Note: Descriptions are shown in the official language in which they were submitted.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
MAMMALIAN ALPHA HELICAL PROTEIN-1
BACKGROUND OF THE INTENTION
Proliferation, maintenance, survival and
differentiation of cells of multicellular organisms are
controlled by hormones and polypeptide growth factors.
These diffusable molecules allow cells to communicate
with each other and act in concert to form cells and
organs, and to repair and regenerate damaged tissue.
Examples of hormones and growth factors include the
steroid hormones (e. g. estrogen, testosterone),
parathyroid hormone, follicle stimulating hormone, the
interleukins, platelet derived growth factor (PDGF),
epidermal growth factor (EGF), granulocyte-macrophage'
colony stimulating factor (GM-CSF), erythropoietin (EPO)
and calcitonin.
Hormones and growth factors influence cellular
metabolism by binding to proteins. Proteins may be
integral membrane proteins that are linked to signaling
pathways within the cell, such as second messenger
systems. Other classes of proteins are soluble .
molecules, such as the transcription factors.
Of particular interest are cytokines, molecules
that promote the proliferation, maintenance, survival or
differentiation of cells. Examples of cytokines include
erythropoietin (EPO), which stimulates the development. of
red blood cells; thrombopoietin (TPO), which stimulates
development of cells of the megakaryocyte lineage; and
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
2
granulocyte-colony stimulating factor (G-CSF), which
stimulates development of neutrophils. These cytokines
are useful in restoring normal blood cell levels in
patients suffering from anemia or receiving chemotherapy
for cancer. The demonstrated in vivo activities of these
cytokines illustrates the enormous clinical potential of,
and need for, other cytokines, cytokine agonists, and
cytokine antagonists. '
SUMMARY OF THE INVENTION
The present invention addresses this need by
providing a novel polypeptide and related compositions
and methods. Within one aspect, the present invention '
provides an isolated polynucleotide encoding a mammalian
protein termed "Alpha helical protein-1" or Zalphal. The
human Zalphal polypeptide is comprised of a sequence of
amino acids 146 amino acids long with the initial Met as
shown in SEQ ID NO:1 and SEQ ID N0:2. It is believed that
amino residues 1-20 are signal sequence, and the mature
Zalphal polypeptide is represented by the amino acid
sequence comprised residues 21, an isoleucine, through
amino acid residue 146, a tyrosine. The mature Zalphal
polypeptide is also defined by SEQ ID N0:45. Within an
additional embodiment, the polypeptide further comprises
an affinity tag. Within a further embodiment, the
polynucleotide is DNA.
Also claimed are polypeptides which are at
least 90% identical to SEQ ID N0:2 or SEQ ID N0:45 and
polynucleotides which encode the polypeptides.
Within a second aspect of the invention there
is provided an expression vector comprising (a) a
transcription promoter; (b) a DNA segment encoding a
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
3
Zalphal polypeptide, and (c) a transcription terminator,
wherein the promoter, DNA segment, and terminator are
operably linked.
Within a third aspect of the invention there is
provided a cultured eukaryotic or bacterial cell into
which has been introduced an expression vector as
disclosed above, wherein said cell expresses a Zalphal
polypeptide encoded by the DNA segment.
Within a further aspect of the invention there
is provided a chimeric polypeptide consisting essentially
of a first portion and a second portion joined by a
peptide bond. The first portion of the chimeric
polypeptide is either (a) a Zalphal polypeptide as shown
in SEQ ID NO: 2 or SEQ ID N0:45 or (b) protein
polypeptides that are at least 90% identical to SEQ ID
N0:2 or SEQ ID N0:45 The second portion of the chimeric
polypeptide consists essentially of another polypeptide
such as an affinity tag. Within one embodiment the
affinity tag is an immunoglobulin Fc polypeptide. The
invention also provides expression vectors encoding the
chimeric polypeptides and host cells transfected to
produce the chimeric polypeptides.
An additional embodiment of the present
invention relates to a peptide or polypeptide which has
the amino acid sequence of an epitope-bearing portion of
a Zalphal polypeptide having an amino acid sequence
described above. Peptides or polypeptides having the
amino acid sequence of an epitope-bearing portion of a
Zalphal polypeptide of the present invention include
portions of such polypeptides with at least nine,
preferably at least 15 and more preferably at least 30 to
50 amino acids, although epitope-bearing polypeptides of
any length up to and including the entire amino acid
CA 02313464 2000-06-08
WO 99/29720 PCT/US98l16273
4
sequence of a polypeptide of the present invention
described above are also included in the present
invention. Also claimed are any of these polypeptides
that are fused to another polypeptide or carrier
molecule. Also claimed are any of these polypeptides that
are fused to another polypeptide or carrier molecule.
Antibodies produced from these epitope-bearing portions
of Zalphal can be used in purifying Zalphal from cell
culture medium. Examples of such epitope-bearing
polypeptides are the polypeptides of SEQ ID NOs: 46 - 56.
Also claimed are proteins or polypeptide which contain~a
sequence which is at least 90% identical to an epitope-
bearing polypeptide described above.
Within an additional aspect of the invention
there is provided an antibody that specifically binds to
a Zalphal polypeptide as disclosed above, and also an
anti-idiotypic antibody which neutralizes the antibody to
a Zalphal polypeptide.
These and other aspects of the invention will
become evident upon reference to the following detailed
description.
DETAILED DESCRIPTION OF THE INVENTION
The term "allelic variant" is used herein to
denote any of two or more alternative forms of a gene
occupying the same chromosomal locus. Allelic variation
arises naturally through mutation, and may result in
phenotypic polymorphism within populations. Gene
mutations can be silent (no change in the encoded
polypeptide) or may encode polypeptides having altered
amino acid sequence. The term allelic variant is also
CA 02313464 2000-06-08
WO 99/29720 PGT/US98/26273
used herein to denote a protein encoded by an allelic
variant of a gene.
The term "expression vector" is used to denote
5 a DNA molecule, linear or circular, that comprises a
segment encoding a polypeptide of interest operably
linked to additional segments that provide for its
transcription. Such additional segments include promoter
and terminator sequences, and may also include one or
more origins of replication, one or more selectable
markers, an enhancer, a polyadenylation signal, etc.
Expression vectors are generally derived from plasmid or
viral DNA, or may contain elements of both.
The term "isolated", when applied to a
polynucleotide, denotes that the polynucleotide has been
removed from its natural genetic milieu and is thus free
of other extraneous or unwanted coding sequences, and is
in a form suitable for use within genetically engineered
protein production systems.
"Operably linked", when referring to DNA
segments, indicates that the segments are arranged so
that they function in concert for their intended
purposes, e.g. transcription initiates in the promoter
and proceeds through the coding segment to the
terminator.
A "polynucleotide" is a single- or double-
stranded polymer of deoxyribonucleotide or ribonucleotide
bases read from the 5' to the 3' end. Polynucleotides
include RNA and DNA, and may be isolated from natural
sources, synthesized in vitro, or prepared from a
combination of natural and synthetic molecules.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
6
The term "promoter" is used herein for its art-
recognized meaning to denote a portion of a gene
containing DNA sequences that provide for the binding of
RNA polymerise and initiation of transcription. Promoter
sequences are commonly, but not always, found in the 5'
non-coding regions of genes.
A "soluble protein" is a protein polypeptide
l0 that is not bound to a cell membrane.
Within preferred embodiments of the invention
the isolated polynucleotides will hybridize to similar
sized regions of SEQ ID NO:1, or a sequence complementary
thereto, under stringent conditions. In general,
stringent conditions are selected to be about 5°C lower
than the thermal melting point (Tm) for the specific
sequence at a defined ionic strength and pH. The Tm it
the temperature (under defined ionic strength and pH) at
which 50% of the target sequence hybridizes to a
perfectly matched probe. Typical stringent conditions
are those in which the salt concentration is about 0.02 M
or less at pH 7 and the temperature is at least about
60°C. As previously noted, the isolated polynucleotides
of the present invention include DNA and RNA. Methods
for isolating DNA and RNA are well known in the art.
Total RNA can be prepared using guanidine HCl extraction
followed by isolation by centrifugation in a CsCl
gradient [Chirgwin et al., Biochemistry 18:52-94 (1979)].
Poly (A)+ RNA is prepared from total RNA using the method
of Aviv and Leder [Pros. Natl. Acid. Sci. USA 69:1408-
1412 (1972)]. Complementary DNA (cDNA) is prepared from
poly(A)+ RNA using known methods. Polynucleotides
CA 02313464 2000-06-08
WO 99/29720 PCT/US98l26273
7
encoding Zalphal polypeptides are then identified and
isolated by, for example, hybridization or PCR.
Additionally, the polynucleotides of the
present invention can be synthesized using a DNA
synthesizer. Currently the method of choice is the
phosphoramidite method. If chemically synthesized double
stranded DNA is required for an application such as the
synthesis of a gene or a gene fragment, then each
complementary strand is made separately. The production
of short genes (60 to 80 bp) is technically
straightforward and can be accomplished by synthesizing
the complementary strands and then annealing them. For
the production of longer genes (>300 bp), however,
special strategies must be invoked, because the coupling
efficiency of each cycle during chemical DNA synthesis is
seldom 100%. To overcome this problem, synthetic genes,
(double-stranded) are assembled in modular form from
single-stranded fragments that are from 20 to 100
nucleotides in length. See Glick, Bernard R. and Jack J.
Pasternak, Molecular Biotechnology, Principles &
Applications of Recombinant DNA,(ASM Press, Washington,
D.C. 1994), Itakura, K. et al. Synthesis and use of .
synthetic oligonucleotides. Annu. Rev. Biochem. 53 . 323-
356 (1984), and Climie, S. et al. Chemical synthesis of
the thymidylate synthase gene. Proc. Natl. Acad. Sci. USA
87 :633-637 (1990).
Those skilled in the art will recognize that.
the sequences disclosed in SEQ ID NOS:1, and 2 represent
a single allele of the human. Allelic variants of these
sequences can be cloned by probing cDNA or genomic
libraries from different individuals according to
standard procedures.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
8
The present invention further provides
counterpart proteins and polynucleotides from other
species ("species orthologs"). Of particular interest
are Zalphal polypeptides from other mammalian species,
including murine, porcine, ovine, bovine, canine, feline,
equine, and other primates. Species orthologs of the
human Zalphal protein can be cloned using information and
compositions provided by the present invention in
combination with conventional cloning techniques. For
example, a cDNA can be cloned using mRNA obtained from~a
tissue or cell type that expresses the protein. Suitable
sources of mRNA can be identified by probing Northern
blots with probes designed from the sequences disclosed
herein. A library is then prepared from mRNA of a
positive tissue or cell line. A protein-encoding cDNA
can then be isolated by a variety of methods, such as by
probing with a complete or partial human or mouse cDNA or
with one or more sets of degenerate probes based on the
disclosed sequences. A cDNA can also be cloned using the
polymerase chain reaction, or PCR (Mullis, U.S. Patent
No. 4,683,202), using primers designed from the sequences
disclosed herein. Within an additional method, the cDNA
library can be used to transform or transfect host cells,
and expression of the cDNA of interest can be detected
with an antibody to the protein. Similar techniques can
also be applied to the isolation of genomic clones. As
used and claimed the language "an isolated polynucleotide
which encodes a polypeptide, said polynucleotide being
defined by SEQ ID NO: 2" includes all allelic variants
and species orthologs of the polypeptide of SEQ ID N0:2.
The present invention also provides isolated
protein polypeptides that are substantially identical to
the protein polypeptides of SEQ ID N0: 2 and its species
orthologs. By "isolated" is meant a protein or
CA 02313464 2000-06-08
WO 99/29720 PCT/US98I26273
9
polypeptide that is found in a condition other than its
native environment, such as apart from blood and anima2
tissue. In a preferred form, the isolated polypeptide is
substantially free of other polypeptides, particularly
other polypeptides of animal origin. It is preferred to
provide the polypeptides in a highly purified form, i.e.
greater than 95% pure, more preferably greater than 99%
pure. The term "substantially identical" is used herein
to denote polypeptides having 50%, preferably 60%, more
preferably at least 80%, sequence identity to the
sequence shown in SEQ ID N0:2 or SEQ ID N0:45, or their
species orthologs. Such polypeptides will more
preferably be at least 90% identical, and most preferably
95% or more identical to SEQ ID N0:2 or SEQ ID N0:45,or
their species orthologs. Percent sequence identity is
determined by conventional methods. See, for example,
Altschul et al., Bull. Math. Bio. 48: 603-616, 1986 and
Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA
89:10915-10919, 1992. Briefly, two amino acid sequences
are aligned to optimize the alignment scores using a gap
opening penalty of 10, a gap extension penalty of 1, and
the "blossom 62" scoring matrix of Henikoff and Henikoff
(ibid.) as shown in Table 1 (amino acids are indicated by
the standard one-letter codes). The percent identity is
then calculated as:
Total number of identical matches
[length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two
sequences)
x 100
CA 02313464 2000-06-08
WO 99/29720 PGT/US98/26273
10 '
~r
I
'-1 N M
~i I
t!7 N N O
I
~ rl M N N
I I,
p., I~ ~-I rl ~' M N
I I I I I
[xa l0 ~' N N ~-1 M r-I
I 1 I I
tn O N .-I r-1 .-i .-1 .-I
i I I I 1
',,~(,, tn ,-t M r-1 O .-1 M N N
I I I I I I I
C' N N O M N r-I N rl r-I
I I I I I I.
H ~ N M r-I O M N rl M v-1 M
1 I 1 I I I
00 M M r-I N r-1 N .-I N N N M
I I I I I I I I I 1
[7 lD N ~ V' N M M N O N N M M
I I I 1 I I I I 1 I I
W ~ N O M M H N M rl O r-1 M N N
I I I I I I I I I I
d ~ N N O M N v-i O M rl O r-1 N rl N
i I I I I I I I~ I
U ~ M ~ M M H .-I M rl N M rl ~-1 N N .-t
I 1 1 I I I I I I I I I 1 I I
Ca CO M O N ~-1 r1 M Wit' rl M M r-I O r-i d' M M
I I 1 1 I I I I 1 1 1 I I
2 l0 rl M O O O rl M M O N M N .-1 O V~ N M
1 1 I I I I I I I
!Zi ~ O N M r-I O N O M N N '-I M N rl rl M N M
I 1 I I I i I 1 I I I I I
FC 'd' v-1 N N O rl rl O N r-1 .-1 .~ ~-I N ~--1 r-I O M N O
I I I I I I I 1 I I I I I i'
r.~ f~G Z C~ U OI W Ch x H a x ~ C=.~ P.~ V7 E-~ 3 ~
H
N
~i
.LZ
td
Ei
111 O tn O
H r-1 N
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
11
Sequence identity of polynucleotide molecules
is determined by similar methods using a ratio as
disclosed above.
Substantially homologous proteins and
polypeptides are characterized as having one or more
amino acid substitutions, deletions or additions. These
changes are preferably of a minor nature, that is
conservative amino acid substitutions (see Table 2) and
l0 other substitutions that do not significantly affect the
folding or activity of the protein or polypeptide; small
deletions, typically of one to about 30 amino acids; and
small amino- or carboxyl-terminal extensions, such as an
amino-terminal methionine residue, a small linker peptide
of up to about 20-25 residues, or a small extension that
facilitates purification (an affinity tag), such as a
poly-histidine tract, protein A [Nilsson et al., EMBD J.
4:1075 (1985); Nilsson et al., Methods Enzymol. 198:3
(1991)], glutathione S transferase
[Smith and Johnson, Gene 67:31 (1988)], or
other antigenic epitope or binding domain. See, in
general Ford et al., Protein Expression and Purification
2: 95-107 (1991). DNAs encoding affinity tags are
available from commercial suppliers (e. g., Pharmacia
Biotech, Piscataway, NJ).
Table 2
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic acid
aspartic acid
Polar: glutamine
asparagine
Hydrophobic: leucine
isoleucine
CA 02313464 2000-06-08
WO 99/29720 PCT/US98~6273
12
Table 2, continued
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
alanine
serine
threonine
methionine
Essential amino acids in the polypeptides of
the present invention can be identified according to
procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis fCunningham
and Wells, Science 244, 1081-1085 (1989); Bass et al.,.
Proc. Natl. Acad. Sci. USA 88:4498-4502 (1991)]. In the
latter technique, single alanine mutations are introduced
at every residue in the molecule, and the resultant
mutant molecules are tested for biological activity
(e.g., ligand binding and signal transduction) to .
identify amino acid residues that are critical to the
activity of the molecule. Sites of ligand-protein
interaction can also be determined by analysis of crystal
structure as determined by such techniques as nuclear
magnetic resonance, crystallography or photoaffinity
labeling. See, for example, de Vos et al., Science
255:306-312 (1992); Srnith et al., J. Mol. Biol. 224:899-
904 (1992); Wlodaver et al., FEBS Lett. 309:59-64 (1992).
The identities of essential amino acids can also be
inferred from analysis of homologies with related
proteins.
Multiple amino acid substitutions can be made
and tested using known methods of mutagenesis and
screening, such as those disclosed by Reidhaar-Olson and
Sauer, Science 241:53-57, (1988) or Bowie and Sauer,
CA 02313464 2000-06-08
WO 99129720 PGT/US98/26273
13
Proc. Natl. Acad. Sci. USA 86:2152-2156 (1989). Briefly,
these authors disclose methods for simultaneously
randomizing two or more positions in a polypeptide,
selecting for functional polypeptide, and then sequencing
the mutagenized polypeptides to determine the spectrum of
allowable substitutions at each position. Other methods
that can be used include phage display (e.g., Lowman et
al., Biochem. 30:10832-10837 (1991); Ladner et al., U.S.
Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204)
and region-directed mutagenesis [Derbyshire et al., Gene
46:145 (1986); Ner et al., DNA 7:127 (1988)].
Mutagenesis methods as disclosed above can be
combined with high-throughput screening methods to detect
activity of cloned, mutagenized proteins in host cells.
Preferred assays in this regard include cell
proliferation assays and biosensor-based ligand-binding
assays, which are described below. Mutagenized DNA
molecules that encode active proteins or portions thereof
(e. g., ligand-binding fragments) can be recovered from.
the host cells and rapidly sequenced using modern
equipment. These methods allow the rapid determination
of the importance of individual amino acid residues in a
polypeptide of interest, and can be applied to
polypeptides of unknown structure.
Using the methods discussed above, one of
ordinary skill in the art can prepare a variety of
polypeptides that are substantially homologous to SEQ ID
N0:2 or allelic variants thereof and retain the
properties of the wild-type protein. As expressed and
claimed herein the language, "a polypeptide as defined~by
SEQ ID NO: 2" includes all allelic variants and species
orthologs of the polypeptide.
Polynucleotides, generally a cDNA sequence, of
the present invention encode the above-described
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
14
polypeptides. A cDNA sequence which encodes a polypeptide
of the present invention is comprised of a series of
codons, each amino acid residue of the polypeptide being
encoded by a codon and each codon being comprised of
three nucleotides. The amino acid residues are encoded by
their respective codons as follows.
Alanine (Ala) is encoded by GCA, GCC, GCG or
GCT;
Cysteine (Cys) is encoded by TGC or TGT;
Aspartic acid (Asp) is encoded by GAC or GAT;
Glutamic acid (Glu) is encoded by GAA or GAG;
Phenylalanine (Phe) is encoded by TTC or TTT;
Glycine (Gly} is encoded by GGA, GGC, GGG or
GGT;
Histidine (His) is encoded by CAC or CAT;
Isoleucine (Ile) is encoded by ATA, ATC or ATT;
Lysine (Lys) is encoded by AAA, or AAG;
Leucine (Leu) is encoded by TTA, TTG, CTA, CTC,
CTG or CTT;
Methionine (Met) is encoded by ATG;
Asparagine (Asn) is encoded by AAC or AAT;
Proline (Pro) is encoded by CCA, CCC, CCG or
CCT;
Glutamine (Gln) is encoded by CAA or CAG;
Arginine (Arg) is encoded by AGA, AGG, CGA,
CGC, CGG or CGT;
Serine (Ser) is encoded by AGC, AGT, TCA, TCC,
TCG or TCT;
Threonine (Thr) is encoded by ACA, ACC, ACG or
ACT;
Valine (Val) is encoded by GTA, GTC, GTG or
GTT;
Tryptophan (Trp) is encoded by TGG; and
Tyrosine (Tyr) is encoded by TAC or TAT.
CA 02313464 2000-06-08
WO 99/29720 PGT/US98/26273
It is to be recognized that according to the
present invention, when a cDNA is claimed as described
above, it is understood that what is claimed are both the
sense strand, the anti-sense strand, and the DNA as
5 double-stranded having both the sense and anti-sense
strand annealed together by their respective hydrogen
bonds. Also claimed is the messenger RNA (mRNA) which
encodes the polypeptides of the present invention, and
which mRNA is encoded by the above-described cDNA. A
10 messenger RNA (mRNA) will encode a polypeptide using the
same codons as those defined above, with the exception.
that each thymine nucleotide (T) is replaced by a uracil
nucleotide (U) .
The protein polypeptides of the present
invention, including full-length proteins, protein
fragments (e. g. ligand-binding fragments), and fusion
polypeptides can be produced in genetically engineered
host cells according to conventional techniques.
Suitable host cells are those cell types that can be
transformed or transfected with exogenous DNA and grown
in culture, and include bacteria, fungal cells, and
cultured higher eukaryotic cells. Eukaryotic cells,
particularly cultured cells of multicellular organisms,
are preferred. Techniques for manipulating cloned DNA
molecules and introducing exogenous DNA into a variety of
host cells are disclosed by Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd ed. (Cold Spring .
Harbor Laboratory Press, Cold Spring Harbor, NY, 1989),
and Ausubel et al., ibid.
In general, a DNA sequence encoding a Zalphal
polypeptide is operably linked to other genetic elements
required for its expression, generally including a
transcription promoter and terminator, within an
expression vector. The vector will also commonly contain
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26Z73
16
one or more selectable markers and one or more origins of
replication, although those skilled in the art will
recognize that within certain systems selectable markers
may be provided on separate vectors, and replication of
the exogenous DNA may be provided by integration into the
host cell genome. Selection of promoters, terminators,
selectable markers, vectors and other elements is a
matter of routine design within the level of ordinary
skill in the art. Many such elements are described in
the literature and are available through commercial
suppliers.
To direct a Zalphal polypeptide into the
secretory pathway of a host cell, a secretory signal
sequence (also known as a leader sequence, prepro
sequence or pre sequence) is provided in the expression
vector. The secretory signal sequence may be that of the
protein, or may be derived from another secreted protein
(e. g., t-PA) or synthesized de novo. The secretory
signal sequence is joined to the Zalphal DNA sequence in
the correct reading frame. Secretory signal sequences
are commonly positioned 5' to the DNA sequence encoding
the polypeptide of interest, although certain signal
sequences may be positioned elsewhere in the DNA sequence
of interest (see, e.g., Welch et al., U.S. Patent No.
5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Cultured mammalian cells are preferred hosts
within the present invention. Methods for introducing
exogenous DNA into mammalian host cells include calcium
phosphate-mediated transfection [Wigler et al., Cell
14:725 (1978); Corsaro and Pearson, Somatic Cell Genetics
7:603, (1981): Graham and Van der Eb, Virology 52:456,
(1973)], electroporation [Neumann et al., EMBO J. 1:841-
845, (1982)], DEAE-dextran mediated transfection [Ausubel
et al., eds., Current Protocols in Molecular Biology,
(John Wiley and Sons, Inc., NY, 1987)], and liposome-
CA 02313464 2000-06-08
WO 99/Z9720 PCT/US98/26273
17
mediated transfection [Hawley-Nelson et al., Focus 15:73
(1993); Ciccarone et al., Focus 15:80, (1993)]. The
production of recombinant polypeptides in cultured
mammalian cells is disclosed, for example, by Levinson et
al., U.S. Patent No. 4,713,339; Hagen et al., U.S. Patent
No. 4,784,950; Palmiter et al., U.S. Patent No.
4,579,821; and Ringold, U.S. Patent No. 4,656,134.
Suitable cultured mammalian cells include the COS-1 (ATCC
No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No.
CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 [ATCC No.
CRL 1573; Graham et al., J. Gen. Virol. 36:59-72 (1977)]
and Chinese hamster ovary (e.g. CHO-K1; ATCC No. CCL 61)
cell lines. Additional suitable cell lines are known in
the art and available from public depositories such as~
the American Type Culture Collection, Rockville,
Maryland. In general, strong transcription promoters are
preferred, such as promoters from SV-40 or
cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288.
Other suitable promoters include those from
metallothionein genes (U.S. Patent Nos. 4,579,821 and
4,601,978) and the adenovirus major late promoter.
Drug selection is generally used to select for
cultured mammalian cells into which foreign DNA has been
inserted. Such cells are commonly referred to as
"transfectants". Cells that have been cultured in the
presence of the selective agent and are able to pass the
gene of interest to their progeny are referred to as
"stable transfectants." A preferred selectable marker is
a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-
type drug, such as G-418 or the like. Selection systems
may also be used to increase the expression level of the
gene of interest, a process referred to as
"amplification." Amplification is carried out by
culturing transfectants in the presence of a low level of
the selective agent and then increasing the amount of
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
18
selective agent to select for cells that produce high
levels of the products of the introduced genes. A'
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g. hygromycin resistance,
multi-drug resistance, puromycin acetyltransferase) can
also be used.
Other higher eukaryotic cells can also be used
as hosts, including insect cells, plant cells and avian
cells. Transformation of insect cells and production of
foreign polypeptides therein is disclosed by Guarino et
al., U.S. Patent No. 5,162,222; Bang et al., U.S. Patent
No. 4,775,624; and WIPO publication WO 94/06463. The use
of Agrobacterium rhizogenes as a vector for expressing
genes in plant cells has been reviewed by Sinkar et al.,
J. Biosci. (Bangalore) 11:47-58, (1987).
Fungal cells, including yeast cells, and
particularly cells of the genus Saccharomyces, can also
be used within the present invention, such as for
producing protein fragments or polypeptide fusions.
Methods for transforming yeast cells with exogenous DNA
and producing recombinant polypeptides therefrom are
disclosed by, for example, Kawasaki, U.S. Patent No.
4,599,311; Kawasaki et al., U.S. Patent No. 4,931,373;
Brake, U.S. Patent No. 4,870,008; Welch et al., U.S.
Patent No. 5,037,743; and Murray et al., U.S. Patent No.
4,845,075. Transformed cells are selected by phenotype
determined by the selectable marker, commonly drug
resistance or the ability to grow in the absence of a
particular nutrient (e. g., leucine). A preferred vector
system for use in yeast is the POT1 vector system
disclosed by Kawasaki et al., U.S. Patent No. 4,931,373 ,
which allows transformed cells to be selected by growth
in glucose-containing media. Suitable promoters and '
terminators for use in yeast include those from
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
19
glycolytic enzyme genes (see, e.g.,.Kawasaki, U.S. Patent
No. 4,599,311; Kingsman et al., U.S. Patent No.
4,615,974; and Bitter, U.S. Patent No. 4,977,092) and
alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including
Hansenula polymorpha, Schizosaccharomyces pombe,
Kluyveromyces lactis, Kluyveromyces fra gilis, Ustilago
maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459-3465 (1986) and Cregg, U.S. Patent No.
4,882,279. Aspergillus cells may be utilized according
to the methods of McKnight et al., U.S. Patent No.
4,935,349. Methods for transforming Acremonium
chrysogenum are disclosed by Sumino et al:, U.S. Patent
No. 5,162,228. Methods for transforming Neurospora are
disclosed by Lambowitz, U.S. Patent No. 4,486,533.
Transformed or transfected host cells are
cultured according to conventional procedures in a
culture medium containing nutrients and other components
required for the growth of the chosen host cells. A
variety of suitable media, including defined media and
complex media, are known in the art and generally include
a carbon source, a nitrogen source, essential amino
acids, vitamins and minerals. Media may also contain
such components as growth factors or serum, as required.
The growth medium will generally select for cells
containing the exogenously added DNA by, for example,
drug selection or deficiency in an essential nutrient
which is complemented by the selectable marker carried on
the expression vector or co-transfected into the host
cell.
Another embodiment of the present invention
provides for a peptide or polypeptide comprising an
CA 02313464 2000-06-08
WO 99/29720 PCT/US98I26273
epitope-bearing portion of a Zalphal polypeptide of the
invention. The epitope of the this polypeptide portion is
an immunogenic or antigenic epitope of a polypeptide of
the invention. A region of a protein to which an antibody
5 can bind is defined as an "antigenic epitope". See for
instance, Geysen, H.M. et al., Proc. Natl. Acad Sci. USA
81:3998-4002 (1984).
As to the selection of peptides or polypeptides
10 bearing an antigenic epitope (i.e., that contain a region
of a protein molecule to which an antibody can bind), it
is well known in the art that relatively short synthetic
peptides that mimic part of a protein sequence are
routinely capable of eliciting an antiserum that reacts
15 with the partially mimicked protein. See Sutcliffe, J.G.
et a1. Science 219:660-666 (1983). Peptides capable of
eliciting protein-reactive sera are frequently
represented in the primary sequence of a protein, can be
characterized by a set of simple chemical rules, and are
20 confined neither to immunodominant regions of intact
proteins (i.e., immunogenic epitopes) nor to the amino~or
carboxyl terminals. Peptides that are extremely
hydrophobic and those of six or fewer residues generally
are ineffective at inducing antibodies that bind to the
mimicked protein; longer soluble peptides, especially
those containing proline residues, usually are effective.
Antigenic epitope-bearing peptides and
polypeptides of the invention are therefore useful to
raise antibodies, including monoclonal antibodies, that
bind specifically to a polypeptide of the invention.
Antigenic epitope-bearing peptides and polypeptides of
the present invention contain a sequence of at least
nine, preferably between 15 to about 30 amino acids
contained within the amino acid sequence of a polypeptide
of the invention. However, peptides or polypeptides
comprising a larger portion of an amino acid sequence of
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
21
the invention, containing from 30 to 50 amino acids, or
any length up to and including the entire amino acid
sequence of a polypeptide of the invention, also are
useful for inducing antibodies that react with the
protein. Preferably, the amino acid sequence of the
epitope-bearing peptide is selected to provide
substantial solubility in aqueous solvents (i.e., the
sequence includes relatively hydrophilic residues and
hydrophobic residues are preferably avoided); and
sequences containing proline residues are particularly
preferred. All of the polypeptides shown in the sequence
listing contain antigenic epitopes to be used according
to the present invention, however, specifically designed
antigenic epitopes include the peptides defined by SEQ ID
NOs:. The present invention also provides polypeptide
fragments or peptides comprising an epitope-bearing
portion of a Zalphal polypeptide described herein. Such
fragments or peptides may comprise an "immunogenic
epitope," which is a part of a protein that elicits an'
antibody response when the entire protein is used as an
immunogen. Immunogenic epitope-bearing peptides can be
identified using standard methods [see, for example,
Geysen et al., supra. See also U.S. Patent No. 4,708,781
(1987) further describes how to identify a peptide
bearing an immunogenic epitope of a desired protein. '
Specific examples of epitope-bearing polypeptides are
those polypeptide which contain SEQ ID NOs: 46 - 56,
especially polypeptides which contain a polypeptide
defined by SEQ ID NOs:50-56. SEQ ID N0:50 is a
polypeptide comprised of Helices A and B; SEQ ID N0:51 is
a polypeptide comprised of helices A, B and C; SEQ ID
N0:52 is a polypeptide comprised of helices A, B, C and
D; SEQ ID N0:53 is a polypeptide comprised of helices B
and C; SEQ ID N0:54 is a polypeptide comprised of helices
B, C and D; SEQ ID N0:55 is a polypeptide comprised of
helices C and D; and SEQ ID N0:56 is comprised of the
polypeptide of SEQ ID N0:2 extending from the beginning
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26I73
22
of helix C to the end of the polypeptide. Antigenic
epitope-bearing peptides and polypeptides of the present
invention are useful to raise antibodies that bind with
the polypeptides described herein which then can be used
to purify the protein in either a native or denatured
form or to detect the Zalpal polypeptide in a western
blot.
PROTEIN ISOLATION:
Expressed recombinant polypeptides (or chimeric
polypeptides) can be purified using fractionation and/or
conventional purification methods and media. See, for
example, "Affinity Chromatography: Principles & Methods"
(Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988),
Methods in Enzymol., Vol. 182, "Guide to Protein
Purification", M. Deutscher, (ed.), pp.529-39 (Acad. .
Press, San Diego (1990)] and "Protein Purification,
Principles and Practice" 3rd Edition, Scopes, Robert
Structure of Zalphal
Zalphal is predicted to be a four-helical .
polypeptide similar to the family of helical cytokines
represented by growth hormone, erythropoietin, leptin and
interleukin-10. Helix A of Zalphal is predicted to
include the amino acid residue 23 of SEQ ID N0:2, an
asparagine, through amino acid residue 37, an arginine.
Helix A is also defined by SEQ ID N046. Helix B of
Zalphal is predicted to include amino acid 53 of SEQ ID
NO: 2, a phenylalanine, through amino acid residue 67, a
phenylalanine. Helix B is also defined by SEQ ID N0:47.
Helix C of Zalphal is predicted to include amino acid 82
of SEQ ID NO: 2, a phenylalanine, through amino acid
residue 96, a leucine residue. Helix C is also defined~by
SEQ ID N0:48. Helix D of Zalphal is predicted to include
amino acid 118 of SEQ ID NO: 2, a tyrosine, through amino
CA 02313464 2000-06-08
WO 99/29720 PCf/US98/26273
23
acid residue 132, an aspartate residue. Helix D is also
defined by SEQ ID N0:49.
Uses
By the use of radiation hybrid panels, Zalphal
was mapped to Xq27.3, in close proximity to Fl~l, a gene
linked to Fragile-X syndrome. FMR1 is an evolutionarily
conserved gene that is transcribed at relatively high .
levels in brain, testis, heart, lung, kidney and placenta
with low to negligible levels in liver, pancreas and
skeletal muscle [Hinds et al., Nature Genet. 3: 36-43
(1993)]. The function of the FMR1 protein is not known.
Studies have shown that FMR1 can bind mRNA and have a
nuclear translocation consensus sequence suggesting that
it may be a nuclear protein [Ashley et a1. Science 262:
563-566 (1993); Siomi et al., Cell 74: 291-298 (1993)].
The molecular basis for Fragile-X syndrome is
due to an unstable, inherited multi-step expansion of a
polymorphic triplet repeat sequence (CGG)n within the 5'
untranslated region of FMR1. See Hagerman, Men. Ret. and
Devel. Dis. Res. Rev. I: 276-280 (1995). In a normal
population, the number of triplet is polymorphic and
ranges from 6-53 units. Carriers of the disease show
repeat length of 43-200 units and are termed as having
premutations. A full mutation is characterized by .
expansion of the repeats to greater than 200 units. As a
consequence of the expansion, the CGG repeats and the
FMR1 promoter sequences become hypermethylated, leading
to the inactivation of the transcription of FMR1 and
perhaps nearby genes. Premutations are associated with
premature ovarian failure, early menopause or precocious
puberty in affected individuals. The severity of these
and other conditions varies in different individuals and
may reflect an underlying dysfunction of the
hypothalamic-pituitary-gonadal axis. Nearly all males
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
24
with a full mutation have mild to severe mental
retardation. [Rousseau et a1. Am. J. Hu. Genet. 55: 225-
237 (1994)]. Approximately 50-70% of the females with a
fully mutated allele mental impairment [Hagerman et. al.
Pediatrics 89: 395-400 (1993); Rousseau et al. ibid.].
Full mutation males also exhibit macroorchidism, distinct
facies, velvety skins and hyperextensible joints. Female
symptoms are more variable which may be due to
differential X-inactivation.
l0
While expression of FMRI is clearly compromised
in fragile-X patients with a full mutation, the
possibility remains that some of the pleiotropic
manifestations of the Fragile-X syndrome may result from
the disruption of expression of nearby genes. Methylation
is known to inhibit transcription by preventing the
direct binding of transcription factors by altering the
conformation of DNA. Methylated DNA has been shown to
favor Z-DNA formation. As such, hypermethylation of CGG
repeats or other mechanisms leading to the extinction of
the FMR1 promoter may affect expression of other genes
over a considerable distance. Clark et al., Am. J. Med.
Genet., 43: 299-396 (1992) have reported that the level
of iduronate sulfatase, encoded by the IDS gene (Hunter
syndrome), which is located 1000 kb distal to the
Fragile-X locus, is decreased in Fragile-X patients.
Zalphal has been placed between two fragile
sites, FRAXA and FRAXE, in Xq27.3 using a radiation
hybrid panel. Due to the close praxirnity to the FMR1
locus, expression of Zalphal may be inhibited by the
expansion of the CGG repeats and the ensuing
hypermethylation resulting in the extinction of FMR1. The
variable phenotypic traits associated with the Fragile-X
syndrome may therefore be due at least in part to the
absence of Zalphal expression. The administration of
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/2b273
Zalphal polypeptide, its agonists or antagonists may
provide a clinical treatment for these conditions
The precise physical distance of Zalphal to
5 FMR1 can be refined using a number of existing mapping
reagents, including somatic cell hybrids, yeast
artificial chromosome (YAC) clones, and bacterial
artificial chromosome (BAC) clones. The existing somatic
cell hybrid mapping panels provide relevant breakpoints
10 at the FRAXA CGG triplet repeat associated with Fragile-X
syndrome [Warren et al., Proc. Nat. Acad. Sci.,87: 3856
(1990}], and at the IDS (Hunter syndrome) locus [Suthers
et. a1. Am. J. Hum. Genet., 47:187 (1990)], distal to
FRAXE. The use of these reagents will serve to confirm
15 that the radiation hybrid panel has placed Zalphal in the
correct chromosomal region with respect to FMRI. A YAC
clone is available containing both FRAXA and FRAXE, and
which contains BSS H II fragments which are consistent.
with pulsed-field map of the genome region; therefore it
20 is likely that this YAC does not carry deletions and is
thus a valid mapping reagent. A BAC contig connecting
FRAXA and FRAXE with one intractable gap is also
available for mapping.
25 Physical mapping of Zalphal can easily be
accomplished by polymerase chain reaction (PCR), using
gene specific primers and the mapping reagents as
template. Analysis using the somatic cell hybrid panels
will be done initially; confirmation of the regional
localization will be followed by higher resolution
mapping using the YAC and BAC clones. Mapping of Zalphal
to one or more BAC clones will provide a precise
localization to within 100 kb, and the relative distance
to the fragile site can then be easily determined.
Since Zalphal transcripts are present in
detectable levels in peripheral blood leukocytes, Zalphal
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
26
expression can also be assessed in widely available
lymphoblastoid cell lines derived from Fragile-X patients
with a range of CGG repeat expansions. Analysis of
Zalphal transcript levels in these cell lines by Northern
blot analysis or by RT/PCR would provide confirmation
that Zalphal transcription levels are reduced or are
absent in Fragile-X patients.
Alteration in Zalphl transcription in Fragile-X
patients can be determined directly by Northern blot
analysis or by RT/PCR analysis on pituitary, aortic or
other RNA samples isolated from Fragile-X patients.
Zalphal transcripts of the present invention were found
at high levels in the pituitary and in aorta. Lower
levels were found in brain, kidney, pancreas, prostate,
testis, ovary, thyroid, spinal cord, trachea, adrenal
gland. Trace levels were found in placenta, lung, liver,
bone marrow and peripheral blood lymphocytes. Expression
in the brain and pituitary suggests that Zalphal plays a
regulatory role in the hypothalamic-pituitary-gonadal
axis.
Recent work provides clinical evidence for a
connective tissue dysfunction in some Fragile-X patients.
Opitz et a~., Am. J. Med. Genet. 17: 101-109 (1984)
described a connective tissue dysplasia which is
characterized by hyperextensible finger joints, flat
feet, and mitral valve prolapse. Waldstein and Hagerman,
Am. J. Med. Genet., 30: 83-98 (1988) reported on a
patient with hypoplasia of the aorta and cardiac valvular
abnormalities. Other physical findings commonly seen in
Fragile-X patients, such as macroorchidism, prominent
ears and hyperelastic skins may also be related to a
connective tissue dysplasia. Elastin fibers in these
affected tissues were reported to be reduced, abnormal in
appearance, fragmented and not orientated. These fibers
may fail to provide the appropriate mesh-work for joint
CA 02313464 2000-06-08
WO 99129720 PCT/US98/26273
27
stability, skin tensile strength, normal aortic growth
and development and proper cardiac valve configuration
and function.
It has been suggested that a locus present at
or near Xq27.3 is responsible for the structural
integrity of elastin or modulation of its production
[Waldstein and Hagerman Am. J. Med. Genet. 30: 83-98
(1988)]. Zalphal might be that proposed locus. Thus,
Zalphal polypeptides, agonists or antagonists thereof may
be therapeutically useful for the growth,
differentiation, maintenance or survival of connective
tissues. In particular, that of the cardiovascular and
epidermis systems. Clinical indications would include the
treatment of blood vessel diseases, macroorchidism, skin
disorders, joint instability and other clinical
connective tissue dysfunctions. Other applications
include cosmetic improvements to normal connective
tissues such as enhancement of skin tone and elasticity.
Evaluation of the Zalphal polypeptide,
fragments thereof, fusion proteins containing Zalphal,
such as Zalphal-Fc constructs, antibodies, agonists or
antagonists for activity in the growth, differentiation,
maintenance or survival of connective tissues can be
carried out using cell cultures or animal systems.
Expression of elastin, collagen, and other phenotypic
markers can be used to monitor efficacy in vitro. When
administered to murine models, proteins of the present
invention are formulated for parental, particularly
intravenous or subcutaneous delivery according to
standard methods. Delivery to animals would also include
the use of viral systems such as the adenovirus, adeno-
associated virus and retrovirus systems. Dosing regimen
is determined empirically taking into account protein
stability and other pharmacokinetic parameters known in
the art. The effects of the present invention on growth,
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
28
differentiation, maintenance or survival of cannective
and other tissues or organs can be assessed by the
examination of histological sections taken from the
recipient animals. Particular attention will be paid to
tissues or organs in which Zalphal is expressed at high
levels. Evaluations would include abnormal cell
proliferation or cell death. Masson trichrome stain for
collagen; orcein and Verhoeff-van Gieson stains for
elastin and collagen; and Hale colloidal iron stain for
acid mucopolysaccharide. The direct effect of the present
invention on skin elasticity and other effects on skin
may be assessed by the use of transdermal delivery
systems known in the art.
The role of the present invention on the
hypothalamic-pituitary-gonadal axis can be assessed by
measurements in changes to the circulating levels of
gonadotropin, luteinizing hormone, follicle-stimulating
hormone and other hormones in the recipient animals.
The present invention also provides reagents
with significant therapeutic value. The Zalphal
polypeptide (naturally occurring or recombinant),
fragments thereof, antibodies and anti-idiotypic '
antibodies thereto, along with compounds identified as
having binding affinity to the Zalphal polypeptide,
should be useful in the treatment of conditions
associated with abnormal physiology or development,
including abnormal proliferation, e.g., cancerous
conditions, or degenerative conditions. For example, a'
disease or disorder associated with abnormal expression
or abnormal signaling by a Zalphal polypeptide should be
a likely target for an agonist or antagonist of the
Zalphal polypeptide.
Antibodies to the Zalphal polypeptide can be
purified and then administered to a patient. These
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
29
reagents can be combined for therapeutic use with
additional active or inert ingredients, e.g., in
pharmaceutically acceptable carriers or diluents along
with physiologically innocuous stabilizers and
excipients. These combinations can be sterile filtered
and placed into dosage forms as by lyophilization in
dosage vials or storage in stabilized aqueous
preparations. This invention also contemplates use of
antibodies, binding fragments thereof or single-chain
antibodies of the antibodies including forms which are
not complement binding.
The quantities of reagents necessary for
effective therapy will depend upon many different
factors, including means of administration, target site,
physiological state of the patient, and other medications
administered. Thus, treatment dosages should be titrated
to optimize safety and efficacy. Typically, dosages used
in vitro may provide useful guidance in the amounts
useful for in vivo administration of these reagents.
Animal testing of effective doses for treatment of
particular disorders will provide further predictive
indication of human dosage. Methods for administration
include oral, intravenous, peritoneal, intramuscular, or
transdermal administration. Pharmaceutically acceptable
carriers will include water, saline, buffers to name just
a few. Dosage ranges would ordinarily be expected from
leg to 1000~g per kilogram of body weight per day.
However, the doses by be higher or lower as can be
determined by a medical doctor with ordinary skill in the
art. For a complete discussion of drug formulations and
dosage ranges see Remington's Pharmaceutical Sciences,l8tn
Ed., (Mack Publishing Co., Easton, Penn., 1996), and
Goodman and Gilma.n's: The Pharmacological Bases of
Therapeutics,9"' Ed. (Pergamon Press 1996).
CA 02313464 2000-06-08
WO 99/Z9720 PCT/US98/26Z73
Introduction of Nucleic Acids into Mammalian Cells
If a mammal has a mutated or lacks a Zalphal
gene, the Zalphal gene can be introduced into the cells
5 of the mammal. In one embodiment, a gene encoding a
Zalphal polypeptide is introduced in vivo in a viral
vector. Such vectors include an attenuated or defective
DNA virus, such as but not limited to herpes simplex
virus (HSV), papillomavirus, Epstein Barr virus (EBV),
10 adenovirus, adeno-associated virus (AAV), and the like.
Defective viruses , which entirely or almost entirely
lack viral genes, are preferred. A defective virus is not
infective after introduction into a cell. Use of
defective viral vectors allows for administration to
15 cells in a specific, localized area, without concern that
the vector can infect other cells. Examples of particular
vectors include, but are not limited to, a defective
herpes virus 1 (HSV1) vector (Kaplitt et al., Molec.
Cell. Neurosci.,2 :320-330 (1991)1, an attenuated
20 adenovirus vector, such as the vector described by
Stratford-Perricaudet et al., J. Clin. Invest., 90 :626-
630 (1992), and a defective adeno-associated virus vector
[Samulski et al., J. Virol., 61:3096-3101 (1987);
Samulski et al . J. Virol. , 63:3822-3828 (1989) J .
In another embodiment, the gene can be
introduced in a retroviral vector, e.g., as described in
Anderson et al., U.S. Patent No. 5,399,346; Mann et al.,
Cell, 33:153 (1983); Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
Markowitz et al., J. Virol., 62:1120 (1988); Temin et
al., U.S. Patent No. 5,124,263; International Patent
Publication No. WO 95/07358; and Blood, 82:845 (1993).
Alternatively, the vector can be introduced by
lipofection in vivo using liposomes. Synthetic cationic
lipids can be used to prepare liposomes for in vivo
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
31
transfection of a gene encoding a marker [Felgner et al.,
Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987); see
Mackey et al., Proc. Natl. Acad. Sci. USA, 85:8027-8031
(1988)]. The use of lipofection to introduce exogenous
genes into specific organs in vivo has certain practical
advantages. Molecular targeting of liposomes to specific
cells represents one area of benefit. It is clear that'
directing transfection to particular cells represents one
area of benefit. It is clear that directing transfection
to particular cell types would be particularly
advantageous in a tissue with cellular heterogeneity,
such as the pancreas, liver, kidney, and brain. Lipids
may be chemically coupled to other molecules for the
purpose of targeting. Targeted peptides, e.g., hormones
or neurotransmitters, and proteins such as antibodies, or
non-peptide molecules could be coupled to liposomes
chemically.
It is possible to remove the cells from the
body and introduce the vector as a naked DNA plasmid and
then re-implant the transformed cells into the body.
Naked DNA vector for gene therapy can be introduced into
the desired host cells by methods known in the art, e.g.,
transfection, electroporation, microinjection,
transduction, cell fusion, DEAF dextran, calcium
phosphate precipitation, use of a gene gun or use of a
DNA vector transporter [see, e.g., Wu et al., J. Biol.
Chem., 267:963-967 (1992); Wu et al., J. Biol. Chem.,
263:14621-14624 (1988)].
Zalphal polypeptides can also be used to
prepare antibodies that specifically bind to Zalphal
polypeptides. These antibodies can then be used to
manufacture anti-idiotypic antibodies. As used herein,
the term "antibodies" includes polyclonal antibodies,
monoclonal antibodies, antigen-binding fragments thereof
CA 02313464 2000-06-08
WO 99/29720 PG"T/US98/26273
32
such as F(ab')2 and Fab fragments, and the like,
including genetically engineered antibodies.
Methods for preparing polyclonal and monoclonal
antibodies are well known in the art (see for example,
Sambrook et al., Molecular Cloning: A Laboratory Manual,
Second Edition, (Cold Spring Harbor, NY, 1989); and
Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies:
Techniques and Applications (CRC Press, Inc., Boca Raton,
FL, 1982). As would be evident to one of ordinary skill
in the art, polyclonal antibodies can be generated from a
variety of warm-blooded animals such as horses, cows,
goats, sheep, dogs, chickens, rabbits, mice, and rats.
The immunogenicity of a Zalphal polypeptide may be
increased through the use of an adjuvant such as Freund's
complete or incomplete adjuvant. A variety of assays
known to those skilled in the art can be utilized to
detect antibodies which specifically bind to Zalphal
polypeptides. Exemplary assays are described in detail
in Antibodies: A Laboratory Manual, Harlow and Lane
(Eds.), (Cold Spring Harbor Laboratory Press, 1988).
Representative examples of such assays include: .
concurrent immunoelectrophoresis, radio-immunoassays,
radio-immunoprecipitations, enzyme-linked immunosorbent
assays (ELISA), dot blot assays, inhibition or
competition assays, and sandwich assays.
Antibodies are determined to be specifically
binding if: 1) they exhibit a threshold level of binding
activity, and 2) they do not cross-react with prior art
polypeptide molecules. First, antibodies herein
specifically bind if they bind to a Zalphal polypeptide,
peptide or epitope with a binding affinity (Ka) of 106 M
1 or greater, preferably 10~ M 1 or greater, more
preferably 108 M 1 or greater, and most preferably 109 M
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
33
1 or greater. The binding affinity.of an antibody can be
readily determined by one of ordinary skill in the art,
for example, by Scatchard analysis.
Second, antibodies are determined to
specifically bind if they do not cross-react with
polypeptides of the prior art. Antibodies do not
significantly cross-react with related polypeptide
molecules, for example, if they detect Zalphal but not
known related polypeptides using a standard Western blot
analysis (Ausubel et al., ibid.). Examples of known
related polypeptides are orthologs, proteins from the
same species that are members of a protein family (e. g.
IL-16), Zalphal polypeptides, and non-human Zalphal.
Moreover, antibodies may be "screened against" known
related polypeptides to isolate a population that
specifically binds to the inventive polypeptides. For
example, antibodies raised to Zalphal are adsorbed to
related polypeptides adhered to insoluble matrix;
antibodies specific to Zalphal will flow through the
matrix under the proper buffer conditions. Such
screening allows isolation of polyclonal and monoclonal
antibodies non-crossreactive to closely related
polypeptides, Antibodies: A Laboratory Manual, Harlow and
Lane (eds.) (Cold Spring Harbor Laboratory Press, 1988r;
Current Protocols in Immunology, Cooligan, et al. (eds.),
National Institutes of Health (John Wiley and Sons, Inc.,
1995). Screening and isolation of specific antibodies is
well known in the art. See, Fundamental Immunology, Paul
(eds.) (Raven Press, 1993); Getzoff et al., Adv. in
Immunol. 43: 1-98 (1988); Monoclonal Antibodies:
Principles and Practice, Goding, J.W. (eds.), (Academic
Press Ltd., 1996); Benjamin et al., Ann. Rev. Immunol. 2:
67-101 (1984).
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
34
A variety of assays known to those skilled in
the art can be utilized to detect antibodies which
specifically bind to Zalphal proteins or peptides.
Exemplary assays are described in detail in Antibodies: A
Laboratory Manual, Harlow and Lane (Eds.) (Cold Spring
Harbor Laboratory Press, 1988). Representative examples
of such assays include: concurrent immunoelectrophoresis,
radioimmunoassay, radioimmuno-precipitation, enzyme
linked immunosorbent assay (ELISA), dot blot or Western
blot assay, inhibition or competition assay, and sandwich
assay. In addition, antibodies can be screened for
binding to wild-type versus mutant Zalphal protein or
polypeptide.
Antibodies to Zalphal may be used for tagging
cells that express the protein, for affinity
purification, within diagnostic assays for determining
circulating levels of soluble protein polypeptides, and
as antagonists to block ligand binding and signal
transduction in vitro and in vivo. Anti-idiotypic
antibodies can be used to discover a receptor of Zalphal.
Radiation hybrid mapping is a somatic cell
genetic technique developed for constructing high-
resolution, contiguous maps of mammalian chromosomes [Cox
et al., Science 250:245-250 (1990)]. Partial or full
knowledge of a gene's sequence allows the designing of
PCR primers suitable for use with chromosomal radiation
hybrid mapping panels. Commercially available radiation
hybrid mapping panels which cover the entire human
genome, such as the Stanford G3 RH Panel and the
GeneBridge 4 RH Panel (Research Genetics, Inc.,
Huntsville, AL), are available. These panels enable
rapid, PCR based, chromosomal localizations and ordering
of genes, sequence-tagged sites (STSs), and other
nonpolymorphic- and polymorphic markers within a region
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
of interest. This includes establishing directly
proportional physical distances between newly discovered
genes of interest and previously mapped markers. The
precise knowledge of a gene's position can be useful in a
5 number of ways including: 1) determining if a sequence is
part of an existing contig and obtaining additional '
surrounding genetic sequences in various forms such as
YAC-, BAC- or cDNA clones, 2) providing a possible
candidate gene for an inheritable disease which shows
10 linkage to the same chromosomal region, and 3) for cross-
referencing model organisms such as mouse which may be
beneficial in helping to determine what function a '
particular gene might have.
15 The present invention also provides reagents
which will find use in diagnostic applications. For
example, the Zalphal gene has been mapped on chromosome
Xq27.3. A Zalphal nucleic acid probe could to used to '
check for abnormalities on the X chromosome. For example,
20 a probe comprising Zalphal DNA or RNA or a subsequence
thereof can be used to determine if the Zalphal gene is
present on chromosome Xq27.3 or if a mutation has
occurred. Detectable chromosomal aberrations at the .
Zalphal gene locus include but are not limited to
25 aneuploidy, gene copy number changes, insertions,
deletions, restriction site changes and rearrangements.
Such aberrations can be detected using polynucleotides of
the present invention by employing molecular genetic
techniques, such as restriction fragment length
30 polymorphism (RFLP) analysis, short tandem repeat (STR)
analysis employing PCR techniques, and other genetic
linkage analysis techniques known in the art [Sambrook et
al., ibid.; Ausubel, et. al., ibid.; Marian, A.J., Chest,
108: 255-265, (1995)].
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
36
The invention is further illustrated by the
following non-limiting examples.
Example 1.
Production of a Pituitarv Gland cDNA Library
RNA extracted from cells of pituitary gland was
purchased from Clontech, Palo Alto, CA and reversed
transcribed in the following manner. The first strand
cDNA reaction contained 10 ~1 of human pituitary twice
poly d(T)-selected poly (A)+ mRNA (Clontech, Palo Alto,
CA) at a concentration of 1.0 mg/ml, and 2 ~.1 of 20
pmole/~.1 first strand primer ZC6191 SEQ ID NO: 4 (GTC TGG
GTT CGC TAC TCG AGG CGG CCG CTA TTT TTT TTT TTT TTT TTT)
containing an Xho I restriction site. The mixture was
heated at 70°C for 2.0 minutes and cooled by chilling on
ice. First strand cDNA synthesis was initiated by the
addition of 8 ~,1 of first strand buffer (5x SUPERSCRIPTT""
buffer; Life Technologies, Gaithersburg, MD), 4 ~1 of 100
mM dithiothreitol, and 2 ~,1 of a deoxynucleotide
triphosphate (dNTP) solution containing 10 mM each of
dTTP, dATP, dGTP and 5-methyl-dCTP (Pharmacia LKB
Biotechnology, Piscataway, NJ) to the RNA-primer mixture.
The reaction mixture was incubated at 37° C for 2 minutes,
followed by the addition of 10 ~1 of 200 U/~1 RNase H-
reverse transcriptase (SUPERSCRIPT II~% Life
Technologies). The efficiency of the first strand
synthesis was analyzed in a parallel reaction by the
addition of 10 ~Ci of 32P-adCTP to a 5 ~tl aliquot from
one of the reaction mixtures to label the reaction for
analysis. The reactions were incubated at 37°C for 5
minutes, 45°C for 45 minutes, then incubated at 50°C for
10 minutes. Unincorporated 32P-adCTP in the labeled
reaction was removed by chromatography on a 400 pore size
gel filtration column (Clontech Laboratories). The
CA 02313464 2000-06-08
WO 99/29720 PGT/US98/Z6273
37
unincorporated nucleotides .and primers in the unlabeled
first strand reactions were removed by chromatography on
400 pore size gel filtration column (Clontech
Laboratories). The length of labeled first strand cDNA
was determined by agarose gel electrophoresis.
The second strand reaction contained 100 ~.1 of
the unlabeled first strand cDNA, 30 ~1 of 5x polymerase I
buffer (125 mM Tris: HC1, pH 7.5, 500 mM KCl, 25 mM
MgCl2, 50mM (NH4)2S04)), 2.0 ~.1 of 100 mM dithiothreitol,
3.0 ~1 of a solution containing 10 mM of each
deoxynucleotide triphosphate, 7 ~.1 of 5 mM ~i-NAD, 2.0 ~.1
of 10 U/~1 E. coli DNA ligase (New England Biolabs;
Beverly, MA), 5 ~1 of 10 U/~1 E. coli DNA polymerase I
(New England Biolabs), and 1.0 ~1 of 2 U/~1 RNase H (Life
Technologies). A 10 ~1 aliquot from one of the second
strand synthesis reactions was labeled by the addition of
10 ~,Ci 32P-adCTP to monitor the efficiency of second
strand synthesis. The reactions were incubated at 16° C
for two hours, followed by the addition of 1 ~.1 of a 10
mM dNTP solution and 5.0 ~.1 T4 DNA polymerase (10 U/~1,
Boehringer Mannheim, Indianapolis, IN) and incubated for
an additional 10 minutes at 16°C. Unincorporated 32p-
adCTP in the labeled reaction was removed by
chromatography through a 400 pore size gel filtration
column (Clontech Laboratories) before analysis by agarose
gel electrophoresis. The reaction was terminated by the
addition of 10.0 ~1 0.5 M EDTA and extraction with
phenol/chloroform and chloroform followed by ethanol
precipitation in the presence of 3.0 M Na acetate and 2
~1 of Pellet Paint carrier (Novagen, Madison, WI). The
yield of cDNA was estimated to be approximately 2 ~g from
starting mRNA template of 10 fig.
Eco RI adapters were ligated onto the 5' ends
of the cDNA described above to enable cloning into an
expression vector. A 12.5 ~,1 aliquot of cDNA (~2.0 fig)
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
38
and 3 ~,1 of 69 pmole/~1 of Eco RI adapter (Pharmacia LKB
Biotechnology Inc.) were mixed with 2.5 ~,1 lOx ligase
buffer (660 mM Tris-HCl pH 7.5, 100 mM MgCl2), 2.5 ~.1 of
mM ATP, 3.5 ~l 0.1 M DTT and 1 ~1 of 15 U/~,1 T4 DNA
5 ligase (Promega Corp., Madison, WI). The reaction was
incubated 1 hour at 5°C, 2 hours at 7.5°C, 2 hours at
10°C, 2 hours at 12.5°C and 16 hours at lOoC. The
reaction was terminated by the addition of 65 ~1 H20 and
10 ~,1 lOX H buffer (Boehringer Mannheim) and incubation
10 at 70°C for 20 minutes.
To facilitate the directional cloning of the
cDNA into an expression vector, the cDNA was digested
with Xho I, resulting in a cDNA having a 5' Eco RI
cohesive end and a 3' Xho I cohesive end. The Xho I
restriction site at the 3' end of the cDNA had been
previously introduced. Restriction enzyme digestion was
carried out in a reaction mixture by the addition of 1.0
~.1 of 40 U/~.1 Xho I (Boehringer Mannheim) . Digestion was
carried out at 37°C for 45 minutes. The reaction was
terminated by incubation at 70°C for 20 minutes and
chromatography through a 400 pore size gel filtration
column (Clontech Laboratories).
The cDNA was ethanol precipitated, washed with
70% ethanol, air dried and resuspended in 13.5 ~1 water,
2 ~1 of lOX kinase buffer (660 mM Tris-HC1, pH 7.5, 100
mM MgCl2) , 0.5 ~1 0.1 M DTT, 2 ~tl 10 mM ATP, 2 ~,1 T4
polynucleotide kinase (10 U/~1, Life Technologies).
Following incubation at 37° C for 30 minutes, the cDNA was
ethanol precipitated in the presence of 2.5 M Ammonium'
Acetate, and electrophoresed on a 0.8% low melt agarose
gel. The contaminating adapters and cDNA below 0.6 Kb in
length were excised from the gel. The electrodes were
reversed, and the cDNA was electrophoresed until
concentrated near the lane origin. The area of the gel
containing the concentrated cDNA was excised and placed
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
39
in a microfuge tube, and the approximate volume of the
gel slice was determined. An aliquot of water
approximately three times the volume of the gel slice
(300 ~1) and 35 ~1 lOx (3-agarose I buffer (New England
Biolabs) was added to the tube, and the agarose was
melted by heating to 65°C for 15 minutes. Following
equilibration of the sample to 45°C,
3 ~,1 of 1 U/~1 [3-agarose I (New England Biolabs) was
added, and the mixture was incubated for 60 minutes at
45°C to digest the agarose. After incubation, 40 ~1 of 3
M Na acetate was added to the sample, and the mixture was
incubated on ice for 15 minutes. The sample was
centrifuged at 14,000 x g for 15 minutes at room
temperature to remove undigested agarose. The cDNA was
ethanol precipitated, washed in 70% ethanol, air-dried
and resuspended in 20 ~,1 water.
Following recovery from low-melt agarose gel, the'
cDNA was cloned into the Eco RI and Xho I sites of
pBLUESCRIPT SK+ vector (Gibco/BRL) and electroporated
into DH10B cells. Bacterial colonies containing ESTs of
known genes were identified and eliminated from sequence
analysis by reiterative cycles of probe hybridization to
hi-density colony filter arrays (Genome Systems). cDNAs
of known genes were pooled in groups of 50 - 100 inserts
and were labeled with 'ZP using a MEGAPRIME labeling kit
(Amersham). Colonies which did not hybridize to the probe
mixture were selected for sequencing. Sequencing was done
using an ABI 377 sequencer using either the T3 or the
reverse primer. The resulting data were analyzed which
resulted in the identification of the novel EST
LPIF1021273 (SEQ ID N0: 3).
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
Example 2
Discoverv of the Zal_phal Gene
The cDNA clone which corresponded to the EST of SEQ
ID NO: 3 was sequenced which resulted in the Zalphal DNA
5 sequence and Zalphal amino acid sequence of SEQ ID NO: 1
and SEQ ID NO: 2 respectively.
Example 3
Northern Blot Analysis
10 Human multiple tissue blotsl, 2, 3, and a human RNA
dot blot (Clontech) were probed to determine the tissue
distribution of Zalphal. A 1.2 kb PCR product
representing the Zalphal cDNA was generated using primers
(SEQ ID N0:26) and (SEQ ID N0:27), made to the
15 pBLUESCRIPT SK+~ , T7 promoter and M13 reverse primer
sequence, respectively. The resulting fragment was
electrophoresed on a 0.7~ agarose gel. The DNA was
extracted from the gel slab with a QIAquick Gel
Extraction Kit (Qiagen). 100 ng of this DNA was labeled
20 with P32 using the REIPRIME~ Labeling System (Amersham)
and unincorporated radioactivity was removed with a
NucTrap Probe Purification Column (Stratagene). Multiple
tissue northerns and a human RNA master blot were
prehybridized 3 hours with 10 ml EXPRESSHYB~ Solution
25 (Clontech) containing 1 mg salmon sperm DNA which was
boiled 5 minutes and then iced 1 minute and added to 10
ml of ExpressHyb Solution, mixed and added to blots.
Hybridization was carried out overnight at 65°C. Initial
wash conditions were as follows: 2X SSC, 0.05 SDS RT for
30 40 minutes with several changes of solution then O.1X
SSC, O.l~k SDS at 50°C for 40 minutes, 1 solution change.
Blots were than exposed to film a -80°C for 2..5 hours.
CA 02313464 2000-06-08
WO 99/Z9720 PCT/US98/Z6273
41
The RNA dot blot showed high expression of Zalphal
in pituitary and aorta. The multiple tissue northern
blots showed abundant expression in thyroid, spinal cord,
brain, kidney and pancreas with lower expression in heart
spleen, prostate, testis, stomach, trachea and adrenal
gland.
Example 3
Chromosomal Assignment and Placement of Zalphal.
Zalphal was mapped to the X chromosome using the
commercially available "GeneBridge 4 Radiation Hybrid
Panel" (Research Genetics, Inc., Huntsville, AL). The
GeneBridge 4 Radiation Hybrid Panel contains PCRable DNAs
from each of 93 radiation hybrid clones, plus two control
DNAs (the HFL donor and the A23 recipient). A publicly.
available WWW server (http://www-genome.wi.mit.edu/cgi-
bin/contig/rhmapper.pl) allows mapping relative to the
Whitehead Institute/MIT Center for Genome Research's
radiation hybrid map of the human genome (the "WICGR"
radiation hybrid map) which was constructed with the
GeneBridge 4 Radiation Hybrid Panel.
For the mapping of Zalphal with the "GeneBridge 4 RH
Panel", 20 ul reactions were set up in a PCRable 96-well
microtiter plate (Stratagene, La Jolla, CA) and used in a
"RoboCycler Gradient 96" thermal cycler (Stratagene).
Each of the 95 PCR reactions consisted of 2 ul lOX
KlenTaq PCR reaction buffer (CLONTECH Laboratories, Inc.,
Palo Alto, CA), 1.6 ul dNTPs mix (2.5 mM each, PERKIN-
ELMER, Foster City, CA), 1 ul sense primer, (SEQ ID N0:
5) 15,869, 5' GCA GCA GTC CCA CAG ATG 3', 1 ul antisense
primer, (SEQ ID N0: 6) ZC 15,868, 5' TGG GCT GAG TGC TTG
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
42
TTT 3', 2 ~1 "RediLoad" (Research Genetics, Inc.,
Huntsville, AL), 0.4 ul 50X Advantage KlenTaq Polymerase
Mix (Clontech Laboratories, Inc.), 25 ng of DNA from an
individual hybrid clone or control and x ul ddH20 for a
total volume of 20 ul. The reactions were overlaid with
an equal amount of mineral oil and sealed. The PCR cycler
conditions were as follows: an initial 1 cycle 5 minute
denaturation at 95°C, 35 cycles of a 1 minute denaturation
at 95°C, 1 minute annealing at 64°C and 1.5 minute
extension at 72°C, followed by a final 1 cycle extension
of 7 minutes at 72°C. The reactions were separated by
electrophoresis on a 2$ agarose gel (Life Technologies,,
Gaithersburg, MD).
The results showed that Zalphal maps 4.71 cR-3000
from the framework marker WI- 5285 on the WICGR radiation
hybrid map. The use of surrounding markers positions
Zalphal in the Xq27.3 region on the integrated LDB map. of
the X chromosome (The Genetic Location Database,
University of Southhampton, WWW server: http://
cedar.genetics. soton.ac.uk/public~html/) .
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
43
Example 4
Construction of Untagaed Amino Terminal Glu-Glu Taaaed,
and Carboxy Terminal Glu-Glu Taaaed Mammalian Expression
Vectors for Zalphal
Three mammalian vectors which express Zalphal are
being constructed using a yeast recombination vector.
Three different variations of the Zalphal polypeptide
were generated; (i) untagged, (ii) amino terminal Glu-Glu
tagged, and (iii) carboxy terminal Glu-Glu tagged. The
amino acid sequence of the Glu-Glu tag is Glu-Glu-Tyr-.
Met-Pro-Met-Glu (SEQ ID N0:25)
The vectors can be made as follows.
Generation of Recombination Linkers
The construction of the expression vector in
which there is no Glu-Glu tag attached to the Zalphal can
be done as follows. Both a 5' and 3' linkers can be
constructed which do not encode a Glu-Glu tag and which
ligate by means of homologous recombination with the
digested plasmid and with the Zalphal gene so as to
produce a plasmid containing the Zalphal gene. This is
done by transfecting the two linker DNAs, Zalphal gene
and the digested plasmid simultaneously into yeast. The
plasmid number can be amplified in the yeast, isolated
from the yeast, transfected to E. coli, amplified, .
isolated and then transfected into mammalian cells to
produce Zalphal. The amino acid carboxy terminal tagged
versions are generated in the same manner except that the
appropriately tagged recombination linkers are used. The
yeast plasmid pCZR199 was engineered from vector
pRS316,[Sikorski and Hieter, Genetics 122: 19-27 (1989).
into which a two PVuII sites were engineered and a EcoRI,
Xbz were engineered between the two PVUII sites.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
44
A. Generation of the Untaacted Amino Terminus
The DNA linker which homologously recombines
with the 3' end of the digested plasmid and the 5' end of
the Zalphl gene and does not add a Glu-Glu tag to Zalphal
can be made as follows.
A solution containing 4pmole each of the sense
oligonucleotide ZC16,469 5' TCG CCC AGC CAG GAA ATC CAT
GCC GAG TTC CAA CGC GGC CGT AGA 3' (SEQ ID N0:8) and the
antisense oligonucleotide ZC16,465, 5' CAG CAG CCG CAG
CTG TTC CAT GAG CTG GCT GTT CTC GAT TCT ACG GCC GCG TTG
GAA CTC GG3' (SEQ ID N0:9) are amplified together by PCR.
The amplified product of these two oligonucleotides was
further extended in the same reaction tube, in the same
PCR reaction using 400 picomoles of the sense primer
ZC16,470 5' CTG CTG TGT GGC GCC GTC TTC GTT TCG CCC AGC
CAG GAA ATC CAT 3' (SEQ ID N0:7) and 400 picomoles of the
antisense primer ZC16,028 5' TAC CTG GCG CAG CAG GCT GGC
CCT CTC GCA CAC CAG CAG CCG CAG CTG TTC CAT 3'(SEQ ID
NO:10) .
The PCR mixture for the reaction contained 40 ~.1 of
lOX PCR buffer,8 ~,l EXTAG (both from Takara), 8 ~1 of 2.5
mM nucleotide triphosphate mix Takara) and 300 ~1 of
water. The PCR reaction was incubated at 94°C for 1.5
minutes, and then run for IO cycles each individual cycle
being comprised of 30 seconds at 94°C, 1 minute at 50°C
and 1 minutes at 72°C. The reaction was ended with an
incubation for 10 minutes at 72°C.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
This resulted in the recombination linker
5' CTG CTG TGT GGC GCC GTC TTC GTT TCG CCC AGC
CAG GAA ATC CAT GCC GAG TTC CAA CGC GGC CGT AGA
5 ATC GAG AAC AGC CAG CTC ATG GAA CAG CTG CGG CTG
CTG GTG TGC GAG AGG GCC AGC CTG CTG CGC CAG GTA
3'(SEQ ID NO:11). .
B) Untagged Carboxy Terminus
The DNA linker which homologously recombines
with the 5' end of the digested plasmid and the 3' end of
the Zalphl gene and does not add a Glu-Glu tag to the ,
carboxy terminus of Zalphal can be made as follows.
4 picomoles of the sense oligonucleotide ZC,16,484,
5' GAC GAA GAC GAC GAC GAC GAA GAA GAG GAG GAT
GAT TAT TAA TCT AGA GGA TCT GGG GTG GCA TCC CTG T 3' (SEQ
ID N0:13) and 4 picomoles of the antisense
oligonucleotide ZC14,455 5' CAG GAG AGG CAC TGG GGA GGG
GTC ACA GGG ATG CCA CCC CAG ATC C 3' (SEQ ID N0:14} were
added together in a PCR reaction mixture. Also added to
the mixture are 400 picomoles of sense primer ZC16,027 5'
GAT GAG ATG AAA CAG TGC TTT GGC TGG GAT GAC GAC GAA GAC
GAC GAC GAC GAA 3' (SEQ ID N0:12)and 400 picomoles of the
antisense primer ZC14,394 5' GGC ACT GGA GTG GCA ACT
TCC AGG GCC AGG AGA GGC ACT GGG GAG G 3'(SEQ ID N0:15)
The PCR mixture for the reaction further contained 40 ~.1
of lOX PCR buffer,8 ~,1 EXTAG (both from Takara), 8 ~1 of
2.5 mM nucleotide triphosphate mix Takara) and 300 ~1 of
water. The PCR reaction was incubated at 94°C for 1.5
minutes, and then run for 10 cycles each individual cycle
being comprised of 30 seconds at 94°C, 1 minute at 50°C
and 1 minutes at 72°C. The reaction was ended with an
incubation for 10 minutes at 72°.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
46
This produced the following oligonucleotide linker
which homologously recombines to the 5' end of the
digested plasmid and the 3' end of the Zalphal gene:
5' GAT GAG ATG AAA CAG TGC TTT GGC TGG GAT GAC GAC GAA
GAC GAC GAC GAC GAA GAA GAG GAG GAT GAT TAT TAA
TCTAGAGGAT CTGGGGTGGC ATCCCTGTGA CCCCTCCCCA GTGCCTCTCC
TGGCCCTGGA AGTTGCCACT CCAGTGCC 3' (SEQ ID N0:16).
C) Glu-Glu Tagged Amino Terminus
A linker which would homologously recombine
with the 3' end of the digested plasmid and the 5' end of
the Zalphal gene and which when the Zalphal gene was
expressed would attach a Glu-Glu tag onto the amino
terminus of Zalphal was produced as follows. 4 picomoles
of the sense oligonucleotide ZC14,397 5' CCG AGT TCC,
AAC GCG GCC GTA GAG AGG AGT ATA TGC CTA TGG AG 3' (SEQ ID
N0:18) and 4 picomoles of the antisense oligonucleotide
ZC15,485 5' CAG CAG CCG CAG CTG TTC CAT GAG CTG GCT GTT
CTC GAT CTC CAT AGG CAT ATA CTC CTC TCT ACG 3'(SEQ ID
N0:19) were added together in a PCR reaction mixture.
Also added to the mixture were 400 picomoles of the sense
primer ZC14,396 5' GTT TCG CCC AGC CAG GAA ATC CAT
GCC GAG TTC CAA CGC GGC CGT 3'(SEQ ID N0:17) and 400
picomoles of the antisense primer ZC16,028 5' TAC CTG GCG
CAG CAG GCT GGC CCT CTC GCA CAC CAG CAG CCG CAG CTG TTC
CAT 3'(SEQ ID NO:10) The PCR mixture for the reaction
further contained 40 ~,1 of lOX PCR buffer,8 ~1 EXTAG
(both from Takara), 8 ~1 of 2.5 mM nucleotide
triphosphate mix Takara) and 300 ~1 of water. The PCR
reaction was incubated at 94°C for 1.5 minutes, and then
run for 10 cycles each individual cycle being comprised
of 30 seconds at 94°C, 1 minute at 50°C and 1 minutes at
72°C. The reaction was ended with an incubation for 10.
minutes at 72°
This produced the following linker:
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
47
5' GTT TCG CCC AGC CAG GAA ATC CAT GCC GAG TTC CAA CGC
GGC CGT AGA GAG GAG TAT ATG CCT ATG GAG ATC GAG AAC AGC
CAG CTC ATG GAA CAG CTG CGG CTG CTG GTG TGC GAG AGG GCC
AGC CTG CTG CGC CAG GTA 3'(SEQ ID N0:20).
D) Glu-Glu Tagged Carboxy Terminus
A linker which would homologously recombine with the
5' end of the digested plasmid and the 3' end of the
Zalphal gene and which when the Zalphal gene was
expressed would attach a Glu-Glu tag onto the carboxy
terminus of Zalphal was produced as follows. 4 picomoles
of the sense oligonucleotide ZC16,486, 5' GAC GAA GAC
GAC GAC GAC GAA GAA GAG GAG GAT GAT TAT GAA GAA TAC ATG
CCC ATG GAA TAA 3'(SEQ ID N0:21) and 4 picomoles of the
antisense oligonucleotide ZC14,393 5' AT GCCACCCCAG
ATCCTCTAGA TTA TTC CAT GGG CAT GTA TTC TTC 3'(SEQ ID
N0:22) were added together in a PCR reaction mixture.
Also added to the reaction mixture were 400 picomoles of
the sense primer ZC16,027, 5' GAT GAG ATG AAA CAG TGC TTT
GGC TGG GAT GAC GAC GAA GAC GAC GAC GAC GAA 3'(SEQ ID
N0:12) and 400 picomoles of the antisense primer ZC14,395
5' GGCAC TGGGGAGGGG TCACAGGGAT GCCACCCCAG
ATCCTCTAGA 3'(SEQ ID N0:23). The PCR mixture for the
reaction further contained 40 ~.1 of lOX PCR buffer,8 ~1
EXTAG (both from Takara), 8 ~,1 of 2.5 mM nucleotide
triphosphate mix Takara) and 300 ~l of water. The PCR
reaction was incubated at 94°C for 1.5 minutes, and then
run for 10 cycles each individual cycle being comprised
of 30 seconds at 94°C, 1 minute at 50°C and 1 minutes at
72°C. The reaction was ended with an incubation for 10
minutes at 72°.
This produced the following oligonucleotide
linker:
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
48
5' GAT GAG ATG AAA CAG TGC TTT GGC TGG GAT GAC GAC GAA
GAC GAC GAC GAC GAA GAA GAG GAG GAT GAT TAT GAA GAA TAC
ATG CCC ATG GAA TAA TCTAGAGGAT CTGGGGTGGC ATCCCTGTGA
CCCCTCCCCA GTGCC 3'(SEQ ID N0:24)
Plasmid Assembly in Yeast
Following the procedure for plasmid assembly through
recombination of homologous DNA sequences in yeast, the
following three versions of zalphal are generated.
A) Untagged Version of zalphal
A mixture of 0.1 ~.g linear pCZR199, 1 mg full
length Zalphal cDNA, and about 1 ~.g of each of the
untagged amino terminus and untagged carboxy terminus
recombination linkers are mixed in a total volume of 10
ml. This mixture is used to transform competent yeast
cells (Saccharomyces cerevisiae). Plasmid DNA from the
successful transformations are transferred to E. coli ,
and the desired constructs were identified by DNA
sequence analysis. The plasmids can then be transfected
into mammalian cells such as Chinese Hamster Ovary (CHO)
cells.
B) Amino Terminal Glu-Glu Tagged Version of Zalphal
Same as above except the Glu-Glu tagged amino
terminus and untagged carboxy terminus
recombination linkers were used.
C) Carboxy Terminal Glu-Glu Tagged Version of
Zalphal
Same as above except the Glu-Glu tagged carboxy
terminus and untagged amino terminus
recombination linkers were used.
CA 02313464 2000-06-08
WO 99/Z9720 PCT/US98/26273
49
Example 6
Expression of Zalphal in Pichia methanolica
Homologous Recombination/ Zalphal
Expression of Zalphal in Pichia methanolica
utilizes the expression system described in co-assigned
PCT W0.97/17450 An expression plasmid containing all or
part of a polynucleotide encoding Zalphal is constructed
via homologous recombination. The expression vector is
built from pCZR204, which contains the AUG1 promoter,
followed by the aFpp leader sequence, followed by an
amino-terminal peptide tag, a blunt-ended SmaI '
restriction site, a carboxy-terminal peptide tag, a
translational STOP codon, followed by the AUG1
terminator, the ADE2 selectable marker, and finally the
AUGl 3' untranslated region. Also included in this vector
are the URA3 and CEN-ARS sequences required for selection
and replication in S. cerevisiae, and the AmpR and colEl
on sequences required for selection and replication in
E. coli. The Zalphal sequence inserted into this vector
begins at residue 27 (Ala) of the Zalphal amino acid
sequence.
In the present case three expression plasmids
were produced for expression of Zalphal in P.
methanolica. The plasmids are: one called the NEE-zalphal
construct produced a Zalphal polypeptide in which the N-
terminus was tagged with a Glu-Glu tag (SEQ ID N0:25),
one called the CEE-zalphal construct produced a Zalphal
polypeptide in which the C-terminus was tagged with a
Glu-Glu tag (SEQ ID N0:25) and one in which the Zalphal
was untagged. In each case two linkers were made for
producing each plasmid. One linker homologously
recombined with the 3'end of the digested plasmid and the
5' end of the Zalphal gene when transformed together with
the digested plasmid and the Zalphal gene in P.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
methanolica; the second linker would homologously
recombine with the 3' end of the Zalphal gene and the 5'
end of the digested plasmid when transformed together
with the digested plasmid and the Zalphal gene in P.
5 methanolica.
Construction of the NEE-Zalphal plasmid
The N-terminal-NEE-zalphal plasmid construct
10 which produces Zalphal tagged with a Glu-Glu tag at the
N-terminus, was made by recombining 100 ng of the SmaI,
digested pCZR204 acceptor vector, the 1 ~g of the EcoRI-
XhoI Zalphal cDNA donor fragment, the 1 ~g of the N-
terminal NEE-zalphal linker (SEQ ID NO: 35) and 1 ~g of
15 the C-terminal untagged linker (SEQ ID N0:36) in a P.
methanolica transformation.
The NEE-zalphal linker was synthesized by a PCR
reaction in which 4 picomoles of ZC13,497 (SEQ ID N0:28),
20 4 picomoles of ZC13,731 (SEQ ID NO: 29) 4 picomoles of
ZC16,023 (SEQ ID N0:30 and 4 picomoles of ZC16,028 (SEQ
ID NO:10) were placed in a PCR reaction mixture. The PCR
mixture for the reaction further contained 40 ~1 of lOX
PCR buffer,8 ~1 EXTAG (both from Takara), 8 ~.1 of 2.5 mM
25 nucleotide triphosphate mix Takara) and 300 ~1 of water.
The PCR reaction was incubated at 94°C for 1.5 minutes,
and then run for 10 cycles each individual cycle being
comprised of 30 seconds at 94°C, 1 minute at 50°C and 1
minutes at 72°C. The reaction was ended with an incubation
30 for 10 minutes at 72°. This produced the oligonucleotide
linker SEQ ID N0:35.
The C-terminal untagged Zalphal linker was made
by placing 4 picomoles of ZC13,734 (SEQ ID N0:31) 4
35 picomoles of ZC15,633 (SEQ ID N0:32) 400 picomoles of
oligonucleotide ZC16,025 (SEQ ID N0:33) and 400 picomoles
oligonucleotide ZC16,027 (SEQ ID N0:34)in a PCR mixture
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z62~3
51
identical to the above-described mixture and the PCR
reaction was run under the same conditions as above. This
produced the linker SEQ ID N0:36.
Construction of the CEE-Zalphal plasmid
The N-terminal untagged Zalphal linker was made
by mixing 4 picomoles of oligonucleotide (SEQ ID N0:37),
4 picomoles of oligonucleotide (SEQ ID N0:38), 400
picomoles of oligonucleotide (SEQ ID N0:39) and 400
picomoles of (SEQ ID NO:10) together in a PCR mixture
identical to the above-described PCR mixture and running
the PCR reaction as it was run above. This produced the
linker of SEQ ID N0:40. '
The C-terminal Zalphal-CEE linker was made by
mixing 4 picomoles of oligonucleotide (SEQ ID N0:41), 4
picomoles of oligonucleotide (SEQ ID N0:42), 400
picomoles of oligonucleotide (SEQ ID N0:43) 400 picomoles
of (SEQ ID NO: 12) and 400 picomoles of (SEQ ID N0:13
together in a PCR mixture identical to the above-
described PCR mixture and running the PCR reaction as was
done above. This produced the linker of SEQ ID N0:44.
The C-terminal-CEE-Zalphal plasmid construct
which expresses Zcytol0 tagged with a Glu-Glu tag at the
C-terminus, was made by recombining 100 ng of the SmaI
digested pCZR204 acceptor vector, the l~,g of the EcoRI-
XhoI zalphal cDNA donor fragment, 1 ~.g of the N-terminal
untagged zalphal linker (SEQ ID N0: 40) and 1 ~.g of the
C-terminal CEE-zalphal tagged linker (SEQ ID N0:44) in a
P. methanolica transformation.
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
52
Construction of the Untagcred Zalphal Exnressing
Construct
The untagged Zalphal.expressing construct was
made by recombining 100ng of the SmaI digested pCZR204
acceptor vector, 1 ~.g of the EcoRI-XhoI Zalphal cDNA
donor fragment, and 1 ~g of each of the two
recombinatorial linkers N-terminal untagged Zalphal
oligonucleotide (SEQ ID N0:40) and the C-terminal
untagged Zalphal oligonucleotid (SEQ ID N0:36) in a P.
methanolica transformation.
Each N-terminal PCR-generated, double-
stranded linker segment that spans 70 base pairs of the
aFpp coding sequence on one end and joins it to the 70
base pairs of the amino-terminus coding sequence from the
mature Zalphal sequence on the other. While each C-
terminus linker contains about 70 base pairs of carboxy
terminus coding sequence from Zalphal on one end with 70
base pairs of AUG1 terminator sequence. Ura+ colonies,
were selected, and DNA from the resulting yeast colonies
was extracted and transformed into E. coli. Individual
clones harboring the correct expression construct were
identified by PCR screening followed by restriction
digestion to verify the presence of the Zalphal insert
and DNA sequencing to confirm the desired DNA sequences
had been enjoined with one another. Larger scale plasmid
DNA is isolated for one of the correct clones, and the
DNA is digested with Sfi I to liberate the Pichia-Zalphal
expression cassette from the vector backbone. The Sfi I-
cut DNA is then transformed into a Pichia methanolica
expression host, designated PMAD16, and plated on ADE D
plates for selection. A variety of clones are picked and
screened via Western blot for high-level Zalphal
expression.
CA 02313464 2000-06-08
WO 99/29720 PGT/US98/26273
53
More specifically, for small-scale protein
production (e.g., plate or shake flask production), P.
methanolica transformants that carry an expression
cassette comprising a methanol-regulated promoter (such
as the AUG1 promoter) are grown in the presence of
methanol and the absence of interfering amounts of other
carbon sources (e. g., glucose). For small-scale
experiments, including preliminary screening of
expression levels, transformants may be grown at 30°C on
solid media containing, for example, 20 g/L Bacto-agar
(Difco), 6.7 g/L yeast nitrogen base without amino acids
(Difco), 10 g/L methanol, 0.4 mg/L biotin, and 0.56 g/L
of -Ade -Thr -Trp powder. Because methanol is a volatile
carbon source it is readily lost on prolonged incubation.
A continuous supply of methanol can be provided by
placing a solution of 50% methanol in water in the lids
of inverted plates, whereby the methanol is transferred
to the growing cells by evaporative transfer. In
general, not more than 1 ml of methanol is used per 100-
mm plate. Slightly larger scale experiments can be
carried out using cultures grown in shake flasks. In a
typical procedure, cells are cultivated for two days on
minimal methanol plates as disclosed above at 30°C, then
colonies are used to inoculate a small volume of minimal
methanol media (6.7 g/L yeast nitragen base without amino
acids, 10 g/L methanol, 0.4 mg/L biotin) at a cell
density of about 1 x 106 cells/ml. Cells are grown at
30°C. Cells growing on methanol have a high oxygen
requirement, necessitating vigorous shaking during
cultivation. Methanol is replenished daily (typically
1/100 volume of 50% methanol per day).
For production scale culturing, fresh cultures
of high producer clones are prepared in shake flasks.
The resulting cultures are then used to inoculate culture
medium in a fermenter. Typically, a 500 ml culture in
YEPD grown at 30°C for 1-2 days with vigorous agitation is
CA 02313464 2000-06-08
WO 99129720 PCT/US98/Z6273
54
used to inoculate a 5-liter fermenter. The cells are
grown in a suitable medium containing salts, glucose,
biotin, and trace elements at 28°C, pH 5.0, and >30%
dissolved 02. After the initial charge of glucose is
consumed (as indicated by a decrease in oxygen
consumption), a glucose/methanol feed is delivered into
the vessel to induce production of the protein of
interest. Because large-scale fermentation is carried
out under conditions of limiting carbon, the presence of
glucose in the feed does not repress the methanol-
inducible promoter.
CA 02313464 2000-06-08
WO 99/29720 PGTNS98/26273
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> Mammalian Alpha Helical Protein-1
<130> 97-71PC
<160> 56
<170> FastSEQ for Windows Version 3.0
<210>1
<211>907
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (95)...(532)
<400> 1
cctcgtgccg tggacacgca cttcctgcga gggctccgtg cgcaccttgg ccgagccgaa 60
ccgagccgag tcctgtcctt ccaggccgtt cgca atg gtg gat gag ttg gtg ctg 115
Met Val Asp Glu Leu Val Leu
1 5
ctg ctg cac gcg ctc ctg atg cgg cac cgc gcc ctg agc atc gag aac 163
Leu Leu His Ala Leu Leu Met Arg His Arg Ala Leu Ser Ile Glu Asn
15 20
agc cag ctc atg gaa cag ctg cgg ctg ctg gtg tgc gag agg gcc agc 211
Ser Gln Leu Met Glu Gln Leu Arg Leu Leu Val Cys Glu Arg Ala Ser
25 30 35
ctg ctg cgc cag gta cgt ccg ccg agc tgc ccg gtg ccc ttc ccc gaa 259
Leu Leu Arg Gln Val Arg Pro Pro Ser Cys Pro Val Pro Phe Pro Glu
40 45 50 55
acg ttt aat ggc gag agc tcc cgg ctc ccc gag ttt atc gtg cag acg 307
Thr Phe Asn Gly Glu Ser Ser Arg Leu Pro Glu Phe Ile Val Gln Thr
60 65 70
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
2
gcg tct tac atg ctc gtg aac gag aac cga ttc tgc aac gac gcc atg 355
Ala Ser Tyr Met Leu Val Asn Glu Asn Arg Phe Cys Asn Asp Ala Met
75 80 85
aag gtg gca ttc cta atc agc ctc ctc acc ggg gaa gcc gag gag tgg 403
Lys Val Ala Phe Leu Ile Ser Leu Leu Thr Gly Glu Ala Glu Glu Trp
90 95 100
gtg gtg ccc tac atc gag atg gat agc ccc atc cta ggt gat tac cgg 451
Val Val Pro Tyr Ile Glu Met Asp Ser Pro Ile Leu Gly Asp Tyr Arg
105 110 115
gcc ttc ctc gat gag atg aaa cag tgc ttt ggc tgg gat gac gac gaa 499
Ala Phe Leu Asp Glu Met Lys Gln Cys Phe Gly Trp Asp Asp Asp Glu
120 125 130 135
gac gac gac gac gaa gaa gag gag gat gat tat taggccctcg accctcgggc 552
Asp Asp Asp Asp Glu Glu Glu Glu Asp Asp Tyr
140 145
ctcgggggggagggccctgcamgccgccaccccctccccgcagccctcaccccgccagga612
gccactgctctcccccttgccctccggtccccttacctactcggagtgtcctcccctgcc672
ccaccagattgctgcaggggcgcggtgtgcctggcagccaaattgttgacacttcttttt732
tcctatgcactggttttacacagctgtcatttttctttcaaaattgcagcagtcccacag792
atgtgtgcatttggacaaatagtacttaaaaacaaaacaaacaagcactcagcccagctc852
ctcaatactacctggaaaaagcattggcattattttcaataaatatcaagcacta 907
<210>2
<211>146
<212>PRT
<213>Homo sapiens
<400> 2
Met Val Asp Glu Leu Val Leu Leu Leu His Ala Leu Leu Met Arg His
1 5 10 15
Arg Ala Leu Ser Ile Glu Asn Ser Gln Leu Met Glu Gln Leu Arg Leu
20 25 30
Leu Val Cys Glu Arg Ala Ser Leu Leu Arg Gln Val Arg Pro Pro Ser
35 40 45
Cys Pro Val Pro Phe Pro Glu Thr Phe Asn Gly Glu Ser Ser Arg Leu
50 55 60
Pro Glu Phe Ile Val Gln Thr Ala Ser Tyr Met Leu Val Asn Glu Asn
65 70 75 80
Arg Phe Cys Asn Asp Ala Met Lys Val Ala Phe Leu Ile Ser Leu Leu
85 90 95
CA 02313464 2000-06-08
WO 99/Z9720 PCTNS98n6273
3
Thr Gly Glu Ala Glu Glu Trp Val Val Pro Tyr Ile Glu Met Asp Ser
100 105 110
Pro Ile Leu Gly Asp Tyr Arg Ala Phe Leu Asp Glu Met Lys Gln Cys
115 120 125
Phe Gly Trp Asp Asp Asp Glu Asp Asp Asp Asp Glu Glu Glu Glu Asp
130 135 140
Asp Tyr
145
<210>3
<211>270
<212>DNA
<213>Homo sapiens
<400> 3
cctcgtgccg tggacacgca cttcctgcga gggctccgtg cgcaccttgg ccgagccgaa . 60
ccgagccgag tcctgtcctt ccaggccgtt cgcaatggtg gatgagttgg tgctgctgct 120
gcacgcgctc ctgatgcggc accgcgccct gagcatcgag aacagccagc tcatggaaca 180
gctgcggctg ctggtgtgcg agagggccag cctgctgcgc caggtacgtc cgccgagctg 240
cccggtgccc ttccccgaaa cgtttaatgg 270
<210> 4
<211> 18
<212> DNA
<213> Homo Sapiens
<400> 4
gcagcagtcc cacagatg 18
<2I0>5
<211>18
<212>DNA
<213>Homo Sapiens
<400> 5
tgggctgagt gcttgttt 18
<210>6
<211>45
<212>DNA
<213>Homo Sapiens
<400> 6
ctgctgtgtg gcgccgtctt cgtttcgccc agccaggaaa tccat 45
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
4
<210> 7
<211> 45
<212> DNA
<213> Homo Sapiens
<400> 7
tcgcccagcc aggaaatcca tgccgagttc caacgcggcc gtaga 45
<210> 8
<211> 45
<212> DNA
<213> Homo Sapiens
<400> 8
tcgcccagcc aggaaatcca tgccgagttc caacgcggcc gtaga 45
<210> 9
<211> 62
<212> DNA
<213> Homo Sapiens
<400> 9
cagcagccgc agctgttcca tgagctggct gttctcgatt ctacggccgc gttggaactc 60
gg 62
<210> 10
<211> 54
<212> DNA
<213> Homo sapiens
<400> 10
tacctggcgc agcaggctgg ccctctcgca caccagcagc cgcagctgtt ccat 54
<210> 11
<211> 141
<212> DNA
<213> Homo sapiens
<400> 11
ctgctgtgtg gcgccgtctt cgtttcgccc agccaggaaa tccatgccga gttccaacgc 60
ggccgtagaa tcgagaacag ccagctcatg gaacagctgc ggctgctggt gtgcgagagg 120
gccagcctgc tgcgccaggt a 141
<210> 12
<211> 54
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/Z6273
<212> DNA
<213> Homo Sapiens
<400> 12
gatgagatga aacagtgctt tggctgggat gacgacgaag acgacgacga cgaa 54
<210> 13
<211> 70
<212> DNA
<213> Homo Sapiens
<400> 13
gacgaagacg acgacgacga agaagaggag gatgattatt aatctagagg atctggggtg 60
gcatccctgt
<210> 14
<211> 46
<212> DNA
<213> Homo sapiens
<400> 14
caggagaggc actggggagg ggtcacaggg atgccacccc agatcc 46
<210> 15
<211> 46
<212> DNA
<213> Homo sapiens
<400> 15
ggcactggag tggcaacttc cagggccagg agaggcactg gggagg 46
<210> 16
<211> 153
<212> DNA
<213> Homo sapiens
<400> 16
gatgagatga aacagtgctt tggctgggat gacgacgaag acgacgacga cgaagaagag 60
gaggatgatt attaatctag aggatctggg gtggcatccc tgtgacccct ccccagtgcc 120
tctcctggcc ctggaagttg ccactccagt gcc 153
<210> 17
<211> 45
<212> DNA
<213> Homo Sapiens
CA 02313464 2000-06-08
WO 99/29720 PGT/US98/26273
6
<400> 17
gtttcgccca gccaggaaat ccatgccgag ttccaacgcg gccgt 45
<210> 18
<211> 44
<212> DNA
<213> Homo sapiens
<400> 18
ccgagttcca acgcggccgt agagaggagt atatgcctat ggag 44
<210> 19
<211> 66
<212> DNA
<213> Homo Sapiens
<400> 19
cagcagccgc agctgttcca tgagctggct gttctcgatc tccataggca tatactcctc 60
66
tctacg
<210> 20
<211> 141
<212> DNA
<213> Homo sapiens
<400> 20
gtttcgccca gccaggaaat ccatgccgag ttccaacgcg gccgtagaga ggagtatatg 60
cctatggaga tcgagaacag ccagctcatg gaacagctgc ggctgctggt gtgcgagagg 120
gccagcctgc tgcgccaggt a 141
<210> 21
<211> 63
<212> DNA
<213> Homo Sapiens
<400> 21
gacgaagacg acgacgacga agaagaggag gatgattatg aagaatacat gcccatggaa 60
taa 63
<210> 22
<211> 46
<212> DNA
<213> Homo Sapiens
CA 02313464 2000-06-08
WO 99/29720 PCT/IJS98/26273
7
<400> 22
atgccacccc agatcctcta gattattcca tgggcatgta ttcttc 46
<210> 23
<211> 45
<212> DNA
<213> Homo Sapiens
<400> 23
ggcactgggg aggggtcaca gggatgccac cccagatcct ctaga 45
<210> 24
<211> 141
<212> DNA
<213> Homo Sapiens
<400> 24
gatgagatga aacagtgctt tggctgggat gacgacgaag acgacgacga cgaagaagag 60
gaggatgatt atgaagaata catgcccatg gaataatcta gaggatctgg ggtggcatcc 120
ctgtgacccc tccccagtgc c 141
<210>25
<211>7
<212>PRT
<213>Homo Sapiens
<400> 25
Glu Glu Tyr Met Pro Met Glu
1 5
<210> 26
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 26
cgtaatacga ctcactatag ggcgaattgg 30
<210> 27
<211> 27
<212> DNA
<213> Homo sapiens
<400> 27
gaaacagcta tgaccatgat tacgcca 27
CA 02313464 2000-06-08
WO 99/29720 PCTNS98~26273
8
<210> 28
<211> 44
<212> DNA
<213> Homo sapiens
<400> 28
agcattgctg ctaaagaaga aggtgtaagc ttggacaaga gaga 44
<210> 29
<211> 51
<212> DNA
<213> Homo Sapiens
<400> 29
ggtgtaagct tggacaagag agaagaagaa tacatgccaa tggaaggtgg t 51
<210> 30
<211> 63
<212> DNA
<213> Homo sapiens
<400> 30
cagcagccgc agctgttcca tcagctggct gttctcgata ccaccttcca ttggcatgta 60
ttc 63
<210> 31
<211> 52
<212> DNA
<213> Homo sapiens
<400> 31
atcatagaag agaaaaacat tagttggcaa actctcaaaa attataaaaa to 52
<210> 32
<211> 51
<212> DNA
<213> Homo Sapiens
<400> 32
tggcaaactc tcaaaaatta taaaaatatc caaacaggca gccgaattct a 51
<210> 33
<211> 62
<212> DNA
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
9
<213> Homo Sapiens
<400> 33
gacgaagacg acgacgacga agaagaggag gatgattatt agaattcggc tgcctgtttg 60
ga 62
<210> 34
<211> 55
<212> DNA
<213> Homo Sapiens
<400> 34
gatgagatga aacagtgctt tggctgggat gacgacgaag acgacgacga cgaag 55
<210> 35
<211> 144
<212> DNA
<213> Homo sapiens
<400> 35
agcattgctg ctaaagaaga aggtgtaagc ttggacaaga gagaagaaga atacatgcca 60
atggaaggtg gtatcgagaa cagccagctc atggaacagc tgcggctgct ggtgtgcgag 120
agggccagcc tgctgcgcca ggta 144
<210>36
<211>147
<212>DNA
<213>Homo Sapiens
<400> 36
gatgagatga aacagtgctt tggctgggat gacgacgaag acgacgacga cgaagaagag 60
gaggatgatt attagaattc ggctgcctgt ttggatattt ttataatttt tgagagtttg 120
ccaactaatg tttttctctt ctatgat 147
<210>37
<211>40
<212>DNA
<213>Homo Sapiens
<400> 37
acggtttatt gtttatcaat actactattg ctagcattgc 40
<210> 38
<211> 62
<212> DNA
CA 02313464 2000-06-08
WO 99129720 PGTNS98/26273
<213> Homo sapiens
<400> 38
tcaatactac tattgctagc attgctgcta aagaagaagg tgtaagcttg gacaagagag 60
as 62
<210>39
<211>63
<212>DNA
<213>Homo Sapiens
<400> 39
cagcagccgc agctgttcca tgagctggct gttctcgatt tctctcttgt ccaagcttac 60
acc 63
<210> 40
<211> 144
<212> DNA
<213> Homo sapiens
<400> 40
ttattgttta tcaatactac tattgctagc attgctgcta aagaagaagg tgtaagcttg 60
gacaagagag aaatcgagaa cagccagctc atggaacagc tgcggctgct ggtgtgcgag 120
agggccagcc tgctgcgcca ggta 144
<210> 41
<211> 39
<212> DNA
<213> Homo sapiens
<400> 41
attataaaaa tatccaaaca ggcagcccta gaatactag 39
<210> 42
<211> 58
<212> DNA
<213> Homo sapiens
<400> 42
aacaggcagc cctagaatac taggaattct actccatagg catatactcc tcgcctcc 58
<210>43
<211>61
<212>DNA
<213>Homo sapiens
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
11
<400> 43
gacgaagacg acgacgacga agaagaggag gatgattatg gaggcgagga gtatatgcct 60
a 61
<210> 44
<211> 144
<212> DNA
<213> Homo Sapiens
<400> 44
gatgagatga aacagtgctt tggctgggat gacgacgaag acgacgacga cgaagaagag 60
gaggatgatt atggaggcga ggagtatatg cctatggagt agaattccta gtattctagg 120
gctgcctgtt tggatatttt tata 144
<210> 45
<211> 126
<212> PRT
<213> Homo sapiens
<400> 45
IleGluAsn SerGlnLeu MetGluGln LeuArgLeu LeuValCys Glu
1 5 10 15
ArgAlaSer LeuLeuArg GlnValArg ProProSer CysProVal Pro
20 25 30
PheProGlu ThrPheAsn GlyGluSer SerArgLeu ProGluPhe Ile
35 40 45
ValGlnThr AlaSerTyr MetLeuVal AsnGluAsn ArgPheCys Asn
50 55 60
AspAlaMet LysValAla PheLeuIle SerLeuLeu ThrGlyGlu Ala
65 70 75 80
GluGluTrp ValValPro TyrIleGlu MetAspSer ProIleLeu Gly
85 90 95
AspTyrArg AlaPheLeu AspGluMet LysGlnCys PheGlyTrp Asp
100 105 110
AspAspGlu AspAspAsp AspGluGlu GluGluAsp AspTyr
115 120 125
<210>46
<211>15
<212>PRT
<213>Homo sapiens
<400> 46
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
12
Asn Ser Gln Leu Met Glu Gln Leu Arg Leu Leu Ual Cys Glu Arg
1 5 10 15
<210>47
<211>15
<212>PRT
<213>Homo Sapiens
<400> 47
Phe Pro Glu Thr Phe Asn Gly Glu Ser Ser Arg Leu Pro Glu Phe
1 5 10 15
<210>48
<211>15
<212>PRT
<213>Homo Sapiens
<400> 48
Phe Cys Asn Asp Ala Met Lys Val Ala Phe Leu Ile Ser Leu Leu
1 5 10 15
<210>49
<211>15
<212>PRT
<213>Nomo Sapiens
<400> 49
Tyr Arg Ala Phe Leu Asp Glu Met Lys Gln Cys Phe Gly Trp Asp
1 5 10 15
<210>50
<211>45
<212>PRT
<213>Homo Sapiens
<400> 50
AsnSer LeuMet Glu Leu ArgLeu Leu Ual Cys Glu
Gln Gln Arg Ala
1 5 10 15
SerLeu ArgGln Val Pro ProSer Cys Pro Val Pro
Leu Arg Phe Pro
20 25 30
GluThr AsnGly Glu Ser ArgLeu Pro Glu Phe
Phe Ser
35 40 45
<210> 51
<211> 74
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
13
<212> PRT
<213> Homo sapiens
<400> 51
Asn Ser Gln Leu Met Glu Gln Leu Arg Leu Leu Val Cys Glu Arg Ala
1 5 10 15
Ser Leu Leu Arg Gln Val Arg Pro Pro Ser Cys Pro Val Pro Phe Pro
20 25 30
Glu Thr Phe Asn Gly Glu Ser Ser Arg Leu Pro Glu Phe Ile Val Gln
35 40 45
Thr Ala Ser Tyr Met Leu Val Asn Glu Asn Arg Phe Cys Asn Asp Ala
50 55 60
Met Lys Val Ala Phe Leu Ile Ser Leu Leu
65 70
<210>52
<211>110
<212>PRT
<213>Homo Sapiens
<400> 52
AsnSer GlnLeuMet GluGln LeuArgLeu LeuValCys GluArgAla
1 5 10 15
SerLeu LeuArgGln ValArg ProProSer CysProVal ProPhePro
20 25 30
GluThr PheAsnGly GluSer SerArgLeu ProGluPhe IleValGln
35 40 45
ThrAla SerTyrMet LeuVal AsnGluAsn ArgPheCys AsnAspAla
50 55 60
MetLys ValAlaPhe LeuIle SerLeuLeu ThrGlyGlu AlaGluGlu
65 70 75 80
TrpVal ValProTyr IleGlu MetAspSer ProIleLeu GlyAspTyr
85 90 95
ArgAla PheLeuAsp GluMet LysGlnCys PheGlyTrp Asp
100 105 110
<210>53
<211>44
<212>PRT
<213>Homo sapiens
<400> 53
Phe Pro Glu Thr Phe Asn Gly Glu Ser Ser Arg Leu Pro Glu Phe Ile
1 5 10 15
CA 02313464 2000-06-08
WO 99/29720 PCT/US98/26273
14
Val Gln Thr Ala Ser Tyr Met Leu Val Asn Glu Asn Arg Phe Cys Asn
20 25 30
Asp Ala Met Lys Val Ala Phe Leu Ile Ser Leu Leu
35 40
<210>54
<211>80
<212>PRT
<213>Homo sapiens
<400> 54
Phe Pro Glu Thr Phe Asn Gly Glu Ser Ser Arg Leu Pro Glu Phe Ile
1 5 10 15
Val Gln Thr Ala Ser Tyr Met Leu Val Asn Glu Asn Arg Phe Cys Asn
20 25 30
Asp Ala Met Lys Val Ala Phe Leu Ile Ser Leu Leu Thr Gly Glu Ala
35 40 45
Glu Glu Trp Val Val Pro Tyr Ile Glu Met Asp Ser Pro Ile Leu Gly
50 55 60
Asp Tyr Arg Ala Phe Leu Asp Glu Met Lys Gln Cys Phe Gly Trp Asp
65 70 75 80
<210>55
<211>51
<212>PRT
<213>Homo sapiens
<400> 55
Phe Cys Asn Asp Ala Met Lys Val Ala Phe Leu Ile Ser Leu Leu Thr
1 5 10 15
Gly Glu Ala Glu Glu Trp Val Val Pro Tyr Ile Glu Met Asp Ser Pro
20 25 30
Ile Leu Gly Asp Tyr Arg Ala Phe Leu Asp Glu Met Lys Gln Cys Phe
35 40 45
Gly Trp Asp
<210>56
<211>65
<212>PRT
<213>Homo sapiens
<400> 56
Phe Cys Asn Asp Ala Met Lys Val Ala Phe Leu Ile Ser Leu Leu Thr
1 5 10 15
<210>52
<211>110
<212>PRT
<213>Homo Sapiens
<400> 52
CA 02313464 2000-06-08
WO 99/29720 PCT/US98126273
Gly Glu Ala Glu Glu Trp Val Val Pro Tyr Ile Glu Met Asp Ser Pro
25 30
Ile Leu Gly Asp Tyr Arg Ala Phe Leu Asp Glu Met Lys Gln Cys Phe
35 40 45
Gly Trp Asp Asp Asp Glu Asp Asp Asp Asp Glu Glu Glu Glu Asp Asp
50 55 60
Tyr
