Note: Descriptions are shown in the official language in which they were submitted.
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99100161
Method for the Detection of Nucleic Acid Sequences
The present invention relates to a novel method for the detection of a nucleic
acid
sequence within a nucleic acid molecule. The method of the invention relies on
the combination of nucleic acid protection, ligation of oligonucleotides to
the
protected nucleic acid molecules and amplification of the ligation products.
The
detection of the amplified products is advantageously effected by converting
the
same to the single-stranded form and hybridizing the single-stranded form
thereof
to an array of single-stranded nucleic acid molecules of at least partially
predetermined sequence fixed to a solid support. The solid support is
preferably a
chip. Detection of hybridized molecules can be effected according to
conventional
methods. The present invention additionally relates to a kit for carrying out
the
method of the invention.
The detection of nucleic acid sequences within biological samples becomes
increasingly important. With the advent of the polymerase chain technology
(PCR)
(see, for example, Saiki et al, Science 239 (1988) 487-491 ), a significant
advance
in the role of molecular biology in diagnosis was achieved. In addition, a
growing
number of genes has become available, mutations in which are related to human
diseases. For example, Scherzinger et al, Cell 90 (1987), 549-558, have
demonstrated a correlation between the number of glutamine repeats in the
huntingtin gene and a phenotype correlated with Huntington's Disease. It is
expected that further human diseases will be directly linked to genetic
disorders
in the future. A number of methods are available that allow the detection of
genetic disorders such as point mutations, deletions or duplications. Such
methods include PCR, RFLP analysis or Southern blotting in combination with
nudeic acid hybridization. Often, these methods are, however, still rather
laborious or allow a detection of only one nucleic acid sequence at a time.
For
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
2
example, the classic PCR method, as a rule, requires specific primers for each
DNA sequence that is to be analyzed. An improvement of the classic PCR is
represented by the so-called multiplex PCR which has, however, turned out not
to
be a very robust technique. Thus, oligonucleotide primer pairs as used for PCR
show different efficiencies for priming and amplifying a DNA sequence. If
several
primer pairs with different priming features are used in the same reaction,
the rate
of misprimings is increased and the amount of specific PCR products is
decreased. When using "strong" (i.e. very efficient) primers together with
weak
(i.e. not very efficient) primers only the "strong" primers may yield a
detectable
product. Furthermore do different assay conditions (Mg2' concentration,
template
concentration, primer concentration, annealing temperature, even different
batches of DNA-polymerase) show a great influence on the amount of different
PCR products.
Accordingly, the technical problem underlying the present invention was to
develop a method that allows for the easy detection of speck nucleic acid
sequences within the sample and which further can be carried out at a rather
low
cost. The solution to said technical problem is achieved by providing the
embodiments characterized in the claims.
Thus, the present invention relates to a method for the detection of a nucleic
acid
sequence within a nucleic acid molecule comprising the steps of
(a) hybridizing single-stranded nucleic acid to one or more single-stranded
nucleic acid probes;
(b) removing non-hybridized nucleic acid from the product of step (a);
(c) converting the hybrid obtained in step (b) into single-stranded form;
(d) ligating oligonucleotides to the single-stranded nucleic acid obtained in
step (c); or
(c') ligating oligonucleotides to the hybrid obtained in step (b);
(d') converting the ligation product of step (c') into single-stranded form;
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
J
(e) carrying out an amplification reaction with the product of step (d) or
(d')
using primers that hybridize to said oligonucleotides or transcribing the
product of step (d) or (c); and
(f) detecting the product of step (e).
The method of the invention allows, by using only one pair of e.g.
complementary
oligonucleotides and two primers (subsequently also termed "universal
primers")
hybridizing thereto, the ampi~cation and subsequent detection of virtually any
nucleic acid sequence that forms a double-stranded nucleic acid hybrid with a
chosen probe. It is particularly preferred that one and the same
oligonucleotide is
used for ligation to the 5'-end as well as the 3'-end and also as the primer.
Examples of such oligonucleotides are oligonucleotides comprising palindromic
sequences. Thus, optionally, one oligonucleotide is sufficient for all steps
to be
carried out in the method of the invention.
In accordance with the present invention, the term "nucleic acid molecule"
comprises also any feasible derivative of a nucleic acid to which a nucleic
acid
probe may hybridize. In addition, the nucleic acid probe may be any derivative
of
a nucleic acid capable of hybridizing to said nucleic acid molecule.
In other embodiments, the primers employed in the method of the invention may
not be identical with the oligonucleotides used for ligation. Nevertheless,
advantageously the same primer may be used for hybridization to the 3'-end and
the 5'-end of the target oligonucleotide, depending on the sequence of said
target.
Consequently, the need for preparing a larger number of different primers or
primer pairs for the analysis of biological samples falls away. If desired,
oligonucleotides or pairs of oligonucleotides with different nucleic acid
sequences
may be employed and manipulated according to conventional methods for ligation
either to the 5'- or 3'- ends of the amplified nucleic acid molecules (see,
for
example, Sambrook et al, "Molecular Cloning, A Laboratorial Manual" CSH Press,
Cold Spring Harbor, (1989)). Naturally, more than one single-stranded nucleic
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
4
acid probe can be hybridized to said nucleic acid. Also, the sample may
comprise
more than one different nucleic acid molecule, such as a pool of different
nucleic
acid molecules.
The sample may be obtained from any biological or synthetic source.
Preferably,
the sample is taken from a natural source such as blood, serum, stool, sputum,
tissue etc. Applied to samples from natural sources, the method of the
invention
may be used for the detection of genetic disorders indicative of human or
animal
diseases.
In its broadest aspect, the method of the invention envisages,;with respect to
the
timing of the ligation of the oligoriucleotides, two alternatives. Either, the
oligonucleotides are ligated to single-stranded protected nucleic acid
molecules
after removal of the protecting strand or they are, preferably in double
stranded
form, ligated to the double-stranded hybridization product. In both cases, non-
hybridized single-stranded nucleic acid is removed prior to the iigation.
Further,
either single-stranded or double-stranded oligonucleotides may be ligated to
the
product according to the first and to the second alternative. As regards the
first
alternative, it is to be noted that the protecting strands to be removed may
be
either the strand that was originally present in the sample or the single-
stranded
probe.
As regards the nature and nucleotide sequence of the oligonucleotides the
following should be noted: if said oligonucleotides are iigated as double-
stranded
complementary nucleic acid molecules, it is advantageous to ligate them first
to
the 5'-end and subsequently to the 3'-end of the protected nucleic acid
molecules,
or vice versa. Advantageously and preferably, the double-stranded
oligonucleotides comprise a recognition and cleavage site for a restriction
endonuclease.
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
As regards the embodiment comprising the transcription of the product in step
(e),
the following should be noted: in this embodiment, at least one of the
oligonucfeotides to be ligated to the protected or protecting nucleotide
sequence
comprises a promoter for a polymerase, preferably a RNA polymerase. Upon
ligation, the corresponding transcript can be produced and visualized
according to
standard protocols.
By setting the conditions for hybridization, the person skilled in the art can
determine if strictly complementary sequences or sequences with a higher or
lower degree of homology are to be detected. The setting of conditions is well
within the skill of the artisan and to be determined according to protocols
described, for example, in SambrooR, loc. cit. or Hames and Higgins, "Nucleic
acid hybridization, a practical approach", IRL Press, Oxford (1985). Thus, the
detection of only specifically hybridizing sequences will usually require
stringent
hybridization and washing conditions such as 0.lxSSC, 0.1% SDS at 65°
C. Non-
stringent hybridization conditions for the detection of homologous and not
exactly
complementary sequences may be set at 6xSSC, 1 % SDS at fi5°C. As is
well
known, the length of the probe and the composition of the nucleic acid to be
determined constitute further parameters of the hybridization conditions.
For the other steps required in the method of the invention, the person
skilled in
the art is in the position to practice them by reverting, for example, to
conventional
protocols. Thus, the removal of single-stranded nucleic acid that did not form
a
hybridization product with the oligo- or polynucleotide used as a probe as
well as
of probes that did not hybridize to any target nucleic acid sequence can be
effected according to protocols described, for example, in Sambrook et al,
loc. cit.
For example, single-stranded nucleic acid such as mRNA may be removed by S1
nuclease or mung bean nuclease digestion. Double-stranded nucleic acid such as
DNA may be removed by employing protocols using ~,-exonuclease. Conventional
protocols may also be employed for the ligation step, the conversion of double-
stranded nucleic acid into single-stranded nucleic acid or for the
amplification
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
6
which may conveniently be carried out by using PCR technology, strand
displacement amplification, linker ligation combined with in vitro
transcription or
techniques comprising rolling circle amplification if the protector or the
protected
molecule is a circular molecule. Thus, in a template dependent ligation, T4-
DNA
ligase may advantageously be used. Template independent ligation would require
a different enzymatic activity such as conferred by T4-RNA ligase. Further,
for
example, the conversion of double-stranded into single-stranded nucleic acid
may
be done by base or heat denaturation. The person skilled in the art is further
capable of converting the complete double-stranded nucleic acid within a
sample
into a single-stranded form, if this is desired. Suitable protocols include,
alone or
in combination, strand displacement reactions by polymerise, chemical or
enzymatic degradation of either strarid, affinity chromatography if the
introduced
primer is labeled and chemical denaturation of (hetero-)duplex nucleic acid
molecules. This measure will also prevent the formation of double-stranded
hybrids within the nucleic acid to be analyzed to which later oligonucleotides
would be ligated, thus giving rise to false positive results. Double-stranded
template dependent ligation of 5'-primer oligonucleotides may also be
performed
in a cyclic ligation reaction using thermostable ligases (e.g. Taq Ligase).
For this
purpose, different types of single-stranded adaptor molecules may be used
which
are complementary to the amplification primer oligonucleotides and terminally
complementary to the protected oligonucleotides. The 5'- and 3'-ends of the
adaptor and the first primer oligonucleotide may in this embodiment be
connected
forming a hairpin loop.
Whereas it is possible to change reaction vials after each step, it is
preferred to
carry out at least steps (b) to (e) in one reaction vessel, preferably in an
Eppendorf tube.
It is preferred that the nucleic acid to be detected andlor the nucleic acid
probe is
comprised of RNA, DNA or PNA. Examples of RNA are rRNA and mRNA, of
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
DNA, cDNA and genomic DNA. Any of the above preferred embodiments may
also be (semi)synthetically produced.
Whereas a number of options are available to the person skilled in the art for
removal of the non-hybridized nucleic acid in step (b), it is preferred that
said
removal is effected by exonuclease activity, such as ~,-exonuclease activity
optionally in combination with (restriction) endonuclease activity, by
affinity
chromatography using, for example, antibodies specific for double-stranded
nucleic acid coupled to a conventional matrix or by gel-electrophoresis or
HPLC. It
is also envisaged in accordance with the present invention that any one or the
combination of the above mentioned nuclease activities are combined with
affinity
chromatography, gel-electrophoresis and/or HPLC in order to remove non-
hybridized nucleic acid in step (b}. As used in accordance with the present
invention, the phrase "removing non-hybridized nucleic acid" evidently also
comprises the removal of single-stranded regions of said nucleic acid that
have
not formed a nucleic acid hybrid with said one or more nucleic acid probes.
In an additional preferred embodiment of the method of the invention, the
oligonucleotides used for ligation are masked at their 3'-ends. Masking the 3'-
or
5'-ends of said oligonucleotides in this embodiment of the invention is
required if
template independent ligation method as with T4-RNA-ligase is used. For
example, one would use one primer which has no 5'-phosphate and a normal 3'-
hydroxy group which is ligated to the 5'-phosphate group of the nucleic acid
to be
analyzed thereby forming a phosphodiesterbond. For the primer ligation to the
3'-
hydroxy group of said analyte one might use a 3'-blocked oligonucleotide (e.g.
an
oligonucleotide carrying an amino block) with an intact 5'-phosphate group.
3'- as well as 5'- primer oligonucleotides are able to form a dimer. The
dimers
have a 5' h drox , '
- y y group and a 3 -blocked end unable to form polymers of higher
order. The primer ligation steps to the 3'-end and to the 5'-end have, in
these
embodiments, therefore to be carried out sequentially in separate reactions to
avoid primer dimer formations. Alternatively, the oligonucleotides used for
ligation
CA 02318371 2000-07-06
WO 99/36571 PGT/EP99100161
8
are designed to form, upon dimer. formation, a restriction site for an
endonuclease
which can subsequently be cleaved.
Thermostable restriction enzymes can be used in a PCR amplification reaction
for
cleaving the primer dimers. The following is an example of this embodiment.
The
5'-oligomer to be ligated to the 5'-end of the protected nucleic acid molecule
has
the sequence
5'-OH-GCACCGCGGAATTCTCGAGGACAA-OH-3'
whereas the 3'-oligomer has the following sequence:
5'-P-AGTCCGTGGCGCCTTAAGAGCTC-3'-X
X denotes the amino block. Upon dimer formation, the following sequence is
established
5'-OH-GCACCGCGGAATTCTCGAGGACAAAGTCCGTGGCGCCTTAAGAGCTC
-3'-OH
wherein a Tthl restriction site is emphasized by bold letters. Final
amplification
may be effected using single-primer oligonucleotides of the following
sequence:
5'-OH-GCACCGCGGAATTCTCGAG-3'-OH
Cleavage with Tthl should be effected early, i.e. once the first double-
strands
have been formed.
It is further preferred that, in the ampl~cation step (e), labeled nucleotides
are
incorporated into the amplification product. This embodiment of the method of
the
invention has the advantage that the amplification product is directly visible
in
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
detection step (f) without the need for an additional detectable means.
Conveniently, the label is a radioactive label, a fluorochrome, a
bioluminescent
label, a chemiluminescent label, a hapten, an enzyme such as horseradish
peroxidase or a chelator for the detection of bound metals.
As has been mentioned herein above, the detection step (f) can be carried out
by
a variety of conventional protocols. Such methods include filter
hybridization,
PCR-ELISA, mass spectroscopy and dot blot assays. For example, if the
protecting nucleic acid molecules are designed to have a distinguishable
length,
the protected nucleic acid sequences/molecules have a distinct length and
mass.
Accordingly, such molecules, in a wide range of masses, will be appropriate
for
analysis by mass spectroscopy. In addition, once the nucleic acid sequence in
the
sample has been determined, it can be verified by nucleic acid sequencing if
an
exactly complementary nucleic acid sequence was searched for or it can be
determined if a homologous sequence was to be identified.
For detecting the ampl~cation product in step (f), the following detailed
protocol is
particularly preferred:
(f) converting the amplified product of step (e) into single-stranded form;
(f') contacting the single-stranded nucleic acid molecules obtained in step
(f)
with an array of single-stranded nucleic acid molecules with at least
partially predetermined sequences attached to a solid support under
conditions that allow the formation of hybrids between said single-stranded
nucleic acid molecules and nucleic acid molecules with said at least
partially predetermined sequence to occur; and
(f") detecting the formation of hybrids formed in step (f').
Again, the conversion of the amplified product into single-stranded form can
be
effected by conventional protocols that have been outlined above.
Also, the hybridization conditions in step (f') will be determined along the
various
schemes delineated herein above. The single-stranded nucleic acid molecules
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
arranged in array form on a solid support may have a fully or partially
predetermined sequence. They may be of natural, synthetic or semi-synthetic
origin. Attachment to the solid support may be effected according to
conventional
protocols, for example, via a biotin-avidin bridge.
The detection of hybrids in step (f") can be carried out by a variety of
means,
usually depending on the labeling that is employed. For example, if the
amplification in step (e) is effected by using fluorochrome-labeled
oligonucleotides, said detection may be by visual means, for example with a
correspondingly equipped microscope. Other options include capillary and gel
electrophoresis, HPLC, mass spectroscopy, nucleic acid hybridization and
nucleic
acid sequencing. One prefen-ed embodiment also applicable to the other
embodiments of the method referred to above, provides for the detection by
using
an anti-double-stranded DNA antibody. Said antibody may either be detectably
labeled or it may be detected using, for example, a tertiary antibody that is
detestably labeled. Another preferred embodiment employs for detection is
hybridization with a detestably labelled probe. Any detection method discussed
above may be assisted by computer technology.
The array referred to above may be any two- or three dimensional arrangement
of
molecules.
It is particularly preferred that the array is in grid form.
!t is further particularly preferred that said solid support is a chip. In one
embodiment, this chip consists of inorganic substances (glass, silica and
others)
or of organic substances (for example polymers) or is a hybrid consisting of
different substances or layers of different substances (plastic coated glass,
for
example, silane coated silica). The oligonucleotide bound to this chip could
be
directly bound by covalent binding or indirectly via hapten interactions (e.g.
a
biotin-avidin bridge).
CA 02318371 2000-07-06
WO 99/3b571 PCT/EP99/00161
11
tn a further preferred embodiment of the method of the invention, after step
(b)
and prior to step (e), the following step is carried out
(b') cleaving a mismatch contained in the hybrid obtained in step (b). The
step
characterizing this embodiment may be carried out prior to or after any of
steps (c), (c'), (d), and (d'). Cleaving of this matches is conveniently done
by the employment of appropriate enzymes such as Cleavase'~""
(Boehringer Mannheim). Upon cleavage of one or optionally both of the
hybridized strands, an amplification product will not form any longer. This
specific embodiment of the invention will find wide range of applications in
the demonstration of the presence of specific mRNA sequences or of
mutations in a genomic sequences related, for example, to cancer. Thus, it
is known Ras sequences contributing to the formation of tumorous cells
carry one specific mutation in their coding sequence. Preparing a
protecting oligonucleotide that is exactly complementary to the mutated
sequence will result in the amplification of that mutated sequence.
Accordingly, cancerous cells can be identified in the sample by applying
the method of the invention. If the protecting oligomer is hybridized only to
wildtype sequences, a mismatch will be formed and, upon cleavage, no
amplification product will be produced. Accordingly, the lack of appearance
of an amplification product is indicative of the absence of turnorous cells.
The basic teaching underlying this embodiment can, of course, be applied
to the person skilled in the art to a wide variety of purposes.
Further, the present invention relates to a kit comprising
(a) matrix bound protecting nucleic acid molecules; and
(b) universal primer oligonucleotides.
The matrix may be any conventional matrix such as polystyrol or magnetic beads
or a chip. The person skilled in the art is able to design the protecting
nucleic acid
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
12
molecules according to the specific target molecules that are to be analyzed.
Advantageously, the matrix comprises a mixture of different nucleic acid
molecules which may be of entirely different origin. Advantageously, the kit
of the
invention further comprises, besides the universal primer oligonucleotide to
be
used for optionally both backward and forward priming as well as optionally
for
ligation to the protected target nucleic acid molecule, hybridization
buffer(s),
nucleases) such as nuclease S9 or mung bean nuclease, nuclease buffers,
ligase(s) and ligation buffer(s), DNA polymerase(s) and polymerase buffers)
suitable for the amplification of the ligation products andlor a control
nucleic acid
the antisense sequence of which is also bound to the above referenced matrix.
The components of the kit of the invention may be packaged.: in containers
such
as vials, optionally in buffers andlor solutions. If appropriate, one or more
of said
components may be packaged in one and the same container.
The kit may be advantageously used for carrying out the method of the
invention.
The references cited in the specification are herewith incorporated by
reference.
The figures show:
Figure 1: Schematic overview of one preferred embodiment of the method of
the invention. Nucleic acids are protected by a protector molecule
from degradation with nucleases. After removal of degradation
products primers are ligated to each end of the protected nucleic
acids and the protected nucleic acids are amplified by a universal
PCR (one primer pair) for all protected nucleic acid fragments.
Subsequently, the amplification products are visualized by various
methods.
CA 02318371 2000-07-06
WO 99136571 PCT/EP99/00161
13
Figure 2: One further embodiment of the invention drawn schematically and
comprising the amplification of nucleic acid fragments after the
protection reaction using matrix bound protector molecules.
(A) nucleic acids capture
(B) degradation of non-protected nucleic acids
(C) ligation of primers
(D) universal PCR.
Figure 3: Universal PCR for the ampl~cation of nucleic acid fragments after
the protection reaction.
P1 = primer 1; cP1 = complementary to primer .P1; P2 = primer 2;
cP2 = complementary to'primer P2
In the first ligation step a primer oligonucleotide is ligated to the 5'-
end of the protected molecule. In the second ligation step an other
oligonucleotide is ligated to the 3'-end of the protected DNA-
molecule.
(A) Synthesis of the one strand with one primer.
(B) Synthesis of the one strand with the other primer. The
possibility of primer dimers having their origin in the ligation
reactions if there are contaminating DNA molecules of one
species ligated to the other one can be circumvented if
(C) 1. there are no contaminating molecules to be ligated
together; or if
2. the sequences of the ligated primer molecules form a
recognition site for a restriction enzyme (indicated in
thin bars) and can be cleaved in a subsequent reaction
D (e.g. in the amplification reaction if a thermostable
restriction endonuciease like Tthl is present in the
buffer).
CA 02318371 2000-07-06
WO 99/36571 PGT/EP99/00161
14
Figure 4: Single primer PCR for "universal PCR" amplification. (P1.1 = single
primer 1; cP1.1 = complementary to single primer P1.1; P1.2 =
single primer 2; cP1.2 = complementary to single primer P1.2)
In the first ligation step a primer oligonucleotide is ligated to the 5'-
end of the protected molecule. In the second ligation step a
oligonucleotide complementary to the 5'-oligonucleotide is ligated to
the protected DNA-molecule. With an amplification primer
complementary to one of the ligated terminal oligonucleotides it is
possible to amplify the protected DNA fragments.
(A) Synthesis of the one strand with the same;primer as the other
strand, since the complementary sequence is produced in
each synthesis cycle.
(B) The possibility of primer dimers having their origin in the
ligation reactions if there are contaminating DNA molecules
of one species ligated to the other one can be circumvented
if
(C) 1. there are no contaminating molecules to be ligated
together; or if
2. the sequences of the ligated primer molecules are
designed to form a recognition site for a restriction
enzyme (indicated in double bars) and therefore can be
cleaved in a subsequent reaction D (e.g. in the
amplification reaction if a ther<nostable restriction
endonucleases like Tthl is present in the buffer).
The Examples illustrate the invention.
Example 1
Analysis of mRNA for the presence of specific target sequences.
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/00161
Insulin specific mRNA was prepared from freshly obtained pancreatic tissue
according to standard procedures. The mRNA was dissolved in hybridization
buffer and insulin specific oligonucleotides of the following sequence:
5?GGGGCTGCTCTCTCCAAGGTAGGAAGGGGACACCCTGGCCGGTCAAGC
CTGGAGGGTGTTGGGTGCTCTCTCTGGAGGGCAATGTCTAGGCCCCTCGAG
-3'
to be used as protectors which were bound to matrix heeds were added. The
hybridization was carried out under constant agitation of the hybridization
mixture
for 16 hours at 65°C. Subsequently; the hybridization solution was
centrifuged
and unhybridized RNA was removed by washing the pellet and then repeating the
centrifugation and washing steps three times. Single-stranded nucleic acid was
subsequently removed by using either S1 nuclease or mung bean nuclease and
incubating the mixture at 37°C for an hour. Afterwards, the nucleases
were
removed by alternative washing steps with conventional washing buffers and
centrifugation. The remaining hybrids were denatured by treatment either under
heating conditions or ~ with low salt buffer. The protecting nucleic acid was
removed by centrifugation. The supernatant was transferred to a new reaction
vessel. To the supernatant conventional ligation buffer was added. The first
oligonucleotide was added and ligated for one hour with T4-RNA ligase. Not
ligated oligonucleotide was removed by conventional washing steps.
Subsequently, the second primer was ligated using the same ligation conditions
as above. Again, the not ligated oligonucleotide was removed by conventional
washing steps. The ligated nucleic acid was precipitated by adding ethanol and
salt using conventional conditions. To the precipitated nucleic acid a
conventional
RT-PCR buffer mix was added. The nucleic acid was amplified employing 30 PCR
cycles in the presence of fluorescence labeled primer oligonucleotides
complementary to the oligonucleotides ligated to the target sequence. The
amplified product was analyzed with a ~i-Imager (Molecular Dynamics).
CA 02318371 2000-07-06
WO 99/36571 PCT/EP99/0016t
16
Example 2
Detection of changes in gene-expression in amplified regions of chromosome 3
in
tumor cells.
Tumor cell lines containing an amplification in chromosome 3 (3q27-3q28) were
analyzed for the overexpression of the following candidate oncogenes: BCL6,
DLGH, DVL3, EIF4G, HSERM, HSFGF12, HSLPP, HUMP, HUMSOMI, RFC4. 5'
phosphorylated single-stranded DNA protectors complementary to the mRNA
transcribed from said oncogenes of different distinguishable length in
polyacrylamide gels were constructed using Genbank data and conventional
oligonucleotide synthesis techniques. RNA from the tumor cell lines was
prepared
by acidic guanidinethiocyanate/phenol/chloroform extraction. S1 protection was
carried out by using an aliquot of the designed oligonucleotides and 20 Irg of
total
RNA. Hybridization was performed overnight in PIPES buffer. After
hybridization
the non-hybridized RNA and DNA was removed by nuclease S1 treatment and
subsequently the DNA protectors were removed by DNA specific nuclease
treatment (RNAse free DNAse I). After precipitation the RNA was dissolved in
iigation buffer and the primer sequences were subsequently added by T4-RNA
ligase in two distinct 5' and 3' ligation steps. Hence all the protected RNA
sequences contain the same flanking regions which could be used for
amplification by Tth polymerase in a one tube RT-PCR reaction. Because of
identical primers of all the sequences, the PCR reaction amplifed the RNA in
the
same ratio as it was present in the cells.
Hence all the problems of multiplex PCR could be avoided. Detection of the
amplification products was done by agarose gel electrophoresis and ethidium
bromide staining.
