Note: Descriptions are shown in the official language in which they were submitted.
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 1 - _
NEW CANDIDA ALBICANS KRE9 AND USES THEREOF
BACFCGROUND OF THE INVENTION
(a) Field of the Invention
The invention relates to a novel gene, CaKRE9,
isolated in the yeast pathogen, Candida albicans, that
is a functional homolog of the S. cerevisiae KRE9 gene
and which is essential for cell wall glucan synthesis,
and to novel antifungal screening assays.
to (b) Description of Prior Art
Fungi constitute a vital part of our ecosystem
but once they penetrate the human body and start
spreading they cause infections or "mycosis" and they
can pose a serious threat to human health. Fungal
is infections have dramatically increased in the last 2
decades with the development of more sophisticated
medical interventions and are becoming a significant
cause of morbidity and mortality. Infections due to
pathogenic fungi are frequently acquired by debilitated
2o patients with depressed cell-mediated immunity such as
those with human immunodeficiency virus (HIV) and now
also constitute a common complication of many medical
and surgical therapies. Risk factors that predispose
individuals to the development of mycosis include neu-
25 tropenia, use of immunosuppressive agents at the time
of organ transplants, intensive chemotherapy and irra-
diation for hematopoietic malignancies or solid tumors,
use of corticosteroids, extensive surgery and pros-
thetic devices, indwelling venous catheters, hyperali-
3o mentation and intravenous drug use, and when the deli-
cate balance of the normal flora is altered through
antimicrobial therapy.
The yeast genus Candida constitutes one of the
major groups that cause systemic fungal infections and
35 the five medically relevant species which are most
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
_ Z _ _
often recovered from patients are C. albicans, C.
tropicalis, C. glabrata, C. parapsilosis and C. krusei.
Much of the structure of fungal and animal cells
along with their physiology and metabolism is highly
s conserved. This conservation in cellular function has
made it difficult to find agents that selectively dis-
criminate between pathogenic fungi and their human
hosts, in the way that antibiotics do between bacteria
and man. Because of this, the common antifungal drugs,
io like amphotericin B and the azole-based compounds are
often of limited efficacy and are frequently highly
toxic. In spite of these drawbacks, early initiation
of antifungal therapy is crucial in increasing the sur-
vival rate of patients with disseminated candidiasis.
15 Moreover, resistance to antifungal drugs is becoming
more and more prominent. For example, 6 years after
the introduction of fluconazole, an alarming proportion
of Candida strains isolated from infected patients have
been found to be resistant to this drug and this is
2o especially the case with vaginal infections. There is
thus, a real and urgent need for specific antifungal
drugs to treat mycosis.
The fungal cell wall: a resource for new antifungal
targets
z5 Tn recent years, we have focused our attention
on the fungal extracellular matrix, where the cell wall
constitutes an essential, fungi-specific organelle that
is absent from human/mammalian cells, and hence offers
an excellent potential target for specific antifungal
3o antibiotics. The cell wall of fungi is essential not
only in maintaining the osmotic integrity of the fungal
cell but also in cell growth, division and morphology.
The cell wall contains a range of polysaccharide poly-
mers, including chitin, (3-glucans and O- and N-linked
35 mannose sidechains of glycoproteins. (3-glucans, homo-
polymers of glucose, are the main structural component
CA 02314611 2000-06-12
- 3 -
component of the yeast cell wall, and constitute up to
60% of the dry weight of the cell wall. Based on their
chemical linkage, two different types of polymers can
be f ound : (31, 3 -glucan and (31, 6 -glucan . The (31, 3 -glucan
s is the most abundant component of the cell wall and it
contains on average 1500 glucose residues per molecule.
It is mainly a linear molecule but contains some 1,6-
linked branchpoints. The (31,6-glucan is a smaller and
highly branched molecule comprised largely of 1,6-
lo linked glucose residues with a small proportion of 1,3-
linked residues. The average size of X31,6-glucan is
approximately 400 residues per molecule. The (31,6-
glucan polymer is essential for cell viability as it
acts as the "glue" covalently linking glycoproteins and
15 the cell wall polymers (31,3-glucan and chitin together
in a crosslinked extracellular matrix.
In United States Patent No. 5, 194, 600 issued on
March 16, 1993 in the names of Bussey et al . , there is
disclosed the screening of specific yeast strains
2o defective in certain mutants of genes which participate
in ~3-glucan assembly.
It would be highly desirable to be provided with
the identification and subsequent validation of new
cell wall related targets that can be used in specific
2s enzymatic and cellular assays leading to the discovery
of new clinically useful antifungal compounds.
SUMMARY OF THE INVENTION
One aim of the present invention is to provide
3o the identification and subsequent validation of a new
target that can be used in specific enzymatic and
cellular assays leading to the discovery of new
clinically useful antifungal compounds.
~,;,M lDfcD SHEE'~'
CA 02314611 2000-06-12
- 3a -
Although a gene involved in the cellular growth
of S. cerevisiae was identified, there are no
certainties that there would be a homolog in Candida
albicans or if present that it would have the same
s function.
In accordance with the present invention a gene
was isolated, CaKRE9, in the yeast pathogen, Candida
albicans, that is a functional homolog of the S.
A~,~-~'~°L~E~ ~~~~-~'~
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 4 - -
glucan synthesis . The gene is not found in humans and
when it is inactivated in C. albicans, the cell cannot
survive when grown on glucose, thus, validating it as a
wholly new target for antifungal drug discovery.
s Using the gene of the present invention, we
intend to utilize novel drug screening assays for which
we possess all the genetic tools.
In accordance with the present invention there
is provided an isolated DNA which codes for a gene
io essential for cell wall glucan synthesis of Candida
albicans, wherein the gene is referred to as CaKRE9,
wherein the sequence of the DNA is as set forth in
Fig. 1.
In accordance with the present invention there
i5 is also provided an antifungal screening assay for
identifying a compound which inhibits the synthesis,
assembly and/or regulation of X31,6-glucan, which com-
prises the steps of:
a) synthesizing (31,6-glucans in vitro from acti
2o vated sugar monomer/polymer and specific (31,6
glucan synthetic proteins;
b) subjecting step a) to a high throughput compound
screen determining absence or presence of (31,6-
glucan, wherein absence of (31,6-glucan is
2s indicative of an antifungal compound.
In accordance with the present invention there
is also provided an in vivo antifungal screening assay
for identifying compounds which inhibit the synthesis,
assembly and/or regulation of (31,6-glucan, which com
so prises the steps of:
a) separately cultivating a mutant yeast strain
lacking one gene for synthesis of (31,6-glucans
and a wild type yeast strain with activated
sugar monomer/polymer UDP-glucose;
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 5 -
b) subjecting both yeast strains of step a) to the
screened compound and determining if the com
pound selectively inhibits growth of wild type
strain which is indicative of an antifungal com
pound.
In accordance with the present invention there
is also provided an in vitro method for the diagnosis
of diseases caused by fungal infection in a patient,
which comprises the steps of:
io a) obtaining a biological sample from the patient;
b) subjecting the sample to PCR using a primer pair
specific for CaKRE9 gene, wherein a presence of
the gene is indicative of the presence of fungal
infection.
u5 In accordance with the present invention, the
gene is CaKRE9.
In accordance with the present invention there
is also provided an in vitro method for the diagnosis
of diseases caused by fungal infection in a patient,
2o which comprises the steps of:
a) obtaining a biological sample from the patient;
b) subjecting the sample to an antibody specific
for CaKre9p antigen, wherein a presence of the
antigen is indicative of the presence of fungal
25 infection.
In accordance with~one embodiment of the present
invention, the fungal infection may be caused by Can-
dida.
In accordance with the present invention there
3o is also provided the use of at least one of KRE9 and
CaKre9 nucleic acid sequences and fragments thereof as
a probe for the isolation of KRE9 homologs in all
fungi .
For the purpose of the present invention the
35 following terms are defined below.
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 6 - _
The term a "mutant yeast strain" is intended to
mean any yeast strain lacking one gene for synthesis of
(31,6-glucan, such as KRE9 and homologs thereof.
The term a "wild type yeast strain" is intended
s to mean any yeast strain containing the KRE9 gene or a
homolog thereof or a plasmid overexpressing the KRE9
gene or a homolog thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
to Fig. 1 illustrates the complete nucleotide and
predicted amino acid sequence of CaKRE9 (SEQ ID NO:1-
2) .
Fig. 2 illustrates the comparison of the
sequence of Kre9p from Candida albicans (SEQ ID N0:2)
15 and Kre9p (SEQ ID N0:3) and Knhlp (SEQ ID N0:4) from
Saccharomyces cerevisiae;
Fig. 3 illustrates the CaKRE9-dependent effect
on the growth (A) and Killer phenotype (B) of kre9A
null mutants;
2o Fig. 4A illustrates the schematic representation
of the strategy for disruption of the Candida albicans
KRE9 gene;
Fig. 4B illustrates the Southern blot verifica
tion of the correct integration of the hisG-URA3-hisG
z5 disruption module into the CaKRE9 gene and proper
CaURA3 excision after 5-FOA treatment; and
Fig. 5 illustrates the quantification of (31,6-
Glucan levels of different Candida albicans strains.
3o DETAINED DESCRIPTION OF THE INVENTION
In accordance with the present invention, the
synthesis and the assembly of the cell wall polymer
(31,6 glucan which plays a central role in the organiza-
tion of the yeast cell wall and which is indispensable
35 for cell viability were extensively studied. Although
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
_ 7 _ _
the biochemistry of ~i1,6 glucosylation is incompletely
understood, a genetic analysis of genes required for
1,6 synthesis has been performed in Saccharomyces cere-
visiae, and has identified many genes required for this
s process. These encode products acting in the endoplas-
mic reticulum, the Golgi complex and at the cell sur-
f ace .
In accordance with the present invention a novel
gene was identified, KRE9, whose product is required
io for the synthesis of (31, 6 linked glucans (Brown JL. et
al. (1993) Molecular & Cellular Biology 13:6346-6356).
KRE9 appears to be a fungal specific gene, as it is
absent from animal lineages based on data base searches
of the Caernorhabditis elegans, mouse and Homo Sapiens
i5 genomes and it also appears to be absent from the
plant, bacterial and archaebacterial lineages.
KRE9 and its homolog KNX1
KRE9 encodes a 30-kDa secretory pathway protein
involved in the synthesis of cell wall X31,6 glucan
20 (Brown JL. et aI. (1993) Molecular & Cellular Biology
13:6346-6356). Disruption of KRE9 in S. cerevisiae
leads to serious growth impairment and an altered cell
wall containing less than 20~ of the wild-type amount
of (31,6 glucan. Analysis of the glucan material
2s remaining in a kre9 null mutant indicated a polymer
with a reduced average molecular mass (Brown JL. et al.
(1993) Molecular & Cellular Biology 13:6346-6356). The
kre9 null mutants also displayed several additional
cell-wall-related phenotypes, including an aberrant
3o multiple budded morphology, a mating defect, and a
failure to form projections in the presence of alpha-
factor. Antibodies generated against Kre9p detected an
O-glycoprotein of approximately 55 to 60 kDa found in
the extracellular medium of a strain overproducing
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 8 - _
Kre9p, indicating it is normally localized at the cell
surface .
In the yeast genome a KRE9 homolog was recently
found, KNH1, whose product, Knhlp, shares 46~ overall
identity with Kre9p (Dijkgraaf GJ. et al. (1996) Yeast
12:683-692). Disruption of the KNH1 locus has no
effect on growth, killer toxin sensitivity or (31,6-glu-
can levels. Overexpression of KNH1 suppressed the
severe growth defect of a kre9 null mutant and restored
io the level of alkali-insoluble (31,6-glucan to almost
wild type levels. When overproduced, Knhlp, like
Kre9p, can be found in the extracellular culture medium
as an O-glycoprotein, and is likely also a cell surface
protein under conditions of normal expression. The dis-
cs ruption of both KNH1 and KRE9 is lethal. Transcription
of KNH1 is carbon-source and KRE9 dependent. The
severe growth defect of a kre9d null mutant observed on
glucose can be partially restored when galactose
becomes the major carbon source. Transcription of the
2o KNHI gene is normally low in wild type cells grown on
glucose but increases approximately five fold in galac-
tose grown cells, where it partially compensates for
the loss of Kre9p and allows partial suppression of the
slow growth phenotype of kre9d cells. These results
2s suggest that KRE9 and KNH1 are specialized in vivo to
function under different environmental conditions
(Dijkgraaf GJ. et al. (2996) Yeast 12:683-692).
The essential nature of the KRE9/KNH1 gene pair,
and the putative extracellular location of their gene
3o products make these proteins a new and potentially
valuable target for antifungal compounds that need not
enter the fungal cell.
~i1,6-glucan in pathogenic fungi
The yeast Saccharomyces cerevisiae, although not
35 a pathogen, is a proven model organism for pathogenic
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 9 - _
fungi as it is closely related taxonomically to oppor-
tunistic pathogens like the dimorphic yeast Candida
albicans. The composition of the cell wall of C. albi-
cans resembles that of S. cerevisiae in containing
s (31, 3- and (31, 6-glucans, chitin, and mannoproteins (Mio,
T. et al., J. Bacteriol. 179:2363-2372 Analyses of the
Candida albicans genes involved in extracellular matrix
assembly are limited but indicate that the proteins
responsible for synthesis of the polymers often resem-
to ble those found in the more extensively studied yeast,
Saccharomyces cerevisiae. The ~i1,6 glucosylation of
proteins appears to be widespread among fungal groups,
and the polymer varies in abundance between fungal spe-
cies. In C. albicans this polymer is particularly
i5 abundant, comprising approximately half of the alkali
insoluble glucan. Comparative studies with C. albicans
have so far identified three genes involved in (31,6
glucosylation based on their relatedness to those in S.
cerevisiae, indicating that synthesis of this polymer
2o is functionally conserved and essential for the growth
of Candida albicans.
Isolation of the CaKRE9 gene
In order to validate KRE9 as a possible new
antifungal target, we have examined if genes related to
25 S. cerevisiae KRE9 were present in C. albicans. Using
complementation of the S. cerevisiae kre9 mutant pheno-
type as a screen, we have isolated a C. albicans gene
that encodes a protein similar to the S. cerevisiae
KRE9 gene product.
3o CaKRE9 was identified by a plasmid shuffle
approach as a gene being able to restore the slow
growth of a Saccharomyces cerevisiae kre9::HIS3 dis-
rupted strain. A diploid strain heterozygous for a
kre9::HIS3 deletion was transformed with a centromeric
35 LYS2-based pRS317 vector containing a wild type copy of
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 10 _
the S. cerevisiae KRE9 gene. Transformants were
selected by prototrophic growth on minimal media,
sporulated and a haploid kre9::HIS3 strain containing a
plasmid-based copy of KRE9 was obtained by tetrad dis-
section and spore progeny analysis. This strain was
shown to possess wild type growth and killer toxin sen-
sitivity and was subsequently transformed with a Can-
dida albicans genomic library contained within the mul-
ticopy YEp352-plasmid harboring the URA3 gene as a
io selectable marker. In order to screen for plasmids
that could restore growth to a kre9::HIS3 mutant, about
20,000 His3+ Lys2+ Ura3+ cells were replica plated on
minimal medium containing a-aminoadipate as a primary
nitrogen source to select for cells that have lost the
i5 LYS2 plasmid-based copy of KRE9 but are still able to
grow, indicating that a copy of the complementing
CaKRE9 gene could be present in such growing cells.
These cells were further tested for loss of the pRS317-
KRE9 plasmid by failure to grow on medium lacking
20 lysine. YEp352-based Candida albicans genomic DNA was
recovered from cells that grew in the presence of
lysine but did not grow in its absence. Upon
retransformation in yeast, only 2 different genomic
inserts were able to partially restore growth of the
2s kre9::HIS3 haploid strain. DNA from both inserts were
sequenced.
The CaKRE9 gene was contained in only one of the
C. albicans clones. Complete sequencing of the 8-kb
fragment containing the CaKRE9 gene revealed an open
3o reading frame of 813 by encoding a 29-kDA secretory
protein of 271 amino acid residues (see Fig. 1). As is
the case with Kre9p and Knhlp (Brown JL. et al. (1993)
Molecular & Cellular Biology 13:6346-6356; Dijkgraaf
GJ. et al. (1996) Yeast 12:683-692), the hydrophobic N-
35 terminal region of CaKre9p comprises an eukaryotic sig-
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 11 - _
nal sequence, with the most likely cleavage site occur-
ring between amino acid residues 21 and 22. CaKre9p
shares 43~ overall identity with Kre9p and 32~ with
Knhlp (see Fig. 2). The amino acid residues are shown
in single-letter amino acid code. Sequences were
aligned with gaps to maximize homology. Dots represent
a perfect match between all sequences while a vertical
slash indicates conservative substitution at a given
position. The most conserved region between the 3 pro-
io teins encompasses a large part of the central region
and most of the C-terminal portion, with the N-terminal
part being largely unique to each protein. Kre9p,
Knhlp and CaKre9p share a high proportion of serine and
threonine residues (26~), potential sites for O-glyco-
i5 sylation, a modification known to occur on Kre9p and
Knhlp, and characteristic of many yeast cell surface
proteins. In addition, all 3 proteins have lysine and
arginine rich C-termini and lack potential N-linked
glycosylation sites.
2o The functional capacity of CaKre9p was assessed
in Saccharomyces cerevisiae by measuring its ability to
restore the growth and killer toxin sensitivity of a
kre9 null mutant. Firstly, the YEp352-based Candida
albicans genomic DNA containing the CaKRE9 gene was
25 transformed into a diploid strain of S. cerevisiae
heterozygous for a kre9::HIS3 deletion, sporulated and
a haploid kre9::HIS3 strain containing a plasmid-based
copy of CaKRE9 was obtained from spore progeny follow-
ing tetrad dissection. As can be seen in Fig. 3A, a
so strain harboring the CaKRE9 gene grows at a slower rate
than a wild type strain or the mutant strain harboring
a copy of KRE9 but significantly faster than the kre9
null mutant which has a severe growth phenotype. Sec-
ondly, the haploid kre9 strain carrying the CaKRE9 was
35 submitted to a killer toxin sensitivity assay (Fig.
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 12 -
3B). K1 killer yeast strains secrete a small pore-
forming toxin that requires an intact cell wall recep-
tor for function. KRE9 null mutations lead to a con-
siderable decrease in the level of (31,6-glucan disrupt-
s ing the toxin receptor (Brown JL. et al. (1993) Molecu-
lar & Cellular Biology 13:6346-6356), leading to killer
resistance and showing no killing zone in the assay.
The killer phenotype of the kre9 mutant allowed a test
of possible suppression by CaKre9p. Overexpression of
to CaKRE9 in the S. cerevisiae haploid strain carrying a
disrupted copy of KRE9 partially suppressed the killer
resistance phenotype (Fig. 3B).
These results imply that Kre9p and CaKre9p both
play very similar roles in (31,6-glucan assembly in S.
15 cerevisiae and C. albicans.
Disruption of the CaKRE9 gene
Experimental strategy:
The gene disruption was performed by the URA
blaster protocol using the hisG-CaURA3-hisG module. A
20 1.6-kb DraI DNA fragment containing the CaKRE9 gene was
subcloned from the original insert into the SmaI site
and the blunted XbaI site (treated with the Klenow
fragment of DNA polymerase I) of YEp352 (see Fig. 4A).
Extracted genomic DNAs are from . CAI4 wild type cells
2s (lane 1), CaKRE9/Cakre9::hisG-URA-hisG heterozygous
mutant (lane 2), CaKRE9/Cakre9::hisG heterozygous
mutant obtained after 5-FOA treatment (lane 3) and
Cakre9/Cakre9::hisG-URA-hisG homozygous null mutant
which is able to grow only when galactose is used as
3o the sole source of carbon.
The CaKRE9 gene was disrupted by deleting a 485
by BstxI-BamHI fragment of the open reading frame and
replacing it by a 4.0 kb BglII/BamHI fragment carrying
the hisG-URA3-hisG module from plasmid pCUB-6 (see
35 Fig. 4A). The sticky ends were enzymatically treated to
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 13 -
accommodate the ligation. This disruption plasmid was
digested by HindIII and KpnI, precipitated with ethanol
and sodium acetate and 100 ~g of the 5.2 kb-disruption
fragment was transformed into CAI4 Candida albicans
s cells by the lithium acetate method.
Putative heterozygous disruptants were selected
on minimal medium carrying glucose or galactose as car-
bon sources but lacking uracil. In preparation for a
second round of gene disruption, the CaURA gene was
to excised using a 5-FOA selection. The second round of
transformation was performed in the same way as the
primary one.
The accurate integration of the hisG-CaURA3-hisG
cassette into the CaKRE9 gene and its excision from
i5 genomic DNA was verified by Southern hybridization
using 3 different probes:
(1) a 405-by fragment from. C. albicans genomic DNA con-
taining coding and 3' flanking sequences of CaKRE9;
(2) a 783 by DNA fragment obtained by PCR and covering
2o the entire CaURA3 coding region; and
(3) a 898 by fragment amplified by PCR that encompasses
the whole of the Salmonella typhimurium hisG gene (see
Fig. 4B) .
All genomic DNAs were digested with the BamHI
2s and SalI restriction enzymes.
Results:
In the first round of transformation where
transformants were selected on glucose containing
plates, the Southern blotting results revealed that the
3o hisG-CaURA3-hisG module correctly integrated into the
Candida albicans KRE9 gene (see Fig. 4). When genomic
DNA of putative heterozygous CaKRE9 disruptions was
digested with the SalI and BamHI restriction enzymes
and probed with the CaKRE9 405-by SalI-BstXI DNA frag-
35 ment along with the hisG and the CaURA3 probes, 2
CA 02314611 2000-06-12
- 14 -
Candida albicans KRE9 gene (see Fig. 4). When genomic
DNA of putative heterozygous CaKRE9 disruptions was
digested with the SalI and BamHI restriction enzymes
and probed with the CaKRE9 405-by SalI-BstXI DNA
s fragment along with the hisG and the Ca URA3 probes, 2
expected bands could be detected (see Fig. 4B, land 2,
for representative result): a 773 by band corresponding
to the wild type gene that could only be detected by
the CaKRE9 probe and a 4318 by diagnostic band,
to revealed by all 3 probes, indicating successful
disruption of one copy of the CaKRE9 gene. After
removal of the CaURA3 using 5-FOA (5-fluoroorotic
acid), the 773 by wild type band could still be
visualized but the disrupted band from which the CaURA3
is was excised shifted to an anticipated 1428 by when
probed with the CaKRE9 and hisG probes but not with
the CaURA3 probe (see Fig. 4B, lane 3).
In order to assess if the CaKRE9 gene is
essential in C. albicans, a second round of disruptions
2o was undertaken in the heterozygous strain where the
CaURA3 gene was eliminated. However, in view of the
nature of the carbon source regulation of the KRE9/KNH1
pair in S. cerevisiae, the second round of
transformation was executed using both glucose and
2s galactose as carbon sources. 32 Ura+ colonies from the
glucose plated transformation were analyzed by Southern
blot hybridization using the 3 different probes and
only yeast cells heterozygous at the CaKRE9 locus could
be found. The absence of the expected homozygous
3o double disruption among the transformants is consistent
with the fact that CaKRE9 is an essential gene in C.
albicans when glucose is the sole carbon source.
Demonstration of CaKRE9 as an essential gene under
these conditions validates the CaKRE9 gene product as a
35 therapeutical target in Candida albicans.
~n.~~ ~!_ ~r~
A~~~:~~.... , f~..~.T
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 15 -
Besting that they could be homozygous disruptants.
Southern blot hybridizations were performed on these 8
transformants and they were shown to be homozygous dis-
ruptants for the CaKRE9 locus: one copy corresponded to
the disrupted gene in which CaURA3 has been removed
(1428 bp) and the second one represented the inactiva-
tion of the remaining wild type copy by the hisG-
caURA3-hisG module (4318 bp; Fig. 4B, lane 4) . Thus a
homozygous disruption of kre9 in C. albicans is lethal
to when glucose constitutes the exclusive carbon source.
Further, it should be appreciated that glucose is the
main source of carbon of human beings.
~i1,6-glucan analysis of C. albicaas CaKRE9 mutants
Experimental strategy:
is Yeast total-cell protein extracts were prepared
from exponentially growing cultures by cell lysis with
glass beads. Cellular extracts were standardized for
total cellular protein and equivalent amounts of pro-
tein were alkali extracted (0.75M NaOH final lh, 75°C) .
ao The alkali soluble fractions were then spotted onto
nitrocellulose and immunoblots were carried out.
Briefly, blots were treated in TBST buffer (10 mM Tris
pH 8.0, 150 mM NaCl, 0.05 TweenT"" 20, containing 5~ non
fat dried milk powder) and subsequently incubated with
25 affinity purified rabbit anti-(31,6-glucans antibodies
(prepared as described Montijn, R.C. et al. (1994) J.
Biol. Chem. 296:19338-19342) in the same buffer. After
antibody binding, membranes were washed in TBST and a
second antibody directed against rabbit immunoglobulins
so and conjugated with horseradish peroxidase, was then
added. The blots were again washed and whole cell ~i1,6
glucans detected using an enhanced chemiluminescence
procedure.
Results
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 16 -
In order to directly measure the effect of inac-
tivating CaKRE9 on X31,6-glucan synthesis and assembly,
a specific rabbit anti-(31, 6-glucan antiserum was raised
against BSA-coupled pustulan (a commercially available
s (31,6 glucan), affinity purified, and used to detect
antigen-antibody complexes by Western blotting of total
cell protein extracts of different yeast strains grown
on galactose. As expected, wild type cells yielded a
strong (31,6-glucan signal (see Fig. 5). The affinity
to purified Ab detected about a quarter of the glucan in
the C. albicans heterozygous dcakre9 whereas no (31,6-
glucan could be detected from a C. albicans homozygous
dcakre9 disruptant grown on galactose (Fig. 5).
Discussion
15 The essential nature of the KRE9 gene in C.
albicans, and the possible extracellular location of
its gene product make this protein a new and poten-
tially valuable target for antifungal compounds that
need not enter the fungal cell. The precise role of
2o Kre9p in ~i-glucan synthesis remains to be precisely
determined but does not prevent the establishment of a
antifungal drug screening assay
The present invention will be more readily un
derstood by referring to the following examples which
2s are given to illustrate the invention rather than to
limit its scope.
EXAMPLE I
In vitro screening method for specific antifungal
agents (enzymatic-based assay)
30 The primary objective is to identify novel com-
pounds inhibiting the synthesis, assembly and/or regu-
lation of X31,6-glucans. This enzymatic assay would
utilize some of the gene products (KRE) involved in
(31,6-glucan synthesis, including using an in vitro
35 assay for CaKre9p. Using specific reagents such as an
antibody to (31,6-glucan, and a specific glucanase for
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 17 -
the polymer, the approach is to synthesize the polymer
in vitro from the activated sugar monomer UDP-glucose.
This task can be accomplished by existing methodologies
such as the production of large amounts of each protein
s and by the availability of genetic tools, such as the
ability to delete or overexpress gene products that are
involved in synthesis of this and the other major poly-
mers. Once the assay has been established it will per-
mit the screening of possible compounds that inhibit
io steps in the synthesis of this essential polymer. When
such inhibitors will be found, they will then be evalu-
ated as candidates for specific antifungal agents.
The effects of such compounds on (31,6-glucan
levels may be directly measured using the anti-(31,6
i5 glucan antibody. This approach can be used on all type
of fungi and can be adapted to a high throughput immu-
noassay to find ~i1,6-glucan inhibitors.
EXAMPhE II
2o In vfvo screening method for specific antifungal agents
(cellular-based assay)
Yeast strains possessing or lacking (31,6-glucans
permit a differential screen for compounds inhibiting
synthesis of this cell wall polymer. Specifically, an
2s antifungal drug screen can be devised based on a whole-
cell assay in which the fungal-specific CaKre9p would
be targeted.
The strains that may be used in accordance with
the present invention include, without limitation, any
3o yeast strain mutant for CaKRE9 and homologs thereof
disrupted strain, conditional mutants, overexpression
strains and suppressed disrupted strains.
Compounds can be tested for their ability to
inhibit growth or kill a wild type C. albicans strain
3s while having no effect on a Cakre9 suppressor strain.
In addition, compounds leading to hypersensitivity in a
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 18 -
CaKRE9 deletion will also be of value as candidate
antifungal drugs. The finding of new antifungal com-
pounds will be greatly simplified by these types of
screens. The direct scoring on cells of the level of
s efficacy of a particular compound (natural product
extracts, pure chemicals...) alleviates the costly and
labor intensive establishment of an in vitro enzymatic
assay. The availability of genetic tools, such as the
ability to delete or overexpress gene products that are
to involved in synthesis of this and the other major poly-
mers will permit the establishment of this new screen-
ing method. When such inhibitors will be found, they
will then be evaluated as candidates for specific anti-
fungal agents.
EXAMPLE III
The use of CaKRE9 in the diagnosis of fungal infection
Detection based on PCR
Candida spp. and other pathogenic fungi are tradi
2o tionally identified by morphological and metabolic
characteristics and often this require days to weeks to
isolate on culture from a patient's sample. Identifi
cation is time-consuming and often unreliable and this
impedes the selection of antimicrobial agents in cases
in which species identification of the organism is nec-
essary. Moreover, culture-based diagnostic methods are
not within the scope of many routine microbiology labo-
ratories and are frequently limited to detection of
pathogenic organisms in patients at an advanced stage
of disease or even at autopsy. The detection of dis-
seminated Candida mycosis is an area where there is an
urgency for new sophisticated techniques of identifica-
tion. Polymerase Chain Reaction (PCR) based tests to
establish the presence of a fungal infection are at
this point highly desirable for laboratory diagnosis
and management of patients with serious fungal dis-
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
- 19 -
eases. The CaKRE9 gene is fungi specific and could be
used to develop new diagnostic procedures of mycosis
based on the PCR. Such diagnostic tests would be pre-
dicted to be highly sensitive and specific. Ulti-
mately, simple kits permitting the diagnosis of fungal
infections will be sold to hospitals and specialized
clinics. Current trends in the hospital microbiology
laboratories indicate that there will be a considerable
future increase in use of the PCR as a diagnostic tool.
to Detection based on anti-CaKre9p antibodies
CaKre9p is thought to be localized at the cell
surface and as such could be detected as a circulating
candidal antigen by an enzyme-linked immunoabsorbent
assay (ELISA) detection kit based on antibodies
i5 directed against CaKre9p. Antibodies directed against
CaKre9p could allow levels of specificity and sensitiv-
ity high enough to permit commercialization of a diag-
nostic kit.
20 EXAMPhE IV
The use of Kre9p in all fuagi
Isolation and use of functional homologs of
KRE9/CaKRE9 from all fungi. Most fungi have (31,6-glu-
cans and likely have KRE9 homologs in their genome.
25 The kre9 mutant can allow isolation of similar genes by
functional complementation from other pathogenic fungi
as what was done to isolate CaKRE9. KRE9 could also
serve as a probe to isolate by homology KRE9 homologs
from other yeasts. In addition, Kre9p allows isolation
30 of homologs in other species by the techniques of
reverse genetics where antibodies raised against Kre9p
could be used to screen expression libraries of patho-
genic fungi for expression of KRE9 homologs that would
immunologically cross react with antibodies raised
35 against S. cerevisiae KRE9 and C. albicans CaKRE9.
CA 02314611 2000-06-12
- 2~ -
The kre9 mutant can allow isolation of similar genes by
functional complementation from other pathogenic fungi
as what was done to isolate CaKRE9. KRE9 could also
serve as a probe to isolate by homology KRE9 homologs
s from other yeasts. In addition, Kre9p allows isolation
of homologs in other species by the techniques of
reverse genetics where antibodies raised against Kre9p
could be used to screen expression librairies of
pathogenic fungi for expression of of KRE9 homologs
io that would immunologically cross react with antibodies
raised against S. cerevisiae KRE9 and C. albicans
CaKRE9. These putative KRE9 homologs in these
pathogenic fungi could serve as targets for potential
new antifungals.
15 Other methods are used to find proteins which
interact with Kre9p and homologs thereof, such as two-
hybrid, co-immunoprecipitation and chromatography using
an activated Kre9p matrix.
A~~'~DED ~~E~
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
1/3
SEQUENCE LISTING
<110> McGILL UNIVERSITY
BUSSEY, Howard
LUSSIER, Marc
SDICU, Anne-Marie
SHAHINIAN, Sarkis, Serge
<120> NEW CANDIDA ALBICANS KRE9 AND USES
THEREOF
<130> 1770-195PCT FC/ld
<150> CA 2,218,446
<151> 1997-12-12
<160> 4
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 816
<212> DNA
<213> Artificial Sequence
<400>
1
atgagacaatttcaaatcatattaatttcccttgttgtttccataataagatgtgttgtt60
gcagatgttgacatcacatcaccaaagagtggagaaactttttctggtagttctggatca120
gcaagtatcaagattacctgggatgattcagacgattcagactcaccgaaatctttggat180
aatgccaaagggtacacaatttctttatgtactggacctacttcagatggggatatccag240
tgtttggatccattagtcaagaacgaagctattgcaggtaaatctaaaacagtttctatt300
ccccagaactcagtacctaatggttattactatttccaaatttacgttactttcactaat360
ggaggtaccactattcattattcaccacgtttcaaattgactggtatgtctggtccaact420
gccactttagatgtcaccgaaacaggatcggtgccagcggatcaagcttcaggatttgat480
actgcaactactgccgactccaaatctttcacagttccatataccctacaaacagggaag540
accagatacgcaccaatgcaaatgcaaccaggtaccaaagtgactgctacaacctggagt600
atgaagttcccaactagtgctgttacttactactcaacaaaggctggcacaccaaatgtg660
gcctctactattaccccaggttggagttatactgctgaatctgccgttaactatgctagt720
gttgctccatatccaacatactggtatcctgccagtgaacgagtgagtaaggctacaatt780
agtgctgctacaaagagaagaagatggttggattga 816
<210> 2
<211> 271
<212> PRT
<213> Artificial Sequence
<400> 2
Met Arg Gln Phe Gln Ile Ile Leu Ile Ser Leu Val Val Ser Ile Ile
1 5 10 15
Arg Cys Val Val Ala Asp Val Asp Ile Thr Ser Pro Lys Ser Gly Glu
20 25 30
Thr Phe Ser Gly Ser Ser Gly Ser Ala Ser Ile Lys Ile Thr Trp Asp
35 40 45
Asp Ser Asp Asp Ser Asp Ser Pro Lys Ser Leu Asp Asn Ala Lys Gly
50 55 60
CA 02314611 2000-06-12
WO 99/31269 PCT/CA98/01151
2/3
Tyr Thr Ile Ser Leu Cys Thr Gly Pro Thr Ser Asp Gly Asp Ile Gln
65 70 75 80
Cys Leu Asp Pro Leu Val Lys Asn Glu Ala Ile Ala Gly Lys Ser Lys
85 90 95
Thr Val Ser Ile Pro Gln Asn Ser Val Pro Asn Gly Tyr Tyr Tyr Phe
100 105 110
Gln Ile Tyr Val Thr Phe Thr Asn Gly Gly Thr Thr Ile His Tyr Ser
115 120 125
Pro Arg Phe Lys Leu Thr Gly Met Ser Gly Pro Thr Ala Thr Leu Asp
130 135 140
Val Thr Glu Thr Gly Ser Val Pro Ala Asp Gln Ala Ser Gly Phe Asp
145 150 155 160
Thr Ala Thr Thr Ala Asp Ser Lys Ser Phe Thr Val Pro Tyr Thr Leu
165 170 175
Gln Thr Gly Lys Thr Arg Tyr Ala Pro Met Gln Met Gln Pro Gly Thr
180 18S 190
Lys Val Thr Ala Thr Thr Trp Ser Met Lys Phe Pro Thr Ser Ala Val
195 200 205
Thr Tyr Tyr Ser Thr Lys Ala Gly Thr Pro Asn Val Ala Ser Thr Ile
210 215 220
Thr Pro Gly Trp Ser Tyr Thr Ala Glu Ser Ala Val Asn Tyr Ala Ser
225 230 235 240
Val Ala Pro Tyr Pro Thr Tyr Trp Tyr Pro Ala Ser Glu Arg Val Ser
245 250 255
Lys Ala Thr Ile Ser Ala Ala Thr Lys Arg Arg Arg Trp Leu Asp
260 265 270
<210> 3
<211> 276
<212> PRT
<213> Artificial Sequence
<400> 3
Met Arg Leu Gln Arg Asn Ser Ile Ile Cys Ala Leu Val Phe Leu Val
1 5 10 15
Ser Phe Val Leu Gly Asp Val Asn Ile Val Ser Pro Ser Ser Lys Ala
20 25 30
Thr Phe Ser Pro Ser Gly Gly Thr Val Ser Val Pro Val Glu Trp Met
35 40 45
Asp Asn Gly Ala Tyr Pro Ser Leu Ser Lys Ile Ser Thr Phe Thr Phe
50 55 60
Ser Leu Cys Thr Gly Pro Asn Asn Asn Ile Asp Cys Val Ala Val Leu
65 70 75 80
Ala Ser Lys Ile Thr Pro Ser Glu Leu Thr Gln Asp Asp Lys Val Tyr
85 90 95
Ser Tyr Thr Ala Glu Phe Ala Ser Thr Leu Thr Gly Asn Gly Gln Tyr
100 105 110
Tyr Ile Gln Val Phe Ala Gln Val Asp Gly Gln Gly Tyr Thr Ile His
115 120 125
Tyr Thr Pro Arg Phe Gln Leu Thr Ser Met Gly Gly Val Thr Ala Tyr
130 135 140
Thr Tyr Ser Ala Thr Thr Glu Pro Thr Pro Gln Thr Ser Ile Gln Thr
145 150 155 160
Thr Thr Thr Asn Asn Ala Gln Ala Thr Thr Ile Asp Ser Arg Ser Phe
165 170 175
Thr Val Pro Tyr Thr Lys Gln Thr Gly Thr Ser Arg Phe Ala Pro Met
180 185 190
CA 02314611 2000-06-12
WO 99/31269 PCT/CA9$/01151
3/3
Gln Met Gln Pro Asn Thr Lye Val Thr Ala Thr Thr Trp Thr Arg Lys
195 200 205
Phe Ala Thr Ser Ala Val Thr Tyr Tyr Ser Thr Phe Gly Ser Leu Pro
210 215 220
Glu Gln Ala Thr Thr Ile Thr Pro Gly Trp Ser Tyr Thr Ile Ser Ser
225 230 235 240
Gly Val Asn Tyr Ala Thr Pro Ala Ser Met Pro Ser Asp Asn Gly Gly
245 250 255
Trp Tyr Lys Pro Ser Lys Arg Leu Sex Leu Ser Ala Arg Lys Ile Asn
260 265 270
Met Arg Lys Val
275
<210> 4
<211> 267
<212> PRT
<213> Artificial Sequence
<400> 4
Met Leu Ile Val Leu Phe Leu Thr Leu Phe Cys Ser Val Val Phe Arg
1 5 10 15
Thr Ala Tyr Cys Asp Val Ala Ile Val Ala Pro Glu Pro Asn Ser Val
20 25 30
Tyr Asp Leu Ser Gly Thr Ser Gln Ala Val Val Lys Val Lys Trp Met
35 40 45
His Thr Asp Asn Thr Pro Gln Glu Lys Asp Phe Val Arg Tyr Thr Phe
50 55 60
Thr Leu Cys Ser Gly Thr Asn Ala Met Ile Glu Ala Met Ala Thr Leu
65 70 75 g0
Gln Thr Leu Ser Ala Ser Asp Leu Thr Asp Asn Glu Phe Aen Ala Ile
85 90 95
Ile Glu Asn Thr Val Gly Thr Aap Gly Val Tyr Phe Ile Gln Val Phe
100 105 110
Ala Gln Thr Ala Ile Gly Tyr Thr Ile His Tyr Thr Asn Arg Phe Lys
115 120 125
Leu Lys Gly Met Ile Gly Thr Lys Ala Ala Asn Pro Ser Met Ile Thr
130 135 140
Ile Ala Pro Glu Ala Gln Thr Arg Ile Thr Thr Gly Asp Val Gly Ala
145 150 155 160
Thr Ile Asp Ser Lys Ser Phe Thr Val Pro Tyr Asn Leu Gln Thr Gly
165 170 175
Val Val Lys Tyr Ala Pro Met Gln Leu Gln Pro Ala Thr Lys Val Thr
180 185 190
Ala Lys Thr Trp Lys Arg Lys Tyr Ala Thr Ser Glu Val Thr Tyr Tyr
195 200 205
Tyr Thr Leu Arg Asn Ser Val Asp Gln His Thr Thr Val Thr Pro Gly
210 215 220
Trp Ser Tyr Ile Ile Thr Ala Asp Ser Asn Tyr Ala Thr Ala Pro Met
225 230 235 240
Pro Ala Asp Asn Gly Gly Trp Tyr Asn Pro Arg Lys Arg Leu Ser Leu
245 250 255
Thr Ala Arg Lys Val Asn Ala Leu Arg His Arg
260 265
