Note: Descriptions are shown in the official language in which they were submitted.
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
RECEPTOR TYROSINE ICINASE, AR-1, IS A REGULATOR OF ANGIOGENESIS
Throughout this application various publications are referenced. The
disclosures of these publications in their entireties are hereby
s incorporated by reference into this application.
INTRO'~pUCTION
The present invention relates generally to the field of genetic
t o engineering and more particularly to genes for receptor tyrosine
kinases and their cognate ligands, their insertion into recombinant DNA
vectors, and the production of the encoded proteins in recipient strains
of microorganisms and recipient eukaryotic cells. More specifically,
the present invention is directed to a novel human factor which is
t s believed to be a regulator of angiogenesis and is therefore designated
AR-1, as well as to methods of making and using the novel factor. The
invention further provides nucleic acid sequences encoding human AR-1,
and methods for the production of the nucleic acids and the gene
products. The novel AR-1 is believed to be a regulator of angiogenesis
2 o and thus the factor, as well as nucleic acids encoding it, may be useful
in the diagnosis and treatment of certain diseases such as neoplastic
diseases involving tumor angiogenesis, wound healing, thromboembolic
diseases, atherosclerosis and inflammatory diseases.
2 5 DACKGROUND OF THE INVENTION
The cellular behavior responsible for the development, maintenance,
and repair of differentiated cells and tissues is regulated, in large
1
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
part, by intercellular signals conveyed via growth factors and similar
ligands and their receptors. The receptors are located on the cell
surface of responding cells and they bind peptides or polypeptides
known as growth factors as well as other hormone-like ligands. The
s results of this interaction are rapid biochemical changes in the
responding cells, as well as a rapid and a long-term readjustment of
cellular gene expression. Several receptors associated with various
cell surfaces may bind specific growth factors.
The phosphorylation of tyrosine residues in proteins by tyrosine
kinases is one of the key modes by which signals are transduced across
the plasma membrane. Several currently known protein tyrosine kinase
genes encode transmembrane receptors for polypeptide growth factors
and hormones such as epidermal growth factor (EGF), insulin, insulin-
~ s like growth factor-I (IGF-I), platelet derived growth factors (PDGF-A
and -B), and fibroblast growth factors (FGFs). (Heldin et al., Cell
Regulation, 1: 555-566 (1990); Ullrich, et al., Cell, 61: 243-54 {1990)).
In each instance, these growth factors exert their action by binding to
the extracellular portion of their cognate receptors, which leads to
2 o activation of the intrinsic tyrosine kinase present on the cytoplasmic
portion of the receptor. Growth factor receptors of endothelial cells
are of particular interest due to the possible involvement of growth
factors in several important physiological and pathological processes,
such as vasculogenesis, angiogenesis, atherosclerosis, and
2 s inflammatory diseases. (Folkman, et al. Science, 235: 442-447 (1987)).
Also, the receptors of several hematopoietic growth factors are
tyrosine kinases; these include c-fms, which is the colony stimulating
factor 1 receptor, Sherr, et al., Cell, 41: 665-676 (1985), and c-kit, a
2
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/Z6800
primitive hematopoietic growth factor receptor reported in Huang, et
al., Cell, 63: 225-33 (1990).
The receptor tyrosine kinases have been divided into evolutionary
s subfamilies based on the characteristic structure of their ectodomains.
(Ullrich, et al. Cell, 61: 243-54 {1990)). Such subfamilies include, EGF
receptor-like kinase (subclass I) and insulin receptor-like kinase
{subclass II), each of which contains repeated homologous cysteine-
rich sequences in their extracellular domains. A single cysteine-rich
region is also found in the extracellular domains of the eph-like
kinases. Hirai, et al., Science, 238: 1717-1720 (1987); Lindberg, et al.
Mol. Cell. Biol., 10: 6316-24 (1990); Lhotak, et al., Mol. Cell. Biol. 11:
2496-2502 (1991 ). PDGF receptors as well as c-fms and c-kit receptor
tyrosine kinases may be grouped into subclass III; while the FGF
1 s receptors form subclass IV. Typical for the members of both of these
subclasses are extracellular folding units stabilized by intrachain
disulfide bonds. These so-called immunoglobulin (Ig)-like folds are
found in the proteins of the immunoglobulin superfamily which contains
a wide variety of other cell surface receptors having either cell-bound
20 or soluble ligands. Williams, et al., Ann. Rev. Immunol., 6: 381-405
(1988).
Receptor tyrosine kinases differ in their specificity and affinity. In
general, receptor tyrosine kinases are glycoproteins which consist of
25 (1) an extracellular domain capable of binding the specific growth
factor(s); (2) a transmembrane domain which usually is an alpha-
helical portion of the protein; (3) a juxtamembrane domain where the
receptor may be regulated by, e.g., protein phosphorylation; (4) a
3
CA 02313804 2000-06-08
WO 99/32639 PCTNS9812G800
tyrosine kinase domain which is the enzymatic component of the
receptor; and (5) a carboxyterminal tail which in many receptors is
involved in recognition and binding of the substrates for the tyrosine
kinase.
Processes such as alternative exon splicing and alternative choice of
gene promoter or polyadenylation sites have been reported to be capable
of producing several distinct polypeptides from the same gene. These
polypeptides may or may not contain the various domains listed above.
1 o As a consequence, some extracellular domains may be expressed as
separate, secreted proteins and some forms of the receptors may lack
the tyrosine kinase domain and contain only the extracellular domain
inserted in the plasma membrane via the transmembrane domain plus a
short carboxyl terminal tail.
A gene encoding an endothelial cell transmembrane tyrosine kinase,
originally identified by RT-PCR as an unknown tyrosine kinase-
homologous cDNA fragment from human leukemia cells, was described
by Partanen, et al., Proc. Natl. Acad. Sci. USA, 87: 8913-8917 (1990).
2o This gene and its encoded protein are called "TIE" which is an
abbreviation for "tyrosine kinase with Ig and EGF homology domains."
Partanen, et al. Mol. Cell. Biol. 12: 1698-1707 (1992).
It has been reported that tie mRNA is present in all human fetal and
2 5 mouse embryonic tissues. Upon inspection, tie message has been
localized to the cardiac and vascular endothelial cells. Specifically,
tie mRNA has been localized to the endothelia of blood vessels and
endocardium of 9.5 to 18.5 day old mouse embryos. Enhanced ie
4
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
expression was shown during neovascularization associated with
developing ovarian follicles and granulation tissue in skin wounds.
Korhonen, et al. Blood 80: 2548-2555 (1992). Thus the TIEs have been
suggested to play a role in angiogenesis, which is important for
developing treatments for solid tumors and several other angiogenesis-
dependent diseases such as diabetic retinopathy, psoriasis,
atherosclerosis and arthritis.
Two structurally related rat TIE receptor proteins have been reported
~ o to be encoded by distinct genes with related profiles of expression.
One gene, termed tie-1, is the rat homolog of human ~. Maisonpierre,
et al., Oncogene 8: 1631-1637 (1993). The other gene, ~-2, may be the
rat homolog of the murine tP gene which, like ~jg, has been reported to
be expressed in the mouse exclusively in endothelial cells and their
~ 5 presumptive progenitors. Dumont, et al. Oncogene 8: 1293-1301 (1993).
The human homolog of ~-2 is described in Ziegler, U.S. Patent No.
5,447,860 which issued on September 5, 1995 (wherein it is referred
to as "ork"), which is incorporated in its entirety herein.
2 o Both genes were found to be widely expressed in endothelial cells of
embryonic and postnatal tissues. Significant levels of tie-2
transcripts were also present in other embryonic cell populations,
including fens epithelium, heart epicardium and regions of mesenchyme.
Maisonpierre, et al., Oncogene 8: 1631-1637 (1993).
The predominant expression of the TIE receptor in vascular endothelia
suggests that TIE plays a role in the development and maintenance of
the vascular system. This could include roles in endothelial cell
5
CA 02313804 2000-06-08
WO 99/32639 PCTNS98l26800
determination, proliferation, differentiation and cell migration and
patterning into vascular elements. Analyses of mouse embryos
deficient in TIE-2 illustrate its importance in angiogenesis,
particularly for vascular network formation in endothelial cells. Sato,
s T.N., et al., Nature 376:70-74 (1995). In the mature vascular system,
the TIEs could function in endothelial cell survival, maintenance and
response to pathogenic influences.
The TIE receptors are also expressed in primitive hematopoietic stem
cells, B cells and a subset of megakaryocytic cells, thus suggesting the
role of ligands which bind these receptors in early hematopoiesis, in
the differentiation and/or proliferation of B cells, and in the
megakaryocytic differentiation pathway. Iwama, et al. Biochem.
Biophys. Research Communications 195:301-309 (1993); Hashiyama, et
i 5 al. Blood 87:93-101 (1996), Batard, et al. Blood 87:2212-2220 (1996).
Applicants previously identified an angiogenic factor, which was
originally called TIE-2 ligand-1 (TL1 ) but is also referred to as
angiopoietin-1 (Ang1 ), that signals through the TIE-2 receptor and is
2 o essential for normal vascular development in the mouse. By homology
screening applicants have also identified an Ang1 relative, termed TIE-
2 ligand-2 (TL2) or angiopoietin-2 (Ang2), that is a naturally occurring
antagonist for Ang1 and the TIE2 receptor. For a description of the
cloning and sequencing of TL1 (Ang1 ) and TL2 (Ang2) as well as for
2 5 methods of making and uses thereof, reference is hereby made to PCT
International Publication No. WO 96/11269 published i 8 April 1996 and
PCT International Publication No. WO 96/31598 published 10 October
1996 both in the name of Regeneron Pharmaceuticals, Inc.; and S. Davis,
6
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
et al., Cell 87: 1161-1169 (1996) each of which is hereby incorporated
by reference. The absence of Ang1 causes severe vascular
abnormalities in the developing mouse embryo. C. Suri, et al., Cell 87:
1171-1180 (1996). Ang1 and Ang2 provide for naturally occurring
s positive and negative regulators of angiogenesis. Positive or negative
regulation of TIE2 is likely to result in different outcomes depending on
the combination of simultaneously acting angiogenic signals.
Applicants have previously identified a family of several related
1 o angiogenic factors. These have been designated TIE-2 ligand-1 (TL1 )
also referred to as angiopoietin-1 (Ang1 ); TIE-2 ligand-2 (TL2) or
angiopoietin-2 (Ang2); Tie ligand-3 (TL3) and Tie ligand-4 (TL4). For
descriptions of the structure and functional properties of these four
related factors, reference is hereby made to the following publications,
~ s each of which is hereby incorporated by reference: U.S. Patent No.
5,643,755, issued 7/1 /97 to Davis, et al.; U.S. Patent No. 5,521,073,
issued 5/28/96 to Davis, et al.; U.S. Patent No. 5,650,490, issued
7/22/97 to Davis, et al.; U.S. Serial No. 08/348,492, filed 12/2/94, now
allowed, date of allowance 8/29/97; U.S. Serial No. 08/418,595, filed
20 4/6/95, now allowed, date of allowance 11/26/96; U.S. Serial No.
08/665,926, filed 6/19/96, now allowed, date of allowance 12/9/97;
PCT International Application No. PCT/US95/12935, filed Oct. 6, 1995,
published on April 18, 1996, with Publication No. WO 96/11269; and
PCT International Application No. PCT/US96/04806, filed April 5,
2 5 1996, published on October 10, 1996, with Publication No.
W096/31598, both PCT applications in the name of Regeneron
Pharmaceuticals, Inc.
7
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
SUMMARY OF THE INVENTION
The present invention provides for a composition comprising human AR-
1 substantially free of other proteins. The invention also provides for
s an isolated nucleic acid molecule encoding human AR-1 The isolated
nucleic acid may be DNA, cDNA or RNA. The invention also provides for
a vector comprising an isolated nucleic acid molecule encoding human
AR-1. The invention further provides for a host-vector system for the
production in a suitable host cell of a polypeptide having the biological
~ o activity of human AR-1. The suitable host cell may be bacterial, yeast,
insect or mammalian. The invention also provides for a method of
producing a polypeptide having the biological activity of human AR-1
which comprises growing cells of the host-vector system under
conditions permitting production of the polypeptide and recovering the
~ s polypeptide so produced.
The invention herein described of an isolated nucleic acid molecule
encoding human AR-1 further provides for the development of the
ligand, a fragment or derivative thereof, or another molecule which is a
2 o receptor agonist or antagonist, as a therapeutic for the treatment of
patients suffering from disorders involving cells, tissues or organs
which express the human AR-1 receptor. The present invention also
provides for an antibody which specifically binds such a therapeutic
molecule. The antibody may be monoclonal or polyclonal. The invention
2 5 also provides for a method of using such a monoclonal or polyclonal
antibody to measure the amount of the therapeutic molecule in a sample
taken from a patient for purposes of monitoring the course of therapy.
8
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
The present invention also provides for an antibody which specifically
binds human AR-1. The antibody may be monoclonal or polyclonal. Thus
the invention further provides for compositions comprising an antibody
s which specifically binds human AR-1 and a vehicle.
The invention further provides for compositions comprising . human AR-
1 in a vehicle. The invention also provides for a method of regulating
angiogenesis in a patient by administering an effective amount of a
t o composition comprising human AR-1 in a vehicle.
Alternatively, the invention provides that human AR-1 may be
conjugated to a cytotoxic agent and a composition prepared therefrom.
15 Biologically active AR-1 may be used to promote the growth, survival,
migration, and/or differentiation and/or stabilization or
destabilization of cells expressing its receptor. Biologically active
AR-1 may be used for the in vi ro maintenance of AR-1 receptor
expressing cells in culture. Alternatively, AR-1 may be used to support
2 o cells which are engineered to express its receptor. Further, the AR-1
and its receptor may be used in assay systems to identify agonists or
antagonists of the receptor.
BRIEF DESCRIPTION OF THE FIGURE
FIGURE 1 A-1 B - Nucleotide and deduced amino acid (single letter code)
sequences of TIE ligand-3. The coding sequence starts at position 47.
The fibrinogen-like domain starts at position 929.
9
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
FIGURE 2 - Comparison of Amino Acid Sequences of TIE Ligand Family
Members. mAng3 = mTL3 = mouse TIE ligand-3; hAng4 = hTL4 = human
TIE ligand-4; hAng1 = hTL1 = human TIE-2 ligandl; mAng1 = mTL1 =
mouse TIE-2 ligand 1; mAng2 = mTL2 = mouse TIE-2 ligand 2; hAng2 =
hTL2 = human TIE-2 ligand 2. The underlined regions indicate conserved
regions of homology among the family members.
FIGURE 3A-3C - Nucleotide and deduced amino acid (single letter code)
sequences of TIE ligand-4. Arrow indicates nucleotide position 569.
FIGURE 4A-4B - Nucleotide and deduced amino acid (triple letter code)
sequences of Human AR-1.
~ 5 DETAILED DESCRIPTION OF THE INVENTION
As described in greater detail below, applicants have isolated and
identified a novel factor related to the TIE-2 ligands that bind the TIE-
2 receptor. The novel factor is referred to herein as human AR-1. The
2 o TIE ligand family members are referred to herein as TIE-2 ligand 1
(TL1 ) also known as angiopoietin-1 (Ang1 ); TIE-2 ligand 2 (TL2) also
known as angiopoietin-2 (Ang2); TIE ligand-3; and TIE ligand-4. The
novel factor is expected to have a function and utility similar to that of
the known TIE-2 Iigands.
The present invention comprises novel nucleic acids and their deduced
amino acid sequences, as well as functionally equivalent variants
thereof comprising naturally occurring allelic variations, as well as
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
proteins or peptides comprising substitutions, deletions or insertional
mutants of the described sequences, which retain biological activity.
Such variants include those in which amino acid residues are
substituted for residues within the sequence resulting in a silent
change. For example, one or more amino acid residues within the
sequence can be substituted by another amino acid{s) of a similar
polarity which acts as a functional equivalent, resulting in a silent
alteration. Substitutes for an amino acid within the sequence may be
selected from other members of the class to which the amino acid
belongs. For example, the class of nonpolar {hydrophobic) amino acids
include alanine, ieucine, isoleucine, valine, proline, phenylalanine,
tryptophan and methionine. The polar neutral amino acids include
glycine, serine, threonine, cysteine, tyrosine, asparagine, and
glutamine. The positively charged (basic) amino acids include arginine,
lysine and histidine. The negatively charged (acidic) amino acids
include aspartic acid and glutamic acid.
Also included within the scope of the invention are proteins or
fragments or derivatives thereof which exhibit the same or similar
2 o biological activity as the human AR-1 described herein, and derivatives
which are differentially modified during or after translation, eTa., by
glycosylation, proteolytic cleavage, linkage to an antibody molecule or
other cellular ligand. Functionally equivalent molecules also include
molecules that contain modifications, including N-terminal
2 5 modifications, which result from expression in a particular
recombinant host, such as, for example, N-terminal methylation which
occurs in certain bacterial (e.g_ E. coli) expression systems. Functional
equivalents also include mutants in which amino acid substitutions are
11
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
made for cysteine molecules to improve stability of the molecules and
to prevent unwanted crosslinking.
The present invention also encompasses the nucleotide sequence that
s encodes the protein described herein as human AR-1, as well as host
cells, including yeast, bacteria, viruses, and mammalian cells, which
are genetically engineered to produce the protein, by eTa. transfection,
transduction, infection, electroporation, or microinjection of nucleic
acid encoding the human AR-1 described herein in a suitable expression
vector. The present invention also encompasses introduction of the
nucleic acid encoding human AR-1 through gene therapy techniques such
as is described, for example, in Finkel and Epstein FASEB J. 9:843-851
(1995); Gunman, et al. PNAS (USA) 91:10732-10736 (1994).
j s One skilled in the art will also recognize that the present invention
encompasses DNA and RNA sequences that hybridize to a human AR-1
encoding sequence, under stringent conditions. The invention also
provides for nucleic acid hybridization probes and
replication/amplification primers having a human AR-1 DNA specific
2 o sequence and sufficient to effect specific hybridization with human
AR-1. Demonstrating specific hybridization generally requires
stringent conditions, for example, hybridizing in a buffer comprising
30% formamide in 5 x SSPE (0.18 M NaCI, 0.01 M NaP04, pH7.7, 0.001 M
EDTA) buffer at a temperature of 42°C and remaining bound when
2 s subject to washing at 42°C with 0.2 x SSPE; preferably hybridizing
in a
buffer comprising 50% formamide in 5 x SSPE buffer at a temperature
of 42°C and remaining bound when subject to washing at 42°C with
0.2x
SSPE buffer at 42°C. Human AR-1 homologs can also be distinguished
12
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
from other polypeptides using alignment algorithms, such as BLASTX
(Altschul, et al. (1990) Basic Local Alignment Search Tool, J. Mol. Biol.
215: 403-410).
Thus, a nucleic acrd molecule contemplated by the invention includes
one having a sequence deduced from an amino acid sequence of a human
AR-1 prepared as described herein, as well as a molecule having a
sequence of nucleic acids that hybridizes to such a nucleic acid
sequence, and also a nucleic acid sequence which is degenerate of the
1 o above sequences as a result of the genetic code, but which encodes a
human AR-1 and which has an amino acid sequence and other primary,
secondary and tertiary characteristics that are sufficiently duplicative
of the human AR-1 described herein so as to confer on the molecule the
same biological activity as the human AR-1 described herein.
Accordingly, the present invention encompasses an isolated and
purified nucleic acid molecule comprising a nucleotide sequence
encoding a human AR-1, wherein the nucleotide sequence is selected
from the group consisting of:
2 0 (a) the nucleotide sequence comprising the coding region of
human AR-1 as set forth in Figure 4A-4B;
(b) a nucleotide sequence that hybridizes under stringent
conditions to the nucleotide sequence of (a); and
(c) a nucleotide sequence which differs from the sequence of
2 5 (a) or (b) due to the degeneracy of the genetic code.
The present invention further provides for an isolated human AR-1
encoded by an isolated nucleic acid molecule of the invention. The
13
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
invention also provides for a vector which comprises an isolated
nucleic acid molecule comprising a nucleic acid sequence encoding
human AR-1.
s Any of the methods known to one skilled in the art for the insertion of
DNA fragments into a vector may be used to construct expression
vectors encoding human AR-1 using appropriate
transcriptional/translational control signals and the protein coding
sequences. These methods may include i~ v' ro recombinant DNA and
~ o synthetic techniques and in vivo recombinations (genetic
recombination). Expression of a nucleic acid sequence encoding human
AR-1 or peptide fragments thereof may be regulated by a second nucleic
acid sequence which is operably linked to the human AR-1 encoding
sequence such that the human AR-1 protein or peptide is expressed in a
15 host transformed with the recombinant DNA molecule. For example,
expression of human AR-1 described herein may be controlled by any
promoter/enhancer element known in the art. Promoters which may be
used to control expression of the ligand include, but are not limited to
the long terminal repeat as described in Squinto et al., (Cell X5:1-20
2 0 (1991 )); the SV40 early promoter region (Bernoist and Chambon, Nature
2~Q:304-310), the CMV promoter, the M-MuLV 5' terminal repeat, the
promoter contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto, et al., Cell 22:787-797 (1980)), the herpes thymidine
kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:144-1445
2 s (1981 )), the adenovirus promoter, the regulatory sequences of the
metallothionein gene (Brinster et al., Nature 296:39-42 (1982));
prokaryotic expression vectors such as the ~i-lactamase promoter
(Villa-Kamaroff, et al., Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731
14
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
(1978)), or the ac promoter (DeBoer, et al., Proc. Natl. Acad. Sci. U.S.A.
x:21-25 (1983)), see also "Useful proteins from recombinant bacteria"
in Scientific American, 242:74-94 (1980); promoter elements from
yeast or other fungi such as the Gal 4 promoter, the ADH (alcohol
dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter,
alkaline phosphatase promoter, and the following animal
transcriptional control regions, which exhibit tissue specificity and
have been utilized in transgenic animals; elastase I gene control region
which is active in pancreatic acinar cells (Swift et al., Cell ~$:639-
~ 0 646 (1984); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol. ~Q:399-
409 (1986); MacDonald, Hepatology 7:425-515 (1987); insulin gene
control region which is active in pancreatic beta cells [Hanahan, Nature
x:115-122 (1985)]; immunoglobulin gene control region which is
active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658;
1 5 Adames et al., 1985, Nature x,1$:533-538; Alexander et al., 1987, Mol.
Cell. Biol. 7:1436-1444), mouse mammary tumor virus control region
which is active in testicular, breast, lymphoid and mast cells (Leder et
al., 1986, Cell X5:485-495), albumin gene control region which is
active in liver (Pinkert et al., 1987, Genes and Devel. 1_:268-276),
2 o alpha-fetoprotein gene control region which is active in liver (Krumlauf
et al., 1985, Mol. Cell. Biol. x:1639-1648; Hammer et al., 1987, Science
2 5:53-58); alpha 1-antitrypsin gene control region which is active in
the liver (Kelsey et al, 1987, Genes and Devel. 1:161-171 ), beta-globin
gene control region which is active in myeloid cells (Mogram et al.,
2 s 1985, Nature 3:338-340; Kollias et al., 1986, Cell 4~F:89-94); myelin
basic protein gene control region which is active in oligodendrocytes in
the brain (Readhead et al., 1987, Cell 48:703-712); myosin light chain-
2 gene control region which is active in skeletal muscle (Shani, 1985,
CA 02313804 2000-06-08
WO 99/32639 PCTNS98IZ6800
Nature x_4:283-286), and gonadotropic releasing hormone gene control
region which is active in the hypothalamus (Mason et al., 1986, Science
x:1372-1378). The invention further encompasses the production of
antisense compounds which are capable of specifically hybridizing with
a sequence of RNA encoding TIE ligand-3 or TIE ligand-4 to modulate its
expression. Ecker, U.S. Patent No. 5,166,195, issued November 24, 1992.
Thus, according to the invention, expression vectors capable of being
replicated in a bacterial or eukaryotic host comprising a nucleic acid
i o encoding human AR-1 as described herein, are used to transfect a host
and thereby direct expression of such nucleic acid to produce human
AR-1, which may then be recovered in a biologically active form. As
used herein, a biologically active form includes a form capable of
causing a biological response such as a differentiated function or
~ s influencing the phenotype of a cell expressing the receptor for human
AR-1.
Expression vectors containing the gene inserts can be identified by four
general approaches: (a) DNA-DNA hybridization, (b) presence or absence
2 0 of "marker" gene functions, (c) expression of inserted sequences and (d)
PCR detection. In the first approach, the presence of a foreign gene
inserted in an expression vector can be detected by DNA-DNA
hybridization using probes comprising sequences that are homologous
to an inserted human AR-1 encoding gene. In the second approach, the
2 5 recombinant vector/host system can be identified and selected based
upon the presence or absence of certain "marker" gene functions (e.g_,
thymidine kinase activity, resistance to antibiotics, transformation
phenotype, occlusion body formation in baculovirus, etc.) caused by the
16
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
insertion of foreign genes in the vector. For example, if a nucleic acid
encoding a human AR-1 is inserted within the marker gene sequence of
the vector, recombinants containing the insert can be identified by the
absence of the marker gene function. In the third approach,
recombinant expression vectors can be identified by assaying the
foreign gene product expressed by the recombinant. Such assays can be
based, for example, on the physical or functional properties of a human
AR-1 gene product, for example, by binding of the human AR-1 to its
receptor or a portion thereof which may be tagged with, for example, a
detectable antibody or portion thereof or by binding to antibodies
produced against the human AR-1 protein or a portion thereof. Cells of
the present invention may transiently or, preferably, constitutively and
permanently express human AR-1 as described herein. In the fourth
approach, DNA nucleotide primers can be prepared corresponding to a
1 5 human AR-1 specific DNA sequence. These primers could then be used
to PCR a human AR-1 gene fragment. (PCR Protocols: A Guide To Methods
and Applications, Edited by Michael A. Innis et al., Academic Press
( 1990)).
2 o The recombinant human AR-1 may be purified by any technique which
allows for the subsequent formation of a stable, biologically active
protein. Preferably, the ligand is secreted into the culture medium
from which it is recovered. Alternatively, the human AR-1 may be
recovered from cells either as soluble proteins or as inclusion bodies,
2 s from which it may be extracted quantitatively by 8M guanidinium
hydrochloride and dialysis in accordance with well known methodology.
In order to further purify the human AR-1, affinity chromatography,
conventional ion exchange chromatography, hydrophobic interaction
17
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
chromatography, reverse phase chromatography or gel filtration may be
used.
In additional embodiments of the invention, a recombinant AR-1
s encoding gene may be used to inactivate or "knock out" the endogenous
gene by homologous recombination, and thereby create an AR-1
deficient cell, tissue, or animal. For example, and not by way of
limitation, the recombinant AR-1 encoding gene may be engineered to
contain an insertional mutation, for example the neo gene, which would
inactivate the native AR-1 encoding gene. Such a construct, under the
control of a suitable promoter, may be introduced into a cell, such as an
embryonic stem cell, by a technique such as transfection, transduction,
or injection. Cells containing the construct may then be selected by
6418 resistance. Cells which lack an intact AR-1 gene may then be
~ s identified, era. by Southern blotting, PCR detection, Northern blotting or
assay of expression. Cells lacking an intact AR-1 encoding gene may
then be fused to early embryo cells to generate transgenic animals
deficient in such ligand. Such an animal may be used to define specific
in vivo processes, normally dependent upon the factor.
The present invention also provides for antibodies to human AR-1
described herein which are useful for detection of the factor in, for
example, diagnostic applications. For preparation of monoclonal
antibodies directed toward human AR-1, any technique which provides
2 ~ for the production of antibody molecules by continuous cell lines in
culture may be used. For example, the hybridoma technique originally
developed by Kohler and Milstein (1975, Nature x:495-497), as well
as the trioma technique, the human B-cell hybridoma technique (Kozbor
18
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/Z6800
et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique
to produce human monoclonal antibodies (Cole et al., 1985, in
"Monoclonal Antibodies and Cancer Therapy," Alan R. Liss, Inc. pp. 77-
96) and the like are within the scope of the present invention.
The monoclonal antibodies may be human monoclonal antibodies or
chimeric human-mouse (or other species) monoclonal antibodies.
Human monoclonal antibodies may be made by any of numerous
techniques known in the art (eTa., Teng et al., 1983, Proc. Natl. Acad. Sci.
1 o U.S.A. 80:7308-7312; Kozbor et al., 1983, Immunology Today 4:72-79;
Olsson et al., 1982, Meth. Enzymol. 92:3-16). Chirneric antibody
molecules may be prepared containing a mouse antigen-binding domain
with human constant regions (Morrison et al., 1984, Proc. Natl. Acad.
Sci. U.S.A. 81:6851, Takeda et al., 1985, Nature 314:452).
Various procedures known in the art may be used for the production of
polyclonal antibodies to epitopes of human AR-1. For the production of
antibody, various host animals, including but not limited to rabbits,
mice and rats can be immunized by injection with human AR-1, or a
2 o fragment or derivative thereof. Various adjuvants may be used to
increase the immunological response, depending on the host species,
and including but not limited to Freund's (complete and incomplete),
mineral gels such as aluminum hydroxide, surface active substances
such as lysolecithin, pluronic polyols, polyanions, peptides, oil
2 s emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially
useful human adjuvants such as BCG (Bacille Calmette-Guerin) and
Corvnebacterium parvum.
19
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
A molecular clone of an antibody to a selected human AR-1 epitope can
be prepared by known techniques. Recombinant DNA methodology (see
e__g,_, Maniatis et al., 1982, Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York) may be used to
construct nucleic acid sequences which encode a monoclonal antibody
molecule, or antigen binding region thereof.
The present invention provides for antibody molecules as well as
fragments of such antibody molecules. Antibody fragments which
~ o contain the idiotype of the molecule can be generated by known
techniques. For example, such fragments include but are not limited to:
the F(ab')2 fragment which can be produced by pepsin digestion of the
antibody molecule; the Fab' fragments which can be generated by
reducing the disulfide bridges of the F(ab')2 fragment, and the Fab
t s fragments which can be generated by treating the antibody molecule
with papain and a reducing agent. Antibody molecules may be purified
by known techniques, g~c~, immunoabsorption or immunoaffinity
chromatography, chromatographic methods such as HPLC (high
performance liquid chromatography), or a combination thereof.
The present invention further encompasses an immunoassay for
measuring the amount of human AR-1 in a biological sample by
a) contacting the biological sample with at least one antibody which
specifically binds human AR-1 so that the antibody forms a
2 s complex with any human AR-1 present in the sample; and
b) measuring the amount of the complex and thereby measuring the
amount of the human AR-1 in the biological sample.
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
The present invention also provides for the utilization of human AR-1
to support the survival and/or growth and/or migration and/or
differentiation of human AR-1 receptor expressing cells.
Further, the discovery by applicants of human AR-1 enables the
utilization of assay systems useful for the identification of the human
AR-1 receptor. Such assay systems would be useful in identifying
molecules capable of promoting or inhibiting angiogenesis.
The invention further provides for both a method of identifying
antibodies or other molecules capable of neutralizing the factor or
blocking the binding ability of the factor, as well as the molecules
identified by the method. By way of nonlimiting example, the method
may be performed via an assay which is conceptually similar to an
ELISA assay. For example, human AR-1 antibody may be bound to a solid
support, such as a plastic multiwell plate. As a control, a known
amount of human AR-1 which has been Myc-tagged may then be
introduced to the well and any tagged human AR-1 which binds the
2 o antibody may then be identified by means of a reporter antibody
directed against the Myc-tag. This assay system may then be used to
screen test samples for molecules which are capable of i) binding to
the tagged factor or ii) binding to the antibody and thereby blocking
binding to the antibody by the tagged factor. For example, a test
2 5 sample containing a putative molecule of interest together with a
known amount of tagged factor may be introduced to the well and the
amount of tagged factor which binds to the antibody may be measured.
By comparing the amount of bound tagged factor in the test sample to
21
CA 02313804 2000-06-08
WO 99/32639 PCTNS98126800
the amount in the control, samples containing molecules which are
capable of blocking factor binding to the antibody may be identified.
The molecules of interest thus identified may be isolated using
methods well known to one of skill in the art.
Once a blocker of factor binding is found, one of skill in the art would
know to perform secondary assays to determine whether the blocker is
binding to the antibody or to the factor, as well as assays to determine
if the blocker molecule can neutralize the biological activity of the
facor. For example, by using a binding assay which employs BIAcore
biosensor technology (or the equivalent), in which either human AR-1
antibody or human AR-1 is covalently attached to a solid support (e.g.
carboxymethyl dextran on a gold surface), one of skill in the art would
be able to determine if the blocker molecule is binding specifically to
t 5 the factor or to the antibody.
One of skill in the art would be able to produce "factorbodies" which
comprise the AR-1 coupled to the Fc domain of IgG ("fFc's"). These
factorbodies may be used as targeting agents, in diagnostics or in
2 o therapeutic applications, such as targeting agents for tumors and/or
associated vasculature as indicated.
The invention herein further provides for the development of the AR-1,
a fragment or derivative thereof as a therapeutic for the treatment of
2 5 patients suffering from disorders involving cells, tissues or organs
which express the AR-1 receptor. Such molecules may be used in a
method of treatment of the human or animal body, or in a method of
diagnosis.
22
CA 02313804 2000-06-08
WO 99132639 PCT/US98/26800
Because AR-1 has been identified as related to the TIE family of
ligands, applicants expect that the AR-1 may be useful for the
induction or prevention of vascularization in diseases or disorders
where such function is indicated. Such diseases or disorders would
include wound healing, ischaemia and diabetes or for preventing or
attenuating, for example, tumor growth. The AR-1 may be tested in
animal models and used therapeutically as described for other agents,
such as vascular endothelial growth factor {VEGF). Ferrara, et al. U.S.
1 o Patent No. 5,332,671 issued July 26, 1994. The Ferrara reference, as
well as other studies, describe in vi o and in vivo studies that may be
used to demonstrate the effect of an angiogenic factor in enhancing
blood flow to ischemic myocardium, enhancing wound healing, and in
other therapeutic settings wherein neoangiogenesis is desired. [See
~ s Sudo, et al. European Patent Application 0 550 296 A2 published Juiy 7,
1993; Banal, et al. Circulation 89:2183-2189 (1994); Unger, et al. Am.
J. Physiol. 266:H1588-H1595 (1994); Lazarous, et al. Circulation
91:145-153 (1995)]. According to the invention, AR-1 may be used
alone or in combination with one or more additional pharmaceutically
2 o active compounds such as, for example, VEGF or basic fibroblast growth
factor (bFGF), as well as cytokines, neurotrophins, etc.
Antagonists of the AR-1, such as antibodies or receptorbodies, would
be useful to prevent or attenuate its biological activity. These agents
2 s may be used alone or in combination with other compositions.
In addition, AR-1 may be useful for the delivery of toxins to a receptor
bearing cell. Where the AR-1 receptor is associated with a disease
23
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
state, AR-1 may be useful as diagnostic reagents for detecting the
disease by, for example, tissue staining or whole body imaging. Such
reagents include radioisotopes, flurochromes, dyes, enzymes and biotin.
Such diagnostics or targeting agents may be prepared. as described in
Alitalo, et al. WO 95/26364 published October 5, 1995 and Burrows, F.
and P. Thorpe, PNAS (USA) 90:8996-9000 (1993) which is hereby
incorporated by reference in its entirety.
The human AR-1 of the present invention may be used alone, or in
~ o combination with another pharmaceutically active agent such as, for
example, ctyokines, neurotrophins, interleukins, etc. In a preferred
embodiment, the human AR-1 may be used in conjunction with any of a
number of the above referenced factors which are known to induce stem
cell or other hematopoietic precursor proliferation, or factors acting
on later cells in the hematopoietic pathway, including, but not limited
to, hemopoietic maturation factor, thrombopoietin, stem cell factor,
erythropoietin, G-CSF, GM-CSF, etc.
2 o The present invention also provides for compositions comprising the
human AR-1 described herein, peptide fragments thereof, or derivatives
in a vehicle. The human AR-1, peptide fragments, or derivatives may be
administered systemically or locally. Any appropriate mode of
administration known in the art may be used, including, but not limited
2 5 to, intravenous, intrathecal, intraarterial, intranasal, oral,
subcutaneous, intraperitoneal, or by local injection or surgical implant.
Sustained release formulations are also provided for.
24
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
The present invention also provides for an antibody which specifically
binds such a therapeutic molecule. The antibody may be monoclonal or
polyclonal. The invention also provides for a method of using such a
monoclonal or polyclonal antibody to measure the amount of the
therapeutic molecule in a sample taken from a patient for purposes of
monitoring the course of therapy.
The invention further provides for a composition comprising a human
AR-1 and a cytotoxic agent conjugated thereto. In one embodiment, the
cytotoxic agent may be a radioisotope or toxin.
The invention also provides for an antibody which specifically binds a
human AR-1. The antibody may be monoclonal or polyclonal.
~ s The invention further provides for a method of purifying human AR-1
comprising:
a) coupling at least one human AR-1 binding substrate to a
solid matrix;
b) incubating the substrate of a) with a cell lysate so that the
2 o substrate forms a complex with any human AR-1 in the cell
lysate;
c) washing the solid matrix; and
d) eluting the human AR-1 from the coupled substrate.
2 5 The substrate may be any substance that specifically binds the human
AR-1. In one embodiment, the substrate is selected from the group
consisting of anti-human AR-1 ~ antibody, human AR-1 receptor and
human AR-1 receptorbody.
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
The invention also provides for a composition comprising human AR-1
in a vehicle, as well as a method of regulating angiogenesis in a patient
comprising administering to the patient an effective amount of the
s therapeutic composition.
In addition, the present invention provides for a method for identifying
a cell which expresses human AR-1 receptor which comprises
contacting a cell with a detectably labeled human AR-1 or factorbody,
under conditions permitting binding of the detectably labeled factor to
the human AR-1 receptor and determining whether the detectably
labeled factor is bound to the human AR-1 receptor, thereby identifying
the cell as one which expresses human AR-1 receptor. The present
invention also provides for a composition comprising a human AR-1 and
15 a cytotoxic agent conjugated thereto. The cytotoxic agent may be a
radioisotope or toxin.
The invention also provides a method of detecting expression of human
AR-1 by a cell which comprises obtaining mRNA from the cell,
2 o contacting the mRNA so obtained with a labeled nucleic acid molecule
encoding human AR-1, under hybridizing conditions, determining the
presence of mRNA hybridized to the labeled molecule, and thereby
detecting the expression of the human AR-1 in the cell.
2 5 The invention further provides a method of detecting expression of
human AR-1 in tissue sections which comprises contacting the tissue
sections with a labeled nucleic acid molecule encoding a human AR-1,
under hybridizing conditions, determining the presence of mRNA
26
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
hybridized to the labelled molecule, and thereby detecting the
expression of human AR-1 in tissue sections.
EXAMPLE 1 - ISOLATION AND SEQUENCING OF FULL LENGTH cDNA
CLONE ENCODING MAMMALIAN TIE LIGAND-~
TIE ligand-3 (TL3) was cloned from a mouse BAC genomic library
(Research Genetics) by hybridizing library duplicates, with either
mouse TL1 or mouse TL2 probes corresponding to the entire coding
sequence of those genes. Each copy of the library was hybridized using
phosphate buffer at 55°C overnight. After hybridization, the filters
were washed using 2xSSC, 0.1 % SDS at 60°C, followed by exposure of X
ray film to the filters. Strong hybridization signals were identified
~ 5 corresponding to mouse TL1 and mouse TL2. In addition, signals were
identified which weakly hybridized to both mouse TL1 and mouse TL2.
DNA corresponding to these clones was purified, then digested with
restriction enzymes, and two fragments which hybridized to the
original probes were subcloned into a bacterial plasmid and sequenced.
2 o The sequence of the fragments contained two exons with homology to
both mouse TL1 and mouse TL2. Primers specific for these sequences
were used as PCR primers to identify tissues containing transcripts
corresponding to TL3. A PCR band corresponding to TL3 was identified
in a mouse uterus cDNA library in lambda gt-11. (Ciontech Laboratories,
2 s Inc., Palo Alto, CA).
Plaques were plated at a density of 1.25 x 106/20x20 cm plate and
replica filters taken following standard procedures (Sambrook, et al.,
27
CA 02313804 2000-06-08
WO 99/32639 PCT/US98I26800
Molecular Cloning: A Laboratory Manual, 2nd Ed., page 8.46, Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York). Duplicate filters
were screened at "normal" stringency (2 x SSC, 65°C) with a 200 by
PCR radioactive probe made to the mouse TL3 sequence. Hybridization
s was at 65°C in a solution containing 0.5 mg/ml salmon sperm DNA.
Filters were washed in 2 x SSC at 65°C and exposed for 6 hours to
X-
ray film. Two positive clones that hybridized in duplicate. were
picked. EcoRl digestion of phage DNA obtained from these clones
indicated two independent clones with insert sizes of approximately
i o 1.2 kb and approximately 2.2 kb. The 2.2kb EcoRl insert was subcloned
into the EcoRl site of pBluescript KS (Stratagene). Sequence analysis
showed that the longer clone was lacking an initiator methionine and
signal peptide but otherwise encoded a probe homologous to both mouse
TL1 and mouse TL2.
i5
Two TL3-specific PCR primers were then synthesised as follows:
US2: cctctgggctcgccagtttgttagg
US1: ccagctggcagatatcagg
2 o The following PCR reactions were performed using expression libraries
derived from the mouse cell lines C2C12ras and MG87. In the primary
PCR reaction, the specific primer US2 was used in conjunction with
vector-specific oligos to allow amplification in either orientation.
PCR was in a total volume of 100m1 using 35 cycles of 94° C, 1
min;
2 5 42°C or 48° C for 1 min; 72° C, 1 min. The secondary
PCR reaction
included the second specific primer, US1, which is contained within the
primary PCR product, in conjunction with the same vector oligos. The
secondary reactions were for 30 cycles, using the same temperatures
28
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
and times as previous. PCR products were gel isolated and submitted
for sequence analysis. On the basis of sequences obtained from a total
of four independent PCR reactions using two different cDNA libraries,
the 5' end of the TL3 sequence was deduced. Northern analysis revealed
moderate to low levels of mouse TL3 transcript in mouse placenta. The
expression of mouse TL3 consisted of a transcript of approximately 3
kb. The full length TL3 coding sequence is set forth in Figure 1 A-1 B.
The mouse TL3 sequence may then be used to obtain a human clone
1 o containing the coding sequence of its human counterpart by hybridizing
either a human genomic or cDNA library with a probe corresponding to
mouse TL3 as has been described previously, for example, in Example 8
in International Publication No. WO 96/31598 published 10 October
1996.
EXAMPLE 2 - ISOLATION OF FULL LENGTH GENOMIC CLONE ENCODING
HUMAN TIE LIGAND-4
TIE ligand-4 (TL4) was cloned from a human BAC genomic library (BAC
HUMAN (II), Genome Systems Inc.) by hybridizing library duplicates,
with either a human TL1 radioactive probe corresponding to the entire
fibrinogen coding sequence of TL1 (nucleotides 1153 to 1806) or a
2 5 mouse TL3 radioactive probe corresponding to a segment of186
nucleotides from the fibrinogen region of mouse TL3 (nucleotides 1307
to 1492 of Figure 1 A-1 B). Each probe was labeled by PCR using exact
oligonucleotides and standard PCR conditions, except that dCTP was
replaced by P~2dCTP. The PCR mixture was then passed through a gel
29
CA 02313804 2000-06-08
WO 99/32639 PCTNS98/26800
filtration column to separate the probe from free P32 dCTP. Each copy
of the library was hybridized using phosphate buffer, and radiactive
probe at 55°C overnight using standard hybridization conditions. After
hybridization, the filters were washed using 2xSSC, 0.1 % SDS at 55°C,
s followed by exposure of X ray film. Strong hybridization signals were
observed corresponding to human TL1. In addition, signals were
identified which weakly hybridized to both human TL1 and mouse TL3.
DNA corresponding to these clones was purified using standard
procedures, then digested with restriction enzymes, and one fragment
~ o which hybridized to the original probes was subcloned into a bacterial
plasmid and sequenced. The sequence of the fragments contained one
exon with homology to both human TLi and mouse TL3 and other
members of the TIE ligand family. Primers specific for these
sequences may be used as PCR primers to identify tissues containing
15 transcripts corresponding to TL4.
The complete sequence of human TL4 may be obtained by sequencing the
full BAC clone contained in the deposited bacterial cells. Exons may be
identified by homology to known members of the TIE-ligand family such
2 o as TL1, TL2 and TL3. The full coding sequence of TL4 may then be
determined by splicing together the exons from the TL4 genomic clone
which, in turn, may be used to produce the TL4 protein. Alternatively,
the exons may be used as probes to obtain a full length cDNA clone,
which may then be used to produce the TL4 protein. Exons may also be
2 s identified from the BAC clone sequence by homology to protein domains
such as fibrinogen domains, coiled coil domains, or protein signals such
as signal peptide sequences. Missing exons from the BAC clone may be
obtained by identification of contiguous BAC clones, for example, by
CA 02313804 2000-06-08
WO 99/32639 PGT/US98/26800
using the ends of the deposited BAC clone as probes to screen a human
genomic library such as the one used herein, by using the exon sequence
contained in the BAC clone to screen a cDNA library, or by performing
either 5' or 3' RACE procedure using oligonucleotide primers based on
s the TL4 exon sequences.
s
Identification of Additional TIE Ligand Family Members
The novel TIE ligand-4 sequence may be used in a rational search for
additional members of the TIE ligand family using an approach that
takes advantage of the existence of conserved segments of strong
homology between the known family members. For example, an
alignment of the amino acid sequences of the TIE ligands shows several
regions of conserved sequence (see underlined regions of Figure 2).
15 Degenerate oligonucleotides essentially based on these boxes in
combination with either previously known or novel TIE ligand homology
segments may be used to identify new TIE ligands.
The highly conserved regions among TL1, TL2 and TL3 may be used in
2 o designing degenerate oligonucleotide primers with which to prime PCR
reactions using cDNAs. cDNA templates may be generated by reverse
transcription of tissue RNAs using oligo d(T) or other appropriate
primers. Aliquots of the PCR reactions may then be subjected to
electrophoresis on an agarose gel. Resulting amplified DNA fragments
2 s may be cloned by insertion into plasmids, sequenced and the DNA
sequences compared with those of all known TIE ligands.
Size-selected amplified DNA fragments from these PCR reactions may
31
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
be cloned into plasmids, introduced into . c li by electroporation, and
transformants plated on selective agar. Bacterial colonies from PCR
transformation may be analyzed by sequencing of plasmid DNAs that are
purified by standard plasmid procedures.
Cloned fragments containing a segment of a novel TIE ligand may be
used as hybridization probes to obtain full length cDNA clones from a
cDNA library. For example, the human TL4 genomic sequence may be
used to obtain a human cDNA clone containing the complete coding
sequence of human TL4 by hybridizing a human cDNA library with a
probe corresponding to human TL4 as has been described previously.
EXAMPLE 3 - Cloning of the full coding sequence of hTL4
~ 5 Both 5' and 3' coding sequence from the genomic human TL-4 clone
encoding human TIE ligand-4 (hTL-4 ATCC Accession No. 98095) was
obtained by restriction enzyme digestion, Southern blotting and
hybridization of the hTL-4 clone to coding sequences from mouse TL3,
followed by subcloning and sequencing the hybridizing fragments.
2 o Coding sequences corresponding to the N-terminal and C-terminal
amino acids of hTL4 were used to design PCR primers (shown below),
which in turn were used for PCR amplification of TL4 from human ovary
cDNA. A PCR band was identified as corresponding to human TL4 by DNA
sequencing using the ABI 373A DNA sequencer and Taq Dideoxy
25 Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster City,
CA). The PCR band was then subcloned into vector pCR-script and
several plasmid clones were analyzed by sequencing. The complete
human TL4 coding sequence was then compiled and is shown in Figure
32
CA 02313804 2000-06-08
WO 99/32639 PCT/US98/26800
3A-3C. In another embodiment of the invention, the nucleotide at
position 569 is changed from A to G, resulting in an amino acid change
from Q to R.
The PCR primers used as described above were designed as follows:
hTL4atg 5'-gcatgctatctcgagccaccATGCTCTCCCAGCTAGCCATGCTGCAG-3'
hTL4not 5'-
gtgtcgacgcggccgctctagatcagacTTAGATGTCCAAAGGCCGTATCATCAT-3'
Lowercase letters indicate utail" sequences added to the PCR primers to
facilitate cloning of the amplified PCR fragments.
EXAMPLE 4 - CLONING OF A NOVEL FACTOR RELATED TO THE TIE
~ s FAMILY OF LIGANDS
Human AR-1 was cloned from a human BAC genomic library (Human
Genome Sciences, Inc., Cat. No. FBAC 4435, Release II) by hybridizing
library duplicates with a mouse TL3 probe. The probe was labeled by
2 o PCR using exact oligonucleotides and standard PCR conditions; except
that dCTP was replaced by P32dCTP. The PCR mixture was then passed
through a gel filtration column to separate the probe from free P32
dCTP. The library was hybridized using phosphate buffer at 55°C
overnight. After hybridization, the filters were washed using 2xSSC,
2 5 0.1 % SDS at 60°C, followed by exposure of X-ray film to the
fitters.
Strong hybridization signals were identified corresponding to mouse
TL3. Genomic DNA corresponding to these clones was purified, digested
with restriction enzymes, and subcloned into a bacterial plasmid and
33
CA 02313804 2000-06-08
WO 99132639 PCT/US98/26800
sequenced. The sequence of the fragment contained a portion of the 3'
end of the human AR-1 gene. To obtain the 5' end of the clone, the 3'
sequence was used to design oligonucleotide primers for use in a
standard RACE procedure. The RACE product was sequenced and found to
s contain the upstream sequence of the gene including the 5' untranslated
sequence. To obtain the full length human AR-1 clone, the 5' sequence
was used to design oligonucleotide primers that were used in
conjunction with Adaptor primer 1 and Adaptor primer 2 (Clontech
Laboratories, Inc., Catalog # 7413-1 ) to amplify Human Skeletal Muscle
1 o Marathon-ReadyT~~ cDNA (Clontech Laboratories, Inc., Catalog # 7413-
1 ). The amplification product was cloned into the pMT21 vector and
sequenced. The nucleotide and deduced amino acid sequence of human
AR-1 is set forth in Figure 4A-4B.
The present invention is not to be limited in scope by the specific
1 s embodiments described herein. Indeed, various modifications of the
invention in addition to those described herein will become apparent to
those skilled in the art from the foregoing description and
accompanying figures. Such modifications are intended to fall within
the scope of the appended claims.
34
