Note: Descriptions are shown in the official language in which they were submitted.
CA 02309765 2000-OS-18
WO 99/30734
PCT/US98/25725
1
VENEZUELAN EQUINE ENCEPHALITIS VIRUS VECTORS EXPRESSING TUMOR-ASSOCIATED
ANTIGENS TO INDUCE CANCER IMMUNITY
Priority
The present application claims priority under Title 35, United States Code,
~ 119 of United States Provisional Application Serial No. 60/068,080, filed
December 18, 1997.
Field of the invention
The present invention describes a novel method of inducing immunity to
cancer. This invention further discloses the use of Venezuelan Equine
Encephalitis (VEE) virus vectors for expression of tumor-associated antigens,
tumor-associated antigenic peptides and cytokines and methods for expressing
these heterologous products in cultured cells, and in humans or animals.
Background of the invention
Cancer is a leading cause of death. Conventional treatment of cancer
consists of chemotherapy, radiation therapy, and surgery, or a combination of
these
approaches. Novel and more effective strategies to combat cancer that
eliminate
the causes of these diseases, or to diminish pain and suffering, thereby
prolonging
the life of an affected patient are continually sought.
Tumor cells are known to express antigenic determinants that can be seen
by the host's immune system. These determinants, called tumor-associated
antigens (TAAs), are often altered or mutated forms of normal host cell
proteins or
peptides. They can be proteins or peptides that are not normally expressed in
the
tissue from which the tumor originates (Houghton, J. Exp. Med. 180: 1-4, 1994)
and can act like a tag to identify tumor cells. One experimental approach to
cancer
therapy involves inducing the patient's immune system to mount an immune
response against the tumor by attacking cells that express the TAAs.
The role of the immune system is to scan the body for proteins and other
molecules that are not normally part of the body, called non-self or foreign
antigens. If the immune system encounters a foreign molecule, an immune
response is usually initiated. The immune response typically is divided into
two
branches. One branch is the humoral response in which B-cells are induced to
produce antibodies against the foreign molecule. These antibodies can bind to
the
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
2
molecules and promote a variety of biological activities. The second branch is
the
cellular branch in which cytotoxic T-cells are induced against the foreign
molecule.
The cytotoxic T-cells find other cells that express the foreign molecule and
kill
those cells. Once the immune system is stimulated, long-lived cells are
expanded
which specifically recognize the foreign antigen upon re-exposure to that
antigen.
One method to induce the immune system to respond to a foreign peptide,
protein or organism is to inject that foreign antigen into the body of the
host by a
process called vaccination. Typically, the peptide, proteins or organism is
delivered
to the host in a formulation that is conducive to stimulating the immune
system.
Should the host come in contact with the foreign antigen in the future, the
foreign
antigen will be more rapidly and vigorously eliminated by the immune system.
This approach has been demonstrated to be useful in the infectious disease
area
where numerous vaccines have protected millions of individuals from viral and
bacterial diseases. This experimental approach has met with little success in
cancer therapy, however, when TAAs are injected. There are several reasons for
the failure of this approach. These include the inability of the immune system
to
recognize the TAAs. Often, antibodies against the TAAs are induced in the
patient, but these seem to be insufficient to alter the course of the disease.
One
explanation is that tumors may secrete factors responsible for dulling the
immune
response. What often appears to be lacking in the immune response against TAAs
is a sufficient cellular response.
One reason for a lack of a sufficient cellular response is that the cytotoxic
T-cells are not being stimulated appropriately. T-cells recognize TAAs and
peptides derived from TAAs when these peptides are exposed on the surface of
specialized cells that "present" the antigens to the T-cells. One class of
antigen-
presenting cell is called the dendritic cell (DC). DC progenitor cells
originate in the
hematopoetic system and reside in the skin and in the areas (interstitial
spaces)
surrounding cells in different tissues (Schuler and Steinman, J. Exp. Med.
186:
1183-118?, 1997). DCs take up proteins and process them intracellularly to
smaller peptides which are then transported to the cell surface in combination
with
a major histocompatibility complex (MHC) protein. It is the combination of
appropriate accessory molecules on the cell surface together with the complex
of
the peptide in association with the MHC protein that serves to "present"
antigen to
the T-cells. The interaction of the DC and T-cell is thought to induce the
production of cell stimulatory molecules, called cytokines, that stimulate the
T-cells
to respond to the presented TAA peptide.
CA 02309765 2000-OS-18
WO 99/30734 PCTNS98/25725
3
An approach to stimulate the immune response to tumors has been to co-
culture or "pulse" DCs with the TAA or related peptides in vitro. After the
appropriate amount of time, the DCs are introduced back into the patient.
Experimental evidence for this approach comes from Celluzzi et al., (J. Exp.
Med.
183: 283-287, 1996), Paglia et al., (J. Exp. Med. 183: 317-322, 1996), and
Zitvogel
et al., (J. Exp. Med. 183: 87-97, 1996) where experimental TAAs or peptides
derived from them were co-cultured with DCs from a mouse. The DCs were
reintroduced back into the mouse. The mouse was then challenged with tumor
cells that expressed the TAA. Treatment with the in vitro pulsed DCs
suppressed
the growth of some tumors. Alternatively, the pulsed DCs were administered to
a
mouse that had an established tumor. In this case, transfer of the DCs lead to
eradication of the tumors. Moreover, the animals were protected from
subsequent
challenge by the tumor cells.
A related approach to stimulate the immune response to tumors has been
to express the TAA or peptides derived from TAAs in DCs in vitro by
recombinant
DNA techniques and then introduce these manipulated DCs into an animal that
contains a tumor that expresses the TAA. For instance, Specht et al. (J. Exp.
Med.
186: 1213-1221, 1997) infected DCs in vitro with a retrovirus that expresses
the
bacterial protein beta-galactosidase. The DCs expressed beta-galactosidase and
presented beta-galactosidase-derived peptides on the cell surface. Mice were
given
tumor cells that express beta-galactosidase and dosed with the engineered DCs.
There was a significant reduction in the number of pulmonary metastatic
nodules
compared to appropriate controls. In addition, Song et al., (J. Exp. Med. 186:
1247-
1256, 1997) did a similar experiment in which beta-galactosidase was expressed
in
mouse DCs after infection of the DCs with an adenovirus vector that expresses
beta-galactosidase. Introduction of the modified DCs into mice with beta-
galactosidase-expressing tumors resulted in prolonged survival of the mice in
both
a prophylactic and therapeutic approach. Therefore, in these model systems,
expression of the model TAA in DCs resulted in enhanced immunity against the
tumor.
In addition to model systems, Hsu et al., (Nature Medicine 2: 52-58, 1996)
isolated DCs from patients with B-cell lymphoma. The particular TAA was
determined for each patient and was cocultured with the DCs in vitro. The DCs
were then given back to the patients. All of the patients mounted an antitumor
cellular response with three out of four patients showing clinical evidence of
tumor
regression. These data indicate that in aitro modification of DCs with the
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
4
appropriate TAA gives positive results in both experimental models and in
clinical
situations.
An improvement in the method of stimulating DCs to present the
appropriate TAA would be beneficial in treating cancers. Current practices as
outlined above involve isolating a patient's DCs and culturing the DCs in
vitro with
TAAs. This requires isolation of the TAAs and production in sufficient
quantity to
be administered to the cells. Other methods require infecting the DCs or their
precursors with a retrovirus or adenovirus that expresses the TAA in vitro.
Since
retroviruses only integrate into dividing cells, only a smaller precursor
population
of DCs are targets for the therapy. This may limit the usefulness of this
approach
depending on the patient and the extent that these precursors are available.
One
alternative would be to use a system in which the TAA could be delivered
directly
to the DCs in uivo. Therefore, the DCs would not have to be isolated,
expanded,
treated in vitro and then re-introduced back into the patient.
Davis et al., (J. Virol. 70: 3781-3787, 1996) has used a live attenuated
Venezuelan equine encephalitis (VEE) virus to project mice from lethal
challenge
by influenza virus by expressing the influenza virus protein called
hemagglutinin
(HA). Interestingly, the HA antigen was expressed in the draining lymph node.
It
was postulated that high level expression in the lymph node by the VEE vector
led
to the strong induction of immunity.
In a subsequent seminar, R.. Johnston showed evidence that DCs are
infected in uivo by using a VEE that expresses the reporter protein, green
fluorescent protein (GFP) (International Business Communication Meeting on
Mammalian and Plant-based Expression Systems, September 22-23, 1997,
Washington D.C.). Therefore, direct infection of mice with a VEE vector that
expresses a targeted viral antigen results in expression in the lymph node in
cells
that appear to be DCs and results in strong immunity against a viral disease.
Using the same or similar VEE vector one could express a TAA in a cancer
patient to stimulate an immune response against the TAA and the corresponding
tumor. Since the VEE vector expressing the TAA would target the DC cells in
the
lymph node, one would anticipate an enhanced immune response against the
tumor compared to a vector that did not target DCs. This could be done
directly in
an outpatient setting without the need to remove the DCs, culture them, expose
them to TAA for various periods of time and then reintroduce them back into
the
patient.
CA 02309765 2000-OS-18
WO 99/30734 PCTNS98/Z5725
Alternatively, one could still culture the DCs in vitro and use the natural
affinity of the VEE vector for the DCs to deliver the TAAs. This would be a
highly
efficient in vitro method of expressing the TAAs and would be expected to
stimulate a strong immune response when the modified DCs were administered
5 back to the patient.
There are several additional approaches to generate the optimal immune
response to the TAAs. In addition to the those mentioned above, the VEE
expressing the TAA could be co-administered or sequentially administered
either
in vivo or in vitro with different cytokines to help stimulate the DCs and/or
the T-
cells to respond to the TAA. This co-administration could be in the form of
another
VEE expressing the cytokines or injection of purified cytokines. An example of
a
cytokine that stimulates the expansion of DCs is a synthetic molecule called
progenipoietin-G (Streeter et al., 38th Annual American Society of Hematology
Meeting, San Diego, CA) In addition, optimal doses IL-2, IL-7 and IL-12 are
known
to enhance cytotoxic T lymphocyte responses (Kubo et al., US Patent
5,662,90?). In
addition, interferons alpha and beta and interleukin-I5 may be valuable in
stimulating the antitumor response. Synthetic cytokines based on interleukin-
3,
(WO 94/12638), chimeric fusion proteins between IL-3 and various growth
factors
(WO 95/21197 and WO 95/21254), and chimeric fusions between TPO and IL-3 (WO
97/12985) are also contemplated. Other peptides, such as those shown in
PCT/US/95/01000, PCT/US/94/08672, WO 94/21287, US 5,674,486 can also be used.
Alternatively, the VEE could express just peptides derived from TAAs in both
the
in vivo and in vitro situations. In addition, the TAA peptide may be made as a
fusion with other peptides known in the art to stimulate the immune response
including but not limited to peptides derived from tetanus toxin, Plasmodium
falciparum CS protein, or the streptococcus 18 kilodalton protein. Moreover,
more
that one open reading frame may be expressed from the VEE vector by use of an
appropriately placed internal ribosomal entry site between the first open
reading
frame and the second reading frame. In all situations, the patients may need
more
that one inoculation of VEE expressing the TAAs or of DCs that were modified
by
the VEE expressing the TAAs in vitro to see a clinical benefit. This boost to
the
immune response could come in the same form as the original treatment or by
any
other means. This includes another vector supplying the TAA or peptide, or
injection of purified TAA or peptide in an appropriate adjuvant.
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
6
Summary of the invention
One object of the invention is a method of treating a subject who has cancer
or who is at high risk of developing a tumor. The method comprises
administering
to the subject a recombinant Venezuelan equine encephalitis (VEE) virus that
expresses an effective amount of heterologous substance from a heterologous
nucleic acid segment, with the VEE virus containing at least one attenuating
mutation. The heterologous nucleic acid segment comprises a promoter operable
in
the subject operatively associated with a nucleic acid encoding a tumor-
associated
antigen or peptide or cytokine effective in eliciting or enhancing an immune
response to the tumor. The tumor-associated antigens) and related peptides can
be taken from, but not limited to, the examples in the literature as reviewed
by
Houghton (J. Exp. Med. 180: 1-4, 1994), Mumberg et al., (Seminars in
Immunology
8: 289-293, 1996) or Boon et al., (Annu. Reu. Immunol. 12: 337-365, 1994) or
from
any other source including, but not limited to, public and private databases.
Moreover, experimental methods of determining tumor-associated antigens are
found in the literature, for example Hsu et al., (Nature Med. 2: 52-58, 1996)
or
Kawakami et al., (Proc. Nat. Acad. Sci. USA 81: 3515-3519, 1994; Proc. Nat.
Acad.
Sci. USA 91: 6458-6462, 1994). Experimental methods of determining antigenic
peptides of tumor-associated antigens are also found in the literature, for
instance
in Kawakami et al., (Journal of Immunology 154: 3961-3968, 1995) and Celis et
al.,
(Proc. Nat. Acad. Sci. USA el: 2105-2109, 1994). Examples of VEE vector
sequences and manipulations are also found in the scientific and patent
literature.
These references include but are not limited to Johnston et al., (WO 95/
32733),
Davis et al., (US 5,185,440), Johnston et al., (WO 96/ 37616), Charles et al.,
(Virol.
228: 153-160, 1997), Caley et al., (J. Virol. 71: 3031-3038, 1997), Davis et
al. (J.
Virol. 70: 3781-3787, 1996; Vaccines 85: 387-391, 1995).
Another aspect of the invention is a DNA compromising a cDNA clone for
an infectious Venezuelan equine encephalitis virus RNA transcript which
contains
at least one attenuating mutation and a heterologous promoter positioned
upstream from the cDNA clone and operationally associated therewith. The VEE
cDNA contains a heterologous promoter operably linked to a cDNA or coding
region of a tumor associated antigen, the coding region of a peptide or
peptides or
the coding region or cDNA of a cytokine.
A further aspect of the invention is to isolate a patient's dendritic cells
and
culture them in vitro in an appropriate culture media supportive of growth and
maintenance of the DC cell. The DC cells are infected in vitro with an
infectious
CA 02309765 2000-OS-18
WO 99/30734 PCT/I1S98/25725
7
recombinant Venezuelan equine encephalitis (VEE) virus with the VEE virus
containing at least one attenuating mutation and a heterologous nucleic acid
segment. The heterologous nucleic acid segment coraprises a promoter operable
in
the subject operatively associated with a nucleic acid encoding a tumor-
associated
antigen or peptide or cytokine effective in eliciting or enhancing an immune
response to the tumor. There are numerous references to the isolation and
maintenance of DCs in aitro, for instance Hsu et al., (Nature Medicine 2: 52-
58,
1996).
A further aspect of the invention is a method of treating a patient who has
cancer or who is at risk of cancer with a viral vector that targets dendritic
cells
because the viral vector is a pseudotype virus which has the dendritic cell
targeting
properties of the Venezuelan equine encephalitis virus but may contain
components of other viruses. The pseudotyped virus contains a heterologous
nucleic acid segment which comprises a promoter operable in the subject
operatively associated with a nucleic acid encoding a tumor-associated antigen
or
peptide or cytokine effective in eliciting or enhancing an immune response to
the
tumor.
A further aspect of the invention is a DNA that can be packaged into a
pseudotyped viral particle that targets to the dendritic cell and contains a
heterologous nucleic acid segment which comprises a promoter operable in the
subject operatively associated with a nucleic acid encoding a tumor-associated
antigen or peptide or cytokine effective in eliciting or enhancing an immune
response to the tumor.
One aspect of the invention is a method of protecting or treating a subject
against primary or metastatic neoplastic diseases, comprising: administering a
recombinant Venezuelan Equine Encephalitis (VEE) virus vector to said subject
in
an effective amount, with said VEE virus vector containing at least one
attenuating mutation, and with said VEE virus vector containing a heterologous
DNA segment, said DNA segment comprising a promoter operably-linked to a DNA
encoding a protein or peptide effective for treating said subject from said
disease.
Preferably, the protein or peptide is a tumor-associated antigen. Even
more preferably, the tumor-associated antigen is MAGE-1. Most preferably, the
peptide has the amino acid sequence EADPTGHSY (SEQ ID NO: 4). Preferably,
the protein or peptide is fused to another peptide selected from the group
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
8
consisting of QYIKANSKFIGITE (SEQ ID NO: 6), DIEIO~IAK1VIEKASSVFNWNS
(SEQ ID NO: 7), and YGAVDSILGGVATYGAA (SEQ ID NO: S).
Preferably, the heterologous promoter is Venezuelan equine encephalitis
26S subgenomic promoter.
Another aspect of the invention is a method wherein the administering
step is a parental administration. Alternatively, the administering step is
carried
out by topically applying the virus to an airway surface of the subject.
Alternatively, the administering step is an intranasal administration step.
Alternatively, the administering step is an inhalation step.
Preferably, the protein is an adjunctive agent selected from the group
consisting of natural cytokines and synthetic cytokines. Even more preferably,
the
cytolcines are selected from the group consisting of interleulsin-2,
interieukin-7,
interleultin-12, interleukin-15, interferon, and progenipoietin-G.
The invention is also directed to a method of modulating tumors in a
patient with a VEE virus vector. It is also directed to a method of inhibiting
proliferation of tumor cells with a VEE virus vector. Preferably, the tumor is
selected from the group consisting of group consisting of lung cancer, breast
cancer,
ovarian cancer, prostate cancer, pancreatic cancer, gastric cancer, colon
cancer,
renal cancer, bladder cancer, melanoma, hepatoma, sarcoma, and lymphoma.
The invention is also directed to a process of inhibiting elevated numbers of
tumor cells comprising administering to a host in need thereof a
therapeutically
effective amount of a VEE virus vector in unit dosage form. It is also
directed to a
process of treating primary or metastatic neoplastic diseases comprising
administering to a mammalian host suffering therefrom a therapeutically
effective
amount of a VEE virus vector in unit dosage form.
The invention is also directed to a method of modulating primary or
metastatic neoplastic diseases in a patient comprising the step of
administering an
effective amount of the protein or peptide to a patient. It is also directed
to a
method of inhibiting the production of tumor cells in a patient comprising the
step
of administering an effective amount of the protein or peptide to a patient.
Preferably, the tumor cell is characteristic of one selected from the group
consisting of lung cancer, breast cancer, ovarian cancer, prostate cancer,
pancreatic
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
9
cancer, gastric cancer, colon cancer, renal cancer, bladder cancer, melanoma,
hepatoma, sarcoma, and lymphoma.
The invention is also directed to a DNA comprising a cDNA clone coding for
an infectious Venezuelan Equine Encephalitis (VEE) virus RNA transcript and a
heterologous promoter positioned upstream from said cDNA clone and operatively
associated therewith, and further comprising at least one attenuating mutation
and containing the nucleotide sequence encoding a TAA, a TAA peptide or a
natural or synthetic cytokine linked operably to a promoter.
The invention is also directed to a composition comprising a VEE virus
vector wherein the protein or peptide is selected from the group consisting of
tumor-associated antigens. Preferably, the tumor-associated antigen is MAGE-1.
Even more preferably, the peptide has the amino acid sequence EADPTGHSY
(SEQ ID NO: 4). Even more preferably, the protein or peptide is fused to
another
peptide having the sequence selected from the group consisting of
QYIKANSKFIGITE, (SEQ ID NO: 6), DIEKKIAK1VIEKASSV'h'1VVVNS, (SEQ ID
NO: 7), or YGAVDSILGGVATYGAA, (SEQ ID NO: 8). Preferably, the
composition includes an adjunctive agent selected from the group consisting of
natural cytokines and synthetic cytokines. Even more preferably, the cytokine
is
selected from the group consisting of are interleukin-2, interleukin-7,
interleukin-
12, interleukin-15, interferon or progenipoietin-G.
The invention also is directed to an infectious VEE virus RNA transcript
encoded by a cDNA clone of a recombinant VEE virus vector. It is also directed
to
infectious VEE virus particles containing such an RNA transcript.
The invention is also directed to a method of treating a subject against
primary or metastatic neoplastic diseases by infecting a subject's dendritic
cells
with a composition comprising a recombinant VEE virus vector. It is also
directed
to a pharmaceutical formulation comprising infectious VEE particles in an
effective
amount in a pharmaceutically acceptable carrier.
The invention is also directed to an inoculum comprised of an effective
amount of nucleic acid encoding a VEE virus vector dissolved or dispersed in
an
aqueous physiologically-tolerable or pharmaceutically-acceptable diluent. It
is also
directed to a pharmaceutical composition comprising a therapeutically
effective
amount of the VEE virus vector in admixture with a pharmaceutically acceptable
carrier. It is also directed to a pharmaceutical composition comprising a VEE
virus
vector, further comprising an adjunctive agent, wherein said adjunctive agent
is
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
selected from the group consisting of chemotherapeutic and immunotherapeutic
agents.
The invention is also directed to a process for administering a VEE virus
vector to protect or treat a subject against primary or metastatic neoplastic
5 diseases, a process for inhibiting elevated numbers of tumor cells, a
process for
treating a host with an effective amount of VEE virus vector, and a process
for
treating a host an effective amount a tumor associated antigen, wherein the
administering step in each of these processes is repeated.
Definitions
10 The term "VEE" means Venezuelan equine encephalitis.
The terms "TAA" and '~'AAs" mean tumor-associated antigen and tumor-
associated antigens, respectively.
The term "DC" and "DCs" mean dendritic cell and dendritic cells,
respectively.
The term "DNA" means deoxyribonucleic acid.
The term "cDNA" means complementary deoxyribonucleic acid.
The term "RNA" means ribose nucleic acid.
The term "oligonucleotide" means a single-stranded sequence of nucleotides
covalently bound in a 5' to 3' orientation.
The term "GFP" means green fluorescent protein.
The term "in vitro" means in a test tube or cell culture dish or container.
The term "in viuo" means in a body as opposed to in a test tube or culture
dish.
The letters "g", "a", "t", and "c", in upper or lower case, when representing
nucleotides, designate guanine, adenine, thymidine, and cytosine,
respectively.
The term "peptide" means a series of amino acids connected to each other
by amide bonds between the alpha-amino and carbonyl groups of adjacent amino
acids. The length of the peptide is not critical and is typically less than
about 30
amino acids.
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/Z5725
11
The term "multimer" means one or more reiterations of a sequence of
amino acids such as a peptide sequence covalently-linked together by amide
bonds.
The term "vector" means any entity that transports a desired component to
or in an appropriate host. For instance, a nucleic acid could be considered a
vector
when it is used to transport genetic information into a subject. Also, a virus
particle may be considered a vector to transport proteins or nucleic acids in
a host.
The term "PADRE" means any epitope which will bind multiple DR alleles.
They are the alleles for Class II MHC (CD4' T helper cells recognize class ID -
stimulate synthesis of IL-2 (growth factor) which then stimulates the CD' T
cells
(killer T cells or CTLs) among others. The PADRE, therefore. attaches tn CIaaR
Tr
MHC which then stimulates CD4' T cells which orchestrate a concerted immune
response. The DR epitope is usually 12-25 amino acids.
Detailed description of the invention
The following examples will illustrate the invention in greater detail
although it will be understood that the invention is not limited to these
specific
examples. Various other examples will be apparent to the person skilled in the
art
after reading the present disclosure without departing from the spirit and
scope of
the invention. It is intended that all such other examples be included within
the
scope of the appended claims.
Geners~l methods
General methods of cloning, expressing, and characterizing proteins are
found in T. Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold
Spring
Harbor Laboratory, 1982, and references cited therein, incorporated herein by
reference; and in J. Sambrook, et al., Molecular Cloning, A Laboratory Manual,
2°°
edition, Cold Spring Harbor Laboratory, 1989, and references cited therein,
incorporated herein by reference. DNA is typically purified from bacterial
lysates
using Promega Wizard Plus Minipreps or Qiagen Plasmid Midi or Maxi kits as per
instructions. DNA fragments are isolated from agarose gel after
electrophoresis
using the Qiagen Qiaex II Gel Extraction Kit (Chatswsorth, CA).
All cell culture reagents can be obtained from GibcoBRL Life Technologies
(Gaithersburg, MD) unless otherwise noted. Baby hamster kidney (BHK-21) cells
were used as a host cell for VEE vectors. There are obtained from ATCC
(Rockville, MD) and are maintained in Dulbecco's modified Eagle's medium
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/Z5725
12
supplemented with 53'o fetal bovine serum (FBS). Dendritic cells are
maintained in
IMDM with 50 ug/ml gentamicin, 73 uM monothioglycerol (Sigma, St. Louis, MO),
20% FBS and various cytokines (see below). Restriction enzymes are available
from GibcoBRL Life Technologies (Rockville, MD), New England Biolabs (Beverly,
MA), Promega (Madison, WI) or other suppliers. The restriction enzyme
recognition sequences are also found in catalogues of suppliers of the
enzymes.
The standard genetic code can be found in various texts such as Metzler
(Biochemistry: The Chemical Reactions of Living Cells, Academic Press, New
York,
1977). Three letter and single letter codes for amino acids are also available
(Metzler, supra).
Ezample 1. Modification of infectious Venezuelan equine encephalitis
virus cDNA.
A molecular clone of VEE virus cDNA is available from ATCC as pV1003
(accession number 68013). This clone has the cDNA downstream from the
bacteriophage T7 promoter for in vitro transcription of the viral genome. It
was
also shown by Davis et al., (US 5,185,440) that there is a 102 base deletion
in the
nsP3 gene but that RNA transcribed from this cDNA clone is infectious in cell
culture and that the deletion mutant is also able to replicate in mice. In
order to
express a foreign gene, the VEE virus cDNA needs to have an internal promoter
to
direct expression of that foreign gene. Also useful is a unique restriction
enzyme
site into which the foreign gene can be easily inserted. Moreover, mutations
need
to be incorporated into the E2 glycoprotein gene to attenuate the virulence of
the
virus. Johnston et al., (WO 95/32733) demonstrate the insertion of a second
copy of
the 26S promoter sequences into an infectious VEE virus cDNA clone. Briefly,
site-directed mutagenesis is used to convert wild-type sequences into the
modified
sequences. Several commercial kits are available for such purposes such as
Promega's Altered Sites" Mutagenesis kit (Catalog #Q6210, Madison, WI). The
nucleotide sequence of VEE virus is available in Genbank (accession L04653).
To add a second copy of the VEE virus 26S promoter into the genome,
pV1003 is digested with EcoRI and HindIII. The approximately 4 kilobase
fragment containing the 3' end of the genome can be subcloned into EcoRI and
HindIII digested pAlter-1 (Promega) to yield plasmid pVEEl. Following the
directions for mutagenesis that accompany the kit, an oligonucleotide
containing
the VEE virus 26S promoter is used to alter the VEE virus sequences. The
oligonucleotide containing the 26S promoter sequences has the sequence:
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98125725
13
aaacataattga/gaggggcccctataactctctacggctaacctgaatggactacgacatcgattaattaattaa/at
a
ca gcagcaa (SEQ ID NO: 1)
where the nucleotides on the left are homologous to sequences just downstream
(3')
of the E1 gene in the 3' untranslated region of VEE virus. The sequences
between
the slashes contain the 26S promoter sequences, the unique CIaI site and an
ochre
translation termination codon in each forward reading frame. The sequences to
the right of the second slash also are homologous to sequences just downstream
(3')
of the E1 gene in the 3' untranslated region of VEE virus. The resulting
plasmid
with the desired modifications is identified by CIaI digestion and nucleotide
sequencing using fluorescent dye terminators using a Perkin Elraer ABI PRISM'S
kit (Foster City, CA) and is designated pVEE2. To incorporate the changes back
into the VEE virus genome, pVEE2 and pV1003 are digested with enzymes
?'th111I and NotI. The approximately 3.9 kilobase pair sequence from pVEE2 is
ligated into the larger fragment of pV1003 to yield a new plasmid pVEE3 which
now has the second copy of the 26S promoter and a unique CZaI site.
Attenuation mutations in the E2 glycoprotein can be incorporated in the
same manner as described above using pVEEl as a target for oligonucleotide-
directed mutagenesis. Attenuating mutations have been published by Johnston
(WO 95/32733) and Davis (US 5,185,440) and can be accomplished by one skilled
in
the art using the Altered SitesR Mutagenesis kit as described. Examples of
attenuating mutations are Glu76Lys, Thr120Lys, G1u209Lys or a combination of
G1u209Lys and Lys245Asn (using the common three letter code for amino acids
and the number indicating the amino acid number in the E2 glycoprotein). The
amino acid to the left of the number is the amino acid in the wild type
sequence
and the amino acid to the right of the number is the amino acid in the
attenuated
strain at that location.
Example 2. Isolation of tumor associated antigens.
A number of TAAs can be introduced into a patient using the VEE virus
vector system. One such antigen can be isolated from various cancer cells and
is
designated MAGE-1 (van der Bruggen et al., Science 2b4: 1643-1647, 1991). The
MAGE-1 nucleotide sequence is available in Genbank, accession number M77481.
To isolate the MAGE-1 cDNA, a cell line or tissue has to be identified that
expresses the antigen. The human thyroid medullary carcinoma cell line TT is
reported to express high levels of MAGE-1 (van der Bruggen et al., Science
254:
1643-1647, 1991). This cell line is available from ATCC (ATCC CRL 1803). Cells
are cultured in Ham's F12 medium with 10% FBS and are plated at about 5 x 108
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
14
cells per T150 flask. Since the coding region for the MAGE-1 protein is not
interrupted by introns, the nucleotide sequence can be isolated from cellular
DNA.
The are a number of commercially available kits for genomic DNA isolation from
cells in culture. One is available from Qiagen. About 40 to 50 micrograms of
genomic DNA are isolated from about 10' cells:
The polymerase chain reaction (PCR) (Saiki et al., Science 2H8: 487-491,
1988) is utilized to isolate the MAGE-1 DNA sequences. The genomic DNA is
diluted in sterile water to less than 10 micrograms per milliliter. A 1
microliter to
50 microliter aliquot of this diluted sample is used as a template in a PCR
using a
kit (GeneAmp) from Perkin-Elmer-Cetus (Norwalk, Conn) as per directions. For
amplification of the sequence, two primers are synthesized by Genosys
(Woodlands,
TX) with the following sequence: the forward primer has the sequence:
atcgatgggtcttcattgcccagctcc (SEQ ID NO: 2)
where the first six nucleotides form the recognition sequence for CIaI and the
remaining sequences are homologous to sequences untranslated and 5' to the
coding region in exon 3. The reverse primer has the sequence
atcgattcccactggccttggctgcaac ISEQ ID NO: 3)
where the first six nucleotides form the recognition sequence for CIaI and the
remaining sequences are homologous to the sequences untranslated at the 3' end
of
the coding region. PCR is carried out on a Perkin-Elmer-Cetus DNA Thermocycler
at recommended conditions for 30 cycles. 10 microliters of the reaction are
analyzed by agarose gel electrophoresis. After staining the gel with ethidium
bromide, an approximately 1 kilobase band is present. The amplified DNA is
cloned directly into a pGEM-T vector (Promega) as per instructions to yield
plasmid pGEM-MAGE-1. DNA sequencing analysis verifies the correct sequence
and distinguishes it from other related sequences such as MAGE-2 or MAGE-3
(van der Bruggen et al., Science 254: 1643-1647, 1991). Because the amplified
MAGE-1 DNA has CZaI sites at each end, it can be removed by CIaI digestion
from
pGEM-MAGE-1 and purified by agarose gel electrophoresis. The VEE virus vector,
pVEE3, is digested with CIaI in the presence of shrimp alkaline phosphatase
(US
Biochemical, Cleveland, OHJ. The alkaline phosphatase is inactivated by
heating
as per directions and the CIaI digested MAGE-1 sequence is ligated to pVEE3
using bacteriophage T4 DNA lipase. Correct orientation of the MAGE-1 DNA is
determined by restriction enzyme mapping.
CA 02309765 2000-OS-18
WO 99/30734
Example 3. Antigenic peptides and expression.
PCT/US98/25725
In addition to expression of the full length reading frame of MAGE-1 in the
VEE virus vector, truncated regions of MAGE-1 may also be expressed. One
example is to express a small peptide derived from MAGE-I that is recognized
by
5 cytotoxic T lymphocytes. This small peptide has the amino acid sequence
EADPTGHSY (SEQ ID NO: 9)
using the single letter code for amino acids in the conventional amino
terminus (on
the left) to carboxyl terminus (on the right) designation (Kubo et al, US
Patent
5,662,907). The oligonucleotide and its complement that encode this peptide
are
10 synthesized (Genosys, Woodlands, TX) with the following attributes: a CZaI
site is
synthesized at the immediate 5' end of the sequence followed by a methionine
initiation codon, followed by the coding sequence of the following
oligonucleotide:
gaagcagaccccaccggccactcctat (SEQ ID NO: 5)
followed by a translation termination codon and another CIaI restriction site.
The
15 strands are annealed together by heating equimolar amounts of the
oligonucleotides in 100 microliter volumes together to boiling and letting the
temperature return to room temperature. The annealed oligonucleotides are
digested with CIaI and ligated to CIaI digested pVEE3 as described above. In
addition to expressing just the monomeric peptide, the peptide sequences may
be
made into a multimers before ligating into the vector. For example, the
peptide
coding region (without the CIaI sites and the termination codon but with the
initiator methionine codon at the 5' end) can be synthesized with an
overlapping
HindIII site at the 5' and the 3' ends. These are ligated together after
annealing
using T4 DNA ligase to form multimers whose size can be evaluated by
polyacrylamide gel electrophoresis. Phosphorylated adapter molecules which
include a ClaI site 5' of a overhanging HindIII site are ligated to the ends
of the
multimers. The multimers with the CZaI adaptors on the ends are digested with
CIaI and ligated into pVEE3 as above.
Other versions of the MAGE-1 peptide can be synthesized by adding amino
acid linker regions to the target peptide sequence. These linkers can be in
the form
of a string of alanine amino acids. The following oligonucleotide
(gaagcagaccccaccggccactcctat (SEQ ID NO: 5)
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
16
and its complementary sequence would be modified by incorporating the codons
for
alanine during the synthesis of the oligonucleotides in the desired number at
either the 5' or 3' ends. A codon for the initiator methionine amino acid
needs to be
positioned appropriately at the 5' end of any designed oligonucleotide for
proper
translation. Multimers of SEQ ID NO: 5 with alanine linkers can be constructed
using the same tactics described above. In addition to alanine, any other
amino
acid may be used to form a linker, preferably glycine or serine. Moreover,
alternating or any other sequence arrangement of alanine and glycine and
serine
may be used.
The target peptide may also be expressed as a fusion with other peptides
that stimulate the immune system. Examples of such peptides are sequences from
tetanus toxin amino acid sequences 830-843
QYIKANSKFIGITE (SEQ ID NO: 6),
Plasmodium falciparum CS protein amino acid sequences 37$-398
DIEKKIAKMEKASSVFNVVNS (SEQ ID N0: 7),
or streptococcus 18 kilodalton protein amino acids 1-16
YGAVDSILGGVATYGAA (SEQ ID NO: 8).
These peptides may be fused at the amino terminal or carboxyl terminal end of
the
MAGE-1 peptide epitope by conventional molecular biology techniques as
described
above. In addition, various sized linkers such as alanine, serine and/or
glycine
amino acids can be used to space the peptide sequences to a desired distance.
Easmple 4. Isolation aad cloning of a cytokine sequence into a YEE virus
vector.
Certain cytokines are known to stimulate the immune response.
Therefore, it may be beneficial to express a cytokine from the VEE vector. One
such cytokine is interleukin-2 (IL-2) (Taniguchi et al., Nature 802: 305-310,
1983).
A plasmid that contains the human IL-2 cDNA is available from ATCC (pLW8l,
ATCC number 61390). The nucleotide sequence of the human IL-2 coding region is
available in Genbank (accession number A06759). Plasmid pLW81 can be used as
a template using PCR to generate the IL-2 coding region with CZaI ends. The
forward primer has the sequence:
atcgat/aacctcaactcctgccaca (SEQ ID NO. 9)
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
17
in which nucleotides to the left of the slash form a CZaI restriction site and
the
nucleotides to the right of the slash are homologous to the 5' untranslated
region of
the gene. The reverse primer has the sequence:
atcgat/agtgggaagcacttaattat (SEQ ID NO. 10)
in which nucleotides to the left of the slash form a CIaI restriction site and
the
nucleotides to the right of the slash are homologous to the 3' untranslated
region of
the gene. The PCR product is ligated into pGEM-T as described above to form
pGEM-IL-2. After confirmation of the correct nucleotide sequence by DNA
sequencing, the IL-2 gene is removed from pGEM-IL-2 by CIaI digestion and
ligated into pVEE3 as described above.
Ezample 5. Isolation and culturing of human dendritic cells.
Human DCs are accessible from either cord blood (Romani et al., J. Exp.
Med. 180: 83-93, 1994) or from bone marrow (Szabolcs et al., J. Immunology
154:
5851-5861, 1995). Briefly, bone marrow cells are centrifuged in standard
Ficoll-
Hypaque gradients and the mononuclear cells are isolated from the interface.
These cells are washed twice with phosphate buffered saline/0.1% bovine serum
albumin, adjusted to 108 cells per milliliter and kept on ice for 30 minutes
in the
presence of 50 microgram per milliliter mouse anti-CD34 monoclonal antibody
(Oncogene Science, Uniondale, N~. The cells are washed three times to remove
unbound monoclonal antibody and incubated with sheep anti-mouse IgGl
immunomagnetic beads (Dynal, Oslo, Norway) for 30 minutes on ice. CD34
positive cells were collected by using a magnet. The beads are detached from
the
cells by incubation overnight in IMDM/20% FBS without enzyme. Suspension
cultures of the CD34+ cells are started in IMDM/209'o FBS at 2 x 105 cells per
5
milliliters in a 35 mm tissue culture dish supplemented with 20 nanograms per
milliliter c-kit ligand (Amgen, Thousand Oaks, CA), 100 nanograms per
milliliter
GM-CSF (Sandoz, East Hanover, NJ) and 10 to 100 nanograms per milliliter TNF-
alpha (Genentech, San Francisco, CA). The DCs (CD14- and HLA-DR') are
identified using a panel of monoclonal antibodies to CD14/LeuM3 and HLA-DR
(from Becton Dickinson, San Jose, CA).
Example 6. Generation of infectious virus from VEE virus vectors.
Plasmid pVEE3 and derivatives are digested with NotI to linearize the
plasmid and run-off transcripts are generated by T7 RNA polymerase as
described
(Davis et al., US Patent 5,185,440). Transcripts are transfected into BHK 21
cells
CA 02309765 2000-OS-18
WO 99/30734
18
PCT/US98/25725
as described (Polo et al., Journal of Virology 82: 2124-2133, 1988) using DEAE-
Dextran (Sigma, St. Louis, MO) although electroporation and transfection by
liposome reagents are also acceptable. After about 24 to 60 hours, when
cytopathic
effects have peaked, the supernatant is harvested. The quantity of infection
virus
is determined by standard plaque assays or infectivity assays in BHK-21 cells
(Burleson et al., Virology: A Laboratory Manual, Academic Press, San Diego,
1992). Virus is expanded on BHK-21 cells and further purified by sucrose
gradient
techniques using endotoxin free sucrose. Briefly, cells are infected using a
multiplicity of infection (MOI) of 1 infectious unit of virus per cell. The
supernatant is aspirated from the cells and overlayed with a minimal volume of
virus such that the cells are just submerged. After 30 to 60 minutes at
37°C with
occasional rocking to prevent drying, an appropriate volume of medium is added
to
the cells for normal culturing. Virus is harvested when cytopathic effects
have
peaked.
Alternatively, dendritic cells can be infected at a lower MOI between 0.001
and Ol. After absorption of the virus, the cells are washed three times in
phosphate-buffered saline with 5~ autologous serum and administered back to
the
host by intravenous infusion over an hour period.
Ezample ?. Inoculation of VEE virus vectors into a host.
Six week old female Balb/c mice (Charles Rivers Laboratories, Wilmington,
MA) are put under light Metofane anesthesia (Pitman-Moors). They are
inoculated
in the rear footpad with an appropriate amount of virus inoculum, preferably
about
10' infectious units, suspended in a 10 microliter volume of phosphate-
buffered
saline containing 5% donor calf serum(Caley et al, Journal of Virology, 71:
3031-
3038, 1997). Reinoculation or "boosting" with a given virus is given at timed
intervals such as 3 weeks using approximately 10° infectious units per
footpad. For
nasal inoculation, the mice are anesthetized and a pipetman is use to deliver
5-10
ul of inoculum to the narea. For intraperitoneal inoculations, the virus is
diluted
as above and 102 to 10' infectious units are delivered with a 2?-guage needle.
Serum samples can be obtained from tail vein bleeds at various times poat-
inoculation or post-boosting to determine antibody titers.
All references, patents, or applications cited herein axe incorporated by
reference in their entirety as if written herein.
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
19
References
Boon, T., Cerottini, J.-C., Van den Eynde, B., van der Bruggen, P. and Van
Pel, A.
Tumor antigens recognized by T lymphocytes. Annual Review of Immunology. 12:
337-365, ( 1994).
Caley, I. J., Betts, M. R., Irlbeck, D. M., Davis, N. L., Swanstrom, R.,
Frelinger, J.
A, and Johnston, R. E. Humoral, mucosal, and cellular immunity in response to
a
human immunodeficiency virus type 1 immunogen expressed by a Venezuelan
equine encephalitis virus vaccine vector. Journal of Virology '71(4): 3031-
3038,
(1997).
Cells, E., Tsai, V., Crimi, C., DeMars, R., Wentworth, P. A., Chesnut, R. W.,
Grey,
H. M., Sette, A, and Serra, H. M. Induction of anti-tumor cytotoxic T
lymphocytes
in normal humans using primary cultures and synthetic peptide epitopes.
Proceedings of the National Academy of Sciences, USA 91: 2105-2109, (1994).
Celluzzi, C. M., Majordomo, J. L, Storkus, W. J., Lotze, M. T. and Falo Jr.,
L. D.
Peptide-pulsed dendritic cells induce antigen-specific, CTL-mediated
protective
tumor immunity. Journal of Experimental Medicine 185: 283-287, (1996).
Charles, P. C., Brown, K. W., Davis, N. L., Hart, M. K. and Johnston, R. E.
Mucosal immunity induced by parenteral immunization with a live attenuated
Venezuelan equine encephalitis virus vaccine candidate. Virology 228(2): 153-
160,
(1997).
Charles, P. C., Waiters, E., Margolis, F. and Johnston, R. E. Mechanism of
neuroinvasion of Venezuelan equine encephalitis virus in the mouse. Virology
208(2): 662-671, (1995).
Davis, N. L., Brown, K. W., Caley, L, Charles, P. C., Swanstrom, R. and
Johnston,
R. E. An attenuated VEE virus vaccine vector: Expression of HIV-1 and
Influenza
genes in cell culture and protection against influenza challenge in mice
immunized
with a vector expression HA. Vaccines 95. Cold Spring Harbor, Cold Spring
Harbor
Laboratory Press: 38?-391, (1995).
Davis, N. L., Brown, K. W., Greenwald, G. F., Zajac, A. J., Zacny, V. L.,
Smith, J. F.
and Johnston, R. E. Attenuated mutants of Venezuelan equine encephalitis virus
containing lethal mutations in the PE2 cleavage signal combined with a second-
site
suppressor mutation in EI. Virology 212(1): 102-110, (1995).
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
Davis, N. L., Brown, K. W. and Johnston, R. E. A viral vaccine vector that
expresses foreign genes in lymph nodes and protects against mucosal challenge.
Journal of Virology ?0(6): 3781-3787, (1996).
Davis, N. L., Grieder, F. B., Smith, J. F., Greenwald, G. F., Valenslci, M.
L., Sellon,
5 D. C., Charles, P. C. and Johnston, R. E. A molecular genetic approach to
the study
of Venezuelan equine encephalitis virus pathogenesis. Archives of Virology
Supplement 9: 99-109, (1994).
Davis, N. L., Powell, N., Greenwald, G. F., Willie, L. V., Johnson, B. J.,
Smith, J. F.
and Johnston, R. E. Attenuating mutations in the E2 glycoprotein gene of
10 Venezuelan equine encephalitis virus: construction of single and multiple
mutants
in a full-length cDNA clone. Virology 18S(1): 20-31, (1991).
Davis, N. L., Willie, L. V., Johnston, R. E. and Smith, J. F. cDNA clone
coding for
Venezuelan equine encephalitis virus and attenuating mutations thereof. US
5,185,440, (1993).
15 Davis, N. L., Willie, L. V., Smith, J. F. and R.E., J. In vitro synthesis
of infectious
Venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a
viable
deletion mutant. Virology 171(1): 189-204, (1989).
Grieder, F. B., Davis, N. L., Aronson, J. F., Charles, P. C., Sellon, D. C.,
Suzuki, K.
and Johnston, R. E. Specific restrictions in the progression of Venezuelan
equine
20 encephalitis virus-induced disease resulting from single amino acid changes
in the
glycoproteins. Virology 206(2): 994-1006, (1995).
Houghton, A. N. Cancer Antigens: Immune recognition of self and altered self.
Journal of Experimental Medicine 180: 1-4, ( 1994).
Hsu, F. J., Benike, C., Fagnoni, F., Liles, T. M., Czerwinski, D., Taidi, B.,
Engleman, E. G. and Levy, R. Vaccination of patients with B-cell lymphoma
using
autologous antigen-pulsed dendritic cells. Nature Medicine 2: 52-58, (1996).
Johnston, R. E., Davis, N. L., Smith, J. F. and Grieder, F. B. Method of
inducing an
immune response with a live Venezuelan equine encephalitis virus expressing a
heterologous immunogen. W095/32733, Filed 26 May 1995, Published 7 December
1995, Priority 27 May 1994.
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/257Z5
21
Johnston, R. E., Davis, N. L., Smith, J. F., Pushko, P., Parker, M. and
Ludwig, G.
Alphavirus RNA replicon systems. W096/37616, Filed 21 May 1996, Published 28
November 1996, Priority 27 May 1994.
Johnston, R. E. and Smith, J. F. Selection for accelerated penetration in cell
culture coselects for attenuated mutants of Venezuelan equine encephalitis
virus.
Virology 162(2): 437-443, (1988).
Kawakami, Y., Eliyahu, S., Delgado, C. H., R,obbins, P. F., Rivoltini, L.,
Topalian,
S. L., Miki, T. and Rosenberg, S. A. Cloning of the gene coding for a shared
human
melanoma antigen recognized by autologous T cell infiltrating into tumor.
Proceedings of the National Academy of Sciences USA 81: 3515-3535-3519,
(1994).
Kawakami, Y., Eliyahu, S., Delgado, C. H., Robbins, P. F., Sakaguchi, K.,
Appella,
E., Yannelli, J. R., Adema, G. J., Miki, T. and Rosenberg, S. A.
Identification of a
human melanoma antigen recognized by tumor-infiltrating lymphocytes associated
with in vivo tumor rejection. Proceedings of the National Academy of Sciences
USA
91: 6458-6462, ( 1994).
Kawakami, Y., Eliyahu, S., Jennings, C., Sakaguchi, K., Kang, X., Southwood,
S.,
Robbins, P. F., Sette, A., Appella, E. and Rosenberg, S. A. Recognition of
multiple
epitopes in the human melanoma antigen gp100 by tumor-infiltrating T
lymphocytes associated with in vivo tumor regression. Journal of Immunology
184:
3961-3968, (1995).
Kubo, R. T., Grey, H. M., Sette, A. and Cells, E. Induction of anti-tumor
cytotoxic T
lymphocytes in humans using synthetic peptide epitopes. US 5,662,907, Filed
Jan
25, 1994
Mumberg, D., Wick, M. and Schreiber, H. Unique tumor antigens redefined as
mutant tumor-specific antigens. Seminars in Immunology 8: 289-293, (1996).
Paglia, P., Chiodoni, C., Rodolfo, M. and Colombo, M. P. Murine dendritic
cells
loaded in vitro with soluble protein prime cytotoxic T lymphocytes against
tumor
antigen in vivo. Journal of Experimental Medicine 183: 317-322, (1996).
Schuler, G. and Steinman, R. M. Dendritic cells as adjuvants for immune-
mediated
resistance to tumors. Journal ofExperimental Medicine 186(8): 1183-1187,
(1997).
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
22
Young, J. W. and Inaba, K. Dendritic cells as adjuvants for class I major
histocompatibility complex-restricted antitumor immunity. Journal of
Experimental Medicine 183: 7-11, (1996).
Zitvogel, L., Mayordomo, J. L, Tjandrawan, T., DeLeo, A. B., Clarke, M. R.,
Lotze,
M. T. and Storkus, W. J. Therapy of marine tumors with tumor peptide-pulsed
dendritic cells: Dependence on T cells, B? costimulation, and T helper cell 1-
associated cytokines. Journal of Experimental Medicine 183: 87-97, (1996).
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
23
SEQ ID Correlation Table
ggQ =D pp; gequ~~ D~scriptioa/llame
(SEQ ID NO: 1) aaacataattga/gaggggcccctataac
tctctacggctaacctgaatggactacga
catcgattaattaattaa/atacagcagc
as
(SEQ ID NO: 2) atcgatgggtcttcattgcccagctcc
(SEQ ID NO: 3) atcgattcccactggccttggctgcaac
(SEQ ID N0: 4) EADPTGHSY
(SEQ ID NO: 5) gaagcagaccccaccggccactcctat
(SEQ ID NO: 6) QYIKANSKFIGITE
(SEQ ID N0: 7) DIEKKIAKMEKASSVfNVVNS Plasmodium falciparum CS
protein amino acid sequences
378-398
(SEQ ID NO: 8) YGAVDSILGGVATYGAA streptococcus 18 kilodalton
protein amino acids 1-16
(SEQ ID NO. 9) atcgat/aacctcaactcctgccaca
(SEQ ID NO. 10) atcgat/agtgggaagcacttaattat
CA 02309765 2000-OS-18
WO 99/30734
Sequence Listing
SEQUENCE LISTING
<110> Hippenmeyer, Paul J.
<120> Cancer Vaccine
1~ <130> C_3061-0
<150> 60/068,080
<151> 1997-12-18
<lso> to
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 87
<212> DNA
<213> human
PCT/US98/25725
<400> 1
aaacataatt gagaggggcc cctataactc tctacggcta acctgaatgg actacgacat 60
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
cgattaatta attaaataca gcagcaa 87
<210> 2
<211> 27
5 <z12> DNA
<213> human
<400> 2
atcgatgggt cttcattgcc cagctcc 27
lU
<210> 3
<211> 28
<212> DNA
<213> human
<400> 3
atcgattccc actggccttg gctgcaac 28
<210> 4
<211> 9
<212> PRT
<213> human
<400> 4
25 Glu Ala Asp Pro Thr Gly His Ser Tyr
1 5
2
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/257Z5
<zlo> s
<211> 27
<212> DNA
<213> human
<400> S
gaagcagacc ccaccggcca ctcctat
<210> 6
<211> 14
<Z12> PRT
<213> human
<400> 6
Gln Tyr Ile Lys Ala Asn Ser Lys Phe Ile Gly Ile Thr Glu
1 5 10
<210> 7
Zfl <211> 21
<212> PRT
<213> human
<400> 7
25 Asp Ile Glu Lys Lys Ile Ala Lys Met Glu Lys Ala Ser Ser Val Phe
1 5 10 15
3
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/25725
Asn Val Val Asn Ser
<210> 8
5 <211> 17
<212> PRT
<213> human
<400> 8
1~ Tyr Gly Ala Val Asp Ser Ile Leu Gly Gly Val Ala Thr Tyr Gly Ala
1 5 10 15
Ala
15 <210> 9
<211> 25
<212> DNA
<213> human
2~ <400> 9
atcgataacc tcaactcctg ccaca 25
<210> 10
<211> 26
25 <212> DNA
<213> human
4
CA 02309765 2000-OS-18
WO 99/30734 PCT/US98/Z5725
<400> io
atcgatagtg ggaagcactt aattat 26
