Note: Descriptions are shown in the official language in which they were submitted.
CA 02311632 2000-OS-25
WO 99/27119 PCTIEP98/07577
-1 -
Method and Compositions Useful for the
Activation of Silent Transgenes
The invention relates to compositions for controlling expression of genetic
sequences, and to a method of use thereof. More particularly the invention
relates to
inducing expression of an antisense nucleic acid sequence that specifically
inactivates
expression of a target gene.
A fundamental problem with existing technology for inactivating gene
expression
relies on use of constitutive promoters, which drive expression of the
incoming transgene
(or gene fragment) all the time. Thus, transformed cells that receive the
incoming
transgene are also immediately subjected to effects of its expression. In
cases where the
incoming transgene can inhibit expression of an essential endogenous gene, all
transformed cells are killed soon after transformation. It is desirable,
therefore, to have
inducible control of the expression of introduced DNA sequences.
However, tight, inducible control of the expression of introduced genes has
not yet
been achieved in whole plants. Such control could have several uses, including
practical
ones such as regulating genes for controlling fertility, and more basic ones
such as probing
function by knock-out of a novel gene.
Many positive transcriptional regulatory factors are modular, consisting of a
DNA-
binding domain and an activation domain that interacts with components of the
transcriptional machinery assembling at the promoter (Ptashne, 1988; Swaffield
et al.,
1995). Fusing combinations of these elements, derived from different kingdoms,
has
resulted in production of diverse hybrid factors having defined DNA-binding
specificities and
transcription activation function for the target organism in question. For
instance, in
transient expression experiments in tobacco protoplasts, transcription factors
derived from
the yeast GAL4 transcriptional activator have been shown to activate
transcription from a
reporter gene controlted by a synthetic promoter consisting of multiple GAL4
DNA binding
sites and a TATA element derived from a promoter recognized by plant cells (Ma
et al.,
1988). The function of hybrid transcriptional activators and activator mutants
has also been
studied through high-velocity microprojectile delivery of genes into the
aleurone layer of
maize seed. A GAL4 DNA binding domain fused to the acidic activation domain of
herpes
simplex virus VP16 protein or the functionally related maize regulatory
protein C1 was
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
_2_
shown to stimulate the expression of a GAL4-dependent reporter gene when both
transactivator and reporter genes were introduced on microprojectiles (Goff et
al., 1991 ). A
chimeric transcriptional activator composed of the DNA binding domain of
bacteriophage
434 fused to the VP16 activation domain was shown to activate gene expression
of a
reporter gene driven by a synthetic promoter consisting of 434 operators fused
to a minimal
35S promoter when transiently introduced into tobacco protoplasts (Wilds et
aL, 1994).
Together these studies establish that DNA binding domains from heterologous
factors can
bind to synthetic promoters containing appropriate binding sites on naked DNA
templates
introduced into plant cells, and non-plant activation domains can productively
interact with
the transcription machinery of the plant when covalently linked to a DNA
binding domain.
Although analysis of transgenes introduced transiently into host cells can be
useful to
make preliminary determinations of gene function, stable transformation would
be a more
broadly applicable system for studying plant gene expression. It is reported,
however, that
the GAL4 DNA binding domain is inefficiently expressed in plants (Reichel, C.
et al., (1995)
"Inefficient Expression of the DNA-Binding Domain of GAL4 in Transgenic
Plants" Plant Cell
Reports 14(12):773-776). An ideal regulatory system for controlling transgene
expression
in plants would have little or no background expression in the absence of a
functional
transcription factor and high expression in the presence of a functional
transcription factor.
What is needed, therefore, are compositions and a method useful for providing
inducible expression of introduced DNA sequences in stably transformed plants.
The present invention answers a long felt yet unfulfilled need in the art by
providing
a method, compositions and transgenic plants containing heterologous DNA
sequences for
stably introducing into a plant hybrid transcription factors and a synthetic
promoter to induce
expression of an activatable DNA sequence, such as a transgene. Importantly,
the
invention described herein effectively separates insertion of the transgene
from its activity,
thus permitting recovery of otherwise lethal transformants, followed later by
their activation.
A utility of the invention is for investigating gene function, for example by
identifying genes
that are important for plant growth, development and viability. A particularly
important
feature of the invention is the ability to induce the expression of antisense
DNA sequences,
or dominant inhibitors, such as a translatable or untranslatable sense
sequence capable of
disrupting gene function, in stably transformed plants to positively identify
one or more
genes essential for normal growth and development of a plant.
CA 02311632 2000-OS-25
WO 99/27119 PCTIEP98/07577
-3-
The invention encompasses hybrid transcription factor genes, synthetic
promoters,
activatable DNA sequences and cells, tissues and plants containing such genes,
promoters
and DNA sequences, and method of use thereof to determine plant gene function.
A hybrid
transcription factor gene and a synthetic promoter are selected or designed
such that the
DNA binding domain of the hybrid transcription factor is capable of binding
specifically to
the synthetic promoter to activate expression of an activatable DNA sequence
driven by the
synthetic promoter.
More specifically, the invention encompasses a first cell or tissue,
preferably a plant
cell or plant tissue, or a plant, containing a sequence encoding a hybrid
transcription factor
necessary to activating a synthetic promoter, and a second cell or tissue,
preferably a plant
cell or plant tissue, or a plant, containing the synthetic promoter, wherein
the first and the
second cell, tissue or plant can be manipulated to create a cell, tissue or
plant containing
the both the sequence encoding the hybrid transcription factor and the
synthetic promoter.
Desirably, the second cell, tissue or plant contains the synthetic promoter
operably linked to
an activatable DNA sequence, whose expression is driven by the synthetic
promoter when
the promoter is activated by the hybrid transcription factor. In another
embodiment the
hybrid transcription factor is designed or selected so as to be controllable
by an
independent factor, such as, for example, estrogen.
The method of the invention encompasses combining the first and the second
cells,
tissues or plants to form a stable transgenic plant containing both the hybrid
transcription
factor gene and the synthetic promoter such that the activatable DNA sequence
is
expressed in the plant. One embodiment permits one skilled in the art to
activate
expression of an otherwise silent gene (or gene fragment) of interest, such as
an antisense
gene, by sexually introducing a gene encoding a transcriptional factor that
specifically
activates expression from a synthetic promoter controlling the gene of
interest. When the
gene of interest is capable of inactivating expression of an endogenous gene,
progeny of
the sexual cross between the plant containing the gene of interest and the
effector plant will
be unable to normally express the endogenous gene. Plant genes essential for
normal
growth or development can be identified in this manner. The identification of
such genes
provide useful targets for screening compound libraries for effective
herbicides.
The invention described herein demonstrates that a hybrid transcription factor
can
function effectively to control gene expression in stably transformed plants.
The following
detailed description is the first evidence that hybrid transcription factors
can effectively
CA 02311632 2000-OS-25
WO 99/27119 PCTIEP98/07577
-4-
activate gene function in whole plants, thereby providing a useful system for
positively
identifying genes essential for plant growth.
The present invention provides an important new method for investigating gene
function in plants. The invention is particularly useful for identifying
endogenous plant DNA
sequences that are necessary or important for growth, development or
viability. The
identification of such DNA sequences provides information essential for the
rational and
efficient development of safe, effective, economically feasible and
environmentally sound
products to solve important agricultural problems. in one embodiment the
invention can be
used to test for function of endogenous genes by knocking out their
expression. In
particular, it can be used to verify potential herbicide target genes, by
ascertaining whether
a gene of interest is essential for normal growth and development of the
plant. This
provides an early and essential link in the screening and development chain
and provides
the motivation to marshal resources and direct the expenditure of effort to
identify and test
the most potent compounds, thereby providing an immediate benefit to the
public.
in order to provide a full, clear, concise and exact description of the
cfaimed
invention, definitions for the following terms as they are used herein are
provided.
Activatabie DNA construct - refers to a DNA sequence, or a recombinant
construct
containing the DNA sequence and a synthetic promoter, which when introduced
into a cell,
desirably a plant cell, is not expressed, i.e. it is silent, unless a complete
hybrid transcription
factor capable of binding to and activating the synthetic promoter, is
present. The
activatable DNA construct subsequently is introduced into cells, tissues or
plants to form
stable transgenic lines capable of expressing the activatable DNA sequence, as
described
more fully below.
Activatable DNA sequence - refers to a DNA sequence that regulates the
expression of
genes in a genome, desirably the genome of a plant. The activatable DNA
sequence is
complementary to the target DNA sequence endogenous in the genome. When the
activatable DNA sequence is introduced and expressed in a cell, it inhibits
expression of the
target DNA. An activatable DNA sequence useful in the present invention
includes those
encoding or acting as dominant inhibitors, such as a translatable or
untranslatable sense
sequence capable of disrupting gene function in stably transformed plants to
positively
identify one or more genes essential for normal growth and development of a
plant. A
preferred activatable DNA sequence is an antisense DNA sequence. The mechanism
by
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
-5-
which antisense sequences work is not known, presumably the antisense RNA
binds to
target gene RNA to inhibit the expression of the target DNA gene product. It
is possible that
such RNA:RNA complexes inhibit the binding or function of translational
machinery,
alternatively it is possible that such RNA:RNA complexes are rapidly degraded.
Other
mechanisms are possible. Desirably the target gene encodes a protein, such as
a
biosynthetic enzyme, receptor, signal transduction protein, structural gene
product or
transport protein that is essential to the growth or survival of the plant.
The interaction of
the antisense RNA sequence and the target gene RNA results in substantial
inhibition of the
expression of the target DNA sequence so as to kill the plant, or inhibit
normal plant growth
or development.
Expression refers to the transcription andlor translation of an endogenous
gene or a
transgene in plants. In the case of antisense constructs, for example,
expression may refer
to the transcription of the antisense DNA only.
Gene refers to a coding sequence and associated regulatory sequences wherein
the coding
sequence is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or
antisense RNA. Examples of regulatory sequences are promoter sequences, 5' and
3'
untranslated sequences and termination sequences. Further elements that may be
present
are, for example, introns.
Gene of interest refers to any gene which, when transferred to a plant,
confers upon the
plant a desired characteristic such as antibiotic resistance, virus
resistance, insect
resistance, disease resistance, or resistance to other pests, herbicide
tolerance, improved
nutritional value, improved performance in an industrial process or altered
reproductive
capability. The "gene of interest" may also be one that is transferred to
plants for the
production of commercially valuable enzymes or metabolites in the plant.
Heterologous DNA sequence - refers to a DNA sequence not naturally associated
with the
host cell into which it is introduced, including non-naturally occurring
multiple copies of a
naturally occurring DNA sequence.
Marker gene refers to a gene encoding a selectable or screenable trait
Operably linked tolassociated with refers to a regulatory DNA sequence is said
to be
"operably linked to" or "associated with" a DNA sequence that codes for an RNA
or a
protein if the two sequences are situated such that the regulatory DNA
sequence affects
expression of the coding DNA sequence.
CA 02311632 2000-OS-25
WO 99127119 PCT/EP98/07577
-6-
Minimal promoter - refers to promoter elements, particularly a TATA element,
that are
inactive, or which have greatly reduced promoter activity in the absence of
upstream
activation. In the presence of suitable transcription factor the minimal
promoter functions to
permit transcription.
Plant refers to structural and physiological unit of the plant, comprising a
protoplast and a
cell wall. The plant cell may be in form of an isolated single cell or a
cultured cell, or as a
part of higher organized unit such as, for example, a plant tissue, or a plant
organ.
Plant cell refers to any plant, particularly to seed plants
Plant material refers to leaves, stems, roots, flowers or flower parts,
fruits, pollen, pollen
tubes, ovules, embryo sacs, egg cells, zygotes, embryos, seeds, cuttings, cell
or tissue
cultures, or any other part or product of a plant
Promoter a DNA sequence that initiates transcription of an associated DNA
sequence. The
promoter region may also include elements that act as regulators of gene
expression such
as activators, enhancers, and/or repressors
Recombinant DNA: molecule a combination of DNA sequences that are joined
together
using recombinant DNA technology
Recombinant DNA technology refers to procedures used to join together DNA
sequences
as described, for example, in Sambrook et al., 1989, Cold Spring Harbor, NY:
Cold Spring
Harbor Laboratory Press
Selectable marker gene refers to a gene whose expression in a plant cell gives
the cell a
selective advantage. The selective advantage possessed by the cells
transformed with the
selectable marker gene may be due to their ability to grow in the presence of
a negative
selective agent, such as an antibiotic or a herbicide, compared to the growth
of non-
transformed cells. The selective advantage possessed by the transformed cells,
compared
to non-transformed cells, may also be due to their enhanced or novel capacity
to utilize an
added compound as a nutrient, growth factor or energy source. Selectable
marker gene
also refers to a gene or a combination of genes whose expression in a plant
cell gives the
cell both, a negative and a positive selective advantage.
Stably transformed - refers to a cell, desirably a plant cell, containing at
least one
heterologous DNA sequence, wherein the heteroiogous DNA sequence is maintained
in the
cell, and is functional under the appropriate conditions for its intended use,
and is heritable
to subsequent generations. The teml specifically includes those cells into
which the
heterologous DNA sequence is initially introduced, by whatever means, and to
CA 02311632 2000-OS-25
WO 99/27119 PGT/EP98/07577
7_
subsequently derived cells, tissues, plants and seeds containing the
heterologous DNA
sequence. The latter are also referred to as stable transgenic lines.
synthetic refers to a nucleotide sequence comprising structural characters
that are not
present in the natural sequence. For example, an artificial sequence that
resembles more
closely the G+C content and the normal codon distribution of dicot and/or
monocot genes is
said to be synthetic.
Transformation (r) refers to introduction of a nucleic acid into a cell. In
particular, the stable
integration of a DNA molecule into the genome of an organism of interest.
As described more fully below, the invention encompasses hybrid transcription
factor genes, synthetic promoters, activatable DNA sequences and cells,
tissues and plants
containing such genes, promoters and DNA sequences, and methods of use
thereof. The
hybrid transcription factor gene and the synthetic promoter are selected or
designed such
that the DNA binding domain of the hybrid transcription factor is capable of
binding
specifically to the synthetic promoter to turn on expression of an activatable
DNA sequence
driven by the synthetic promoter.
In one embodiment the invention is based on sexual crossing to achieve
inducible
gene activation, relying on an transcriptional effector line to activate
expression of a silent
transgene under the control of a synthetic, activatable promoter. Traits whose
expression
can be controlled with this system include both non-plant genes, translated or
untranslated
sense genes for transcriptional control elements such as endogenous promoters,
or post-
transcriptional control elements, and antisense genes to knock out expression
of
endogenous genes (e.g. AdSS, which is described below). In one case the
transcriptional
effector line contains a DNA sequence encoding a hybrid transcription factor,
as described
more fully below, which is crossed with a cell, tissue or plant line
containing the synthetic
promoter operably linked to the activatable DNA sequence. In another case, the
transcriptional effector line contains a DNA sequence encoding one portion of
a hybrid
transcription factor, wherein the protein encoded thereby is capable of
forming a hybrid
transcription factor through peptide-peptide interaction with the conjugate
part of the hybrid
transcription factor. The synthetic promoter, activatable DNA sequence and the
DNA
sequence encoding the corresponding conjugate part of the hybrid transcription
factor are
contained in a separate line. In yet another case, the hybrid transcription
factor is rendered
ineffective by an inhibitor, thereby preventing it from activating the
synthetic promoter, far
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98I07577
_g_
example by blocking functional binding of the hybrid transcription factor to
the synthetic
promoter. Consequently, the activatable DNA sequence is not expressed unless
and until
the hybrid transcription factor inhibitor is removed.
Based on this disclosure, one skilled in the art will appreciate that any DNA
sequence or gene of interest can be controlled in this way.
This system is especially useful for allowing expression of traits that might
otherwise
be unrecoverable as constitutively driven transgenes. For instance, foreign
genes with
potentially lethal effect, or antisense genes or dominant negative mutations
designed to
abolish function of essential genes, while of great interest in basic studies
of plant biology,
present inherent experimental problems. Decreased transformation frequencies
are often
cited as evidence of lethality associated with a particuiar constitutively
driven transgene, but
negative results of this type are laden with alternative trivial explanations.
A system of the
type described here allows stable maintenance and propagation of a test
transgene
separate from its expression. This ability to separate transgene insertion
from expression is
crucial for firm conclusions about essentiality of gene function to be drawn.
The present
invention , therefore, is a substantial contribution to the art.
Variation in severity of phenotype can be achieved by examining the phenotypes
of
multiple independent activatable lines crossed to a single activator. By
relying on position
effect to provide varying levels of expressibility from the different
transgenic loci, it is
possible to obtain a phenocopy of an allelic series for a specific trait. This
is illustrated
below in Example 2, which shows that a diversity of expression levels from an
antisense
gene designed to knock out an essential metabolic function results in plant
lines with
varying severity of phenotype. Similarly, other traits will also be
inactivatable to varying
degrees in independent lines.
Optionally, expression of particular traits is achieved by further controlling
the
expression of the hybrid activator gene with appropriate promoters, for
example promoters
regulated in developmental time or space. Depending on the stringency of
control of the
promoter in question, assessing the function of a gene of interest in specific
cell types,
tissues, or organs or at specific times in development is possible. For
instance, the
requirement for function of a gene in embryo development could be tested by
activating an
antisense transgene with a factor driven by a promoter known to be expressed
strongly in
developing seeds. Such an approach has been widely used in Drosophila, usually
by
inserting the a GAL4 effector construct at random to obtain fusions to various
genomic
enhancers directing expression in different cell and tissue types (Brand and
Perrimon,
CA 02311632 2000-OS-25
WO 99lZ7119 PCT/EP98/07577
_g_
1993). Similarly, the DNA constructs of the present invention provide
additional control of
gene expression by way of chemically inducible promoters, for example using
steroid-
inducible gene expression as exemplified by Schena, et al. (Proc. Natl. Acad.
Sci., USA,
Vol. 88, pp 10421-10425, December 1991 ).
Further levels of modulation of expression are achieved by choosing an
activation
domain of appropriate strength for a specific application. Recently, plant
transcriptional
activation domains of net positive or negative charge were identified in a
yeast functional
screen (Estruch et al., 1994). Fusion of these domains to the DNA binding
domain of GAL4
yielded proteins capable of activating a GAL4-dependent promoter gene when
both were
introduced into maize or tobacco cells on microprojectiles. Thus, a variety of
different
activation domains are identifiable by direct functional or structural
screens.
Although the work described here is exemplified in Arabidopsis, the
transactivation
per se is not limited to this one species. Using appropriate promoters, the
system described
here functions in any species, including commercially important plants,
including but not
limited to corn, rice, wheat, sugar beet, barley, rye, cotton, rape, oats,
sorghum, millet, turf
grasses and ornamentals.
Hybrid Transcription Factor Gene
A hybrid transcription factor gene comprises DNA sequences encoding 1 ) a DNA-
binding domain and 2) an activation domain that interacts with components of
the
transcriptional machinery assembling at the promoter. Gene fragments are
joined, typically
such that the DNA binding domain is toward the 5' terminus and the activator
domain is
toward the 3' terminus, to form a hybrid gene whose expression produces a
hybrid
transcription factor. One skilled in the art is capable of routinely combining
various DNA
sequences encoding DNA-binding domains with various DNA sequences encoding
activation domains to produce a wide array of hybrid transcription factor
genes.
Examples of DNA sequences that can be used to make hybrid transcription
factors
useful in the invention include, but are not limited to those encoding the DNA
binding
domain of GAL4, bacteriophage 434, lexA, lacl, and phage lambda repressor.
Examples of DNA sequences that can be used to make hybrid transcription
factors
useful in the invention include, but are not limited to those encoding the
acidic activation
domain of herpes simplex VP1 fi, maize C1, and P1. In addition, suitable
activation domains
can be isolated by fusing DNA pieces from an organism of choice to a suitable
DNA binding
domain and selecting directly for function. (Estruch et al., 1994,
incorporated by reference in
CA 02311632 2000-OS-25
WO 99/27119 PCTIEP98I07577
-10-
its entirety). Domains of transcriptional activator proteins can be swapped
between proteins
of diverse origin. (Brent and Ptashne (1985) Cell 43:729-736).
A desirable hybrid transcription factor gene comprises DNA sequences encoding
the
GAL4 DNA binding domain fused to the maize C1 activation domain. One skilled
in the art
can use routine molecular biology and recombinant DNA technology to make
desirable
hybrid transcription factor genes.
Synthetic Promoter
A synthetic promoter comprises at least one DNA binding site recognized by the
DNA binding domain of the hybrid transcription factor, and a minimal promoter,
preferably a
TATA element derived from a promoter recognized by plant cells. More
particularly the
TATA element is derived from a promoter recognized by the plant cell type into
which the
synthetic promoter will be incorporated. Desirably, the DNA binding site is
repeated multiple
times in the synthetic promoter so that the minimal promoter may be more
effectively
activated, such that the activatable DNA sequence associated with the
synthetic promoter is
more effectively expressed.
Examples of DNA binding sites that can be used to make synthetic promoters
useful
in the invention include but are not limited to the upstream activating
sequence {UASG)
recognized by the GAL4 DNA binding protein, the lac operator, and the lexA
binding site.
Examples of promoter TATA elements recognized by plant cells include those
derived from
CaMV 35S, the maize Bz1 promoter, the UB03 promoter, Agrobacterium nopaline
synthase
or mannopine synthase promotor such as SuperMAS, maize Bz1 promotor, UBG~3
promotor, hsp80 from Brassica oleracea and arabidopsis actine-2 promotor.
A desirable synthetic promoter comprises a truncated CaMV 35S sequence
containing
the TATA element (nucleotides -59 to +48 relative to the start of
transcription), fused at its 5'
end to approximately 10 concatemeric direct repeats of the upstream activating
sequence
(UASG) recognized by the GAL4 DNA binding domain. One skilled in the art can
use
routine molecular biology and recombinant DNA technology to make desirable
synthetic
promoters.
Activatable DNA sequence
An activatable DNA sequence encompasses any DNA sequence for which stable
introduction and expression in a plant cell is desired. Particularly desirable
activatable DNA
sequences are sense or antisense sequences, who expression results in
decreased
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
-11-
expression of their endogenous counterpart genes, thereby inhibiting normal
plant growth or
development.
The activatable DNA sequence is operably linked with the synthetic promoter to
form
the activatable DNA construct. The activatable DNA sequence in the activatable
DNA
construct is not expressed, i.e. it is silent, in transgenic lines, unless a
hybrid transcription
factor capable of binding to and activating the synthetic promoter, is also
present. The
activatabie DNA construct subsequently is introduced into cells, tissues or
plants to form
stable transgenic lines expressing the activatable DNA sequence, as described
more fully
below.
Cell, Tissue or Plant Containing the Hybrid Transcription Factor, or the
Synthetic Promoter
and Activatable DNA sequence
The invention also encompasses a first and a second cell or tissue, preferably
a plant
cell or plant tissue, or plant, containing a hybrid transcription factor gene
and an activatabie
DNA construct, respectively. The first cell, tissue or plant and the second
cell, tissue or
plant are selected such that they can be manipulated to create a plant cell,
plant tissue or
plant containing the hybrid transcription factor gene and expressing the
hybrid transcription
factor, and also containing and activating the synthetic promoter of the
activatable DNA
construct so as to express the activatable DNA sequence driven by the
promoter.
Hybrid transcription factor genes and activatable DNA constructs above are
introduced into a cell, tissue or plant by methods well known and routinely
used in the art,
including but not limited to crossing, Agrobacterium-mediated transformation,
Ti plasmid
vectors, direct DNA uptake such as microprojectile bombardment, liposome
mediated
uptake, micro-injection and the like.
Transgenic plant lines containing the hybrid transcription factor gene are
created
using, for example, Agrobacterium-mediated transformation. Primary
transformants (T1
generation) are screened for the ability to activate expression from a
corresponding
synthetic promoter (i.e. a synthetic promoter that is activatabie by the
hybrid transcription
factor) by transiently transforming them with a reporter construct. Routine
RNA gel blot
analysis is used to confirm that the transformants express the hybrid
transcription factor
gene. The transgenic nature of the fines is further tested in the T2
generation for
segregation of kanamycin resistance (or other appropriate selectable marker
gene carried
on the inserted DNA) as a single locus after selfing. The presence of a single
T-DNA insert
is confirmed by genomic DNA gel blot analysis in lines that show 3:1
segregation. These
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
_12_
lines may be further analyzed for expression of the hybrid transcription
factor gene by RNA
gel blot analysis. Several T2 plants are selfed to obtain T3 progeny, which
are screened for
homozygosity of the inserted hybrid transcription factor gene.
Transgenic lines containing a synthetic promoter activatable by a desired
hybrid
transcription factor are prepared in a similar fashion by Agrobacterium-
mediated
transformation. The transgenic lines containing the synthetic promoter and the
activatable
DNA sequence (the activatabie DNA construct), and optionally a selectable
marker are
prepared by standard methods. Optionally, the transgenic lines are selected
for the marker
to confirm the presence of the activatable DNA construct.
F1 Planfs Containing the Hybrid Transcription Factor, and the Activatable DNA
Construct
F1 plants containing both the hybrid transactivator gene and the activatable
DNA
construct are generated by cross-pollination and selected for the presence of
an
appropriate marker, such as kanamycin. In contrast to plants containing the
activatable
DNA construct atone, the F1 plants generate high levels of activatabfe DNA
sequence
expression product, comparable to those obtained with strong constitutive
promoters such
as CaMV 35S.
A useful assay method of the invention comprises
a) crossing a first stably transformed plant comprising a hybrid transcription
factor gene encoding a hybrid transcription factor capable of activating a
synthetic promoter, when said synthetic promoter is present in the plant, and
wherein the plant is homozygous for the hybrid transcription factor;
b) with a second stably transformed plant comprising an activatable DNA
sequence and a synthetic promoter that is activatable by the hybrid
transcription factor, wherein the DNA sequence is expressed in the presence
of the hybrid transcription factor to yield F1 plants expressing the DNA
sequence; and
c) determining the effect of expression of the DNA sequence on the F1 plants.
Preferred is said assay wherein the hybrid transcription factor gene encodes a
DNA
binding domain derived from a GAL4 gene of yeast and the transcription
activation domain
derived from a C1 gene of maize.
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
-13-
Further preferred is said assay, wherein the minimal promoter is selected from
the
group consisting of the CaMV 35S minimal promoter, the maize Bz1 promoter and
the
UBA3 promoter.
Preferred is said assay, wherein the synthetic promoter sequence comprises a
CaMV 35S minimal promoter containing a TATA element fused at its 5' end to 10
concatemeric copies of the upstream activating sequence recognized by a GAL4
DNA
binding domain.
Preferred is said assay, wherein the hybrid transcription factor gene encodes
a DNA
binding domain derived from a GAL4 gene of yeast and the transcription
activation domain
derived from the C1 gene of maize, and wherein the activatable DNA construct
comprises a
synthetic promoter sequence comprising a CaMV 35S minimal promoter containing
a TATA
element fused at its 5' end to 10 concatemeric copies of the upstream
activating sequence
recognized by a GAL4 DNA binding domain.
Another useful method of the invention provides for identifying essential
plant gene
inhibitors, such as the plant AdSS gene comprising,
a) reacting a plant AdSS enzyme and AdSS substrate in the presence of a
suspected inhibitor of AdSS enzymatic function; and
b) comparing the rate of AdSS enzymatic reaction in the presence of the
suspected
inhibitor to the rate of AdSS enzymatic reaction under the same conditions in
the
absence of the suspected inhibitor, to determine whether the suspected
inhibitor
inhibits AdSS.
A preferred embodiment of the invention encompasses a plant comprising a
hybrid
transcription factor gene and an activatable DNA construct, wherein the hybrid
transcription
factor encoded by the hybrid transcription factor gene is capable of
activating the synthetic
promoter of the activatable DNA construct to induce expression of an operably
linked
antisense DNA sequence, wherein the plant is stabiy transformed with the
hybrid
transcription factor and with the activatable DNA construct.
Preferred is said plant, wherein the hybrid transcription factor gene
comprises
CA 02311632 2000-OS-25
WO 99127119 PCTIEP98/07577
-14-
a DNA binding domain derived from a gene selected from the group consisting of
a
GAL4 gene of yeast, bacteriophage 434, IexA, lacl and lambda phage repressor;
a transcription activation domain derived from a gene selected from the group
consisting of herpes simplex VP16, maize C1 and P1;
the activatable DNA construct comprises a minimal promoter selected from the
group consisting of the CaMV 35S minimal promoter, the maize Bz1 promoter and
the
UBQ3 promoter.
Further preferred is said ptant, wherein the synthetic promoter sequence
comprises
a CaMV 35S minimal promoter containing a TATA element fused at its 5' end to
10
concatemeric copies of the upstream activating sequence recognized by a GAL4
DNA
binding domain.
Further preferred is said plant, wherein the hybrid transcription factor gene
encodes
a DNA binding domain derived from a GAL4 gene of yeast and the transcription
activation
domain derived from the C1 gene of maize, and wherein the activatable DNA
construct
comprises a synthetic promoter sequence comprising a CaMV 35S minimal promoter
containing a TATA element fused at its 5' end to 10 concatemeric copies of the
upstream
activating sequence recognized by a GAL4 DNA binding domain.
Further preferred is said plant, wherein the activatable DNA sequence is an
AdSS
antisense sequence.
CA 02311632 2000-OS-25
WO 99/Z7119 PCT/EP98/07577
-15-
EXAMPLES
The examples disclosed below demonstrate that a hybrid transcription factor
can
function effectively to control gene expression in stabiy transformed plants.
The invention is
further described and will be further understood by one skilled in the art in
light of the
following non-limiting examples.
Example 1 - Expression of a Silent Reporter Gene in Stable Transgenic Plants
This example illustrates that crossing a transgenic plant line expressing a
GAL4/C1
hybrid factor to a line containing a reporter transgene controlled by an
appropriate synthetic
promoter results in strong induction of reporter gene expression. The
appropriate genes for
testing the system in Arabidopsis were constructed as described more fully
below.
A hybrid transcription factor gene is constructed from components of the GAL4
and
Ci genes previously shown to contain the DNA-binding and transcription
activation
functions, respectively. (The construct used for plant transformation pAT 53
contains a left
border sequence coupled to a 35S promotor operably linked to a hybrid
transcription faction
comprised of a GAL4 DNA binding domain coupled to a C1 activation domain with
a 35S 3'
terminator sequence and a pNOS/NPT/nos 3' selectable marker cassette bounded
by a
right border sequence). The N-terminal 147 amino acids of the encoded protein
derive from
GAL4, and the C-terminal 101 amino acids are derived from the carboxy-terminal
amino
acids 173-273 of C1. A similar combination had previously been shown to
function in
transient assays (Goff et al., 1991 }.
A synthetic promoter designed to be activatabfe by this factor is constructed
using
Bz1 TATA element (optionally the truncated CaMV 35S promoter, containing the
TATA
element (nucleotides -59 to +48 relative to the start of transcription) is
used), fused at its 5'
end to 10 concatemeric copies of the upstream activating sequence (UASa)
recognized by
GAL4 protein. (The construct pAT 73 contains a left border sequence coupled to
a 35S
promotor operably linked a dihydrofolate reductase coding sequence linked to a
35S 3'
terminator, which in tum is ligated to a 10-fold concatenated GAL4 binding
site construct
containing a TATA element operably linked to a GUS reporter element with a 35S
3'
terminator, all of which is bounded by a right border sequence.) To evaluate
the efficacy of
the system in stable transformants, a reporter gene is selected as the
activatabfe DNA
sequence, for example a modified E. coli uidA (p-glucuronidase; GUS) coding
sequence
CA 02311632 2000-OS-25
WO 99/27119 PCTIEP98/07577
-16-
driven by the synthetic UASGITATA promoter. The GUS gene is considered a model
reporter gene for expression in that its gene product is readily detected and
quantified.
Transgenic Arabidopsis plant lines containing the hybrid transcription factor
gene
were created using Agrobacterium-mediated transformation. Primary
transformants (T1
generation) were screened for ability to activate expression from the
synthetic UAS~I'TATA
promoter by transiently transforming them with a luciferase reporter
construct.
Approximately half of the T1 transformants tested showed luciferase activity
after
microprojectile bombardment. RNA gel blot analysis confirmed that these
transformants
expressed the GAL4/C1 gene. These lines were further tested in the T2
generation for
segregation of kanamycin resistance (the selectable marker gene carried on the
T-DNA) as
a single locus after selfing. Presence of a single T-DNA insert is confirmed
by genomic
DNA gel blot analysis in lines that showed 3:1 segregation (data not shown).
These lines
are further analyzed for expression of the GAL4/C1 gene by RNA gel blot
analysis. RNA
blot analysis shows that both lines expressed detectable levels of stable RNA
derived from
the transgene. A single effector line, designated pAT53-103, was chosen for
further
experiments, and several T2 plants were selfed to obtain T3 transgenic progeny
which were
screened for homozygosity of the T-DNA insert.
Transgenic Arabidopsis plant lines containing the UAS~ITATAIGUS gene were
created using Agrobacterium-mediated transformation, and were selected on
methotrexate
and screened for homozygosity. Two lines, designated pAT73-309 and -346, were
analyzed for GUS activity, and found to have very low amounts, not
significantly different
from assay background (Table 1 ). F1 plants containing both the hybrid
transactivator gene
and the activatable reporter gene were generated by cross-pollination and
selected on
kanamycin. In contrast to plants containing the reporter gene alone, the F1
plants produced
very high levels of GUS activity, comparable to those obtained with strong
promoters such
as CaMV 35S (Table 1 ).
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
-17-
Table 1. (3-gtucuronidase activity in F1 plants.
GUS activity
Transformant (nmol MUlmin/mg protein)
35SIGUS line 7 17.6 ~ 4.3
line 105 19.1 f 7.2
line 115 12.1 ~ 3.7
untransformed Nossen 0.03 0.01
pAT53-103 0.01 0.0
pAT73-309 0.01 0.01
pAT73-309 x pAT53-1034.97 3.41
F1
pAT73-346 0.01 0.0
pAT73-346 x pAT53-1036.02 2.3
F1
* GUS activity was measured for 20 plants of each line or F1 cross (mean ~
standard
deviation).
Example 2 - Expression of Silent Antisense DNA Sequences in Stable Transgenic
Plants
Additionally, the invention can be used to investigate gene function, by
inducing
expression of an antisense gene that specificalty inactivates expression of a
test gene. The
invention is used to drive expression of an antisense gene to eliminate gene
function. The
gene encoding adenylosuccinate synthetase (AdSS), one of two steps in de novo
purine
biosynthesis that converts IMP to AMP, was used as an activatable DNA
sequence. AdSS
has recently been implicated as the target of the potently herbicidal natural
product
hydantocidin (Cseke et aL, 1996; Fonn~-Pfister et al., 1996; Siehl et al.,
1996). AdSS
activity is measured by standard enzymatic assays well known in the art, for
example by
reacting AdSS enzyme and an AdSS substrate that the AdSS enzyme is capable of
catalyzing to a product measurably distinct from the substrate, and measuring
the rate of
CA 02311632 2000-OS-25
WO 99127119 PC'TlEP98/07577
-18-
catalytic conversion of substrate to product. The conversion may be measured
directly by
determining the amount of substrate or product, or both present in the
reaction at various
times, or indirectly by measuring a label, such as radioactivity, or a color
indicator
associated with the substrate or the product only. Southern blot analysis
reveals that the
full-length cDNA used for antisense gene construction here represents a single
gene in the
Arabidopsis genome.
Based on the successful antisense DNA sequence expression achieved in the
stable transgenic plants of Example 1, it was postulated that successful
expression in stable
transgenic plants containing both a hybrid transcription factor gene and a
synthetic
promoter driving expression of an AdSS antisense sequence would result in
inactivation of
endogenous AdSS gene expression. It was also postulated that if the AdSS
antisense
sequence were successfully expressed, then plant lethality would result based
upon the
analogy to the herbicidal effect of hydantocidin. However, prior to running
such
experiments, it was not clear to one skilled in the art whether expression of
the antisense in
stably transformed plants would occur and would result in inactivation of the
AdSS gene.
As described more fully below, the AdSS antisense sequence was successfully
expressed
in stable transgenic plants, and expression of endogenous AdSS enzyme was
inhibited.
Fifteen transgenic plants containing the UAS~/TATAlantisense AdSS construct (.
were
generated by Agrobacierium transformation. (Construct pJG261 AntiAdSS contains
a left
border sequence coupled to a pNos/BAR/gene 7 3' selectable marker cassette
linked to a
10-fold concatenated GAL4 binding site construct containing a TATA element,
which is
linked to AdSS antisense coding sequence terminated by 3553' and a right
border
sequence.)Fiowers borne on the primary transformants were crossed to pollen
from the
homozygous transactivator line pAT53-103. F1 seed were plated on kanamycin to
select
for the outcrossed progeny. These primary transformants are hemizygous for the
introduced T-DNA (containing the antisense gene), which in most cases will
segregate as a
single Mendelian trait. Thus, the antisense gene should segregate 1:1 against
a
background that always contains the transactivator in the hemizygous state
(except in rare
contaminants from selfing, which are selected by germination on a selectable
marker, such
as kanamycin). In six fines, approximately 50% of the seedlings were severely
retarded in
growth, in some cases failing to germinate completely. Five other lines
survived through
true leaf expansion, but showed various growth anomalies after transfer to
soil. A final four
lines showed little or no abnormal phenotype.
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98/07577
-19-
To confirm that the severe growth retardation and lethality seen was due to
presence
of the antisense transgene, polymerase chain reactions were carried out using
primers
designed to amplify the region between the 5' end of the AdSS cDNA and the
minimal 35S
promoter. Gel electrophoresis demonstrates that there is a one-to-one
correspondence
was observed between abnormal seedlings and the antisense gene. To examine the
variation in phenotype among different antisense lines, we carried out RNA gel
blot
hybridizations on F1 plants derived from different antisense lines. Gel blot
probed with
AdSS probe containing RNA from untransformed Col-0 plants , pAT53-103 plants
and F1
plants derived from crossing pAT53-103X antisense AdSS shows that little AdSS
RNA was
detected in a line with a severe phenotype. (The most severe seedling lethal
lines had to
be omitted from the analysis because so little tissue was available for RNA
extraction.)
The Examples will be further understood in view of the following technical
descriptions.
Recombinant plasmids
pSGZLI was constructed by ligating the GAL4-C1 EcoRl fragment from pGALCI
(Goff et al., 1991) into the EcoRl site of ptC20H. The GAL4-C1 fragment of
pSGZLI was
excised with BamHl-BgAI and inserted into the BamHl site of pCIB770 (Rothstein
et aL,
1987) yielding pAT53.
UAS~ sites and the minimal 35S promoter (-59 to +1 ) were excised from
pGALLuc2 (Goff et al., 1991 ) as an EcoRl-Psfl fragment and inserted into the
respective
sites of pBluescript, yielding pAT52. pAT66 was constructed with a three-way
iigation
between the Hindlll-Psii fragment of pAT52, a Pstf-EcoRl fragment of pCIB1716
(containing
a 35S untranslated leader, GUS gene, 35S terminator) and Hirrdlll-EcoRl cut
pUCl8. The
35S leader of pAT66 was excised with Psd-Ncol and replaced with a PCR-
generated 35S
leader extending from +1 to +48 to yield pAT71.
pCIB921 contains a dihydrofolate reductase (dhfr) plant selectable marker gene
inserted in the BamHl site of pCIB710 (Rothstein et al., 1987). The 35S
promoterl dhfr
gene cassette of pCIB921 was excised with Xbal-EcoRl and inserted into the
respective
sites of pCIB730 (Rothstein et al., 1987) to make pAT58. pAT73 was constructed
by
inserting the EcoRl fragment from pAT71 containing 10 UASg sited minimal 35S
promoted
GUS/ 35S terminator into the EcoRl site of pAT58.
Plasmid pBS SK+ (Stratagene, LaJolla, CA) was linearized with Sad, treated
with
mung bean nuclease to remove the Sad site, and re-ligated with T4 ligase to
make
CA 02311632 2000-OS-25
WO 99/Z7119 PCT/EP98/07577
-20-
pJG201. The UAS~ICaMV 35S minimal promoterIGUS geneICaMV terminator cassette
was
removed from pAT71 with Kpnl and cloned into the Kpnl site of pJG201 to make
pJG304.-
pJG304 was partially digested with restriction endonuclease Asp718 to isolate
a full-length
linear fragment. This fragment was ligated with a molar excess of the
oligonucleotide 5'
GTA CCT CGA GTC TAG ACT CGA G 3'. Restriction analysis was used to identify a
clone
with this linker inserted 5' to the site, and this plasmid was designated
pJG304f~Xhol.
A fragment of the AdSS synthase cDNA clone described previously (Fonn~-Pfister
et
al., 1996) (GenBank accession #U49389) was PCR-amplified with the
oligonucleotide
primers 5' GATTCGAGCTCATGTCTCTCTCTTCCCTC 3' and 5'
GATTCCCATGGTGGACCTGAACCAACTC 3'. The vector pJG3040Xhol was digested with
Sad and Ncol to excise the GUS gene coding sequence. The AdSS PCR fragment was
digested with Sad and Ncol and ligated into pJG304~Xhol to make
pJG304AntiAdSS.
Vector pGPTV (Backer et al., 1992) was digested with EcoRl and Hindlll to
remove
the nopaline synthase promoter/GUS cassette. Concurrently, the superlinker was
excised
from pSE380 (Invitrogen, San Diego, CA) with EcoRl and Hindtll and cloned into
the
EcoRlIHindlll linearized pGPTV, to make pJG261.
pJG304AntiAdSS was cut with Xhol to excise the cassette containing the
UAS~/35S
minimal promoterlantisense AdSSICaMV terminator fusion. This cassette was
ligated into
Xhol-digested pJG261, such that transcription was divergent from that of the
bar selectable
marker, producing pJG261 AntiAdSS.
Transgenic plants
pJG261 AntiAdSS was electro-transformed into Agrobacterium tumefaciens strain
GV3101 (pMP90) (Koncz and Schell, 1986), and Arabidopsis plants (ecotype
Columbia)
were transformed by infiltration (Bechtold et al., 1993) using the resulting
strain. Seeds
from the infiltrated plants were selected on agar germination medium
(Murashige-Skoog
salts at 4.3 g/liter, MES at 0.5 g/titer, 1 % sucrose, thiamine at 10
Nglliter, pyridoxine at 5
Nglliter, nicotinic acid at 5 frglliter, myo-inositol at 1 mglliter, pH 5.8)
containing glufosinate
(Basta~; AgrEvo) at 15 mgltiter.
Arabidopsis root exptants (ecotype Nossen) were transformed with pAT53 as
described (Valvekens et aL, 1988).
Fifteen transgenic plants containing the UAS~Iminimal CaMV 35S
promoterlantisense
AdSS construct were transplanted to soil and grown to maturity in the
greenhouse. Flowers
borne on the primary transformants were crossed to pollen from the homozygous
GAL4/C1
CA 02311632 2000-OS-25
WO 99/27119 PCT/EP98107577
-21 -
transactivator line pAT53-103. F1 seeds were plated on germination medium
containing 50
mg/liter kanamycin.
Nucleic Acid Analysis
RNA was isolated by phenoUchloroform extraction followed by LiCI precipitation
as
described (Lagrimini et aL, 1987). RNA gel blots were performed as described
(Ward et al.,
1991 ). Hybridization probes were labeled with a~P-dCTP by the random priming
method
using a PrimeTime kit (International Biotechnologies, Inc., New Haven, CT).
Hybridization
conditions were 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04 pH 7.0, 1 mM
EDTA, 1
bovine albumin at 65C. After hybridization overnight, the fitters were washed
with 1% SDS,
50mM NaP04, 1 mM EDTA at 65C (Church and Gilbert, 1984).
