular clones of infectious genomes of AAV were constructed by insertion of
double-
strand molecules of AAV into plasmids by procedures such as GC-tailing
(Samulski et al.,
1982, Proc. Natl. Acad. Sci. USA, 79:2077-2081), addition of synthetic linkers
containing
restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-
73) or by direct,
blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666).
Transfection of such AAV recombinant plasmids into mammalian cells that were
also
infected with an appropriate helper virus, such as adenovirus, resulted in
rescue and
excision of the AAV genome free of any plasmid sequence, replication of the
rescued
genome and generation of progeny infectious AAV particles. This provided the
basis for
performing genetic analysis of AAV as summarized above and permitted
construction of
AAV transducing vectors.
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
Based on the genetic analysis, the general principles of AAV vector
construction
were defined as reviewed recently (Carter, 1992, Current Opinions in
Biotechnology,
3:533-539; Muzyczka, 1992, Curr. Topics in Microbiol. and Immunol., 158:97-
129).
AAV vectors are generally constructed in AAV recombinant plasmids by
substituting
portions of the AAV coding sequence with foreign DNA to generate a recombinant
AAV
(rAAV) vector or "pro-vector". In the vector, the terminal (ITR) portions of
the AAV
sequence must generally be retained intact because these regions are generally
required in
cis for several functions, including excision from the plasmid after
transfection, replication
of the vector genome and integration and rescue from a host cell genome. In
some
situations, providing a single ITR may be sufficient to carry out the
functions normally
associated with two wild-type ITRs (see, e.g., Samulski et al., WO 94/13788,
published 23
June 1994).
The vector can then be packaged into an AAV particle to generate an AAV
transducing virus by transfection of the vector into cells that are infected
by an appropriate
helper virus such as adenovirus or herpesvirus; provided that, in order to
achieve
replication and encapsidation of the vector genome into AAV particles, the
vector must
generally be complemented for any AAV functions required in trans,
particularly rep and
cap, that were deleted in construction of the vector.
Such AAV vectors are among a small number of recombinant virus vector systems
which have been shown to have utility as in vivo gene transfer agents
(reviewed in Carter,
1992, Current Opinion in Biotechnology, 3:533-539; Muzyczlca, 1992, Curr. Top.
Microbiol. Immunol. 1 S 8:97-129) and thus are potentially of great importance
for human
gene therapy. AAV vectors are capable of high-frequency transduction and
expression in a
variety of cells including cystic fibrosis (CF) bronchial and nasal epithelial
cells (see, e.g.,
Flotte et al., 1992a, Am. J. Respir. Cell Mol. Biol. 7:349-356; Egan et al.,
1992, Nature,
358:581-584; Flotte et al., 1993a, J. Biol. Chem. 268:3781-3790; and Flotte et
al., 1993b,
Proc. Natl. Acad. Sci. USA, 93:10163-10167); human bone marrow-derived
erythroleukemia cells (see, e.g., Walsh et al., 1992, Proc. Natl. Acad. Sci.
USA, 89:7257-
7261 ); as well as brain, eye and muscle cells. AAV may not require active
cell division for
transduction and expression which would be another clear advantage over
retroviruses,
especially in tissues such as the human airway epithelium where most cells are
terminally
differentiated and non-dividing.
6
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
There are at least two desirable features of any AAV vector designed for use
in
human gene therapy. The first is that the transducing vector be generated at
titers
sufficiently high to be practicable as a delivery system. This is especially
important for
gene therapy stratagems aimed at in vivo delivery of the vector. For example,
it is likely
that for many desirable applications of AAV vectors, such as treatment of
cystic fibrosis by
direct in vivo delivery to the airway, the desired dose of transducing vector
may be from
10$ to 10'°, or, in some cases, in excess of 10'° particles.
Secondly, the vector preparations
are preferably essentially free of wild-type AAV virus (or any replication-
competent
AAV). The attainment of high titers of AAV vectors has been difficult for
several reasons
including preferential encapsidation of wild-type AAV genomes (if they are
present or
generated by recombination), and the difficulty in generating sufficient
complementing
functions such ~s those provided by the wild-type rep and cap genes. Useful
cell lines
expressing such complementing functions have been especially difficult to
generate, in part
because of pleiotropic inhibitory functions associated with the rep gene
products. Thus,
cell lines in which the rep gene is integrated and expressed may grow slowly
or express
rep at very low levels.
The first AAV vectors described contained foreign reporter genes such as neo,
cat
or dhfr expressed from AAV transcription promoters or an SV40 promoter
(Tratschin et
al., 1984b, Mol. Cell. Biol. 4:2072-2081; Hermonat & Muzyczka, 1984, Proc.
Natl. Acad.
Sci. USA, 81:6466-6470; Tratschin et al., 1985, Mol. Cell. Biol. 5:3251-3260;
McLaughlin
et al., 1988, J. Virol., 62:1963-1973; Lebkowski et al., 1988 Mol. Cell.
Biol., 7:349-356).
These vectors were packaged into AAV-transducing particles by co-transfection
into
adenovirus-infected cells together with a second "packaging plasmid"
containing the AAV
rep and cap genes expressed from the wild-type AAV transcription promoters.
Several
strategies have~been employed in attempts to prevent encapsidation of the
packaging
plasmid. In some cases, (Hermonat & Muzyczka, 1984; McLaughlin et al., 1988) a
large
region of bacteriophage lambda DNA was inserted into the packaging plasmid
within the
AAV sequence to generate an oversized genome that could not be packaged. In
other
cases, (Tratschin et al., 1984b; Tratschin et al., 1985, Lebkowski et al.,
1988), the
packaging plasmid had deleted the ITR regions of AAV so that it could not be
excised and
replicated and thus could not be packaged. All of these approaches failed to
prevent
generation of particles containing replication-competent AAV DNA and also
failed to
7
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
generate effective high titers of AAV transducing particles. Indeed, titers of
not more than
10° infectious particles per ml were cited by Hermonat & Muzyczka,
1984.
In many studies, the presence of overlapping homology between AAV sequences
present in the vector and packaging plasmids resulted in the production of
replication-
competent AAV particles. It was shown by Senapathy and Carter (1984, J. Biol.
Chem.
259:4661-4666) that the degree of recombination in such a system is
approximately
equivalent to the degree of sequence overlap. It was suggested in a review of
the early
work (Carter 1989, Handbook of Parvoviruses, Vol. II, pp. 247-284, CRC Press,
Boca
Raton, FL) that titers of 106 infectious particles per ml might be obtained,
but this was
based on the above-cited studies in which large amounts of replication-
competent AAV
contaminated the vector preparation. Such vector preparations containing
replication-
cornpetent AAV will generally not be preferred for human gene therapy.
Furthermore,
these early vectors exhibited low transduction efficiencies and did not
transduce more than
1 or 2% of cells in cultures of various human cell lines even though the
vectors were
supplied at multiplicities of up to 50,000 particles per cell. 'This may have
reflected in part
the contamination with replication-competent AAV particles and the presence of
the AAV
rep gene in the vector. Furthermore, Samulski et al. (1989, J. Virol. 63:3822-
3828)
showed that the presence of wild-type AAV significantly enhanced the yield of
packaged
vector. Thus, in packaging systems where the production of wild-type AAV is
eliminated,
the yield of packaged vector may actually be decreased. Nevertheless, for use
in any
human clinical application it will be preferable to essentially eliminate
production of
replication-competent AAV.
Additional studies (McLaughlin et al., 1988; Lebkowski et al., 1988)
attempting to
generate AAV vectors laoking the AAV rep or cap genes still generated
replication-
competent AAV and still produced very low transduction frequencies on human
cell lines.
Thus, McLaughlin et al., 1988 reported that AAV rep-negative cap-negative
vectors
containing the neo gene packaged with the same packaging plasmid used earlier
by
Hermonat & Muzyczka (1984) still contained replication-competent AAV. As a
consequence, it was only possible to use this virus at a multiplicity of 0.03
particles per
cell (i.e., 300 infectious units per 10,000 cell) to avoid double hits with
vector and wild-
type particles. Thus, when 32,000 cells were infected with 1000 infectious
units, an
average of 800 geneticin-resistant colonies was obtained. Although this was
interpreted as
8
CA 02308008 2000-04-13
WO 99/20779 PCTNS98/21938
demonstrating that the virus was capable of yielding a transduction frequency
of 80%, in
fact only 2.5% of the cells were transduced. Thus the effectively useful titer
of this vector
was limited. Furthermore, this study did not demonstrate that the actual titer
of the vector
preparation was any higher than those obtained previously by Hermonat &
Muzyczka
(1984). Similarly, Lebkowski et al., 1988, packaged AAV vectors which did not
contain
either a rep or cap gene, using an ori-negative packaging plasmid (pBalA)
identical to that
used earlier by Tratschin et al., (1984b, 1985), and reported transduction
frequencies that
were similarly low, in that for several human cell lines not more than 1 % of
the cells could
be transduced to geneticin resistance even with their most concentrated vector
stocks.
Lebkowski et al., (1988) did not report the actual vector titers in a
meaningful way but the
biological assays, showing not more than 1% transduction frequency when 5 x
106 cells
were exposed to three ml of vector preparation, indicate that the titer was
less than 2 x 10"
geneticin resistant units per ml. Also, the pBalA packaging plasmid contains
overlapping
homology with the ITR sequence in the vector and can lead to generation of
replication-
competent AAV by homologous recombination.
Laface et al. (1988) used the same vector as that used by Hermonat & Muzyczka
(1984) prepared in the same way and obtained a transduction frequency of 1.5%
in marine
bone marrow cultures, again showing very low titer.
Sa~-nulski et al. (1987, J. Virol., 61:3096-3101) constructed a plasmid called
pSub201 which contained an intact AAV genome in a bacterial plasmid but which
had a
deletion of 13 nucleotides at the extremity of each ITR and thus was rescued
and replicated
less efficiently than other AAV plasmids that contained the entire AAV genome.
Samulski
et al. (1989, J. Virol., 63:3822-3828) constructed AAV vectors based on
pSub201 but
deleted for rep and cap and containing either a hyg or neo gene expressed from
an SV40
early gene promoter. They packaged these vectors by co-transfection with a
packaging
plasmid called pAAV/Ad which consisted of the entire AAV nucleotide sequence
from
nucleotide 190 to 4490 enclosed at either end with one copy of the adenovirus
ITR. In this
packaging plasmid the AAV rep and cap genes were expressed from their native
AAV
promoters (i.e. p5, p19 and p40, as discussed above). The function of the
adenovirus ITR
in pAAV/Ad was thought to enhance the expression level of AAV capsid proteins.
However, rep is expressed from its homologous promoter and is negatively
regulated and
thus its expression is limited. Using their encapsidation system, Samulski et
al. generated
9
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
AAV vector stocks that were substantially free of replication-competent AAV
but had
transducing titers of only 3 x 104 hygromycin-resistant units per ml of
supernatant. When
a wild-type AAV genome was used in the packaging plasmid, the titer of the AAV
vector
prep was increased to S x 10' hygromycin-resistant units per ml. The low titer
produced in
this system thus appears to have been due in part to the defect in the ITR
sequences of the
basic pSub201 plasmid used for vector construction and in part due to limiting
expression
of AAV genes from pAAV/Ad. In an attempt to increase the titer of the AAVneo
vector
preparation, Samulski et al. generated vector stocks by transfecting, in bulk,
thirty 10-cm
dishes of 293 cells and concentrating the vector stock by banding in CsCI.
This produced
an AAVneo vector stock containing a total of 10g particles as measured by a
DNA dot-blot
hybridization assay. When this vector stock was used at multiplicities of up
to 1,000
particles per cell, a transduction frequency of 70% was obtained. This
suggests that the
particle-to-transducing ratio is about 500 to 1,000 particles since at the
ratio of one
transducing unit per cell the expected proportion of cells that should be
transduced is 63%
according to the Poisson distribution.
Although the system of Samulski et al. (1989), using the vector plasmid
pSub201
and the packaging plasmid pAAV/Ad, did not have overlapping AAV sequence
homology
between the two plasmids, there is overlapping homology at the XbaI sites and
recombination of these sites can lead to the generation of complete
replication-competent
AAV. That is, although overlapping homology of AAV sequence is not present,
the
complete AAV. sequence is contained within the two plasmids and the plasmids
share a
short (non-AAV) sequence that might facilitate recombination to generate
replication-
competent AAV, which is undesirable. That this class of recombination occurs
in AAV
plasmids was shown by Senapathy & Carter (1984, J. Biol. Chem. 259:4661-4666).
Given
the problems of low titer, and the capability of generating wild-type
recombinants, the
system described by Samulski et al., 1989, does not have practical utility for
human gene
therapy.
Several other reports have described AAV vectors. For example, Srivastiva et
al.,
(1989, Proc. Natl. Acad. Sci. USA, 86:8078-8082) described an AAV vector based
on the
pSub201 plasmid of Samulski et al. (1987), in which the coding sequences of
AAV were
replaced with the coding sequences of another parvovirus, B 19. This vector
was packaged
into AAV particles using the pAAV/Ad packaging plasmid to generate a
functional vector,
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
but titers were not reported. This system was based on pSub201 and thus
suffers from the
defect described above for this plasmid. Second, the vector and the packaging
plasmid
contained overlapping AAV sequences (the ITR regions) and thus recombination
yielding
contaminating wild-type virus is highly likely.
$ Chatterjee et al. (1991, Vaccines 91, Cold Spring Harbor Laboratory Press,
pp. 85-
89), Wong et al. (1991, Vaccines 91, Cold Spring Harbor Laboratory Press, pp.
183-189),
and Chatterjee et al. (1992, Science, 258:1485-1488) describe AAV vectors
designed to
express antisense RNA directed against infectious viruses such as HIV or
Herpes simplex
virus. However, these authors did not report any titers of their AAV vector
stocks.
Furthermore, they packaged their vectors using an ori-negative packaging
plasmid
analogous to that used by Tratschin et al. (1984b, 1985) containing the BalA
fragment of
the AAV genome and therefore their packaging plasmid contained AAV vector
sequences
that have homology with AAV sequences that were present in their vector
constructs. This
will also lead to generation of replication-competent AAV. Thus, Chatterjee et
al., and
Wong et al., used a packaging system known to give only low titer and which
can lead to
generation of replication-competent AAV genomes because of the overlapping
homology
in the vector and packaging sequences.
Other reports have described the use of AAV vectors to express genes in human
lymphocytes (Muro-Cacho et al., 1992, J. Immunotherapy, 11:231-237) or a human
erythroid leukemia cell line (Walsh et al., 1992, Proc. Natl. Acad. Sci. USA,
89:7257-
7261) with vectors based on the pSub201 vector plasmid and pAAV/Ad packaging
plasmid. Again, titers of vector stocks were not reported and were apparently
low because
a selective marker gene was used to identify those cells that had been
successfully
transduced with the vector.
Transduction of human airway epithelial cells, grown in vitro from a cystic
fibrosis
patient, with an AAV vector expressing the selective marker gene neo from the
AAV p5
promoter was reported (Flotte et al., 1992, Am. J. Respir. Cell. Mol. Biol.
7:349-356). In
this study the AAVneo vector was packaged into AAV particles using the pAAV/Ad
packaging plasmid. Up to 70% of the cells in the culture could be transduced
to geneticin
resistance and the particle-to-transducing ratio was similar to that reported
by Samulski et
al. (1989). Thus to obtain transduction of 70% of the cells, a multiplicity of
up to several
hundred vector particles per cell was required. Transduction of human airway
epithelial
11
CA 02308008 2000-04-13
WO 99/20779 PCTNS98/21938
cells in in vitro culture using an AAV transducing vector that expressed the
cystic fibrosis
transmembrane conductance regulator (CFTR) gene from the AAV ITR promoter
showed
that the cells could be functionally corrected for the electrophysiological
defect in chloride
channel function that exists in cells from cystic fibrosis patients (Egan et
al., Nature, 1992,
358:581-584; Flotte et al., J. Biol. Chem. 268:3781-3790).
The above-cited studies suggest that AAV vectors have potential utility as
vectors
for treatment of human disease by gene therapy. However, the difficulty in
generating
sufficient amounts of AAV vectors has been a severe limitation on the
development of
human gene therapy using AAV vectors. One aspect of this limitation is that
there have
been very few studies using AAV vectors in in vivo animal models (see, e.g.,
Flotte et al.,
1993b; and Kaplitt et al., 1994, Nature Genetics 8:148-154). This is generally
a reflection
of the difficulty associated with generating sufficient amounts of AAV vector
stocks
having a high enough titer to be useful in analyzing in vivo delivery and gene
expression.
One of the limiting factors for AAV gene therapy has been the relative
inefficiency
of the vector packaging systems that have been used. In the absence of
suitable cell lines
expressing sufficient levels of the AAV traps complementing functions, such as
rep and
cap, packaging of AAV vectors has been achieved in adenovirus-infected cells
by co-
transfection of a packaging plasmid and a vector. The efficiency of this
process is
expected to be limited by the efficiency of transfection of each of the
plasmid constructs,
and by the low level of expression of Rep proteins from the packaging plasmids
described
to date. Each of these problems appears to relate to the biological activities
of the AAV
Rep proteins which are known to be associated with pleiotropic inhibitory
effects. In
addition, as noted above, all of the packaging systems described above have
the ability to
generate replication-competent AAV by recombination.
The difficulty in generating cell lines stably expressing functional Rep
apparently
reflects a cytotoxic or cytostatic function of Rep as shown by the inhibition,
by Rep
protein, of neo-resistant colony formation (Labow et al., 1987; Trempe et al.,
1991 ). This
also appe~.rs to relate to the tendency of Rep to reverse the immortalized
phenotype in
cultured cells, which has made the production of cell lines stably expressing
functional rep
extremely difficult. Several attempts to generate cell lines expressing rep
have been made.
Mendelson et al., (1988, Virology, 166:154-165) reported obtaining in one cell
line some
low level expression of AAV Rep52 protein but no Rep78 or Rep68 protein after
stable
12
CA 02308008 2000-04-13
WO 99/20779 PCTNS98/21938
transfection of HeLa or 293 cells with plasmids containing an AAV rep gene.
Because of
the absence of Rep78 and Rep68 proteins, vector could not be produced in the
cell line.
Another cell line made a barely detectable amount of Rep78 which was
nonfunctional.
Vincent et al. (1990, Vaccines 90, Cold Spring Harbor Laboratory Press, pp.
353-
359) attempted to generate cell lines containing the AAV rep and cap genes
expressed
from the normal AAV promoters, but these attempts were not successful either
because the
vectors were contaminated with a 100-fold excess of wild-type AAV particles or
because
the vectors were produced at only very low titers of less than 4 x 103
infectious particles.
Other variations that have been proposed include systems based on the
production
of AAV Cap proteins that might be used to reconstitute AAV particles, e.g. by
assembly in
vitro (see, e.g., WO 96/00587, published O1 November 1996); systems employing
AAV
rep-cap genes on a helper virus (see, e.g., WO 95/06743, published 09 March
1995); and
systems employing helper viruses from non-human mammals (see, e.g., WO
95/20671,
published 03 August 1995).
In yet another approach, Lebkowski et al. (U.S. patent 5,173,414, issued 22
Dec.
1992) constructed cell lines containing AAV vectors in an episomal plasmid.
These cell
lines could then be infected with adenovirus and transfected with the trans-
complementing
AAV functions rep and cap to generate preparations of AAV vector. It is
claimed that this
allows higher titers of AAV stocks to be produced. However, in the examples
described,
the only information relative to titer that is shown is that one human cell
line, K562, could
be transduced at efficiencies of only 1% or less, which does not indicate high
titer
production of any AAV vector. In this system the vector is carried as an
episomal
(unintegrated) construct, and it is stated that integrated copies of the
vector are not
preferred. In a subsequent patent (LT.S. No. 5,354,678, issued 11 Oct. 1994),
Lebkowski et
al. suggest introducing rep and cap genes into the cell genome but the method
again
requires the use of episomal AAV transducing vectors comprising an Epstein-
Barr virus
nuclear antigen (EBNA) gene and an Epstein-Barr virus latent origin of
replication; and,
again, the only information relative to titer indicated that it was fairly
low. Similarly,
Kotin et al. (W095/14771, published O1 3une 1995) suggested a system employing
"first"
and "second" vectors to provide a source of an rAAV vector and AAV rep-cap
genes,
respectively. The proposed system involves a series of sequential
transfections/infections
of the host cells, in a transient transfection system. No data were provided
regarding
13
CA 02308008 2000-04-13
WO 99/20779 PCT/US98I21938
rAAV viral titers obtained and, indeed, it is not apparent that any rAAV virus
was actually
produced according to the suggested system, much less at high titer).
The problem of suboptimal levels of rep expression after plasmid transfection
also
relates to another biological activity of these proteins. There is evidence
(Tratschin et al.,
1986, Mol. Cell. Biol. 6:2884-2894) that AAV Rep proteins down-regulate their
own
expression from the AAV-p5 promoter which has been used in the various
previously
described packaging constructs such as pAAV/Ad (Samulski et al., 1989) or
pBalA
(Lebkowski et al., 1988, 1992).
Arother attempt to develop cell lines expressing functional rep activity was
recently published by Holscher et al. (1994, J. Virol. 68:7169-7177). They
described the
generation of cell lines in which rep was placed under control of a
glucocorticoid-
responsive MMTV promoter. Although they observed particle formation, the
particles
were apparently noninfectious. Additional experiments indicated that the
defect was quite
fundamental; namely, there was virtually no accumulation of single-stranded
rAAV DNA
in the cells. Production of infectious particles required an additional
transient transfection
with constitutive highly-expressed rep constructs (i.e. they had to "add back"
Rep activity
to cells that were supposed to be able to provide it themselves).
There is a significant need for methods that can be used to efficiently
generate
rAAV vectors that are essentially free of wild-type or other replication-
competent AAV;
and a corresponding need for cell lines that can be used to effectively
generate such rAAV
vectors. Several improved approaches to generating AAV packaging cell lines
have also
been described recently, see, e.g., T. Flotte et al., WO 95/13365 (Targeted
Genetics
Corporation and Johns Hopkins University), and corresponding U.S. Patent
5,658,776; J.
Trempe et al., WO 95/13392 (Medical College of Ohio), and corresponding U.S.
Patent
Application Serial No. 08/362,608, now proceeding to issuance as a U.S.
Patent; and J.
Allen, WO 96/17947 (Targeted Genetics Corporation). The present invention
provides
additional improvements in the production of high-titer rAAV vector
preparations.
DISCLOSURE OF THE INVENTION
The present invention provides compositions and methods that provide
amplifiable
expression of the AAV rep and/or cap genes (also referred to herein as "AAV
packaging
genes") which can be employed in the generation of recombinant AAV (rAAV)
vectors. In
14
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
particular, the inventors have found that by removing the AAV rep and/or cap
genes from
their normal environment (i.e. flanked by the AAV ITRs) and placing them in
amplifiable
linkage with one or more activating elements (exemplified by the "P1" sequence
of human
chromosome 19, or analogous elements), it is possible to obtain controlled but
highly
amplifiable expression of the AAV packaging genes in cells to be used for the
preparation
of rAAV vectors. As described and exemplified herein, packaging cassettes
comprising
rep and/or cap sequences in amplifiable linkage to P1 or a P1-like element can
be
integrated into the chromosome of a host cell or can be maintained
extrachromosomally as
an episome. The methods and compositions of the present invention can be used
to
generate stable AAV producer cells that are capable of supporting production
of a very
large burst of rAAV particles upon infection with a suitable helper virus
(such as
adenovirus) or provision of helper functions.
Accordingly, in one embodiment, the invention provides a recombinant
polynucleotide sequence encoding an adeno-associated virus (AAV) packaging
cassette
comprising at least one AAV packaging gene amplifiably linked to a P 1
sequence, or an
equivalent activating element.
In additional embodiments, the invention provides methods for producing high-
titer
stocks of rAAV vectors containing a foreign gene of interest, by co-expressing
an rAAV
vector containing a gene of interest along with an AAV packaging cassette
comprising at
least one AAV packaging gene amplifiably linked to an activating element.
The invention also provides compositions and methods for producing cell lines
comprising an AAV packaging cassette of the invention together with an rAAV
vector
containing a gene of interest; cell lines produced thereby; compositions and
methods for
high-efficiency packaging of an rAAV vector containing a gene of interest; and
rAAV
vectors packaged according to the method of the invention.
As illustrated below, AAV packaging cassettes comprising one or more
activating
elements and one or more AAV packaging genes can be introduced into a host
cell and
propagated episomally or they can be integrated into a chromosome of a
mammalian host
cell. Thus, in an exemplary embodiment, the invention provides AAV packaging
cassettes
comprising AAV packaging genes and an activating element that are capable of
integrating
into the genome of a host cell (such as a mammalian cell); as well as
packaging cells
comprising such stably-integrated integrated cassettes. In another exemplary
embodiment,
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
the invention provides episomal packaging cassettes comprising one or more AAV
packaging genes and one or more activating elements, present within a host
cell as a freely-
replicating episome (or capable of being introduced into a host cell such
that, after
introduction into the host cell, the packaging cassette will exist as a freely-
replicating
episomal element); as well as packaging cells comprising such episomally-
maintained
packaging cassettes. Illustrative examples of the design and use of both types
are provided
herein.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows a map of the p5repcapDHFR plasmid.
Figure 2 shows a map of the P1RCD plasmid.
Figure 3 shows a map of the episomal packaging plasmid P1/p5repcap/RepB. The
concatameric P 1 elements (at "12 o'clock" on the circle) are indicated. Each
P 1 element
comprises a terminal resolution site (TRS) and a Rep-binding site (RBS, also
known as a
Rep-binding motif or RB Motif). The p5repcap(-Pl)/Rep8 construct is identical
except
that it does not contain the concatameric P 1 elements.
Figure 4 shows phosphorimaging analysis of a Southern blot to assay levels of
the
episomal P1-containing packaging plasmid in the presence (+) or absence (-) of
Ad5
infection. Lanes 1 and 2 - HeLa cells containing the episomal packaging
plasmid
pSrepcap(-P1)/RepB. Lanes 3 and 4, 5 and 6 - HeLa cells containing the
episomal
packaging plasmid P1/p5repcap/RepB.
Figure 5 shows phosphorimaging analysis of a Southern blot to assay rAAV-CFTR
production in cells containing the episomal packaging plasmids p5repcap{-
P1)/Rep8 and
P1/p5repcap/RepB, in the presence (+) or absence (-) of Ad5 infection. Lanes 1
and 2 -
HeLa cells containing the episomal packaging plasmid p5repcap(-P1)/Rep8. Lanes
3 and
4, 5 and 6 - HeLa cells containing the episomal packaging plasmid
P1/p5repcap/RepB.
DETAILED DESCRIPTION OF THE INVENTION
A basic challenge in the area of gene therapy is the development of strategies
for
efficient gene delivery to cells and tissues in vivo. One strategy involves
the use of adeno-
associated virus (AAV) vectors. Recombinant AAV vectors are recombinant
constructs of
the AAV genome comprising sequences required in cis for vector packaging
(typically
16
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
AAV ITR sequences), along with heterologous polynucleotide(s) encoding a
protein or
function of interest. Recombinant AAV vectors are potentially powerful tools
for human
genetherapy.
Although rAAV vectors are capable of in vivo gene delivery, for example in the
respiratory tract, high titers of such vectors are necessary to allow the
delivery of a
sufficiently high multiplicity of vector in a minimal volume. Consequently,
optimal
packaging methodology is of central importance for AAV-mediated gene therapy
approaches. Packaging of rAAV vectors is mediated by the products of two AAV
genes:
rep (replication proteins) and cap (capsid proteins), which can be provided
separately in
traps. A sequence comprising AAV packaging genes to be provided in traps is
often
referred to herein as a "packaging cassette". It is thus desirable to
construct packaging cell
lines containing both the AAV packaging genes (e.g., in a packaging cassette)
and an
rAAV vector. However, stable, helper-free AAV packaging cell lines have been
difficult
to obtain, primarily due to the activities of Rep and Cap proteins, for which
low-level
expression can impose a severe constraint on packaging, while high-level
expression
(particularly of Rep proteins) can negatively affect the host cell (see
Background). The
present invention provides controlled but amplifiable expression of the rep
and cap genes,
to thereby provide Rep and capsid proteins at levels sufficient for production
of high-titer
vector stocks, while avoiding any effects of cell toxicity (as can occur if
the rep gene is
placed under the control of regulatory elements that exhibit some constitutive
activity or
are not tightly regulated).
The methods and compositions of the present invention, which allow for
controlled, amplifiable expression of AAV packaging genes, even when the
packaging
genes are expressed from their native promoters {such as the rep gene p5
promoter, which
is a relatively weak promoter), provide substantial improvements in packaging
efficiency.
This is accomplished by providing AAV packaging genes in a recombinant DNA
construct
wherein they are amplifiably linked to an activating element. In preferred
embodiments,
the activating element is directly or indirectly triggered by the user when it
is desired to
initiate vector production, preferably by infection with helper virus or
provision of helper
function. The use of the P1 sequence of human chromosome 19 is exemplary in
these
respects. Thus, in the absence of adenovirus infection (or equivalent helper
function), little
if any Rep is produced from the p5 promoter, which is relatively weak or
inactive in the
17
CA 02308008 2000-04-13
WO 99120779 PCT/US98/21938
absence of helper virus infection or provision of helper function (e.g.,
adenovirus infection
or inclusion in the host cells of helper functions, such as ElA activity in
human 293 cells).
Without wishing to be bound by theory, it appears that upon infection or
provision of
helper function, the p5 promoter is turned on to some degree, resulting in the
synthesis of
some Rep protein, which may then, by acting via the P 1 activating element,
trigger an
amplification event by which the linked rep and/or cap genes are amplified -
thereby
serving as the basis for a much higher level of expression. The activating
element,
exemplified by~ P 1, can thus promote amplification of AAV packaging genes to
which it is
linked. The resulting elevation in template levels would allow the gene
products (like Rep
and Cap proteins) to be produced in much higher amounts, particularly in view
of the fact
that their promoters can also be transcriptionally activated to thereby
provide efficient
packaging functions. Inclusion of an activating element in an AAV packaging
cassette,
along with AAV packaging genes, thus provides a new type of AAV packaging
cassette
which is particularly useful in the production of high-titer stocks of rAAV
vectors, as
described and exemplified herein.
Some previous attempts to incorporate rep genes into a host cell may have
resulted
in either of two undesirable alternatives: (1) host cells containing a stably-
integrated,
expressed rep gene in which cytotoxic and/or cytostatic effects limit cell
growth and/or led
to poor titers of rAAV vectors; or (2) host cells exhibiting normal growth
rates, but
nevertheless having little capability for generating high titers of rAAV
vectors (possibly
reflecting integration at transcriptionally silent sites, sequence
rearrangements, etc.).
Without wishing to be bound by theory, it is proposed that the AAV packaging
cassettes of
the present invention can also be used to effectively provide a baseline level
of Rep
proteins that is very low (if present at all) and is therefore not detrimental
to the growth of
the host cell, but can be amplified when required (for example by helper virus
infection or
provision of helper function) to a level that promotes efficient production of
rAAV vectors.
Thus, when brought about under the control of the user, amplification results
in increased
levels of templates comprising AAV packaging genes, which collectively allow
high levels
of expression of packaging gene products (e.g., Rep and Cap proteins), which
in turn
facilitates production of high titers of rAAV genomes.
In the case of the wild-type AAV, for example, it is generally believed that
the
native promoter for Rep protein expression (p5) is relatively weak and
consequently that
18
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
synthesis of native Rep proteins does not occur to any substantial degree in
the absence of
stimulatory factors such as the ElA proteins provided by adenovirus as a
helper virus, or
equivalent helper functions. (It should be noted that human 293 cells contain
portions of
the human adenovirus genome, in particular the E1 region, that appear to
stimulate the p5
promoter.) In addition to the relatively low activity of the rep p5 promoter
in the absence
of helper function, it appears that AAV Rep proteins can effectively modulate
their own
expression. Both of these phenomena tend to prevent replication from occurring
when the
virus is in the latent proviral state.
The present invention effectively provides for controlled amplification of DNA
comprising the packaging cassettes of the invention, thereby providing
increased template
levels for synthesis of AAV packaging proteins. Thus, in the packaging
cassettes of the
invention, AAV packaging genes can be operably linked to relatively weak
promoters and
nevertheless be capable of providing acceptable levels of packaging proteins
upon
activation. In preferred embodiments, AAV packaging genes are operably linked
to their
native promoters (i.e., p5, p19 and p40, in the case of AAV2 as described
above). Since p5
is an extremely weak promoter, and virtually no transcription initiated from
p5 is observed
in the absence of helper function, an AAV packaging cassette wherein packaging
gene
expression is controlled by p5 is not likely to have any Rep-dependent
cytostatic effect on
the host cell prior to activation and amplification. However, upon activation
by helper
virus infection or provision of helper function, the packaging cassette
template is
amplified, leading to a greater number of templates for transcription of AAV
packaging
proteins. Furthermore, helper virus infection or provision of helper function
is believed
also to stimulate transcription from the p5 promoter (which regulates
synthesis of mRNA
encoding Rep proteins). Accordingly, in the packaging cassettes of the
invention,
expression of AAV packaging genes is preferably not triggered until provision
of helper
function (i.e., at the time the host cells are to be used for packaging of
rAAV particles),
thereby avoiding the accumulation of high (and potentially cytostatic or
cytotoxic) levels
of AAV packaging proteins prior to the time they are required for packaging.
These
preferred embodiments thus provide two levels of augmentation of packaging
protein
synthesis, in which a helper function-dependent activating element is
amplifiably linked to
sequences encoding AAV packaging genes, whose promoters are also stimulated by
helper
function.
19
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
The inventors have shown, as described below, that AAV packaging cassettes
comprising activating elements (as exemplified by the P 1 sequence element)
can be used to
generate dramatic increases in the levels of vector production. The use of P 1
sequences as
activating elements for the AAV packaging cassettes of the present invention
is believed to
be particularly convenient since the same event that is required to trigger
the productive
generation of AAV particles (i.e. provision of helper virus or helper
functions) is believed
to also trigger amplification of a construct containing an activating element
such as P1
(such as, for example, a packaging cassette of the invention), and up-regulate
the AAV
promoters (including PS), resulting in both provision of increased template
and in higher
levels of synthesis of the packaging gene products (i.e. AAV packaging
proteins) from the
amplified templates. Thus, according to the present invention, the coupling of
activating
elements, such as P1, with AAV packaging genes can provide a combination of
advantages
including control of packaging gene product levels (in the "pre-activated"
state) and, upon
activation, amplification of template levels and stimulation of transcription.
It is also noted that, in many cases, the activation of replication origins
is, or can
be, subject to strict control. Accordingly, various replication origins, such
as those present
in eukaryotic or prokaryotic chromosomes, viral genomes, organelle genomes,
and
bacteriophage genomes, for example, and other origin-like or "ori-like"
sequences can be
used in the practice of the invention (e.g. , as alternatives or additions to
the use of P 1 ).
Such "activatable" origins are those that are not constitutive, but rather
require a signal
before replication initiation and subsequent amplification of linked sequences
will occur.
The practice of the present invention will employ, unless otherwise indicated,
conventional techniques of molecular biology, microbiology, recombinant DNA,
and
immunology, which are within the skill of the art. Such techniques are
explained fully in
the literature. See e.g., Sambrook, Fritsch, and Maniatis, Molecular Cloning:
A
Laboratory Manual, Second Edition (1989); Oligonucleotide Synthesis (M.J. Gait
Ed.,
1984); Animal Cell Culture (R.I. Freshney, Ed., 1987); the series Methods in
Enzymology
(Academic Press, Inc.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller
and
M.P. Calos eds. 1987); Handbook of Experimental Immunology, (D.M. Weir and
C.C.
Blackwell, Eds.); Current Protocols in Molecular Biology (F.M. Ausubel, R.
Brent, R.E.
Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds., 1987);
and Current
Protocols in Immunology (J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M.
Shevach
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
and W. Strober, eds., 1991 ).
All patents, patent applications, and publications mentioned herein, both
supra and
infra, are hereby incorporated herein by reference.
Definitions
The terms "polypeptide", "peptide" and "protein" are used interchangeably to
refer
to polymers of amino acids of any length. These terms also include proteins
that are post-
translationally modified through reactions that include, but are not limited
to,
glycosylation, acetylation and phosphorylation.
"Polynucleotide" refers to a polymeric form of nucleotides of any length,
either
ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers
only to the
primary structure of the molecule. Thus, double- and single-stranded DNA, as
well as
double- and single-stranded RNA are included. It also includes modified
polynucleotides
such as methylated or capped polynucleotides.
A "gene" refers to a polynucleotide containing at least one open reading frame
that
is capable of encoding a particular protein after being transcribed and
translated.
A "transcriptional regulatory sequence" as used herein, refers to a nucleotide
sequence that controls the transcription of a gene or coding sequence to which
it is
operably linked. Transcriptional regulatory sequences of use in the present
invention
generally include at least one transcriptional promoter and may also include
one or more
enhancers and/or terminators of transcription.
A "promoter," as used herein, refers to a nucleotide sequence that directs the
transcription of a gene or coding sequence to which it is operably linked.
"Operably linked" refers to an arrangement of two or more components, wherein
the components so described are in a relationship permitting them to function
in a
coordinated manner. By way of illustration, a transcriptional regulatory
sequence or a
promoter is operably linked to a coding sequence if the transcriptional
regulatory
sequence or promoter promotes transcription of the coding sequence. An
operably linked
transcriptional regulatory sequence is generally joined in cis with the coding
sequence,
but it is not necessarily directly adjacent to it.
"Recombinant," refers to a genetic entity distinct from that generally found
in
nature. As applied to a polynucleotide or gene, this means that the
polynucleotide is the
21
CA 02308008 2000-04-13
WO 99120779 PCTlUS98121938
product of various combinations of cloning, restriction and/or ligation steps,
and other
procedures that result in a construct that is distinct from a polynucleotide
found in nature.
"Heterologous" means derived from a genotypically distinct entity from that of
the
rest of the entity to which it is compared. For example, a polynucleotide
introduced by
genetic engineering techniques into a different cell type is a heterologous
polynucleotide
(and, when expressed, can encode a heterologous polypeptide). Similarly, a
transcriptional regulatory sequence or promoter that is removed from its
native coding
sequence and operably linked to a different coding sequence is a heterologous
transcriptional regulatory sequence or promoter.
A "vector", as used herein, refers to a recombinant plasmid or virus that
comprises
a polynucleotide to be delivered into a host cell, either in vitro or in vivo.
The
polynucleotide to be delivered, sometimes referred to as a "target
polynucleotide,"
"transgene", or "gene of interest" may comprise a coding sequence of interest
in gene
therapy (such as a gene encoding a protein of therapeutic interest) and/or a
selectable or
detectable marker.
A "replicon" refers to a polynucleotide comprising an origin of replication
which
allows for replication of the polynucleotide in an appropriate host cell.
Examples of
replicons include episomes (including plasmids), as well as chromosomes (such
as the
nuclear or mitochondria) chromosomes).
An "origin," "replication origin," "ori-like sequence" or "ori element" is a
nucleotide sequence involved in one or more aspects of initiation of DNA
replication,
such as, for example, binding of replication initiation factors, unwinding of
the DNA
duplex, primer formation, and/or template-directed synthesis of a
complementary strand.
As discussed in detail herein and in the art, ori-like sequences can generally
be found in
any polynucleotide that is naturally replicated, including plasmids and
viruses, as well as
prokaryotic, mitochondria) and chloroplast genomes and eukaryotic chromosomes.
Such
ori-like sequences can be identified genetically (i.e., replication-defective
mutants, ars
sequences) or functionally (i. e., through biochemical assay, electron
microscopy, etc. ), as
is known in the art.
"Stable integration" of a polynucieotide into a cell means that the
polynucleotide
has been integrated into a replicon that tends to be stably maintained in the
cell. Although
episomes such as plasmids can sometimes be maintained for many generations,
genetic
22
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/Z1938
material carried episomally is generally more susceptible to loss than
chromosomally-
integrated material. However, maintenance of a polynucleotide can often be
effected by
incorporating a selectable marker into or adjacent to a polynucleotide, and
then
maintaining cells carrying the polynucleotide under selective pressure. In
some cases,
sequences cannot be effectively maintained stably unless they have become
integrated
into a chromosome; and, therefore, selection for retention of a sequence
comprising a
selectable marker can result in the selection of cells in which the marker has
become
stably-integrated into a chromosome. Antibiotic resistance genes can be
conveniently
employed as such selectable markers, as is well known in the art. Typically,
stably-
integrated polynucleotides would be expected to be maintained on average for
at least
about twenty generations, preferably at least about one hundred generations,
still more
preferably they would be maintained permanently. The chromatin structure of
eukaryotic
chromosomes can also influence the level of expression of an integrated
palynucleotide.
Having the genes carried on stably-maintained episomes can be particularly
useful where
it is desired to have multiple stably-maintained copies of a particular gene.
The selection
of stable cell lines having properties that are particularly desirable in the
context of the
present invention are described and illustrated below.
"AAV" is adeno-associated virus. Adeno-associated virus is a defective
parvovirus that grows only in cells in which certain functions are provided by
a co-
infecting helper virus. General reviews of AAV may be found in, for example,
Carter,
1989, Handbook of Parvoviruses, Vol. I, pp. 169-228, and Berns, 1990,
Virology, pp.
1743-1764, Raven Press, (New York). The AAV2 serotype was used in some of the
illustrations of the present invention that are set forth in the Examples.
However, it is
fully expected that these same principles will be applicable to other AAV
serotypes since
it is now known that the various serotypes are quite closely related - both
functionally and
structurally, even at the genetic level (see, e.g., Blacklow, 1988, pp. 165-
174 of
Parvoviruses and Human Disease, J.R. Pattison (ed.); and Rose, 1974,
Comprehensive
Virology 3: 1-61). For example, all AAV serotypes apparently exhibit very
similar
replication properties mediated by homologous rep genes; and all bear three
related capsid
proteins such as those expressed in AAV2. The degree of relatedness is further
suggested
by heteroduplex analysis which reveals extensive cross-hybridization between
serotypes
along the length of the genome; and the presence of analogous self annealing
segments at
23
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
the termini that correspond to inverted terminal repeats (lTRs). The similar
infectivity
patterns also suggest that the replication functions in each serotype are
under similar
regulatory control.
A "recombinant AAV vector" (or "rAAV vector") refers to a vector comprising
one or more polynucleotide sequences of interest, genes of interest or
"transgenes" that
are flanked by AAV inverted terminal repeat sequences (ITRs). Such rAAV
vectors can
be replicated and packaged into infectious viral particles when present in a
host cell that
has been infected with a suitable helper virus and that is expressing AAV rep
and cap
gene products (i.e. AAV Rep and Cap proteins). When an rAAV vector is
incorporated
into a larger polynucleotide (e.g. in a chromosome or in another vector such
as a plasmid
used for cloning or transfection), then the rAAV vector is typically referred
to as a "pro-
vector" which can be "rescued" by replication and encapsidation in the
presence of AAV
packaging functions and necessary helper functions.
A "helper virus" for AAV refers to a virus that allows. AAV (which is a
"defective" parvovirus) to be replicated and packaged by a host cell. A number
of such
helper viruses have been identified, including adenoviruses, herpesviruses and
poxviruses
such as vaccinia. The adenoviruses encompass a number of different subgroups,
although
Adenovirus type 5 of subgroup C (Ad5) is most commonly used. Numerous
adenoviruses
of human, non-human mammalian and avian origin are known and available from
depositories such as the ATCC. Viruses of the herpes family include, for
example, herpes
simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as
cytomegaloviruses
(CMV) and pseudorabies viruses (PRV); which are also available from
depositories such
as ATCC. "Helper function" refers to the activity provided by the helper virus
that allows
replication and packaging of an AAV genome, or any equivalent activity. Helper
functions are also believed to stimulate transcription of some AAV promoters,
including
p5, and may enhance processivity of replication in cells in which helper
functions are
expressed.
"Packaging" as used herein refers to a series of subcellular events that
results in
the assembly and encapsidation of a viral vector, particularly an rAAV vector.
Thus,
when a suitable vector is introduced into a packaging cell line under
appropriate
conditions, it can be assembled into a viral particle. Functions associated
with packaging
of viral vectors, particularly rAAV vectors, are described herein and in the
art.
24
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
AAV "rep" and "cap" genes are genes encoding replication and encapsidation
proteins, respectively. AAV rep and cap genes have been found in all AAV
serotypes
examined, and are described herein and in the references cited. In wild-type
AAV, the rep
and cap genes are generally found adjacent to each other in the viral genome
(i.e. they are
"coupled" together as adjoining or overlapping transcriptional units), and
they are
generally conserved among AAV serotypes. AAV rep and cap genes are also
individually and collectively referred to herein as "AAV packaging genes." AAV
packaging genes that have been modified by deletion or point mutation, or
which have
been subdivided into components which can be rejoined by recombination (e.g.,
as
described in co-owned U.S. Patent Application Serial No. 60/041,609, filed 18
December
1996, the disclosure of which is hereby incorporated by reference), may also
be used in
the present invention. AAV packaging genes can also be operably linked to
other
transcriptional regulatory sequences, including promoters, enhancers and
polyadenylation
("polyA") sequences (which additional transcriptional regulatory sequences can
also be
heterologous). An "AAV packaging cassette" is a recombinant construct which
includes
one or more AAV packaging genes.
"Effciency" when used in describing a cell line refers to certain useful
attributes
of the line; in particular, the growth rate, and (for packaging cell lines)
the number of
virus particles produced per cell. "Efficient growth" of a packaging cell line
refers to the
effective growth rate of the packaging cell, related to a comparable parental-
type cell (i.e.,
a cell that does not carry an introduced AAV packaging gene) Preferably, the
relative
growth rate is at least 20% of the parental type, more preferably, 40%, more
preferably,
80%, still more preferably, 90% and, most preferably, 100%. "High efficiency
packaging" indicates production of at least about 100 viral particles per
cell, more
preferably at least about 1,000 viral particles per cell, still more
preferably at least about
10,000 viral particles per cell. "High safety packaging" indicates that, of
the recombinant
AAV viral particles produced, fewer than about 1 in 106 are replication-
competent AAV
viral particles, preferably fewer than about 1 in 1 O$ are replication-
competent, more
preferably fewer than about 1 in 10'° are replication-competent, still
more preferably
fewer than about 1 in 10'2 are replication-competent, most preferably none are
replication-
competent. Preferred packaging cells of the present invention exhibit
combinations of
such high efficiency and high safety.
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
"Host cells", "cell lines", "cell cultures", "packaging cell line" and other
such
terms denote higher eukaryotic cells, preferably mammalian cells, most
preferably human
cells, useful in the present invention. These cells can be used as recipients
for
recombinant vectors, viruses or other transfer polynucleotides, and include
the progeny of
the original cell that was transduced. It is understood that the progeny of a
single cell may
not necessarily be completely identical (in morphology or in genomic
complement) to the
original parent cell.
A "therapeutic gene", "target polynucleotide", "transgene", "gene of interest"
and
the like generally refer to a gene or genes to be transferred using a vector.
Typically, in
the context of the present invention, such genes are located within the rAAV
vector
(which vector is flanked by inverted terminal repeat (ITR) regions and thus
can be
replicated and encapsidated into rAAV particles). Target polynucleotides can
be used in
this invention to generate rAAV vectors for a number of different
applications. Such
polynucleotides include, but are not limited to: (i) polynucleotides encoding
proteins
useful in other forms of gene therapy to relieve deficiencies caused by
missing, defective
or sub-optimal levels of a structural protein or enzyme; (ii) polynucleotides
that are
transcribed into anti-sense molecules; {iii) polynucleotides that are
transcribed into
decoys that bind transcription or translation factors; (iv) polynucleotides
that encode
cellular modulators such as cytokines; (v) polynucleotides that can make
recipient cells
susceptible to specific drugs, such as the herpes virus thymidine kinase gene;
(vi)
polynucleotides for cancer, therapy, such as ElA tumor suppressor genes or p53
tumor
suppressor genes for the treatment of various cancers and (vii)
polynucleotides that
encode antigens or antibodies. To effect expression of the transgene in a
recipient host
cell, it is preferably operably linked to a promoter or other such
transcriptional regulatory
sequence, either its own or a heterologous promoter. A large number of
suitable
promoters are known in the art, the choice of which depends on the desired
level of
expression of the target polynucleotide; whether one wants constitutive
expression,
inducible expression, cell-specific or tissue-specific expression, etc. The
rAAV vector
may also contain a selectable marker.
An "activating element" is a sequence that responds to the presence of an
activation
signal by amplifying (i.e., replicating the sequences) to which it is
amplifiably linked. A
preferred activating element is the P 1 element and preferred activation
signals include
26
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
AAV helper functions (as exemplified by adenovirus ElA function) or their
equivalents.
As used herein, two sequences, one of which is an activating element; are
"amplifiably
linked" when they are in sufficient proximity to each other that replication
initiating from
the activating element results in amplification (i.e., increased copy number)
of the other
S sequence. Preferably, the copy number of the amplified sequence is amplified
2-fold or
greater, more preferably, 10-fold or greater, still more preferably, 20-fold
or greater. It is
to be noted that the ability of an activating element to amplify an
amplifiably-linked
sequence will be influenced by the degree of processivity of replication
initiating from the
activating element. Thus, factors that enhance processivity of replication
will tend to
increase the effective level of amplification of a sequence that is
amplifiably linked to an
activating element. In the context of the present invention, infection with
adenovirus, or
provision of equivalent helper function, may enhance processivity of
replication as well as
initiating amplification.
1 S SEQUENCES ACTIVATING AMPLIFICATION AND CONTROLLED, HIGH-EFFICIENCY
EXPRESSION OF AAV PACKAGING GENES
The present inventors have discovered that activating elements such as the P 1
sequence (normally found on human chromosome 19), when amplifiably linked to
AAV
packaging genes, can provide controlled, amplifiable expression of the linked
packaging
genes and/or a dramatic increase in the ability of such genes to support the
production of
high titers of rAAV vectors. In particular, when an AAV packaging cassette of
the present
invention is co-expressed in host cells with an rAAV vector (containing one or
more genes
of interest flanked by AAV ITR sequences) under suitable conditions including
the
provision of helper virus or helper function, high titers of AAV virus
containing the rAAV
2S vector are produced by the host cells. Thus, P I exemplifies a class of
activating elements
possessing, among other properties, activatable replication function, that is
useful in the
construction of AAV packaging cassettes to promote production of high-titer
stocks of
rAAV vectors.
The methods and compositions of the invention will therefore utilize
recombinant
DNA constructs wherein AAV packaging genes are amplifiably linked to one or
more
activating elements. The presently preferred activating elements are
exemplified by P 1
and P1-like elements that exhibit structural and functional properties related
to initiation of
27
CA 02308008 2000-04-13
WO 99lZ0779 PCT/US98/21938
replication. Most preferred are elements that act as helper function-inducible
origins of
replication. Other sequences that can be directly or indirectly induced to
initiate
replication in response to helper function will also be useful in the practice
of the
invention. In addition, sequences that are not inducible by helper function,
but which can
be induced to initiate DNA replication by other stimuli (provided and/or
controlled by the
user), are also useful as activating elements in the practice of the
invention. Examples of
such other inducible activating elements would include, by way of
illustration, a sequence
at which replication is initiated in the presence of a replication protein
that is itself
inducible (e.g., a temperature-sensitive replication protein that can be
activated by a shift to
permissive temperature, or a replication protein whose gene is placed under
the control of
an inducible promoter). Naturally-occurring activating elements having the
desired
properties can be isolated; alternatively, synthetic sequences can be designed
based, in
whole or in part, on the observed relationships between structure and function
found in
naturally-occurring activating elements.
The P 1 element contains at least two distinct sequence motifs, a site at
which Rep
proteins can bind, known as the "Rep-binding motif" (or "Rep-binding site")
and a
terminal resolution site, at which bound Rep protein can nick the DNA (see
Example A 1 ).
During AAV replication, it is believed that Rep protein binds within the AAV
inverted
terminal repeat and catalyzes the formation of a nick (at the terminal
resolution site),
resulting in covalent attachment of Rep protein to the newly generated 5' end.
The 3' end
of the nick serves as a primer for AAV DNA synthesis. Consequently, the Rep
binding
motif and/or the terminal resolution sequence, alone or in combination, may
form all or
part of an activating element for expression of AAV packaging genes.
Furthermore,
binding and cleavage of a sequence by Rep proteins can be used as an assay to
identify
additional activating elements.
With respect to the use of inducible origins as activating elements, it is
noted that
origin sequences in eukaryotes ("ori sequences") are generally associated with
several
characteristic functions including, but not limited to, protein binding, DNA
unwinding and
template-directed chain elongation. See, for example, Kornberg and Baker
(1992) DNA
REPLICAT10N, Second Edition, W.H. Freeman & Co., New York; Boulikas (1996) J.
Cell
Biochem. 60:297-316; and Dif~ley (1996) Genes & Devel. 10:2819-2830.
Accordingly,
28
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
sequences having one or any combination of these properties can fmd use as
activating
elements in the practice of the present invention.
For instance, various initiator proteins bind at or near the on sequence to
facilitate
initiation of DNA replication. Accordingly, sequences capable of binding such
initiator
proteins, and the initiator proteins themselves (and their encoding genes) can
find use in
the practice of the invention. Determination of the ability of a particular
protein to bind to
an on sequence can be assayed by several methods that are well-known in the
art,
including, but not limited to, sedimentation, nuclease protection, filter
binding, gel
mobility-shift, and various affinity techniques, including, but not limited
to, DNA affinity
matrices. Assays for origin function are well-known in the art and include
electron
microscopy, genetic analysis and template-directed incorporation of labeled
nucleoside
triphosphate, to name just a few. Activation of origin function can be
detected as an
increase in level of replication as determined by the above-mentioned origin
assays. Thus,
origin sequences can be identified, proteins that interact with a particular
origin can also be
identified, and the ability of an ori-binding protein to activate a particular
origin can be
determined by methods that are well-known in the art.
Thus, in additional embodiments, activating elements can take the form of
inducible replication origins, such as mammalian, viral, mitochondrial,
chloroplast,
plasmid or bacteriophage replication origins, for example.
Accordingly, an inducible origin can be amplifiably linked to AAV packaging
genes in an AAV packaging cassette and the packaging cassette can be
introduced into
suitable host cells containing an rAAV vector (or to which an rAAV vector is
added
simultaneously or subsequently). When packaging of the rAAV vector is
required, the
host cells are provided with a molecule, such as a protein, which activates
the inducible
origin, along with a helper function. The activating molecule can be provided
directly.
Alternatively, if the activating molecule is a protein, then a gene (or genes)
encoding the
protein, under the transcriptional control of an inducible promoter, can be
present in the
host cells. In this case stimulation of transcription of the genes) encoding
the activating
protein can be achieved by provision of the appropriate inducing molecule, or
the genes)
encoding the activating protein can be placed under the control of a promoter
that is
activated by a helper function, such as adenovirus infection. An appealing
feature of the
latter method is that the same signal (i.e., provision of helper function) can
be responsible
29
CA 02308008 2000-04-13
WO 99/20779
PCT/US98/21938
for transcriptional stimulation of both the genes) encoding the inducing
rnolecule(s) and
AAV packaging genes (since, for instance, transcription from the p5 promoter
is thought to
be stimulated by helper function, such as adenovirus infection). For
additional, non-
lirniting examples of promoters that are inducible by helper function (and
methods to
identify such promoters) see, for example, co-owned PCT Publication WO
96/17947, the
disclosure of which is hereby incorporated by reference in its entirety.
Further examples of
inducible promoters include, but are not limited to, the MMTV LTR promoter,
which is
inducible by glucocorticoids, and the metallothionein promoter, which is
inducible by
heavy metals. Many other inducible promoters are known in the art and can be
used in this
aspect of the invention.
Among other sequence that are commonly associated with origins of replication
are
palindromic sequences, sequences having the potential to form cruciform
structures, DNA
unwinding elements, sequences involved in synthesis or recruitment of
replication primers,
bent or curved DNA (which can be detected by its altered electrophoretic
mobility),
nuclease sensitive sequences, and nuclear matrix attachment sites. See, for
example,
Boulikas (1996) J. Cell Biochem. 60:297-316; and Diffley (1996) Genes & Devel.
10:2819-2830. In addition, sequences involved in chromosomal or
extrachromosomal
gene amplification can also be used as activating elements. To provide just
one example,
amplification of the dihydrofolate reductase (DHFR) gene occurs in response to
methotrexate. .
Sequences possessing origin activity, which may be useful as activating
elements,
can also be identified by electron microscopic analysis of replicating DNA
molecules.
See, for example, Fareed et al. (1980) Meth. Enzymology, vol. 65 (eds. L.
Grossman and
K. Moldave), Academic Press, New York, pp. 709-717.
Assays for ori-like sequences that can serve as activating elements in the
present
invention have been described above and are well-known to those of skill in
the art. In
addition, proteins, such as Rep, which interact with particular activating
elements, can be
identified by methods well-known in the art, including those described above,
and used for
the identification of additional activating elements.
30
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/Z1938
ORIENTATION AND SPACING OF ACTIVATING ELEMENTS WITH RESPECT TO AAV
PACKAGING GENES
We have observed that placing an activating element, as exemplified by a P 1
sequence, near to a cassette comprising AAV packaging genes resulted in a
dramatic
S increase in the ability of the packaging genes to support the production of
recombinant
AAV vectors. Indeed, as shown below, a P 1 element placed more than 4 kb
downstream
of the rep gene transcriptional start site in an integrated AAV packaging
cassette resulted
in approximately a 14-fold amplification of the packaging cassette (see
Example A 11
below) and close to a 1,000-fold increase in rAAV virus titer (see Example A
12 below),
compared to cells containing a packaging cassette lacking a P 1 element.
Although placing
an activating element further away from an AAV packaging gene (e.g. 5-10 kb or
further)
may result in somewhat lower activity, longer distances between an activating
element and
its amplifiably-linked AAV packaging genes would still be expected to provide
a degree of
activation sufficient for improved rAAV production, especially under
conditions in which
1 S processivity of replication is enhanced, as discussed above. Where P1 is
used as an
activating element, it can be desirable to have at least some spacer sequence
(e.g. about 0.5
to 1 kb) between the Pl sequence and the AAV packaging genes in order to
reduce or
eliminate the possibility that recombination between P 1 and an ITR sequence
could
regenerate a replication-competent AAV genome that would be of a size that
could be
efficiently packaged.
In amplifying copies of integrated AAV in response to helper virus infection,
the
P 1 element appears to direct amplification unidirectionally. Without wishing
to be bound
by theory, it is believed that interaction of Rep with a Rep-binding motif may
be followed
by nicking between the two T residues in a Terminal Resolution Site (TRS), as
illustrated
below. Subsequently, replication may initiate from the 3' hydroxyl end of the
nick and
proceed toward the Rep-binding motif. Accordingly, it is presently preferred
that a
unidirectional activating element as in the case of P 1 be oriented such that
unidirectional
replication proceeds from the activating element toward the associated AAV
packaging
gene(s). Alternatively, AAV packaging genes can be flanked by activating
elements that
are oriented so that replication initiated at each element proceeds "inward"
toward the
AAV packaging gene(s). However, bidirectional activating elements are also
useful in the
practice of the invention, since, in these cases, one of the two directions of
replication will
31
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
proceed toward the associated AAV packaging genes. Furthermore, for episomal
packaging cassettes, a unidirectional activating element wherein replication
is oriented
away from associated AAV packaging genes can also be useful, since replication
will
proceed around the circular episomal genome and eventually encounter the
associated
AAV packaging gene sequences. One can also incorporate multiple copies of such
activating elements, which can be oriented to promote replication in both
directions.
Exemplary illustrations of such constructs are provided below.
Addition of multiple activating elements to an AAV packaging cassette would be
expected to provide further degrees of amplification. For example, two P 1
elements that
are oriented such that replication initiated from each progresses in opposite
directions
would provide correspondingly higher levels of amplification of linked
sequences. Thus,
insertion of a second P 1 element into a construct such as P 1 RCD in such an
orientation as
to amplify the opposite strand of an integrated packaging construct should
increase
amplification, Rep and Cap levels and rAAV virus production.
In general, addition of multiple activating elements to the AAV packaging
cassettes
of the invention should increase amplification and therefore should increase
levels of AAV
packaging gene products. Consequently, production of rAAV vectors and virus
production
should also be increased under these conditions, compared to situations in
which a single
activating element is present in a packaging cassette.
PRODUCTION OF RAAV VECTORS
To generate recombinant AAV particles useful for such purposes as gene
therapy,
the packaging cell line is generally supplied with a recombinant AAV vector
comprising
AAV inverted terminal repeat (ITR) regions surrounding one or more
polynucleotides of
interest (or "target" polynucleotides).
The target polynucleotide, if it is intended to be expressed, is generally
operably
linked to a promoter, either its own or a heterologous promoter. A large
number of
suitable promoters are known in the art, the choice of which depends on the
desired level
of expression of the target polynucleotide; whether one wants constitutive
expression,
inducible expression, cell-specific or tissue-specific expression, etc. The
rAAV vector can
also contain a positive selectable marker in order to allow for selection of
cells that have
been infected by the rAAV vector; and/or a negative selectable marker (as a
means of
32
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
selecting against those same cells should that become necessary or desirable);
see, e.g.,
S.D. Lupton, PCT/US91/08442 and PCT/US94/05601.
By way of illustration, we have used rAAV vectors containing polynucleotides
that
encode a functional cystic fibrosis transmembrane conductance regulator
polypeptide
(CFTR) operably linked to a promoter. As is now known in the art, there are a
variety of
CFTR polypeptides that are capable of reconstituting CFTR activity in cells
derived from
cystic fibrosis patients. For example, Carter et al. have described truncated
variants of
CFTR genes that encode functional CFTR proteins (see, e.g., USSN 08/455,552,
filed 31
May 1995, now proceeding to issuance). See also, Rich et al. (1991, Science,
253:
205-207) who have described a CFTR derivative missing amino acid residues 708-
835,
that was capable of transporting chloride and capable of correcting a
naturally occurring
CFTR defect, and Egan et al. (1993) who described another CFTR derivative
(comprising
about 25 amino acids from an unrelated protein followed by the sequence of
native CFTR
beginning at residue 119) that was also capable of restoring
electrophysiological
characteristics of normal CFTR. To take two additional examples, Arispe et al.
(1992,
Proc. Natl. Acad. Sci. USA 89: 1539-1543) showed that a CFTR fragment
comprising
residues 433-586 was sufficient to reconstitute a correct chloride channel in
lipid bilayers;
and Sheppard et al. (1994, Cell 76: 1091-1098) showed that a CFTR polypeptide
truncated
at residue 836 to about half its length was still capable of building a
regulated chloride
channel. Thus, the native CFTR protein, and mutants and fragments thereof, all
constitute
CFTR polypeptides that are useful in the practice of this invention.
Other useful target polynucleotides can be used in this invention to generate
rAAV
vectors for a number of different applications. Such polynucleotides include,
but are not
limited to: (i) polynucleotides encoding proteins useful in other forms of
gene therapy to
relieve deficiencies caused by missing, defective or sub-optimal levels of a
structural
protein or enzyme; (ii) polynucleotides that are transcribed into anti-sense
molecules; (iii)
polynucleotides that are transcribed into decoys that bind transcription or
translation
factors; (iv) polynucleotides that encode cellular modulators such as
cytokines; (v)
polynucleotides that can make recipient cells susceptible to specific drugs,
such as the
herpes virus thymidine kinase gene; and (vi) polynucleotides for cancer
therapy, such as
the wild-type p53 tumor suppressor cDNA for replacement of the missing or
damaged p53
33
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
gene associated with over 50% of human cancers, including those of the lung,
breast,
prostate and colon.
Since the therapeutic specificity of the resulting recombinant AAV vector is
determined by the plasmid introduced, the same packaging cell line can be used
for any of
these applications. The plasmid comprising the specific target polynucleotide
is
introduced into the packaging cell for production of the AAV vector by one of
several
possible methods; including, for example, electroporation.
Helper virus can be introduced before, during or after introduction of the
rAAV
vector. For instance, the plasmid can be co-infected into the culture along
with the helper
virus. The cells are then cultured for a suitable period, typically 2-5 days,
in conditions
suitable for replication and packaging as known in the art (see references
above and
examples below). Lysates are prepared, and the recombinant AAV vector
particles are
purified by techniques known in the art.
In a preferred embodiment, also illustrated in the Examples below, the
recombinant
AAV vector is itself stably integrated into a packaging cell line. Such
stable, vector-
containing packaging lines can also optionally contain stable chromosomal or
episomal
packaging cassettes. Cell lines such as those described above can be grown and
stored
until ready for use. To induce production of rAAV particles, the user simply
infects the
cells with helper virus and cultures the cells under conditions suitable for
replication and
packaging of AAV (as described below).
Recombinant AAV vectors prepared using the methods and compositions of the
present invention can be purified according to techniques known in the art,
see, e.g., the
various AAV references cited above. Alternatively, improved purification
techniques can
be employed, such as those described by Atkinson et al. in a commonly-owned
U.S.
application entitled Methods for Generating High Titer Helper-Free
Preparations of
Recombinant AAV Vectors, filed OS September 1997 (as U.S. Serial No.
08/925,815).
The rAAV vectors can be used to deliver polynucleotides to target cells either
in
vitro or in vivo, as described in the references cited herein and in the art.
For delivery in
vivo, the rAAV vectors will typically be contained in a physiological suitable
buffered
solution treat can optionally comprise one or more components that promote
sterility,
stability and/or activity. Any means convenient for introducing the vector
preparation to a
34
CA 02308008 2000-04-13
WO 99/Z0779 PCTlUS98121938
desired location within the body can be employed, including, for example, by
intravenous
or localized injection, by infusion from a catheter or by aerosol delivery.
EXAMPLES
S
A. GENERATION OF AN INTEGRATED AAV PACKAGING CASSETTE FOR RAAV
PRODUCTION
A 1 Construction of an AAV packaging cassette employing P 1 as an exemplary
activating element
We have found that a P 1 sequence, as found within a region believed to be an
AAV
integration locus on human chromosome 19, can be used as an activating element
within
the context of the present invention. The exemplary P 1 sequence we used
comprises
nucleotides 354-468 of the AAV S1 locus (Kelman et al (1994} Curr. Opin.
Genet. Dev.
4:185-195 also Weitzman et al (1994) Proc. Natl. Acad. Sci. 91:5808-5817).
Shown below
1 S is the nucleotide sequence of P 1 (SEQ ID NOs. 1 and 2), including a
presumed terminal
resolution site (TRS) at nucleotides 372-377, and a presumed Rep binding motif
(RB
Motif, also known as a Rep-binding site or RBS), at nucleotides 386-401. Also
indicated
(by the downward-pointing arrow) is the presumed Rep cleavage site located
between the
thymidines of the TRS.
TRs
5' CGGGCGGGTGGTGGCGGCGGTTGGGGCTCGGCGCTCGCTCGCTCGCTGGGCGGGCGGGCGGT 3'
2S 3' GCCCGCCCACCACCGCCGCCAACCCCGAGCCGCGAGCGAGCGAGCGACCCGCCCGCCCGCCA 5'
R8 Motif
A 2. Construction of p5repcap
As an exemplary AAV packaging cassette, we linked a P 1 element (as described
above) to AAV rep and cap genes that remained operably linked to their native
AAV
promoters. As a first step in that process, an AAV packaging cassette,
p5repcap,
comprising the AAV rep and cap encoding sequences transcriptionally linked to
the native
pS, p19 and p40 promoters and followed by the AAV2 polyadenylation signal, was
constructed as follows. Briefly, a fragment from pAV2 comprising nucleotides
193 to 379
3S (Srivastiva et al. (1983) J. Virol. 45:555-564) was obtained by PCR
amplification. The
3S
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
design of the PCR primers resulted in addition of a BgIII site at the S' end
of the amplified
fragment and encompassed the PpuMI site (at AAV-2 nucleotide 3S0) close to the
3' end.
The PCR-amplified DNA was digested with BgIII and PpuMI to generate a
restriction
fragment comprising AAV-2 nucleotides 193-350. A restriction fragment
comprising
S nucleotides 3S1-4498 of pAV2 was isolated from pAV2 by digestion with PpuMI
and
SnaBI. These two fragments (representing nucleotides 193-4498 of pAV2) were
ligated
into a tgLS(+)HyTK retroviral vector (S.D. Lupton et al., Molecular and
Cellular Biology,
11: 3374-3378, 1991) in a four-way ligation that also included a StuI-BstEII
fragment of
tgLS(+)HyTK and a BstEI-StuI fragment of tgLS(+)HyTK to which a BgIII linker
had
been attached at the StuI end. This ligation generated tgLS(+)HyTK-repcap.
Subsequently, a BgIII - CIaI fragment from tgLS(+)HyTK-repcap, including AAV
rep and
cap genes transcriptionally linked to the native pS, p19 and p40 promoters and
followed by
the AAV2 polyadenylation signal, was isolated and cloned into the BamHI and
CIaI sites
of pSP72 (Promega).
1S
A 3. Construction of p5repcapDHFR
An AAV packaging expression plasmid, p5repcapDHFR, was constructed for the
purpose of producing an integrated packaging line including the construct
p5repcap
(Example A 2) and a modified dihydrofolate reductase gene (DHFR) as a
selectable
marker. Specifically, p5repcap {Example A 2) was linearized at a PvuII site
located just
upstream of the rep gene, and blunt-end ligated to a 1.8 kb fragment of pFR400
(Simonsen
et al. (1983) Proc. Natl. Acad. Sci. USA 80:2495-2499). This pFR400 fragment
was
comprised of a modified DHFR gene, with a reduced affinity for methotrexate
(Mtx),
transcriptionally linked to the SV40 early promoter and followed by the
polyadenylation
2S site from the Hepatitis B virus (HBV) surface antigen gene. The pFR400
fragment was
prepared by fiat digesting with SaII, followed by a four base pair fill-in (to
generate a
blunt end) and subsequent PwII digestion and gel purification. The resulting
construct,
p5repcapDHFR (Figure 1), contains a DHFR gene whose transcription is regulated
by an
upstream SV40 early promoter and a downstream Hepatitis B Virus
polyadenylation site.
Immediately downstream of this DHFR transcriptional cassette lie the AAV rep
and cap
genes, followed by an AAV polyadenylation site.
36
CA 02308008 2000-04-13
WO 99/20779
PCTNS98/21938
A 4. Addition of P 1 to a r -containin lasmid: Construction of P 1 RCD
An exemplary AAV packaging cassette was then generated by incorporating a P 1
element (Example A 1) into expression plasmid p$repcapDHFR (Example A 3). In
the
construction of the plasmid, "P 1 RCD", containing this packaging cassette,
the P 1 element
$ was inserted downstream of the AA.V polyadenylation signal in p$repcapDHFR
in an
orientation such that replication initiating from the P 1 element proceeds
first into the cap
gene and then into the rep gene (i.e., replication initiates at the 3' -OH of
the TRS on the
anti-sense strand and proceeds in a $'-to-3' direction towards the cap gene).
To facilitate
insertion of the P 1 element into p$repcapDHFR, a pair of oligonucleotides
were
synthesized which include the P1 sequence flanked by ends compatible with a
BgIII
restriction site (see sequences below, SEQ ID NOs. 3 and 4). The pair were
annealed, then
ligated to p$repcapDHFR previously linearized at a BgIII site located just
downstream of
the AAV polyadenylation site (Example A 3, nucleotide 6217). A clone named
P1RCD
was selected, containing a P 1 insert in an orientation such that replication
initiated at P 1
1$ proceeds in the direction of the cap and rep genes (Figure 2).
P1 Oligonucleotide pair: Top line: S8Q ID NO 3
Bottom line: S$Q ID NO 4
RB Motif
2O 5'GATCACTAGTACCGCCCGCCCGCCCAGCGAGCGAGCGAGCGCCGAGCCCCAACCGCCGCCACCACCCGCCCGA
3'
3~ TGATCATGGCGGGCGGGCGGGTCGCTCGCTCGCTCGCGGCTCGGGGTTGGCGGCGGTGGTGGGCGGGCTCTAGA
5'
TRS
2$ Additional exemplary constructs were produced in which the location and
multiplicity of the P 1 element was varied. P 1 ($')RCD contained a single P 1
element
upstream of the rep and cap genes at a distance of 1.5 kilobases from the rep
translation
initiation site. The construct 2PIRCD contained two P1 elements: the first
located
immediately downstream of cap as in P1RCD (see above) and the second inserted
1.$ kb
30 upstream of rep as in P 1 ($')RCD described above.
Insertion of a P 1 element into p$repcapDHFR to generate P 1 ($' )RCD, and
into
P 1 RCD to generate 2P 1 RCD, was performed in a manner analogous to that
described
above for insertion of a P1 element into p$repcapDHFR to generate P1RCD,
except that
the oligonucleotide pair listed below (SEQ ID NO $) was used. The new oligo
pair was
3$ annealed and ligated into p$repcapDHFR and P1RCD previously linearized at
the Pvu II
37
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
site located 1.5 kilobases upstream of the rep translation initiation codon.
Clones were
selected such that the orientation of the P1 insert resulted in DNA
replication proceeding
first into the rep gene and then into cap.
P1 oligo pair for coastruction of P1(5')RCD aad 2P1RCD
SSQ ID NO 5:
TRS
5' CCCGGGCGGGTGGTGGCGGCGGTTGGGGCTCGGCGCTCGCTCGCTCGCTGGGCOGGCGGGCGGTCAG 3'
3' GGGCCCGCCCACCACCGCCGCCAACCCCGAGCCGCGAGCGAGCGAGCOACCCGCCCGCCCGCCAGTC 5'
RB Motif
Additional exemplary packaging plasmids were constructed that contained P 1
elements in constructs lacking a selectable marker. Construct P 1 (5')RC
contained a single
P 1 element immediately upstream of the rep and cap genes; P 1 RC contained a
single P 1
element immediately downstream from the rep and cap genes; and 2P 1 RC
contained two
P 1 elements flanking rep-cap. The constructs were produced as described above
in this
example except that AAV packaging construct p5repcap (Example A2) was used in
place
of AAV packaging construct p5repcapDHFR. The P 1 sequence was inserted as
described
above in this example using both of the oligo pairs described above, as
appropriate. Virus
was produced by co-transfection of either p5repcap, P 1 RC, P 1 (5')RC, or 2P
1 RC along
with rAAV vector ACAPSN according to the method of Example A6, infra. Virus
titer
was measured for each using the method of Example A7, infra.
A 5. Construction of rAAV vector ACAPSN
The plasmid ACAPSN was constructed according to Lynch et al. (1997) Circ. Res.
80: 497-505 and PCT Publication WO 97/32990, as follows. The ITR sequences and
plasmid backbone were derived from AAV-CFTR. Afione et al. (1996) J. Virol.
70:3235-
3241. Briefly, the AAV-CFTR vector was digested with XhoI and SnaBI and the
ITRs and
plasmid backbone were gel isolated. An Xhol to SnaBI fragment containing a
portion of
the CMV promoter (nucleotides -671 to -464) [See, e.g., Boshart, et al., Cell,
41: 521-530
(1985)] was gel isolated and ligated to the ITR plasmid backbone fragment
derived from
AAV-CFTR to generate "pAAV-CMV (SnaBI)." Next, an Spel to SnaBI fragment
38
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
containing the synthetic polyadenylation signal was inserted into SpeI/SnaBI
digested
pAAV-CMV (SnaBl) to generate "pAAV-CMV (SpeI)-spA." The pAAV-CMV (SpeI)-
spA vector contains nucleotides -671 to -584 of the CMV promoter. Next, the
human
placental alkaline phosphatase cDNA sequence linked to the Simian virus 40
promoter
driving the E. coli neomycin gene was isolated from LAPSN [See, e.g., Clowes
et al.
(1994) J. Clin. Invest. 93: 644-651] as an SpeI to NheI fragment and inserted
into pAAV-
CMV (SpeI)-spA (which had been linearized with SpeI) to create "pAAV-APSN." An
SpeI to NheI fragment containing CMV promoter nucleotides -585 to + 71 was
inserted
into SpeI-linearized pAAV-APSN to generate vector "ACAPSN."
A 6. Virus production
Packaging of rAAV particles was performed as previously described. See, e.g.,
Flotte et al., J. Biol. Chem. 268 (5): 3781-3790 (1993); Flotte et al., Proc.
Natl. Acad. Sci.
USA, 93: 10163-10167 (1993); and Flotte et al. (1995) Gene Ther. 2:29-37.
According to
these protocols, equal amounts of packaging plasmids (either p5repcapDHFR or P
1 RCD)
and the rAAV vector ACAPSN were co-transfected into HeLa cells which had been
infected with helper Ad 5 at a MOI of 5. After incubation for 65 hours at
37°C in a
humidified atmosphere of 10% C02, cells were harvested and lysed by
freeze/thawing and
sonication. Cell debris was removed by centrifugation at 3000 xg for 5
minutes. The
resulting cleared lysates were heat-treated for 1 hour at 56°C to
inactivate residual
adenovirus.
A 7. Measurement of virus titer by 6418 resistance
Methods The titer of virus produced by the method in Example A 6 from co-
transfection of ACAPSN and either the p5repcapDHFR or P1RCD AAV packaging
plasmid was determined by the measurement of geneticin (G418) resistance. The
protocol
includes seeding 5 x 104 HeLa cells per well in a 6 well dish (Costar) in
Dulbecco's
Modified Eagles medium, 10% fetal bovine serum, with penicillin and
streptomycin
(DMEM complete). After 24 hours, cells were exposed to serial dilutions (in
DMEM) of
virus-containing cleared lysates (Example A 6) for 24 hours at 37°C in
a total volume of 1
ml (the maximal amount of cleared lysate that is assayable being 0.1 ml).
Virus-containing
39
CA 02308008 2000-04-13
WO 99/20779 PCT/US98121938
medium was then removed and fresh DMEM, containing 1 mg/ml 6418, was added to
the
cells. Cells were cultured for 10 days under selective conditions, medium was
then
removed, and the cells were washed once in methanol and stained with methylene
blue.
Colonies on each well were then counted and results expressed as 6418-
resistant colony
forming units per milliliter (G418' cfu/ml).
Results The packaging plasmids P 1 {S')RCD, P 1 RCD and 2P 1 RCD (see
Example A 4) were assayed for their ability to produce virus in a co-
transfection with
rAAV vector ACAPSN. Co-transfection, helper virus infection and preparation of
cleared
lysates were performed as described in Example A6.
The construct containing a single P 1 element downstream of cap (P 1 RCD)
produced four-fold more virus than the non-P 1 containing construct,
p5repcapDHFR
(1900+/-1400 cfu/mL vs. 490 +/- 58 cfu/mL, respectively). When the P1 element
was
located at a distance of 1.5 kb upstream of the rep-cap gene cassette (P 1
(5')RCD), a 20-
fold increase in virus production was observed relative to the non-P 1
construct,
pSrepcapDHFR (9900 +/- 1000 cfu/mL vs 480 +/- 58 cfu/mL, respectively).
Incorporating
both P1 elements, such that one was located 1.5 kb upstream of rep and the
other was
immediately downstream of cap, resulted in a further increase in virus
production (17,500
+/- 2000 cfu/mL), i.e. 36-fold compared to p5repcapDHFR.
The AAV packaging constructs lacking a DHFR marker containing a single P 1
element either immediately upstream or downstream of the rep and cap genes (P
1 (5')RC or
P 1 RC, respectively, see Example A 4) resulted in a 3 fold increase in rAAV
vector titer
compared to the non-P1 containing construct, p5repcap (5500 +/- 1514 Cfu/ml or
5700 +/-
1172 vs. 1700 +/- 560 Cfu/ml). Incorporating both P 1 elements flanking the
rep and cap
genes (2P1RC, see Example A 4) further increased virus production 10-fold
compared to
the single P1-containing constructs (53000 +/-8082 Cfu/ml), equivalent to a 30-
fold
increase in viral titer compared to the non-P1 containing construct, p5repcap.
These
results show that P1 functions to amplify vector production, independent of
location or
distance from the rep-cap gene cassette, when tested in transient co-
transfection.
A 8. Production of packaging cell lines
Polyclonal cell lines with an integrated AAV packaging cassette either
containing
(P1RCD) or lacking (p5repcapDHFR) the Pl element were produced by
electroporation of
CA 02308008 2000-04-13
WO 99/20779 PCT/U598/21938
HeLa cells. Specifically, 4 x 106 HeLa cells were electroporated with 12 p,g
DNA
(p5repcapDHFR or P 1 RCD) that had been linearized with PwII restriction
endonuclease,
which cleaves just upstream of the SV40 promoter-DHFR gene cassette. The cells
were
electroporated in serum free DMEM using a BioRad Gene Pulser at 0.25 Volts and
960 p,F.
After electroporation, cells were resuspended in DMEM complete (see Example A
7) and
allowed to recover at 37°C in a humidified atmosphere of 10% C02. After
24 hours, cells
were subjected to selection in complete medium containing 500 nM methotrexate.
Clonal
cell lines were derived from the P1RCD polyclonal population by limiting
dilution.
Producer lines are generated by introduction of an rAAV vector construct into
a clonal
P 1 RCD-containing packaging line.
The constructs p5repcap, P1RC, P1(S')RC, and 2P1RC (see Example A 4) were
modified for the purpose of producing stable cell lines by following the
procedure
described in Example A 3, using a puromycin resistance gene in place of the
modified
DHFR gene. The four resulting AAV packaging constructs were named pSRC-Pur,
P1RC-
Pur, P 1 (5')RC-Pur, and 2P 1 RC-Pur. Polyclonal cell lines were produced from
these four
constructs as described above in this example, except the methotrexate
selection was
replaced with drug selection by puromycin at a concentration of 1 pg/mL.
A 9. Isolation of total genomic DNA from packaging cells
rAAV genomes were packaged according to Example A 6 in polyclonal cell lines
containing either p5repcapDHFR or P 1 RCD (Example A 8) by transfection with
ACAPSN
in the presence or absence of adenovirus. At 65 hours after transfection with
ACAPSN,
cells were harvested and centrifuged at 3000 xg for 5 minutes. Total genomic
DNA was
isolated according to the method previously reported (Sambrook et al., supra).
Specifically, cells were washed once with TBS (150 mM Trizma base, 300 mM
NaCI, pH
7.4) and resuspended in THE Buffer (10 mM Tris-Cl pH 8, 100 mM NaCI and 25 mM
EDTA pH 8). Proteinase K was added to a final concentration of 100 pg/ml and
SDS was
added to a final percentage of 0.5% (w/v). After mixing, cells were incubated
at 50°C for 3
hours. Samples were then extracted once with phenol (pH 8), once with
phenol:chloroform:isoamyl alcohol (24:24:1 ), and once with chloroform. DNA,
present in
the aqueous phase, was then precipitated with 100% ethanol and centrifuged at
12,000 xg
41
CA 02308008 2000-04-13
WO 99/20779 PCT/US98l21938
for 30 minutes. The pellets, containing genomic DNA, were washed once with 70%
ethanol, air dried, and resuspended in TE buffer (10 mM Tris, 1 mM EDTA pH 8).
A 10. Southern blotting analysis
Total genomic DNA isolated by the method of Example A 9 was examined for the
amplification of rep and cap genes in the presence and absence of adenovirus.
Specifically, 10 p,g of DNA was digested with restriction endonuclease BgII
thereby
releasing a 3.8 kb fragment comprising rep and cap genes (AAV-2 nucleotides
543-4,380)
from p5repcapDHFR or P 1 RCD. Digested DNA samples were then fractionated by
agarose gel electrophoresis and transferred to UV-Duralon membrane
(Stratagene) by
capillary action, overnight, in lOx SSC (1.5 M NaCI, O.15M Sodium Citrate).
Nucleic acid
was cross-linked to the membrane by exposure to ultraviolet light, and the
membranes
were rinsed in 2x SSC and probed with a 32P labeled 1.9 kb XhoI-BgIII fragment
from
pAV2, random-prime labeled using prime-it, Stratagene. After washing, the
membranes
were visualized by phosphorimaging and the amount of the 3.8 kb band was
quantified.
A 11. Analysis of packaging cassette amplification in polyclonal packaging
cell lines
Total genomic DNA prepared and digested according to Example A 9 for
polyclonal samples P1RCD and p5repcapDHFR (Example A 8) was analyzed by the
Southern blotting method of Example A 10. Degree of amplification was measured
by
relative photon intensity of the 3.8 kb band determined from phosphorimaging
according
to Example A 10. DNA from P1RCD-containing cells gave a value of 406,725
intensity
units for the 3.8 kb band, while DNA from cells containing pSrepcapDHFR gave a
value of
30,211. Thus the presence of P1, in the P1RCD polyclonal line, is responsible
for a 13.5-
fold amplification of rep and cap genes, in the presence of adenovirus.
A 12. Virus production by packaging cell lines
Polyclonal cell lines, containing either P1RCD or p5repcapDHFR, were
transiently
transfected with ACAPSN in the presence of adenovirus, rAAV genomes were
packaged,
and cleared lysates were produced according to the method of Example A 6.
Cleared
lysates were assayed for viral titer (Example A 7), which was determined from
triplicate
transfections. When maximal amounts of cleared lysate were assayed (i.e., the
amount at
42
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
which non-specific cell killing begins to occur), a polyclonal cell line
containing
p5repcapDHFR yielded 0 6418' cfu/ml, while a polyclonal cell line containing P
1 RCD
yielded 957 6418' cfu/ml. Virus production by clonal lines ranged from 0.8 x
102 - 1.5 x
10° 6418' cfu/ml.
Stable cell lines containing integrated P1-containing packaging plasmids
expressing puromycin resistance were tested for virus production. A stable
cell line
containing a single P 1 element downstream from the cap gene (P 1 RC-Pur)
increased virus
titer 4 fold over the non-P 1 containing cell line, pSRC-Pur (216 +/- 67
Cfu/ml vs. 51.1 +/-
30 Cfu/ml). When the P1 element was located upstream of the rep gene (P1(S')RC-
Pur), a
similar increase in virus titer occurred (333 Cfu/ml +/-150), 6 fold over the
non-P1
containing cell line, pSRC-Pur . The stable cell line containing 2 P1 elements
flanking
rep-cap (2P1RC-Pur), resulted in a further increase in viral titer (658 +/-
122 Cfu/ml) to
13-fold that of the non-P 1 containing cell line, pSRC-Pur. These results show
that P 1
functions to amplify vector production in a stable cell line, regardless of
its location.
B. USE OF AN EPISOMALLY-MAINTAINED AAV PACKAGING CASSETTE FOR RAAV
PRODUCTION
B 1. Construction of an EBNA-1 based AAV Packaging vector containing P1
elements
The EBNA-1 episomal packaging cassette containing AAV rep and cap genes
along with two P1 elements was constructed in the following manner. Two 69 by
oligonucleotides containing the published P1 sequence (Urcelay et al. (1995)
J. Virol.
69:2038-46) were synthesized. In addition to the PI sequence, the
oligonucleotides
contain a unique SmaI restriction site. After annealing, the SphI-compatible
oligonucleotides were inserted into the SphI site of the p5repcap vector
(Example A 2). A
clone containing two opposing concatameric P1 elements (TRS-RBS-RBS-TRS) was
obtained.
A 4424 by PvuII/BgIII fragment containing the two P1 elements and p5repcap
sequences was isolated. These sequences were inserted into the NruIBamHI-
digested
Rep8 EBNA-1 plasmid (invitrogen). The resulting plasmid was designated
P1/p5repcap/RepB. In this construct, the tandem P1 sequences are located 84
nucleotides
upstream of the p5 promoter and the associated rep and cap genes (Figure 3).
43
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
In addition, a p5repcap/Rep8 plasmid that did not contain a P1 element was
constructed by isolating a 4355 by PvuIIBgIII fragment from the p5repcap
vector. This
fragment was inserted into NruIBamHI digested RepB. The resulting plasmid was
designated p5repcap(-P 1 )/RepB.
B 2. Generation of cell lines containing a stably-integrated rAAV vector and
an episomal
P 1 AAV packaging cassette
The rAAVCFTR or ACAPSN vector was transfected into HeLa cells via
electroporation. Individual clones were isolated and screened for an intact,
stably
integrated rAAV vector. The P1/p5repcap/Rep8 packaging cassette was then
transfected
into HeLa/AAV-CFTR cells via CaHP04-mediated transfection and stable
transfectants
were selected using 2.5 mM L-histidinol. A HeLa/AAV-CFTR cell line containing
a
p5repcap(-P1)/Rep8 packaging cassette was generated in similar fashion.
B 3. Amplification of P 1-containing episomal packaging cassette
To determine if the P1/p5repcap/Rep8 packaging cassette is amplifiable in
stable
HeLa/AAV-CFTR cell line, the following experiment was carried out. The stable
HeLa/AAV-CFTR cell line from Example B 2 were seeded in duplicate at 2.5x105
cells/plate. After 24 hrs one plate for each cell line was infected with Ad5
at a multiplicity
of 10. After 48 hrs. infected and uninfected cells were harvested. The genomic
DNA was
isolated, digested with BgIII and XbaI restriction enzymes, and the resultant
fragments
were separated by electrophoresis and transferred to a membrane. The blot was
then
probed with a'ZP-labeled 2.0 kb rep fragment and the degree of amplification
was
determined by Southern blotting as described in Example A 10. The results are
shown in
Figure 4 and indicate that in the presence of adenovirus the P1-episomal
packaging
cassette exhibits a high degree of amplification (10 to 100 fold increase),
whereas in the
absence of adeno virus no amplification is observed. The p5repcap(-P1)
episomal
packaging cassette exhibited very little detectable amplification in the
presence and no
detectable amplification in the absence of adenovirus.
44
CA 02308008 2000-04-13
WO 99120779 PCT/US98/21938
B 4. Production of rAAV-CFTR vector in HeLa/AAV-CFTR cell line containing a
P1/p5repcap/Rep8 packaging cassette
To demonstrate rAAV virus production in a HeLa/AAV-CFTR cell line containing
a P1/p5repcap/Rep8 episomal packaging cassette, the following experiment was
carried
out. See PCT Publication WO 96/17947 for details. Briefly, HeLa/AAV-CFTR cells
containing either a P1/p5repcap/Rep8 or a p5repcap(-P1)/Rep8 episomal
packaging
cassette were seeded at 2.5 x 106 cells/plate and infected with Ad5 at a MOI
of 10. After
48 hrs., the cells were harvested, resuspended in TMEG buffer, and sonicated
in 15-second
bursts for 2 min. to release rAAV. One percent of the crude lysate was heat-
treated at 56°C
for 45 min and then added to 2.5 x 105 c1.37 cells, with or without AdS. The
cells were
harvested after 48 hrs and genomic DNA was isolated. The DNA was digested with
EcoRI, resolved by electrophoresis, transferred to a membrane and probed with
a 3zp-
labeled 1.4 kb CFTR fragment. Results are shown in Figure 5 and indicate that
in the
presence of Ad5 the cell line containing the P1/pSrepcap/Rep8 packaging
cassette was
producing at least 10 times more virus than the cell line containing the
p5repcap(-P1)/Rep8
packaging cassette.
B 5. P1-EBNA vector variations
To reduce the potential for generating wild type AAV or replication-competent
chimeric AAV, a second generation P1/p5repcap/Rep8 packaging cassette was
constructed
that contains a nonessential 1300 by DNA stuffer fragment between the P 1
elements and
the p5repcap sequences. To construct this packaging cassette, a 4355 by
PvuII/EcoRV
fragment containing p5repcap sequences was isolated from the p5repcap vector
(Example
A 2). This fragment was inserted at the EcoRV site of pAdBn (Quantum
Biotechnologies).
The resulting plasmid was digested with BgIII and NotI and a 4485 by p5repcap
fragment
was isolated. This BgIII/NotI fragment was inserted into BamHI/NotI-digested
pRep8
(Invitrogen).
To insert the two concatameric P 1 elements into this plasmid the P 1
/p5repcap/Rep8
packaging cassette (see Example B i) was digested with PstI to remove the
p5repcap
sequences. The plasmid backbone, containing the two P1 elements, was
relegated. The
resulting plasmid was digested with PvuII and NotI, and a 138 by fragment,
containing
concatameric P1 sites, was isolated. This P1 dimer was then inserted into
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
P1/p5repcap/Rep8 that had been digested with Nrul and NotI. Finally, to insert
the
nonessential stuffer fragment, a 1300 by HaeIII fragment from X174 was ligated
into the
SnaI site of P1/p5repcap/Rep8. The resulting plasmid is used as an AAV
packaging
cassette to stimulate replication and packaging of rAAV vectors.
While the invention has been described, for purposes of clarity and
illustration,
with reference to the description and examples above, it is clear that many
variations and
modifications can be made by one of skill in the art, without departing from
the scope of
the appended claims.
46
CA 02308008 2000-04-13
WO 99/20779 PCT/US98/21938
SEQUENCE LISTING
<110> Targeted Genetics Corporation
Lynch, Carmel M.
Burstein, Haim
Stepan, Anthony M.
Lockert, Dara H.
<120> AMPLIFIABLE ADENO-ASSOCIATED VIRUS (AAV) PACKAGING
CASSETTES FOR THE PRODUCTION OF RECOMBINANT AAV VECTORS
<130> 226272003940
<140> Unassigned
<141> 1998-10-20
<150> US 60/090,109
<151> 1997-10-21
<160> 5
<170> PatentIn Ver. 2.0
<210> 1
<211> 62
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: AAV vectors
<400> 1
cgggcgggtg gtggcggcgg ttggggctcg gcgctcgctc gctcgctggg cgggcgggcg 60
gt 62
<210> 2
<211> 62
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: AAV vectors
<400> 2 '
accgcccg.~.c cgcccagcga gcgagcgagc gccgagcccc aaccgccgcc accacccgcc 60
cg 62
<210> 3
<211> 73
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: AAV vectors
<400> 3
gatcactagt accgcccgcc cgcccagcga gcgagcgagc gccgagcccc aaccgccgcc 60
accacccgcc cga 73
<210> 4
<211> 79
<212> DNA
<213> Artificial Sequence
CA 02308008 2000-04-13
WO 99/Z0779 PCT/US98/21938
<220>
<223> Description of Artificial Sequence; AAV vectors
<400> 4
agatctcggg cgggtggtgg cggcggttgg ggctcggcgc tcgctcgctc gctgggcggg 60
cgggcggtac tagt
74
<210> 5
<211> 67
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: AAV vectors
<400> 5
cccgggcggg tggtggcggc ggttggggct cggcgctcgc tcgctcgctg ggcgggcggg 60
cggtcag 67
2
