METHOD FOR IDENTIFYING VALIDATED TARGET AND ASSAY COMBINATIONS

METHODES POUR IDENTIFIER DES COMBINAISONS DE CIBLES ET DE DOSAGES VALIDES

English Abstract

The invention comprises methods useful within a larger process for identifying
compounds and/or designing further compounds with activity to produce a
desired phenotype (for example, growth inhibition) in cells whose target cell
component is the subject of certain studies to identify such compounds. The
invention employs constructed cells comprising a regulable gene encoding a
biomolecule which modulates (inhibits or activates) in vivo the function of a
target component of the cell which can be an enzyme for example. The process
incorporates methods for identifying biomolecules that bind to a chosen target
cell component in vitro, methods for identifying biomolecules that also bind
to the chosen target and modulate its function intracellularly, causing a
phenotypic effect. The intracellular effect of a biomolecule can be tested in
cell culture, or tested after introduction of the constructed cells into a
host mammal in vivo, and methods for identifying compounds that compete with
the biomolecules for sites on the target in competitive binding assays.
Compounds identified by the series of steps in this process are candidates for
drugs with the desired activity on the cell. Targets for which such compounds
can be identified are validated as being essential to a phenotype of the cell.

French Abstract

L'invention concerne des méthodes permettant, dans le cadre d'un processus plus général, d'identifier des composés et/ou de concevoir de nouveaux composés dont l'activité est destinée à produire le phénotype souhaité (par exemple d'inhibition de la croissance) dans des cellules dont le composant cellulaire cible est le sujet de certaines études, qui visent à identifier les composés susmentionnés. Cette invention utilise des cellules construites, renfermant un gène pouvant être régulé codant pour une biomolécule qui module (inhibe ou active) in vivo la fonction d'un composant cible de ladite cellule, par exemple une enzyme. Le processus de cette invention comprend des méthodes d'identification des biomolécules qui se lient in vitro à un composant cellulaire cible choisi, ainsi que des méthodes d'identification des biomolécules qui se lient également à la cible choisie et qui modulent sa fonction de manière intracellulaire, provoquant ainsi un effet phénotypique. L'effet intracellulaire d'une biomolécule peut être testé dans une culture cellulaire, ou après l'introduction desdites cellules construites dans un mammifère hôte in vivo. Cette invention concerne également des méthodes d'identification des composés qui entrent en compétition avec des biomolécules pour des sites de la cible dans des dosages par liaison compétitive. Les composés identifiés au cours des différentes étapes de ce processus sont potentiellement des médicaments présentant l'activité voulue sur la cellule. Les cibles de ces composés ainsi identifiés sont validées comme étant essentielles à un phénotype de la cellule.

Claims

-50-

CLAIMS

What is claimed is:

1. A method for determining whether a biomolecule produces a phenotypic
effect on a cell, comprising the steps of:
a) introducing into an animal a cell comprising an exogenous gene
encoding the biomolecule, wherein the gene is regulable by the
introduction of a repressor or inducer into the animal;
b) introducing the repressor or inducer into the animal, thereby
regulating expression of the gene to produce the biomolecule in the
cell; and
a) monitoring said cell in the animal for a phenotypic effect;
whereby if the cell manifests a phenotypic effect, the biomolecule produces a
phenotypic effect on the cell.
2. A method for determining whether a target component of a cell is essential
for normal growth of said cell, comprising:
a) in cells comprising a biomolecule and a target cell component,
wherein the biomolecule is a biomolecular binder of the target cell
component, and wherein a gene encoding the biomolecule is
regulable, regulating expression of tho gene to produce the
biomolecule by addition of repressor or inducer to the cells in culture;
b) monitoring growth of the cells in culture relative to growth of
suitable control cells, whereby, if growth is decreased in the cells
compared to growth of suitable control cells, then the biomolecule is
a biomolecular inhibitor of growth;
e) introducing into one or more test animals cells in which growth can
be decreased compared to the control cells as determined in step b);
d) introducing repressor or inducer into the test animals, thereby
regulating expression of the gene to produce the biomolecular
inhibitor of growth in the introduced cells; and



-51-



e) monitoring said test animals for inhibition of the growth of the cells;
wherein observing fewer cells, slower growth of cells, or fewer or loss severe
changes caused by the cells in said test animals compared to cells, growth of
cells, or changes caused by the cells, respectively, in suitable control
animals
indicates that the target component of said cell is essential for normal
growth
of said cell.
3. A method for identifying a biomolecular inhibitor of growth of cells,
comprising:
a) in cells comprising a biomolecule and a target cell component,
wherein the biomolecule is a biomolecular binder of the target cell
component, and the gene encoding the biomolecule is regulable,
regulating expression of the gene to allow production of the
biomolecule;
b) monitoring growth of the cells in culture relative to growth of
suitable control cells, whereby, if growth is decreased in the cells
compared to growth o f suitably control cells, then the biomolecule is
a biomolecular inhibitor of growth of the cells in culture;
c) introducing into one or more test animals cells in which growth can
be decreased compared to the control cells in step b);
d) regulating expression of the gene to allow production of the
biomolecule in the introduced cells; and
c) monitoring said test animals for inhibition of the growth of the cells;
wherein observing fewer cells, slower growth of cells, or fewer or less severe
changes caused by the cells in said test animals compared to cells, growth of
cells, or changes caused by the cells, respectively, in suitable control
animals
indicates that the biomolecule is a biomolecular inhibitor or growth of the
cells.
4. A method for identifying one or more compounds that are binding analogs of
a biomolecular binder, said method comprising the steps of:



-52-



a) identifying a biomolecular binder of an isolated target cell component
of said cell;
b) constructing a second cell in which an exogenous gene encoding said
biomolecular binder is regulably expressed;
c) testing said second cell in culture for the phenotypic effect upon
expression of the gene encoding the biomolecular binder; and
d) identifying, if the biomolecular binder caused the phenotypic effect in
the second cell, one or more compounds that compete with the
biomolecular binder for binding to the target cell component in a
competitive binding assay;
whereby, if a compound competes with the biomolecular binder for binding
to the target cell component, then the compound is a binding analog of the
biomolecular binder.
5. A method for identifying a compound which is a binding analog of a
biomolecular binder, comprising:
a) identifying a biomolecular binder of an isolated target cell component
of the first cell;
b) constructing a second cell comprising the target cell component and
an exogenous gene which encodes the biomolecular binder, wherein
the gene is regulable by introduction of a repressor or inducer into the
animal;
c) introducing the second cell into one or more animals;
d) introducing the repressor or inducer into the animal, thereby
regulating expression of the gene to produce the biomolecular binder
in the second cell;
e) monitoring the second cell in the animal(s) for the phenotypic effect;
and
f) identifying, if the biomolecular binder caused the phenotypic effect in
the second cell, one or more compounds that compete with the
biomolecular binder for binding to the target cell component;



-53-



whereby, if a compound competes with the biomolecular binder for binding
to the target cell component, then the compound is a binding analog of the
biomolecular binder.
6. A method for determining whether a biomolecule produces a phenotypic
effect on a cell of a pathogenic species, comprising the steps of:
a) introducing into as animal a cell of a pathogenic species, comprising
an exogenous gene encoding the biomolecule;
b) regulating expression of the gene to product the biomolecule in the
cell; and
e) monitoring said cell in the animal for a phenotypic effect;
whereby if the cell manifests a phenotypic effect, the biomolecule produces a
phenotypic effect on the cell.
7. A method for determining whether a biomolecule products a phenotypic
effect on a cell of a pathogenic species, comprising the steps of:
a) constructing a cell of a pathogenic species, comprising an exogenous
gene encoding the biomolecule;
b) introducing said cell into an animal;
c) regulating expression of the gene to product the biomolecule in the
cell; and
d) monitoring said cell in the animal far a phenotypic effect;
whereby if the cell manifests a phenotypic effect, the biomolecule produces a
phenotypic effect on the cell.
8. A method for determining whether a biomolecular binder produces a
phenotypic effect on a first cell of a pathogenic species, comprising:
a) identifying a biomolecular binder of an isolated target cell component
of the first cell;
b) constructing a second cell of the pathogenic species comprising the
target cell component and a regulable, exogenous gene encoding the
biomolecular binder; and



-54-



e) testing the second cell in culture for the phenotypic effect, upon
production of the biomolecular binder in the second cell;
whereby, if the second cell shows the phenotypic effect upon production of
the biomolecular binder, then the biomolecular binder products a phenotypic
effect on the first cell.
9. A method for determining whether a target component of a first cell of a
pathogenic species is essential to producing normal growth of said cell
during infection, comprising:
a) identifying a biomolecular binder of a target component of the first
cell;
b) constructing a second cell of the pathogenic species, comprising the
target component and a regulable, exogenous gene encoding the
biomolecular binder;
c) infecting one or more test animals with the a second cell;
d) regulating expression of the exogenous gene in the second cell to
produce the biomolecular binder; and
o) monitoring the test animals and one or more suitable control animals
for signs of infection;
wherein observing fewer or less seven signs of infection in the test animals
than in the control animals indicates that the target component of the first
cell is essential to producing normal growth of said cell during infection.
10. A method for identifying one or more compounds that are binding analogs of
a biomolecular binder of a target cell component of a pathogenic species,
said method comprising the steps of:
a) identifying a biomolecular binder of an isolated target cell component
of the pathogenic species;
b) constructing a cell of the pathogenic species in which an exogenous
gene encoding said biomolecular binder is regulably expressed;
c) testing said cell in culture for the phenotypic effect upon expression
of the gene encoding the biomolecular binder; and



-55-



d) identifying if the biomolecular binder caused the phenotypic effect in
the cell, one or more compounds that compete with the biomolecular
binder for binding to the target cell component is a competitive
binding assay;
whereby, if a compound competes with the biomolecular binder for binding
to the target cell component, than the compound is a binding analog of the
biomolecular binder of a target cell component of a pathogenic species.
11. A method for identifying a biomolecular inhibitor of growth of cells of a
pathogen comprising:
a) contacting a biomolecule with isolated target cell component of the
pathogen;
b) applying a means of detecting bound complexes of biomolecules and
target cell component, whereby, if said bound complexes are
detected, the biomolecule has been identified as a biomolecular
binder of the target cell component;
c) constructing a pathogen having a regulable gene encoding the
biomolecular binder;
d) regulating expression of the gene encoding the biomolecular binder,
thereby expressing the gene; and
c) monitoring growth of cells of the pathogen in culture relative to
suitable control cells;
whereby, if growth of the cells of the pathogen is decreased compared to
growth of suitable control cells, then the biomolecule(s) is a biomolecular
inhibitor of growth of the pathogen cells.
12. A method for identifying one or more compounds that bind to a target cell
component of a pathogen, comprising:
a) constructing a pathogen comprising a regulable gene encoding a
biomolecule which binds to the target cell component;
b) infecting one or more test animals with the constructed pathogen;



-56-



c) regulating expression of the regulable gene to produce the
biomolecule;
d) monitoring the test animals and one or more suitable control animals
for signs of infection, wherein observing fewer or less severe signs of
infection in the test animals than in the control animals indicates that
the biomolecule is a biomolecular inhibitor of infection; and
e) identifying one or more compounds that compete with the
biomolecular inhibitor of infection for binding to the target cell
component in a competitive binding assay;
whereby, if a compound competes with the biomolecular inhibitor of
infection for binding to the target cell component, then the compound binds
to a target cell component of a pathogen.
13. A method for identifying one or more compounds that bind to a target cell
component of a pathogen, comprising:
a) constructing a pathogen comprising a regulable gene encoding a
biomolecule which binds to the target cell component;
b) regulating expression of the gene in a culture of constructed pathogen
cells, thereby producing the biomolecule in the constructed pathogen
cells;
c) monitoring growth of the constructed pathogen cells in culture,
relative to growth of suitable control cells, whereby, if growth is
decreased in the constructed pathogen cells, compared to growth of
the control cells, then the biomolecule is a biomolecular inhibitor of
growth;
d) infecting one or more test animals with the constructed pathogen
cells;
e) regulating expression of the regulable gene, thereby producing the
biomolecule in the constructed pathogen cells in the test animals;
f) monitoring the test animals and the control animals for signs of
infection, wherein observing fewer or less severe signs of infection in


-57-

the test animals than in the control animals indicates that the
biomolecule is a biomolecular inhibitor of infection; and
g) identifying one or more compounds that compete with the
biomolecular inhibitor of infection for binding to the target cell
component;
whereby, if a compound competes with the biomolecular inhibitor of
infection for binding to the target cell component, then the compound binds
to the target cell component of the pathogen.
14. A method for identifying a biomolecular inhibitor of infection,
comprising:
a) is pathogen cells comprising a biomolecule and a cell component,
wherein the biomolecule is a biomolecular binder of the cell
component, and expression of the gene encoding the biomolecule is
regulable, regulating expression of the gene, thereby producing the
biomolecule;
b) monitoring growth of the pathogen cells in culture relative to growth
of the control cells, whereby, if growth is decreased in the pathogen
cells compared to growth of the control cells, then the biomolecule is
a biomolecular inhibitor of growth;
c) infecting one or more test animals with the pathogen cells in which
growth was decreased compared to the control cells in step b);
d) regulating expression of the gene, thereby producing the biomolecule
in the pathogen cells in the animals; and
e) monitoring said test animals for signs of infection;
wherein observing fewer or less severe signs of infection in said test animals
compared to signs of infection is suitable control animals indicates that the
biomolecule is a biomolecular inhibitor of infection.

Description

CA 02317653 2000-07-06
WO 99135494 PCTNS99l00474
METHOD FOR IDENTIFYING VALIDATED
TARGET AND ASSAY COMBINATIONS
RELATED APPLICATIONS
This application claims the benefit of U.S. Patent Application Number
60/070,965 filed on January 9, 1998; U.S. Patent Application Number 601076,638
filed on March 3, 1998; U.S. Patent Application Number 60/081,753 filed on
April
14, 1998; U.S. Patent Application Number 60/085,844 filed on May 18, 1998;
U.S.
Patent Application Number 60/089,828 filed on June 19, 1998; U.S. Patent
Application Number 60/094,698 filed on July 30, 1998; U.S. Patent Application
Number 60/100,211 filed on September 14, 1998; U.S. Patent Application Number
60/101,718 filed on September 24, 1998; and U.S. Patent Application Number
60/107,751 filed on November 10, 1998. The teachings of each of these
referenced
applications are incorporated herein by reference in their entirety.
BACKGROUND OF THE INVENTION
In the discovery and development of new drugs, it is a common strategy to
first try to identify molecules or complexes of molecules, naturally occurring
within
cells, that are involved in producing symptoms of a disease. These naturally
occurnne molecules can be thought of as "targets." A second major part of the
strategy is then to find molecules that bind to the targets. These molecules
are
candidates for drug development, on the theory that a molecule that binds to a
target
can modulate (inhibit or enhance) the function of the target, thereby causing
a
change in the biological status of the cell containing the target. The change
caused
in the cell (e.g., a change in phenotype towards wild type, or a change in
growth
rate) may be therapeutically beneficial to the animal or human host of the
cell.
The genomics revolution, by determining the DNA sequences of great
numbers of genes from many different organisms, has considerably broadened the
possibilities for drug discovery by identifying large numbers of molecules
that are
potential targets of drug action. These technical advances in genomics
however,
have posed an entirely new set of challenges. Specifically, how can one prove
that a
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 2 PCTNS99/00474
chosen target molecule is essential to maintaining the disease or disorder to
be
treated? That is, how does one validate a target? (See "target validation" in
Definitions.}
Although methods currently available to validate targets do provide some
guidelines in selection of drug targets, they are usually not conducted under
the
conditions in which a drug actually interacts with its target, and therefore
provide a
limited set of information. In addition, they do not directly address, among
other
things: 1 ) if a wild type (normal) target is essential for cell growth and
viability
during the disease state; 2) if the wild type gene products themselves are
suitable
targets for drug discovery; 3) if specific sites on a target are suitable for
drug
interaction (for example, in a pathogenic organism, there can be one gene
coding for
a single protein target with two activities -- one activity essential for
growth and
infectivity, the second activity non-essential); 4) if a compensatory
mechanism in
the cell, either in vitro or in vivo, can overcome or compensate for target
modulation
or, 5) if a disease state can be cured by modulation of function of the
candidate
target. These methods also do not provide a direct route for testing wild type
target
proteins in high throughput screening assays.
An analysis of the discovery of novel antimicrobial agents illustrates the
problems researchers in all fields of drug development face today. The
increasing
prevalence of drug-resistant pathogens (bacteria, fungi, parasites, etc.) has
led to
significantly higher mortality rates from infectious diseases and currently
presents a
serious crisis worldwide. Despite the introduction of second and third
generation
antimicrobial drugs, certain pathogens, such as vancomycin resistant strains
of
Enterococcus facieunt, have developed resistance to all currently available
drugs.
New antimicrobial drugs must be discovered to treat such infections by such
organisms, and new methods are urgently needed to facilitate making such
discoveries.
Neither whole cell screening, chemistry nor target based drug discovery
approaches as currently applied, have met the challenge of controlling
infectious
diseases, particularly those caused by drug resistant microorganisms. Whole
cell
screening assays have been limited by the fact that they are unable to
identify
compounds that can effectively modulate a target function inside the cell but
cannot
permeate the cell membrane to get to the target. Therefore entire classes of
potent,
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/004~4
3
intracellular target modulators, which could be subsequently modified by
medicinal
chemistry to increase cell membrane permeability, go undetected. Chemistry
based
approaches have focused on chemically modifying the molecular structure of
existing antimicrobial drugs or combining existing antimicrobials with another
agent
to circumvent established resistance mechanisms. Technical advances in
molecular
biology, automated methods for high throughput screening and chemical
syntheses
have led to an increase in the number of target based screens utilized for
antimicrobial drug discovery and in the number of compounds being analyzed.
However, despite these advances, only a limited number of antimicrobial dntgs
acting by a novel mechanism have been identified during recent years.
How does one efficiently establish screening assays for drugs that can be
used with a variety of different targets having different properties,
enzymatic
activities, or even unknown functions? A number of potentially novel, valuable
targets are incompatible with current methods to screen for drug candidates
because
either the target's exact function and molecular mechanism of action are
unknown,
or there are technical obstacles preventing the development of effective high
throughput screening methods. It can take anywhere from six months to several
years to develop a screening assay, which is impractical when the goal is to
rapidly
screen multiple targets in a cost-effective manner.
The path in the progression from target identification through assay
development, high throughput screening, medicinal chemistry, lead
optimization,
preclinical and clinical drug development is expensive, time consuming and
full of
technical challenges. Many different targets must be screened against multiple
chemical compounds to identify new lead compounds for drug development. New,
efficient technologies are needed that can be broadly applied to a variety of
different
targets to validate targets in the direct context of the desired outcome of
drug
therapy and to rapidly develop screening assays using these targets for drug
discovery. Such developments will allow the wealth of genomics information to
be
leveraged for drug discovery and will lower the risk and costs while
expediting the
timelines of the drug discovery process.
SUBSTITUTE SHEET (RU'LE 25)


CA 02317653 2000-07-06
WO 99/35494 PCTNS99/00474
4
SUMMARY OF THE INVENTION
The invention relates to methods that couple the validation of a target (see
Definitions) for drug discovery with the development of an assay to identify
compounds that cause a phenotypic effect on the target cell. These procedures
can
be applied to identifying compounds that bind to and modulate the function of
target
components of a cell whose function is known or unknown, and cell components
that are not amenable to other screening methods.
The invention relates to procedures for identifying a compound that binds to
and modulates (inhibits or enhances) the function of a component of a cell,
thereby
producing a phenotypic effect in the cell. Within these procedures are methods
for
identifying a biomolecule (See Definitions section) that 1 ) binds to, in
vitro, a
component of a cell that has been isotated from other constituents of the cell
and that
2) causes, in vivo, as seen in an assay upon intracellular expression of the
biomolecule, a phenotypic effect (See Definitions section) in the cell which
is the
usual producer and host of the target cell component. In an assay
demonstrating
characteristic 2) above, intracellular production of the biomolecule can be in
cells
grown in culture or in cells introduced into an animal. Further methods within
these
procedures are those methods comprising an assay for a phenotypic effect in
the cell
upon intracellular production of the biomolecule, either in cells in culture
or in cells
that have been introduced into one or more animals, and an assay to identify
one or
more compounds that behave as competitors of the biomolecule in an assay of
binding to the target cell component.
One procedure envisioned in the invention is a process, for identifying one or
more compounds that produce a phenotypic effect on a cell. The process is at
the
same time a method for target validation (See Definitions section). The
process is
characterized by identifying a biomolecule which binds an isolated target cell
component, constructing cells comprising the target cell component and further
comprising a gene encoding the biomolecular binder which can be expressed to
produce the biomolecular binder, testing the constructed cells for their
ability to
produce, upon expression of the gene encoding the biomoiecular binder, a
phenotypic effect in the cells (e.g., inhibition of growth), wherein the test
of the
constructed cells can be a test of the cells in culture or a test of the cells
after
introducing them into host animals, or both, and further, identifying, for a
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 ~ PCT/US99/00474
biomolecular binder that caused the phenotypic effect, one or more compounds
that
compete with the biomolecular binder for binding to the target cell component.
A test of the constructed cells after introducing them into host animals is
especially well-suited to assessing whether a biorriolecular binder can
produce a
S particular phenotype by the expression (regulatable by the researcher) of a
gene
encoding the biomolecular binder. In this method, cells are constructed which
have
a gene encoding the biomolecular binder, and wherein the biomolecular binder
can
be produced by regulation of expression of the gene. The constructed cells are
introduced into a set of animals. Expression of the gene encoding the
biomolecular
binder is regulated in one group of the animals (test animals) such that the
biomolecular binder is produced. In another group of animals, the gene
encoding
the biomolecular binder is regulated such that the biomolecular binder is not
produced (control animals). The cells in the two groups of animals are
monitored
for a phenotypic change (for example, a change in growth rate). If the
phenotypic
change is observed in cells in the test animals and not in the cells in the
control
animals, or to a lesser extent in the control animals, then the biomolecular
binder has
been proven to be effective in binding to its target cell component under in
vivo
conditions.
A further embodiment of the invention is a method for determining whether
a target cell component of a particular cell type (a "first cell") is
essential to
producing a phenotypic effect on the first cell, the method having the steps:
isolating the target component of the first cell; identifying a biomolecular
binder of
the isolated target component of the first cell; constructing a second type of
cells
("second cell") comprising the target component and a regulable, exogenous
gene
encoding the biomolecular binder; and testing the-second cell in culture for
an
altered phenotypic effect, upon production of the biomolecular binder in the
second
cell; whereby, if the second cell shows the altered phenotypic effect upon
production
of the biomolecular binder, then the target component of the first cell is
essential to
producing the phenotypic effect on the first cell. The target cell component
in this
embodiment and in other embodiments not limited to pathogens can be one that
is
found in mammalian cells, especially cells of a type found to cause or
contribute to
disease or the symptoms of disease (e.g., cells of tumors or cells of other
types of
hvperproliferative disorders).
SUBSTITUTE SHEET (RUi.E -26)


CA 02317653 2000-07-06
WO 99/35494 6 PCT/US99/00474
The invention further relates to methods particularly well suited to a
procedure for identifying and/or designing compounds with antimicrobial
activity
against a pathogen whose target cell component is the subject of studies to
identify
such compounds. A common mechanism of action of an antimicrobial agent is
binding to a component of the cells of the pathogen treated with the
antimicrobial.
The procedure includes methods for identifying biomolecules that bind to a
chosen
target in vitro, methods for identifying biomolecules that also bind to the
chosen
target and modulate its function during infection of a host mammal in vivo,
and
methods for identifying compounds that compete with the biomolecules for sites
on
the target in competitive binding assays. Compounds identified by this
procedure
are candidates for drugs with antimicrobial activity against the pathogen.
One embodiment of the invention is a method for identifying a biomolecular
inhibitor of growth of pathogen cells by using cell culture techniques,
comprising
contacting one or more types of biomolecules with isolated target cell
component of
the pathogen, applying a means of detecting bound complexes of biomolecules
and
target cell component, whereby, if the bound complexes are detected, one or
more
types of biomolecules have been identified as a biomolecular binder of the
target cell
component, constructing a pathogen strain having a regulable gene encoding the
biomolecular binder, regulating expression of the gene encoding the
biomolecular
binder to express the gene; and monitoring growth of the pathogen cells in
culture
relative to suitable control cells, whereby, if growth of the pathogen cells
is
decreased compared to growth of suitable control cells, then the biomolecule
is a
biomolecular inhibitor of growth of the pathogen cells.
A further embodiment of the invention is a method, employing an animal
test, for identifying one or more compounds that inhibit infection of a mammal
by a
pathogen by binding to a target cell component, comprising constructing a
pathogen
comprising a regulable gene encoding a biomolecule which binds to the target
cell
component, infecting test animals with the pathogen, regulating expression of
the
regulable gene to produce the biomolecule, monitoring the test animals and
suitable
control animals for signs of infection, wherein observing fewer or less severe
signs
of infection in the test animals than in suitable control animals indicates
that the
biomolecule is a biomolecular inhibitor of infection, and identifying one or
more
compounds that compete with the biomolecular inhibitor of growth for binding
to
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99/35494 ~ _ PCT/US99/00474
the target cell component (as by employing a competitive binding assay), then
the
compound inhibits infection of a mammal by a pathogen by binding to a target.
The competitive binding assay to identify binding analogs of biomolecular
binders, which have been proven to bind to their targets in an intracellular
test of
binding, can be applied to any target for which a biomolecular binder has been
identified, including targets whose function is unknown or targets for which
other
types of assays are not easily developed and performed. Therefore, the method
of
the invention offers the advantage of decreasing assay development time when
using
a gene product of known function as a target cell component and the advantage
of
bypassing the major hurdle of gene function identification when using a gene
product of unknown function as a target cell component.
Other embodiments of the invention are cells comprising a biomolecule and
a target cell component, wherein the biomolecule is produced by expression of
a
regulable gene, and wherein the biomolecule modulates function of the target
cell
component, thereby causing a phenotypic change in the cells. Yet other
embodiments are cells comprising a biomolecule and a target cell component,
wherein the biomolecule is a biomolecular binder of the target cell component,
and
is encoded by a regulable gene. The cells can include mammalian cells or cells
of a
pathogen, for instance, and the phenotypic change can be a change in growth
rate.
The pathogen can be a species of bacteria, yeast, fungus, or parasite, for
example.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is an illustration showing the steps in cloning of the Pro-3 peptide
for regulated expression as a GST (glutathione-S transferase) fusion protein.
See
Example 1.
Figure 2 is a photograph of an SDS-polyacrylamide gel showing expression
of the Pro-3 peptide in E. coli cells. Production of the Pro-3/GST fusion and
production of ~i-galactosidase in E. coli cells carrying pC'844 or pPROTet-
LacZ
were analyzed by SDS-PAGE. The concentrations of anhydrotetracycline (aTc)
used for induction of gene expressian are indicated above the lanes on the
gel. See
Example 2.
Figure 3A is a graph showing E. coli growth inhibition by expression of Pro-
3 peptide encoded on the pC3844 plasmid. The ODD of the bacterial cultures in
the
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 R PCT/US99/00474
presence (+aTc) or absence (-aTc) of anhydrotetracycline were monitored at the
time
points shown. See Example 2.
Figure 3B is a graph showing results of a control experiment to compare
with the results shown in Figure 3A. The E. coli cells used in the experiment
harbor
the pPROTet-GST plasmid.
Figure 4A is a graph showing functional complementation of growth
inhibition by Pro-3 peptide, by expression of a heterologous ProRS gene. The
growth of E. coli cells DHSaPRO/pC'844 carrying a Staphylococcus aureus ProRS
expression construct was characterized in the presence (Pro3 Expression) or
absence
(No Pro3 Expression) of 200 ng/ml anhydrotetracycline by monitoring ODD at the
time points shown.
Figure 4B is a graph showing the results of a control experiment to compare
with the results in Figure 4A. The growth of E. coli cells DHSaPRO/pC'844
carrying pACYCI77 was characterized in the presence (Pro3 Expression) or
absence
(No Pro3 Expression) of 200 ng/ml anhydrotetracycline by monitoring ODD at the
time points shown.
Figure 5 is a scanned image of an 18% SDS-polyacrylamide gel stained with
Coomassie blue. Inducible expression of chloramphenicol acetyltransferase
(CAT)
in S. aureus. The whole cell lysates of S. aureus RN4220 (Host) or RN4220
harboring pWH353 (C3SaE-1 ) or pWH354 (C3SaE-2) with (+) or without (-}
tetracycline induction were analyzed by electrophoresis on an 18% SDS-
polyacrylamide gel.
Figure 6 is a graph showing S. aur-eus MetRS tRNA charging activity
(shown as counts per minute of trichloracetic acid precipitable ['H]-
methionine) is
inhibited by increasing concentrations of JTO1.
Figure 7 is a graph showing fluorescence polarization plotted with the
concentration of compound added, indicating inhibition of Pro3 peptide binding
to
E. coli ProRS in this assay by known inhibitors: open circles, CB-16914;
fclled
circles, CB-118831; open squares. CB-680 negative control.
Figure 8 is a bar graph showing fluorescence of microtiter wells in the assay
described in Example 9. Wells 1-G contain Met-1F alone. Wells 7 and 8 contain
S.
ac~reus MetRS (methionyl-tRNA synthetase) alone; wells 9-18 and 19-28 contain
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 9 PCTNS99100474
Met-1 peptide from 640 nM to 1.25 nM; wells 29-96 contain 1% DMSO (dimethyl
sulfoxide).
DETAILED DESCRIPTION OF THE IIWENTION
Definitions
Target: (also. "target component of a cell," or "target cell component")
a constituent of a cell which contributes to and is necessary for the
production or
maintenance of a phenotype of the cell in which it is found. A target can be a
single
type of molecule or can be a complex of molecules. A target can be the product
of a
single gene, but can also be a complex comprising more than one gene product
(for
example, an enzyme comprising a and (3 subunits, mRNA, tRNA, ribosomal RNA
or a ribonucleoprotein particle such as a snRNP). Targets can be the product
of a
characterized gene (gene of known function) or the product of an
uncharacterized
gene (gene of unknown function).
Target Validation: the process of determining whether a target is essential to
the
maintenance of a phenotype of the cell type in which the target normally
occurs.
For example, for pathogenic bacteria, researchers developing antimicrobials
want to
know if a compound which is potentially an antimicrobial agent not only binds
to a
target in vitro, but also binds to, and modulates the function of, a target in
the
bacteria in vivo, and especially under the conditions in which the bacteria
are
producing an infection -- those conditions under which the antimicrobial agent
must
work to inhibit bacterial growth in an infected animal or human. If such
compounds
can be found that bind to a target in vitro and alter the target's function in
cells
resulting in an altered phenotype, as found by testing cells in culture and/or
as found
by testing cells in an animal, then the target is validated.
Phenotypic Effect: a change in an observable characteristic of a cell which
can
include, e.g., growth rate, level or activity of an enzyme produced by the
cell,
sensitivity to various agents, antigenic characteristics, and level of various
metabolites of the cell. A phenotypic effect can be a change away from wild
type
(normal) phenotype, or can be a change towards wild type phenotype, for
example.
A phenotypic effect can be the causing or curing of a disease state,
especially where
mammalian cells are referred to herein. For cells of a pathogen or tumor
cells,
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 1 ~ PCTNS99/00474
especially, a phenotypic effect can be the slowing of growth rate or cessation
of
growth.
Biomolecule: a molecule which can be produced as a gene product in cells that
have
been appropriately constructed to comprise one or more genes encoding the
biomolecule. Preferably, production of the biomolecule can be turned on, when
desired, by an inducible promoter. A biomolecule can be a peptide,
polypeptide, or
an RNA or RNA oligonucleotide, a DNA or DNA oligonucleotide, but is preferably
a peptide. The same biomolecules can also be made synthetically. For peptides,
see
Merrifield, J., J. Am. Chem. Soc. 85: 2140-2154 (1963). For instance, an
Applied
Biosystems 431A Peptide Synthesizer (Perkin Elmer) can be used for peptide
synthesis. Biomolecules produced as gene products intracellularly are tested
for
their interaction with a target in the intracellular steps described herein
(tests
performed with cells in culture and tests performed with cells that have been
introduced into animals). The same biomolecules produced synthetically are
tested
for their binding to an isolated target in an initial in vitro method
described herein.
Synthetically produced biomolecules can also be used for a final step of the
method
for finding compounds that are competitive binders of the target.
Biomolecular Binder (of a target): a biomolecule which has been tested for its
ability to bind to an isolated target cell component in vitro and has been
found to
bind to the target.
Biomolecular Inhibitor of Growth: a biomolecule which has been tested for its
ability to inhibit the growth of cells constructed to produce the biomolecule
in an "in
culture" test of the effect of the biomolecule on growth of the cells, and has
been
found, in fact, to inhibit the growth of the cells in this test in culture.
Biomolecular Inhibitor of Infection: a biomolecule which has been tested for
its
ability to ameliorate the effects of infection, and has been found to do so.
In the test,
pathogen cells constructed to regulabiy express the biomolecule are introduced
into
one or more animals, the gene encoding the biomolecule is regulated so as to
allow
production of the biomolecule in the cells, and the effects of production of
the
biomolecule are observed in the infected animals compared to one or more
suitable
control animals.
Isolated: term used herein to indicate that the material in question exists in
a
physical milieu distinct from that in which it occurs in nature. For example,
an
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99135494 11 PCTNS99/00474
isolated target cell component of the invention may be substantially isolated
with
respect to the complex cellular milieu in which it naturally occurs. The
absolute
level of purity is not critical, and those skilled in the art can readily
determine
appropriate levels of purity according to the use to which the material is to
be put.
In manv circumstances the isolated material will form part of a composition
(for
example: a more or less crude extract containing other substances), buffer
system or
reagent mix. In other circumstances, the material may be purified to essential
homogeneity, for example as determined by PAGE or column chromatography (for
example, HPLC).
Pathogen or Pathgenic Organism: an organism which is capable of causing
disease,
detectable by signs of infection or symptoms characteristic of disease.
Pathogens
can include proearyotes (which include, for example, medically significant
Gram-
positive bacteria such as Streptococcus pneumoniae, Enterococcus jaecalis and
Staplylococcus aureus, Gram-negative bacteria such as Escherichia coli,
Pseudomonas aeroginosa and Klebsiella pneumoniae, and "acid-fast" bacteria
such
as Mvcobacteria, especially M. tuberculosis), eucaryotes such as yeast and
fungi (for
example, Candida albicans arid Aspergillars fumigatus) and parasites. It
should be
recognized that pathogens can include such organisms as soil-dwelling
organisms
and "normal flora" of the skin, gut and orifices, if such organisms colonize
and cause
symptoms of infection in a human or other mammal, by abnormal proliferation or
by growth at a site from which the organism cannot usually be cultured.
The present invention relates to methods that couple the validation of a
target
cell component for drug discovery with the development of a validated assay to
identify compounds that cause a phenotypic effect,on the target cell (cell
harboring
the target cell component). When the target cells are cells of a pathogenic
organism,
compounds identified by this procedure are candidates for drugs with
antimicrobial
activity against the pathogen.
The method utilized for target validation provides a test of how a
biomolecule produced intracellularly binds to a specific site on a target cell
component and alters the target's function in a cell during an established
infection or
disease. The technology to validate the target identifies a biomolecule
specific to
the target that can be used in a screening assay to identify drug leads,
thereby
coupling target validation with drug lead identification. The method alsa
validates
SUBSTITUTE SHEET (RUi.E 2B)


CA 02317653 2000-07-06
WO 99/35494 12 PCTNS99l00474
specific sites on a target molecule for drug discovery, which is especially
important
for proteins involved in multiple functions.
Described herein are methods that result in the identification of compounds
that cause a phenotypic effect on a cell. The general steps described herein
to find a
compound for drug development can be thought of as these: ( 1 } identifying a
biomolecule that can bind to an isolated target cell component in vitro, (2)
confirming that the biomolecule, when produced'in cells with the target cell
component, can cause a desired phenotypic effect and (3) identifying, by an in
vitro
screening method, for example, compounds that compete with the biomolecule for
binding to the target cell component. Advantages of the these steps are that
it is not
necessary to identify the function of the target cell component and it is not
necessary
to develop an assay tailored to the function (e.g., enzyme activity) of the
target cell
component.
Central to these methods is general step (2) above, intracellular validation
of
a biomolecule comprising one or more steps that determine whether a
biomolecule
can cause a phenotypic effect on a cell, when the biomolecule is produced by
the
expression (which can be regulable) of a gene in the cell. As used in general
step
(2), a biomolecule is a gene product (e.g., polypeptide, RNA, peptide or RNA
oligonucleotide) of an exogenous gene -- a gene which has been introduced in
the
course of construction of the cell. See also Definitions section.
Biomolecules that bind to and alter the function of a candidate target are
identified by various in vitro methods. Upon production of the biomolecule
within a
cell either in vitro or within an animal model system, the biomolecule binds
to a
specific site on the target, alters its intracellular function, and hence
produces a
phenotypic change (e.g. cessation of growth, cell death). When the biomolecule
is
produced in engineered pathogen cells in an animal model of infection,
cessation of
growth or death of the engineered pathogen cells leads to the clearing of
infection
and animal survival, demonstrating the importance of the target in infection
and
thereby validating the target.
A method for ( 1 ) identifying a biomolecule that produces a phenotypic effect
on a cell (wherein the cell can be, for instance, a pathogen cell or a
mammalian cell)
and (2) simultaneous intracellular target validation, can comprise steps of
introducing into an animal a cell comprising an exogenous regulable gene
encoding
SUBSTITUTE SHEET (RUIrE 26)


CA 02317653 2000-07-06
WO 99/35494 13 PCT/US99/00474
the biomolecule, regulating expression of the gene to produce the biomolecuie
in the
cell, and monitoring said cell in the animal for a phenotypic effect, compared
to a
suitable control cell. If the cell of this test manifests a phenotypic effect.
this
indicates that the biomolecule produced in the cell causes a phenotypic effect
on the
cell. If this phenotypic effect is the inhibition of growth of the cells, then
the
biomolecule can be termed a "biomolecular inhibitor" or a "biomolecular
inhibitor
of growth." It may be desirable to perform another test of intracellular
function,
using cell culturing techniques, wherein the cell comprising an exogenous
regulable
gene encoding the biomolecule of interest, and comprising the target cell
component, is treated so as to turn on expression of the gene encoding the
biomolecule, and one or more phenotypic characteristics of the cells in
culture are
monitored relative to suitable control cells, where the control cells do not
produce
the biomolecule. It may be preferable, where both "in culture" and "in animal"
intracellular tests are performed, to do an "in culture" test first.
The purpose of intracellular validation for the combination of a potential
target for drug action and molecule for drug development is two-fold. First,
it
demonstrates that the biomolecule under study produces a phenotypic effect on
a
living cell. In contrast with conditions in an in vitro binding test, the
biomolecule in
an intracellular test is exposed to a multitude of potential binding partners
in the
living cell, and interaction with one or more of these binding partners in the
cell may
be unproductive or result in undesirable effects. These effects are not
detectable in
an in vitro binding test. Second, where a biomolecule has been shown
previously by
in vitro tests to bind to a target cell component (that is, the biomolecule
can be
called a "biomolecular binder" of the target cell component; See Definitions
section), intracellular validation provides proof that the target cell
component is
essential to the maintenance of the original phenotype of the cell. Therefore,
the
target is validated for drug discovery and the biomolecule can then be
utilized in a
competitive binding assay to identify compounds that wilt have an effect on
target
molecule function.
Efficient binding between a biomolecule and a target cell component may be
demonstrated in vitro; even binding that inhibits activity of a target enzyme
may be
demonstrated in vitro. However, in the living cells, there could exist a
redundant
system that nullifies the effect of the biomolecule binding to the target cell
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99135494 14 PCTNS99/00474
component. For example, production of an enzyme having similar activity to
that of
the target cell component may be induced in the cells. By a mechanism such as
this,
the cell could escape any effect the biomolecule might otherwise cause by
binding to
the target cell component.
Using an intracellular test to validate biomolecule/target cell component
interaction is superior to using only an in vitro test using isolated
molecules, because
the intracellular test ensures that the target cell component is in its
natural
conformation and that the biomolecule "sees" the target cell component in that
conformation, as that conformation occurs in a disease state. That in an
intracellular
test a biomolecule finds a site which ultimately causes a phenotypic effect on
the
cell indicates that the biomolecule is binding to a functionally relevant site
on the
target cell component (e.g., an active site of an enzyme). Thus, molecules
that are
found to be structural analogs of the biomolecule and to compete with the
biomolecule for a binding site on the target will also interact with the
functionally
relevant site of the target cell component, as functional analogs. A
functional analog
of the biomolecule can be found through competitive binding assays of the
biomolecule against compounds (as in a library of compounds) that are
potential
binders of the target cell component. Structural analogs can also be found by
rational drug design once a biomolecular binder is identified, by designing
drugs
that mimic the structure of the biomolecular binder. These structural analogs
can be
tested for their binding properties by techniques described herein.
A further advantage of the intracellular test in which the biomolecule is
produced from one or more genes in the cell, is that the biomolecule does not
have
to pass through a cell membrane or rely on inefficient uptake mechanisms of
the
cell. Intracellular production of the biomolecule ensures that a biomoiecule
that
interacts with a functional site on a target cell component to produce an
effect will
be detected, even if uptake of the biomolecule into the cell is limited. By
the
intracellular test, more biomolecules testing as being able to cause the
desired
phenotypic effect can be detected as candidates for further testing to find
functional
analogs for drug development. In a test employing extracellular addition of
biomolecuies, biomolecules that bind the target cell component but are taken
up by
the cell onlv to a limited extent could be missed as candidates for further
testing to
find functional analogs for drug development. Limited uptake of a biomolecule
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 15 PCTNS99/00474
which has been found to bind to a target irt vitro is not necessarily a
barrier to further
steps towards drug development, as a structural portion of the ultimate
compound to
be administered as a drug can be selected for its stability, membrane
solubility,
efficient uptake, etc., and can be chemically combined with a compound whose
structure mimics the active binding portion of the biomolecule. Intracellular
production of the biomolecule, in an intracellular test of the effect of a
biomolecule,
as opposed to uptake from outside the cell, can also minimize degradation of
the
biomolecules from extraceliular and intracellular degradative enzymes (e.g.,
proteases).
In further steps following one or more intracellular tests of the
biomolecule/target cell component combination, one or more compounds that can
also produce the phenotypic effect caused by the biomolecule can be identified
in an
in vitro competitive binding assay {which may be adapted for high-throughput
screening) as compounds that compete with the biomolecule for a binding site
on the
target cell component. Target cell components can be isolated from the type of
cell
in which the phenotypic effect is desired (for instance, cells of pathogenic
bacteria,
yeast or fungi; mammalian cells, such as tumor cells), or from cells
engineered to
produce the cell component or a derivative of the cell component that would
provide
(at least some) structurally identical binding sites (e.g., a fusion protein).
Compounds that produce the phenotypic effect observed with the biomolecule can
be found in the competitive binding assay upon screening of libraries of
compounds
(for example, small molecule compounds. or natural products or libraries that
can be
selected for having as their members compounds that have greater intracellular
stability than biomolecules such as peptides or RNA oligonucleotides).
The invention includes methods for identifying compounds that inhibit the
growth of cells having a target cell component. The target cell component can
first
be identified as essential to the growth of the cells in culture and/or under
conditions
in which it is desired that the growth of the cells be inhibited. These
methods can be
applied, for example, to various types of cells that undergo abnormal or
undesirable
proliferation, including cells of neoplasms (tumors or growths. either benign
or
malignant) which, as known in the art, can originate from a variety of
different cell
types. Such cells can be referred to, for example, as being from adenomas,
carcinomas, lymphomas or leukemias. The method can also be applied to cells
that
SUBSTITUTE SHEET (RU'LE 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
16
proliferate abnormally in certain other diseases, such as arthritis, psoriasis
or
autoimmune diseases.
Described herein are similar methods for identifying inhibitors of target
molecules or target cell components of pathogenic organisms. These methods can
include a target validation procedure using an animal model for confirming
that a
cell component of a pathogenic organism is essential, after infection with the
organism has been established in a host, and that the inhibitor is effective
against the
organism after the organism has established the infection. A goal of the
procedure is
to identify compounds and/or gain the knowledge required to design compounds
that
can be used as antimicrobial agents to treat a human or other mammal having an
infection of the organism.
The invention provides methods for in vitro and in vivo validation of target
and assay combinations. Following selection of biomolecular binders to the
isolated
target cell component of interest, the invention can incorporate steps for (1
)
regulable (e.g., inducible) intracellular expression of a gene encoding the
biomolecular binder and (2) monitoring cell viability in culture (e.g., cell
growth in
liquid media or agar plates) or in vivo (e.g., growth of introduced cells or
pathogen
virulence in an animal infection model) or both. If intracellular expression
of the
biomolecular binder inhibits the function of a target essential for growth
(presumably by binding to the target at a biologically relevant site) cells
monitored
in step (2) will exhibit a slow growth or no growth phenotype. Targets found
to be
essential for growth by these methods are validated starting points for drug
discovery, and can be incorporated into assays to identify more stable
compounds
that bind to the same site on the target as the biomolecuie.
Where the cells are pathogen cells and the desired phenotypic change to be
monitored is inhibition of growth, the invention provides a procedure to
examine the
activity of target (pathogen) cell components in an animal infection model.
Controlled expression in cells of biomolecular binders to the target of
interest
mimics the environment for traditional antimicrobial therapy and validates
targets as
essential and appropriate for drug discovery. The technology facilitates
choosing
the best antimicrobial targets for drug discovery by facilitating direct
obsen~ation of
the effect (phenotype) produced by target inhibition at a specific target
subsite. The
process is broadly applicable to a variety of targets. The process also
validates
SUBSTITUTE SHEET (RUtE 26)


CA 02317653 2000-07-06
WO 99/35494 1~ PCT/US99/00474
target and biomolecular binder combinations as a direct path to high
throughput
screening for binding analogs of the biomolecular binder, and is equally
facile with
targets that are gene products of genes of unknown function or genes of known
function. Validated target and biomolecular binder assay combinations can be
used
directly in in vitro or irr vivo competitive binding assays for screening
chemical
compound files. Compounds that compete with the biomolecular binders are
identified as potential medicinal chemistry leads.
In the course of this method, it may be decided to study as a target cell
component a gene product of a particular cell type (e.g., a type of pathogenic
bacteria), wherein the target cell component is already known as being encoded
by a
characterized gene, as a potential target for a modulator to be identified. In
this case,
the target cell component can be isolated directly from the cell type of
interest,
assuming suitable culture methods are available to grow a sufficient number of
cells,
using methods appropriate to the type of cell component to be isolated (e.g.,
protein
purification methods such as differential precipitation, ion exchange
chromatography, gel chromatography, affinity chromatography, HPLC).
Alternatively, the target cell component can be produced recombinantly, which
requires that the gene encoding the target cell component be isolated from the
cell
type of interest. This can be done by any number of methods, for example known
methods such as PCR, using template DNA isolated from the pathogen or a DNA
library produced from the pathogen DNA, and using primers based on known
sequences or combinations of known and unknown sequences within or external to
the chosen gene. See, for example, methods described in "The Polymerase Chain
Reaction," Chapter 15 of Current Protocols in Molecular Biology, (Ausubel,
F.M.
et al., eds), John Wiley &: Sons, New York, 1998. Other methods include
cloning a
gene from a DNA library (e.g., a cDNA library from a eucaryotic pathogen) into
a
vector (e.g., plasmid, phage, phagemid, virus, etc.) and applying a means of
selection or screening to clones resulting from a transformation of vectors
(including
a population of vectors now having inserted genes) into appropriate host
cells. The
screening method can take advantage of properties given to the host cells by
the
expression of the inserted chosen gene (e.g., detection of the gene product by
antibodies directed against it, detection of an enzymatic activity of the gene
product), or can detect the presence of the gene itself (for instance, by
methods
SUBSTITUTE SHEET (RUSE ~26)


CA 02317653 2000-07-06
WO 99/35494 18 PCTNS99/00474
employing nucleic acid hybridization). For methods of cloning genes in E.
coli,
which also may be applicable to cloning in other bacterial species, see, for
example,
"Eschericl:ia coli, Plasmids and Bacteriophages," Chapter 1 of Current
Protocols in
Molecular Biology, (Ausubel, F.M. et al., eds), John Wiley & Sons, New York,
1998. For methods applicable to cloning genes of eukaryatic origin, see
Chapter 5
("Construction of Recombinant DNA Libraries"), Chapter 9 ("Introduction of DNA
Into Mammalian Cells"} and Chapter 6 ("Screening of Recombinant DNA
Libraries") of Current Protocols in Molecular Biology, (Ausubel, F.M. et al.,
eds),
John Wiley & Sons, New York, 1998.
Target proteins can be expressed with E. coli or other prokaryotic gene
expression systems, or in eukaryotic gene expression systems. Since many
eukaryotic proteins cant' unique modifications that are required for their
activities,
e.g. glycosylation and methyiation, protein expression can in some cases be
better
carried out in eukaryotic systems, such as yeast, insect, or mammalian cells
that can
perfonm these modifications. Examples of these expression systems have been
reviewed in the following literature: Methods in Enzymology, Volume 185, eds
D.V. Goeddel, Academic Press, San Diego, 1990; Geisse et al, Protein
Expression
and Purification 8:271-282, 1996; Simonsen and McGrogan, Biologicals 22: 85-
94;
Jones and Morikawa, Current Opinions in Biotechnologies 7: 512-S I 6, 1996;
Possee, Current Opinions in Biotechnologies 8:569-572.
Where a gene encoding a chosen target cell component has not been isolated
previously, but is thought to exist because homologs of the gene product are
known
in other species, the gene can be identified and cloned by a method such as
that used
in Shiba et al., US 5,759,833, Shiba et al., US 5,629,188, Martinis et al., US
5,656,470 and Sassanfar et al., US 5,756,327. The teachings of these four
patents
are incorporated herein by reference in their entirety.
It is an advantage of the target validation method that it can be used with
target cell components which have not been previously isolated or
characterized and
whose functions are unknown. In this case, a segment of DNA containing an open
reading frame (ORF; a cDNA can also be used, as appropriate to a eukaryotic
cell)
which has been isolated from a cell of a type that is to be an object of drug
action
(e.g., tumor cell, pathogen cell) can be cloned into a vector, and the target
gene
product of the ORF can be produced in host cells harboring the vector. The
gene
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 19 PCTNS99/00474
product can be purified and further studied in a manner similar to that of a
gene
product that has been previously isolated and characterized.
In some cases, the open reading frame (in some cases, cDNA) can be isolated
from a source of DNA of the cells of interest (genomic DNA or a library, as
appropriate), and inserted into a fusion protein or fusion polypeptide
construct. This
construct can be a vector comprising a nucleic acid sequence which provides a
control region (e.g., promoter, ribosome binding site) and a region which
encodes a
peptide or polypeptide portion of the fusion polypeptide wherein the
poiypeptide
encoded by the fusion vector endows the fusion polypeptide with one or more
properties that allow for the purification of the fusion polypeptide. For
example, the
vector can be one from the pGEX series of plasmids (Phat~rtacia) designed to
produce fusions with glutathione S-transferase.
The isolated DNA having an open reading frame, whether encoding a known
or an as yet unidentified gene product, when inserted into an expression
construct,
1 S can be expressed to produce the target cell component in host cells. Host
cells can
be, for example, Gram-negative or Gram-positive bacterial cells such as
Escherichia
coli or Bacillus subtilis, respectively, or yeast cells such as Saccharomyces
cerevisiae, Scl:izosacclraromyces pombe or Pichia pastoris. It is preferable
that the
target cell component to be used in target validation studies be produced in a
host
that is genetically related to the pathogen from which the gene encoding it
was
isolated. For example, for a Gram-negative bacterial pathogen, an E. coli host
is
preferred over a Pichia pastoris host. The target cell component so produced
can
then be isolated from the host cells. Many protein purification methods are
known
that separate proteins on the basis of, for instance, size, charge, or
affinity for a
binding partner (e.g., for an enzyme, a binding partner can be a substrate or
substrate
analog), and these methods can be combined in a sequence of steps by persons
of
skill in the art to produce an effective purification scheme. For methods to
manipulate RNA, see, for example, Chapter 4 in Current Protocols in Molecular
Biology (Ausubel, F.M. et al., eds), John Wiley & Sons, New York, 1998.
An isolated ceil component or a fusion protein comprising the cell
component can be used in a test to identify one or more biomolecular binders
of the
isolated product (general step ( 1 )). A biomolecular binder of a target cell
component
(See Definitions section) can be identified by ir: vitro assays that test for
the
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99!35494 20 PCT/US99/00474
formation of complexes of target and biomolecular binder noncovalently bound
to
each other. For example, the isolated target can be contacted with one or more
types
of biomolecules under conditions conducive to binding, the unbound
biomolecules
can be removed from the targets, and a means of detecting bound complexes of
biomolecules and targets can be applied. The detection of the bound complexes
can
be facilitated by having either the potential biomolecular binders or the
target
labeled or tagged with an adduct that allows detection or separation (e.g.,
radioactive
isotope or fluorescent label; streptavidin, avidin or biotin affinity label).
Alternatively, both the potential biomolecular binders and the target can be
differentially labeled. For examples of such methods see, e.g., WO 98/19162.
The biomolecules to be tested for binding to a target can be from a library of
candidate biomolecular binders, (e.g., a peptide or oligonucleotide library).
For
example, a peptide library can be displayed on the coat protein of a phage
(see, for
examples of the use of genetic packages such as phage display libraries,
Koivunen,
E. et al., J. Biol. Chem. 268:20205-20210 (1993)). The biomolecules can be
detected by means of a chemical tag or label attached to or integrated into
the
biomolecules before they are screened for binding properties. For example, the
label
can be a radioisotope, a biotin tag, or a fluorescent label. Those molecules
that are
found to bind to the target molecule can be called biomolecular binders.
An isolated target cell component, an antigenically similar portion thereof,
or
a suitable fusion protein comprising all of or a portion of or the entire
target can be
used in a method to select and identify biomolecules which bind specifically
to the
target. Where the target cell component comprises a protein, fusion proteins
comprising all of, or a portion of, the target linked to a second moiety not
occurring
in the target as found in nature, can be prepared for use in another
embodiment of
the method. Suitable fusion proteins for this purpose include those in which
the
second moiety comprises an affinity ligand (e.g., an enzyme, antigen,
epitope). The
fusion proteins can be produced by the insertion of a gene encoding a target
or a
suitable portion of such gene into a suitable expression vector, which encodes
an
affinity ligand (e.g., pGEX-4T-2 and pET-lSb, encoding glutathione S-
transferase
and His-Tag affinity ligands, respectively). The expression vector can be
introduced
into a suitable host cell for expression. Host cells are lysed and the lysate,
containing fusion protein, can be bound to a suitable affinity matrix by
contacting
SUBSTITUTE SHEET (RUi.E-26) '"


CA 02317653 2000-07-06
WO 99/35494 21 PCTNS99/00474
the lysate with an affinity matrix under conditions sufficient for binding of
the
affinity ligand portion of the fusion protein to the affinity matrix.
In one embodiment, the fusion protein can be immobilized on a suitable
affinity matrix under conditions sufficient to bind the aff nity ligand
portion of the
fusion protein to the matrix, and is contacted with one or more candidate
biomolecules (e.g., a mixture of peptides) to be tested as biomolecular
binders,
under conditions suitable for binding of the biomolecules to the target
portion of the
bound fusion protein. Next, the affinity matrix with bound fusion protein can
be
washed with a suitable wash buffer to remove unbound biomolecules and non-
specifically bound biomolecules. Biomolecules which remain bound can be
released
by contacting the affinity matrix with fusion protein bound thereto with a
suitable
elution buffer. Wash buffer can be formulated to permit binding of the fusion
protein to the affinity matrix, without significantly disrupting binding of
specifically
bound biomolecules. In this aspect, elution buffer can be formulated to permit
retention of the fusion protein by the affinity matrix; but can be formulated
to
interfere with binding of the test biomolecule(s) to the target portion of the
fusion
protein. For example, a change in the ionic strength or pH of the elution
buffer can
lead to release of biomolecules, or the elution buffer can comprise a release
component or components designed to disrupt binding of biomolecules to the
target
portion of the fusion protein.
Immobilization can be performed prior to, simultaneous with, or after
contacting the fusion protein with biomolecule, as appropriate. Various
permutations of the method are possible, depending upon factors such as the
biomolecules tested, the affinity matrix-ligand pair selected; and elution
buffer
formulation. For example, after the wash step, fusion protein with
biomolecules
bound thereto can be eluted from the affinity matrix with a suitable elution
buffer (a
matrix elution buffer, such as glutathione for a GST fusion). Where the fusion
protein comprises a cleavable linker, such as a thrombin cleavage site,
cleavage from
the affinity ligand can release a portion of the fusion with the biomolecules
bound
thereto. Bound biomolecule can then be released from the fusion protein or its
cleavage product by an appropriate method, such as extraction.
One or more candidate biomolecular binders can be tested simultaneously.
Where a mixture of biomolecules is tested, the biomolecules selected by the
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
22
foregoing processes can be separated (as appropriate) and identified by
suitable
methods (e.g., PCR, sequencing, chromatography). Large libraries of
biomolecules
(e.g., peptides, RNA oligonucleotides) produced by combinatorial chemical
synthesis or other methods can be tested (see e.g., Ohlmeyer, M.H.J. et al.,
Proc.
Natl. Acad. Sci. USA 90:10922-10926 (1993) and DeWitt, S.H. et al., Proc.
Natl.
Acad. Sci. USA 90:6909-6913 ( 1993), relating to tagged compounds; see also
Rutter,
W.J. et al. U.S. Patent No. 5,010,175; Huebner, V.D. et al., U.S. Patent No.
5,182,366; and Geysen, H.M., U.S. Patent No. 4,833,092). Random sequence RNA
libraries (see Ellington, A.D. et al., Nature 346:818-822 (1990); Bock, L.C.
et al.,
Nature 355:584-566 (1992); and Szostak, J.W., Trends in Biochern. Sci. 17:89-
93
(March, 1992)) can also be screened according to the present method to select
RNA
molecules which bind to a target. Where biomolecules selected from a
combinatorial library by the present method cant' unique tags, identification
of
individual biomolecules by chromatographic methods is possible. Where
biomolecules do not carry tags, chromatographic separation, followed by mass
spectrometry to ascertain structure, can be used to identify individual
biomolecules
selected by the method, for example.
Other methods to identify biomolecular binders of a target cell component
can be used. For example, the two-hybrid system or interaction trap is an in
vivo
system that can can be used to identify polypeptides, peptides or proteins
(candidate
biomolecular binders) that bind to a target protein. In this system, both
candidate
biomolecular binders and target cell component proteins are produced as fusion
proteins. The two-hybrid system and variations on it have been described (US
5,283,173 and US 5,468,614; Gotemis, E.A. et al., pages 20.1.1-20.1.35 In
Current
Protocols in Molecular Biolog>>, F.M. Ausubel et al., eds., John Wiley and
Sons,
containing supplements up through Supplement 40, 1997; two-hybrid systems
available from Clontech, Palo Alto, CA).
Once one or more biomolecular binders of a cell component have been
identified, further steps can be combined with those taken to identify the
biomolecular binder, to identify those biomolecular binders that produce a
phenotypic effect on a cell (where "a cell" can mean cells of a cell strain or
cell line).
Thus, a method for identifying a biomolecule that produces a phenotypic effect
on a
first cell can comprise the steps of identifying a biomolecular binder of an
isolated
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99/35494 23 PCT/US99/00474
target cell component of the first cell; constructing a second cell comprising
the
target cell component and a regulable exogenous gene encoding the biomolecular
binder; and testing the second cell for the phenotypic effect, upon production
of the
biomolecular binder in the second cell, where the second cell can be
maintained in
culture or introduced into an experimental animal. If the second cell shows
the
phenotypic effect upon intracellular production of the biomolecular binder,
then a
biomolecuie that produces a phenotypic effect on the first cell has been
identified.
Testing the second cell is general step (2) of the invention, as the three
general steps
were outlined above.
Host cells (also, "second cells" in the terminology used above) of the cell
type (e.g., species of pathogenic bacteria) the target was isolated from (or
the gene
encoding the target was originally isolated from, if the target is produced by
recombinant methods), can be engineered to harbor a gene that can regulably
express the biomolecular binder (e.g., under an inducible or repressible
promoter).
The ability to regulate the expression of the biomolecular binder is desirable
because
constitutive expression of the biomolecular binder could be lethal to the
cell.
Therefore, inducible or regulated expression gives the researcher the ability
to
control if and when the biomolecular binder is expressed. The gene expressing
the
biomolecular binder can be present in one or more copies, either on an
extrachromosomal structure, such as on a single or multicopy plasmid, or
integrated
into the host cell genome. Plasmids that provide an inducible gene expression
system in pathogenic organisms can be used. For example, plasmids allowing
tetracycline-inducible expression of a gene in Staplzvlococcus aureus have
been
developed. See Example 6.
For intracellular expression of a biomolecule to be tested for its phenotypic
effect in a eukaryotic cell (e.g., mammalian cell), the genes for expression
can be
carried on plasmid-based or virus-based vectors, or on a linear piece of DNA
or
RNA. For examples of expression vectors, see Hosfield and Lu, Biotech»iques
25:306-309, 1998; Stephens and Cockett, Nucleic Acid Researclr 17:7110, 1989;
Wohlgemuth et al. Gene Therapy 3:503-512, 1996; Ramirez-Solis et al, Ge»e
87:291-294, 1990; Dirks et al, Gerre 149:387-388, 1994; Chengalvala et al.
Current
Opi»io» irr Biotech»ologies 2:718-722, 1991; A~ethods i» E»zwrologv, Volume
185,
(D.V. Goeddel, ed.) Academic Press, San Diego, 1990. The genetic material can
be
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 24 PCT/LIS99/00474
introduced into cells using a variety of techniques, including whole cell or
protoplast
transformation, electroporation, calcium phosphate-DNA precipitation or DEAE-
Dextran transfection, liposome mediated DNA or RNA transfer, or transduction
with
recombinant viral or retroviral vectors. Expression of the gene can be
constitutive
(e.g., ADH1 promoter for expression in S cerevisiae (Bennetzen, J.L. and Hall,
B.D., J. Biol. Chem. ?57:3026-3031 (1982)), or CMV immediate early promoter
and
RSV LTR for mammalian expression) or inducible, as the inducible GAL1 promoter
in yeast (Davis, L.I. and Fink, G.R., Cell 61:965-978 ( 1990)). A variety of
inducible
systems can be utilized, for example, E. coli Lac repressor/operator system
and TnlO
Tet repressor/operator systems have been engineered to govern regulated
expression
in organisms from bacterial to mammalian cells. Regulated gene expression can
also be achieved by activation. For example, gene expression governed by HIV
LTR can be activated by HIV or SIV Tat proteins in human cells; GAL4 promoter
can be activated by galactose in a nonglucose-containing medium. The location
of
i5 the biomolecule binder genes can be extrachromosomal or chromosomally
integrated. The chromosome integration can be mediated through homologous or
nonhomologous recombinations.
For proper localization in the cells, it maybe desirable to tag the
biomolecule
binders with certain peptide signal sequences (for example, nuclear
localization
signal (NLS) sequences, mitochondria localization sequences). Secretion
sequences
have been well documented in the art.
For presentation of the biomolecular binders in the intracellular system, they
can be fused N-terminally, C-terminally, or internally in a carrier protein
(if the
biomolecular binder is a peptide), and can be fused (5', 3' or internally) in
a carrier
RNA or DNA molecule (if the biomolecular binder is a nucleic acid). The
biomolecular binder can be presented with a protein or nucleic acid structural
scaffold. Certain linkages (e.g., a 4-glycine linker for a peptide or a
stretch of A's
for an RNA can be inserted between the biomolecular binder and the carrier
proteins
or nucleic acids.
In such engineered cells, the effect of this biomolecular binder on the
phenotype of the cells can be tested, as a manifestation of the binding
(implying
binding to a functionally relevant site, thus, an activator, or more likely,
an
inhibitory) effect of the biomolecular binder on the target used in an ifi
virr-o binding
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99/35494 PCTNS99/00474
assay as described above. An intracellular test can not only determine which
biomolecular binders have a phenotypic effect on the cells, but at the same
time can
assess w ~hether the target in the cells is essential for maintaining the
normal
phenotype of the cells. For example, a culture of the engineered cells
expressing a
5 biomolecular binder can be divided into two aliquots. The first aliquot
("test" cells}
can be treated in a suitable manner to regulate (e.g., induce or release
repression of,
as appropriate) the gene encoding the biomolecular binder, such that the
biomolecular binder is produced in the cells. The second aliquot ("control"
cells)
can be left untreated so that the biomolecular binder is not produced in the
cells. In
10 a variation of this method of testing the effect of a biomolecular binder
on the
phenotype of the cells, a different strain of cells, not having a gene that
can express
the biomolecular binder, can be used as control cells. The phenotype of the
cells in
each culture ("test" and "control" cells grown under the same conditions,
other than
the expression of the biomolecular binder), can then be monitored by a
suitable
15 means (e.g., enzymatic activity, monitoring a product of a biosynthetic
pathway,
antibody to test for presence of cell surface antigen, etc.). Where the change
in
phenotype is a change in growth rate, the growth of the cells in each culture
("test"
and "control" cells grown under the same conditions, other than the expression
of
the biomolecular binder), can be monitored by a suitable means (e.g.,
turbidity of
20 liquid cultures, cell count, etc). If the extent of growth or rate of
growth of the test
cells is less than the extent of growth or rate of growth of the control
cells, then the
biomolecular binder can be concluded to be an inhibitor of the growth of the
cells, or
a biomolecular inhibitor.
If the phenotype of the test cells is altered relative to that of the control
cells,
25 then the biomolecular binder can be concluded to he one that causes a
phenotypic
effect. In an optional additional test, isolated target cell component having
a known
function (e.g., an enzyme activity} can be tested for modulation of this known
function in the presence of biomolecular binder under conditions conducive to
binding of the biomolecular binder to the target cell component. Positive
results in
these tests should encourage the investigator to continue in the drug
discovery
process with efforts to find a more stable compound (than a peptide,
polypeptide or
RNA biomolecule) that mimics the binding properties of the biomolecular binder
on
the tested target cell component.
SUBSTITUTE SHEET (RIi~E 26)


CA 02317653 2000-07-06
WO 99/35494 PCTNS99/00474
26
A further test can, again, employ an engineered strain of cells that comprise
both the target cell component and one or more genes encoding a biomolecule
tested
to be a biomolecular binder of the target cell component. The cells of the
cell strain
can be tested in animals to see if regulable expression of the biomolecular
binder in
the engineered cells produces an observable or testable change in phenotype of
the
cells. Both the "in culture" test for the effect of intracellular expression
of the
biomolecular binder and the "in animal" test (described below) for the effect
of
intracellular expression of the biomolecular binder can be applied not only
towards
drug discovery in the categories of antimicrobials and anticancer agents, but
also
towards the discovery of therapeutic agents to treat inflammatory diseases,
cardiovascular diseases, diseases associated with metabolic pathways, and
diseases
associated with the central nervous system, for example.
Where the engineered strain of cells is a strain of pathogen cells or tumor
cells, the object of the test is to see whether production of the biomolecular
binder in
the engineered strain inhibits growth of these cells after their introduction
into an
animal by the engineered pathogen. Such a test can not only determine which
biomolecular binders are inhibitors of growth of the cells, but at the same
time can
assess whether the target in the cells is essential for maintaining growth of
the cells
(infection, for a pathogenic organism) in a host mammal. Suitable animals for
such
an experiment are, for example, mammals such as mice, rats, rabbits, guinea
pigs,
dogs, pigs, and the like. Small mammals are preferred for reasons of
convenience.
The engineered cells are introduced into one or more animals ("test" animals)
and
into one or more animals in a separate group ("control" animals) by a route
appropriate to cause symptoms of systemic or local growth of the engineered
cells.
The route of introduction may be, for example, by oral feeding, by inhalation,
by
subdermal, intramuscular, intravenous, or intraperitoneal injection as
appropriate to
the desired result.
After the cell strain has been introduced into the test and control animals,
expression of the gene encoding the biomolecular binder is regulated to allow
production of the biomolecular binder in the engineered pathogen cells. This
can be
achieved, for instance, by administering to the test animals a treatment
appropriate
to the regulation system built into the cells, to cause the gene encoding the
biomolecular binder to be expressed. The same treatment is not administered to
the
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 2~ PCTNS99/00474
control animals. but the conditions under which they are maintained are
otherwise
identical to those of the test animals. The treatment to express the gene
encoding the
biomolecular binder can be the administration of an inducer substance (where
expression of the biomolecular binder or gene is under the control of an
inducible
promoter) or the functional removal of a repressor substance (where expression
of
the biomolecular binder gene is under the control of a repressible promoter).
After such treatment, the test and control animals can be monitored for a
phenotypic effect in the introduced cells. Where the introduced cells are
constructed
pathogen cells, the animals can be monitored for signs of infection (as the
simplest
endpoint, death of the animal, but also e.g., lethargy, lack of grooming
behavior,
hunched posture, not eating, diarrhea or other discharges; bacterial titer in
samples
of blood or other cultured fluids or tissues). In the case of testing
engineered tumor
cells, the test and control animals can be monitored for the development of
tumors or
for other indicators of the proliferation of the introduced engineered cells.
If the test
animals are observed to exhibit less growth of the introduced cells than the
control
animals, then the biomolecule can be also called a biomolecular inhibitor of
growth,
or biomolecular inhibitor of infection, as appropriate, as it can be concluded
that the
expression in vivo of the biomolecular inhibitor is the cause of the relative
reduction
in growth of the introduced cells in the test animals.
Further steps of the procedure involve in vitro assays to identify one or more
compounds that have binding and activating or inhibitory properties that are
similar
to those of the biomolecules which have been found to have a phenotypic
effect,
such as inhibition of growth. That is, compounds that compete for binding to a
target cell component with the biomolecule would then be structural analogs of
the
biomolecules. Assays to identify such compounds can take advantage of known
methods to identify competing molecules in a binding assay. These steps
comprise
general step (3) of the method.
In one method to identify such compounds, a biomolecular inhibitor (or
activator) can be contacted with the isolated target-cell component to allow
binding,
one or more compounds can be added to the milieu comprising the biomolecular
inhibitor and the cell component under conditions that allow interaction and
binding
between the cell component and the biomolecular inhibitor, and any
biomolecular
inhibitor that is released from the cell component can be detected.
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 28 PCTNS99/00474
One suitable system that allows the detection of released biomolecular
inhibitor (or activator) is one in which fluorescence polarization of
molecules in the
milieu can be measured. The biomolecular inhibitor can have bound to it a
fluorescent tag or label such as fluorescein or fluorescein attached to a
linker.
Assays for inhibition of the binding of the biomolecular inhibitor to the cell
component can be done in microtiter plates to conveniently test a set of
compounds
at the same time. In such assays, a majority of the fluorescently labeled
biomolecular inhibitor must bind to the protein in the absence of competitor
compound to allow for the detection of small changes in the bound versus free
probe
population when a compound which is a competitor with a biomolecular inhibitor
is
added (B. A. Lynch, et al.. Analytical Biochemistry 147:77-82 (1997)}. If a
compound competes with the biomolecular inhibitor for a binding site on the
target
cell component, then fluorescently labeled biomolecular inhibitor is released
from
the target cell component, lowering the polarization measured in the milieu.
In a further method for identifying one or more compounds that compete
with a biomolecular inhibitor (or activator) for a binding site on a target
cell
component, the target cell component can be attached to a solid support,
contacted
with one or more compounds, and contacted with the biomolecular inhibitor. One
or
more washing steps can be employed to remove biomolecular inhibitor and
compound not bound to the cell component. Either the biomolecular inhibitor
bound to the target cell component or the compound bound to the target cell
component can be measured. Detection of biomolecular inhibitor or compound
bound to the cell compound can be facilitated by the use of a label on either
molecule type, wherein the label can be, for instance, a radioactive isotope
either
incorporated into the molecule itself or attached as an adduct, streptavidin
or biotin,
a fluorescent label or a substrate for an enzyme that can produce from the
substrate a
colored or fluorescent product. An appropriate means of detection of the
labeled
biomolecular inhibitor or compound moiety of the biomolecular inhibitor-cell
component complex or the compound-cell component complex can be applied. For
example, a scintillation counter can be used to measure radioactivity.
Radiolabeled
streptavidin or biotin can be allowed to bind to biotin or streptavidin,
respectively,
and the resulting complexes detected in a scintillation counter. Alkaline
phosphatase conjugated to streptavidin can be added to a biotin-labeled
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
29
biomolecular inhibitor or compound. Detection and quantitation of a biotin-
labeled
complex can then be by addition of pNPP substrate of alkaline phosphatase and
detection by spectrophotometry, of a product which absorbs W light at a
wavelength of 405 nm. A fluorescent label can also be used, in which case
detection
of fluorescent complexes can be by a fluorometer. Models are available that
can
read multiple samples, as in a microtiter plate.
For example, in one type of assay, the method for identifying compounds
comprises attaching the target cell component to a solid support, contacting
the
biomolecular inhibitor with the target cell component under conditions
suitable for
binding of the biomolecular inhibitor to the cell component, removing unbound
biomolecular inhibitor from the solid support, contacting one or more
compounds
(e.g., a mixture of compounds) with the cell component under conditions
suitable for
binding of the biomolecular inhibitor to the cell component, and testing for
unbound
biomolecular inhibitor released from the cell component, whereby if unbound
biomolecular inhibitor is detected, one or more compounds that displace or
compete
with the biomolecular inhibitor for a particular site on the target cell
component
have been identified.
Other methods for identifying compounds that are competitive binders with
the biomolecule for a target can employ adaptations of fluoresence
polarization
methods. See, for instance, Anal. Bioche»r. 253(2):210-218 ( 1997), Arral.
Biochem.
249(1):29-36 (1997), BioTechrrigues !7(3):585-589 (1994) and Nature 373:254-
256
( 1995 ).
Those compounds that bind competitively to the target cell component can
be considered to be drug candidates. Further appropriate testing can confinm
that
those compounds which bind competitively with biomolecular inhibitors (or
activators) possess the same activity as seen in an intracellular test of the
effect of
the biomolecular inhibitor or activator upon the phenotype of cells.
Derivatives of
these compounds having modifications to confer improved solubility, stability,
etc.,
can also be tested for a desired phenotypic effect.
Combining steps for testing the phenotypic effects of a biomolecule, as can
be produced in an intracellular test, with steps for identifying compounds
that
compete with the biomolecule for sites on a target cell component, yields a
method
for identifying a compound which is a functional analog of a biomolecule which
SUBSTITUTE SHEET (RUSE 26)

25-02-2000 evuEv ~Ii~~ vi~c~ i v t ~ 25- Z- 0 : 22 : ~_> .t~, : -. +49 89
lug i,v, US 009900474
CPI980~ p~MA
~30-
produces a rh~otypie effect on a ceh. These steps can be to test, for the
phenotypic
effect, ~:ither in culture or in an animal model, or ui both, a eels which
plbduccs a
biamolecLlc by xegulable mcgression of an exogenous gent in the cell, and to
identify, if the biomolccule caused the phenotypic effect, one or more
compounds
that comr~tc with the biomoleculc for binding to a target cell component~ If a
compound is found to compete with the biomolccule for binding to the t,argoi
cell
component, then the compound is a functional analog of a biomolecule which
produces a phenotypic effect on the cell. Such a functional analog can cause
qualitatively a similar effect on the cell, but to a similar degree, lesser
degree ar
greater degree than the biomolecule.
!~ further embodiment ofthe invention combining general steps (1) and (2) is
a method for determining whether a target component of a cell is essential to
prnducing a phenotypic affect on the cell, comprising isolating the target
component
from ftc call, identifying a biomalccular binder of the isolated target
component of
the cell, constructing a second cell coraprising the target component an d a
re~tlabla,
exogenous gent encoding the biomolecnlar binder, and testing the second cell
in
cultt~ro for an altered phenotypic effect, upon production of the biomolecular
binder
in the s,-.rend cell, whereby, if the second cell shows the altered phenotypic
effect
upon production of the biomalecular binder, then the target component of the
first
cell is essential to producing ihc phenotypic effect on the first cell.
The merhods described herein arc well suited~to the identification of
corr~pounds that can inhibit the proliferation of ihc cells of infectious
agents such as
bacteria, fungi and tl:e like. In addition, a procedure such as the one
outlined below
can be used is the identification of campouncs to inhibit the prolifcratian of
cancer
cells. Tho two procedures described below furtherillustraie the use of the
methods
described herein and would provide proof of principle of these methods with a
known target fox anticancer therapy.
Marnrnalian dihydmfolate reductase (DHrR) is a pnovcn target for asnticancer
thcrdpy. Methotrexate (MTX) is one of many existing drugs that inhibit DHFk.
It
is widely used for anticancer chemotherapy.
NI l'i 3T3 is a mouse fibroblast cell line that is able to develop spontaneous
transforrnc~ cells when eultesrcd in low c~necnt:wtion (2%) of calf scrum in
molecular, cellular and developmental biology mcdiurn 4tYL (MCDB) (.1~(. Chow
and
AMENDED SHEET
CA 02317653 2000-07-06


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
31
H. Rubin, Proc. ~Vatl. .4cad. Sci. USA 95(8):4550-4555 (1998)). The
transformed
cells, which can be selectively inhibited by MTX (Chow and Rubin), are
isolated.
Both the normal and transformed NIH3T3 cells are transfected with pTet-On
plasmid (Clontech; Palo Alto, CA). Stable cell lines that express high levels
of
reverse tetracycline-controlled activator (rtTA) are isolated and
characterized for
their normal or transformed phenotype (Chow and Rubin).
The DHFR gene (Genbank Accession # L26316) from the NIH 3T3 cell line
is amplified by reverse transcription-PCR (RT-PCR) using poly A' RNA isolated
from NIH 3T3 cells (Sambrook, J. et al., Molecular Cloning: A Laboratory
Manual,
2nd edition, Cold Spring Harbor Laboratory Press, 1989). Active DHFR is
expressed using the BacPAK Baculovirus Expression System (Clontech) or other
appropriate systems. The expressed DHFR is purified and biotinylated and
subjected to peptide binder identification as exemplified for bacterial
proteins. The
identified peptides are biochemically characterized for in vitro inhibition of
DHFR
activity. Peptides that inhibit DHFR are identified. A nucleic acid encoding
each
peptide can be cloned into a vector such as pGEX-4T2 (Pharmacia) to yield a
vector
which encodes a fusion polypeptide having the peptide fused to the N-terminus
of
GST. This can also be done by PCR amplification as exemplified herein for the
peptide Pro-3. The fusion genes are cloned into plasmid pTRE (Clontech) for
regulated expression. The constructed plasmid or the vector is cotransfected
with
pTK-Hyg into the stable NIH 3T3 cell line that expresses rtTA. The resulting
cell
lines, termed 3T3N-VITA (normal 3T3 cells that express rtTA and the DHFR
inhibitory peptides), 3T3T-VITA (transformed 3T3 cells that express rtTA and
the
DHFR inhibitory peptides), or 3T3T-VITA control (transformed 3T3 cells that
express rtTA and GST), are characterized for their normal or transformed
phenotype
(loss of contact inhibition, change in morphology, immortalization, etc.).
l OZ-10' of 3T3T-VITA or 3T3T-VITA control cells are mixed with 105
3T3N-VITA and are grown in MCDB 402 medium with 10% calf serum at 37°C
for
three days. Tetracycline is added to the medium to a final concentration of 0
to 1
ug/ml. In a control, 200 nM of MTX is added. The cultures are incubated for an
additional eight days, and the number of foci formed are counted as described
by M.
Chow and H. Rubin. Proc. Natl. Acad. Sci. USA 95(8):4550-4555 (1998). Peptides
that specifically inhibit foci formation of 3T3 transformed cells are
identified.
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
32
A marine model of fibroblastoma (Kogerman, P. et al., Oncogene
15(12):1407-1416 (1997)) is used for evaluting the DHFR/peptide combination
for
identification of compounds for cancer therapy. Various amounts of 3T3T-VITA
or
3T3T-VITA control cells (10', 10'', 105, 106 cells) are injected
subcutaneously into 5
groups (10 in each group) of athymic nude mice (4-6 weeks old, 18-22 g) to
determine the minimal dose needed for development of fibroblastomas in all of
the
tested animals. Upon determination of the minimal tumorigenic dose, 6 groups
of
athymic nude mice (10 each) are injected subcutaneously (s.c.) with the
minimal
tumorigenic dose for 3T3T-VITA or 3T3T-VITA control cells to develop
fibroblastoma. One week after injection, group 1 mice start receiving MTX s.c.
at 2
mg/kg/day as positive control, group 2 to 5 start receiving l, 2, 5, or 10
mg/kg/day
of tetracycline, group 6 start receiving saline (vehicle) as control. Five
weeks after
the introduction of cells, all of the mice are sacrificed and tumors are
removed from
them. Tumor mass is measured and compared among the groups.
An effective peptide identified by these in vivo experiments can be used for
screening libraries of compounds to identify those compounds that
competitively
bind to DHFR.
One mechanism of tumorigenesis is overexpression of proto-oncogenes such
as Ha-ras (Reviewed by Suarez, H.G., Anticancer Research 9(5):1331-1343
(1989)).
Compounds that inhibit the activities of the products of such proto-oncogenes
can be
used for cancer chemotherapy. What follows is a further illustration of the
methods
described herein, as applied to mammalian cells.
Transgenic mice that overexpress human Ha-ras have been produced. Such
transgenic mice develop salivary and/or mammary adenocarcinomas (Nielsen, L.L.
et al, In Yivo &(5):1331-1343 (1994)). Secondary transgenic mice that express
rtTA
can be generated using the pTet-On plasmid from Clontech.
Human Ha-ras open reading frame cDNA (Genbank Accession #G00277) is
amplified by RT-PCR using polyA' R~IA isolated from human mammary gland or
other tissues. Active Ha-ras is expressed using the BacPAK Baculovirus
Expression
System (Clontech) or other appropriate systems. The expressed Ha-ras is
purified
and biotinylated and subjected to peptide binder identification as exemplified
herein
for bacterial proteins as target cell components. The identified peptides are
biochemicallv characterized for in virro inhibition of Ha-ras GTPase activity.
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 33 PCT/US99/00474
Peptides that inhibit Ha-ras are cloned into plasmid pTRE (Clontech) for
regulated
expression as an N-terminal fusion of GST. Such constructs are used to
generate
tertiary transgenic mice using the secondary transgenic mice. Transgenic mice
that
are able to overexpress peptide genes are identified by Northern and Western
analysis. Control mice that express GST are also identified.
Various doses of tetracycline are administered to the tertiary transgenic mice
by s.c. or i.p. injection before or after tumor onset. Prevention or
regression of
tumors resulting from expression of the peptide genes are analyzed as
described
above for murine fibroblastoma.
Peptides found to be effective in in vivo experiments will be used to screen
compounds that inhibit human Ha-ras activity for cancer therapy.
The method of the invention can be applied more generally to mammalian
diseases caused by: ( 1 ) loss or gain of protein function, (2) over-
expression or loss
of regulation of protein activity. In each case the starting point is the
identification
of a putative protein target or metabolic pathway involved in the disease. The
protocol can sometimes vary with the disease indication, depending on the
availability of cell culture and animal model systems to study the disease. In
all
cases the process can deliver a validated target and assay combination to
support the
initiation of drug discovery.
Appropriate disease indications include, but are not limited to, Alzheimer's,
arthritis, cancer, cardiovascular diseases, central nervous system disorders,
diabetes,
depression. hypertension, inflammation, obesity and pain.
Appropriate protein targets putatively linked to disease indications include,
but are not limited to (1) the leptin protein, putatively linked to obesity
and diabetes;
(2) a mitogen-activated protein kinase putatively linked to arthritis,
osteoporosis and
atherosclerosis; (3) the interleukin-1 beta converting protein putatively
linked to
arthritis, asthma and inflammation; (4) the caspase proteins putatively linked
to
neurodegenerative diseases such as Alzheimer's, Parkinson's and stroke, and
(5) the
tumor necrosis factor protein putatively linked to obesity and diabetes.
Appropriate
protein targets include also, but are not limited to, enzymes catalyzing the
following
types of reactions: ( 1 ) oxido-reductases, (2) transferases, (3) hydrolases,
(4) lyases,
(5) isomerases, and (6) ligases.
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
34
The arachidonic acid pathway constitutes one of the main mechanisms for
the production of pain and inflammation. The pathway produces different
classes of
end products, including the prostaglandins, thromboxane and leukotrienes.
Prostaglandins, an end product of cyclooxygenase metabolism, modulate immune
S function, mediate vascular phases of inflammation and are potent
vasodilators. The
major therapeutic action of aspirin and other non-steroidal anti-inflammatory
drugs
(NSAIDs) is proposed to be inhibition of the enzyme cyclooxygenase (COX). Anti-

inflammatory potencies of different NSAIDs have been shown to be proportional
to
their action as COX inhibitors. It has also been shown that COX inhibition
produces
toxic side effects such as erosive gastritis and renal toxicity. The knowledge
base
regarding the toxic side effects of COX inhibitors has been gained through
years of
monitoring human therapies and human suffering. Two kinds of COX enzymes are
now known to exist, with inhibition of COX1 related to toxicity, and
inhibition of
COX2 related to reduction of inflammation. Thus, selective COX2 inhibition is
a
desirable characteristic of new anti-inflammatory drugs. The method of the
invention can provide a route from identification of potential drug targets to
validating these targets (for example, COX1 and COX2) as playing a role in
disease
(pain and inflammation) to an examination of the phenotype for the inhibition
of one
or both target isozymes without human suffering. Importantly, this information
can
be collected in vivo.
As an alternative strategy, the method of the invention can be used to define
the phenotype of "genes of unknown function" obtained from various human
genome sequencing projects or to assess the phenotype resulting from
inhibition of
one isozyme subtype or one member of a family of related protein targets.
The present invention is more specifically illustrated in the following
examples, which are not intended to be limiting in any way.
EXEMPLIFICATION
Example 1: Isolating a peptide that binds to and inhibits E. coli prolyl-tRNA
synthetase
Because of its well established genetic and expression systems, Escherichia
coli was chosen for initial tests of the methods. Prolyl-tRNA svnthetase
(ProRS)
catalyzes the attachment of proline to its cognate tRNA for protein
biosynthesis. It
SUBSTITUTE SHEET (RULE 26)


CA 02317653 2000-07-06
WO 99/35494 35 PCT/US99/00474
is an enzyme of essential cellular function and is a good candidate for target
validation.
In order to produce pure protein for peptide selection, the E. coli ProRS gene
(Genbank accession number: M97858) was PCR amplified and cloned into the pET-
20b vector (Novagen) using standard molecular cloning protocols (J. Sambrook,
et
al., Molecular Cloning: A Laboraton~ Manual, 2"~ edition, Cold Spring Harbor
Laboratory Press, 1989). The overexpressed ProRS was purified sequentially on
Q-
and SP-Sepharose columns. The purified ProRS was biotinylated using EZ-linkr"'
Sulfo-NHS-LC-Biotin from Pierce according to the instructions packaged with
the
biotinylation compound, captured onto streptavidin-agarose beads and used to
select
specific binding peptides from a peptide library displayed on coat protein III
of M13
phages using a standard protocol (J. K. Scott and G. P. Smith, Science 249:386-
390
(1990)). Thirteen clones from phages that were identified as having a high
affinity to
ProRS were sequenced. These clones share 4 different sequences, 3 of which are
closely related (Table 1). See Example 4 of W098/19162, published 7 May 1998.
Table 1. Peptide sequences with high binding affinity to E. coli ProRS
SEQ ID NO: P tide Se uence # of Pha a Isolated


1 SRDWGFWDWGVDRSR 5


2 SRDWGFWRLPESMASR 3


3 SREWHFWRDYNPTSR 4


4 SSERGSGDRGEKGSR 1


The peptide having sequence number 3 was synthesized and tested for
inhibition of tRNA charging activity of E. coli ProRS. This peptide inhibits
E. coli
ProRS aminoacylation activity, demonstrates competitive inhibition with both
proline and ATP, and exhibits a K; of 300 nM. This peptide is called Pro-3
(also,
Pro3).
Example 2: Regulated expression of Pro-3 in E. coli causes cessation of cell
growth
Regulated intracellular expression of the Pro-3 peptide in E. coli was
achieved by fusing an oligonucleotide encoding the peptide to the 5' end of a
gene
encoding a glutathione S-transferase (GST) protein. To generate the peptide
SUBSTITUTE SHEET (RUSE 28)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
36
expression construct, the Pro-3/GST fusion gene was PCR amplified using a
combination of the Pro3, Pro3/GST, and GST/R primers as illustrated in Figure
1.
Primers Pro3 and Pro3/GST encode the Pro-3 peptide sequence; the latter
anneals to
the 5' end of the GST gene on plasmid pGEX-4T2 (Pharmacia). A 4-amino acid
linker was introduced between the Pro-3 peptide and GST for flexibility. The
PCR
product was further amplified with primers Pro3(Kpn) and GST/R(Bam), digested
with KpnI and BamHI restriction endonucleases, and ligated to the KpnI/BamHI
sites of the expression vector pPROTet (Clontech, Palo Alto, CA) using
standard
cloning protocols. pPROTet_uses the P4 promoter of phage lambda combined with
.
the Tet operator of the Tn 10 tetracycline resistance operon to direct the
regulated
expression of the cloned gene (Clontech, PROTM Bacterial Expression System
User
Manual, PT3161-1, Version PR7Y629). The ligated DNA was then used to
transform DHSaPRO (Clontech), an E. coli strain expressing the Tet repressor.
Clone pC3844 was sequenced and identified as containing the Pro-3/GST fusion
gene. The linker between the Pro3 peptide and GST is Glu-Gly-Gly-Gly. pC3844
was also transformed into the E. coli strain JM109/pSC, which is JM109
harboring a
plasmid expressing Tet repressor that was isolated from BL21PR0 (Clontech).
The
resulting E. coli strain is called JM109/pSC/pC3844.
Table 2. Oligonucleotides used to generate Pro-3/GST expression construct
Pro3: 5'CCAACAACATATGTCCCGTGAATGGCACTTCTGGCGTGACTAC (SEQ ID NO:S)
Pro3/GST:
5'TTCTGGCGTGACTACAACCCGACCTCCCGTGGGGGTGGAGGCATGTCCCCTA
TACTA (SEQ ID N0:6)
GST/R: 5'AGTTGAATTCTTAATCCGATTTTGGAGGATGG (SEQ ID N0:7)
Pro(Kpn): 5'CAAGGTACCCATGTCCCGTGAATGGCAC (SEQ ID N0:8)
GST/R(Bam): 5'CGCGGATCCTTAATCCGATTTTGGAGGATGG (SEQ ID N0:9)
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99135494 PCT/US99/00474
37
To test the expression of the Pro-3~GST fusion gene, overnight cultures of
DHSaPRO harboring pC'844 or pPROtet-LacZ (Clontech), a control expression
plasmid with the same backbone as pCz844 and a LacZ gene for expression, were
inoculated into fresh LB broth containing 34 pglmL chloramphenicol (an
antibiotic
for maintaining the expression plasmid}, and 50 pgimL spectinomycin (an
antibiotic
for maintaining the Tet repressor gene). Expression was induced by addition of
anhydrotetracycline to 0, 10, 100, or 500 ngimL, when the bacterial culture
reached
an ODD of 0.5. Anhydrotetracycline is a derivative of tetracycline that acts
as a
potent inducer of the TetO/R system and is less toxic to E. toll than
tetracycline (T.
Lederer, et al., Biochemistry, 35:7439-7446 (1996); B. Oliva, et al.,
Antin:icrob.
Agents Chemother. 36:913-919 ( 1992}. After 2.5 hours of induction by exposure
to
anhydrotetracycline, cells were pelleted from 1 mL culture and iysed by
boiling in
100 ~L of SDS-PAGE sample buffer. The samples were examined with SDS-
PAGE; gels were stained with Coomassie Blue (Fi-gure 2). The results
demonstrated
that while basal level expression is undetectable, the Pro-3/GST fusion
protein was
produced to a significant level upon anhydrotetracycline induction, a level
comparable to ~i-galactosidase production from lacZ. The reduced amount of
total
protein in the expression samples of Pro-3/GST but not the LacZ control con
elates
with the growth inhibition observed during the induction of Pro-3/GST (see
below).
The expressed Pro-3/GST fusion protein was purified on a glutathione-
agarose affinity column according to a procedure provided by Pharmacia (see,
e.g.,
procedures manual from Pharmacia P-L Biochemicals, Inc.: GST Gene Fusion
Svstem, regarding use of pGEX expression vectors and glutathione-S-transferase
fusion proteins, 1993). The N-terminal sequence of the purified protein was
determined by Edman cycles and confirmed to have the expected Pro-3 peptide
sequence. The purified Pro-3/GST was also confirmed to inhibit E. toll ProRS
activity, with a K; of 180 nM, similar to that of the Pro-3 peptide.
That expression of Pro-3/GST, but not of GST alone inhibits E. toll growth,
was demonstrated by the following experiment. Overnight cultures of JM 109/pSC
cells harboring pC'844 (JM109/pSC/pC3844}, or pPROTet-GST (same as pC3844
without the Pro-3 peptide sequence) were diluted 100-fold in fresh LB medium
containing 34 pg/mL chloramphenicol and 50 pgimL spectinomycin. After 2 hours
growth at 37°C, 100 ~L aliquots of each of these bacterial cultures
were transferred
SUBSTITUTE SHEET (RUiE 26)


CA 02317653 2000-07-06
WO 99/35494 PCT/US99/00474
38
to wells of a 96-well microtiter plate, with or without 10 ng of
anhydrotetracycline
dissolved in 1 ~cL ethanol. The growth of bacterial cultures, which were
constantly
under agitation, was monitored with a plate reader (SpectraMAX-250, Molecular
Devices). The results depicted in Figure 3A and Figure 3B demonstrate that E.
coli
growth was specifically inhibited by expression of the Pro-3 peptide.
Example 3: In vivo expression of Pro-3 peptide to cure a lethal infection
Intracellularly expressed Pro-3 was expected to bind to and inhibit a specific
essential cellular target in a manner similar to that of an antimicrobial
drug. Pro-3
was expected to cure the infection when its expression was induced in an
animal
model of bacterial infection. An established animal infection model was used
to test
this concept (C.O. Onyeji er al.. Arrtinricrob. Agents Chemother. 38:1112-1117
( 1994)).
Eight groups of CD-1 female mice (5 mice per group, Charles River
Laboratories; Wilmington, MA) weighing 20-24 g were used in this experiment.
The inoculum was prepared from E. coli JM109/pSC/pC'844 which was cultured at
37°C for 17 hr in Luria-Bertani broth containing spectinomycin and
chloramphenicol, and then 100 wl of the culture was diluted to 1 ml with
medium for
reading OD at 600 nm (0.2403, the medium as blank). The turbidity of a 0.5
McFarland standard is equivalent to ODD 0.1, or IOR cfu/ml. Then 3x109 cfu
(colony-forming units) ofE. coli JM109/pSC/pC'844 (1.25 ml) from the overnight
culture were diluted to 15 ml with 0.01 M phosphate buffered saline (Sigma P-
0261)
containing 8% hog gastric mucin (Sigma M-2378), 100 pg/ml spectinomycin and 68
pg/ml chloramphenicol. Each mouse of groups 1 through 4 was injected with 0.5
ml
of the inoculum intraperitoneally (i.p.), equivalent to 1 x 10$ cfu/mouse
(lethal dose).
Groups 5 through 8 served as vector control. The control inoculum was
prepared from E. toll pPROTet-GST whose vector carries a gene encoding
glutathione S-transferase, but no Pro-3 peptide. E. .toll pPROTet-GST was
cultured
at 37°C for 17 hr in Luria-Bertani broth containing spectinomycin and
chloramphenicol, and then 100 pl of the culture were diluted to 1 ml with the
medium for reading OD at 600 nm (0.2858, the medium as blank). Then 3x109 cfu
(1.05 ml) from the overnight culture were diluted to 15 ml with 0.01 M
phosphate
buffered saline containing 8% hog gastic mucin. Each mouse of groups 5 through
8
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 PCTNS99/00474
39
was injected (i.p.) with E. coli pPROTet-GST inocula equivalent to 1x108
cfulmouse
(lethal dose).
One and four hours after the inoculation, groups 1 and S animals received a
saline injection i.p. at 10 mlr~kg; groups 2, 3 and 4 animals received i.p.
injections of
anhydrotetracycline at 2, 1 and 0.5 mg/kg (diluted in saline), respectively;
groups 6,
7 and 8 received i.p. injections of anhydrotetracycline at 2, 1 and 0.5 mg/kg,
respectiveiy. The injection volume for all the animals was 10 mUkg.
The data summarized in Table 3 demonstrate that inhibition of E. coli ProRS
activity by in vivo intracellular expression of Pro-3 peptide cures a lethal
infection in
the mouse model.
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 4o PCT/US99/00474



'v



~. m ~n ~n v~ ~ m n h v,
~, c ~, n v o 0 0 0


>


_



N N
x v N a N a X v v N
~ ~ ~ X k iNGU
...: ~ X ~ 7C ~ L V V X
w Q.~ d. V ~'~ ~ Cl.U CLV 0.
_ v
bD~ CU ~ ~ ~ L bD 00
O ~ ~ ~ ~ O .C .C ~!1
C N ._ ..~-C v1C .G N ~
< Q a ~ a ~ ~


M


W



E"


E'"
U a.CL a.U c. U c.~ a. ~ ,a.~ a.~ ci
o ~ ~ ~ 1~,. ~, . ' ,.,
U N C: .NU ~ U ~ v N v asj aij ai
o ~ o ~ ~w~"' N p o p o p o p 'o
,~" E o o o o oG c ~ E oG E r~ E
~ U ~ c.0~ ~ E 0. ' C1.c~f3. c.~.p. w
U ~ c.~..~ c.~..~ O ' U ~ U ~ U
m 1 ao U U ' U ' aca m ~ m
a O O O x C m V x " O ~ O (~
:. v O a 6~jO W w W


W : W W


a



'~ v~ v~ v~ v~ H ~ v~ vo


w


4



a.


a ~ N M ~' v1 v:7 t~ 00


O


4.



SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 41 PCT/US99/00474
Example 4: Specific inhibition of ProRS: examination of intracellular tRNA
charging levels.
The levels of aminoacylated tRNAs in E, coli cells either with or without
expression of Pro-3 peptide were examined in order to confirm that E. toll
growth
inhibition was caused by inhibition of ProRS activity. For this purpose, 400
ml of
fresh LB broth containing 34 pg/ml chloramphenicol and 50 pg/ml spectinomycin
were inoculated with 4 ml JM109/pSC/pC'844 overnight culture and grown at
37°C
to an ODD of 0.3. The bacterial culture was split into two 200 ml subcultures.
To
one of them anhydrotetracycline was added to final concentration of 500 ng/ml.
After an additional 35 minutes, the bacterial cells were harvested and the
level of
charged tRNAP'°, tRNA~'" and tRNAP"' were determined following the
protocol
described by Folk and Berg (W. R. Folk and P. Berg, Journal of Bacteriology
102:204-212 (1970)). The results as summarized in Table 4 indicate that
expression
of Pro-3 specifically inhibits charging of tRNAP'°.
Table 4
aaRS Charged tRNA
-Inducer +Inducer


ProRS 70% 23%


MetRS 108% 96%


PheRS 104% 98%


Example 5: Functional complementation of Pro-3 peptide inhibition by
expression
of a heterologous ProRS gene
If ProRS is the primary intracellular target of the Pro-3 peptide, E. toll
growth inhibition by Pro-3 peptide should be relieved by functional
complementation with a heterologous ProRS. It was found that Pro-3 does not
inhibit S. aureus ProRS enzyme activity, which efficiently charges E. toll
tRNAP'°.
The S. aureus ProRS gene (WO 97/26343; EP 785272) was amplified with
oligonucleotides S.PRS/XhoI-5' (5'AAT CCG CTC GAG GAT TAT TGC TAT
TGG TGC C) (SEQ ID NO:10) and S.PRS/Hind-3' (5'AAT CGT AAG CTT TTA
TTT TAA GTT ATC ATA TTT) (SEQ ID NO:11 }, digested with Xho I / Hind III
SUBSTITUTE SHEET (Rlji.E 26)


CA 02317653 2000-07-06
WO 99/35494 42 PCT/US99/00474
restriction endonucleases, and cloned into Xho I / Hind III sites in pACYC 17
7. The
cloned S. aureus ProRS gene carnes its own promoter and ribosome binding site,
and is in the same orientation as the disrupted kanamycin resistance gene in
the
vector for efficient expression. Either the S. aureus ProRS expression
construct or
the pACYC177 vector alone was transformed into DH5aPR0 /pC'844. The growth
of the resulting E. coli strains was followed in the presence or absence of
200 ng/ml
anhydrotetracycline. As depicted in Figure 4A and Figure 4B, with the S.
aa~reus
ProRS expression construct, E. coli cell growth was no longer inhibited by
expression of the Pro-3 peptide. The results proved that the growth inhibition
by the
Pro-3 peptide is specifically caused by inhibition of ProRS activity.
Example 6: S. aureus expression systems
E. colilBacillus shuttle expression vectors pWH353 and pWH354 were
obtained from Professor Wolfgang Hillen (Mikrobielle Genetik, Universitat
Tubingen, Tubingen, Germany; see M. Geissendorfer and W. Hillen, Appl.
Microbiol. Biotechnol., 33:657-663 (1990); DE 3934454). These expression
vectors
carry a TnlO tet repressor gene. They also contain synthetic promoters with
one or
two Tet repressor binding sites that are optimized for inducible expression in
B.
subtilis. These inducible promoters direct the expression of CAT
(chloramphenicol
acetyltransferase).
pWH353 and pWH354 were transformed into S, aureus RN4220 cells by
electroporation (S. Schenk and R. A. Laddaga, CMS Microbiology Letters, 94:133-

138 (1992)). The transformants were tested for inducible expression by growing
in
LB broth containing 30 ~g/ml kanamycin. After the OD~~ reached 0.5, the
cultures
were split and tetracycline was added to one set of the cultures to a final
concentration of 0.5 ~cg/ml. The cultures were maintained with aeration for 3
hours
at 37°C. The S. aureus cells were then pelleted and resuspended in 80
mM Tris-
HCI, pH 7.4 containing 200,ug/ml lysostaphin, incubated at 37°C for 5
minutes,
frozen and thawed twice on dry ice/ethanol and 37°C water bath. The
samples were
then sonicated twice and centrifuged at 14.OOOg for 10 minutes. The
supernatants
were collected and subjected to electrophoretic analysis on an 18% SDS-
polyacrylamide gel stained with Coomassie blue (Figure 5). The CAT activities
in
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 43 PCT/US99/00474
these samples were determined (Frankel, A.D. et al.. Proc. Natl. Acad. Sci.
USA
86:7397-7401 ( 1989)) and summarized in Table S.
Table S. Inducible expression of CAT activity in S. aureus
Plasmid Induction Relative CAT Activit


No Plasmid - ND '


No Plasmid +


WH3S3 - 41


WH3S3 + >4110


WH3S4 - 1


WH3S4 + 3S0


ND: Not detectable.
Example 7: Identification of small peptides that specifically bind to and
inhibit S.
aureus methionyl-tRNA synthetase (MetRS)
The S. at~reus MetRS gene has been cloned (EP 785269; WO 97/26350).
1S The gene was PCR amplified and cloned into pGEX-4T2 (Pharrnacia) for
expression
as a GST fusion using standard molecular cloning protocols. The expressed GST-
S.
aureus MetRS was purified on a glutathione agarose column and the GST moiety
was removed by thrombin cleavage. The resulting nonfusion S. aureus MetRS was
then biotinylated using EZ-LinkT~' Sulfo-NHS-LC-Biotin from Pierce according
to
the instructions enclosed with the biotinylation compound. The biotinylated S.
aureus MetRS was used for selecting binding peptides from a 12-mer peptide
library
displayed on M13 phages (New England Biolabs). After 4 rounds of selection, 12
phage clones were isolated and sequenced. Out of thse 12 clones, 11 yielded 4
different sequences as summarized in Table 6. Peptides of sequence JTO1 and
JT02
2S were synthesized. JTO1 was tested for inhibition of S. aureus MetRS
activity.
The activity of S. aureus MetRS was monitored by the aminoacylation
reaction. The enzyme was diluted in SO mM HEPES, pH 7.5, 5 mM DTT and
0.01 % BSA. A typical SO pL reaction mixture contained 30 mM HEPES, pH 7.5,
10 mM MgCh, 30 mM KCI, 90 pM E. coli tRNA, 2 mM ATP and S ltM ['H]-
methionine (10 Ci/mmol). The reaction was initiated by addition of enzyme at
2S °C. At 4 different timepoints, 10 pL of the reaction was quenched
into 1 SO pL
cold S% TCA on a Millipore filter plate. The filter plate is then washed three
times
with cold S°% TCA followed by water and then ethanol. The filter plate
was dried
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 44 PCT/US99/00474
before addition of 100 uL Packard Microscint-20 and counted on a Packard Top-
Count microplate scintillation counter.
Inhibition studies were performed for the peptides against two of the
substrates, ATP and methionine. This was done at varying concentrations of
peptides by holding the concentration of one substrate at its Km value ( 1.5
mM for
ATP and 5 pM for methionine), while varying the other substrate concentration
around its Km value. The initial velocity data obtained were then analyzed
using
GraFit.
The results as depicted in Figure 6 indicate that peptide JTO1 is a
competitive
inhibitor of S. aureus MetRS. The K;'s for JTO1 are 138 nM (methionine) and 13
nM (ATP). The Id's for JT02 are 1.7 ~M (methionine) and 0.5 ~M (ATP) and 13
nM (ATP).
Table 6. Peptide sequences identified from phage panning
Peptide Peptide Sequence SEQ ID NO: Number of Phage
Isolated


JTO1 DPNTW LRWPMH 12 7


JT02 MWDLPYIWSRPV 13 2


JT03 ADTLNWYYYASW 14 1


JT04 ANNLSTMKKLKQ 15 1


Example 8: Development of Assay for E.coli ProRS and Pro3 peptide
A non-radioactive, homogeneous, sensitive Fluorescent Polarization (FP)
assay has been developed for E. coli ProRS and Pro3 peptide. FP is a
ratiometric
detection method which is capable of discriminating between free and bound
states
of a fluorescently labeled tracer based on differences in the rotation rates
of the two
states. The E. coli ProRS FP binding assay involves the incubation of
fluorescently
labeled Pro3 peptide (Pro3-F) with purified E. coli ProRS. In the bound state,
Pro3-
F is bound to E. coli ProRS and an increase in ploarization signal is detected
using a
FP detection system. In the free state, Pro3-F is not bound to E. coli ProRS
and
there is a decrease in polarization signal.
SUBSTITUTE SHEET (RUSE 26)


CA 02317653 2000-07-06
WO 99/35494 45 PCTNS99/00474
See Example 1 for cloning and purification of E. coli ProRS. See Example 1
(SEQ ID N0:3) for description of Pro3 peptide. Fiuorescently labeled Pro3
peptide
(Pro3-F) was synthesized and purified by SynPep Coip, Dublin, CA. Its sequence
is
shown below.
NH2-SREWHFWRDYNPTSRGGK(FITC)-CO-amide (SEQ ID N0:16)
A 96-well plate (Costar cat #3915) was blocked for 1 hour at room
temperature with 150 pL/well 2 mg/ml BSA (FisherBiotech cat #BP1600-100) in
0.1M NaHC03, The plate was then washed manually three times with 150 pL/well
of TBST ( 10 mM Tris-HCl pH 8.0, 150 mM NaCI, 0.05% Tween 20). To each well,
10 uL of 10% DMSO/TBST or compound (0.0001 - 100pM) in 10% DMSO/TBST
was incubated for 20 minutes at room temperature with 50 pL of 2.36 pM E. coli
ProRS in TBST (10 mM Tris-HCL pH 8.0, 150 mM NaCI, 0.05% Tween 20).
Following the pre-incubation, 40 pL of 0.391 pM Pro3-F in TBST was added to
each well, mixed and incubated at room temperature for 60 minutes. The plate
was
then read in an LJL Analyst (LJL Biosystems, Sunnyvale, CA) in fluorescent
polarization mode.
To assess the ability of the E. coli ProRS/Pro3-F FP binding assay to detect
pM and nM inhibitors, three compounds were tested. CB-16914 and CB-118831
are known inhibitors of E. coli ProRS (nM and uM inhibitors, respectively) and
CB-
680 was used as a negative control. As shown in Figure 7, both CB-16914 and CB-

I 18831 were shown to inhibit Pro3-F binding whereas CB-680 had no effect.
Figure 7 shows fluorescence polarization binding assay inhibition curves for
CB-16914 (0.0001-lO lxM), CB-118831 (0.046-100 pM) and CB-680 (0.0001-10
pM) with 1.18 uM E. coli ProRS and 0.625 pM Pro3-F.
SUBSTITUTE SHEET (RUSE 28)


CA 02317653 2000-07-06
WO 99/35494 46 PCT/US99/00474
Example: 9. Development of assay for S. aureus MetRS and Metl peptide
A non-radioactive, homogeneous, sensitive fluorescent polarization (FP)
assay has been developed for Staphylococcus aureus MetRS (Sa MetRS) and Metl
peptide. FP is a ratiometric detection method which is capable of
discriminating
between free and bound states of fluorescently labeled tracer based on
differences in
the rotation rates of the two states. The Sa MetRS FP binding assay involves
the
incubation of fluorescently labeled Metl peptide (Metl-F) with purified Sa
MetRS.
In the bound state. Metl-F is bound to Sa MetRS and an increase in
polarization
signal is detected using a FP detection system. In the free state, Metl-F is
not bound
to Sa MetRS and there is a decrease in polarization signal.
See Example 7 for cloning and purification of SaMetRS. Sa MetRS GST
fusion protein was cleaved with thrombin prior to these studies. Fluorescently
labeled Metl peptide (Metl-F) was synthesized and purified by SynPep Corp,
Dublin CA. Its sequence is shown below
NHZ-DPNTWQLRWPMHGGK(FITC)-CO-amide (SEQ ID N0:17)
A 96-well plate (Costar cat# 3915) was blocked for 1 hour at room
temperature with 150 pL/well 2 mg/ml bovine serum albumin (BSA) (FisherBiotech
cat# BP1600-100) in 0.1 M NaHC03. The plate was then washed manually three
times with 150 pL/well of TBS ( 10 mM Tris-HC1 pH 8.0, 1 SO mM NaCI). To each
well, 20 pL of 5% DMSO/TBS or compound (0.0001-100 uM) in 5% DMSO)/TBS
was incubated for 20 minutes at room temperature with 80 pL of 0.025 pM Sa
MetRS and 0.00625 pM Metl-F in reaction buffer (87.5 mM HEPES pH 7.5, 25
mM MgCI~, 25 mM KCI, 25 pg/ml BSA, 5 mM DTT). The plate was then read in
an LJL Analyst (LJL Biosystems, Sunnyvale CA) in fluorescent polarization
mode.
To assess the ability of the Sa MetRS/Metl-F FP binding assay to detect ~tM
and nM inhibitors, seven compounds were tested as well as the unlabeled Met-1
peptide. The seven compounds are known inhibitors (ICS s in nM to uM range) of
Sa MetRS functional charging assay. As shown in Table 7, six of the seven
inhibitors showed similar IC~o's (within 3-4x) in the FP binding assay as
compared
to the functional assay. The FP assay was unable to detect CB-125552 which may
SUBSTITUTE SHEET (RUi.E 26)


CA 02317653 2000-07-06
WO 99/35494 4~ PCT/US99100474
be due to ( 1 ) poor compound solubility or (2) compound binding at a site on
Sa
MetRS different from the site bound by the Met-1 peptide.
SUBSTITUTE SHEET (RUtE 28)


CA 02317653 2000-07-06
WO 99/35494 4g PCT/US99/00474
a


s


..



c



N


N


tC



C O
U C ~ C ~ ~ N C ~ ~O
N .~Ua
c ca Q ~ .. c n c c


LL


O


s U
0 ~D ~ '~ ~ M V~ ~ ~ fV
N 0
3 ~ Q N ri o c ~ v o
U


c


0


N


a~ a~
a, o > > b > o
E E"~'_, L1 '~' A L1 '~ -.
..:. ... ~
U Q '~ .c. .c.
w Q.
o U U U


0



' > > > :c
.c ~ D ~ .....o D D .:. ..
.c .o ~ ~ x ~e,
z c i ~ z z
U o U
U


c
3 c


0
c o ~ M z ~ o o S
c o ~
N n n n


N



U a O ono ~ c v.~,~ ~ _
U s.. 00 00 ~l'~ ~ V~ G
p ~p ~ ~ ~ ~ LLl ca z
oo r~ m ~ m m ~ a.
U U U U U U



a
SUBSTITUTE SHEET (RULE 26)

.~nt~~cfi~~ as :25- y- o : 2~?:~7 : ~ ' ~-ø9 8~ US 009900474
25-02-2000 LVVV 1 171 V't~LJ I 11 1 1111 11V.
CPI98G3p9MA
-49-
The Ft' assay for Sa MctRS inhibition has been evaluated to sc~e if it is
amenable for
high throughput screening (FITS) for drug discovery. The hP assay for 5a MetRS
has been reduced to 96-well format and has been automated which is necessary
for
I-fTS, 1'iguro 8 sliows results of an cxperirncnt vn a crn~trol plate that was
run to
assess the performance of the FP HTS assay. Sa MetRS v~ras at 20 nM final
concentration; Metl F was at 5 nM final corlccntration. Wells 1-6 contain Mat
iF
alone; wells 7-8 contain Sa MetRS alone; wells 9-18 and 19-28 contain Mctl-~'
from
640 nIvl to I.25 ~M; wells 29-96 contain 1% DMSO. The mP range between free
Matl-1~ and Mctl F bound by Sa MotRS was 141 mP, 1'he ~Cso for Mctl was tested
on the plate in duhlicatc and tho results were consistent with previously
determined
values. The signs! tv noise ratio for the plate assay (SIN} was 7:1 which is
acceptable for HTS.
Table 8. Plats Statistics
mean mP 244


I $ std dcv 9


free peptide103


mP range 141


CB-000231 24517


rc~ cwt


zo srnr 7n


All references cited herein era hereby incorporated by reference herein in
their entirety.
While this invention has been particularly shown and described with
references to preferred embodiments thGreo~ it will be uadcrstood by those
skilled
25 in the art that various changes it1 form and details may be made therein
without
departing from the spirit and scope of the invention as dcfinccl by tl~e
appondcd
c1 aims.
AMENDED SHEET
CA 02317653 2000-07-06