Note: Descriptions are shown in the official language in which they were submitted.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
DESCRIPTION
RECOMBINANT CELL LINES FOR DRUG SCREENING
BACKGROUND OF THE INVENTION
The present application is related to co-pending U.S. Patent Applications
serial number
60/072,556; 60/071,193 and 60/071,209 each of which were filed on January 12,
1998. This
application is further related to co-pending U.S. Patent Application serial
number 60/087,848
and 60/087,821 both of which were filed on June 3. 1998. The entire text of
each of the above-
referenced disclosures is specifically incorporated by reference herein
without disclaimer.
I. Field of the Invention
The present invention relates generally to the fields of biochemistry and
bioengineering
of eukaryotic cells. More particularly, it provides compositions and methods
for screening for
modulators of secretory function.
2. Description of Related Art
Cells of neuroendocrine origin generally have the capacity to synthesize and
secrete one
or more polypeptide products in a regulated manner. For example, cells of the
anterior or
intermediate lobes of the pituitary produce growth hormone or
proopiomelanocortin (POMC)-
derived peptides, such as ACTH and MSH; thyroid C cells secrete calcitonin;
and distinct types
of pancreatic cells produce and secrete hormones such as glucagon and insulin.
Neuroendocrine cells also exhibit sorting mechanisms whereby a given
polypeptide or
protein, destined for secretion, is targeted to the regulated secretory
pathway or the default
constitutive secretory pathway. These cells also have processes for achieving
secretory protein
maturation, which generally involves protein folding. disulfide bond
formation, glycosylation,
endoproteolytic processing as well as other types of post-translational
modifications.
Neuroendocrine cells exhibit controlled release of the secretory protein or
polypeptide, most
often in response to one or more external signaling molecules. or
"secretagogues," and thus
have regulatory pathways allowing the cells to secrete a desired product from
the secretory
storage granules in response to physiological or pharmacological stimuli.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
2 -
One of the more well known examples of neuroendocrine cells are the ~ cells of
the
islets of Langerhans in the pancreas. These cells secrete insulin in response
to modulators such
as amino acids, glyceraldehyde, free fatty acids, and, most prominently.
glucose. The capacity
of normal islet (3 cells to sense a rise in blood glucose concentration and to
respond to elevated
levels of glucose by secreting insulin is critical to the control of blood
glucose levels. Increased
insulin secretion in response to a glucose load prevents chronic hyperglycemia
in normal
individuals by stimulating glucose uptake into peripheral tissues.
particularly muscle and
adipose tissue. Aberrations in insulin secretion have serious consequences,
i.e., diabetes.
Approximately 16 million people in the United States have diabetes, and there
has been
an increase in the rate of prevalence of this disorder such that the percent
of the population with
diabetes is projected to increase (ADA, 1996). Some studies project that about
250 million
people worldwide will be afflicted by diabetes by the year 2020 (O' Rahilly,
1997). Currently,
over 600.000 people are diagnosed with diabetes each year in the United
States. The most
prevalent forms of this disorder are insulin-dependent diabetes mellitus (IDDM
or type I) and
noninsulin-dependent diabetes mellitus (NIDDM or type II). The former is
typically earlier in
onset. accounts for about 10%-15% of total cases, results from the autoimmune
destruction of
the pancreatic ~3-cell, and always requires insulin therapy. NIDDM often
presents later in life,
and progression of the disease is associated with ~i-cell exhaustion and
eventual ~i-cell failure
such that about 60% of people with the disease eventually convert from insulin-
independence to
an insulin-dependent status. In addition to insulin therapy, NIDDM patients
are usually treated
with diet and oral agents, particularly in the early phases of the disease.
Greater than 90% of
NIDDM patients require pharmacological treatment in order to achieve long-term
glycemic
control (Krall and Beaser, 1989; ADA, 1996).
Insulin was the first therapeutic drug prescribed for the treatment of
diabetes. It was
introduced in 1922 for the treatment of IDDM and dramatically reduced the
mortality rate in
this patient population (Joslin Diabetes Manual). Treatment for IDDM largely
remains
centered around self injection of insulin once or twice daily. The possibility
of islet or pancreas
fragment transplantation has been investigated as a means for permanent
insulin replacement
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
3 _
(Lacy, 1995). However, this approach has been severely hampered by the
difficulties
associated with obtaining tissue, as well as the finding that transplanted
islets are recognized
and destroyed by the same autoimmune mechanism responsible for destruction of
the patients'
original islet ~3 cells. Thus, the development of new therapeutic strategies
is highly desirable.
In the 1950s. sulfonylurea drugs became available for the treatment of NIDDM.
This
class of drugs is widely prescribed in the United States and acts directly on
the pancreatic ~3-
cell to stimulate insulin secretion. Long-term use of the sulfonylurea drugs
often results in a
loss of drug efficacy. Usage among patients goes from about 64% in the first
five years after
diagnosis, to 37% after 20 years of diabetes (Diabetes 1996: vital
Statistics).
More recently. PrandinTM (Repaglinide) a novel insulin secretagogue and member
of the
meglitinide class of drugs, has become available for the treatment of NIDDM.
Prandin acts on
the same (3-cell receptor as the sufonylureas and stimulates insulin secretion
via closure of
ATP-dependent potassium channels. However, as the absorption and elimination
of Prandin is
more rapid than the sulfonylureas, this drug may pose less risk for
hypoglycemic episodes
(Balfour JA, Faulds D. Repaglinide. Drug Aging, 13(2): 173 180, 1998 and
Physicians Desk
Reference, Ed 53, 1999). Also, drugs with physiological targets other than the
pancreatic ~i-ceil
have become available for the treatment of NIDDM (Bressler and Johnson, 1997).
Metformin
(N,N-dimethylimidocarbonimidic diamide hydrochloride, also known as
GLUCOPHAGER)
and troglitazone (a thiazolidinedione, also known as Rezulin) are
antihyperglycemic agents that
act to decrease glucose production from the liver and to improve peripheral
insulin sensitivity
(Henry 1997). Acarbose, an oligosaccharide also known as PrecoseR, exerts its
activity in the
gastrointestinal tract where it functions as an inhibitor of alpha-
glucosidase. Inhibition of this
enzyme prevents the conversion of complex carbohydrates to simple, absorbable
sugars and
thereby functions to decrease postprandial hyperglycemia (Coniff and Krol.
1997). Metformin,
troglitazone and acarbose recently have been approved for use in the United
States, but it
remains to be seen how effective these drugs, or combinations thereof, will be
in preventing the
short-term and long-term complications of diabetes (Bressler and Johnson,
1997).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
4
Clearly, there is a need for improvement, both in the number of pharmaceutical
agents
available for the prevention and treatment of diabetes, and in the
effectiveness with which such
agents prevent or retard the onset of diabetic complications as well as other
neuroendocrine
based diseases.
SUMMARY OF THE INVENTION
This invention describes the genetic tailoring of cell lines and their use in
high through-
put, biological assays for the identification of novel therapeutic compounds
or drug targets. In
particular, the use of humanized rodent pancreatic (3-cell lines as screening
toots for
therapeutics in the prevention and/or treatment of diabetes will be described.
Thus, in one aspect, the present invention provides a method of identifying a
modulator
of secretory function comprising the steps of: (i) providing an immortalized
cell having a stable
secretory function; (ii) contacting the cell with a candidate substance; (iii)
measuring the
secretory function of the cell; and (iv) comparing the secretory function of
the cell in step (iii)
with the secretory function of the cell of step (i), wherein an alteration in
the secretory function
indicates that the candidate substance is a modulator of the secretory
function.
In certain embodiments, the secretory function of the cell comprises the
secretion of a
polypeptide. The polypeptide may be an amidated polypeptide, a glycosylated
polypeptide, a
hormone, an enzyme or a growth factor. In other aspects, the secretory
function is dependent
on a regulator wherein the regulator is selected from the group consisting of
calcium ions,
CAMP, ealmodulin, phosphorylation. dephosphorylation, membrane polarization
glucose, ATP,
ADP, fatty acids, trigIycerides, nitrous oxide (and other free radicals) and
NADPH. In other
aspects of the present invention, the modulator inhibits the secretion; in yet
other embodiments.
the modulator stimulates the secretion.
In certain embodiments of the present invention, the cell is encapsulated in a
biocompatible matrix. In other embodiments, the cell is in an animal. The cell
may be a fetal
cell. In other embodiments, the cell is part of a primary cell obtained from
human tissue. The
cell may, independently be part of an adherent culture or as part of a
suspension culture. In
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
particular embodiments, the cell is an immortalized cell. The cell may be
independently, an
endocrine cell, and more particularly it may be a neuroendocrine cell. The
neuroendocrine cell
may be obtained from a human neuroendocrine tumor.
The cell may be an insulinoma cell, a human cell, a non-human cell, a
secretory cell, a
pancreatic beta cell, a pancreatic alpha cell, a pituitary cell, an adipocyte,
a hepatocyte, a
muscle cell, a lung cell or a gastrointestinal cell. In other aspects of the
invention, the cell is
responsive to modulators of secretion. In alternative aspects of the present
invention, the cell is
non-responsive to modulators of secretion.
IO
The glycosylated polypeptide may be selected from the group consisting of
amylin,
luteinizing hormone, follicle stimulating hormone and chorionic gonadotrophin.
In preferred
embodiments, the hormone may be selected from the group consisting of growth
hormone,
prolactin, placental lactogen, luteinizing hormone, follicle-stimulating
hormone, chorionic
gonadotropin, thyroid-stimulating hormone, leptin. adrenocorticotropin (ACTH),
angiotensin I,
angiotensin II, ~i-endorphin, (3-melanocyte stimulating hormone (~i-MSH),
cholecystokinin,
endothelin I, galanin, gastric inhibitory peptide (GIP), glucagon, insulin,
lipotropins,
neurophysins and somatostatin. The amidated polypeptide may be selected from
the group
consisting of calcitonin, calcitonin gene related peptide (CGRP), ~i-
calcitonin gene related
peptide, hypercalcemia of malignancy factor ( 1-40) (PTH-rP), parathyroid
hormone-related
protein (107-139) (PTH-rP), parathyroid hormone-related protein (107-111) (PTH-
rP),
cholecystokinin (27-33) (CCK), galanin message associated peptide,
preprogalanin (65-105),
gastrin I, gastrin releasing peptide, glucagon-like peptide (GLP-1),
panereastatin, pancreatic
peptide, peptide YY, PHM, secretin, vasoactive intestinal peptide (VIP),
oxytocin, vasopressin
(AVP), vasotocin, enkephalins, enkephalinamide. metorphinamide (adrenorphin),
alpha
melanocyte stimulating hormone (alpha-MSH). atrial natriuretic factor (5-28)
(ANF), arnylin,
amyloid P component (SAP-1), corticotropin releasing hormone (CRH), growth
hormone
releasing factor (GHRH), luteinizing hormone-releasing hormone (LHRH),
neuropeptide Y,
substance K (neurokinin A), substance P and thvrotropin releasing hormone
(TRH). In
particularly preferred embodiments, the cell secretes insulin in response to a
modulator. The
growth factor may be selected from the group consisting of epidermal growth
factor, platelet-
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
6
derived growth factor, fibroblast growth factor, hepatocyte growth factor and
insulin-like
growth factor 1. In other embodiments, the polypeptide may be an enzyme that
is a secreted
enzyme. In particular embodiments, the secreted enzyme may be selected from
the group
consisting of adenosine deaminase, galactosidase, glucosidase,
lecithin:cholesterol
S acyltransferase (LCAT), factor IX, sphingolipase, lysosomal acid lipase,
lipoprotein lipase,
hepatic lipase, pancreatic lipase related protein, pancreatic lipase and
uronidase. An especially
preferred enzyme is LCAT.
In those embodiments wherein the cell is non-responsive to modulators of
secretion the
cell may be engineered to modify the secretion of the polypeptide in response
to the
secretagogue. In particular embodiments, the cell may be engineered to secrete
an amidated
polypeptide. a glycosylated polypeptide, a hormone or a growth factor in
response to the
secretagogue.
In particular embodiments, the cell is an engineered cell that expresses a
recombinant
GLUT-2 gene. In other embodiments, the cell is an engineered cell that
expresses a
recombinant glucokinase (hexokinase IV) gene. In still further embodiments,
the cell is an
engineered cell that has a reduced hexokinase I activity relative to the cell
from which it was
prepared.
In particularly preferred aspects of the present invention, the cell is
derived from a (3TC,
RIN, HIT. BHC, CM, TRM, TRM6, AtT20, PC12, BG 49/206, BG40/110, BG-H03, BG
498/45, BG 498/20, NCI-H810 (CRL-5816), BON, NES2Y, NC1-H508 (CLL-253), HEPG2
or
HAPS cell. More particularly, the cell may be selected from the group
consisting of (3G HO1,
(3G H02, ~3G H03, (3G H04, (3G HOS, (3G H06, (3G H07, (3G H08, ~3G H09, (3G H
10, ~3G
HI1, ~iG H12. (3G H13, (3G H14, ~iG H15, ~iG H16, (3G H17, ~iG H18, ~iG H19,
~3G H20, ~iG
H21, (3G H22, (3G H23 and (3G H25.
In certain aspects of the present invention, the cell secretes an endogenous
secretory
polypeptide. In other aspects, the cell is engineered to increase secretion of
an endogenous
secretory polypeptide. In still further embodiments. the cell is engineered to
modify the
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
7
secretion of an endogenous secretory polypeptide in response to the modulator.
More
particularly, the cell comprises an endogenous gene encoding the polypeptide
and in certain
aspects, the expression of the gene is inhibited. In still further preferred
embodiments, the cell
further comprises an exogenous gene that encodes an exogenous
secretor~° polypeptide, the cell
secreting the exogenous secretory polypeptide.
It is contemplated that the cell is grown in defined media further
supplemented with a
growth factor specific for the cell. The cell may be a human pancreatic (3-
cell and the growth
factor is HGF, IGF-1. PDGF, NGF or growth hormone.
In other embodiments, the cell expresses an endogenous receptor. In particular
aspects,
the cell comprises an endogenous gene encoding the receptor and the expression
of the gene is
inhibited. In other aspects, the cell may be engineered to modify the
expression of an
endogenous receptor in response to the modulator. The modulator may be a
stimulator of the
expression or an inhibitor of the expression.
In those aspects wherein an endogenous gene has been inhibited, the cell may
further
comprise an exogenous gene that encodes an exogenous receptor, the cell
expressing the
exogenous receptor. In more particular embodiments, the receptor is selected
from the group
consisting of a-adrenergic receptor, ~i-adrenergic receptor, potassium inward
rectifying
channel, sulphonylurea receptor, GLP-1 receptor, L-Ca2+ receptor, voltage-
dependant late
rectifying channel, growth hormone receptor, luteinizing hormone receptor,
corticotrophin
receptor, urocortin receptor, glucocorticoid receptor, pancreatic polypeptide
receptor,
somatostatin receptor, muscarinic receptor, BK channel and leptin receptor.
In particular embodiments, the cell secretory function is responsive to a cell
signaling
molecule and the cell signaling molecule is a modulator of the secretion. In
preferred
embodiments, the modulator may be a stimulator or an inhibitor of the
secretion. The cell
signal may be Ca2+ dependent or Ca2+ independent.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
8
Also provided by the present invention is a modulator of secretory function
identified
according a method comprising the steps of (i) providing an immortalized cell
having a stable
secretory function; (ii) contacting the cell with a candidate substance; (iii)
measuring the
secretory function of the cell; and (iv) comparing the secretory function of
the cell in step (iii)
with the secretory function of the cell of step (i), wherein an alteration in
the secretory function
indicates that the candidate substance is a modulator the secretory function.
Alternative aspects of the present invention provide a modulator of
polypeptide
secretion identified according a method comprising the steps of: (i) providing
a stable,
immortalized cell that secretes a polypeptide; (ii) contacting the cell with a
candidate substance;
(iii) incubating the cell; (iv) measuring the secretion of the polypeptide;
and (v) comparing the
secretion of the polypeptide in the cell of step (iii) with the secretion of
the polypeptide in the
cell of step (i), wherein an alteration in the secretion of the polypeptide
indicates that the
candidate substance is a modulator the secretion.
In still other aspects, the present invention provides a method of identifying
a modulator
of insulin secretion comprising the steps of (i) providing an engineered
pancreatic ~i cell; (ii)
contacting the cell with a candidate substance; (iii) measuring the insulin
secretion of the cell;
and (iv) comparing the insulin secretion of the cell in step (iii) with the
insulin secretion of the
cell of step (i), wherein an alteration in the insulin secretion indicates
that the candidate
substance is a modulator the secretion.
Another embodiment of the present invention provides a method of identifying a
modulator of insulin secretion comprising the steps of (i) providing an
engineered pancreatic ~
cell; (ii) contacting the cell with a candidate substance; (iii) measuring the
intracellular signal of
the cell; and (iv) comparing the intracellular signal of the cell in step
(iii) with the intracellular
signal of the cell of step (i); wherein an alteration in the intracellular
signal indicates that the
candidate substance is a modulator the insulin secretion. The intracellular
signal can include
but is not limited to pH, calcium, ATP, ADP, action potentials, membrane
polarity. fatty acid
pools such as free fatty acids and triglycerides, glycolytic flux, NADPH,
NADP. NADH, NAD,
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
9
nitrous oxide and other free radicals, DNA fragmentation and other events
associated with
apoptosis, patterns of gene expression, cAMP, calmodulin, and enzyme
activities.
A more specific embodiment of the present invention provides a method of
identifying a
modulator of insulin secretion comprising the steps of (i) providing an
engineered pancreatic (3
cell; (ii) contacting the cell with a candidate substance; (iii) measuring the
intracellular Ca2+ of
the cell; and (iv) comparing the intracellular Ca'~ of the cell in step (iii)
with the intracellular
Ca2+ of the cell of step (i); wherein an alteration in the intracellular Ca2+
indicates that the
candidate substance is a modulator the insulin secretion.
Another aspect of the present invention provides an engineered human cell line
that has
a regulated secretory pathway, the cell comprising a transgene encoding a
therapeutic
polypeptide. In preferred embodiments, the transgene is introduced to the cell
by contacting the
cell with an expression construct comprising the gene operably linked to a
promoter functional
in eukaryotic cells. In particularly preferred embodiments, the cell is
selected from the group
consisting of ~iTC, RIN, HIT,. BHC, CM, TRM. TRM6, AtT20, PC 12, BG 49/206,
BG40/110,
BG-H03, BG 498/45, BG 498/20, NCI-H81 U (CRL-5816), BON, NES2Y, NCI-H508 (CLL-
253), HEPG2 or HAPS cell. More particularly. the cell may be selected from the
group
consisting of ~3G HO1, (3G H02, ~iG H03, ~G H04, (3G HOS, (3G H06, (3G H07,
(3G H08, ~iG
H09, ~iG H10, (3G H11, ~3G H12, [3G H13, ~iG H14, (3G H15, (3G H16, ~3G H17,
~iG H18, ~iG
H19, (3G H20, (3G H21, ~iG H22, (3G H23 and ~iG H25.
Other objects, features and advantages of the present invention will become
apparent
from the following detailed description. It should be understood, however,
that the detailed
description and the specific examples, while indicating preferred embodiments
of the invention,
are given by way of illustration only, since various changes and modifications
within the spirit
and scope of the invention will become apparent to those skilled in the art
from this detailed
description.
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to
further demonstrate certain aspects of the present invention. The invention
may be better
understood by reference to one or more of these drawings in combination with
the detailed
5 description of specific embodiments presented herein.
FIG. 1. Multiple signaling pathways are involved in the regulation of insulin
secretion. Insulin secretion is regulated by fuels and hormones, and is
subject to regulation as
well by synthetic compounds. The various modulators exert effects via specific
cell surface
10 receptors, metabolic pathways, and ion fluxes. Most changes in secretion
are mediated through
changes in intracellular calcium.
FIG. 2. Schematic summary of how engineered cell lines can facilitate in vitro
and
in vivo testing of candidate compounds that modulate insulin secretion.
Compounds can be
screened for their effects on secretory function using primary islets,
enriched populations of
beta cells, and engineered cell lines. Information from these screens can be
used to elucidate
potentially novel drug targets and to enrich for compounds that impact
secretory function.
Encapsulated cells can be transplanted into rodents or other mammals for pre-
clinical in vivo
testing of candidate compounds.
FIG. 3. Engineered beta-cell lines respond to a variety of secretagogues. (3G
49/206
cell lines were plated, cultured for 48 hrs., rinsed and washed two times (20
min. each) in
HEPES Buffered Biological Salt Solution (HBBSS). HBBSS supplemented with
secretagogue(s) was added to each well and allowed to incubate for 2 hours.
Medium was
harvested from each well, assayed for insulin, and the amount of insulin
secreted per hour,
normalized to cell number, was determined. Normalization for cell number was
achieved by
staining with the neutral red, a viability dye.
FIG. 4. The response of engineered ~i-cell lines to secretagogues is stable
over time
and population doublings. (3G 49/206 cells were tested for stability of
secretogogue
responsiveness by monitoring insulin secretion over several population
doublings (PD) ranging
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
11
from PD 12 to PD 10~. Cells were plated, cultured for 48 hrs, and washed two
time (30 min.
each) in a I-IBBSS. Insulin secretion was stimulated with glucose alone (Basal
+) or in the
absence or presence of glucose (presence indicated by "+") with IBMX. The
stimulatory
cocktail contains a mixture of secretagogues (BetaGene media supplemented with
10 mM
S glucose, 10 mM glutamine, leucine. and arginine, 100pM carbachol, and 100p.M
/BMX).
FIG. 5. Secretagogue-stimulated insulin secretion of engineered RIN cell lines
is
maintained in microbeads. (3G 49/206 cells were encapsulated in ~0 pl alginate
beads,
cultured in BetaGene medium for 72 hrs, and tested for secretagogue-responsive
insulin
secretion. Following washes in HBBSS, cells were stimulated with glucose,
glucose plus
IBMX, or a Stimulatory Cocktail (BetaGene supplemented with 10 mM glucose, 10
mM
glutamine, leucine, and arginine, 100p,M carbachol, 100~tM /BMX, 0.1% BSA, 20
mM HEPES).
As shown, glucose plus IBMX resulted in an 8-fold stimulation in insulin
secretion, which is
comparable to the fold stimulation observed with adherent cultures.
FIG. 6. Engineered RIN cells retain secretory responsiveness in a 96-well
format.
~iG 49/206 cells were plated and assayed in 48-well dishes (100,000/well) as
described in the
legend to FIG. 3. for 96-well assays, 30,000 ~iG 49/206 cells were plated and
cultured for 48
hrs. in 150 pl of BetaGene Medium/ 2.5% FCS; washed twice, 20 min each, in 200
p.l in
HBBSS, and cells stimulated with glucose or glucose plus IBMX.
FIG. 7. Overexpression of the alpha2-adrenergic receptor in RIN cell lines
confers
an increased sensitivity to Clonidine in vitro. ~iG 265/2 and (3G 265/4, cell
lines that
overexpress transgenic alpha2-adrenergic receptor, were compared to the
parental cell line ((3G
18/3E1) for the capacity of Clonidine to inhibit stimulated insulin secretion.
Cell lines were
plated, cultured for 48 hrs, and washed two times (30 min. each) in a basal
medium (RPMI
medium/ without glucose/0.5% BSA/ 20 mM HEPES/ 100 pm diazoxide). Cells were
stimulated to secrete insulin with a stimulatory cocktail - amino acids
supplemented with 0, 1,
10 or 100 nM Clonidine. 1 nM Clonidine was potently inhibitory of stimulated
insulin
secretion in both the (3G 265/2 and ~iG 265/4 cell lines resulting in a 60%
and 30% reduction,
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
12
respectively. The parental (3G 18/3E1 cell lines was resistant to the
inhibitory effects at all
concentrations of Clonidine tested.
FIG. 8. Engineered RIN cell lines that express transgenic alpha2-adrenergic
receptor are more sensitive than human islets to Clonidine. (3G 265/2 cells
and human islets
were encapsulated in alginate microbeads and stimulated to secrete insulin in
0, 1, 10, 100, or
1000 nM Clonidine. Washes and stimulations were performed as described in the
legend to
FIG.7. At 10 nM Clonidine. human islets were refractory to Clonidine; whereas,
insulin
secretion from (3G 265/4 cells was inhibited by about 35%.
FIG. 9. Overexpression of the alpha2-adrenergic receptor in RIN cell lines
confers
an increased sensitivity to Clonidine in vivo. ~iG 265/2 cell lines were
encapsulated in
alginate beads and injected intraperitoneally (IP) into Zucker diabetic, fatty
rats. Following 4-S
days of in vivo growth and normalization of blood glucose, rats were injected
IP with Clonidine
(50 pg/kg), or Yohimbine (7i pg/kg). 20 minutes post-injection blood samples
were taken to
determine the levels of human insulin and rat C-peptide in the plasma.
Yohimbine had no effect
on human insulin or rat C-peptide levels. Clonidine injection resulted in a
50% reduction of
human insulin and rat C-peptide in plasma.
FIG. 10A and FIG. IOB. Engineered beta-cell lines lose stimulated insulin
secretion, but maintain basal insulin secretion in the absence of fetal bovine
serum. FIG.
10A. (3G 18/3E1 cells were encapsulated in alginate and maintained for one
week in culture in
BetaGene medium with or without FBS supplement. Beads were washed with basal
medium
and treated with a cocktail (BetaGene supplemented with 10 mM glucose, 10 mM
glutamine,
leucine, and arginine, 100pM carbachol, IOO~.M IBMX, 0.1% BSA, 20 mM HEPES) to
stimulate
insulin secretion. Cells that had been maintained in FBS-supplemented BetaGene
media
responded with a 3-4 fold increase in insulin secretion; whereas those cells
non-supplemented
with FBS failed to stimulate insulin secretion following exposure to the
stimulatory cocktail. In
contrast to the dramatic differences in secretion, the basal insulin secretion
from the two groups
is maintained at equivalent levels. FIG. lOB compares the effects of different
lots of BetaGene
Medium and FBS on cellular growth. As shown, lots 7E183 is equivalent to lot
7H3299 with
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
13
respect to support of cellular growth. and 9 days of FBS-depletion diminishes
gro~.rth of the
cells by 10 - 20%.
FIG. 11A and FIG. 11B. Over-expression of somatostatin receptor (SSTRV) in ~3G
40/110 confers increased sensitivity to somatostatin (SS-28). A cell line
expressing high
levels of the transgenic SSTRV receptor ((3G 603/11) was compared to a non-
expressing cell
line, ~iG 603/7 (FIG. 11A). As shown, 50 pM SS-28 was potently inhibitory of
glucose-
stimulated insulin secretion from (3G 603/11. but had no effect on (3G 603/7
insulin secretion.
Secretion studies were performed with HBBSS supplemented with varying
concentrations of
SS-28 in the absence or presence of 10 mM glucose. As shown in FIG. 11B, 5 nM
SS-28
inhibits insulin secretion from ~iG 603/11 when cells were stimulated with
BetaGene Medium
in the absence of glucose and in a stimulatory cocktail (BetaGene Media
supplemented with 10
mM glucose, l0 mM giutamine, leucine, and arginine, 1 OO~M carbachol, 100~M
/BMX, 0.1 °/a
BSA, 20 mM HEPES).
IS
FIG. 12A and FIG. 12B. Efficient processing of overexpressed human proinsulin
in engineered human neuroendocrine cells. Immunoreactive insulin was measured
from
HPLC-fractionated samples prepared from ~iG 498/20. Peaks were identified by
migration
position of standards. FIG. 12A is the analysis of insulin content extracted
from the cells, and
FIG. 12B is the analysis of insulin secreted into the media.
FIG. 13A and FIG. 13B. Regulated secretion from engineered human cell lines.
Insulin secretion from ~iG 498/20 was measured in a two hour static incubation
assay at basal
conditions (0 mM) or stimulated conditions: 10 mM glucose (10 mM); 10 mM
glucose + 100
pM IBMX (IBMX + IOmM); 100 pM carbachot (carb); 100 pM carbachol + 10 mM
glucose
(carb + 10 mM); 10 nM PMA (PMA); 10 nM PMA + 10 mM glucose (PMA + glucose);
RPM/
Medium + 100 ~M diazoxide + BSA (RPM/ + Diaz); or a stimulatory cocktail (RPMI
medium
supplemented with 10 mM glucose; BSA; 10 mM each arginine, leucine, glutamine;
100 ~M
carbachoI, and 100 ~tM IBMX). In FIG. 13B, cell line ~iG 498/45 (created by
transfection of
BG H03 with a plasmid conferring resistance to neomycin and encoding human
insulin) was
engineered for increased levels of insulin expression by the introduction of a
number of
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
14
plasmids. all of which encoded human insulin but varied in the genes encoding
antibiotic
resistance. The 793, 794, and 796 cell lines are resistant to mycophenolic
acid, puromycin, and
hygromycin, respectively. The data show the presence of a regulated secretory
pathway in the
progenitor cell line (498/45) and the maintenance of this capacity through a
second round of
engineering (793, 794, and 796 cell lines). The increase in stimulated
secretion over basal
secretion ranges from about 6- to 15-fold among the various clones.
FIG. 14A, FIG. 14B, and FIG. 14C. Correction of Diabetes in Rodents.
Encapsulated (3G 498/20 and (3G H03 cells and were implanted into STZ-
diabetic, NIH nude
rats (FIG. 14A), immune-competent STZ-diabetic Wistar rats (FIG. 14B) or
Zucker Diabetic
Fatty Rats (ZDF, FIG. 14C). Unengineered, parental cells (~3G H03) or low
doses of ~3G 498/20
cells failed to affect hyperglycemia. In contrast, doses of (3G 498/20 ranging
from 15 to 25
million cells per 100 gm body weight completely corrected hyperglycemia in
nude and
immune-competent hosts; and in IDDM and NIDDM.
FIG. 15. Human C-peptide levels in the serum of rats implanted with (iG 498/20
or
the parental (3G H03 correlate with cell number. As shown. implantation of (3G
498/20 cells
into STZ-diabetic Wistar rats elevates human C-peptide levels in the serum
with the highest
dose of cells (25 million/ 100 gm body weight) producing the highest level of
serum human C-
peptide levels for the longest period of time. The drop in C-peptide to levels
below about 3
ng/ml with both cell doses of ~iG 498/20 correlate with increases in blood
glucose shown in
FIG. 14B. (3G H03 cells do not produce detectable levels of human C-peptide.
FIG. 16A and 16B. Implantation into diabetic rodents with ~3G 498/20 cells
improves glucose tolerance. Following an overnight fast. animals were given a
glucose bolus,
and blood glucose levels were monitored. As shown both STZ-treated Wistar rats
(FIG. 16A)
and ZDF rats (FIG. 16B) show a dose dependent improvement in glucose tolerance
when
implanted with ~3G 498/20 versus implants with the unengineered parental cell
line, (3G H03.
FIG. 17A and 17B. Cell-based delivery of insulin via encapsulated ~iG 498/20
cells
reduces glycated hemoglobin (GHb) in diabetic rodents. STZ-treated Fisher
nudes (FIG.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
17A) or STZ-treated Wistar rats (FIG. 17B) that were implanted with ~iG 498/20
cells
experienced about 58% and 33% reduction, respectively, in % glycated
hemoglobin as
compared to control diabetic animals implanted with the unengineered parental
cell line (3G
H03.
5
FIG. 18A and FIG. 18B. (3G H03 and (3G 498/20 cells are resistant to the
effects of
cytokines. In FIG. 18A, (3G H03 and (3G 498/20 cells were incubated in
BetaGene medium
supplemented with various human cytokines as indicated for 48 hours. Tested
cytokines had no
impact on viability as assessed by comparing cytokine-treated cultures to
untreated controls. In
10 FIG. 18B, (3G 498/20 cells were tested for the maintenance of secretory
function in presence of
cytokines (IL-1 b I S ng/ml; IFN 200 units/ml; TNFa and TNF~i each at 10
ng/ml). Insulin
secretion was stimulated by incubating the cells in HBBSS containing 0.1 % BSA
and
supplemented with 10 mM glucose, or 10 mM glucose plus either I00 pM carbachol
or 10 nM
PMA. Two sets of cultures were exposed to cytokines for 24 hours, prior to
secretion studies
15 (24h cytokines, and 24h cytokines + HBBSS + cytokines}; and two sets of
cultures were
supplemented with cytokines for the 2 hr secretion period (HBBSS + cytokines,
and 24h
cytokines + HBBSS + cytokines). The control culture (HBBSS) was not exposed to
cytokines.
The secretory function of (3G 498/20 cells was unaffected by short or tong-
term exposure to
cytokines.
FIG. 19. Engineered (3G H04 fail to secrete insulin from the regulated
secretory
pathway. Transgenic (CMV-insulin/ SV40-Neo), clonal derivatives of (3G H04
known to
secrete human insulin were tested for the capacity to secrete human insulin
from the regulated
secretory pathway. There was no difference between basal conditions (HBBSS
with no glucose)
and stimulated conditions (HBBSS + 25 mM KCl + 2.5 mM Forskolin + 50 p.M IBMX)
in the
~iG H04 clones: 707/55, 707/63, 707/76, 707/94, and 707/96. In contrast, in
the clonal line
derived from (3G H03, there was a robust response to the aforementioned
secretagogue cocktail,
with about a 5-fold difference between basal and stimulated secretion.
FIG. 20. Major components of the counter-regulatory and sympathetic responses
to hypoglycemia. Sympathetic activation involves both stimulation of
adrenaline secretion
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
16
from the adrenal medulla, and increased release of noradrenaline (and
adrenaline) from
sympathetic nerve endings, which act directly in sympathetically innervated
tissues (e.g. the
liver and arterioles) and also spill over into the circulation. Vasopressin
has weak counter-
regulatory effects on its own, but acts synergistically with the other
hormones (figure adapted
from "Textbook of Diabetes", 2nd. Edn. John C. Pickup and Gareth WiiIiam Eds.,
Blackwell
Sciences, Publ., 1997).
FIG. Z1. General mechanisms for modulating secretion from the regulated
secretory pathway. As schematically illustrated, secretion from the regulated
secretory
pathway can be modulated by the transgenic expression of cellular proteins
that act as positive
regulators of secretion (oval with a "+") or negative regulators (oval with "-
"). Typically such
proteins function as receptors at the cell surface. Each class of receptor is
subject to activation
(ACT.) or inhibition (INH.) of activity by the binding of receptor-specific
ligands, and such
ligands can be physiological or pharmacological agents. The modulation in
receptor activity by
ligand binding is translated through intracellular signaling to stimulate or
inhibit the secretion
of peptide hormones from the regulated secretory pathway.
FIG. 22. A Two-Step method for creating human neuroendocrince cell lines.
Primary tissues, such as human islets, or neuroendocrine tumors, such as
insulinomas, can be
induced to proliferate through transgenic expression of growth-promoting
proteins. A preferred
protocol for such engineering is to selectively direct gene expression with
the use of tissue-
specific promoters and to provide transgenes via infection with recombinant
adenovirus.
Following an induction of proliferation, the cell population of interest is
subject to enhanced
rates of immortalization via infection with recombinant retroviruses.
FIG. 23. Total insulin release from a human insulinoma. A freshly excised
human
insulinoma, about 1 cm3. was processed and initially plated into two tissue
culture wells. 9.6
cm2 each. The cells that survived were subsequently aliquoted into a variety
of culture
conditions. At the times indicated, tissue culture media samples were obtained
from each of the
cell samples, and insulin was measured by RIA. The insulin output from the
different samples
was summed to give total output.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
17
FIG. 24. Maintenance of human islets in BetaGene Medium supplemented with
various concentrations of glucose. Islets were cultured in BetaGene Medium
with 3.9. 7.8
and 22 mM glucose for 2 weeks. The secretory responses to glucose
concentrations of 3.9 mM,
22 mM and 22 mM +50 pM IBMX were then compared. Although lower glucose was
less
deleterious than the higher concentration. both resulted in impaired secretory
response.
FIG. 25. Maintenance of human islets in BetaGene Medium supplemented with
various concentrations of fetal bovine serum. The serum requirements of human
islets were
tested in long term (2 month) cultures supplemented with various amounts of
serum, 1 %, 3.5%.
or 10% FBS and 5% horse serum (ES). In an acute secretion experiment, insulin
secretion from
islets cultured in 10% FBS exhibited lower response to glucose or to a
stronger mixed
secretagogue stimulus. The sustained insulin output from human islets with 1%
FBS
supplementation (in BetaGene Medium ) suggested that human islets may also
secrete insulin
and survive under serum-free conditions
FIG. 26. Comparison of commonly used medias to BetaGene Medium in the
maintenance of human islets. Islets were cultured for 2-3 months with BetaGene
Medium,
Medium 199, alpha MEM, or CMRL. all with equivalent glucose, and 0.1% BSA. In
four
independent islet isolations the insulin output was the highest with islets
cultured in BetaGene
Medium. In contrast, CMRL performed the poorest, essentially with no islet
survival past 2
months with a114 isolations studied.
FIG. 27 Long-term culture of human islets in BetaGene Medium restores and
maintains glucose-stimulated insulin secretion. The capacity of BetaGene
Medium to sustain
the dose-responsive nature of the insulin secretory response was evaluated
with continuous
cultures. Human islets were stimulated with varied glucose concentrations at
intervals to
monitor secretory changes that may occur with time. A common finding was an
initially poor
response (shown at 1 week), with increased function with time of culture in
BetaGene Medium
(6 weeks and 13 weeks), and a maintained capability to secrete insulin in
response to glucose
for times >4 months.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
18
FIG. 28A and 28B. Processing of proinsulin to mature insulin is enhanced by
culturing human islets in BetaGene Medium. Insulin content was extracted from
HI21 and
fractionated by HPLC. Initially, 99% of the insulin was unprocessed insulin,
with only 29 ng
mature insulin/1000 IEQ (FIG. 28A). The mature insulin content was increased
18-fold to S 12
ng/1000IEQ after 4 weeks of culture in BetaGene Medium; this represents >90%
of the insulin
content (FIG. 28B).
FIG. 29A and FIG. 29B. Modified RIP activity in transiently transfected RIN
cells. FIG. 29A. A schematic representation of the types of modified RIP
promoters. FIG. 29B.
Modified RIP promoter - human growth hormone (hGH) constructs were transiently
transfected into RIN cells. After 48 to 96 h, hGH protein levels in the medium
were determined
by a radioimmunoassay. As shown in the figure, the modified RIP promoters,
FFE31-415RIP
and FFE6/-415RIP, were approximately 5-fold stronger than the RIP (-415RIP)
promoter by
1 S itself.
FIG. 30A, FIG. 30B and FIG. 30C. Modified RIP activity in stably transfected
RIN cells. The CMV promoter, RIP promoter. and several modified RIP promoters
were
fused to insulin and were stably transfected into RIN cells. FIG. 30A. Insulin
mRNA levels for
each promoter construct were determined by Northern blot and quantitated with
a
phosphoimager. Cyclophilin mRNA levels were also determined by a phosphoimager
as a
control for Northern blot loading differences. FIG. 30B. Insulin protein
levels secreted into the
culture medium were determined by a radioimmunoassay. FIG. 34C. Insulin
protein levels
within the cell were determined by a radioimmunoassay after breaking open the
cells by
sonication. In all three cases, be it insulin mRNA levels, secreted insulin
protein, or insulin
protein content inside the cell, the modified RIP promoters were significantly
stronger than the
RIP promoter by itself. The FFE6 modified RIP promoters approach the activity
of the very
strong CMV promoter.
FIG. 31. Mitogenic signal pathways in ~i-cells. Mitogenic pathways are shown
for
insulin-tike growth factor-1 (IGF-1) and for growth hormone (GH). The IGF-
1/IGF-1 receptor
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
19
complex can signal cell mitogenesis via two pathways but in [i cells it does
so primarily
through the IRS pathway. Mitogenic stimulation of (3 cells by GH is through
the JAK/STAT
pathway.
S FIG. 32. IGF-1 stimulation of [i cell growth in the presence of increasing
glucose
concentrations IGF-1 (10 nM) was added to INS1 cells incubated at different
glucose
concentrations. As judged by [3H]-thymidine incorporation glucose alone can
initiate INSI cell
growth in a dose-dependent manner reaching a maximum of approximately 10-fold
at 18 mM
glucose. The effect of glucose on INS1 cell growth is potentiated by IGF-1
reaching a
maximum of INS 1 cell growth at lSmM glucose.
FIG. 33. Growth hormone stimulation of (3 cell growth in the presence of
increasing glucose concentrations. rGH (IOnM) was added to INS1 cells
incubated at
different glucose concentrations. The action of rGH, like that of IGf-l,
requires a background
of glucose to exert its effects. The rGH has little effect on cell growth
until a threshold of
6mM glucose and reaches a maximum at 15 mM glucose where there is an
approximately 50-
fold increase in [3H]-thymidine incorporation over that at 0 mM glucose.
FIG. 34. Additive effects of IGF-1 and rGH on [i cell growth. INS1 cells were
incubated with either 10 nM IGF-1 alone, IOnM rGH alone. or both IOnM IGF-1
and IOnM
rGH at increasing glucose concentrations. As previously shown in Fig. 29 and
Fig. 30, both
1GF-1 and rGH potentiate the effect of glucose on INS1 cell growth to
approximately the same
degree. An additive effect on cell growth is observed when both growth factors
are added to
INS 1 cells at the same time.
FIG. 35. Adenoviral overexpression of IRS-1, IRS-2, and SV40 large T-antigen
in
INSI cetls. INSI cells were infected with either AdV-[iGal. AdV-IRS-l, AdV-IRS-
2, or AdV-
larger-antigen (Tag) for 1 hour. After 1 hour, the cells were washed and
incubated another 24
hours. IGF-1 (10 nM) was added to the INS1 cells in the presence of either 3
mM or 15 mM
glucose. Adenoviral-mediated overexpression of IRS-2 in INSI cells in the
presence of 10 nM
IGF-1 and 15 mM glucose resulted in an approximately 200-fold increase in [3H]-
thymidine
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/0055t
incorporation compared to uninfected cells plus no glucose. AdV-IRS-1 infected
cells in the
presence of 10 nM IGF-1 and 15 mM glucose showed no increase of ['H]-thymidine
incorporation over and above that for uninfected cells or cells infected with
AdV-[iGal in the
presence of 10 nM IGF-1 and I S mM glucose.
S
FIG. 36. BetaGene Medium enhances growth of an engineered, human
neuroendocrine cell line. The BG785/5 cell line was derived from BGH04 cells
which were
derived and routinely cultured in RPMI w/FBS. The growth rate of BG785/5 cells
in BetaGene
and RPMI media, with FBS or SF, is shown. Although cells grown in RPMI w/FBS
exhibited a
10 longer lag phase, the growth of cells in BetaGene medium and RPMI w/FBS was
similar, all
with doubling times of 2 days. However, cells in RPMI w/SF essentially failed
to grow, with an
apparent doubling time of 26t 1 days.
FIG. 37. BetaGene Medium enhances secretory function of an engineered, rodent
15 neuroendocrine cell lines (BG170-hGH). The human growth hormone (hGH)
output of cells
grown in BetaGene Medium with FBS was approx. 5 times greater than growth
hormone output
from cells in RPMI w/FBS. Similarly, the hGH output of BetaGene Medium w/SF
was more
than 5 times that of RPMI w/SF. While BetaGene Medium supplemented with SF
sustained
hGH output equal to that of RPMI w/FBS, it was not sufficient to support the
same secretory
20 function as BetaGene Medium with FBS.
FIG. 38. BetaGene Medium maintains secretory function of BG 18/E1 cell line.
The insulin secretory function of BG18/3E1 cells was maintained when cells
were cultured in
BetaGene Medium supplemented with 5%, 2%, or 1% FBS. There was an impairment
of
secretory function with cells supplemented with 0.5% FBS or SF during the
plateau phase of
growth (about day 8 - 9 of culture). The secretory impairment at plateau phase
under these
conditions may be due to decreased biosynthesis or processing of insulin
rather than an
impairment of secretion.
FIG. 39. Growth in BetaGene Medium maintains regulated secretion from the BG
18/E1 cell line. BG18/3E1 cells were grown and maintained at plateau phase for
4 days in
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
21
BetaGene supplemented with minerals, minerals and amino acids, amino acids. or
2% FBS.
The ability to respond to a secretagogue cocktail is shown for various SF- and
2% FBS-
supplemented cultures in BetaGene Medium. This demonstrates that the
capability of the
regulated secretory pathway has been maintained, only the absolute output has
been affected in
both unstimulated and stimulated states. while the fold response is
maintained.
FIG. 40. BetaGene Medium enhances production of GLP-1 from an engineered,
rodent neuroendocrine cell line. The capability of BetaGene medium to sustain
processing
and secretion of a peptide that yields proteolytically cleaved and amidated
products was
evaluated by measuring GLP-1 (amidated and non-amidated) production. Cells.
BG191/26,
were plated in T25 flasks with BetaGene Medium and then the medium was
switched to RPMI,
RPMI ("0") with 75 p,M ascorbate ("75"). or BetaGene Medium, all with 2% FBS.
Both the
total GLP-1 and the amidated GLP-1 output/day of cells in BetaGene Medium was
essentially
double that of cells in RPMI.
FIG. 41. Ascorbate-2-phosphate supplemented media enhances insulin production
of an engineered human neuroendocrine cell line. A suspension culture of
BG498/45 cells
(PD33) were plated in varying concentrations of ascorbate or A-2-P. Samples
were collected for
insulin assay and medium changed after 2 and 5 days of culture. In the initial
2 days of culture
ascorbate altered insulin output by reducing insulin about 20%, only at the
highest
concentration. In the final 3 days cells. high concentrations of ascorbate
were cytotoxic, white
t~400 pM concentrations of both ascorbate and A-2-P enhanced insulin
secretion. The highest
concentration of A-2-P did not inhibit insulin output.
FIG. 42. Media supplementation with ascorbate-2-phosphate can effect increased
amidation activity with cultured cells. Production of amidated and nonamidated
GLP1 was
determined by immunoassay of secreted cell products from cells cultured 1 day
in RPM/
medium (with 2% FBS) supplemented with varying concentrations of A-2-P. The
dose-
response shows half max. and maximal amidation activity with ~1 and 10-100 pM
of A-2-P.
The amount of amidated GLP-1 plateaued from 25-1000 pM. Concentrations of 10
mM
consistently {4 separate experiments) resulted in slight decreases in amidated
GLP-1, with a
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
22
similar tendency to reduce non-amidated GLP-1 output. Supplementation with A-2-
P results in
a decrease in non-amidated GLP-1. such that amidated/ non-amidated exceeds
100%. Maximal
output of amidated GLP-1 with this cell line is X12 pmol/million cells-day,
representing 5 fold
increase over 0 ~M A-2-P. This result demonstrates that supplementation with A-
2-P can effect
increased amidation activity with cultured cells.
FIG. 43. Optimal Copper Concentration for PAM Activity. BG191/26 cell
monolayers in T25 flasks were changed to RPMI medium ~ copper, or BG Medium t
additional copper (the latter medium contains 5 nM copper). Medium samples
were collected
after 24 h and the GLP-1 species were separated and quantified by HPLC. The
results show that
supplementing RPMI (which has no copper in its formulation) increases the
output of amidated
GLP-1. Further supplementation of BG medium with copper to 250 and 500 nM does
not
increase amidated GLP-1, whereas 1 pM copper tends to decrease amidated GLP-1.
These
results indicate that 5 nM copper is adequate for PAM activity in cultured
neuroendocrine cells
FIG. 44. Lack of Cytotoxic Effect of ascorbate-2-phosphate on Primary Human
Islets. Human islets encapsulated in alginate beads were set up in 24 well
plates with l-DSO islet
equivalents/well and cultured in BetaGene Medium with or without added A-2-P
and copper.
Secretory function and glucose-sensing was determined by incubating the islets
with different
concentrations of glucose for 90 minutes (from 2.2 to 22 mM). This glucose
dose-response test
was performed immediately before adding ascorbate to the cultures and at 2
week intervals. In
the first 2 weeks 500 pM A-2-P, and 1 ~.M copper was supplemented. In the
second 2 weeks
ascorbate was increased to 2 mM, copper was kept at 1 ~M. A-2-P did not impair
function as
indicated by sensing of glucose, and the maintenance of maximal insulin
secretion indicates
that there is minimal toxicity of A-2-P for these culture times.
FIG. 45. Two sequential rounds of bulk culture growth, bulk cryopreservation,
and
thaws do not alter secretory function. ~3G 18/3E 1 cells which had been grown
in bulk cultures
were tested for maintained secretory performance. This was determined by
assaying insulin
secretory response (y-axis) to a secretagogue cocktail ("Swiss") after (x-
axis): one bulk culture
production and one freeze/thaw (C 1 F/T); at harvest after one bulk culture
production (C 1
CA 02318379 2000-07-12
WO 99/35495 PCT/U599/00551
23
PostBulk); at seeding of second bulk culture after one bulk and one
freeze/thaw (Cl Seed C2);
harvest from second bulk culture (Post C2); and after secand bulk culture and
second bulk
freeze and thaw (C2 FIT). Insulin secretory response from these cells was
unaltered by bulk
culture and freezing; neither unstimulated (Basal) nor secretagogue-induced
("Stim") secretion
S was altered.
FIG. 46. Insulin output of cells in defined Betagene Medium. Comparison of
insulin
output from encapsulated (3G18/3E1 cells.in defined BetaGene Medium (~iGM)
with output of
cells in BetaGene Medium supplemented with FBS ((3BM+) or select media with
and without
FBS. Aginate-encapsulated (3G18/3E1 cells were cultured in 24 well plates in
BetaGene
Medium without (~iGM) or with FBS (~iGM+); in MEM without (MEM) or with FBS
(MEM+);
in a mixture of F12 and MEM without (F12/MEM) or with (F12/MEM+) FBS. Media
samples
were collected at intervals and assayed for insulin, and growth was determined
by assay of
viable cell mass terminally. Cell growth of cultures: MEM+ was 5015% of ~iGM+
and
F12/MEM+, which were equivalent; MEM was <10%, F12/MEM was SOtS%, and (3GM was
8018%. Insulin output of (3GM+ was the best, with F 12/MEM+ and (3GM
essentially
equivalent.
FIG. 47. Switching cells to Defined BetaGene Medium increases insulin output.
A
portion of unsupplemented cultures of (3G18/3E1 cells of figure 46 were
continued an
additional 3 days. Half of the cells cultured in Fl2lMEM (no FBS) were
switched to defined
(3GM for the final 3 days. Switching to defined BetaGene Medium more than
doubled insulin
output, indicating that BetaGene Medium can compensate for insufficiencies of
other defined
media.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Many cells are designed to produce and secrete biologically active molecules
in vivo
that take effect at locations distal to the secretory cell. Neuroendocrine
cells, by definition,
have sorting mechanisms, whereby a given polypeptide, protein or hormone
destined for
secretion, is targeted to the regulated secretory pathway or the default
constitutive secretory
pathway. Loss or impaired function of neuroendocrine cells is associated with
a variety of
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
24
human diseases and disorders. For example, the failure of substantia nigra
cells to properly
produce dopamine results in Parkinson's Disease. The failure of thyroid cells
to properly
produce thyroid hormones results in athyrotic cretinism, and the loss of
adrenal gland cells,
with the consequent failure to produce adrenal hormones results in Adison's
Disease. Other
disorders such as short stature, Paget's Disease, infertility and
endometriosis are generally
treated by recombinant growth hormone, calcitonin, gonadotropins, and
gonadotropin-releasing
hormone, respectively. Perhaps one of the most widely known secretory disorder
is diabetes, in
which the neuroendocrine cells of the Islets of Langherans undergo a loss of
function.
In all the cases of secretory cell function disorder, there are significant
drawbacks in the
currently available treatment regimens, which generally rely on injections and
suffer from the
additional drawbacks of proper dosing, loss of drug efficacy, drug side
effects, and patient
compliance. There is a need for both new and effective pharmaceutical agents
for the
prevention and treatment of neuroendocrine based disease and in the
effectiveness with which
such agents prevent or retard the onset of complications. The present
invention is directed
toward addressing these needs.
Secretary cells generally, and in particular neuroendocrine cells, have
several
endogenous functions that make them uniquely suited for production of a wide
range of
proteins, including secreted peptide hormones. These specialized functions
include the
regulated secretary pathway. The regulated secretary pathway embodies the
secretary granules
of neuroendocrine cells which serve as the site of maturation and storage of a
large class of
peptide hormones with profound biological functions. Proper biological
function of the
peptides is due both to their secretion in a regulated and titratable manner
and a complex set of
post-translationai modifications resulting in the final, biologically active
product. As a result,
these cells can be used as in vitro models of in viva secretary cell function.
Stable cell lines
that reflect the in viva production and secretion of proteins, could be
employed in the
identification of modulators of said protein secretion.
The present invention is designed to take advantage of the secretary machinery
of
certain cells for the purpose of screening for modulators of secretary
function. A variety of
CA 02318379 2000-07-12
WO 99/35495 ~5 PCTNS99/00551
different modifications may be made to these cells to make them more suitable
candidates for
drug screening.
The development of therapeutic agents that target the pancreatic (3-cell in
patients with
NIDDM has been hampered by an insufficiency of in vitro assays that are
biologically relevant,
stable, and allow for high through-put. From the perspective of fidelity to
the target biology,
the preferred material for in vitro screens for the purposes of identifying
therapeutics is
functional islets from human cadavers. However, such use of human islets is
impractical due to
extremely limited amounts of material, age-related difference in [3-cell
function, and
complicated as well by the batch-to batch variation that has been observed for
islet preparations
(Jansson et al., 1995; McClenaghan et al., 1996).
One material that could be potentially used in biological screens to identify
candidate
agents as therapies for NIDDM are rodent ~i-cell lines. Several such cell
lines have been
established, maintained for extended periods in vitro, and characterized with
regard to the
synthesis and regulated secretion of insulin. The cell lines include those
established from the
pancreatic islets of rat (Chick et al., 1977; Gazdar et al., 1980; MeClenaghan
et al., 1996)
hamster (Ashcroft et al., 1986), and mouse (Miyazaki et al., 1990; Knaack et
al., 1994). These
cell lines and their clonal derivatives potentially provide an unlimited
supply of material;
however, they are deficient in other properties important for their use as
screening tools for
therapeutic agents for diabetes.
All existing (3-cell lines are deficient in key functional aspects when
compared to islet
ø-cells. Insulin content is decreased and proinsulin processing is often
impaired (Poitout e~ al.,
1996). In (3-cell lines the threshold or magnitude of glucose-stimulated
insulin secretion
(GSIS) and response to agents that can potentiate GSIS are often not
representative of primary
(3-cells (Newgard, Diabetes Rev. 1996). In addition, many (3-cell lines
express peptides that
are not expressed by the primary (3-cell such as somatostatin, pancreatic
polypeptide. and
glucagon (Madsen et al., 1986).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
26
One of the most ubiquitous properties of established (3-cell lines is
phenotypic
instability such that, with extended cultivation. the cells loose those traits
that are singularly (3-
cell in nature. HIT cells, many (3TC cell lines. and unengineered RIN cell
lines have less
insulin content than a normal ~i-cell (Radvanyi el ul.. 1993), and this level
has been reported to
drop if the cells are maintained in culture for multiple population doublings
(Clark et al., 1990;
Poitout et al., 1996). One study reports that HIT cells lose responsiveness to
glucose, arginine,
and various secretagogues with serial passages (Zhang et al., 1989). Many ~iTC
cell lines
display relatively normal GSIS at early passages, but with continuous
propagation, these cells
acquire aberrant insulin secretion that is characterized by a hypersensitivity
to glucose (Efrat et
al., 1988; Efrat et al., 1993; Poitout et al.. 1996).
The present invention, however, provides stable cells lines with a phenotypic
integrity
that allows them to be used as screening tools for the identification of novel
substances that can
be employed in the modulation of secretory function that is manifest in a
number of diseased
states including diabetes. These cell lines may be derived from a previously
characterized,
immortal RIN cell line that has been further engineered with secretory
properties. In an
alternative embodiment, the present invention provides methods and
compositions that will
allow one of skill in the art to engineer secretory cells so that they are
immortalized. Further,
these cells are engineered to ensure that glucose sensing and responsiveness
is maintained over
a period of time, i.e., indefinitely. The components for such a system, and
methods of making
and using such cell lines are set forth in detail below.
A. The Use of Engineered ~i-Cell Lines for Drug Discovery in NIDDM
The onset and progression of NIDDM are marked by discreet stages of (3-cell
dysfunction and failure with defects in insulin secretion presenting
throughout the disease
(Porte 1991; Granner and O'Brien 1992: Polonsky 1995; Palonsky, Sturis et al.,
1996). The
early phases of NIDDM often are characterized by insulin resistance and a
compensatory
increase in the secretion of insulin. As hyperinsulinemia fails to completely
overcome insulin
resistance, mild fasting hyperglycemia and impaired glucose tolerance become
detectable.
With progression of the diabetic state, hypoinsulinemia presents. The first-
phase of insulin
secretion is short in duration and facilitates immediate glucose disposal. Its
loss, typically early
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
27
in NIDDM, results in postpandrial hyperglycemia. Eventually, the second phase
of glucose-
stimulated insulin secretion becomes impaired and results in overt NIDDM with
fasting
hyperglycemia. Other defects in insulin secretion that often are present in
NIDDM are
abnormal, pulsatile insulin secretion, an increase in the plasma of ratio of
proinsulin to insulin,
and impairments of various secretagogues to potentiate GSIS (Porte 1991;
Granner and O'Brien
1992; Polonsky 1995; Polonsky, Sturis et al., 1996).
It is postulated that the ongoing decline of the (3-cell in NIDDM is related
to
perturbations in glucose homeostasis and fatty acid metabolism, (Porte 1991)
or as has more
recently been termed "glucolipotoxicity" (DeFronzo.1997). Glucolipotoxicity
refers to the
detrimental effects that sustained elevations of plasma glucose and free fatty
acids have on (3-
cell metabolism. The resulting disruption of (3-cell fuel metabolism leads to
faulty insulin
secretion and contributes to ongoing (3-cell failure. Optimal glucose-sensing
and subsequent
insulin secretion have been linked to two key ~i-cell proteins: the glucose
transporter, type 2
(GLUT-2) and hexokinase, type IV, (glucokinase). The relatively low affinity
of these proteins
for glucose allows them to be rate-limiting in the transport and metabolism of
glucose and
provides the glucose-sensing required for physiologically relevant insulin
secretion (Newgard
and McGarry 1995; Matschinsky 1996). Cytosolic long chain fatty acyl-CoA
esters and free
fatty acids are potentiators of GSIS (DeFronzo, I 997). Partitioning of fatty
acyl-CoA molecules
between the cytoplasm and mitochondria is regulated by glucose. Basal glucose
levels
stimulate transport into the mitochondria and ~3-oxidation, and elevations of
intracellular
glucose promote increases in cytoplasmic concentrations of long-chain fatty
acyl CoA esters
and potentiation of GSIS. A key point for regulating the partitioning of fatty
acids is carnitine
palmitoyl transferase 1 (CPT-1 ), the protein that transports fatty acyl-CoA
molecules into the
mitochondria from the cytoplasm. CPT-1 is inhibited by malonyl CoA, a
metabolite that
increases with increases in glucose metabolism (DeFronzo, 1997). Thus, the
metabolism of
glucose in the pancreatic ~3-cell is tightly coupled to the metabolism of
fatty acids, both in
normal physiology and in pathogenic states such as diabetes. Whereas short-
term elevations in
glucose and fatty acids are part of the normal signaling required for fuel
homeostasis, chronic
exposures are detrimental to (3-cell physiology and could contribute to an
inhibition of insulin
secretion.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
28
Fatty acid metabolism in the (3-cell also seems to be regulated by the effects
of leptin
(Shimabukuro, Koyama et al., 1997; Zhou, Shimabukuro et al., 1997). Leptin is
a peptide
hormone synthesized in and secreted from adipocytes. It has dramatic effects
on body
composition by regulating food intake and thermogenesis. Rodent strains with
defects either in
leptin production or leptin receptors are obese and a have high incidence of
NIDDM. Increases
in plasma leptin levels have been shown to reduce body fat in several obese
and non-obese
rodent models. Leptin receptors are expressed in tissues throughout the body
and have been
shown to be present in pancreatic islets. Leptin has been shown to induce
enzymes of fatty acid
oxidation and deplete triglyceride pools in pancreatic islets (Shimabukuro,
Koyama et al.,
1997; Zhou, Shimabukuro et al., 1997). It is postulated that leptin functions
in normal
physiology to protect the ø-cell from lipotoxicy and helps to prevent
adipogenic diabetes
(Shimabukuro, Koyama et al., 1997; Shimabukuro, Koyama et al., 1997; Zhou,
Shimabukuro et
al., 1997). It is currently unknown if defects in leptin-regulated fatty acid
metabolism are
1 S causally linked to progressive (3-cell failure that is characteristic of
NIDDM in humans.
Clearly, ~i-cell failure characteristic of NIDDM is a complex and multifaceted
process.
Currently, the only pharmaceutical agents that target the (3-cell in NIDDM are
compounds that
bind the SUR/KIR channels. Such compounds include the widely used sulfonylurea
agents and
an unrelated compound, PrandinTM. These drugs treat the symptom of
hyperglycemia by
interacting with K~-ATP channels to stimulate insulin secretion. However, long-
term use of the
sulfonylurea drugs often results in a loss of drug efficacy. There are no
therapeutic agents
available for the following defects that are often seen in diabetes: defects
in fatty acid
metabolism, oxidative damage to (3-cells, loss of potency of glucose and other
secretagogues in
insulin secretion, loss of receptor-mediated insulin secretion other than
SUR/KIR or internal
signaling machinery, and progressive ~i-cell failure.
FIG. 2 illustrates the use of human primary islets or (3-cells and engineered
cell lines in
drug screening and drug discovery programs that target (3-cell dysfunction in
NIDDM. As
shown, human islets can provide a starting point for the discovery of novel
targets and
validation of candidate targets and candidate compounds. In addition, the use
of human islets
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
29
throughout a NIDDM drug discovery path could provide a "check" in the
identification of hits.
optimization of leads, and selection of candidate compounds. In the case of
the discovery of
novel targets, human islets can be used as a starting point for the synthesis
of cDNA libraries so
that discreet mRNAs encoding target proteins may be cloned. In a preferred
embodiment, the (3-
cells of the human islet may be enriched to serve as a screening tool or
starting material for
cDNA synthesis. Enrichment could be achieved through cell sorting or through
selective
survival of the ~3-cells of the islet. In the latter case, human islets could
be infected with
recombinant adenovirus or transfected with DNA plasmids in which expression of
neomycin
phosphotransferease (NPT) or another enzyme encoding antibiotic resistance is
driven by an
insulin promoter. Such tissue-specific expression of NPT would provide for the
selective
survival of the (3-cells following exposure of the mixed cell population to
6418.
Despite the power and advantages of human islets in NIDDM-drug discovery
programs,
they are encumbered with multiple short-comings, the most important of which
is a severe
limitation in supply. The use of engineered cell lines circumvents this
potential constriction in
NIDDM-drug discovery programs. As shown, engineered cell lines with stable and
predictable
(3-cell phenotypes can be created and used in the screening and enrichment of
compounds that
alter (3-cell secretory function. In a preferred embodiment, following the
validation of a target
in the (3-cell, such a target could be cloned from a human islet or an
enriched ~i-cell population.
and subsequently over-expressed in a (3-cell line to create a biological model
that is suitahle for
high throughput screening assays. The use of the engineered cell line could
extend beyond in
vitro screens to use in the creation of a "humanized" animal model. Because
engineered RIN
cells grow well in rodent models. these cell lines offer the capacity of in
vivo testing of
candidate compounds for safety and efficacy. In a preferred embodiment, the
endogenous (3-
cells of a rodent would be selectively ablated through the administration of
streptozotocin.
Encapsulated, engineered cell lines that express the appropriate human target
could then be
implanted and the in vivo biological effects of candidate compounds on the
secretory function
of transplant could be assessed.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
B. Desired Properties of an Islet ~i-cell
Thus, in a particular embodiment. the present invention provides a secretory
cell that
may be employed in the identification of modulators of secretory function.
Such compounds
will be especially useful in a variety of diseased states in which secretory
function has been
5 impaired. Such compounds also will be used against impaired [3-cell function
and metabolism.
An example of such a state would be the loss of (3-cell integrity that is
manifest in diabetes.
Thus, immortalized secretory cells that have a stable neuroendocrine phenotype
will be used to
identify compounds that will be useful in the regulating this secretory
function. There are a
number of properties that are desired of a cell line that will be
representative of a human islet
10 (3-cell. First, it is important to ensure that engineered cell lines have a
measurable activity that
accurately reflects the regulation and capacity of the secretory pathway. One
way to achieve
this endpoint is to express a transgenic polypeptide at high levels that is
processed and secreted
through the regulated secretory pathway. Such a peptide, by definition, will
be detectable in the
media of the cultured cells, and its secretion will be dependent of the
stimulatory or inhibitory
1 S signals that are received and processed by the cell.
The regulated pathway of the ~3-cell encompasses both acute regulation of
insulin
secretion (i.e. a large increment between the unstimulated and stimulated
states) and the
complete processing of proinsulin to the mature insulin polypeptide. In islet
~i-cells, secretory
20 granules allow the storage of insulin as a depot at the plasma membrane
that can be released
within seconds of arrival of a fuel-derived or hormonal signal, and also serve
as the site of
conversion of proinsulin to insulin by virtue of their high concentrations of
the relevant
convertases PC1 (also known as PC3) and PC2. The presence of secretory
granules and
retention of proinsulin processing capacity represent a major advantage of
insulinoma and other
25 neuroendocrine cell lines relative to cells less specialized for secretion
of peptide hormones
such as hepatoma cells or fibroblasts.
A second, and certainly central parameter. is for the cell to he equipped with
a capacity
for modulator-sensing and responsiveness. The term "modulator" encompasses
stimulators and
30 inhibitors of secretory function. For example. glucose responsiveness has
several components
that must be considered, including the appropriate threshold for the response
(islet ~i-cells
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
31
typically respond to glucose at concentrations in excess of the fasting level
of 4-5 mM), rapid
response dynamics ((3-cells secrete insulin in response to glucose within
minutes of its
application and turn off insulin secretion nearly as rapidly when glucose is
removed) and an
appropriate magnitude of response.
Finally, it is imperative that engineered cell lines retain phenotypic and
genotypic
stability. This includes maintenance of both genes that are inserted or
deleted during the course
of engineering and key endogenous genes. As discussed below this is a
significant limitation
on current technology.
RIN 1046-38 cells are derived from a radiation-induced insulinoma but can be
shown to
be glucose responsive when studied at low passage numbers (Clark et al.,
1990). This response
is maximal at subphysiological glucose concentrations and is lost entirely
when these cells are
cultured for more than 40 passages (Clark et al., 1990). Although, RIN 1046-38
cells of low
passage number exhibit GSIS, the maximal secretion is at glucose
concentrations considerably
lower than the threshold for response of normal ~i-cells (Knaack et al.,
1994). These cells also
express GLUT-2 and glucokinase, the high Km glucose transporter and glucose
phosphorylating enzymes that appear to control glucose flux and GSIS in (3-
cells (Newgard,
1996). With time in culture, however, RIN 1046-38 cells lose expression of
GLUT-2 and
glucokinase, become glucose unresponsive, and experience a decline in insulin
content (Hughes
et ul., 1992; Knaack et al., 1994; Ferber et al., 1994). The creation of novel
cell lines in which
the genes for GLUT-2, glucokinase and human insulin are stably expressed in
RIN 1046-38
cells by an "iterative engineering" strategy has been described (Clark et al.,
1997). Important
characteristics of engineered lines include insulin content that approaches
that of normal human
islet (3-cells, efficient processing of the overexpressed human proinsulin to
mature insulin, and
stability of expression of the transgenes in vitro and in vivo.
C. Host Cells
A variety of host cells are contemplated for use in assays for identifying
modulators of
secretory function. For such screening purposes it will be desirable, as
stated above, that the
polypeptide be released from cells in response to the modulators of the
present invention.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
32
These cells may be established cell lines that are engineered to express
secretory proteins.
Alternatively, a human (3-cell line that is immortalized and retains the
characteristics of the
primary (3-cell would be a preferred material to use in assays. The attempts
at immortalization
of human pancreatic ~i-cells have resulted in cell lines that do not retain
the defining properties
of the primary (3-cell, such as the capacity to synthesize insulin and secrete
it from the
regulated secretory pathway. These cells lines and engineering thereof are
described in further
detail herein below.
Engineering of secretory cells to synthesize secretory proteins for the
purposes of the
present invention will advantageously make use of many attributes of these
cells. Regulated
secretory cells present a natural bioreactor containing specialized enzymes
involved in the
processing and maturation of secreted proteins. These processing enzymes
include
endoproteases (Steiner et al., 1992) and carboxypeptidases (Fricker, 1988) for
the cleavage of
prohormones to hormones and PAM, an enzyme catalyzing the amidation of a
number of
I S peptide hormones (Eipper et al., 1992a). Similarly, maturation and folding
of peptide
hormones is performed in a controlled, stepwise manner with defined parameters
including pH,
calcium and redox states.
Complete processing requires sufficient levels of the processing enzymes as
well as
sufficient retention of the maturing peptides. In this way, physiological
signals leading to the
release of the contents of the secretory granules ensures release of fully
processed, active
proteins. This is important for both maximum production for in vitro purposes
and for the
possible use of cells for in vivo purposes.
All cells secrete proteins through a constitutive, non-regulated secretory
pathway. A
subset of cells are able to secrete proteins through a specialized regulated
secretory pathway.
Proteins destined for secretion by either mechanism are targeted to the
endoplasmic reticulum
and pass through the golgi apparatus. Constitutively secreted proteins pass
directly from the
golgi to the plasma membrane in vesicles, fusing and releasing the contents
constitutively
without the need for external stimuli. In cells with a regulated pathway,
proteins leave the golgi
and concentrate in storage vesicles or secretory granules. Release of the
proteins from secretory
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
33
granules is regulated, requiring external stimuli. This external stimulus,
defined as a
secretagogue, can vary depending on cell type, optimal concentration of
secretagogue, and
dynamics of secretion. Proteins can be stored in secretory granules in their
final processed
form. In this way a large intracellular pool of mature secretory product
exists which can be
released quickly upon secretagogue stimulation.
A cell specialized for secreting proteins via a regulated pathway also can
secrete
proteins via the constitutive secretory pathway. Many cell types secrete
proteins by the
constitutive pathway with little or no secretion through a regulated pathway.
As used herein,
"secretory cell" defines cells specialized for regulated secretion, and
excludes cells that are not
specialized for regulated secretion. The regulated secretory pathway is found
in secretory cell
types such as endocrine, exocrine, neuronal, some gastrointestinal tract cells
and other cells of
the diffuse endocrine system.
The origin of the starting cells for use in the present invention thus
includes human
tissues and tumors of neuroendocrine lineages that have a well defined
regulated secretory
pathway. Cells with defined conditions for culturing ex vivo with some
replicative capacity
also are preferred. Pancreatic (3-cells, pancreatic a-cells and pituitary
cells are preferred for use
in the present invention, with ~i-cells being more preferred. Examples of such
cells are shown
in Table 1 (Pearse and Takor. 1979; Nylen and Becker, 1995).
The neuroendocrine cells of the invention preferably will secrete one or more
of the
endogenous secretory polypeptides listed herein in Table 1. Stable ~i-cells
that secrete insulin
will be preferred in certain aspects of the invention, with cells that secrete
correctly processed
human insulin being more preferred. The stable ~i-cells of the invention also
may be
advantageously used to secrete endogenous human amylin. The other preferred
cell types of
the invention, pituitary cells. may be used advantageously to secrete
endogenous human growth
hormone, ACTH or MSH.
In addition to pancreatic (3 cells, pancreatic a-cells, and pituitary cells.
further cells
within Table 1 that are more preferred for use in the present invention
include thyroid C cells,
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
34
which secrete endogenous human calcitonin; intestinal endocrine cells, which
secrete
endogenous human GLP-1 and GIP: and pancreatic a cells, which secrete
endogenous human
glucagon. Particularly preferred cells are shown in Table 2.
The term "regulated secretory pathway" means that the rate of secretion of an
endogenous polypeptide can be stimulated by external stimuli, commonly
referred to as
secretagogues. Thus, as used herein a secretagogue is a substance that
stimulates the secretion
of a polypeptide. Secretagogues can be physiological in nature, e.g., glucose,
amino acids, or
hormones, or pharmacological, e.g.. IBMX, forskolin, or sulfonylureas.
Polypeptides destined
for the regulated secretory pathway are stored in intracellular storage
vesicles known as
secretory granules.
Glucose is the most important stimulator of insulin secretion, not only
because of its
potent direct effects, but also because it is permissive for the stimulatory
action of a wide array
of other secretagogues. While there is good evidence to suggest that glucose
exerts its effect
through its own metabolism, resulting in the creation of signals that appear
to work through
modulation of ion channel activities and influx of extracellular Ca2+, the
exact nature of the
metabolic coupling factors remains unknown. The magnitude of the insulin
secretory response
appears to be related to the rate of ~3-cell glucose metabolism, and both
parameters are sharply
increased in response to modest increments in extracellular glucose
concentrations within the
physiological range of 4 to 8 mM. ~i-cells are equipped with the glucose
transporter GLUT-2
and the glucose phosphorylating enzyme glucokinase which have kinetic
properties,
particularly a relatively low affinity for glucose, that are ideal for
modulation of glucose
responsiveness at the relatively high concentrations of the sugar encountered
in the circulation
(Newgard and McGarry 1995).
Although glucose is widely regarded as the predominant signal for insulin
release in the
postprandial phase, changes in the levels of other metabolic fuels, "incretin"
hormones, and
neurotransmitters provide important amplification and modulation of the
glucose signal (fryer.
1992). Nutritional signals also are derived from amino acids and lipids that
each serve as
potentiators of glucose-stimulated insulin secretion. Many secretagogues
effect a response in
the /3-cell via interaction with specific receptors. Glucagon-like peptide 1
(GLP-I ) is an
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
3J _
example of such a secretagogue. This peptide hormone binds its receptor and
potentiates
insulin secretion in the presence of glucose. Activin A has been reported to
stimulate insulin
secretion in rat pancreatic islets and HIT cell lines. This stimulation is
receptor-mediated and
Ca2+-dependent (Shibata et al., 1996). Leptin receptors have been reported to
be expressed in
~i-cells (Kieffer et al., 1996); however, reports of the effects of leptin on
insulin secretion are
varied (Emilsson et al., 1997; Tanizawa et al., 1997). Recent studies suggest
that leptin directly
affects the triglyceride pools in the (3-cell (Shimabukuro et al., 1997; Zhou
et al., 1997); thus
with long-term exposure leptin indirectly affects insulin secretion by
impacting the incretin
effects that fatty acids have on GSIS.
Epinephrine and its analogues, such as Clonidine, act to inhibit insulin
secretion via
signaling through the alpha 2 adrenergic receptor. Likewise, somatostatin and
pancreatic
polypeptide VIP, PACAP, GIP, acetylcholine, cholecytokinin also act via
specific receptors to
inhibit insulin secretion (Lambert and Atkins 1989).
(3 cells also respond to a number of non-physiological compounds that act via
endogenous receptors or signaling machinery (Clark et ul.. 1990). Carbachol
stimulates insulin
secretion via activation of muscarinic receptors. Inhibition of
phosphodiesterase via
administration of IBMX allows for the accumulation of cyclic AMP, a
potentiator of insulin
secretion. Stimulation of kinase activity, such as the phorbol ester
activation of protein kinase
C, will stimulate insulin secretion if cells are exposed the kinase-activator
for short periods of
times. Diazoxide inhibits insulin secretion by interacting with and opening
the potassium-ATP
channel. Sulfonylurea drugs such as glibenclamide and tolbutamide maintain the
K+-ATP
channel in a closed state, allowing for membrane depolarization, increased
calcium influx, and
increased insulin secretion (Bressler and Johnson, 1997). Other kinds of K+
channels, such as
large-conductance Ca2+-dependent K+ (BK) channels and late rectifying voltage
dependant
channels, have been reported to be expressed in pancreatic (3-cells and
participate in regulating
membrane polarity and secretion (Dukes and Philipson, 1996; Kalman et al.,
1998).
Compounds that open or block these channels are currently under development
and may be
useful pharmacological agents (Olesen et al., 1994: Strobaek et al., I996).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
36 -
PRANDINTM (repaglinide) is an oral blood glucose-lowering drug of the
meglitinide
class used in the management of type 2 diabetes mellitus (also known as non-
insulin dependent
diabetes mellitus or NIDDM). Repaglinide, S(+) 2-ethoxy-4(2((3-methyl-1-(2-(1-
piperidinyl)
phenyl)-butyl) amino)-2-oxoethyl) benzoic acid, is chemically unrelated to the
oral sulfonylurea
insulin secretagogues. Repaglinide lowers blood glucose levels by stimulating
the release of
insulin from the pancreas. This action is dependent upon functioning ~i-cells
in the pancreatic
islets. Insulin release is glucose-dependent and diminishes at low glucose
concentrations.
Repaglinide acts by closing ATP-dependent potassium channels in the (3-cell
membrane
by binding at characterizable sites. This potassium channel blockade
depolarizes the ~i-cell,
which leads to an opening of calcium channels. The resulting increased calcium
influx induces
insulin secretion. The ion channel mechanism is highly tissue selective with
low affinity for
heart and skeletal muscle. In patients with type 1 diabetes. administration of
PrandinTM
improves glycemic control, as reflected by HbA» and fasting glucose levels.
This is associated
with a reduction in the diabetic complications retinopathy, neuropathy, and
nephropathy.
Although controlling the blood glucose in type 2 diabetes has not been
established to be
effective in preventing the long-term cardiovascular and neural complications
of diabetes,
improved glycemic control is an important goal in patients with non-insulin-
dependent disease
because it is presumed that the mechanisms by which glucose causes
complications is the same
in both forms of diabetes.
1. Glucose Responsive Cells
For some peptide hormones or factors, it may be desirable to cause the
polypeptide to be
released from cells in response to changes in the circulating glucose
concentration. The most
obvious example of a secretory cell type that is regulated in this fashion is
the ~3-cell of the
pancreatic islets of Langerhans, which releases insulin and amyiin in response
to changes in the
blood glucose concentration. Engineering of primary (3-cells for production of
products other
than insulin is not practical. Instead, a preferred vehicle may be one of the
several cell lines
derived from islet ~i-cells that have emerged over the past two decades. While
early lines were
derived from radiation- or virus-induced tumors (Gazdar et crl.. 1980,
Santerre et al., 1981),
more recent work has centered on the application of transgenic technology
(Efrat et al.. 1988,
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
37 -
Miyazaki et crl.. 1990). A general approach taken with the latter technique is
to express an
oncogene, most often SV40 T-antigen, under control of the insulin promoter in
transgenic
animals, thereby generating (3-cell tumors that can be used for propagating
insulinoma cell
lines (Efrat et al.. 1988, Miyazaki et al., 1990). While insulinoma lines
provide an advantage in
that they can be grown in essentially unlimited quantity at relatively low
cost, most exhibit
differences in their glucose-stimulated insulin secretory response relative to
normal islets.
These differences can be quite profound, such as in the case of RINmSF cells,
which were
derived from a radiation-induced insulinoma and which in their current form
are completely
lacking in any acute glucose-stimulated insulin secretion response (Halban et
al., 1983). RIN
1046-38 cells are also derived from a radiation-induced insulinoma but can be
shown to be
glucose responsive when studied at low passage numbers (Clark et ul.. 1990).
This response is
maximal at subphysiological glucose concentrations and is lost entirely when
these cells are
cultured for more than 40 passages (Clark et al., 1990). GLUT-2 and
glucokinase are expressed
in low passage RIN 1046-38 cells but are gradually diminished with time in
culture in
synchrony with the loss of glucose-stimulated insulin release (Ferber et al..
1994). Restoration
of GLUT-2 and glucokinase expression in RIN 1046-38 cells by stable
transfection restores
glucose-stimulated insulin secretion (Ferber et al., 1994), and the use of
these genes as a
general tool for engineering of glucose sensing has been described in a
previously issued patent
(Newgard, U.S. Patent 5,427,940). RIN 1046-38 cells transfected with the GLUT-
2 gene alone
are maximally glucose responsive at low concentrations of the sugar
(approximately ~0 pM),
but the threshold for response can be shifted by preincubating the cells with
2-deoxyglucose,
which when converted to 2-deoxyglucose-6-phosphate inside the cell serves as
an inhibitor of
low Km hexokinase, but not glucokinase activity (Ferber et al., 1994).
Recently, Asafari et al. reported on the isolation of a new insulinoma cell
line called
INS-1 that retains many of the characteristics of the differentiated (3-cell,
most notably a
relatively high insulin content and a glucose-stimulated insulin secretion
response that occurs
over the physiological range (Asafari et al., 1992). This line was isolated by
propagating cells
freshly dispersed from an X-ray induced insulinoma tumor in media containing 2-
mercaptoethanol. Consistent with the finding of physiological glucose
responsiveness, a recent
report indicates that INS-1 cells express GLUT-2 and glucokinase as their
predominant glucose
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
38
transporter and glucose phosphorylating enzyme, respectively (Marie et al..
1993). INS-1 cells
grow very slowly and require 2-mercaptoethanol. It remains to be determined
whether glucose
responsiveness and expression of GLUT-2 and glucokinase are retained with
prolonged
culturing of these cells, or in vivv.
Cell lines derived by transgenic expression of T-antigen in ~i-cells
(generally termed
(3 TC cells) also exhibit variable phenotypes (Efrat et al., 1988, Miyazaki et
al., 1990, VVhitesell
et al., 1991 and Efrat et al., 1993). Some lines have little glucose-
stimulated insulin release or
exhibit maximal responses at subphysiological glucose concentrations (Efrat et
al.. 1988,
Miyazaki et al., 1990, Whitesell eu ul., 1991 ), while others respond to
glucose concentrations
over the physiological range (Miyazaki et al., 1990 and Efrat et al., 1993).
It appears that the
near-normal responsiveness of the latter cell lines is not permanent, since
further time in culture
results in a shift in glucose dose response such that the cells secrete
insulin at subphysiological
glucose concentrations (Efrat et crl.. 1993). In some cases, these changes
have been correlated
with changes in the expression of glucose transporters and glucose-
phosphorylating enzymes.
Miyazaki et al., isolated two classes of clones from transgenic animals
expressing an insulin
promoter/T-antigen construct. Glucose-unresponsive lines such as MIN-7 were
found to
express GLUT-1 rather than GLUT-2 as their major glucose transporter isoform,
while MIN-6
cells were found to express GLUT-2 and to exhibit normal glucose-stimulated
insulin secretion
(Miyazaki et al., 1990). More recently, Efrat and coworkers demonstrated that
their cell line
(3TC-6, which exhibits a glucose-stimulated insulin secretion response that
resembles that of the
islet in magnitude and concentration dependence, expressed GLUT-2 and
contained a
glueokinase:hexokinase activity ratio similar to that of the normal islet
(Efrat et al.. 1993).
With time in culture, glucose-stimulated insulin release became maximal at
low,
subphysiological glucose concentrations. GLUT-2 expression did not change with
time in
culture, and glucokinase activity actually increased slightly, but the major
change was a large
(approximately 6-fold) increase in hexokinase expression (Efrat et al., 1993).
Furthermore.
overexpression of hexokinase I. but not GLUT-1, in well-differentiated MIN-6
cells results in
both increased glucose metabolism and insulin release at subphysiological
glucose
concentrations. Similar results have been obtained upon overexpression of
hexokinase I in
normal rat islets (Becker et ul.. 1994b). These results are all consistent
with the observations of
CA 02318379 2000-07-12
WO 99/35495 39 PCT/US99/00551 -
Ferber et al., described above in showing that a high hexokinase:glucokinase
ratio will cause
insulin-secreting cells to respond to glucose concentrations less than those
required to stimulate
the normal (3-cell.
2. Non-glucose Responsive Cells
An alternative host to insulinoma cell lines are non-islet cell lines of
neuroendocrine
origin that are engineered for insulin expression. The foremost example of
this is the AtT-20
cell, which is derived from ACTH secreting cells of the anterior pituitary. A
decade ago,
Moore et al. demonstrated that stable transfection of AtT-20 cells with a
construct in which a
viral promoter is used to direct expression of the human proinsulin cDNA
resulted in cell lines
that secreted the correctly processed and mature insulin polypeptide (Moore et
al., 1983).
Insulin secretion from such lines (generally termed AtT-20ins) can be
stimulated by agents such
as forskolin or dibutyryl cAMP, with the major secreted product in the form of
mature insulin.
This suggests that these cells contain a regulated secretory pathway that is
similar to that
operative in the islet ~i-cell (Moore et crl.. 1983, Gross et al., 1989). More
recently, it has
become clear that the endopeptidases that process proinsulin to insulin in the
islet /3-cell,
termed PC2 and PC3, are also expressed in AtT-20ins cells (Smeekens et al.,
1990, Hakes et
al., 1991). AtT-20ins cells do not respond to glucose as a secretagogue
(Hughes et al., 1991).
Interestingly, AtT-20 cells express the glucokinase gene (Hughes et al., 1991,
Liang et al.,
1991) and at least in some lines, low levels of glucokinase activity (Hughes
et al., 1991 and
1992, Quaade et al., 1991), but are completely lacking in GLUT-2 expression
(Hughes et al.,
1991 and 1992). Stable transfection of these cells with GLUT-2, but not the
related transporter
GLUT-1, confers glucose-stimulated insulin secretion, albeit with maximal
responsiveness at
subphysiological glucose levels, probably because of a non-optimal
hexokinase:glucokinase
ratio (Hughes et al., 1992, 1993).
The studies with AtT-20ins cells are important because they demonstrate that
neuroendocrine cell lines that normally lack glucose-stimulated peptide
release may be
engineered for this function. Other cell lines that are characterized as
neuroendocrine, but
lacking in endogenous glucose response include PC 12, a neuronal cell line
(ATCC CItL 1721 )
and GH3, an anterior pituitary cell line that secretes growth hormone (ATCC
CCL82.1 ). It is
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
40 _
not possible to determine whether such cell lines will gain glucose
responsiveness by
engineering similar to that described for the AtT-20ins cell system without
performing the
experiments. However, these lines do exhibit other properties important for
this invention such
as a regulated secretory pathway, expression of endopeptidases required for
processing of
prohormones to their mature hormone products, and post-translational
modification enzymes.
Some or all neuroendocrine lines also will be useful for glucose-regulated
product delivery,
using the methods described in U.S, Patent 5,427,940 to generate such
responsiveness.
3. Stable Human Secretory Cells
In particular embodiments, the present invention uses stable human secretory
cells by
transforming a non-stable secretory cell such that it is immortalized and
retains its phenotype
through numerous cell culture passages. The final attributes of such cell
lines of the present
invention are functionally defined as having maintained a regulated secretory
pathway, being
stable to in vitro culture and, preferably, as being amenable to further
engineering. The present
1 S section describes the production of these cells for use in the screening
assays of the present
invention.
The human secretory or neuroendocrine cell will be "culturable," i.e., it will
be capable
of growing in vitro and producing the desired endogenous secretory polypeptide
with a
demonstrated reguiated secretory pathway. A "stable, transformed" human
regulated secretory
cell in the context of the present invention will be a cell that exhibits in
vitro growth for at least
twenty population doublings. The resultant human regulated secretory cell also
will maintain
the required differentiated phenotype after transformation, i.e., it will
exhibit the phenotypic
properties of a demonstrable regulated secretory pathway, secretory storage
granules, the
capacity for peptide processing, and will produce the selected endogenous
secretory
polypeptide.
In particular embodiments, the stable human secretory cell is a ~3-cell. The
human (3-
cells of the present invention will exhibit the capacity to grow in vitro,
with a minimum of at
least about 20 population doublings, or preferably, of about 30, about 40,
about 50, about 60,
about 70, or about 80 population doublings. Even more preferably, the
resultant human ~i-cells
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
41 -
of the invention will have even further increments of population doublings up
to and including
a completely transformed state wherein the cells grow in perpetuity.
The human (3-cells of the present invention also will exhibit the capacity to
produce
biologically active human insulin. The insulin produced may be comprised
entirely of mature
insulin; or entirely of the biological precursor of mature insulin, termed
proinsulin; or of all
possible mixtures of proinsulin, insulin, and processing intermediates that
are produced in the
course of conversion of proinsulin to insulin. While the preferred embodiment
of the present
invention are cells that produce primarily or exclusively mature insulin,
cells that produce
proinsulin will also be useful in various embodiments. Such cells are useful
per se, particularly
as any form of insulin can be obtained in vitro, purified and converted to
mature insulin.
Furthermore. insulin is an exemplary secretory protein, the stable human
neuroendocrine cell
line may be engineered to express a variety of secretory proteins for the
purposes of identifying
specific modulators of secretory function.
Cells that produce primarily or exclusively immature insulin also are useful
in that the
capacity to produce mature insulin can be re-engineered into the cells
themselves, in which
instances the stable cells can then be used in vivo. By way of example only,
proteases known
as PC2 and PC3 that are responsible for the conversion of proinsulin to
insulin can be
introduced into the stable human ~3 cells by genetic engineering methods.
thereby enhancing the
efficiency of conversion of proinsulin to insulin.
The stable human ~3 cells of the present invention generally will exhibit a
minimal
insulin content of about 5 ng/million cells, but may contain as much as, or
even more insulin
than, normal isolated human islets, which have approximately 1-1 U pg/million
cells. It will be
understood that the cells of the present invention may contain any amount of
insulin within the
above-specified ranges, such as about 10 ng insulin/million cells. about 50
ng, about 100 ng,
about 200 ng. about S00 ng, about 1000 ng (1 fig), about 2 Ixg. about ~ p,g,
about 10 pg, about
20 p.g, about 50 pg, about 75 fig, up to and including about 100 ~g
insuiin/million cells. It will
be understood that any and all integers within these ranges will define an
insulin content that
may be present within the stable human (3 cells of the invention.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
42 -
In further preferred embodiments, the human (3 cells of the present invention
may be
defined as cells having an insulin content of between about 10%, about 20%,
about 30%. about
40%, about SO%, about 60%, about 70%, about 80%, about 90%, up to and
including about
100% of normal human islet content, which is about 1-10 ~g/million cells.
The human ~3 cells of the present invention will preferably exhibit enhanced
insulin
secretion when exposed to one or more secretagogues selected from IBMX,
carbachol. amino
acids, and glucose, or when exposed to a secretory "cocktail" of such
compounds. The human
(3 cells will more preferably exhibit enhanced insulin secretion when exposed
to glucose, and
will most preferably exhibit enhanced insulin secretion when exposed to 10 mM
glucose.
The increase in insulin secretion in response to a non-glucose secretagogue or
cocktail
thereof should be at least about 1.1 times or about 1.5 times that observed in
cells incubated in
the absence of the secretagogue or secretory cocktail. However, in preferred
embodiments, the
increase in insulin secretion in response to a non-glucose secretagogue or
cocktail thereof
should be at least about double that observed in cells incubated in the
absence of the
secretagogue or secretory cocktail. In more preferred embodiments, a higher
increase will be
observed, up to and including a 3-fold, 5-fold, 10-fold, 20-fold, SO-fold, 100-
fold, 200-fold,
300-fold, 500-fold, 750-fold or even about a 1000-fold enhancement.
The human (3-cells of the present invention preferably will exhibit a glucose-
stimulated
insulin secretion (GSIS) response. This increase in secretion should be at
least about 1.1 times
or about 1.5 times that observed in cells incubated in the absence of glucose.
More preferred
are increases in secretion of at least about double that observed in cells
incubated in the absence
of glucose, with even more preferred increases being higher, up to and
including a 3-fold,
5-fold, 10-fold, 20-fold. 50-fold, 100-fold, 200-fold, 300-fold, 500-fold, 750-
fold or even about
a 1000-fold enhancement. including all increments therebetween.
In preferred embodiments, glucose responsive insulin secretion will be
observed in the
range of 1.0 to 20 mM glucose. GSIS response will occur more preferably with a
threshold for
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
43 -
response of 3-5 mM glucose, with maximal secretion stimulated by 10-20 mM
glucose. as
occurs in normal human islets. Cell lines with glucose dose responses
occurring over a higher
or lower range also will have significant utility, given that any regulated
insulin production will
be useful.
Many secretory cells have a GSIS response not originally in the range observed
for
normal human islets still will be useful as such cells will be amenable to
genetic engineering
methods, as embodied in U.S. Patent x.427..940, and as further disclosed
herein, in order to alter
the glucose dose response. These methods are contemplated for use in
applications with stable
human cells to achieve the desired glucose concentration dependence.
Furthermore, as stated.
human ~3 cells that are completely lacking glucose responsiveness also are
included within the
invention, since the known genetic engineering methods (U.S. Patent 5,427,940)
can be used to
confer glucose sensing in neuroendocrine cell lines previously lacking a
glucose response.
a. Starting Cells
Primary human neuroendocrine secretory cells are immortalized as described in
further
detail elsewhere in the specification. The present section is directed to
describing the starting
cells that may be further engineered for the drug screening purposes of the
present invention.
Fetal Cells. Human fetal pancreases at 18 to 24 gestational weeks can be
obtained
through nonprofit organ procurement centers, with patient consent for tissue
donation being
obtained. Dissection of specific organs from the fetuses is often done at the
procurement
centers. Isolation of fetal pancreases and islets is performed by established
techniques
(Otonkoski et al., 1993; incorporated herein by reference).
Cells from Primary Human Tissues. Human organs can be obtained from autopsies
through nonprofit organ procurement centers. High quality human islets are
available, for
example, from Dr. Camillo Ricordi of the University of Miami Medical Center,
an islet
transplant surgeon who supplies human islets to scientists throughout the
United States.
Automated methods for isolation of human pancreatic islets have been
established (Ricordi et
al., 1988; incorporated herein by reference).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
44 _
Cells from Resected Nettroendocrine Tumors. Explanted tumor samples from
surgically resected tumors are another preferred starting material. More
preferred are
insulinomas and pituitary tumors. Two exemplary insulinomas have been reported
(Gueli et
al., 1987; Cavallo et al., 1992). Although none of the described human
"insulinomas" actually
have the properties required to be properly described as stable human (3
cells, the techniques of
the present invention are still suitable for use with such cell populations as
starting materials in
order to procure a pure population of stable, human insulin-producing cells
from the mixture of
cells currently available.
IO
Human Neuroendocrine Cell Lines. It will be understood that tumor cell lines
and
insulinomas arising from explants of resected neuroendocrine tumors are not
necessarily, by
definition, stable cells; some such cells maintain a differentiated phenotype
for two, four or
about six months at the maximum. However, such cells are intended for use as
starting
materials in the present invention.
Otlter Neuroendocrine Cell Types. Table 1 shown below (Pearse and Takor, 1979;
Nylen and Becker, 1995), while not a complete list, is exemplary of the types
of cells
contemplated for use in the present invention. ~3 cells. a-cells and pituitary
cells are preferred
for use in the present invention, with ~i cells being more preferred.
Additional cell types useful
in the present invention will be readily known to those of skill in the art.
CA 02318379 2000-07-12
WO 99/35495 45 PCT/US99/00551
o ~ c
a
V a~ ar
C~ cCf ~G CC CCf
~ O O
'u O ~ ~ O O ~ E
~~ :
o C O" G ~ ~ ~ C
Q ~ x ~ o ~ o
U ~ C7 c'ba 0., ~ C7
s.
a
0 0 0
0 0
Q.
0 0
...
a ~n
a~ .-. .-.
0. 0 0
~c~.'~ ~ j
E., O O
U
", L
C7
,~,v _ o~0
z O ~ c ~ o x _
~ -a
0 c. o o '
~= M ~ ~ o
D ~ ~ x ~ M ~_
z 4 x ~
M M x z x z
~ O ~ C/) V7
H ~ ~ ~, .~ ~- ~.
z ~ ~
o ~ ~ ~ o
o ~ .~ .~ ~ ~,
'
'T x O C ~
O b
c~ V O G! O .S
H ~ U G.
~ ~ .~ .~ .~
a ~ ~ z
a
0 0 0 0 0 0
$, ., .r .. ~, ~., _~
O V ~ ~ O ~ "C3
~ O ~ N
L ~ U v~ ~ "~ ~"' C7
z g
,
x Q
CA 02318379 2000-07-12
WO 99/35495 46 PCT/US99/00551
o ~ a
o ~ c~ ~s
o ~ E
E"~'~ ~, o
~
c ~ o
' '~ c~ O
~
c ~ :~ C
V ~ O ~ ~ ;
~
y n
>, U o ; o ~ o
c
0 0 .~ .o.~ ;'~ ca
m c ~~.. O V ..~...~ O
E-~ a. rnU ; ~ C7 ~n
C7
0
... .-. ~.
~o
O O
~
lrti~ ~ N ;00 ~ M
.r _
cu,X o ~C .o o X '
o ~ ~ X ',~ .... .r
' '
~..r~ ~ ~ W
O O O r O cU O
;
C
w " cd .~~.. ~'s:,ai ~ cd
N V
C" ' ~ V ~' O
V
U U rn U ' v~ C7 r~
C7
s,
o a
it
O
G ~ N 00
U ~ o
n.
N
O ,...]
.r .~i
-b
~C ~ ' p
H
O ~' -~ O~ '...
p
M p 00 U
~
. t.
O ~ ,
p
C_'.
t ~
. f~~'.j"
r ,
O
Q N .r :.
'x '~.
..-~ 7,
O ~/ O ~ N C~
r" C7 CA O O U C1,
~
U c -c pq, ; ~ c
o ' a? a~ ' '
'
e
.. v ~ o ~ ~ ,.:. r~.. >.
' ;' ~ O ~-
N
p . V C ~
~ > p a : p N O
bD O , .~ ~ O p 'C J N
O ~ x , ~ p ~
~" cd
~ ~ at
O c4'~ i~C7 ~ ; p _O ~ a' O N
c~
U v~ a.. U U a~ : v~ C7 a. - v~ v~
C7
'
,.. .w
y = V ; V
a o ,
as a~ .o c
c U a
V V
N O O ~
V ~' .r O ', N C U V U
O v~
'
fl a~ U a .~ , .~ ~ rn
U . o .=. a~ O _; l7
;
a~
~ ~ ~ V V t-.
_
~ C ~ ~1
C7
D "Cf ,'~G V V
ca .O O '
.
~ ;.,:,s."O v~
.
~ ~ ~ 0.
E- CL C.U : C7 W
C7
CA 02318379 2000-07-12
WO 99/35495 4,~ PCT/US99/00551
L cCS
O
w c3
G O p
E y ~n c~C o C E
a n 'ri c~ ~
C p O ~ C O C
:~ ~ ~ 004 ~
c~ w > a. (~
z v ~ c7 v~ c7
a
y
O n
O
C, ~ ~ O
OMO M pp M ~
O
_
O N 'r x C O
W O N v.r
r M U ~.-.O_
b O c~ b4 C
r.~"'.. ~ H U O
U O~ ~ O
C7 t C7
> v~ C7
a
~c E ono v~ ~' ~ o
~ N
O O ~ ~ M ~''~ ~ o~
i.. M ~ a~
U w ~ .-. O ~ ~ Mp aj o
L: ~ ~ V7 ~' >,
,..,m ~ M O ,~(~,O ~!1O~
a ~ C .-. ...,
o ~ O .~ ~ O N ..,.a. x ~.W
E"~C~ N C x ~ ~ ~ y
~ ~ O O ~ O ~ O c~ U_ O
~ " ~ O
H ~ v z O ~ t5 v
z ~ ~ ~
,
0 ..
o ~ 0 o a.
y
o ~ ~ x >, U ~ n, .5
~, ~ ~ ~ .~ ~ ~s
o .~ ~ U ~, v ~ ap '~ v
o ~ ~ c ~ .~ ' C7
W ~ C7 U ~ > :o~ .~ ~ ~ c~c o
C7 z ~ v~ ~-. C7 ~. a. v~
ar
a
as
U
.~ m .~ ~ . W n rn
U U V ~ ~ N
U U V U V V U
a c~ x ~ z x ~ U n.
U
O 'a:w
z O
~~
w ri
CA 02318379 2000-07-12
WO 99/35495 4g PCT/US99/00551
O L
O
b N ~ N
a ~ ~ o
o -0 0
d . p~., o ~.
''~3> E-~ >
U
s.
as
o ~. .-.
a
~
v r: r
o. ~ 0 0
N M M
U M M
y
O '~ ~' ~'
U ri > >~
'''' o c
0 o
U M ' ono
o. Q:. N
o
w ~ ~ x
c, M ' .- O
v1 ~ O
O O O
C3 > o ~
E"~ U .~ ~ O
O
_C
O, N ~ _O
Q O ~ O T .C
;3 ~ ~ O ~ O
V -t...~',~ ~ vhf O
bD ~ C ~
O ~ O O n-~r..~.
'b of 'U> '~ ~
w U v > >
U
N ~ N
sxr ~ ~ _O
'L
~' c~ .i7~ OD
a v v~ ...
'~O O ~ O U
V s0.. G.
O ~ O O V C~ 'f'~..00
i, .--v~_ O p, ...
'~ O c~ G,
z o z a. a,
ri ~i
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
49
In addition to (3 cells, pituitary cells are preferred for use with this
invention. In general.
pituitary cells may allow for higher efficiency of transformation as culture
conditions have been
reported for promoting the proliferation of rodent pituitary cells in vitro
(Nicol et al., 1990).
The inventors contemplate establishing similar conditions for human pituitary
cells which will
S allow for retroviral infection and provide a means for efficiently
introducing transforming
genes.
Cells from the intermediate lobe may have an advantage for use in cell-based
therapies
of 1DDM as there is a suggestion that this cell type can survive and sustain
secretory function in
autoimmune disease. These cells would therefore be useful in providing an
indication of the
effects of the modulators in vivo, as these cells would be less prone to
attack from the host. The
POMC promoter was used to drive expression of insulin in the cells of the
intermediate lobe of
transgenic nonobese diabetic (NOD) mice. Such cells were resistant to
autoimmune-dependent
destruction even when implanted next to islets in which ~3 cells were
destroyed during the
course of the disease (Lipes et al., 1996).
CA 02318379 2000-07-12
WO 99/35495 5o PCT/US99/00551
a~ o
a >
~- .~
b
E-~ o
w.
x '_'
V ~> +
0
~'>>''z z + z z z z
w ~ L
> '
z + z z z z
a
.a ' +3 5C
w
U o
z zc~~~ +
d
+~x Qc~
c~
z~~~~~
N C~
C)
w .a m n ~ .,
H z_ ~d~ x x~~~ x x ~ x
C7 C7 C7 a. ~ C7 C7 V
z
w
A ~ + +
' N N ' ' '
'J y G. G.
O Q,w ~MU~MU~MU ~MV~M; VlM~CnM
E,., w0.. +~U+~+U .°+U~ ~~ +U+ +oU. +~U '.+~U
Q z
Q U ~ d U > d U ~ d U ~ d U U Q. Q U Q U
a. a. > a~ a. .. a. n. ~ Cs. a. > a. a, a. U a. a. > a. a, >
W _C .b
bD '"
p ~ by by bD o4 04
>~ ~ ~ C
U Ex-~ .Ø7 a ~ i ,..oa
M
O 00 V1
00 C ~ O
V~ ~ 00 ~ 00 00 00
N ~ U1 V~ V1 V''1
d
U ~ a0.' U
V U U ~ U CU J
z o U ~ N n N ono
a ~ ~ M
x z x x x ~ x
a
..
a o 0 0 0 0
x x x x x y x
CA 02318379 2000-07-12
WO 99/35495 51 PCT/US99/00551
v o
.r ,~
w_
0
~''rz z z z z z z
m
_~ o
~ >z + z z z z z
3
E-r o
L +
~- x ~ x
C7 C7 C7
z °'
o
V W~ O O x O O O
,~ C~ " " E" " ., . ,.
Wdx ~ o x x
~ " "
z
H
c~ cv E- " U~ ~ Z ,
C, W (~ M "" C~ U ~ C~ M ~ f/~ M V C~ M U (n M U H ~ W
w a, + U~,., > + + a. U + ~ > z + ~ + +' 'AJ~,." +° + ~ + 2 U~ z V
~~~~~~>~~~~~~>~~>~~?~z~z
w '~ o
on on do ~ y ~ ~ o
o
,.a fn ~ ~c Z o U
0o J
U ° ° U ~ °~
,,a ~ ~ o
c,.., ,
U yn ~~", U = ,'~ U
00 o Q x ' . U o0
Q~ a Q ~ Q
x x z~ z z~ z x
0
V D p ~ '-' ~ M d'
n- x x x x x ~ x
CA 02318379 2000-07-12
WO 99/35495 52 PCT/lJS99/00551
a o
..., .>
y > +
0
~'>'''>zz z zzz + z
m
L
d = ~ z ~~ z
>+ z + + ,
~= o
L
zV
b ~ z z z z
a
V a ~ O O O O O ~ O O
eV W d = ~ x x x x .W.. x
.a: ~ . " " " . . "
'gas C7 C7 C5 C7 C~ C7 J C~
E
" + + - + +
. N N N M N N N
a: + 'v + U + U + U ~" U + U -E U
Lc.z~w~~~_ ~ww ~a,w~0.,w~0.,a~a.w~a,w
W ~~.. ~ U U ~ U ~ ~~ U U ~ U U ~ ~ U ~ V U 'n U U ~ U V
aQ.,~~ad.~aV.,UaQ..aU"> aQ..~~ad..~>aQ.,oU..>a.,oU..>ad.nU,>
o
'ice
's: o a4 ~ on tw on
v
U a ~ a a
M
M o0
n ~ ' .~-~ 'J~ at
E" N ~ V~1 ~ ~ Lay N cNC c~
U V ~ x ~ ..~~ ~ ~ o
Zo~ U "'v°v°o'JO'~
.- a M ~ ~ a N N
x z x x x z x.~
c
V ~, ~ ~ ~ ~. o - N
r. N N N
x x ~ x z x x
CA 02318379 2000-07-12
WO PCT/US99/00551
99/35495
53
~
p
.
~
c
b
.
.
U
O
~
O
O
Op
0.
~,
z
."
;'>_ ~x+
~, + ,
>
b
Ho
x~
'
~ +
; ~
x
0
~ + z +
Q
~
> + z +
U
b
D
~r O
O
~
'
U
z
c~
' W
o
N
:... =- a
~ " z:a
+ ..:.
b ~ w+ + a+"xN ,b
~
~
o
z c7 z z c~ c7
c~
H
d~z
_ 0
V V O O 0
W~ U
. o
' a r~ " z f " '
~ d x x~ z ~
_~
~
c
~ C U
O
c C7 C7
a 7 p
E-~ ~
~
~3
' ' ' ,
>
H
N ~ ' ~
on
o + A... W z C1. ~ O
z'" Cl. W
+ W '' ~
W "' v .~
U~ U >:
'
~
G~ ' J ~r .d
' ' ...
' '
'
z~. +~++~ ,' + d
~+ o
~_
U~
y 0. ~ > V
> ~"
> 'b
U b
.fl A
, G
.~
a
x
... ~
~
0
v 7
0., U ~ aG ,~
o
~
C
i
~1
.
~
c
>
v z x ,
H
0
U Q ~ .
s
ai
~
z ~ a~ z
~
~.~
z z ~
~o:
~
z
o
~
A .
.
~
N N ~ W
'S O
~ ~
~
E
O
. CV .
.
r
O
N
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
S4 -
Table 2 describes the properties of certain cell lines that are exemplary
startin;~ cells for
use in the instant application. ~iG H03 cells are derived from a human non-
small cell lung
carcinoma (ATCC Number: CRL-5816). These cells have a neuroendocrine
phenotype. and
can be grown in a monolayer. This line was derived by Gazdar and associates
from a lung tissue
S obtained from a patient prior to therapy. H03 cells as obtained from the
ATCC are not able to
synthesize the peptide neuromedin B (NMB) or the gastrin releasing peptide
(GRP).
Other lung carcinoma cells include cells designated herein as (3G H04, (3G
HOS, (3G
H07, (3G H09, (3G H19, (3G H20 and ~iG H21. These. as well as additional cells
lines derived
from other sources, are described in further detail herein below. These cell
lines are only
exemplary starting cells for use in the present application, given the
teachings provided herein,
one of ordinary skill in the art will be able to identify additional cells
with characteristics that
would make them appealing as cells to be engineered for use in the present
invention.
HO1 cells (ATCC Number: CCL-2S 1 ) also may be used in the present invention.
These
cells are human colorectal carcinoma cells having an epithelial morphology.
These cells grow
in floating aggregates of round cells. A characteristic that makes these cells
useful in the
context of the present invention is that they contain cytoplasmic dense core
granules
characteristic of endocrine secretion.
~iG H02 cells are obtained from the ATC'C (CRL-1803) are derived from a
thyroid
medullary carcinoma. Their morphology is epithelial and are known to produce
high levels of
calcitonin and carcinoembryonic antigen (CEA). Chromosomal analysis of the
cell line and
tumors induced in nude mice reveal an aneuploid human karyotype with several
marker
chromosomes.
(3G H04 cells are obtained from the ATCC' (CRL-5803) are lung carcinoma cells
and
have a neuroendocrine phenotype. The cells have a homozygous partial deletion
of the pS3
protein, and lack expression of pS3 protein. The cella are able to synthesize
the peptide NMB at
0.1 pmol/mg protein, but not the gastrin releasing peptide (GRP)
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
55 -
Another lung carcinoma cell that may prove a useful host cell in the context
of the
resent invention is designated (3G HOS (ATCC Number: CRL.-6808). This is a
classic small cell
lung cancer cell line with an epithelial morphology. This line was derived
from cells recovered
from pleural effusion taken from a patient after chemotherapy. NCI-H378
expresses elevated
levels of the 4 biochemical markers of SCLC: neuron specific enolase, the
brain isoenzyme of
creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity. The
cells express the
c-kit gene as well as the L-myc gene, and L-myc is amplified. The cells
express easily
detectable levels of p53 mRNA compared.to levels found in normal lung
Also useful is (3G H06, (ATCC Number: CRL-5815). having an epithelial
morphology,
these cells produce neuromedin B (NMB). This line was derived from tissue
taken prior to
therapy. This is the best differentiated of the available bronchial carcinoid
lines. The cells
express easily detectable levels of p53 mRNA compared to levels found in
normal lung. The
cells are able to synthesize the peptide NMB (at 0.1 pmol/mg protein), but not
the gastrin
releasing peptide (GRP). The cell line secretes a parathyroid hormone-like
protein which is
calcium stimulated through a protein kinase C pathway. Further, growth of NCI-
H727 cells is
inhibited by epidermal growth factor (EGF) receptor monoclonal antibodies.
Another classic small cell lung cancer cell line is ~iG H07 (ATCC Number: CRL-
5804).
This line was derived from cells recovered from pleural effusion obtained from
a patient prior
to therapy, and expresses elevated levels of the 4 biochemical markers of
SCLC: neuron-
specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase
and bombesin-like
immunoreactivity. Only trace amounts of the retinoblastoma susceptibility gene
(RB) mRNA,
were detected. RB protein was not detected. The cells express the c-kit gene
as well as the N-
myc gene. N-myc is not amplified. The cells are not able to synthesize the
peptide neuromedin
B (NMB) or the gastrin-releasing peptide (GRP). They express easily detectable
levels of p53
mRNA compared to levels found in normal lung. These cells are useful for
transfection studies.
~iG H08 are carcinoma cells isolated from a stage 3A squamous cell lymph node
carcinoma (ATCC Number: CRL-5867). ~iG H09 are derived from an atypical lung
carcinoid
and are available form the ATCC (CRL-5838). (3G H10 cell line is a
commercially available
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
56 -
cell line derive from lung carcinoma (ATCC Number CCL-18~) Another similar
cell line is
ATCC number CCL-185.1 derived from CCL-185 which was initiated through explant
culture
of lung carcinomatous tissue. CCL-185.1 are adapted to growth in serum-free
medium.
(3G H 11 cells may be obtained form ATCC (number HTB-9) and are derived from a
bladder carcinoma. (3G H13 (ATCC Number: CRL-2139) are from a primitive
neuroectodermal brain tumor. The cells express CCK specific mRNA and
synthesize
considerable quantities of variably processed CCK prohormone.
ATCC Number: CCL-249 are designated herein as (3G H14 and are derived from a
colon adenocarcinoma. This is one of 14 colorectal carcinoma cell lines
derived from a well
differentiated sigmoid tumor from a patient prior to therapy. The line was
initially grown in
medium with fetal bovine serum, but was later adapted to growth in the
chemically defined
medium ACL-4. Floating aggregates produce tubuloglandular structures lined by
columnar
epithelia.
~iG H 15 are from a colorectal carcinoma (ATCC Number: CCL-253) and have an
epithelial phenotype. This line was derived from a metastasis to the abdominal
wall obtained
from a patient after treatment with 5-fluorouracil.
~iG H 16 are the same as the commercially available cell line of ATCC Number:
CRL-
59~4. These are gastric carcinoma cells that express the surface glycoproteins
carcinoembryonic antigen (CEA) and TAG 72 and the muscarinic cholinergic and
vasoactive
intestinal peptide (VIP) receptors but lack gastrin receptors
ATCC Number: HTB-10 are the cells referred to herein as (3G H 18, these cells
are
derived from a neuroblastoma cell line and is one of two cell lines (see also
ATCC HTB-11) of
neurogenic origin.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
57 -
(3G H19 or ATCC Number: HTB-184 are small cell lung carcinoma cells of an
extrapulmonary origin and are from an adrenal metastasis in an adult. The
cells produce easily
detectable p~3 mRNA at levels comparable to those in normal lung tissue.
(3G H20 (ATCC Number: HTB-177) are a large cell carcinoma cell line derived
from
the pleural fluid of a patient with large cell cancer of the lung. The cells
stain positively for
keratin and vimentin but are negative for neurofilament triplet protein. The
line expresses some
properties of neuroendocrine cells, is relatively chemosensitive and can be
cloned in soft agar
(with or without serum).
~iG H21 (ATCC Number: CRL-2195) is yet another small cell lung carcinoma cell
that
may be useful as a starting cell in the present invention. It can grow as
suspension and loosely
adherent culture and is a biochemically stable continuously cultured cell line
which has retained
important features of SCLC . The line was derived from a non-encapsulated
primary fun~~ tumor
from the apical portion of the upper lobe of the left Lung. This cell line is
an unusual
undifferentiated large cell variant of small cell lung carcinoma. It has the
morphology of a
variant, but the biochemical properties of a classic SCLC. Electron microscopy
revealed the
presence of gland formation and intracytoplasmic lamellar bodies. The cells
have
neuroendocrine markers L-dopa decarboxylase and dense core secretory granules.
~3G H23 is a long-term tissue culture cell line derived from a metastatic
human carcinoid
tumor of the pancreas (Ewers et al., 1991; Parekh et al., 1994). This cell
line is also known as
BON (Ewers et al., 1991 ), tumors derived from this cell line are
histologically identical to the
original tumor. The cells have significant amounts of neurotensin,
pancreastatin. and serotonin
(5-HT) are demonstrated in the cells by radioimmunoassay (RIA) and the
presence of
chromogranin A, bombesin, and S-HT is confirmed by immunocytochemistry.
i=urther, the
cells possess neurosecretory granules and functional receptors for
acetylcholine:. 5-HT,
isoproterenol, and somatostatin. BON cells possess a specific transport system
for uptake of 5-
HT from the medium; this uptake system may be a route for regulation of
autocrine ettects of S-
HT on carcinoid cells (Parekh er ul., 1994). This unique human earcinoid tumor
cell line should
provides an exemplary starting material for the bioengineering described
herein and will be
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
58 -
useful in that they possess intracellular mechanisms ideally adapted for
secretagogue action in
the release of amines and peptides.
Yet another starting cell that may be useful in the present invention is
designated (3G
H25 (ATCC Number: HB-8065) derived from a hepatoblastoma. This cell line
produces
alpha-fetoprotein (a fetoprotein): albumin: alpha2 macroglobulin (a-2-
macroglobulin); alphal
antitrypsin (a-1-antitrypsin); transferrin; alphal antichymotrypsin;(a-1-
antichymotrypsin);
haptogiobin; ceruloplasmin; plasminogen and demonstrates decreased expression
of apoA-I
mRNA and increased expression of catalase mRNA in response to gramoxone
(oxidative stress)
complement (C4); C3 activator; fibrinogen; alphal acid glycoprotein (a-1 acid
glycoprotein);
alpha2 HS glycoprotein (a-2-HS-glycoprotein); beta lipoprotein (~i-
lipoprotein); retinol binding
protein.
4. Regulation of the Growth of Stable Cells
1 S There is an advantage to developing human cell lines that do not
ultimately express the
transforming constructs. The transforming genetic construct may, therefore, be
functionally
and/or physically separated from the cell after transformation. Advantages
include generation
of cell lines that do not constitutively express oncogenes which can act as
tumor antigens in
vivo, control of growth of the resulting tumor lines for stable in vivo use
and possibly the
control of the differentiated state of the resultant cell line.
a. Functional Separation
Temperature-Sensitive Regulation of Oncogene Expression. The use of
temperature
sensitive oncogenes allows for turning the growth promoting activity on and
off In general,
oncogenes that are active at lower than physiological temperatures (i.e.,
32°C to 34°C) and off
at physiological or higher temperatures (37°C to 39°C) are
preferred. Using this approach.
stable cell lines can be expanded, and further genetic modifications can be
made and
characterized in vitro at the low, permissive temperatures. When placed in
vivo, these same cell
lines will be exposed to the non-permissive temperature, and will not grow. As
an example of
an oncogene with these traits, a temperature sensitive version of the SV40
virus was isolated
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
59 -
and shown to have a mutation in the coding region of the large T antigen gene
(Bourre and
Sarasin. 1983).
Conditional Expression. Promoters capable of driving expression of
heterologous
genes in response to an exogenously added compound allow for conditional
expression of
oncogenes inserted under the control of the promoter. The addition of the
promoting agent then
allows stable cell lines to be expanded and transformed. When placed in vivo,
expression of the
oncogene is turned off, unless the activating factor is provided.
Examples of such systems include the lac repressor system (Fieck et al., 1992;
Wyborski and Short, 1991; each incorporated herein by reference) and
tetracycline regulatory
system (U.S. Patent 5,464,758; Gossen and Bujard, 1992; Gossen et al., 1995;
each
incorporated herein by reference).
b. Physical Separation
The present invention contemplates the use of the ('relLox site-specific
recombination
system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to
rescue specific
genes out of a genome. Briefly, the system involves the use of a bacterial
nucleotide sequence
knows as a LoxP site, which is recognized by the bacterial C:re protein. The
Cre protein
catalyzes a site-specific recombination event. This event is bidirectional,
i.e., Cre will catalyze
the insertion of sequences at a LoxP site or excise sequences that lie between
two LoxP sites.
Thus, if a construct for insertion also has flanking LoxP sites. introduction
of the Cre protein, or
a polynucleotide encoding the Cre protein, into the cell will catalyze the
removal of the
construct DNA. This technology is enabled in U.S. Patent No. 4,959,317, which
is hereby
incorporated by reference in its entirety.
The present invention also contemplates the use oi~ recombination activating
genes
(RAG) I and 2 to rescue specific genes from the genome of transformed cell
lines. RAG-1
(GenBank accession number M29475) and RAG-2 (GenBank accession numbers M64796
and
M33828) recognize specific recombination signal sequences (RSSs) and catalyze
V(D)J
recombination required for the assembly of immunoglobulin and T cell receptor
genes (Schatz
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
60 -
et al., 1989; Oettinger et al., 1990; Cumo and Oettinger, 1994). Transgenic
expression of
RAG-1 and RAG-2 proteins in non-lymphoid cells supports V(D)J recombination of
reporter
substrates (Oettinger et al., 1990). For use in the present invention, the
transforming construct
of interest is engineered to contain flanking RSSs. Following transformation,
the transforming
construct that is internal to the RSSs can be deleted from the genome by the
transient
expression of RAG-1 and RAG-2 in the transformed cell.
D. Methods of Blocking Endogenous Polypeptides
In certain embodiments, it may be necessary to block expression of~ an
endogenous gene
product as an initial modification of host cells according to the present
invention. The targeted
endogenous gene encodes a protein normally secreted by the host cell. Blocking
expression of
this endogenous gene product, while engineering high level expression of genes
of interest,
represents a unique way of usurping secretory function cells for exogenous
protein production.
Cells generated by this two-step process express heterologous proteins,
including a
variety of natural or engineered proteins (fusions, chimeras, protein
fragments, etc. ). Cell lines
developed in this way are uniquely suited for in vitro assays for the
identification of modulators
of protein secretion as well as in vivo cell-based delivery or in vitro large-
scale production of
defined peptide hormones with little or no contaminating or unwanted
endogenous protein
production.
A number of basic approaches are contemplated for blocking of expression of an
endogenous gene in host cells. First, constructs are designed to homologously
recombine into
particular endogenous gene loci, rendering the endogenous gene nonfunctional.
Second,
constructs are designed to randomly integrate throughout the genome. resulting
in loss of
expression of the endogenous gene. Third, constructs are designed to introduce
nucleic acids
complementary to a target endogenous gene. Expression of RNAs corresponding to
these
complementary nucleic acids will interfere with the transcription and/or
translation of the target
sequences. Fourth, constructs are designed to introduce nucleic acids encoding
ribozymes -
RNA-cleaving enzymes - that will specifically cleave a target mRNA
corresponding to the
endogenous gene. Fifth, endogenous gene can be rendered dysfunctional by
genomic site
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
61 -
directed mutagenesis. Each of these methods for blocking protein production
are well known to
those of skill in the art. By way of example, WO publication numbers WO
97/26334
(published July 24, 1997) and WO 97/26321 (published July 24, 1997) describe
these
methodologies and are specifically incorporated herein by reference.
E. Iterative Engineering to Create Novel Cell Lines with Stable Expression
As an alternative to the transgenic expression of T-antigen in islet (3-cells
to produce (3-
cell lines as screening tool. the present inventors contemplate the use of the
tools of molecular
biology to engineer cell lines with properties that approximate those of the
normal ~i-cell
(Hughes et al., 1992; Ferber et crl.. 1994).
The cell line chosen for these studies, RIN 1046-38, loses glucose
responsiveness as
well as GLUT-2 and glucokinase expression with time in culture (Clark et al.,
1990; Ferber et
al., 1994). Stable transfection of RIN 1046-38 cells of intermediate, but not
high passage
numbers with GLUT-2 reconstitutes GSIS and induces a 4-fold increase in
glucokinase activity
relative to untransfected control cells (Ferber et al., 1994). While these
studies represent an
important start point, major issues must be dealt with before the cells can be
perceived as
having any therapeutic value. Among the fundamental deficiencies in RIN 1046-
38 cells is that
the insulin content of RIN 1046-38 cells is less than one-tenth of the normal
human islet ~3-cell
(Clark et al., 1990). This notwithstanding, RIN 1046-38 cells express rat
rather than human
insulin. Another problem is that the up-regulation of glucokinase activity in
response to
GLUT-2 transfection is transient. and the cells lose glucose responsiveness
over time (Ferber et
al., 1994). And finally, the maximal increase in insulin secretion in response
to glucose is only
3-fold, and occurs at subphysiological glucose concentrations (50-100 pM)
(Ferber et al.,
1994). The inventors address these deficiencies by molecular engineering,
which wi ll require
the introduction of several genes (GLUT-2, glueokinase, human insulin} into a
single cell line,
as well as a reduction in expression of other undesired genes that are
normally expressed by
these cells (hexokinase I. rat insulin). As a major step towards this goal,
the inventors have
used a process of "iterative engineering" to create novel RIN cell lines with
stable expression of
human insulin, GLUT-2 and glucokinase. The results of these investigations are
described in
further detail herein below.
CA 02318379 2000-07-12
WO 99/35495 PCT/lJS99/00551
62 -
In many situations, multiple rounds of iterative engineering will be
undertaken in
generating the final cell lines. The events that may be conducted as separate
construction
events include blocking expression of endogenous gene products by molecular
methods
(including targeting of both copies of the endogenous gene), introducing a
heterologous gene,
and further modification of the host cell to achieve high level expression.
The particular
difficulty in performing multiple steps like this is the need for distinct
selectable markers. This
is a limitation in that only a few selectable markers are available for use in
mammalian cells
and not all of these work sufficiently well for the purposes of this
invention.
The present invention therefore contemplates the use of the CrelLox site-
specific
recombination system (Sauer, 1993, available through Gibco/BRL, Inc.,
Gaithersburg, Md.) to
rescue specific genes out of a genome. most notably drug selection markers. It
is claimed as a
way of increasing the number of rounds of engineering. Briefly, the system
involves the use of
a bacterial nucleotide sequence knows as a LoxP site, which is recognized by
the bacterial Cre
protein. The Cre protein catalyzes a site-specific recombination event. This
event is
bidirectional, i.e., Cre will catalyze the insertion of sequences at a LoxP
site or excise sequences
that lie between two LoxP sites. Thus. if a construct containing a selectable
marker also has
LoxP sites flanking the selectable marker, introduction of the Cre protein, or
a polynucleotide
encoding the Cre protein, into the cell will catalyze the removal of the
selectable marker. If
successfully accomplished, this will make the selectable marker again
available for use in
further genetic engineering of the cell. This technology is explained in
detail in U.S. Patent No.
4,959,317, which is hereby incorporated by reference in its entirety.
In certain embodiments, in order to increase the output of an endogenous
peptide or
even of a heterologous peptide, the present invention contemplates the
supplemental expression
or overexpression of proteins involved in maintaining the specialized
phenotype of host cells.
especially their secretory capacity. Such proteins may be used to supplement
the cell's natural
enzymes. In such cases engineering the overexpression of a cell type-specific
transcription
factor, such as the Insulin Promoter Factor 1 {IPFI) found in pancreatic (3-
cells (Ohlsson et al..
1993), is particularly contemplated.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
63 -
Insulin promoter factor 1 (IPF-l; also referred to as STF-1. IDX-1, PDX-1 and
~iTF-1)
is a homeodomain-containing transcription factor proposed to play an important
role in both
pancreatic development and insulin gene expression in mature (3-cells (Ohlsson
et al., 1993,
Leonard et al., 1993, Miller et al., 1994, Kruse et al., 1993). In embryos,
IPF-1 is expressed
prior to islet cell hormone gene expression and is restricted to positions
within the primitive
foregut where pancreas will later form. Indeed, mice in which the IPF-1 gene
is disrupted by
targeted knockout do not form a pancreas (Jonsson et al., 1994). Later in
pancreatic
development, as the different cell types of the pancreas start to emerge, IPF-
1 expression
becomes restricted predominantly to [3-cells. IPF-1 binds to 'fAAT consensus
motifs contained
within the FLAT E and P1 elements of the insulin enhancer/promoter, whereupon,
it interacts
with other transcription factors to activate insulin gene transcription (Peers
et al., 1994).
Although IPF-1 will generally be present in the resultant stable human (3-
cells of the
present invention, the overexpression of IPF-1 in human (3-cell lines may be
used to serve two
purposes. First, it will increase transgene expression under the control of
the insulin
enhancer/promoter. Second, as IPF-1 appears to be critically involved in (3-
cell maturation,
stable overexpression of IPF-1 in the ~i-cell lines should encourage these
cells to maintain the
differentiated function of a normal human (3-cell.
1. Proteins
A variety of different proteins can be expressed according to the present
invention.
Proteins can be grouped generally into two categories - secreted and non-
secreted. Discussions
of each are detailed below. There are some general properties of proteins that
are worthy of
discussion at this juncture.
First, it is contemplated that many proteins will not have a single sequence
but, rather,
will exists in many forms. These forms may represent allelic variation or,
rather, mutant forms
of a given protein. Second, it is contemplated that various proteins may be
expressed
advantageously as "fusion" proteins. Fusions are generated by linking together
the coding
regions for two proteins, or parts of two proteins. This generates a new,
single coding region
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
64 -
that gives rise to the fusion protein. Fusions may be useful in producing
secreted forms of
proteins that are not normally secreted or producing molecules that are
immunologically
tagged. Tagged proteins may be more easily purified or monitored using
antibodies to the tag.
A third variation contemplated by the present invention involves the
expression of protein
fragments. It may not be necessary to express an entire protein and, in some
cases, it may be
desirable to express a particular functional domain, for example, where the
protein fragment
remains functional but is more stable, or less antigenic, or both.
a. Secreted Proteins
Expression of several proteins that are normally secreted can be engineered
into
neuroendocrine cells. The cDNA's encoding a number of useful human proteins
are available.
Examples would include soluble CD-4, Factor VIII, Factor IX, von Willebrand
Factor, TPA,
urokinase, hirudin. interferons, TNF, interleukins, hematopoietic growth
factors, antibodies,
albumin, leptin. transferrin and nerve growth factors.
Peptide Hormones. Peptide hormones claimed herein for engineering in
neuroendocrine cells are grouped into three classes with specific examples
given for each.
These classes are defined by the complexity of their post-translational
processing. Class I is
represented by Growth Hormone, Prolactin and Parathyroid hormone. A more
extensive list of
human peptides that are included in Class I is given in Table 3. These require
relatively limited
proteolytic processing followed by storage and stimulated release from
secretory granules.
Class II is represented by Insulin and Glucagon. A more extensive list of
human peptide
hormones that are included in Class II are given in Table 4. Further
proteolytic processing is
required, with both endoproteases and carboxypeptidases processing of larger
precursor
molecules occurring in the secretory granules. Class III is represented by
Amylin, Glucagon
like Peptide I and Calcitonin. Again, a more extensive list of Class III human
peptide
hormones is given in Table S. In addition to the proteolytic processing found
in the Class II
peptides, amidation of the C-terminus is required for proper biological
function. Examples of
engineering expression of all three of these classes of peptide hormones in a
neuroendocrine
cell are found in this specification.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
65 -
TABLE 3
CLASS I HUMAN PEPTIDE HORMONES
Growth Hormone
Prolactin
Placental Lactogen
Luteinizing Hormone
Follicle-stimulating Hormone
Chorionic Gonadotropin
Thyroid-stimulating Hormone
Leptin
Relaxin
TABLE 4
HUMAN PEPTIDE HORMONES PROCESSED BY
ENDOPROTEASES FROM LARGER PRECURSORS
Adrenocorticotropin (ACTH)
Angiotensin I and II
~i-endorphin
(3-Melanocyte Stimulating Hormone ((3-MSH)
Cholecystokinin
Endothelin I
Galanin
Gastric Inhibitory Peptide (GIP)
Glucagon
Insulin
Lipotropins
Neurophysins
Somatostatin
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
b6 -
TABLE s
AMIDATED HUMAN PEPTIDE HORMONES
Calcium Metabolism Peptides:
Calcitonin
Calcitonin Gene related Peptide (CGRP)
~3-Calcitonin Gene Related Peptide
Hypercalcemia of Malignancy Factor (1-40) (PTH-rP)
Parathyroid Hormone-related protein (107-139) (PTH-rP)
Parathyroid Hormone-related protein ( I 07-111 ) (PTH-rP)
Gastrointestinal Peptides:
Cholecystokinin (27-33) (CCK)
Galanin Message Associated Peptide, Preprogalanin (65-105)
Gastrin I
Gastrin Releasing Peptide
Glucagon-like Peptide (GLP-1 )
Pancreastatin
Pancreatic Peptide
Peptide YY
PHM
Secretin
Vasoactive Intestinal Peptide (VIP)
Pituitary Peptides:
Oxytocin
Vasopressin (AVP)
Vasotocin
Enkephalins:
Enkephalinamide
Metorphinamide (Adrenorphin)
Alpha Melanocyte Stimulating Hormone (alpha-MSH)
Atrial Natriuretic Factor (5-28) (ANF)
Amylin
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
67 -
Table 5 - Continued
Amyloid P Component (SAP-1)
Corticotropin Releasing Hormone (CRH)
Growth Hormone Releasing Factor (GHRH)
Luteinizing Hormone-Releasing Hormone (LHRH)
Neuropeptide Y
Substance K (Neurokinin A )
Substance P
Thyrotropin Releasing Hormone (TRH)
b. Non-Secreted Proteins
Expression of non-secreted proteins can be engineered into neuroendocrine
cells. Two
general classes of such proteins can be defined. The first are proteins that,
once expressed in
cells, stay associated with the cells in a variety of destinations. These
destinations include the
cytoplasm, nucleus, mitochondria, endoplasmic reticulum, golgi, membrane of
secretory
granules and plasma membrane. Non-secreted proteins are both soluble and
membrane
associated. The second class of proteins are ones that are normally associated
with the cell, but
have been modified such that they are now secreted by the cell. Modifications
would include
site-directed mutagenesis or expression of truncations of engineered proteins
resulting in their
secretion as well as creating novel fusion proteins that result in secretion
of a normally non-
secreted protein.
Cells engineered to produce such proteins will be used for in vitro and in
vivo screening
for modulators of protein production and secretion. This will entail
purification of the secreted
protein from the conditioned media from cells secreting the engineered
protein. In vivo, cell-
based screening methods would either be based on secretion of the engineered
protein or
beneficial effects of the cells expressing a non-secreted protein.
The cDNA's encoding a number of therapeutically useful human proteins are
available.
These include cell surface receptors, transporters and channels such as GLUT2,
CFTR, leptin
receptor, sulfonylurea receptor, (3-cell inward rectifying channels, a2-
adrenergic receptor,
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
68 -
pancreatic polypeptide receptor, somatostatin receptor, glucocorticoid
receptor. potassium
inward rectifying channel, GLP-1 receptor and muscarinic receptor cuc. Other
proteins include
protein processing enzymes such as PC2 and PC3, and PAM, transcription factors
such as IPF1,
and metabolic enzymes such as adenosine deaminase, phenvlalanine hydroxylase,
glucocerebrosidase.
Engineering mutated, truncated or fusion proteins into neuroendocrine cells
also is
contemplated. Examples of each type of engineering resulting in secretion of a
protein are
given (Ferber et ul., 1991; Mains et al., 1995). Reviews on the use of such
proteins for
studying the regulated secretion pathway are also cited (Burgess and Kelly,
1987; Chavez et al.,
1994).
Leptin - Engineering Leptin Expression in Cells. In another embodiment of the
present invention, the engineered cells may express and overexpress the
obesity-associated
protein known as leptin. Leptin is a peptide hormone that controls body
composition and is
believed to do so, at least in part, via interaction with hypothalamic
receptors that regulate food
intake and body weight. The various isoforms of leptin receptor (Ob-R),
including the long
isoform (OB-Rb), are widely expressed in various tissues, suggesting that
leptin may play an
important role in actions on extraneural tissues as well.
Additional evidence that leptin has non-neural function comes from a report
that
extraordinary changes in body fat are seen in rats made chronically
hyperleptinemic by
treatment with an adenovirus vector expressing the leptin cDNA. Chen et al.,
Proc. Nat'1 Acad.
Sci. USA 93:14795 ( 1996). In this report, rats lost all discernible body fat
within 7 days of
adenovirus infusion, while animals that were "pair-fed" at the same low rate
of food intake as
the hyperleptinemic animals retain more of their body fat. The magnitude and
rapidity of the
lipid depletion suggested the possibility of a direct "hormone-to-cell" action
by leptin, in
addition to effects cause through the sympathetic nervous system.
Chen et ul. ( 1996) also examined the effects of leptin overexpression on
plasma glucose,
insulin, plasma triglycerides and free fatty acid levels. While glucose did
not change, both
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
69
plasma triglycerides and free fatty acids dropped by about 50% in adenoviral-
leptin treated
animals, when compared to controls (Ad-(3-gal or saline). These studies now
have been
confirmed and extended with respect to phospholipids. No clear cut changes in
phospholipid
concentration was observed. However, using an in vitro system, it was
established that
reductions in triglyceride levels could be achieved in the absence of
sympathetic nervous
system effects. Studies performed to determine what pathways are involved in
the triglyceride
depletion indicated that leptin-induced triglyceride depletion involves a
novel mechanisms by
which triglyceride disappears through enhanced intracellular triglyceride
metabolism. rather
than through more traditional free fatty acid export pathways.
Insulin levels in adenovirus-leptin infected rats dropped even more
dramatically than the
fatty acids, being only about 1 /3 of the amount seen in controls. As stated
above. the glucose
levels of these animals was normal, however. These findings are consistent
with enhanced
insulin sensitivity in treated animals. Pancreata were isolated from
hyperleptinemic rats and
examined for (3-cell function and morphology. The most striking finding was
the complete
absence of insulin secretion in response to either glucose or arginine. The
morphology
appeared normal, and it was determined that insulin secretion could be
reestablished following
perfusion of pancreatic tissue in the presence of free fatty acids, thereby
establishing an
important role for these molecules in (3-cell function. These studies also
indicate that leptin-
mediated reduction of elevated tissue lipid levels will improve ~i-cell
function, reduce insulin
resistance and help restore abnormal glucose homeostasis in obese individuals.
A further connection between diabetes and leptin comes from studies with
genetically
obese ZDF rats, which contain mutant OB-R genes. The islets of these animals
become
overloaded with fat at the time that hyperglycemia begins. Because maneuvers
that reduce islet
fat content prevent diabetes in ZDF rats, it has been proposed that the
accumulation of
triglycerides in islets plays a causal role in ~i-cell dysfunction. Thus, the
predisposition to
diabetes in homozygous ZDF rats may reflect the fact that their tissue have
been completely
"unleptinized" throughout their life and therefore have accumulated high
levels of TG. In
normal rats, this accumulation is prevented by the action of leptin. It is
expected that any
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
70 -
therapy that reduces triglycerides in islets and in the target tissues of
insulin will improve (3-cell
function and reduce insulin resistance.
In hyperleptinemic rats, every tissue that was examined was lipopenic. Thus,
it is
speculated that normal non-adipocytes carry a minute quantity of triglyceride,
perhaps to serve
as a reserve source of fuel in adipocytes that are depleted of fat by
starvation and become
unable to meet the fuel needs of certain tissues. It is suspected that this
triglyceride storage
function is closely regulated by leptin. In. the obese ZDF rats, this
regulatory control is absent,
and these putative intracellular triglycerides reserves soar to levels of over
1000-times that of
hyperleptinemic rats.
In light of these observations, the present application therefore encompasses
various
engineered cells which express leptin in amounts in excess of normal. The
methods by which
leptin genes may be manipulated and introduced are much the same as for other
genes included
herein, such as amylin. A preferred embodiment would involve the use of a
viral vector to
deliver a leptin-encoding gene, for example, an adenoviral vector. This
approach may be
exploited in at Ieast two ways. First, in the engineering of cells to produce
certain polypeptides
in vitro, it may be desirable to express high levels of leptin in order to
down-regulate various
cellular functions, including synthesis of certain proteins. Similarly, Ieptin
overexpression may
synergize with cellular functions, resulting in the increased expression of an
endogenous or
exogenous polypeptide of interest.
Second, it may be desirable to use a leptin-overexpressing cell, or a leptin
expression
construct, such as a leptin-expressing adenovirus, in an in vivo context. This
includes various
"combination" approaches to the treatment of disease states such as obesity,
hyperlipidemia and
diabetes. For example, leptin expressing cell lines may provide for prolonged
expression of
leptin in vivo and for high level expression. Preliminary results indicate
that injection of
recombinantly produced leptin is less efficacious at achieving weight loss and
reduction of
lipids. Induction of hyperleptinemia using cells Iines or expression
constructs also may find
use in reducing fat content in livestock just prior to slaughter. Moreover,
because leptin-
induced weight loss may act through different mechanisms than those currently
employed, it
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
71 -
may be possible to avoid related side effects such as diet-induced ketosis,
heart attack and other
diet-related symptoms. These regimens may involve combinations of other
engineered cells,
cells engineered with leptin and at least one other gene or genetic construct
(knock-out,
antisense, ribozyme, etc.), combination gene therapy or combination with a
drug. The methods
of delivering such pharmaceutical preparations are described elsewhere in this
document
Enzymes. In still further embodiments, of the present invention, the
engineered cells
may express and/or overexpress certain enzymes of therapeutic value. Such
enzymes include
by are not limited to adenosine deaminase (e.g. Genbank Accession Nos. P55265;
U18121;
U73107; 297053; P00813; U75503; DUHUA), galactosidase (e.g. Genbank Accession
Nos
P54803; P51569; P23780; D00039), glucosidase (e.g. Genbank Accession Nos
P29064 (a-
glucosidase), P26208 (~i-glucosidase), lecithin:cholesterol acyltransferase
(LCAT, e.g. Genbank
Accession Nos. 729921 (baboon), P04180 (human), XXHUN (human LCAT precursor),
X04981 ), factor IX (e.g., Genbank Accession Nos. P00740 (human) K02402
(human) P00741
(bovine) and A22493), sphingolipase, lysosomal acid lipase (e.g., Genbank
Accession Nos
P38571; 541408), lipoprotein lipase (e.g., Genbank Accession No. P06858),
hepatic lipase
(e.g., Genbank Accession Nos. AF037404; P11150; P07098}, pancreatic lipase
related protein
(e.g., Genbank Accession Nos. P5431 S; P54317) pancreatic lipase (P16233) and
uronidase.
2. Processing Enzymes
The present invention also contemplates augmenting or increasing the
capabilities of
cells to produce biologically active polypeptides. This can be accomplished,
in some instances,
by overexpressing the proteins involved in protein processing, such as the
endoproteases PC2
and PC3 (Steiner et al., 1992) or the peptide amidating enzyme, PAM (Eipper et
al., 1992a) in
the case of amidated peptide hormones.
Expression of proteins involved in maintaining the specialized phenotype of
host cells.
especially their secretory capacity, is important. Engineering the
overexpression of a cell type-
specifec transcription factor such as the Insulin Promoter Factor 1 (IPF1)
found in pancreatic (3-
cells (Ohlsson et al., 1993) could increase or stabilize the capabilities of
engineered
neuroendocrine cells. Insulin promoter factor 1 (IPF-1: also referred to as
STF-1, IDX-1, PDX-
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
77 _
1 and ~3TF-1 ) is a homeodomain-containing transcription factor proposed to
play an important
role in both pancreatic development and insulin gene expression in mature (3-
cells (Ohlsson et
al., 1993, Leonard et al., 1993, Miller et al., 1994, Kruse et al.. 1993). In
embryos, IPF-1 is
expressed prior to islet cell hormone gene expression and is restricted to
positions within the
primitive foregut where pancreas will later form. Indeed, mice in which the
IPF-1 gene is
disrupted by targeted knockout do not form a pancreas (Jonsson et al., 1994).
Later in
pancreatic development, as the different cell types of the pancreas start to
emerge, IPF-1
expression becomes restricted predominantly to ~i-cells. IPF-1 binds to TAAT
consensus
motifs contained within the FLAT E and P1 elements of the insulin
enhancer/promoter,
whereupon, it interacts with other transcription factors to activate insulin
gene transcription
(Peers e~ ul.. 1994).
Stable overexpression of IPF-1 in neuroendocrine ~i-cell lines will serve two
purposes.
First, it will increase transgene expression under the control of the insulin
enhancer/promoter.
Second, because IPF-1 appears to be critically involved in (3-cell maturation,
stable
overexpression of IPF-1 in (3-cell lines should cause these mostly
dedifferentiated (3-cells to
regain the more differentiated function of a normal animal (3-cell. If so,
then these
redifferentiated ~i-cell lines could potentially function as a more effective
neuroendocrine cell
type for cell-based delivery of fully processed, bioactive peptide hormones.
Also, further engineering of cells to generate a more physiologically-relevant
regulated
secretory response is claimed. Examples would include engineering the ratios
of glucokinase to
hexokinase in rat insulinoma cells that also overexpress the Type II glucose
transporter (GLUT-
2) such that a physiologically-relevant glucose-stimulated secretion of
peptide hormones is
achieved. Other examples include engineering overexpression of other signaling
proteins
known to play a role in the regulated secretory response of neuroendocrine
cells. These include
cell surface proteins such as the ~i-cell-specific inwardly rectifying
potassium channel (BIR;
Inagaki ei ul., 1995), involved in release of the secretory granule contents
upon glucose
stimulation, the sulfonylurea receptor (SUR), and other ATP sensitive
channels. Other cell
surface signaling receptors which help potentiate the glucose-stimulated
degranulation of ~i-
cells including the glucagon-like peptide I receptor (Thorens, 1992) and the
glucose-dependent
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
73
insulinotropic polypeptide receptor (also known as gastric inhibitory peptide
receptor) (Usdin,
1993) can be engineered into neuroendocrine cells. These (3-cell-specific
signaling receptors,
as welt as GLUT-2 and glucokinase, are involved in secretory granule release
in response to
glucose. In this way, glucose stimulated release of any heterologous peptide
targeted to the
secretory granule can be engineered. Alternatively, other cell surface
signaling proteins
involved in non-glucose-stimulated release of secretory granule contents can
be engineered into
neuroendocrine cells. Examples would include releasing factor receptors such
as Growth
Hormone Releasing Factor Receptor (Lin et al., 1992) and Somatostatin or
Growth Hormone
Releasing Hormone Receptor (Mayo, 1992).
3. Modified Secretory Response
The present invention further includes embodiments where the resultant stable
neuroendocrine cells are further engineered to modify the secretion of the
endogenous secretory
polypeptide in response to one or more secretagogues.
The engineering of the resultant stable cells to generate a more
physiologically-relevant
regulated secretory response includes engineering the expression or
overexpression of signaling
proteins known to play a role in the regulated secretory response of
neuroendocrine cells.
These include cell surface proteins such as the [3-cell-specific inwardly
rectifying potassium
channel ((3 cell inward rectifier, BIR; Inagaki et al., 1995), involved in
release of the secretory
granule contents upon glucose stimulation, the sulfonylurea receptor (SUR),
and ATP sensitive
channel. Other heterologous releasing factor receptors may be used in these
aspects of the
invention, as may adrenergic receptors and the like.
Other cell surface signaling receptors which assist with potentiating the
glucose-
stimulated degranulation of (3-cells include the glucagon-like peptide I
receptor (Thorens,
1992) and the glucose-dependent insulinotropic polypeptide receptor (also
known as gastric
inhibitory peptide receptor} (Usdin et al., 1993), which can also be
engineered into
neuroendocrine cells according to the present invention. These (3-cell-
specific signaling
receptors, as well as GLUT-2 and glucokinase (see below), are involved in
secretoy granule
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
74
release in response to glucose. In this way, glucose stimulated release of a
peptides targeted to
the secretory granule can be reengineered or enhanced.
In still further embodiments, other cell surface signaling proteins involved
in non-
glucose-stimulated release of secretory granule contents can be engineered
into the stable
neuroendocrine cells of the invention. Examples include releasing factor
receptors such as
Growth Hormone Releasing Factor Receptor (Lin et al., 1992) and Somatostatin
or Growth
Hormone Releasing Hormone Receptor (Mayo. 1992).
4. Cell Signaling Machinery
The pancreatic ~3-cell is continually exposed to a complex mixture of
molecules that
modulate insulin synthesis, storage, and exocytosis. The information in this
mixture is
translated to regulatory signals by three distinct mechanisms: (1) transport
into the cell and
metabolism of fuels, (2) ion fluxes, relative to extracellular and
intracellular ion pools, and (3)
hormonal signals that are mediated via receptors (reviewed in Komatsu et al.,
1997). The
transport and metabolism of glucose is the dominant signal that regulates
insulin secretion. A
large portion of the glucose effect is mediated by K+-ATP channels, depends on
membrane
polarity, and regulates the influx of extracellular calcium through L-type
Ca2+ channels. Amino
acids are another fuel that participate in insulin secretion via the
regulation of the K+-ATP
channel.
Glucose metabolism also affects intracellular Ca2+ stores by mechanisms that
are
independent of K+-ATP channels. This portion of glucose-regulated insulin
secretion is
augmented by many other molecules involved in glycemic control such as fatty
acids and
muscarinic receptor ligands. Binding to the muscarinic receptor by
acetylcholine results in the
activation of phospholipases, enzymes that catalyze the conversion of
phophoinositides to
inositol triphosphates (IP3) and diacylglycerol (DAG). Increased IP3 levels
stimulate the
release of Ca2+ from intracellular stores and contribute to signals for
exocytosis of insulin. A
central theme in Ca2+-induced secretion is the activation of Ca2+/calmodulin-
dependent kinases
that link Ca2+ levels to exocytosis (Ashcroft, 1994).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
There is also evidence that glucose regulates insulin secretion by events that
are both
K+-ATP channel-independent and Ca'+-independent. This form of regulation
applies most
often to the augmenting effects observed for hormones that bind receptors such
as GLP-1, GIP,
pituitary adenylate cyclase activating peptide (PACAP), and vasoactive
intestinal peptide
5 (VIP). Receptors for these peptide hormones are typically coupled to GT'P-
binding proteins
that regulate the membrane bound form of adenylate cyclase. Stimulation of the
receptors
results in increases in cyclic AMP levels and increases in the activity of
protein kinase A, a
potentiator of insulin secretion. Other secretory kinase effects may also be
independent of the
K+-ATP channels and intracellular Ca2+. Protein kinase C is stimulated by DAG
and functions
10 to augment glucose-stimulated insulin secretion. (Komatsu et al., 1997).
Prentki has proposed a model for glucose metabolism that takes into account
many
aspects of stimulated insulin secretion (Prentki, 1994). It categorizes
stimulatory events as
glycolytic and post-glycolytic and supports the view that the glucose-mediated
regulation of
15 insulin secretion cannot be fully explained by the effects of the K+-ATP
channels and increases
in intracellular Ca2+. In the model proposed, pyruvate is a key intermediate
metabolite and its
fates provide two distinct mechanisms to stimulate secretion. Pyruvate
dehydxogenase, which
is stimulated by an increase in the ATP/ADP ratios resulting from glycolysis,
moves the
metabolism of glucose toward the citric acid cycle by the conversion of
pyruvate to acetyl CoA.
20 Carbon fluxes through the citric acid cycle boost the ATP/ADP ratios even
higher, and
stimulate the closure of K+-ATP channels and the concomitant increases in
intracellular Ca2+.
Pyruvate also is a key metabolite in anaplerosis, the replenishment of citric
acid cycle
intermediates. This arm of pyruvate metabolism is initiated by the activity of
pyruvate
25 carboxylase, an enzyme that catalyzes the conversion of pyruvate to
citrate. When citrate is
abundant it can be transported from the mitochondria into the cytoplasm and
converted to
malonyl CoA, a molecule that provides a link between glucose metabolism and
fatty acid
metabolism. Increases in malonyl CoA promote the accumulation of fatty acid
intermediates,
potentiators of insulin secretion that appear to be independent of Ca2t
(Prentki, 1994).
CA 02318379 2000-07-12
WO 99/35495 PCT/1jS99/00551
76
F. Transforming Genetic Constructs
The present invention further provides methods for preparing immortalized
stable
human neuroendocrine cells or secretory cells that have maintained their
regulated secretory
pathway. The methods generally comprise providing to a human neuroendocrine or
regulated
secretory cel l an effective amount of a transforming genetic construct that
comprises an operative
transforming unit under the transcriptional control of a promoter specific for
the target
neuroendocrinecell.
In preferred aspects of the preparative methods, the target human
neuroendocrine cells
will be provided with the transforming genetic construct by infection with a
recombinant virus,
most preferably an adenovirus, that comprises the transforming construct. The
methods
described herein may involve the use of two, three or more distinct
transforming genetic
constructs. In certain aspects the use of defined media. or the use of defined
media
supplemented with one or more growth factors specific for the target
neuroendocrine cells is
contemplated. Also contemplated is the use of one or more promoters that have
enhanced
transcriptional activity, such as promoters comprising multimerized promoter
elements, the
additional provision of a growth factor receptor gene to the target cell
and/or the use of
transforming genetic constructs that involve elements for effecting controlled
or regulated
expression or subsequent excision. The present section relates to the
transforming genes and
genetic constructs.
1. Geaes
Exemplary transforming genes and constructs are listed herein in Table 6. Any
one or
more of the genes listed therein may be used in the context of the present
invention. Where two
or more transforming genes are provided to a human neuroendocrine cell, it may
be preferable
to provide genes from different functional categories, such as those that
perturb signal
transduction. affect cell cycle, alter nuclear transcription. alter telomere
structure or function,
inhibit apoptosis, or that exert pleiotropic activities. It will be understood
that the genes listed
in Table 6 are only exemplary of the types of oncogenes. mutated tumor
suppressors and other
transforming genetic constructs and elements that may be used in this
invention. Further
transforming genes and constructs will be known to those of ordinary skill in
the art.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
77
TABLE 6
EXEMPLARY ONCOGENES AND MUTANT TUMOR SUPPRESSORS
I. ONGOGENES MODE OF ACTION
tyrosine kinases, both membrane-associated and cytoplasmic perturb signal
transduction
forms. such as Src family, Jak/Stats, Ros, Neu, Fms, Ret, abl.
Met
serine/threonine kinases: Mos, Raf, protein kinase C, PIM-1
growth factor and receptors: platelet derived growth factor
(PDGF). insulin-like growth factor (IGF-1), insulin receptor
substrate (IRS-1 and IRS-2), Erb family, epidermal growth
factor (EGF}, growth hormone, hepatocyte growth factor
(HGF) basic fibroblast growth factor (bFGF)
small GTPases (G) proteins including the ras family, rab
family, and Gsa
receptor-type tyrosine phosphatase IA-2
cyclin-dependent protein kinases (cdk), classes A - E; affect cell cycle
members of the cyclin family such as cyclin D
Myc family members including c-myc, N-myc, and L-myc; alter nuclear
transcription
Rel family members including NF-kappaB; c-Myb, Ap-1, fos,
jun, insulinoma associated cDNA (IA-1), ErbB-1, PAX gene
family
telomerase lengthens telomeres of
chromosomes
bcl-2 and family members including Bcl-xl, Mcl-1, Bak, A 1. inhibit apoptosis
A20
inhibitors of interleukin-lb-converting enzyme and family
members
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
78
Table 6 - Continued
I. ONGOGENES MODE OF ACTION
viral proteins such as SV40 and polyoma large T antigens, pleiotropic
activities
SV40 temperature sensitive large T antigen, adenovirus ElA
and E1B, papilomavirus E6 and E7
II. MUTANT TUMOR SUPPRESSORS
p53, retinoblastoma gene (Rb), Wilm's tumor (WT1), bax failure to promote
alpha, interleukin-1 b-converting enzyme and family, MEN-1 apoptosis
gene (chromosome 11 q 13), neurofibromatosis, type 1 (NF 1 ),
edk inhibitor p16, colorectal cancer gene (DCC), familial
adenomatosis polyposis gene (FAP), multiple tumor
suppressor gene (MTS-1 ), BRCA1, BRCA2
In certain embodiments. the immortalizing genetic construct will comprise a
gene or
cDNA that is responsible for the perturbation of signal transduction.
Representative members
of this class are genes or cDNAs encoding tyrosine kinases, serine/threonine
kinases, growth
factors and receptors, small GTPases, and receptor-type tyrosine phosphatase
IA-2. Exemplary
of the members preferred for use in the present invention is neu (also known
as her2 or erbB-2;
GenBank accession numbers M 11730, X03363, U02326 and S57296). neu was
discovered as
an oncogene in breast cancer, but it is also found in other forms of cancer.
neu appears to be a
member of the receptor tyrosine kinase family. Also preferred is hepatocyte
growth factor
receptor (HGFr, also known as scatter factor receptor; GenBank accession
number U 11813).
This is an example of a receptor, either endogenously present or expressed
from a recombinant
adenovirus, that is used to stimulate proliferation of a target cell
population. Other preferred
members are insulin-like growth factor 1 receptor (GenBank accession number
X04434 and
M24599), and GTPase Gsu (GenBank accession numbers X56009, X04409). Gs~x is
associated
with pituitary tumors that secrete growth hormone, but not other
neuroendocrine or endocrine
tumors.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
79 _
In alternative embodiments. the immortalization genetic construct may be a
factor that
affects the cell cycle. Exemplary of this type of factor is cyclin Dl (also
known as PRAD or
bcl-l; GenBank accession numbers M64349 and M73554). This is associated as an
oncogene
primarily with parathyroid tumors. Other factors that may comprise the genetic
immortalization construct include those gene that alter nuclear transcription
c-myc (GenBank
accession numbers J00120, K01980. M23541, V00501, X00364). Inhibitors of
apoptosis are
also preferred for use is bcl-2 (distinct from bcl-l, cyclin D1; GenBank
accession numbers
M14745, X06487). Overexpression of this oncogene was first discovered in T
cell lymphomas.
bcl-2 functions as an oncogene by binding and inactivating Bax, a protein in
the apoptotic
pathway. In other aspects the genetic constructs comprise molecules with
pleiotropic activities.
preferred from this class is SV40 large T antigen (TAG; GenBank accession
number J02400).
Also preferred is temperature sensitive large T antigen.
Other genes that will be useful in immortalizing the neuroendocrine cells are
constructs
that result in the failure to promote apoptosis. Preferred in this category
are p53 and the
retinoblastoma gene. Most forms of cancer have reports of p53 mutations.
Inactivation of p53
results in a failure to promote apoptosis. With this failure, cancer cells
progress in
tumorogenesis rather than be destined for cell death. A short list of cancers
and mutations
found in p53 is: ovarian (GenBank accession numbers 553545, S62213, 562216);
liver
(GenBank accession numbers 562711, S62713, S62714, 567715, 572716); gastric
(GenBank
accession numbers 563157); colon (GenBank accession numbers S63610); bladder
(GenBank
accession numbers 585568, S85570, 585691 ); lung (GenBank accession numbers
S41969,
S41977); and glioma (GenBank accession numbers S85807, 585712, S85713).
In still further preferred embodiments, the invention contemplates the use of
growth
factor receptor genes and growth factor genes as the transforming elements. As
an example of
this embodiment, human (3 cells are infected with a recombinant adenovirus
that provides
overexpression of growth hormone receptor {GenBank Accession Nos. J04811 and
X0656? )
controlled by the modRIP {or modHlP) promoter. (3 cells cultured in a defined
medium would
then be stimulated to proliferate by the addition of growth hormone to the
medium. The
replicating population of (3 cells are then transformed by retroviral
constructs that will result in
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
80 -
stable expression of growth hormone receptor or an alternate transforming
gene. The use of
other growth promoting genes such as IGF-1 receptor (and its ligand in the
medium) and or the
signaling substrate of growth factor receptors (such as IRS-2 in the case of
IGF-1 receptor)
could similarly be used to achieve growth and transformation.
In still further preferred embodiments, the invention contemplates the use of
several
transforming gene constructs in combination. As an example of this embodiment,
the
transforming genetic construct may include more than one operative
transforming unit, or more
than one construct can be supplied.
2. Constitutive Promoters
Throughout this application, the term "expression construct" is meant to
include any
type of genetic construct containing a nucleic acid coding for a gene product
in which part or all
of the nucleic acid encoding sequence is capable of being transcribed. The
transcript may be
translated into a protein, but it need not be. In certain embodiments,
expression includes both
transcription of a gene and translation of mRNA into a gene product. In other
embodiments,
expression only includes transcription of the nucleic acid encoding a gene of
interest.
In preferred embodiments, the nucleic acid encoding a gene product is under
transcriptional control of a promoter. A "promoter" refers to a DNA sequence
recognized by
the synthetic machinery of the cell, or introduced synthetic machinery,
required to initiate the
specific transcription of a gene. The phrase "under transcriptional control"
means that the
promoter is in the correct location and orientation in relation to the nucleic
acid to control RNA
polymerase initiation and expression of the gene.
The term promoter will be used here to refer to a group of transcriptional
control
modules that are clustered around the initiation site for RNA polymerase II.
Much of the
thinking about how promoters are organized derives from analyses of several
viral promoters,
including those for the HSV thymidine kinase (tk) and SV40 early transcription
units. These
studies, augmented by more recent work, have shown that promoters are composed
of discrete
functional modules, each consisting of approximately 7-20 by of DNA, and
containing one or
more recognition sites for transcriptional activator or repressor proteins.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
81
At least one module in each promoter functions to position the start site for
RNA
synthesis. The best known example of this is the TATA box. but in some
promoters lacking a
TATA box. such as the promoter for the mammalian terminal deoxynucleotidyl
transferase
gene and the promoter for the SV40 late genes, a discrete element overlying
the start site itself
helps to fix the place of initiation.
Additional promoter elements regulate the frequency of transcriptional
initiation.
Typically. these are located in the region 30-110 by upstream of the start
site, although a
number of promoters have recently been shown to contain functional elements
downstream of
the start site as well. The spacing between promoter elements frequently is
flexible, so that
promoter function is preserved when elements are inverted or moved relative to
one another. In
the tk promoter, the spacing between promoter elements can be increased to 50
by apart before
activity begins to decline. Depending on the promoter, it appears that
individual elements can
function either co-operatively or independently to activate transcription.
The particular promoter that is employed to control the expression of a
nucleic acid
encoding a particular gene is not believed to be important, so long as it is
capable of expressing
the nucleic acid in the targeted cell. Thus, where a human cell is targeted,
it is preferable to
position the nucleic acid coding region adjacent to and under the control of a
promoter that is
capable of being expressed in a human cell. Generally speaking, such a
promoter might include
either a human or viral promoter.
In various embodiments, the human cytomegalovirus (CMV) immediate early gene
promoter. the SV40 early promoter, the Rous sarcoma virus long terminal
repeat, rat insulin
promoter and glyceraldehyde-3-phosphate dehydrogenase can be used to obtain
high-level
expression of the gene of interest. The use of other viral or mammalian
cellular or bacterial
phage promoters which are well-known in the art to achieve expression of a
gene of interest is
contemplated as well, provided that the levels of expression are sufficient
for a given purpose.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
82
By employing a promoter with well-known properties, the level and pattern of
expression of the gene product following transfection can be optimized.
Further. selection of a
promoter that is regulated in response to specific physiologic signals can
permit inducible
expression of the gene product. Tables 6 and 7 list several elements/promoters
which may be
employed, in the context of the present invention, to regulate the expression
of the gene of
interest. This list is not intended to be exhaustive of all the possible
elements involved in the
promotion of gene expression but, merely, to be exemplary thereof.
Enhancers were originally detected as genetic elements that increased
transcription from
a promoter located at a distant position on the same molecule of DNA. This
ability to act over
a large distance had little precedent in classic studies of prokaryotic
transcriptional regulation.
Subsequent work showed that regions of DNA with enhancer activity are
organized much like
promoters. That is, they are composed of many individual elements, each of
which binds to one
or more transcriptional proteins.
The basic distinction between enhancers and promoters is operational. An
enhancer
region as a whole must be able to stimulate transcription at a distance; this
need not be true of a
promoter region or its component elements. On the other hand, a promoter must
have one or
more elements that direct initiation of RNA synthesis at a particular site and
in a particular
orientation, whereas enhancers lack these specificities. Promoters and
enhancers are often
overlapping and contiguous, often seeming to have a very similar modular
organization.
Below is a list of viral promoters, cellular promoters/enhancers and inducible
promoters/enhancers that could be used in combination with the nucleic acid
encoding a gene
of interest in an expression construct (Table 7 and Table 8). Additionally,
any
promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB)
could also
be used to drive expression of the gene. Eukaryotic cells can support
cytoplasmic transcription
from certain bacterial promoters if the appropriate bacterial polymerise is
provided, either as
part of the delivery complex or as an additional genetic expression construct.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
83
TABLE 7
ENHANCER
ImmunoglobulinHeavy Chain
ImmunoglobulinLight Chain
T-Cell Receptor
HLA DQ a and DQ (3
~i-Interferon
Interleukin-2
Interleukin-2 Receptor
MHC Class II S
MHC Class II HLA-DRa
(3-Actin
Muscle Creatine Kinase
Prealbumin (Transthyretin)
Elastase I
Metallothionein
Collagenase
Albumin Gene
a-Fetoprotein
i-Globin
(3-Globin
e-fos
c-HA-ras
CA 02318379 2000-07-12
WO 99/35495 PCTlUS99/00551
84
Table 7 - Continued
ENHANCER
Insulin
Neural Cell Adhesion Molecule (NCAM)
a I -Antitrypsin
H2B (TH2B) Histone
Mouse or Type I Collagen
Glucose-RegulatedProteins (GRP94 and GRP78)
Rat Growth Hormone
Human Serum Amyloid A (SAA)
Troponin I (TN I)
Platelet-Derived Growth Factor
Duchenne Muscular Dystrophy
S V40
Polyoma
Retroviruses
Papilloma Virus
Hepatitis B Virus
Human ImmunodeficiencyVirus
Cytomegalovirus
Gibbon Ape Leukemia Virus
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
85 -
TABLE 8
Element Inducer
MT II Phorbol Ester (TPA)
Heavy metals
MMTV (mouse mammary Glucocorticoids
tumor virus)
13-Interferon poly(rI )X
poly(rc)
Adenovirus 5 E2 Ela
c-jun Phorbol Ester (TPA), H20z
Collagenase Phorbol Ester (TPA)
Stromelysin Phorbol Ester (TPA), IL-1
SV40 Phorbol Ester (TPA)
Murine MX Gene Interferon, Newcastle Disease Virus
GRP78 Gene A23187
oc-2-Macroglobulin IL-6
V imentin Serum
MHC Class I Gene H-2kBInterferon
HSP70 Ela, SV40 Large T Antigen
Proliferin Phorbol Ester-TPA
Tumor Necrosis Factor FMA
Thyroid Stimulating Thyroid Hormone
Hormone
a Gene
Insulin E Box Glucose
3. Secretory Cell-Specific Promoters
In certain aspects of the present invention, the expression of the
transforming genetic
construct is under the control of a promoter. The promoter is required to
express the
transforming genetic construct to a degree sufficient to effect transformation
of a target cell
type amongst a population of different cell types such that the transformed
target cell results in
the generation of a stable human regulated secretory cell.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
86
Promoters can be classified into two groups, ubiquitous and tissue- or cell-
specific.
Ubiquitous promoters activate transcription in all or most tissues and cell
types. Examples of
ubiquitous promoters are cellular promoters like the histone promoters,
promoters for many
metabolic enzyme genes such as hexokinase I and glyceraldehyde-3-phosphate
dehydrogenase,
and many viral promoters such as CMVp and the Rous sarcoma virus promoter
(RSVp).
Tissue- or cell-specific promoters activate transcription in a restricted set
of tissues or
cell types or, in some cases, only in a single cell type of a particular
tissue. Examples of
stringent cell-specific promoters are the insulin gene promoters which are
expressed in only a
single cell type (pancreatic ~i cells) while remaining silent in all other
cell types, and the
immunoglobulin gene promoters which are expressed only in cell types of the
immune system.
Various exemplary promoters are shown above in Table 1 (Pearse and Takor,
1979;
Nylen and Becker. 1995}. Although not a complete list, these promoters are
exemplary of the
types of promoters contemplated for use in the present invention. Additional
promoters useful
in the present invention will be readily known to those of skill in the art.
The promoter may be "context specific" in that it will be expressed only in
the desired
cell type and not in other cell types that are likely to be present in the
population of target cells,
e.g., it will be expressed in (3 cells, but not in a or S cells, when
introduced into intact human
islets. In this scenario, an insulin promoter targets the expression of a
linked transforming
oncogene selectively to ~i cells of a human islet preparation even though many
other
contaminating cell types exist in the preparation.
As the present invention is applicable to the generation or stably transformed
neuroendocrine secretory cell lines other than ~i cells, other context
specific promoters may be
employed. For example, the cell-specific prolactin gene promoter can be used
to express a
linked transforming oncogene selectively to lactotrophs surrounded by all the
other cell types
present in a pituitary cell preparation.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
87 _
a. (3 Cell-Specific Promoters.
It has been documented that the two rat insulin gene promoters, RIP 1 (GenBank
accession number J00747) and R.IP2 (GenBank accession number J00748), as well
as the
human insulin promoter (HIP; GenBank accession number V00565), direct
stringent cell-
specific expression of the insulin gene in rodent (3 cell insulinoma lines
(German et ul., 1990),
primary islet cells (Melloul et ul., 1993), and in (3 cells of transgenic mice
(Efrat et ul.. 1988).
As the sequence and position of the functional promoter elements are well
conserved
between HIP, RIP1 and RIP?, the transcription factors that interact with these
elements are
likely to be conserved across species. In fact, HIP can direct cell-specific
expression of linked
genes in rodent (3 cell lines and rat primary islets, albeit, at a somewhat
lower level than that
observed for RIPl (Melloul et ul., 1993).
The inventors postulate that RIP1 and RIP2 should function effectively in
human
~i cells. However, due to the lack of any human insulinoma cell lines and to
the difficulty of
obtaining human primary islets, there has been a dearth of analysis of the
human or rat insulin
promoters in human ~3 cells.
Melloul et al., ( 1993) demonstrated that the isolated 50-by RIP 1 FAR/FLAT
minienhancer (FF), an essential promoter element for RIP1 activity, could
express a linked
reporter gene in both adult rat and human islet cells. Furthermore, FF
activity could be
substantially induced by increased concentrations of glucose in both species
of adult islets.
Additional results from gel-shift studies strongly suggested that the same or
similar (3 cell-
specific transcription factors) from both adult rat and human islet cell
nuclear extracts bound to
conserved sequences contained within both the RIP1 FF and the analogous region
of HIP.
b. Further Neuroendocrine Cell-Specific Promoters.
Representative are the glucagon promoter, GenBank accession number X03991:
growth
hormone promoter, GenBank accession numbers J03071 and K00470; POMC gene
promoter,
GenBank accession numbers VO1510 and K02406; calcitonin promoter, GenBank
accession
number X15943; and the GIP gene promoter, GenBank accession number M31674.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
88
c. Modified Promoters.
Promoters can be modified in a number of ways to increase their
transcriptional activity.
Multiple copies of a given promoter can be linked in tandem, mutations which
increase activity
may be introduced, single or multiple copies of individual promoter elements
may be attached,
parts of unrelated promoters may be fused together, or some combination of all
of the above
can be employed to generate highly active promoters. All such methods are
contemplated for
use in connection with the present invention.
German et al., (1992) mutated three nucleotides in the transcriptionally
important FLAT
E box of the rat insulin I gene promoter (RIP), resulting in a three- to four-
fold increase in
transcriptional activity of the mutated RIP compared to that of a nonmutated
RIP as assayed in
transiently transfected HIT cells. Also, the introduction of multiple copies
of a promoter
element from the E coli tetracycline resistance operon promoter were
introduced into the CMV
promoter, significantly increasing the activity of this already very potent
promoter (Liang et al..
1996). Additionally, part of the CMV promoter, which has high but short-lived
transcriptional
activity in dog myoblasts, was linked to the muscle-specific creatine kinase
promoter (MCKp),
which has weak but sustained expression in dog myoblasts, resulting in a
hybrid promoter that
sustained high-level expression for extended periods in dog myoblasts.
d. Multimerized Promoters.
Several modified rat insulin promoters (modRIP) containing multimerized
enhancer
elements have been engineered. The currently preferred modRIP contains six
multimerized
repeats of a 50 base pair region of the cis acting enhancer of RIP, placed
upstream of an intact
copy of RIP.
These novel promoters have been shown to direct expression of transgenes in
stably
engineered ~i cell lines at levels above those attained with unmodified
insulin promoters and, in
some cases, approaching the levels achieved with the Cytomegalovirus promoter
(CMVp).
CMVp is one of the strongest activating promoters known, but in a very non-
tissue specific
manner. Therefore, the present modified rat insulin promoters can be used to
direct the tissue
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
89 _.
specific expression of transforming genes at levels presently achievable only
with the non-
specific CMVp.
4. Other Regulatory Elements
Where a cDNA insert is employed, one will typically desire to include a
polyadenylation signal to effect proper polyadenylation of the gene
transcript. The nature of
the polyadenylation signal is not believed to be crucial to the successful
practice of the
invention, and any such sequence may be employed. Also contemplated as an
element of the
expression cassette is a terminator. These elements can serve to enhance
message levels and to
minimize read through from the cassette into other sequences.
5. Selectable Markers
In certain embodiments of the invention, the delivery of a nucleic acid in a
cell may be
identified in vitro or in vivo by including a marker in the expression
construct. The marker
would result in an identifiable change to the transfected cell permitting easy
identification of
expression. Usually the inclusion of a drug selection marker aids in cloning
and in the selection
of transformants, for example, neomycin, puromycin. hygromycin, DHFR, GPT,
zeocin and
histidinol. Alternatively, enzymes such as herpes simplex virus thymidine
kinase {tk)
(eukaryotic) or chloramphenicol acetyltransferase (CAT) (prokaryotic) may be
employed.
Immunologic markers also can be employed. The selectable marker employed is
not believed
to be important, so long as it is capable of being expressed simultaneously
with the nucleic acid
encoding a gene product. Further examples of selectable markers are well known
to one of skill
in the art.
6. Multigene constructs and IRES
In certain embodiments of the invention, the use of internal ribosome binding
sites
(IRES) elements are used to create multigene, or polycistronic, messages. IRES
elements are
able to bypass the ribosome scanning model of 5' methylated Cap dependent
translation and
begin translation at internal sites (Pelletier and Sonenberg. 1988). IRES
elements from two
members of the picanovirus family (polio and encephalomyocarditis) have been
described
(Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message
(Macejak and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
90 -
Sarnow, 1991 ). IRES elements can be linked to heterologous open reading
frames. Multiple
open reading frames can be transcribed together, each separated by an IRES,
creating
polycistronic messages. By virtue of the IRES element, each open reading frame
is accessible
to ribosomes for efficient translation. Multiple genes can be eff ciently
expressed using a single
S promoter/enhancer to transcribe a single message.
Any heterologous open reading frame can be linked to IRES elements. This
includes
genes for secreted proteins, mufti-subunit proteins, encoded by independent
genes, intracellular
or membrane-bound proteins and selectable markers. In this way, expression of
several
proteins can be simultaneously engineered into a cell with a single construct
and a single
selectable marker.
G. Secretory Cell Culture
The neuroendocrine cell and the stable neuroendocrine cells of the present
invention
1 S will be grown in cell culture. The present section describes the
methodology related to growth
of cells in culture.
1. Culture Conditions
Primary cells are expanded by established culture conditions. For example, ~i
cells can
be cultured and even induced to divide as described (Clark and Chick, 1990;
Beattie et al.,
1991; Hayek et ul., 1995; each incorporated herein by reference).
Human islets isolated by an automated method (Ricordi et al.. 1988) are
maintained in
culture and transformed by the inventive engineered expression of proteins
that promote
accelerated cell replication. The transformation methods of the invention
preferably involve the
use of specific culture conditions designed to preferentially promote
neuroendocrine cell
growth, which are used in conjunction with the stable activation of cell
specific gene promoter
controlled protein expression.
The culture conditions are achieved by manipulating the following cell culture
variables: media growth/survival factors (such as IGF-1, growth hormone,
prolactin, PDGF,
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
91
hepatocyte growth factor. and transferrin), media differentiation factors
(such as TGF-(3). media
lipids, media metabolites (such as glucose, pyruvate, galactose, and amino
acids). media serum
(percentage serum, serum fraction, species of serum), gaseous exchange (ratio
atmospheric
02:C02, and media volume), physical form of the islets prior to plating
(whole, dispersed, or
cell sorted islet cells). and extracellular substrate for cellular attachment
(such as laminin,
collagen, matrigel, and HTB-9 bladder carcinoma derived matrix).
Fibroblast growth/survival in culture is eliminated by culturing the islets in
defined
media using factors (such as IGF-1, cysteine, and growth hormone) to
selectively confer a
growth/survival advantage to ~3 cells in preference to fibroblasts.
Establishment of fibroblast
free cultures will allow prolonged maintenance of human islet (3 cells in
culture for subsequent
infection with adenovirus expression vectors in cases where (3 cells are in a
non-proliferative
state, or retrovirus expression vectors for (3 cells which have been induced
to proliferate by
oncogene expression. Fibroblasts may even be killed by fibroblast-directed
toxins.
2. Defined Media
Media comprising one or more growth factors that stimulate the growth of the
target
neuroendocrine cell and do not substantially stimulate growth of distinct
cells in the cell
population; i.e., act to induce preferential growth of the target cells rather
than faster-growing,
more hardy cells in the population, as may be used to deplete fibroblasts.
Examples include
defined serum free conditions used for (3 cells (Clark et al., 1990;
incorporated herein by
reference), or inclusion of growth or differentiation factors known to allow
preferential growth
of (3 cells (WO 95/29989; incorporated herein by reference).
In particular embodiment, the inventors have developed a media composition
that will
be particularly useful in the growth and propagation of the cells of the
present invention. The
rational behind the development of "BetaGene" medium had its beginnin~~s with
the
observation that in bioreactor high density cultures of ~i-cell line RIN-38.
ethanolamine was a
rapidly consumed component of the growth medium. An equimolar mixture of
ethanolamine-
phosphoethanolamine was found to protect RIN-38 13-cells from linoleic acid
toxicity
(approximately 30 p.g/ml in serum-free medium).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
92
Subsequently, it was found that bioreactor cultures of this cell line could be
maintained
for weeks in the absence of serum when the medium was supplemented with a
mixture of~
ethanolamine-phosphoethanolamine. bovine serum albumin, and transferrin. These
indications
for critical lipid components ensured that other lipid components as lipoic
acid, inositol (both
indicated as protective in vivo, in the literature), cholesterol, TWEEN 80 and
putrescine would
be included in the subsequent medium formulations.
A second finding was critical to the determination of the optimal formulation
for (3-
cells. This was the development of a rapid screening method for evaluating the
best
commercial medium formulation. The method entails encapsulating ~3G18/3E1
cells- a rodent
~i-cell line engineered to secrete human insulin- in I.5% alginate beads. (3-
cells encapsulated in
beads are very amenable to serumless culture, and beads were cultured in
different media ~FBS
for 3-6 days and insulin secretion was monitored to estimate growth and
function.
The serumless cultures then were returned to the same base medium supplemented
with
FBS, with continued insulin monitoring. The media screened were those most
commonly used
for culture of primary islets in the literature. Performance of the different
media were indicated
by the rate and magnitude of functional loss. as well as the rate of recovery
and completeness of
recovery after return to FBS supplementation. One medium CMRL1066 was clearly
inferior,
while M199, and a-MEM were fairly equivalent. Media such as F12 and RPMI were
not readily
evaluated by this approach, due to the low calcium concentration of these
media and resultant
deterioration of the Ca-alginate hydrogel. The latter were then evaluated as
equal mixtures with
M199 and MEM. An M199-F12 mixture was determined to be the best performing
formulation
tested, while an MEM-F12 mixture could be used with at least short term
equivalency. Many
components of the 13G Medium are at concentrations that would be found in
mixed
formulations (others reflect our optimization).
Cells in alginate beads have been used routinely to screen medium components.
This
approach has simplified and greatly accelerated screening studies. The use of
cells in beads has
been refined to include acutely stimulated insulin secretion. This has led to
the identification of
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
93 _
culture supplements that are critical to maintaining secretory function in 13-
cells / 13-cell lines in
the absence of serum. (Additional lipids minor, BSA & transferrrin major).
The knowledge that normal ~i-cells have high ascorbate concentrations, and
that PAM,
the enzyme responsible for amidation of such islet peptides as pancreatic
polypeptide and
amylin, requires ascorbate, and Cu, led to the inclusion of these components.
However,
ascorbate is quite unstable in medium at 37°C, therefore. a stabilized
form of ascorbate was
screened for dose-dependent deleterious effects on growth and insulin
secretion. None was
encountered over a wide range of concentrations from 10-6 to 10-3 M. An
intermediate
concentration of stabilized ascorbate (ascorbate-phosphate) was tested for its
effect on
amidation, using cells engineered to express GLP-1 or amylin. The intermediate
concentration
(50-100 pM) was found to greatly improve amidation. both in flask and high
density scale-up
cultures, and was thus identified as the concentration for 13G Medium.
I S Bicarbonate was increased in the formulation to provide better pH control
for scale-up
cultures (such as the CellCubeTM). Zinc was supplemented because primary beta
cells have high
concentrations of zinc and several islet enzymes bind Zn, and insulin crystal
is coordinate with
Zn. Finally, glucose concentrations are known to be critical for 13-cell
culture. One objective of
the medium development was to derive a formulation that would optimally
support primary
pancreatic islets as well as 13-cell lines. As a result. human islets were
used to determine a
glucose concentration that could support survival and function of human islets
in culture.
Glucose in the range of 7 mM (6-8 mM) provided long term survival (months) of
human islets,
with maintenance of glucose sensing, as indicated by dose-response studies of
glucose-induced
insulin secretion, and by maintained (and in islets of two donors restored
insulin processing).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
94
TABLE 9
THE FOLLOWING SPECIFICATION PROVIDES AN EXEMPLARY
COMPOSITION OF BETAGENE MEDIUM
Component Formulation Component Formulation
gIL mmolll gIL mmoIIL
Amino acids Vitamins
Alanine 0.025 0.280615 Ascorbate-2- 0.0181 0.070675517
phosphate-Mg
salt
ArginineHCI 0.2107 0.998578 DL-aTocopherol 0.0000056.77507
P04 E-O6
2Na
AsparagineH200.05 0.333333 d-biotin 0.00001 4.09836
E-05
Aspartate 0.03 0.225564 Ergocalciferol 0.0001 0.000251889
CysteineHCIH200.03512 0.199545 D-Ca Pantothenate0.0006190.001297694
Cystine2HCI 0.01564 0.049968 Choline chloride0.00723 0.051642857
Glutamic acid2H200.075 0.454545 Folic acid 0.0013 0.002947846
Glutamine 0.1 0.684932 myo-inositol 0.035 0.194444444
Glycine 0.0287550.383400 Menadione 0.00001 5.81395
E-05
HistidineHCIH200.04188 0.199429 Niacin 0.0000250.000203087
Hydroxyproline0.01 0.076336 Niacinamide 0.0000250.000204918
Isoleucine 0.0525 0.400763 PABA 0.00005 0.000364964
Leucine 0.12 0.916031 PyridoxalHCI 0.0000250.000122549
LysineHCI 0.07 0.382514 PyridoxineHCI 0.0000250.000121359
Methionine 0.015 0.100671 Riboflavin 0.0001 0.000265957
Phenylalanine0.032 0.193939 ThiamineHCI 0.001 0.002967359
Proline 0.04 0.347826 Vitamin A acetate0.00014 0.000426829
Serine 0.025 0.238095 Vitamin B12 0.0013570.001001476
Threonine 0.048 0.403361
Tryptophan 0.01 0.049020
Tyrosine2Na2H200.0519 0.198851
CA 02318379 2000-07-12
WO 99/35495 PCT/I1S99/0055t
Table 9 - Continued
Component Formulation Component Formulation
g1L mmol(L gll mmolll
Amino acids Vitamins
Ualine 0.046 0.393162 Other
Adenine SOa - -
ATP 2Na - -
AMP - -
Cholesterol 0.0001 0.000258398
Deoxyribose 0.00025 0.001865672
Ethanolamine 0.0001560.002554028
Salts Glucose 1.4 7.777777778
CaCl2 0.11661 1.050541 Glutathione 0.0000258.14332
(reduced) E-05
CuS045H20 0.00000249 0.000010 GuanineHCI - -
Fe1N03139H20- Hypoxanthine
FeS047H20 0.000834 0.003000 Linoleic acid 0.00004210.000150357
KCI 0.311825 4.157667 Lipoic acid 0.00010320.000500971
MgCl2 - Phenol Red 0.01 0.025125628
MgS04 0.09767 0.813917 Phosphorylethanolami0.0070550.05
ne
NaCI 6.8 117.241379Putrescine2HC10.0001610.001
NaHC03 2.2 26.190476Ribose 0.00025 0.001666667
NaH2P04HZO 0.07 0.507246 Sodium Acetate0.025 0.304878049
Na2P04 0.07102 0.500141 Sodium Pyruvate0.1101 1.000909091
ZnS047H20 0.000863 0.002997 Thymidine - -
Manganese TWEEN 80 0.01
Uracil - -
Xanthine Na
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
96
3. Proliferation
Cells may be induced to proliferate by initial infection with adenovirus or
adeno-
associated virus (AAV) comprising a gene that induces cellular proliferation,
the gene being
under the control of a promoter specific for the regulated secretory cell. The
cells may be
induced to proliferate by growth on a stimulatory cell matrix (Hayek et al..
1995).
4. In vivo Passage
A potential concern is that the studies of Hayek and associates (WO 95/29989)
have
indicated that as human islet cell growth is stimulated, insulin content can
fall rapidly. If this
same phenomenon occurs as ~i cell proliferation is stimulated by methods of
the present
invention, expression of the insulin promoter driven oncogene or of the
endogenous insulin
gene may also decline. The use of modified RIP promoters with enhanced
activity may
overcome this concern.
Alternatively, previous investigators have shown that the fall in insulin
content
experienced in replicating human islet cells can be partially restored by
transplantation of the
cells in athymic rodents (Neisor et al., 1979; Beattie et al., 1995).
Therefore, to complete the
transformation process, it may be necessary to expose the celis to the in vivo
environment.
Cell transplantation studies in nude rats are straightforward and in vivo
passage can
readily be included as a component of human ~3 cell line generation. The
transformed human
cells may be placed in vivo, e.g., under kidney capsule of the nude rat, to
allow outgrowth of
transformed cells. In addition to promoting maintenance of the tissue specific
expression of the
oncogene in the primary cells, the lack of an immune response in the nude rat
is known to allow
long term survival and expression of recombinant adenovirus infected cells
(Dai et al., 1995;
Yang et al.. 1994b).
H. DNA Delivery
In order for the neuroendocrine cell to be immortalized by the genetic
construct or to
stably express the secretory polypeptide to interest, the nucleic acid
encoding the genes may be
stably integrated into the genome of the cell. In yet further embodiments. the
nucleic acid may
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
97 -
be stably maintained in the cell as a separate, episomal segment of DNA. Such
nucleic' acid
segments or "episomes" encode sequences sufficient to permit maintenance and
replication
independent of, or in synchronization with the host cell cycle. How the
expression construct is
delivered to a cell and where in the cell the nucleic acid remains is
dependent on the type of
S expression construct employed. All expression constructs and delivery
methods are
contemplated for use in the context of the present invention, although certain
methods are
preferred, as outlined below.
1. Transfection
In order to effect expression of a gene construct, the expression construct
must be
delivered into a cell. As described below, the preferred mechanism for
delivery is via viral
infection, where the expression construct is encapsidated in an infectious
viral particle.
However, several non-viral methods for the transfer of expression constructs
into cultured
mammalian cells also are contemplated by the present invention. In one
embodiment of the
present invention, the expression construct may consist only of naked
recombinant DNA or
plasmids. Transfer of the construct may be performed by any of the methods
mentioned which
physically or chemically permeabilize the cell membrane.
a. Liposome-Mediated Transfection.
In a particular embodiment of the invention, the expression construct may be
entrapped
in a liposome. Liposomes are vesicular structures characterized by a
phospholipid bilayer
membrane and an inner aqueous medium. Multilamellar liposomes have multiple
lipid layers
separated by aqueous medium. They form spontaneously when phospholipids are
suspended in
an excess of aqueous solution. The lipid components undergo self rearrangement
before the
formation of closed structures and entrap water and dissolved solutes between
the lipid bilayers
(Ghosh and Bachhawat, 1991 ). Also contemplated is an expression construct
complexed with
Lipofectamine (Gibco BRL).
Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro
has
been very successful (Nicolau and Sene, 1982; Fraley et al.. 1979; Nicolau el
al.. 1987). Wong
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
98 -
et al., (1980) demonstrated the feasibility of liposome-mediated delivery and
expression of
foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
In certain embodiments of the invention, the liposome may be complexed with a
hemagglutinating virus (HVJ). This has been shown to facilitate fusion with
the cell membrane
and promote cell entry of liposome-encapsulated DNA (Kaneda et al., 1989). In
other
embodiments, the liposome may be complexed or employed in conjunction with
nuclear non-
histone chromosomal proteins (HMG-1 ) (Kato et al., 1991 ). In yet further
embodiments. the
liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
Melloul et al., (1993) demonstrated transfection of both rat and human islet
cells using
liposomes made from the cationic lipid DOTAP, and Gainer et al., (1996)
transfected mouse
islets using Lipofectamine-DNA complexes.
b. Electroporation
In certain other embodiments of the present invention, the expression
construct is
introduced into the cell via electroporation. Electroporation involves the
exposure of a
suspension of cells and DNA to a high-voltage electric discharge.
Transfection of eukaryotic cells using electroporation has been quite
successful. Mouse
pre-B lymphocytes have been transfected with human kappa-immunoglobulin genes
(Potter e/
al., 1984), and rat hepatocytes have been transfected with the chloramphenicol
acetyltransferase
gene (Tur-Kaspa et al., 1986) in this manner. Examples of electroporation of
islets include
Soldevila et al., (1991) and PCT application WO 91/09939.
c. Calcium Phosphate Precipitation or DEAF-Dextran Treatment.
In other embodiments of the present invention, the expression construct is
introduced to
the cells using calcium phosphate precipitation. Human KB cells have been
transfected with
adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique. Also in
this manner.
mouse L(A9), mouse C127, CHO, CV-l, BHK, NIH3T3 and HeLa cells were
transfected with
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
99 -
a neomycin marker gene (Chen and Okayama. 1987). and rat hepatocytes were
transfected with
a variety of marker genes (Rippe et ul.. 1990}.
In another embodiment, the expression construct is delivered into the cell
using DEAE-
dextran followed by polyethylene glycol. In this manner, reporter plasmids
were introduced
into mouse myeloma and erythroleukemia cells (Gopal, 1985).
d. Particle Bombardment
Another embodiment of the invention for transferring a naked DNA expression
construct into cells may involve particle bombardment. This method depends on
the ability to
accelerate DNA-coated microprojectiles to a high velocity allowing them to
pierce cell
membranes and enter cells without killing them (Klein et al., 1987). Several
devices for
accelerating small particles have been developed. One such device relies on a
high voltage
discharge to generate an electrical current, which in turn provides the motive
force (Yang et al.,
1990). The microprojectiles used have consisted of biologically inert
substances such as
tungsten or gold beads. Gainer et al., ( 1996) have transfected mouse islets
with a luciferase
gene/human immediate early promoter reporter construct, using ballistic
particles accelerated
by helium pressure.
e. Direct Microinjection or Sonication Loading.
Further embodiments of the present invention include the introduction of the
expression
construct by direct microinjection or sonication loading. Direct
microinjection has been used to
introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub,
1985), and
LTK- fibroblasts have been transfected with the thymidine kinase gene by
sonication loading
(Fechheimer et al., 1987).
f. Adenoviral Assisted Transfection.
In certain embodiments of the present invention, the expression construct is
introduced
into the cell using adenovirus assisted transfection. Increased transfection
efficiencies have
been reported in cell systems using adenovirus coupled systems (Kelleher and
Vos, 1994;
CA 02318379 2000-07-12
WO 99/35495 PCT/US99100551
100 -
Cotten e~ ul., 1992; Curiel, 1994). and the inventors contemplate using the
same technique to
increase transfection efficiencies into human islets.
g. Receptor Mediated Transfection.
Still further expression constructs that may be employed to deliver the tissue-
specific
promoter and transforming construct to the target cells are receptor-mediated
delivery vehicles.
These take advantage of the selective uptake of macromolecules by receptor-
mediated
endocytosis that will be occurring in the target cells. In view of the cell
type-specific
distribution of various receptors, this delivery method adds another degree of
specificity to the
present invention. Specific delivery in the context of another mammalian cell
type is described
by Wu and Wu (1993; incorporated herein by reference).
Certain receptor-mediated gene targeting vehicles comprise a cell receptor-
specific
ligand and a DNA-binding agent. Others comprise a cell receptor-specific
ligand to which the
DNA construct to be delivered has been operatively attached. Several ligands
have been used
for receptor-mediated gene transfer (Wu and Wu, 1987, 1988: Wagner et al.,
1990; Ferkol et
al., 1993; Perales et al., 1994; Myers, EPO 0273085), which establishes the
operability of the
technique. In the context of the present invention, the ligand will be chosen
to correspond to a
receptor specifically expressed on the neuroendocrine target cell population.
In other embodiments, the DNA delivery vehicle component of a cell-specific
gene
targeting vehicle may comprise a specific binding ligand in combination with a
liposome. The
nucleic acids to be delivered are housed within the liposome and the specific
binding ligand is
functionally incorporated into the liposome membrane. The liposome will thus
specifically
bind to the receptors of the target cell and deliver the contents to the cell.
Such systems have
been shown to be functional using systems in which, for example, epidermal
growth factor
(EGF) is used in the receptor-mediated delivery of a nucleic acid to cells
that exhibit
upregulation of the EGF receptor.
In still further embodiments, the DNA delivery vehicle component of the
targeted
delivery vehicles may be a liposome itself, which will preferably comprise one
or more lipids
CA 02318379 2000-07-12
WO 99/35495 PCT/tJS99/00551
101
or glycoproteins that direct cell-specific binding. For example, Nicolau et
ul.. ( 1987 ~ employed
lactosyl-ceramide, a galactose-terminal asialganglioside, incorporated into
liposomes and
observed an increase in the uptake of the insulin gene by hepatocytes. It is
contemplated that
the tissue-specific transforming constructs of the present invention can be
specifically delivered
into the target cells in a similar manner.
2. Vira! Infection
a. Adenovirallnfection.
One of the preferred methods for delivery of the transforming constructs
involves the
use of an adenovirus expression vector. Although adenovirus vectors are known
to have a low
capacity for integration into genomic DNA, this feature is counterbalanced by
the high
efficiency of gene transfer afforded by these vectors. "Adenovirus expression
vector" is meant
to include those constructs containing adenovirus sequences sufficient to (a)
support packaging
of the construct and (b) to ultimately express a tissue-specific transforming
construct that has
been cloned therein.
The expression vector comprises a genetically engineered form of adenovirus.
Knowledge of the genetic organization of adenovirus, a 36 kb, linear, double-
stranded DNA
virus, allows substitution of large pieces of adenoviral DNA with foreign
sequences up to 7 kb
(Grunhaus and Horwitz. 1992). In contrast to retrovirus, the adenoviral
infection of host cells
does not result in chromosomal integration because adenoviral DNA can
replicate in an
episomal manger without potential genotoxicity. Also, adenoviruses are
structurally stable, and
no genome rearrangement has been detected after extensive amplification.
Adenovirus is particularly suitable for use as a gene transfer vector because
of its mid-
sized genome, ease of manipulation, high titer, wide target-cell range and
high infectivity. Both
ends of the viral genome contain 100-200 base pair inverted repeats (ITRs),
which are cis
elements necessary for viral DNA replication and packaging. The early (E) and
late (L) regions
of the genome contain different transcription units that are divided by the
onset of viral DNA
replication. The E 1 region (E 1 A and E I B) encodes proteins responsible for
the regulation of
transcription of the viral genome and a few cellular genes. 'the expression of
the E2 region
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
102 -
(E2A and E2B) results in the synthesis of the proteins for viral DNA
replication. These
proteins are involved in DNA replication. late gene expression and host cell
shut-off (Renan,
1990). The products of the late genes, including the majority of the viral
capsid proteins. are
expressed only after significant processing of a single primary transcript
issued by the major
late promoter (MLP). The MLP, (located at 16.8 m.u.) is particularly efficient
during the late
phase of infection, and all the mRNA's issued from this promoter possess a 5'-
tripartite leader
(TPL) sequence which makes them preferred mRNA's for translation.
In a current system, recombinant adenovirus is generated from homologous
recombination between shuttle vector and provirus vector. Due to the possible
recombination
between two proviral vectors, wild-type adenovirus may be generated from this
process.
Therefore, it is critical to isolate a single clone of virus from an
individual plaque and examine
its genomic structure.
Generation and propagation of the current adenovirus vectors, which are
replication
deficient, depend on a helper cell line, designated 293, which was transformed
from human
embryonic kidney cells by Ad5 DNA fragments and constitutively expresses E1
proteins
(Graham et al., 1977). Since the E3 region is dispensable from the adenovirus
genome (Jones
and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells,
carry foreign DNA
in either the E1, the D3 or both regions (Graham and Prevec, 1991). In nature,
adenovirus can
package approximately 105% of the wild-type genome (Ghosh-Choudhury et al.,
1987).
providing capacity for about 2 extra kb of DNA. Combined with the
approximately 5.5 kb of
DNA that is replaceable in the E 1 and E3 regions, the maximum capacity of the
current
adenovirus vector is under 7.5 kb. or about 15% of the total length of the
vector. More than
80% of the adenovirus viral genome remains in the vector backbone.
Helper cell lines may be derived from human cells such as human embryonic
kidney
cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal
or epithelial
cells. Alternatively, the helper cells may be derived from the cells of other
mammalian species
that are permissive for human adenovirus. Such cells include, e.g.. Vero cells
or other monkey
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
103 -
embryonic mesenchymal or epithelial cells. As stated above, the preferred
helper cell line is
293.
Recently, Racher et al., (1995) disclosed improved methods for culturing 293
cells and
propagating adenovirus. In one format, natural cell aggregates are grown by
inoculating
individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge,
UK) containing 100-
200 rnl of medium. Following stirring at 40 rpm, the cell viability is
estimated with trypan
blue. In another format, Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (S
g/1) is employed
as follows. A cell inoculum, resuspended in 5 ml of medium, is added to the
earner (50 ml) in
a 250 ml Erlenmeyer flask and left stationary, with occasional agitation, for
1 to 4 h. The
medium is then replaced with 50 ml of fresh medium and shaking initiated. For
virus
production, cells are allowed to grow to about 80% confluence, after which
time the medium is
replaced (to 25% of the final volume) and adenovirus added at an MOI of 0.05.
Cultures are
left stationary overnight, following which the volume is increased to 100% and
shaking
commenced for another 72 h.
Other than the requirement that the adenovirus vector be replication
defective, or at least
conditionally defective, the nature of the adenovirus vector is not believed
to be crucial to the
successful practice of the invention. The adenovirus may be of any of the 42
different known
serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred
starting material
in order to obtain the conditional replication-defective adenovirus vector for
use in the present
invention. This is because Adenovirus type 5 is a human adenovirus about which
a great deal
of biochemical and genetic information is known, and it has historically been
used for most
constructions employing adenovirus as a vector.
As stated above, the typical vector according to the present invention is
replication
defective and will not have an adenovirus E 1 region. Thus, it will be most
convenient to
introduce the transforming construct at the position from which the E1-coding
sequences have
been removed. However, the position of insertion of the construct within the
adenovirus
sequences is not critical to the invention. The polynucleotide encoding the
gene of interest may
also be inserted in lieu of the deleted E3 region in E3 replacement vectors as
described by
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
104 -
Karlsson et al.. ( 1986) or in the E4 region where a helper cell line or
helper virus complements
the E4 defect.
Adenovirus growth and manipulation is known to those of skill in the art, and
exhibits
broad host range in vitro and in vivo. This group of viruses can be obtained
in high titers, e.g.,
109-10' ~ plaque-forming units per ml, and they are highly infective. The life
cycle of
adenovirus does not require integration into the host cell genome. The foreign
genes delivered
by adenovirus vectors are episomal and, therefore, have low genotoxicity to
host cells. No side
effects have been reported in studies of vaccination with wild-type adenovirus
(Couch et al.,
1963; Top et al., 1971 ), demonstrating their safety and therapeutic potential
as in vivo gene
transfer vectors.
Adenovirus vectors have been used in eukaryotic gene expression (Levrero et
al., 1991;
Gomez-Foix et al., 1992) and vaccine development (Grunhaus and Horwitz, 1992;
Graham and
Prevec. 1992). Recently, animal studies suggested that recombinant adenovirus
could be used
for gene therapy (Stratford-Perricaudet and Perricaudet, 1991: Stratford-
Perricaudet et al.,
1990; Rich et al., 1993). Studies in administering recombinant adenovirus to
different tissues
include trachea instillation (Rosenfeld et al., 1991; Rosenfeld et ul.. 1992),
muscle injection
(Ragot et crl.. 1993), peripheral intravenous injections (Herz and Gerard.
1993) and stereotactic
inoculation into the brain (Le Gal La Salle et al., 1993).
Recombinant adenovirus and adeno-associated virus (see below) can both infect
and
transduce non-dividing human primary cells. In fact, gene transfer
efficiencies of
approximately 70% for isolated rat islets have been demonstrated by the
inventors (Becker et
al., 1994a; Becker et al., 1994b; Becker et al., 1996) as well as by other
investigators (Gainer et
al.. 1996).
b. AAV Infection.
Adeno-associated virus (AAV) is an attractive vector system for use in the
human cell
transformation of the present invention as it has a high frequency of
integration and it can infect
nondividing cells, thus making it useful for delivery of genes into mammalian
cells in tissue
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
105 -
culture (Muzyczka. 199? j. AAV has a broad host range for infectivity
(Tratschin et crl.. 1984;
Laughlin, et ul., 1986: Lebkowski, et al., 1988; McLaughlin, et al., 1988),
which means it is
applicable for use with human neuroendocrine cells, however, the tissue-
specific promoter
aspect of the present invention will ensure specific expression of the
transforming construct.
S Details concerning the generation and use of rAAV vectors are described in
U.S. Patent No.
5,139,941 and U.S. Patent No. 4,797,368, each incorporated herein by
reference.
Studies demonstrating the use of AAV in gene delivery include LaFace et al.,
(1988);
Zhou et al., (1993); Flotte et al., (1993); and Walsh et al., (1994).
Recombinant AAV vectors
have been used successfully for in vitro and in vivo transduction of marker
genes (Kaplitt et al.,
1994; Lebkowski et ul.. 1988; Samulski et al., 1989; Shelling and Smith, 1994;
Yoder et al.,
1994; Zhou et al.. 1994: Hermonat and Muzyczka, 1984; Tratschin et al.. 198:
McLaughlin et
al., 1988) and genes involved in human diseases (Flotte et al., 1992; Luo et
ul.. 1994; Ohi, et
al., 1990; Walsh, et ul.. 1994; Wei, et al., 1994). Recently, an AAV vector
has been approved
for phase I human trials for the treatment of cystic fibrosis.
AAV is a dependent parvovirus in that it requires coinfection with another
virus (either
adenovirus or a member of the herpes virus family) to undergo a productive
infection in
cultured cells (Muzyczka. 1992). In the absence of coinfection with helper
virus, the wild type
AAV genome integrates through its ends into human chromosome 19 where it
resides in a
latent state as a provirus (Kotin et al., 1990; Samulski et al., 1991). rAAV.
however, is not
restricted to chromosome 19 for integration unless the AAV Rep protein is also
expressed
(Shelling and Smith, 1994). When a cell carrying an AAV provirus is
superinfected with a
helper virus, the AAV genome is "rescued" from the chromosome or from a
recombinant
plasmid, and a normal productive infection is established (Samulski, et al..
1989; McLaughlin,
et al., 1988; Kotin, et al.. 1990; Muzyczka, 1992).
Typically, recombinant AAV (rAAV) virus is made by cotransfecting a plasmid
containing the gene of interest flanked by the two AAV terminal repeats
(McLaughlin et al.,
1988; Samulski et al., 1989; each incorporated herein by reference) and an
expression plasmid
containing the wild type AAV coding sequences without the terminal repeats,
for example
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
106 -
pIM45 (McCarty et al., 1991; incorporated herein by reference). The cells are
also infected or
transfected with adenovirus or plasmids carrying the adenovirus genes required
for AAV helper
function. rAAV virus stocks made in such fashion are contaminated with
adenovirus which
must be physically separated from the rAAV particles (for example, by cesium
chloride density
centrifugation). Alternatively, adenovirus vectors containing the AAV coding
regions or cell
lines containing the AAV coding regions and some or all of the adenovirus
helper genes could
be used (Yang et al., 1994a; Clark et ul.. 1995). Cell lines carrying the rAAV
DNA as an
integrated provirus can also be used (Flotte et al., 1995).
The present invention contemplates infection of the target cells with a
recombinant
adeno-associated virus (AAV) containing an oncogene driven by a tissue
specific promoter.
Recombinant AAV plasmids with RIP driving T antigen have been constructed.
c. RetroviralInfection.
The retroviruses are a group of single-stranded RNA viruses characterized by
an ability
to convert their RNA to double-stranded DNA in infected cells by a process of
reverse-
transcription (Coffin, 1990). The resulting DNA then stably integrates into
cellular
chromosomes as a provirus and directs synthesis of viral proteins. The
integration results in the
retention of the viral gene sequences in the recipient cell and its
descendants. The retroviral
genome contains three genes, gag, pol, and env that code for capsid proteins,
polymerase
enzyme, and envelope components, respectively. A sequence found upstream from
the gag
gene contains a signal for packaging of the genome into virions. Two long
terminal repeat
(LTR) sequences are present at the 5' and 3' ends of the viral genome. These
contain strong
promoter and enhancer sequences and are also required for integration in the
host cell genome
(Coffin, 1990).
In order to construct a retroviral vector, a nucleic acid encoding a gene of
interest is
inserted into the viral genome in the place of certain viral sequences to
produce a virus that is
replication-defective. In order to produce virions, a packaging cell line
containing the gag, pol.
and env genes but without the LTR and packaging components is constructed
(Mann et al.,
1983). When a recombinant plasmid containing a cDNA, together with the
retroviral LTR and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
107 -
packaging sequences is introduced into this cell line (by calcium phosphate
precipitation for
example), the packaging sequence allows the RNA transcript of the recombinant
plasmid to be
packaged into viral particles, which are then secreted into the culture media
(Nicolas and
Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The media containing the
recombinant
retroviruses is then collected, optionally concentrated, and used for gene
transfer. Retroviral
vectors are able to infect a broad variety of cell types. However, integration
and stable
expression require the division of host cells (Paskind et al., 1975).
Concern with the use of defective retrovirus vectors is the potential
appearance of wild-
type replication-competent virus in the packaging cells. This can result from
recombination
events in which the intact sequence from the recombinant virus inserts
upstream from the gag,
pol, env sequence integrated in the host cell genome. However, new packaging
cell lines are
now available that should greatly decrease the likelihood of recombination
(Markowitz et al.,
1988; Hersdorffer et al., 1990).
d. Other Viral Vectors.
Other viral vectors may be employed as expression constructs in the present
invention.
Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal
and Sugden,
1986; Coupar et al., 1988) and herpesviruses may be employed. They offer
several attractive
features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988;
Baichwal and
Sugden, 1986; Coupar et al., 1988; Norwich et ul.. 1990).
With the recent recognition of defective hepatitis B viruses, new insight was
gained into
the structure-function relationship of different viral sequences. In vitro
studies showed that the
virus could retain the ability for helper-dependent packaging and reverse
transcription despite
the deletion of up to 80% of its genome (Norwich et al., 1990). This suggested
that large
portions of the genome could be replaced with foreign genetic material. Chang
et al., recently
introduced the chloramphenicol acetyltransferase (CAT) gene into duck
hepatitis B virus
genome in the place of the polymerase, surface. and pre-surface coding
sequences. It was
cotransfected with wild-type virus into an avian hepatoma cell line. Culture
media containing
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
108 -
high titers of the recombinant virus were used to infect primary duckling
hepatocytes. Stable
CAT gene expression was detected for at least 24 days after transfection
(Chang et al.. 1991 ).
In still further embodiments of the present invention. the nucleic acids to be
delivered
are housed within an infective virus that has been engineered to express a
specific binding
ligand. The virus particle will thus bind specifically to the cognate
receptors of the target cell
and deliver the contents to' the cell. A novel approach designed to allow
specific targeting of
retrovirus vectors was recently developed based on the chemical modification
of a retrovirus by
the chemical addition of lactose residues to the viral envelope. This
modification can permit
the specific infection of hepatocytes via sialoglycoprotein receptors.
Another approach to targeting of recombinant retroviruses was designed in
which
biotinylated antibodies against a retroviral envelope protein and against a
specific cell receptor
were used. The antibodies were coupled via the biotin components by using
streptavidin (Roux
et al.. 1989). Using antibodies against major histocompatibility complex class
I and class II
antigens, they demonstrated the infection of a variety of human cells that
bore those surface
antigens with an ecotropic virus in vitro (Roux et al., 1989).
3. Multiple Viral Infection
A further alternative for practicing the present invention is to use
adenovirus or AAV
infection of primary cells leading to in vitro expansion of a primary cell
population that is then
amenable to stable oncogene transfer by methods requiring cell growth such as
retroviral
transduction, plasmid transfection of expanding cells (Lipofectin or
electroporation), or a
second round of Adenovirus and/or AAV infection.
Another embodiment of the invention is to use alternating AAV and adenovirus
infections. Propagation of AAV is dependent upon adenovirus. and using both
viruses may
lead to more productive infections. Such a method may increase the number of
final cells that
have oncogenes integrated and expressed.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
109 -
Multiple, sequential viral infections may allow one of skill in the art to
exploit the
benefits of various viral delivery systems and avoid their limitations. For
example. a limitation
of adenoviral gene delivery is that this system affords a very low rate of
integration of viral and
recombinant DNAs into the host cell genome. Consequently, adenoviral gene
expression is
diluted when the cells divide and typically is used only for transient gene
expression. An
advantage that adenoviral gene delivery has over many other viral vectors is
that entry of the
virus into the cell and the expression of transgenic proteins is not dependent
on cellular
replication. This benefit of adenoviral gene delivery is in contrast to
retroviruses where the
integration and sustained expression of virally introduced DNA is dependent on
cellular
replication.
The coupling of these two viral systems for tire transformation of primary
tissues
minimizes the limitations of each and maximally exploits their distinct
biological properties.
For example, primary human pancreatic (3-cells typically do not divide in
culture and are
thereby resistant to transformation by immortalizing gene constructs delivered
by retroviruses.
However, human ~3-cells can be infected with adenovirus for the purposes of
transgenic protein
expression.
In a preferred embodiment, human ~i-cells or pancreatic islets would first be
infected
with a recombinant adenovirus that provides for the expression of a growth-
promoting protein
to stimulate cellular division. Cellular replication could be monitored by
measuring thymidine
incorporation or other techniques that have been developed to monitor DNA
replication. In
addition or alternatively, dividing cells could be enriched by FACS. Following
the stimulation
of cellular replication (about 12-96 hours following adenoviral infection).
cells could be
successfully infected with a recombinant retrovirus that has been en~,ineered
to express
immortalizing gene products. The genomic DNA of a dividing cell population
will be
susceptible to stable integration by retrovirus and expression of recombinant
proteins. This
system of sequential and varied viral infections could further be optimized by
the use of tissue-
specific promoters for transgene expression in designated cell types and the
expression of
antibiotic resistance markers to selectively enrich for virally infected
cell,.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
110 -
I. Glucose-Responsive Insulin Secretion
Glucose responsiveness is an important parameter in the neuroendocrine cell
lines of the
present invention. Immortal RIN cells have been shown to lose glucose
responsiveness over
time. The glucose-responsiveness can be re-engineered into a stable cell that
secretes insulin
but in which the glucose-response has been lost, diminished or shifted.
The basis for engineering the stable cells to produce a cell with glucose-
regulated
insulin secretion is disclosed in U.S. Patent 5,427,940, incorporated herein
by reference. U.S.
Patent 5,427,940 discloses islet and non-islet cell lines of neuroendocrine
origin which are
engineered for insulin e~cpression and glucose regulation. First, even the
insulin gene can be
supplied to such an engineered cell and, although this will nat be required in
many aspects of
the present invention, it is also contemplated.
The basis for such engineering originated in part with studies using AtT-20
cells. which
are derived from ACTN secreting cells of the anterior pituitary. It has been
demonstrated that
stable transfection of AtT-20 cells with a construct in which a viral promoter
is used to direct
expression of the human proinsulin cDNA results in cell lines that secrete the
correctly
processed and mature insulin polypeptide (Moore et al., 1983). Insulin
secretion from such
lines (generally termed AtT-20ins) can be stimulated by agents such as
forskolin or dibutyryl
cAMP, with the major secreted product in the form of mature insulin. These
results suggest
that these cells contain a regulated secretory pathway that is similar to that
operative in the islet
~i-cell (Moore et al., 1983, Gross et al., 1989). More recently; it has become
clear that the
endopeptidases that process proinsulin to insulin in the islet (3-cell, termed
PC2 and PC3, are
also expressed in AtT-20ins cells (Smeekens and Steiner, 1990, Hakes et al.,
1991 ).
1. GLUT-2 and Glucokinase
AtT-20ins cells do not respond to glucose as a secretagogue (Hughes et crl.,
1991 ).
Interestingly, AtT-20 cells express the glucokinase gene (Hughes et al., 1991,
Liang et al.,
1991) and at least in some lines, low levels of glucokinase activity (Hughes
et al.. 1991: 1992;
Quaade et al., 1991 ), but are completely lacking in GLUT-2 expression (Hughes
et al.. 1991;
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
111 -
1992). Stable transfection of these cells with GLUT-2. but not the related
transporter GLUT-l,
confers glucose-stimulated insulin secretion (U.S. Patent 5,427,940; Hughes et
al., 1992, 1993).
The studies with AtT-20ins cells are important because they demonstrate that
neuroendocrine cell lines that lack glucose-stimulated peptide release may be
engineered for
this function. Therefore, once a stable human neuroendocrine cell that has a
regulated secretory
pathway has been generated by the present invention, certain elements of the
responsiveness
can be reengineered into the stable cell. In contrast, the "regulated
secretory pathway",
including the secretory granules, endopeptidases and post-translational
modification enzymes,
cannot be reengineered into a cell lacking such a pathway.
One of the present inventors has previously shown that GLUT-2 and glucokinase
work
in tandem as the "glucose sensing apparatus" of the (3-cell (U.S. Fatent
5,427,940). U.S. Patent
5,427,940, incorporated herein by reference. describes methods for conferring
glucose sensing
in neuroendocrine cells and cell lines by transfection of such cells with one
or more genes
selected from the insulin gene, the glucokinase gene and the GLUT-2 glucose
transporter gene,
so as to provide an engineered cell having all three of these genes. The
glucokinase and
GLUT-2 genes are thus preferred for use in re-engineering stable human cells.
U.S. Patent 5,427,940 discloses that three functional genes are required to
give glucose-
responsive insulin secreting capacity to a cell: an insulin gene, a GLUT 2
glucose transporter
gene and a glucokinase gene. In the practice of the re-engineering aspects of
the present
invention, therefore, it may be that only one of these three genes needs to
additionally supplied,
expressed or overexpressed.
Thus, if the stable human cell produces and expresses a reasonable level of
insulin, but
in a non-regulated manner, the provision of either or both of a functional
glucokinase gene and
a GLUT-2 gene will be desired. One of ordinary skill in the art will be
readily able to test the
levels of glucokinase and GLUT-2 expression, either by molecular biological
hybridization or
biochemical activity assays, in order to determine which one or both of such
enzymes is not
sufficiently expressed or active and should therefore be supplied in
recombinant form. If the
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
112 -
stable cell does not express either of the aforementioned genes in a
functional fashion, or at
physiological levels, it will be preferred to introduce both genes. In re-
engineering glucose-
responsiveness using GLUT-2 and/or glucokinase the constructs of GenBank
accession
numbers J03145 and M25807, respectively, may be used. In other embodiments,
even the
insulin gene could be re-engineered and overexpressed in a stable cell of the
invention.
2. Hexokinase Reduction
In studies in which the stable transfection of AtT-20ins cells with GLUT-2,
but not
GLUT-1, conferred glucose-stimulated insulin secretion. this was achieved with
maximal
responsiveness at subphysiological glucose levels. The inventor reasoned that
this was likely
due to a non-optimal hexokinase:glucokinase ratio (U.S. Patent 5,427,940).
In re-engineering glucose-responsiveness, the stable cells of the invention
may be
modified to any degree such that they have a reduced a low Km hexokinase
activity relative to
the stable parent cell from which the re-engineered cell was prepared.
Depending on the
intended use of the cells, cells in which a moderate hexokinase inhibition is
achieved will have
utility. Such inhibition levels are contemplated to be those in which the low
Km hexokinase
activity is reduced by at least about 5%, about 10%. about 15%, about 20%, or
about 25%
relative to control levels.
Re-engineered cells exhibiting more significant inhibition are also
contemplated within
the invention. Accordingly, cells in which the low Km hexokinase activity is
reduced by about
30%, about 40%, about SO%, about 60% or even about 70% or higher, with respect
to control
levels, are contemplated as part of this invention and will be preferred in
certain embodiments.
In embodiments of re-engineering a stable cell to secrete insulin in response
to glucose,
other parameters may be applied in assessing useful levels of low Km
hexokinase inhibition.
For example, it may be desired to determine the ratio of glucokinase to
hexokinase (GK:HK
ratio) and to monitor changes in this ratio as hexokinase is inhibited. It
will be understood that
a cell in which this ratio is changed to reflect the ratio commonly observed
in functional or
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
11J -
natural pancreatic ~i-cells, or in which the ratio is changed towards this.
will be an
advantageous engineered cell in the context of this invention.
In certain preferred embodiments, it is contemplated that cells of this
invention will
have a low K,t, hexokinase activity that has been reduced to a level
appropriate to confer more
physiological insulin secretion capacity to the cell. This includes re-
engineered cells that have
a near-homeostatic insulin secretion capacity.
"Engineered cells that exhibit more physiological insulin secretion" are cells
that exhibit
glucose-stimulated insulin secretion (GSIS} closer to the normal range than
the parent stable
cell from which they were prepared. In this regard, the maximal glucose
response of previously
described cell lines generally occurs at subphysiological glucose
concentrations of between
about 10 mM and about 100 mM.
The GSIS of normal islet ~i-cells generally occurs at glucose concentrations
of between
about 3 mM to 20 mM, with ranges of 5 to 20 mM and 4 to 9 mM being frequently
reported.
Insulin responses in these ranges would therefore be described as "near-
homeostatic insulin
secretion." Cells that comprise an inhibitor in an amount effective to reduce
the low Km
hexokinase activity of the cell to a level sufficient to confer insulin
secretion in response to an
extracellular glucose concentration of between about 1 mM and about 20 mM will
thus be most
preferred. Extracellular glucose concentrations of "between about 1 mM and
about 20 mM "
will be understood to include each and every numerical value within this
range, such as being
about 1, 2. 3, 4. 5, 7.5, 10, 12, 14, 16, 18, and about 20 mM or so.
To re-engineer the ratios of glucokinase to hexokinase by inhibiting
hexokinase, and
thus to render the glucose-responsive insulin secretion more physiological,
any one of a variety
of methods may be employed, including blocking of expression of the gene in
the stable human
cells and/or inhibiting or reducing the activity of any protein produced. In
creating molecular
biological tools to effect these methods, the hexokinase gene construct of
GenBank accession
number J04526 may be utilized.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
114 -
In molecular approaches suitable for reducing hexokinase activity via
inhibiting gene
expression, constructs can be designed to introduce nucleic acids
complementary to a target
endogenous gene, i. e. , an antisense approach. Expression of RNAs
corresponding to these
complementary nucleic acids will interfere with the transcription and/or
translation of the target
sequences. Inhibitory constructs can still further be designed to homologously
recombine into
the hexokinase endogenous gene locus, rendering the endogenous gene
nonfunctional, i.e., a
knock-out approach. Genetic constructs may also be designed to introduce
nucleic acids
encoding ribozymes, RNA-cleaving enzymes, that will specifically cleave the
target hexokinase
mRNA. In other embodiments, the hexokinase activity may be abrogated by
constructs
designed to randomly integrate throughout the genome, resulting in loss of
expression of the
endogenous hexokinase gene. Further, the endogenous gene can be rendered
dysfunctional by
genomic site directed mutagenesis. These methods for blocking hexokinase
production are well
known to those of skill in the art. By way of example, WO publication numbers
WO 97/26334
(published July 24, 1997) and WO 97/26321 (published July 24, 1997) describe
these
methodologies and are specifically incorporated herein by reference.
J. Screening For Modulators Of Secretion
The immortalized secretory cell lines described by the present invention have
been
shown to have a stable neuroendocrine phenotype. They are capable of providing
a measurable
secretion of the secretory product. Furthermore, they have been shown to be
secretagogue
responsive, thereby showing that these cell lines respond to modulators of
secretory function.
Therefore, within certain embodiments of the invention, methods are provided
for screening for
modulators of secretory function. Such methods may use the cells of the
present invention
either as adherent cells on a culture dish, as part of an alginate biomatrix,
in suspension culture
or in any other form that permits the secretion of the polypeptide to be
monitored. These cells
are then used as reagents to screen small molecule and peptide libraries to
identify modulators
of secretory function.
Secretory function embodies all aspects of the cell's capacity to sense the
extracellular
milieu, respond to that milieu via the activation and inhibition of a variety
of intracellular
signaling mechanisms, and accordingly regulate the secretion of a peptide or
hormone from the
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
115 -
secretory pathway. Such intracellular signals may include. but are not limited
to, calcium ions.
cAMP, calmodulin, phosphorylation, dephosphorylation, membrane polarization,
glucose. pH.
ATP, ADP, fatty acid pools such as free fatty acids and triglycerides, nitrous
oxide and other
free radicals, action potentials, glycolytic flux, DNA fragmentation and other
events associated
with apoptosis, patterns of gene expression, NADPH, NADP, NADH, NAD and enzyme
activities.
Regulation from the secretory pathway can occur at any phase in the synthesis
and
release of a peptide or hormone including gene transcription; stability of the
mRNA;
translation; post-translational modifications such as proteolytic processing,
formation of
disulfide bonds, amidation, and glycosylation; trafficking through the
secretory tubules and
vesicles; storage within the secretory granule; membrane fusions, and
exocytosis. In particular
embodiments, the secretory function may be manifest as the secretion of a
particular
polypeptide from a secretory cell.
The polypeptide is generally secreted into the media of the cells, from where
it can be
quantified using any of a number of techniques. The polypeptide may be
detected directly from
the media using for example, ELISA, RIA and the like. Alternatively, the
polypeptide may be
purified prior to detection according to known methods, such as precipitation
(e.g., ammonium
sulfate), HPLC, immunoprecipitation, ion exchange chromatography, affinity
chromatography
(including immunoaffinity chromatography) or various size separations
(sedimentation, gel
electrophoresis, gel filtration). Such techniques of polypeptide separation
are well known to
those of skill in the art. The purified polypeptide may then quantified
through
immunodetection methods, biological activity, or radioisotope labeling. These
techniques are
described herein below.
1. Assay Formats
a. Stimulators of Secretory Function
The present invention provides methods of screening for stimulators of
secretory
function, by monitoring secretory function in the absence of the candidate
substance and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
116 -
comparing such results to the assay performed in the presence of candidate
secretory function
stimulators.
In certain embodiments, the present invention concerns a method for
identifying such
S stimulators. It is contemplated that this screening technique will prove
useful in the general
identification of a compound that will serve the purpose of promoting,
augmenting or
increasing the secretion of, for example, a polypeptide from a secretory cell
as exemplified by
the immortalized secretory cells of the present invention. Such compounds will
be useful in the
treatment of various secretory disorders resulting from impaired secretory
function, such as for
example, diabetes, Parkinson's disease, athyrotic cretinism and Adison's
disease.
In these embodiments, the present invention is directed to a method for
determining the
ability of a candidate substance to stimulate the secretory function of
immortalized cells that
either naturally secrete molecules or have been engineered to possess
secretory function as
described herein. The method including generally the steps of-.
(a) providing at least one immortalized cell having stable secretory function;
(b) contacting said cell with said candidate substance;
(c) measuring the secretory function of said cell: and
(d) comparing the secretory function of the cell in step (c) with the
secretory
function of the cell of step (a).
To identify a candidate substance as being capable of stimulating secretory
function in
the assay above, one would measure or determine the secretory function in the
absence of the
added candidate substance by determining the secretion of the desired
molecule. One would
then add the candidate substance to the cell and determine the secretory
function in the presence
of the candidate substance. A candidate substance which increases the
secretory function or
capacity relative to the secretory function in its absence, is indicative of a
candidate substance
with stimulatory capability.
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
117 -
Secretory function may be determined by measuring the amount of secreted
molecule.
In particular embodiments, the secreted molecule will be a polypeptide such as
an amidated
polypeptide, glycosylated polypeptide, a hormone or a growth factor. In such
circumstances
these molecules may be detected using any of a number of techniques well known
to those of
skill in the art as described herein below. Secretory function may also be
monitored by
measuring, for example, calcium ions, cAMP, calmodulin. phosphorylation,
dephosphorylation,
membrane polarization glucose, ATP, ADP, fatty acids and NADPH or membrane
potential.
Detection of these molecules can be performed using immunreactive detection,
fluorescence
luminescence, changes in action potential and the like.
b. Inhibitors of Secretory Function
These assays may be set up in much the same manner as those described above in
assays for secretory function stimulators. In these embodiments, the present
invention is
directed to a method for determining the ability of a candidate substance to
have an inhibitory
or even antagonistic effect on secretion from the immortalized cells described
herein. The
method including generally the steps of-.
(a) providing at least one immortalized cell having secretory function;
(b) contacting said cell with said candidate substance:
(c) measuring the secretory function of said cell; and
(d) comparing the secretory function of the cell in step (c) with the
secretory
function of the cell of step (a).
To identify a candidate substance as being capable of inhibiting secretory
function one
would measure or determine such a secretory activity in the absence of the
added candidate
substance and monitoring the secretory function. One would then add the
candidate inhibitory
substance to the cell and determine the secretory function in the presence of
the candidate
inhibitory substance. A candidate substance which is inhibitory would decrease
the secretion
from said cell, relative to the amount of secretion in its absence.
CA 02318379 2000-07-12
WO 99/35495 PCTIUS99I00551
118 -
c. Candidate Substances
As used herein the term "candidate substance" refers to any molecule that is
capable of
modulating secretory function. The candidate substance may be a protein or
fragment thereof, a
small molecule inhibitor, or even a nucleic acid molecule. It may prove to be
the case that the
most useful pharmacological compounds for identification through application
of the
screening assay will be compounds that are structurally related to other known
modulators of
secretion. The active compounds may include fragments or parts of naturally-
occurring
compounds or may be only found as active combinations of known compounds which
are
otherwise inactive. However, prior to testing of such compounds in humans or
animal
models, it will be necessary to test a variety of candidates to determine
which have potential.
Accordingly. the active compounds may include .fragments or parts of naturally-
occurring compounds or may be found as active combinations of known compounds
which are
otherwise inactive. Accordingly, the present invention provides screening
assays to identify
agents which stimulate or inhibit cellular secretion, it is proposed that
compounds isolated from
natural sources. such as animals, bacteria, fungi, plant sources, including
leaves and bark, and
marine samples may be assayed as candidates for the presence of potentially
useful
pharmaceutical agents. It will be understood that the pharmaceutical agents to
be screened
could also be derived or synthesized from chemical compositions or man-made
compounds.
Thus, it is understood that the candidate substance identified by the present
invention may be
polypeptide, polynucleotide, small molecule inhibitors or any other compounds
that may be
designed through rational drug design starting from known secretagogues or
inhibitors of
secretory function.
The candidate screening assays are simple to set up and perform. Thus, in
assaying for
a candidate substance, after obtaining an immortalized secretory cell of the
present invention,
one will admix a candidate substance with the cell, under conditions which
would allow
measurable secretion to occur. In this fashion, one can measure the ability of
the candidate
substance to stimulate the secretory function of the cell in the absence of
the candidate
substance. Likewise. in assays for inhibitors after obtaining an immortalized
secretory cell, the
candidate substance is admixed with the cell. In this fashion the ability of
the candidate
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
119 -
inhibitory substance to reduce, abolish, or otherwise diminish secretion from
said cell may be
detected.
"Effective amounts" in certain circumstances are those amounts effective to
reproducibly stimulate secretion from the cell in comparison to their normal
levels.
Compounds that achieve significant appropriate changes in activity will be
used.
Significant increase in secretory function, e.g., as measured using RIA, HPLC,
ELISA,
biological activity and the like are represented by an increase/decrease in
secretion of at least
about 30%-40%, and most preferably, by increases of at least about 50%, with
higher values of
course being possible. The active compounds of the present invention also may
be used for the
generation of antibodies which may then be used in analytical and preparatory
techniques for
detecting and quantifying further such inhibitors.
1 S It will, of course, be understood that all the screening methods of the
present invention
are useful in themselves notwithstanding the fact that effective candidates
may not be found.
The invention provides methods for screening for such candidates, not solely
methods of
finding them.
2. Purification of Secreted Products
Purification techniques are well known to those of skill in the art, and will
be used to
purify the molecules secreted from the immortalized secretory cells of the
present invention.
These techniques tend to involve the separation the secreted protein or other
secretory molecule
from other components of the mixture. Having separated the secreted product
from the other
components, the sample may be purified using chromatographic and
electrophoretic techniques
to achieve complete purification. Analytical methods particularly suited to
the preparation of a
pure peptide are ion-exchange chromatography, exclusion chromatography;
polyacrylamide gel
electrophoresis; isolectric focusing. A particularly efficient method of
purifying peptides is fast
protein liquid chromatography or even HPLC.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
120 -
In certain aspects, the secreted molecule is a polypeptide and may be isolated
from the
conditioned media and analyzing the extracts by HPLC as described (Halban et
al., 1986,
Sizonenko and Halban, 1991 ). Solvent systems, gradients and flow rates used
were as
described by Halban et al., (1986) however it is well within the skill of the
ordinary person ion
S the art to adapt the chromatography conditions to suit individual need.
Standards may be used
to obtain optimization of chromatography conditions and methods.
Certain aspects of the presem invention concern the purification, and in
particular
embodiments, the substantial purification, of a secreted product. The term
"purified" as used
herein, is intended to refer to a composition, isolatable from other
components, wherein the
product is purified to any degree relative to its naturally-obtainable state,
i.e., in this case,
relative to its purity within a hepatocyte or ~i-cell extract. A purified
protein or peptide
therefore also refers to a protein or peptide, free from the environment in
which it may naturally
occur.
Generally, "purified" will refer to a protein or peptide composition that has
been
subjected to fractionation to remove various other components, and which
composition
substantially retains its expressed biological activity. Where the term
"substantially purified" is
used, this designation will refer to a composition in which the protein or
peptide forms the
major component of the composition, such as constituting about 50% or more of
the proteins in
the composition.
Various methods for quantifying the degree of purification of the protein or
peptide will
be known to those of skill in the art in light of the present disclosure.
These include, for
example, determining the specific activity of an active fraction, or assessing
the number of
polypeptides within a fraction by SDS/PAGE analysis. A preferred method for
assessing the
purity of a fraction is to calculate the specific activity of the fraction, to
compare it to the
specific activity of the initial extract, and to thus calculate the degree of
purity, herein assessed
by a "-fold purification number". The actual units used to represent the
amount of activity will,
of course, be dependent upon the particular assay technique chosen to follow
the purification
and whether or not the expressed protein or peptide exhibits a detectable
activity.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
121 -
Various techniques suitable for use in protein purification will be well known
to those
of skill in the art. These include, for example, precipitation with ammonium
sulphate, PEG,
antibodies and the like or by heat denaturation, followed by centrifugation;
chromatography
steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite and
affinity
chromatography; isoelectric focusing; gel electrophoresis; and combinations of
such and other
techniques. As is generally known in the art, it is believed that the order of
conducting the
various purification steps may be changed, or that certain steps may be
omitted, and still result
in a suitable method for the preparation of a substantially purified protein
or peptide.
There is no general requirement that the protein or peptide always be provided
in their
most purified state. Indeed, it is contemplated that less substantially
purified products will have
utility in certain embodiments. Partial purification may be accomplished by
using fewer
purification steps in combination, or by utilizing different forms of the same
general
purification scheme. For example, it is appreciated that a cation-exchange
column
chromatography performed utilizing an HPLC apparatus will generally result in
a greater -fold
purification than the same technique utilizing a low pressure chromatography
system. Methods
exhibiting a lower degree of relative purification may have advantages in
total recovery of
protein product, or in maintaining the activity of an expressed protein.
It is known that the migration of a polypeptide can vary, sometimes
significantly, with
different conditions of SDS/PAGE (Capaldi et al.. 1977). It will therefore be
appreciated that
under differing electrophoresis conditions, the apparent molecular weights of
purified or
partially purif ed expression products may vary.
High Performance Liquid Chromatography (HPLC) is characterized by a very rapid
separation with extraordinary resolution of peaks. This is achieved by the use
of very fine
particles and high pressure to maintain and adequate flow rate. Separation can
be accomplished
in a matter of minutes, or a most an hour. Moreover, only a very small volume
of the sample is
needed because the particles are so small and close-packed that the void
volume is a very small
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
122 -
fraction of the bed volume. Also, the concentration of the sample need not be
very great
because the bands are so narrow that there is very little dilution of the
sample.
Gel chromatography, or molecular sieve chromatography. is a special type of
partition
chromatography that is based on molecular size. The theory behind gel
chromatography is that
the column, which is prepared with tiny particles of an inert substance that
contain small pores,
separates larger molecules from smaller molecules as they pass through or
around the pores,
depending on their size. As long as the material of which the particles are
made does not
adsorb the molecules, the sole factor determining rate of flow is the size.
Hence, molecules are
eluted from the column in decreasing size, so long as the shape is relatively
constant. Gel
chromatography is unsurpassed for separating molecules of different size
because separation is
independent of all other factors such as pH, ionic strength. temperature, etc.
There also is
virtually no adsorption, less zone spreading and the elution volume is related
in a simple matter
to molecular weight.
Affinity Chromatography is a chromatographic procedure that relies on the
specific
affinity between a substance to be isolated and a molecule that it can
specifically bind to. This
is a receptor-ligand type interaction. The column material is synthesized by
covalently
coupling one of the binding partners to an insoluble matrix. The column
material is then able to
specifically adsorb the substance from the solution. Elution occurs by
changing the conditions
to those in which binding will not occur (alter pH, ionic strength,
temperature, etc. ).
A particular type of affinity chromatography useful in the purification of
carbohydrate
containing compounds is lectin affinity chromatography. Lectins are a class of
substances that
bind to a variety of polysaccharides and glycoproteins. Lectins are usually
coupled to agarose
by cyanogen bromide. Conconavalin A coupled to Sepharose was the first
material of this sort
to be used and has been widely used in the isolation of polysaccharides and
glycoproteins other
lectins that have been include lentil lectin, wheat germ agglutinin which has
been useful in the
purification of N-acetyl glucosaminyl residues and Helix pomatia lectin.
Lectins themselves
are purified using affinity chromatography with carbohydrate ligands. Lactose
has been used to
purify lectins from castor bean and peanuts; maltose has been useful in
extracting lectins from
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
123 -
lentils and jack bean: N-acetyl-D galactosamine is used for purifying lectins
from soybean; N-
acetyl glucosaminyl binds to lectins from wheat germ; D-galactosamine has been
used in
obtaining lectins from clams and L-fucose will bind to lectins from lotus.
S The matrix should be a substance that itself does not adsorb molecules to
any significant
extent and that has a broad range of chemical, physical and thermal stability.
The ligand should
be coupled in such a way as to not affect its binding properties. The ligand
should also provide
relatively tight binding. And it should be possible to elute the substance
without destroying the
sample or the ligand. One of the most common forms of affinity chromatography
is
immunoaffinity chromatography. The generation of antibodies that would be
suitable for use in
accord with the present invention is discussed below.
3. Methods of Detection
The present invention encompasses methods for determining the effects of
active
compounds on the secretory function of the immortalized secretory cells of the
present
invention. Generally, this wilt be achieved by determining the secretion of,
for example a
secretory polypeptide, of the immortalized secretory cell in the presence of
the active
compounds and comparing the level of secretion with those levels observed in
normal cells of
the same type. In this manner the secretory function of the immortalized
secretory cells may be
quantitated.
The immunodetection methods of the present invention have evident utility in
the
detecting polypeptide secretion. Here, a sample containing the secreted moiety
is contacted
with a corresponding antibody. Thus, in an exemplary assay, a modulator
screening assay is
performed in which cells secreting a polypeptide are exposed to a test or
candidate substance
under suitable conditions and for a time sufficient to permit the agent to
effect secretion of the
polypeptide. The secretion of the polypeptide is then detected by incubating
the reaction
mixture with for example a specific antibody, which antibody may be labeled
directly or may
be detected secondarily. (o.g., using a labeled idiotypic or species specific
antibody) under
conditions that permit the formation of immune complexes between the
polypeptide and its
specific antibody. The test reaction is compared to a control reaction which
lacks the test
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
124 -
sample. To complete the modulator screening assay, the presence and/or amount
of complexes
formed between the polypeptide and the antibody is detected in the test sample
(e.g. by
determining the presence or amount of label bound directly to the antibody or
to a secondary
antibody directed against the primary antibody). Within this exemplary assay,
agents that
inhibit polypeptide secretion will demonstrate a reduced binding with
polypeptide-specific
antibodies relative to the control sample and agents that induce or stimulate
polypeptide
secretion will demonstrate an increased binding with specific antibodies
relative to the control
sample.
Those of skill in the art are very familiar with differentiating between
significant
secretion of a protein, which represents a positive identification, and low
level or background
secretion of such a protein.
a. Immunodetection Methods
In still further embodiments. the present invention concerns immunodetection
methods
for binding, purifying, removing. quantifying or otherwise generally detecting
biological the
secreted components. The steps of various useful immunodetection methods have
been
described in the scientific literature and are well known to those of skill in
the art.
In general, the immunobinding methods include obtaining a sample suspected of
containing a compound of interest (i.e. the secreted molecule), and contacting
the sample with
an antibody under conditions effective to allow the formation of
immunocomplexes.
The immunobinding methods include methods for detecting or quantifying the
amount
of a reactive component in a sample, which methods require the detection or
quantitation of any
immune complexes formed during the binding process. Here, one would obtain a
sample to be
measured as containing a secreted molecule, and contact the sample with an
antibody or
encoded protein or peptide, as the case may be, and then detect or quantify
the amount of
immune complexes formed under the specific conditions.
In terms of detection. the biological sample analyzed may be any sample that
is
suspected of containing a secreted molecule from the immortalized, secretory
cells of the
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
125 -
present invention. Such a cell may be an immortalized neuroendocrine cell, an
immortalized
pancreatic ~i-cell, or even any biological fluid that comes into contact with
the secretory cells in
vivo.
Contacting the chosen sample with the antibody under conditions effective and
for a
period of time sufficient to allow the formation of immune complexes (primary
immune
complexes) is generally a matter of simply adding the composition to the
sample and incubating
the mixture for a period of time long enough for the antibodies to form immune
complexes
with, i.e., to bind to, any antigens present. After this time, the sample-
antibody composition,
such as a tissue section, ELISA plate, dot blot or western blot, will
generally be washed to
remove any non-specifically bound antibody species, allowing only those
antibodies
specifically bound within the primary immune complexes to be detected.
In general, the detection of immunocomplex formation is well known in the art
and may
be achieved through the application of numerous approaches. These methods are
generally
based upon the detection of a label or marker, such as any radioactive,
fluorescent, biological or
enzymatic tags or labels of standard use in the art. U.S. Patents concerning
the use of such
labels include 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437;
4,275,149 and
4,366,241, each incorporated herein by reference. Of course, one may find
additional
advantages through the use of a secondary binding ligand such as a second
antibody or a
biotin/avidin ligand binding arrangement, as is known in the art.
The secreted protein, peptide or corresponding antibody employed in the
detection may
itself be linked to a detectable label, wherein one would then simply detect
this label, thereby
allowing the amount of the primary immune complexes in the composition to be
determined.
Alternatively, the first added component that becomes bound within the primary
immune complexes may be detected by means of a second binding ligand that has
binding
affinity for the encoded protein, peptide or corresponding antibody. In these
cases, the second
binding ligand may be linked to a detectable label. The second binding ligand
is itself often an
antibody, which may thus be termed a "secondary" antibody. The primary immune
complexes
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
126
are contacted with the labeled. secondary binding ligand. or antibody. under
conditions
effective and for a period of time sufficient to allow the formation of
secondary immune
complexes. The secondary immune complexes are then generally washed to remove
any non-
specifically bound labeled secondary antibodies or ligands. and the remaining
label in the
secondary immune complexes is then detected.
Further methods include the detection of primary immune complexes by a two
step
approach. A second binding ligand, such as an antibody. that has binding
affinity for the
encoded protein, peptide or corresponding antibody is used to form secondary
immune
complexes. as described above. After washing, the secondary immune complexes
are contacted
with a third binding ligand or antibody that has binding affinity for the
second antibody, again
under conditions effective and for a period of time sufficient to allow the
formation of immune
complexes (tertiary immune complexes). The third ligand or antibody is linked
to a detectable
label, allowing detection of the tertiary immune complexes thus formed. This
system may
provide for signal amplification if desired.
b. ELISA
It is contemplated that the secreted proteins or peptides of the invention
will be detected
in a preferred embodiment in ELISA assays. Antibodies against such secreted
proteins are
readily available to those of skill in the art.
Immunoassays, in their most simple and direct sense. are binding assays.
Certain
preferred immunoassays are the various types of enzyme linked immunosorbent
assays
(ELISA) and radioimmunoassays (RIA) known in the art.
In one exemplary ELISA, antibodies binding to the secreted proteins of the
invention
are immobilized onto a selected surface exhibiting protein affinity, such as a
well in a
polystyrene microtiter plate. Then, a test composition containing the secreted
polypeptide is
added to the wells. After binding and washing to remove non-specifically bound
immune
complexes, the bound antibody may be detected. Detection is generally achieved
by the
addition of a second antibody specific for the target protein. that is linked
to a detectable label.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
127
This type of ELISA is a simple "sandwich ELISA". Detection may also be
achieved by the
addition of a second antibody, followed by the addition of a third antibody
that has binding
affinity for the second antibody, with the third antibody being linked to a
detectable label.
In another exemplary ELISA, the samples containing the secreted polypeptide
are
immobilized onto the well surface and then contacted with the antibodies of
the invention.
After binding and washing to remove non-specifically bound immune complexes,
the bound
antigen is detected. Where the initial antibodies are linked to a detectable
label, the immune
complexes may be detected directly. Again, the immune complexes may be
detected using a
second antibody that has binding affinity for the first antibody, with the
second antibody being
linked to a detectable IabeI.
Another ELISA in which the proteins or peptides are immobilized, involves the
use of
antibody competition in the detection. In this ELISA, labeled antibodies are
added to the wells,
allowed to bind to the secreted protein, and detected by means of their label.
The amount of
marker antigen in an unknown sample is then determined by mixing the sample
with the
labeled antibodies before or during incubation with coated wells. The presence
of marker
antigen in the sample acts to reduce the amount of antibody available for
binding to the well
and thus reduces the ultimate signal. This is appropriate for detecting
antibodies in an unknown
sample, where the unlabeled antibodies bind to the antigen-coated wells and
also reduces the
amount of antigen available to bind the labeled antibodies.
Irrespective of the format employed, ELISAs have certain features in common,
such as
coating, incubating or binding, washing to remove non-specifically bound
species, and
detecting the bound immune complexes. These are described as follows:
In coating a plate with either antigen or antibody, one will generally
incubate the wells
of the plate with a solution of the antigen or antibody, either overnight or
for a specified period
of hours. The wells of the plate will then be washed to remove incompletely
adsorbed material.
Any remaining available surfaces of the wells are then "coated" with a
nonspecific protein that
is antigenically neutral with regard to the test antisera. These include
bovine serum albumin
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
128 -
(BSA), casein and solutions of milk powder. The coating of nonspecific
adsorption sites on the
immobilizing surface reduces the background caused by nonspecific binding of
antisera to the
surface.
S In ELISAs, it is more customary to use a secondary or tertiary detection
means rather
than a direct procedure. Thus, after binding of a protein or antibody to the
well, coating with a
non-reactive material to reduce background, and washing to remove unbound
material, the
immobilizing surface is contacted with the control and/or clinical or
biological sample to be
tested under conditions effective to allow immune complex (antigen/antibody)
formation.
Detection of the immune complex then requires a labeled secondary binding
ligand or antibody,
or a secondary binding ligand or antibody in conjunction with a labeled
tertiary antibody or
third binding ligand.
"Under conditions effective to allow immune complex (antigen/antibody)
formation"
means that the conditions preferably include diluting the antigens and
antibodies with solutions
such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline
(PBS)/TweenT""
These added agents also tend to assist in the reduction of nonspecific
background.
The "suitable" conditions also mean that the incubation is at a temperature
and for a
period of time sufficient to allow effective binding. Incubation steps are
typically from about
1 to 2 to 4 hours, at temperatures preferably on the order of 25° to
27°C, or may be overnight at
about 4°C or so.
Following all incubation steps in an ELISA, the contacted surface is washed so
as to
remove non-complexed material. A preferred washing procedure includes washing
with a
solution such as PBS/Tween'"", or borate buffer. Following the formation of
specific immune
complexes between the test sample and the originally bound material, and
subsequent washing,
the occurrence of even minute amounts of immune complexes may be determined.
To provide a detecting means, the second or third antibody will have an
associated label
to allow detection. Preferably, this label will be an enzyme that will
generate color
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/0055t
129
development upon incubating with an appropriate chromogenic substrate. Thus,
for example,
one will desire to contact and incubate the first or second immune complex
with a urease,
glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated
antibody for a period
of time and under conditions that favor the development of further immune
complex formation
S (e.g., incubation for 2 hours at room temperature in a PBS-containing
solution such as PBS-
TweenT"').
After incubation with the labeled antibody, and subsequent to washing to
remove
unbound material, the amount of label is quantified, e.g., by incubation with
a chromogenic
substrate such as urea and bromocresol purple or 2,2'-azido-di-(3-ethyl-
benzthiazoline-6-
sulfonic acid [ABTS] and H202, in the case of peroxidase as the enzyme label.
Quantitation is
then achieved by measuring the degree of color generation, e.g., using a
visible spectra
spectrophotometer.
In a one embodiment, the screening assay uses live cells in the 96-well format
has long
been the standard used as the format lends itself to automation and robotics
handling. The 96-
well plate format allows for a variety of different candidate substances to be
tested in one plate.
However, use of live cells for the purpose of drug screening has inherent
problems associated
with the handling of the cells. Handling attachment dependent cell culture in
the 96-well
format becomes difficult when there is a need for several exchanges of
solution. The forces of
surface tension associated with the meniscus on the well wall stress and even
damages cells on
the bottom of the well as aqueous solutions are removed or added. The shear
forces created by a
suction device (e.g., a pipet tip) as it is close to the cell layer removing
the last microliter of
solution may also damage and remove cells. In order to overcome these
problems, the cells are
encapsulated in highly porous, biocompatible hydrogels in a bead form. In a
preferred assay
format, the encapsulated cells are placed in a 96-well plates that
incorporates a filter-bottom.
The cells are then incubated with the candidate substance for a suitable
period of time to allow
the cell to secrete the polypeptide of interest. This incubation step is
followed by the harvesting
of the media from the cells by the application of a vacuum below the plate to
empty all wells in
one step. The collected samples are then assayed for the presence of the
secreted peptide using
standard ELISA techniques well known to those of skill in the art.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
130
In other preferred embodiments, the detection assays may be radioimmunoassays
as
described by various groups (Halban et crl., 1986; Pieber. et al., 1994).
Standard commercially
available radioimmunoassays are available from Coat-a-count, Diagnostic
Products Corp., Los
Angeles for insulin, and rat amylin immunoassay (Peninsula Laboratories, EIAH-
7323.
Immunoreactive species of glucagon, glucagon-like peptide I (7-37, non
amidated) and
glucagon-like peptide (7-36, amide) were determined as described by the
suppliers of the
respective commercial kits (all purchased from Peninsula Laboratories Inc. Cat
#s RIK-7165,
RIK-7123 and RIK-7168, respectively)
c. Non-Immunologic Methods
Alternatively, one may employ non-immunologic procedures in the measuring the
secretory function according to the of the present invention. For example,
when examining
molecules that are involved in receptor interactions, it is possible to set up
assays that look at
the occupancy of relevant receptor molecules. This can be performed, for
example, by using
labeled ligand molecules that will be compete with the ligand (stimulators and
inhibitor) in the
sample. The more ligand in the sample, the less labeled receptor that will be
bound to the
receptor. Such studies can be performed on whole cells as well as on purified
receptors. Labels
include radiolabels, fluorescent labels and chemilluminescent labels.
Other non-immunologic forms of diagnostic assays include those that look for
the
presence of biological activity of the secreted polypeptide.
4. In vivo Assays
The present invention also provides for the testing of candidate substances
for their
ability to modulate secretory function of cell in in vivo contexts. This
approach has the added
advantage of assessing (i) the function of cells under normal. physiologic
conditions including
the presence of various intercellular signaling mechanisms and (ii) the
ability of candidate
substances to target cells local, regional or distal to their site of
administration and (iii)
localization and/or tissue distribution of a secreted metabolite or downstream
effector
metabolite. Different formulations including time release compositions also
may be assessed.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
131
Finally, this format permits testing on the basis of physiologic states rather
than the mere
increase or decrease of secretory function. This provides additional
information on the actual
potential therapeutic benefit of the substance for the host, testing of
therapeutic vs. toxic
concentrations to establish therapeutic ranges and drug safety parameters, as
well as allowing
for in vivo interactions to be monitored.
The preferred embodiment for in vivo screening of candidate substances
involves the
use of a nude rodent model. The nude mouse lacks immune functions that might
compromise
or interfere with testing of implanted cells of the present invention. This
system is well
characterized and is used for a variety of other purposes including a model of
transplanted
human cancer. Yet another preferred model is one in which the animal has
diabetes (IDDM or
NIDDM).
Briefly, immortalized secretory cells of the present invention will be
transferred, as part
of an implantable device (described elsewhere in this document) into a
suitable site of the host
animal. Typically, subcutaneous implant on the flank, back or hindlimb of the
animal, or
intraperitoneal insertion, is preferred. Intramuscular implant, usually on the
hindlimb, also is
contemplated. Particular issues that will affect the choice of implantation
site include (i)
similarity to the normal site the cells might be found or implanted clinically
and (ii) the
importance of establishing a supporting vasculature structure for the implant.
After a suitable period of time for stabilization of the implant. usually 1 to
10 days, the
animal is ready for testing. The initial step involves the determination of
steady state levels of
any metabolite that will be used as a read-out for effects on modulation of
the implanted cells.
This often will involve taking peripheral blood measurements of the metabolite
of interest.
Such metabolites include, but are not limited to, glucose, insulin, glucagon,
GLP-1, amylin,
leptin, somatostatin, growth hormone. Alternatively, one may assess functional
attributes of the
animal such as alteration in blood glucose in the case of insulin and loss of
body fat in the case
of leptin. Other parameters that could be monitored include, in body weight,
food intake, blood
pressure, metabolic rate, body temperature, serum minerals, elc.
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
132
Once steady state levels and conditions have been determined, the candidate
substance
is administered. Depending on the location of the implant and the particular
purpose for the
assay, the candidate substance, formulated in a pharmacologically acceptable
fashion. will be
administered to the animal. Suitable routes include oral, rectal, vaginal,
topical or intravenous
S or intraarterial injection. Also contemplated are intramuscular,
intraperitoneal. intraocular,
subcutaneous or submucosal administration.
As stated above. the metabolite will be tested from the appropriate tissue or
fluid from
the host animal. Fluids include blood, lymph, saliva, sputum, feces, urine.
semen or tears.
Tissues that may be sampled include liver, brain, muscle, pancreas, spleen.
testis, ovarian,
stomach, intestine, endocrine glands, adrenal glands and kidney. Depending on
the metabolite,
different methodology. also described above, will be used to separate and
identify the presence,
quantity andldistribution of the metabolite. In addition, histologic
examination, involving
microscopy, may be performed. Modulation of the metabolite or function, in the
presence of
the candidate substance, as compared with the levels determined prior to
provision of the
candidate substances, will indicate that the candidate substance is a
modulator of that
metabolite or function.
Following completion of the experimental phase, rescue of the implant may be
performed for the purpose of determining the secretory status of the implant
cells. Any change
in the behavior or characteristics of the cells could impact the results.
Proper controls will
include animals implanted with empty devices and animals implanted with
devices populated
with "placebo" (non-responsive, non-secretory) cells.
K. Cell Propagation
The cells of the present invention may be present propagated as non-anchorage
dependent cells growing freely in suspension throughout the bulk of the
culture; or as
anchorage-dependent cells requiring attachment to a solid substrate for their
propagation (i.e., a
monolayer type of cell growth). WO publication numbers WO 97/26334 (published
July 24,
1997) and WO 97/26321 (published July 24, 1997) are specifically incorporated
herein by
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
133 -
reference and describe the different modes of cell culture that can be
employed to maintain the
cells of the present invention.
In particular embodiments, the cells that will be used for the screening of
modulators of
S secretory function may be in a microcarrier culture van Wezel ( 1967). This
mode of the culture
propagation on the microcarriers makes it possible to use this system for
cellular manipulations.
such as cell transfer without the use of proteolytic enzymes, co-cultivation
of cells.
transplantation into animals, and perfusion of the culture using decanters,
columns, fluidized
beds, or hollow fibers for microcarrier retainment.
l0
As described herein, particular embodiments, employ microencapsulation of
cells
because this system readily lends itself to batch screening methods such as 96-
well plate
screening and also provides a useful mode of providing the cells to an animal
model for in vivo
testing. The cells are retained inside a semipermeable hydrogel membrane. A
porous
15 membrane is formed around the cells permitting the exchange of nutrients,
gases, and metabolic
products with the bulk medium surrounding the capsule. Several methods have
been developed
that are gentle, rapid and non-toxic and where the resulting membrane is
sufficiently porous and
strong to sustain the growing cell mass throughout the term of the culture.
These methods are
all based on soluble alginate gelled by droplet contact with a calcium-
containing solution. Lim
20 (1982) describes cells concentrated in an approximately 1% solution of
sodium alginate which
are forced through a small orifice, forming droplets, and breaking free into
an approximately
1% calcium chloride solution. The droplets are then cast in a layer of
polyamino acid that
ionically bonds to the surface alginate. Finally the alginate is reliquified
by treating the droplet
in a chelating agent to remove the calcium ions. Other methods use cells in a
calcium solution
25 to be dropped into a alginate solution. thus creating a hollow alginate
sphere. A similar
approach involves cells in a chitosan solution dropped into alginate, also
creating hollow
spheres.
Microencapsulated cells are easily propagated in stirred tank reactors and,
with beady
30 sizes in the range of 150-1500 pm in diameter, are easily retained in a
perfused reactor using a
fine-meshed screen. The ratio of capsule volume to total media volume can kept
from as dense
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
1 s4 -
as 1:2 to 1:10. With intracapsular cell densities of up to IOg, the effective
cell density in the
culture is 1-~ x 10'.
The advantages of microencapsulation over other processes include the
protection from
the deleterious effects of shear stresses which occur from sparging and
agitation, the ability to
easily retain beads for the purpose of using perfused systems, scale up is
relatively
straightforward and the ability to use the beads for use in 96-well screening
assays and in
implantation.
The cells of the present invention may. irrespective of the culture method
chosen, be
used in protein production and as cells for in vitro cellular assays and
screens as part of drug
development protocols.
L. In vivo Uses
1. Pharmaceutically Acceptable Formulations
Where clinical applications are contemplated, it will be necessary to prepare
pharmaceutical compositions of the stable cells in a form appropriate for the
intended
application, which will most usually be within a selectively permeable
membrane. Nonetheless,
the cells will generally be prepared as a composition that is essentially free
of pyrogens, as well
as other impurities that could be harmful to humans or animals.
One will generally desire to employ appropriate salts and buffers to render
stable cells
suitable for introduction into a patient within their selectively permeable
membrane,
implantable device or other delivery vehicle. Aqueous compositions of the
present invention
comprise an effective amount of stable neuroendocrine cells dispersed in a
pharmaceutically
acceptable carrier or aqueous medium, and preferably encapsulated.
The phrase "pharmaceutically or pharmacologically acceptable" refer to
molecular
entities and compositions that do not produce adverse, allergic, or other
untoward reactions
when administered to an animal or a human. As used herein, "pharmaceutically
acceptable
carrier" includes any and alI solvents, dispersion media, coatings,
antibacterial and antifungal
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/0055t
135 -
agents, isotonic and absorption delaying agents and the like. As used herein,
this term is
particularly intended to include biocompatible implantable devices and
encapsulated cell
populations. The use of such media and agents for pharmaceutically active
substances is well
know in the art. Except insofar as any conventional media or agent is
incompatible with the
vectors or cells of the present invention, its use in therapeutic compositions
is contemplated.
Supplementary active ingredients also can be incorporated into the
compositions.
Under ordinary conditions of storage and use, the cell preparations may
further contain a
preservative to prevent growth of microorganisms. Intravenous vehicles include
fluid and
nutrient replenishers. Preservatives include antimicrobial agents. anti-
oxidants, chelating
agents and inert gases. The pH and exact concentration of the various
components in the
pharmaceutical are adjusted according to well-known parameters.
2. Cell-Based Delivery and Devices
I S The engineered cells of the present invention may be introduced into
animals, including
human subjects, so that modulators of secretion identifed by the present
invention can provide
a controlled secretion of a desired polypeptide. In order for the cells to
simulate normal human
~i-cells, ideally cells are engineered to achieve glucose dose responsiveness
resembling that of
islets. However, other cells will also achieve advantages in accordance with
the invention. It
should be pointed out that the studies of Madsen and coworkers have shown that
implantation
of poorly differentiated rat insulinoma cells into animals results in a return
to a more
differentiated state, marked by enhanced insulin secretion in response to
metabolic fuels
(Madsen et ul., 1988). These studies suggest that exposure of engineered cell
lines to the in
vivo milieu may have some effects on their responses) to secretagogues.
A preferred method of providing the cells to an animal involves the
encapsulation of the
engineered cells in a biocompatible coating. In this approach. the cells are
entrapped in a
capsular coating that protects the contents from immunological responses. One
preferred
encapsulation technique involves encapsulation with alginate-polylvsine-
alginate. Capsules
made employing this technique generally have a diameter of approximately 0.5
to 1 mm and
should contain several hundred cells.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
136
Cells may thus be implanted using the alginate-polylysine encapsulation
technique of
O'Shea and Sun ( 1986), with modifications, as later described by Fritschy et
ul.. ( I 991; both
references incorporated herein by reference). The engineered cells are
suspended in 1.3%
sodium alginate and encapsulated by extrusion of drops of the cell/alginate
suspension through
a syringe into CaCl2. After several washing steps, the droplets are suspended
in polylysine and
rewashed. The alginate within the capsules is then reliquified by suspension
in 1 mM EGTA
and then rewashed with Krebs balanced salt buffer.
An alternative approach is to seed Amicon fibers with stable cells of the
present
invention. The cells become enmeshed in the fibers, which are semipermeable,
and are thus
protected in a manner similar to the micro encapsulates (Altman et al., 1986;
incorporated
herein by reference). After successful encapsulation or fiber seeding, the
cells may be
implanted intraperitoneally, usually by injection into the peritoneal cavity
through a large gauge
needle (23 gauge).
A variety of other encapsulation technologies have been developed that are
applicable to
the practice of the present invention (see, e.g., Lacy et al., 1991; Sullivan
c~t ul., 1991;
WO 91/10470; WO 91 /10425; WO 90/15637; WO 90/02580; U.S. Patent 5.011.472;
U.S.
Patent 4,892,538; U.S. Patent 5,002,661, U.S. Patent 5,569,462, U.S. Patent
5,593,440,
U.S. Patent 5,549,675, U.S. Patent 5,545,223, U.S. Patent 5,314,471, U.S.
Patent 5,626,561 and
WO 89/01967; each of the foregoing being incorporated by reference). To the
extent that these
references describe encapsulation techniques that will be useful in
combination with the present
invention, some of these references are described in further detail herein
below.
Lacy et. al. ( 1991 ) encapsulated rat islets in hollow acrylic fibers and
immobilized these
in alginate hydrogel. Following intraperitoneal transplantation of the
encapsulated islets into
diabetic mice, normoglycemia was reportedly restored. Similar results were
also obtained
using subcutaneous implants that had an appropriately constructed outer
surface on the fibers.
It is therefore contemplated that engineered cells of the present invention
may also be
straightforwardly "transplanted" into a mammal by similar subcutaneous
injection.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
137
Sullivan et. al. (1991) reported the development of a biohybrid perfused
"artificial
pancreas", which encapsulates islet tissue in a selectively permeable
membrane. In these
studies, a tubular semi-permeable membrane was coiled inside a protective
housing to provide a
S compartment for the islet cells. Each end of the membrane was then connected
to an arterial
polytetrafluoroethylene (PTFE) graft that extended beyond the housing and
joined the device to
the vascular system as an arteriovenous shunt. The implantation of such a
device containing
islet allografts into pancreatectomized dogs was reported to result in the
control of fasting
glucose levels in 6/10 animals. Grafts of this type encapsulating engineered
cells could also be
used in accordance with the present invention.
U.S. Patent 5,626,561, specifically incorporated herein by reference,
describes an
implantable containment apparatus for a therapeutic device and method for
loading and
reloading the device. The implantable containment apparatus is made of
selectively permeable
material and can be used to contain a therapeutic device, such as a drug
delivery device. a cell
encapsulation device, or a gene therapy device. A therapeutic device can be
easily placed and
replaced in the apparatus without damaging tissues associated with the
selectively permeable
material of the apparatus.
U.S. Patent 4,402,694, also is incorporated herein by reference and describes
a body
cavity access device containing a hormone source. In this patent, the device
supplies a
hormone to a patient. The device is made of an implantable housing which is
placed in the
body and has an impermeable extracorporeal segment and a semipermeable
subcutaneous
segment. A hormone source such as live. hormone-producing cells, e.g.,
pancreatic islet cells
or the engineered human cells of the present invention are then removably
positioned in the
housing to provide a hormone/ and or other peptide supply to the patient. Such
a device also
can contain a sensor located within the subcutaneous segment and operably
associated with a
dispenser to release medication into the housing and to the patient.
Hydrophilic polymeric chambers for encapsulating biologically active tissue
and
methods for their preparation are described in U.S. Patent 4,298,002. In the
technology
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
138 -
described therein the tissue refers to those essential cellular components of
a particular organ
that is capable of receiving, modifying or secreting hormones. A device
comprising such
chamber and such tissue is fabricated and implanted in a living body so that
said tissue is
permitted normal function without being rejected by the host's immunological
system. The
viability of the tissue in the device is maintained by a correlation of
factors including pore size
and membrane thickness of the hydrophilic chamber. To maintain the viability
of the tissue,
the implanted device allows the inflow of essential nutrients and gases, and
outflow of
metabolites and products while simultaneously excluding the ingress of
cellular components of
the host's immunological system. To the extent that the device described
therein can be used to
implant the engineered cells of the present invention. U.S. Patent 4,298,002
is incorporated by
reference herein.
U.S. Patent 5,01/,472 describes devices and methods to provide hybrid, modular
systems for the constitutive delivery of appropriate dosages of active factor
to a subject and, in
some instances, to specific anatomical regions of the subject. This patent is
incorporated herein
by reference in that it contains devices and methods that may be useful in
conjunction with the
present invention. This system includes a cell reservoir containing living
cells capable of
secreting an active agent, which is preferably adapted for implantation within
the body of the
subject and further includes at least one semipermeable membrane, whereby the
transplanted
cells can be nourished by nutrients transported across the membrane while at
the same time
protected from immunological, bacterial, and viral assault. The systems
further include a
pumping means, which can be implantable or extracorporeal, for drawing a body
fluid from the
subject into the cell reservoir and for actively transporting the secreted
biological factors from
the cell reservoir to a selected region of the subject.
Similarly, U.S. Patent 4,892,538 describes methods and compositions for the in
vivo
delivery of neurotransmitters by implanted, encapsulated cells and the
technology described
therein may be useful in combination with the present invention.
U.S. Patent 5,002,661 describes an artificial pancreatic perfusion device in
which a
hollow fiber having an inner diameter of about ~ mm is surrounded by islets of
Langerhans
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
139 -
enclosed in a housing. The islets are suspended in a semi-solid matrix which
ensures desired
distribution of the cells about the hollow fiber. The hollow fiber and
suspended islets are
enclosed in a housing which further aids the desired distribution of islets
about the hollow fiber.
The hollow fiber has a porosity which selectively allows passage of substances
having a
molecular weight of less than about 100,000 Daltons. The semi-solid matrix in
which the islets
are embedded and suspended is formed of an appropriate supporting material
such as alginate
or agar. This device may be used with the present invention in that the
engineered cells of the
present invention may substitute for the islet cells.
U.S. Patent 5,549,675, incorporated herein by reference, describes additional
methods
for implanting tissue in a host. The method comprises creating an implant
assembly for holding
cells including a wall for forming a porous boundary between the host tissue
and the implanted
cells in the device and implanting the device and then adding the cells. The
pore size of the
boundary is such that it is sufficient to isolate the implanted cells from the
immune response.
U.S. Patent 5,545,223, describes methods of making and using ported tissue
implant systems
and is therefore incorporated herein by reference.
In certain instances it may be necessary to enhance vascularization of implant
devices,
methods for achieving such an aim are disclosed in U.S. Patent 5,569, 462. The
methods
involve placing a population of therapeutic substance-producing cells into the
cell receiving
chamber of an immunoisolation apparatus, implanting the apparatus into a
patient, and
administering an immunomodulatory agent to the patient. The immunomodulatory
agent
increases the number of close vascular structures in the vicinity of the
implanted device, which
increases the long term survival of the cell population housed therein.
In other instances, it may be necessary to supply the cells of the present
invention in a
relatively high density. Brauker, et. al. (U.S. Patent 5,593.440. and U.S.
Patent 5,314.471 each
incorporated herein by reference) describe tissue implant systems and methods
for sustaining
viable high cell densities within a host.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
140
Implantation employing such encapsulation techniques are preferred for a
variety of
reasons. For example. transplantation of islets into animal models of diabetes
by this method
has been shown to significantly increase the period of normal glycemic
control, by prolonging
xenograft survival compared to unencapsulated islets (O'Shea and Sun. 1986;
Fritschy et al.,
S 1991). Also, encapsulation will prevent uncontrolled proliferation of clonal
cells. Capsules
containing cells are implanted (approximately 1,000-I0,000/animal)
intraperitoneally and blood
samples taken daily for monitoring of blood glucose and insulin.
An alternate approach to encapsulation is to simply inject glucose-sensing
cells into the
scapular region or peritoneal cavity of diabetic mice or rats, where these
cells are reported to
form tumors (Sato e~ ul.. 1962). Implantation by this approach may circumvent
problems with
viability or function. at least for the short term, that may be encountered
with the encapsulation
strategy. This approach will allow testing of the function of the cells in
experimental animals,
which is a viable use of the present invention, but certainly is not
applicable as an ultimate
strategy for treating human diabetes. Nonetheless, as a pre-clinical test,
this will be understood
to have significant utility.
In summary. biohybrid artificial organs encompass all devices which substitute
for an
organ or tissue function and incorporate both synthetic materials and living
cells. Implantable
immunoisolation devices will preferably be used in forms in which the tissue
is protected from
immune rejection by enclosure within a semipermeable membrane. Those of skill
in the art
will understand device design and performance, as it relates to maintenance of
cell viability and
function. Attention is to be focused on oxygen supply, tissue density and the
development of
materials that induce neovasclarization at the host tissue-membrane interface;
and also on
protection from immune rejection. Membrane properties may even be further
adapted to
prevent immune rejection, thus creating clinically useful implantable
immunoisolation devices.
An effective amount of the stable cells is determined based on the intended
goal. The
term "unit dose" refers to a physically discrete unit suitable for use in a
subject, each unit
containing a predetermined quantity of the therapeutic composition calculated
to produce the
desired response in association with its administration, i.e., the appropriate
route and treatment
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
141
regimen. The quantity to be administered. both according to number of
treatments and unit
dose, depends on the subject to be treated, the state of the subject, and the
protection desired.
Precise amounts of the therapeutic composition also depend on the judgment of
the practitioner
and are peculiar to each individual.
M. Examples
The following examples are included to demonstrate preferred embodiments of
the
invention. It should be appreciated by those of skill in the art that the
techniques disclosed in
the examples which follow represent techniques discovered by the inventor to
function well in
the practice of the invention, and thus can be considered to constitute
preferred modes for its
practice. However, those of skill in the art should, in light of the present
disclosure, appreciate
that many changes can be made in the specific embodiments which are disclosed
and still
obtain a like or similar result without departing from the spirit and scope of
the invention.
EXAMPLE 1
Stable response to a variety of secretagogues.
[3G 49/206 was chosen as representative of an engineered ~i-cell line that
reproducibly
responds to a variety of secretagogues. This line has been engineered to
stably express
functional glucose transporter (GLUT-2) and glueokinase proteins and
biologically active
human insulin (Clark et al., 1997).
Prior to testing, cells were plated on polystyrene plastic 48-well or 96-well
tissue culture
plates at a density of 0.1 x 10~ cells/cm2 (approx. 50% confluency) - approx.
90 x 10'
cells/well or 30 x 103 cells/well, respectively. Cells were allowed to recover
and propagated for
24-72 hours in regular growth media (~iGene media with 3.5% FBS). After
propagation and
before stimulation, the cells are rinsed once and washed twice for 20 min.
each in FIEPES
Buffered Biological Salt Solution (HBBSS; in mmol/l: 114 NaCI, 4.7 KCI, 1.21
KH,PU~. 1.16
MgS04, 25.5 NaHC03, 2.~ CaCI~. 10 mM HEPES. 0.1% BSA) at 37 °C. 0.5 ml
of tIBBSS
supplemented with secretagogue(s) was added to each well and allowed to
incubate for ? hours
at 37°C. At the end of the incubation period, HBBSS was harvested from
each well and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
142
assayed for insulin. Results are e~.pressed in terms of fold stimulation over
a basal sample
containing HBBSS only.
The cell lines of the present invention show stable insulin secretion with
time in
S continuous culture. The cell lines chosen represent established lines that
have undergone more
than 100 population doublings (2-3 years) during which two or three genes were
iteratively
introduced, including time for clonal selection for each gene introduced. The
cells therefore
already have shown Iong term stability during the engineering process. Cells
thawed from
cryogenic storage for experimentation are kept in maintenance culture in
parallel. From these
cultures, cells are harvested and plated for two more repeat experiments two
to three weeks
apart. This will prove stability over the course of a couple of months,
demonstrating a window
of time in which it is possible to validate reproducible results.
Secretagogues have been selected to represent agents that signal via discrete
pathways,
i.e., glucose and amino acids via metabolic signals, IBMX and GLP-1 via cAMP,
carbachol via
muscarinic receptors, sulfonylureas via the K+--ATP channels, and phorbol
esters via protein
kinase C. Cells are stimulated with the following:
~ 100 ~M IBMX; with and without 10 mM glucose
~ a mixture of 10 mM each of glutamine, leucine, and arginine; with and
without 10
mM glucose
~ 100 pM carbachol; with and without 10 mM glucose
~ 10 nM glyburide; with and without 10 mM glucose
~ 10 nM GLP-1; with and without 10 mM glucose
~ 10 nM PMA; with and without 10 mM glucose
2S ~ Stimulatory Cocktail (10 mM each of glutamine, leucine, and arginine, 100
pM
carbachol, 100 pM IBMX, and 10 mM glucose in BetaGene Medium with 0.1
BSA).
The following controls are incorporated: No stimulant (basal); with and
without 10 mM
glucose; 100pM Diazoxide.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
143 -
The selected engineered cell lines have stable and reproducible responses to
the various
secretagogues over time in culture (FIG. 3 and FIG. 4). The data shown are
from the last of
three experiments. In the first experiment the cells had undergone 8
population doublings
(PDs) 'after the engineering and clone selection was completed. The parental
cell line had been
stable for over two years, undergone more than 100 PDs, and subjected to two
more
engineering steps. Through all these manipulations, the cells have maintained
a remarkably
stable phenotype. In the last experiments the cells had undergone further 8
PDs (approx. 16
days) in continuous culture.
On average, in each of the experiments the cells had a 10 fold response
(relative to
basal, a 1 fold response means no change) to glucose alone. A 1-1.5 fold
response to IBMX
alone was observed, but there was a 20-30 fold response to IBMX in the
presence of glucose,
consistent with IBMX's ability to potentiate the effect of glucose on insulin
secretion. The
amino acids, in the absence or presence of glucose, elicit a ?0-30 fold
response, as they serve as
fuel molecules in the metabolic pathways. Carbachol as well as GLP-1, when
tested alone,
have no appreciable effect on secretion, but have a 1 ~-?~ fold response in
the presence of
glucose. Glyburide, in the absence or presence of glucose, elicit a 7-15 fold
response, as the
sulfonylurea inhibits the K+ channel and causes depolarization of the cell
membrane. PMA,
acting directly on protein kinase C has an 8-10 fold effect on basal secretion
in the absence of
glucose and a strong 30-40 fold response in the presence of glucose. A
stimulatory cocktail that
includes glucose, IBMX, amino acids, and carbachol, yields a 30-40 fold
response.
EXAMPLE 2
Maintenance of Secretagogue Responsiveness Through Bulk Cell Production
For consistency and reproducibility between experiments, engineered ~3-cell
lines were
bulk produced in a bioreactor, harvested and frozen to establish a homogeneous
repository of
cells. Cells undergoing this process should continue to secrete complex, fully
biologically active
polypeptides into the growth media with no significant differences in the
response to glucose
and other secretagogues pre-bulk, post-bulk and post-thaw. (3G 49/206
(described in example 1 )
was selected as a representative engineered ~i-cell line to undergo the
complete process; bulk
production, harvest, freeze and thaw. Representative samples from each step
were analyzed for
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
144 -
response to various secretagogues. Each of the procedures and the secretion
profile are
described in detail below.
~iG cell lines were bulk produced in the CellCubeTM system (Corning Costar)
and frozen
as described in example 30.
Frozen vials of ~iG 49/206 representing each stage of the bulk production
process were
thawed and allowed to recover prior to testing their insulin response to
various secretagogues.
The cells were ready to plate for testing of cell response to various
secretagogues 48- 72
hours after thawing. This assay was done to demonstrate that each of the
processes described;
bulk production, harvest, freeze and thaw, has no appreciable effect on the
secretory response of
(3G 49/206 cells. The secretory response of pre-bulk, post bulk and harvest,
and freeze/thaw
samples was studied using the secretagogues listed in the table below. Each of
the listed
secretagogues and their signaling pathway has been previously described. The
data are as
follows:
TABLE 10
PERFORMANCE OF BG 49/206 CELLS THROUGH BULK
PRODUCTION AND CRYOPRESERVATION
Fold Stimulation
Pre-Cube Post-Cube Post-Cube Frz/Thaw
Stimulus PD18 Pre-Freeze PD29
PD29
Basal 1.00 1.00 1.00
Basal +lOmM Glucose 12.01 11.21 11.4
100pM IBMX 2.64 2.64 4.29
100kM IBMX + Glucose31.74 18.82 22.36
IOmM as 22.17 19.45 21.50
l OmM as + Glucose 29.19 18.75 22.92
100pM Carbachol 1.43 1.?3 1.60
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
145 _
Table 10 - Continued
Fold Stimulation
Yre-Cube Post-Cube Post-Cube Frz/Thaw
Stimulus PD18 Pre-Freeze PD29 PD29
luuplvl c:arbachol + 23.22 17.59 18.57
Glucose
IOnM GLP-1 2.12 2.24 1.82
I OnM GLP-1 + Glucose 22.55 21.37 16.78
IOnM Glyburide 8.31 10.19 7.g0
IOnM Glyburide + Glucose16.55 13.77 11.77
l OnM PMA 10.46 9.80 2.81
I OnM PMA + Glucose 39.48 30.32 23.67
Stimulatory cocktail 38.61 39.71 38.55
As shown in Table 10, there is no appreciable difference in the overall
secretion
response of ~3G 49/206 cells which have undergone bulk production, bulk
freezing and thawing.
EXAMPLE 3
Use of alginate encapsulated cells to enhance stability of
the cells and their secretory response.
The use of living cells for the purpose of drug screening has inherent
problems
associated with the handling of the cells. For high-throughput screening
purposes, the 96-well
format has long been the standard used it lends itself to automation and
robotics handling.
However, handling attachment dependent cell culture in the 96-well format
becomes difficult
when there is a need for several exchanges of solution. The forces of surface
tension associated
with the meniscus on the well wall stress and even damages cells on the bottom
of the well as
aqueous solutions are removed or added. The shear forces created by a suction
device (e.g.. a
pipet tip) as it is close to the cell layer removing the last microliter of
solution also is adequate
- to damage and remove cells. When it is necessary to remove all liquid from a
well before
addition of liquid in the next step, cells are left exposed directly to air.
Any direct exposure to
air is undesirable and causes stress to the cells. It may result in impaired
and unpredictable
function and response. When working with large numbers of wells there will
obviously be cells
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
146
that will be exposed to air for prolonged periods of time. This only
aggravates the problem of
drying and of unpredictable results.
The technique of encapsulating the cells was applied for testing to solve all
of the above
problems and to further advantages. Cells encapsulated in highly porous,
biocompatible gels in
a bead form enjoy the advantage of being protected from mechanical and
physical forces that
are at play in a small well. In addition to adding this protection, small
beads can be handled in
suspension and, thus, are very amenable to be dispensed by standard robotic
equipment. This
reduces the amount of manual labor involved and increases reproducibility of
cell count per
well, another factor that is often hard to control when using multiwell
plates. An important
feature is that beads do not restrict the user to cell culture plasticware. By
using 96-well plates
that incorporate a filter-bottom one can now apply vacuum below the plate to
empty all wells in
just one simple step. This makes exchanges of solution more efficient and
rapid. For collection
of solutions for assaying, it also is possible to collect the contents of each
well in the vacuum
process. All of the above steps can take advantage of an automated process
using robotics.
Cells in suspension in alginate (1.5 x 106 cells/ml) were encapsulated in
approx. 800 pm
beads (approx. 4,000 cells/bead) by dripping and congealing the slurry into a
Ca~ containing
solution. A suspension of alginate beads was aliquoted into polystyrene
plastic 48-well or 96-
well tissue culture plates yielding approx. 50 beads per well.
49/206 cells were encapsulated in alginate using the following procedure.
Trypsinized
and PBS-washed cells are evenly suspended in a 1.5 - 2% final concentration of
sodium
alginate (50:50 mixture of LV low viscosity and HV high viscosity, Kelco, CA)
in growth
medium without serum. The suspension is loaded in a syringe and then dispensed
through a 27
gauge needle at approx. 0.3 ml/min. The droplets leaving the tip of the needle
are blown off by
a continuous air stream. By adjusting the velocity of the air stream, beads
averaging approx.
800 p.m can be achieved reproducibly. The droplets are blown into a container
holding a 1.35%
(w/v) CaCl2/20 mM HEPES solution. The beads are allowed to fully congeal for
approx. 10
min in the CaCl2 solution. Beads are washed twice in growth medium without
serum and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
147 _
placed a T-flask with regular growrth medium and incubated for about 72 hours
with one
feeding at 48 hours.
After incubation the beads were transferred into a ~0-ml conical and the total
volume
adjusted so the settled bead slurry makes up approx. 50% oi~ the volume. Using
a repeat
pipetter. 50 ~l bead slurry (about 30,000 cells) is dispensed into each well.
Washing,
stimulation, and assaying is performed as described above
The data presented FIG. S demonstrate that it is possible to encapsulate
engineered RIN
cells and maintain comparable responses to secretagogues relative to non-
encapsulated cells.
The fold responses are essentially equivalent to the data in F1G. 3 and FIG. 4
with regard to
fold stimulation. It should be noted that the data falls within a narrower
range as indicated by
the smaller standard deviation values derived. This observation is indicative
of better control of
total remaining cell number at time of stimulation and of more stable
conditions for all cells in
the individual wells.
EXAMPLE 4
Maintenance of secretion performance in a 96- well format.
Several criteria must be met in order for cell-based screens to meet the
current industry
standards for high through put screening (HTS).. First, the screens must be
adaptable to a
microtiter plate screening format. Second, the read-out or signal from an
assay must be
compatible with data management software so information can be tracked and
integrated. Third,
total screen time should be minimized. Fourth, assays should be sensitive and
precise.
When cultured and assayed in 12-well plates, measurements of insulin secretion
from
BetaGene cell lines are sensitive and precise (Hohmeier e~ crl.. 1997). It is
important to
determine if these properties can be maintained when the cells are cultured
and assayed in
microtiter plates. As shown in FIG. 6, the performance of (3G 49/206 cells was
compared in 48-
well and 96-well formats. Cells were plated, cultured. and assayed in 48-well
dishes
(100,000/well) as described in the legend to FIG. 3. For 96-well assays, (3G
49/206 cells
(30,000 per well) were plated and cultured for 48 hrs. in I SO ~1 of BetaGene
Medium/ 2.5%
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
148 -
fetal bovine serum: washed twice (20 min each. in 200 pl in HBBSS), and
stimulated with
glucose or glucose plus IBMX. The pattern of secretory responsiveness is
maintained when (3G
49/206 cells were plated. cultured, and assayed in a 96-well format: the
inclusion of diazoxide
in the medium provides a slight clamp to basal secretion, glucose alone is
potently stimulatory.
S and the glucose response can be augmented by the inclusion of IBMX as a
secretagogue.
EXAMPLE 5
Construction of expression plasmids and production
of stably transfected RIN cell lines.
To enhance the responsiveness of insulin secretion to various modulators, a
number
receptor cDNAs or genes were engineered into RIN cell lines for the stable
expression of the
receptor proteins. Receptors of interest include the following: alpha-2
adrex~ergic receptor
(ATTC number 59303, HPalpha2GEN Genbank accession numbers M 18415, M23533,
incorporated herein by reference), glucagon-like peptide I receptor (Genbank
accession
numbers: L23503. U 10037, 001156, 001104: each incorporated herein by
reference),
somatostatin receptor V (mouse Genbank accession number AF004740; human
Genbank
accession numbers: L14865> L14856, M81830, M96738, M81829, L07833 each
incorporated
herein by reference). Other receptors to be used include the SUR channel
(Genbank accession
numbers L78207. 063455, L78243, incorporated herein by reference), KIR channel
(Genbank
accession number D50582. incorporated herein by reference), pancreatic
polypeptide receptor
(Genbank accession numbers: 266526, 042387, 042389 each incorporated herein by
reference), muscarinic receptors (Genbank accession numbers: X52068, X15264,
X15265,
X15266, AF026263 each incorporated herein by reference); glucocorticoid
receptor (Genbank
accession numbers: M 10901, M 11050 each incorporated herein by reference},
human (glucose-
dependent insulinotropic peptide) GIP receptor (Genbank accession number
X81832,
incorporated herein by reference) human PACAP/VIP receptor (Genbank accession
numbers
L36566, D17516, 1118810, each incorporated herein by reference) human ~i-cell
type Ca2+
channel (Genbank accession number M83566 incorporated herein by reference) and
leptin
receptor (Genbank accession numbers: 043168, 052912, 052913, 052914 each
incorporated
herein by reference). human gastrin/ cholecystikinin (CCK) B receptor (Genbank
accession
numbers: L34339, L07746 each incorporated herein by reference), human CCK A
receptor
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
149 -
Genbank accession number L 136US incorporated herein by reference) and human
galanin
receptor (Genbank accession number L34339 incorporated herein by reference).
Following the appropriate manipulations, DNAs encoding the receptors were
ligated
into plasmids suitable for the stable transfection of mammalian cells. Such
plasmids contain
genes that confer resistance to antibiotics and cloning sites for transgene
insertion and
expression. Resistance to hygromycin (hygromycin phosphotransferase) is
encoded in the
plasmid designated pCB7 and resistance to zeomycin is encoded in CW102
(pZeocmv).
CW102 was created by replacing the SV40 promoter in pZeoSV with the CMV
promoter.
pZeoSV was digested with Bam HI and the ends were blunted-ended by a fill-in
reaction with
Klenow. The CMV promoter was excised from pAC/CMV by digestion with Not I and
prepared for blunt-end ligations by treatment with Klenow. There are two
copies of the CMV
promoter in CW102: one driving the expresssion of the zeomycin resistance gene
and the other
for transcribing transgenes of interest.
RIN 1046-38 cells and derived cell lines were grown BetaGene Medium containing
7.8
mM glucose and supplemented with 3.5% fetal bovine serum (JRH Biosciences,
Lenexa. KS),
100 milliunits/ml penicillin and 100 pg/ml streptomycin. Cells were passaged
weekly using
0.05% trypsin-EDTA solution and cultured in an atmosphere of 95% air and 5%
C02 at 37oC_
For stable transfections, RIN cell lines were grown to 50 to 75% confluence.
harvested
by trypsinization, washed once with phosphate-buffered saline (PBS), and
resuspended in PBS
for counting. For each electroporation, 1 x 10~ cells were pelleted by
centrifugation at 1000
rpm for 2 minutes and resuspended in 0.4 ml electroporation buffer (137 mM
NaCI. 6 mM
glucose, S mM KCI, 0.7 mM Na~HP04, 20 mM Hepes, pH 7.0 ; or in BetaGene medium
without serum). DNA was added to the cell suspension to achieve a final
concentration of 30-
50 p,g/ml. DNA was electroporated into the cells in a 2 mm cuvette at 170
volts. ~ 10 ~cF and
129 ohms using an Electro Cell Manipulator 600 (BTX, Inc.). Stably transfected
cells were
selected by culturing in the appropriate drug for about 2 weeks. The drug
concentrations used
were- 500 pg/ml active fraction 6418 (Geneticin, Gibco Life Sciences); 300
pg/m1 for
hygromycin (Boehringer Mannheim); 400 pg/ml for zeomicin (InVitroGen).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
I50 _
The gene encoding the human alpha-2A receptor (a2AR) inserted into a plasmid
backbone (ATCC number 59303, HPalpha2GEN) was purchased from the American Type
Culture Collection. Following replication and preparation of this plasmid at
BetaGene, the
DNA was designated BX700. BX700 plasmid DNA was digested with restriction
endonucleases Kpn I, Nhe I, and Hind III to release the a2AR genomic fragment.
This
fragment was ligated into pBluescript II SK plasmid that had been digested
with Spe I, treated
with the large fragment (Klenow) of DNA polymerase I to fill-in the overhangs
created by Spe I
digestion, and dephosphorylated with calf intestinal alkaline phosphatase
(CIAP). The plasmid
resulting from this ligation, CE406, was digested with Kpn I and Xba I, and
the a2AR DNA
was ligated in to pCB7 to create CE616 plasmid DNA.
The full-length human glucagon-like peptide I (GLP-1) receptor mRNA (Genbank
accession number: L23503) and a portion of the rat GLP-1 mRNA (Genbank
accession number:
M97797) were reverse transcribed and amplified by the polymerase chain
reaction (RT-PCR).
Total RNA was isolated from tissues using RNAzoI B RNA isolation reagent
(Cinna/Biotex
Laboratories International). RT-PCR was performed using the TltanTM One Tube
RT-PCR
System (Beohringer Mannheim). For the amplification of a portion of the rat
GLP-1 receptor
mRNA, 100 ng of B17/I total RNA was transcribed at SS° C using AMV
reverse transcriptase
and amplified with a blend of Taq DNA polymerase and Pwo DNA polymerase. 35
rounds of
amplification were performed with denaturation at 94° C (30 secs),
annealing at 59° C (45 secs)
and extension at 68° C (2 min.) using oligonucleotides IDK4
(5'CAGCCTGCCCTGGAGGGAC3' SEQ ID NO:I)
and IDKS (5'CCGAGAAGGCCAGCAGTGTGTAC3' SEQ ID N0:2). Utilizing the same
RT-PCR conditions, the full-length human GLP-1 mRNA was amplified from RNA
isolated
from a human small cell lung line (ATCC: HTB-184, NCI: HS10A) using
oligonucleotides
IDK3 (5'TGGTGGAATTCCTGAACTCCCCC3' SEQ ID N0:3) and IDK6
(5'GATTGGCCACCCGGCCTGCA3' SEQ ID N0:4). The rat GLP-1 cDNA was subcloned
into pNOTA/T7 (S' to 3', Inc) to create plasmid CU201. The human PCR product
was
subcloned into pBluescript KS that had been digested with EcoR V and the
resulting plasmid
was designated CX800. The GLP-1 receptor fragment was isolated from CX800
following
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
1S1
digestion with EcoR 1 and Hind III, and ligated with CW10? that had been
digested with EcoR I
and Hind III.
The human pancreatic polypeptide receptor (PPR) mRNA was amplified from RNAs
S isolated from human lung cell lines (ATCC number: CRL-5816; NCI-H810) using
the TitanTM
One Tube RT-PCR System. 100ng of total RNA was transcribed at SS° C; 3S
rounds of
amplification were performed with 94°C denaturation (30 secs),
S7°C annealing (30 secs), and
68° C extension (2 min). PCR products were subcloned into pBluescript
SK that had been
digested with Hind III and filled in with Klenow to create plasmid DG10S. The
PPR fragment
form DG 1 OS was ligated into C W 102 as a EcoR Il Kpn I fragment.
The mouse somatostatin receptor, type V gene ligated into pBluescript was
received
from the Dr. F. Charles Brunicardi, Baylor Medical Center, Houston, Texas.
Following
replication of the plasmid at BGene the DNA was designated CW000. CW000 was
digested
IS with PpulhlI and treated with Klenow. The SSTRV DNA was ligated in CW102
that had been
digested with Bam H I and treated with Klenow and CIAP, and the resulting
plasmid was
designated CXS03.
EXAMPLE 6
Transgenic overexpression of the a2AR improves the response of RIN cells to
Clonidine, an analogue of epinephrine.
Epinephrine participates in regulating circulating glucose levels by
stimulating glucose
production from the liver and inhibiting insulin secretion from the pancreatic
~i-cell. In
2S comparison to human pancreatic islets, ~iGl8/3E1 cells are relatively
refractory to epinephrine
and C'lonidine, an analogue of epinephrine. As determined by the capacity of
Clonidine to
inhibit insulin-secretion, human pancreatic islets are about 10-told more
sensitive to this
compound than (3G18/3E1 cells. It was reasoned that the sensitivity of
(3G18/3E1 cells to
Clonidine could be increased by the transgenic overexpression of the a2AR.
~iGIB/3E1 cells
were electroporated (EP26S) with plasmid CE616. Following selection with
hygromycin and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
152
growth. single colonies were assayed by immunocytochemisty for the expression
of the
transgenic a2AR.
(3G 18/3E 1 cells and single clones derived from EP265 were plated on Falcon 8-
chamber
S culture slides and maintained for 2 days in BetaGene Medium. Following
fixation, cells were
incubated with a2AR antibody (diluted 1:200; Dr. John Regan, University of
Arizona, Tucson).
Following incubation with a secondary antibody (antichicken IgG .alkaline
phosphatase)
immune complexes were detected colormetrically. The specificity of the a2AR
antibody was
confirmed by competition assays with a a2AR-glutathione-S transferase fusion
protein. Eight
individual clones were analyzed for sensitivity to Clonidine in insulin-
secretion assays. The
capacity of the cell tines to secrete mature insulin during stimulation of the
regulated secretory
pathway was determined by incubating for 1 hour in a mixture of secretagogues.
The mixture
consisted of RPMI medium (JRH BioSciences) with 5 mM glucose. supplemented
with 0.1%
BSA, 100 pM carbachol, and 100 pM of isobutylmethylxanthine (IBMX). As
evidenced by the
capacity of Clonidine to inhibit insulin secretion, one clonal cell line
overexpressing a2AR
((36265/2), was about 10-fold more sensitive to Clonidine than human
pancreatic islets (FIG. 8)
and about 100-fold more sensitive than ~3G18/3E1 cells (FIG. 7).
~iG265/2 cell lines were encapsulated in alginate and injected into the
intraperitoneal
cavity of Zucker diabetic rats to test if an enhanced sensitivity to Clonidine
would extend to in
vivo conditions. Beads were maintained in vivo for 3 - 5 days, or until blood
glucose
normalized. Animals were injected with Clonidine, an agonist of the a2AR
(SO~g/kg) or
Yohimbine, an antagonist of the a2AR (75pg/kg). Blood glucose, rat C-peptide
II, and human
insulin levels were monitored at 20 minute intervals post-injection. As shown
in FIG. 9,
Clonidine injection resulted in a 50% reduction of human insulin in plasma;
whereas,
Yohimbine had no effect on human insulin in plasma. Measurement of rat C-
peptide II
demonstrated that the vascularized endogenous [3-cells were similarly
inhibited by Clonidine,
but unaffected by Yohimbine. These results indicate that the overexpression of
a2AR in RIN
cell lines (~iG 265/2 ) confers an in vivo sensitivity to Clonidine.
CA 02318379 2000-07-12
WO 99/35495 PCT/1JS99/00551
1S3
EXAMPLE 7
Loss of insulin secretion in the absence of FBS.
The progression of NIDDM is characterized by metabolic failure of the
pancreatic (3
cell and the subsequent extinction of glucose-stimulated insulin secretion.
There is can ently no
S optimal in vitro system that models the progressive ~3-cell dysfunction that
occurs in vivo in
NIDDM. FIG. 1OA graphically represents insulin secretion from engineered cell
lines that
have been maintained in culture for one week with (3Gene medium, supplemented
or non-
supplemented with 3% fetal bovine serum (FBS). As shown, withdrawal of serum
for one
week results in the complete ablation of stimulated insulin secretion;
however, basal secretion
is relatively unchanged relative to controls cells that have been maintained
in FBS-
supplemented growth medium. In contrast to the dramatic effect on stimulated
insulin
secretion, the lack of FBS in BetaGene medium has very mild effects on growth,
resulting in
only a 10 - 20% reduction in total cell number relative to controls following
9 days of culture
(FIG. l OB).
1S
The loss of stimulated insulin secretion from engineered (3-cell lines that
occurs in the
absence of FBS in the culture medium (FIG. l0A and FIG. l OB) provides an in
vitro system for
modeling the loss of insulin secretion that occurs in NIDDM. All the aspects
of engineered ~-
cells that make them suitable for the identification of insulin-modulating
compounds also create
an ideal reagent for modeling ~3-cell dysfunction. The effects of FBS-
deprivation shown in
FIG. 10 are relatively rapid, reproducible, and amenable to high-throughput
screening.
Experiments could be designed to identify serum factors that are involved in
the maintenance of
stimulated secretion, identify candidate genes and proteins whose expression
patterns are
modulated by FBS-deprivation, or screen for compounds that maintain stimulated
insulin
secretion despite the absence of FBS in the culture medium. Information from
am~ of these
screens could be informative as to biology of ~i-cell dysfunction in NIDDM and
provide new
insights into the design of therapeutic compounds.
EXAMPLE 8
Overexpression of Somatostatin Receptor to Enhance Sensitivity to Somatostatin
Somatostatin (SS-28) is a peptide hormone
(SerAlaAsnSerAsnProAlaMetalaProArgGluArgLysAlaGlyCysLysAsnPhePheTrpLysThrPheTh
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
154
rSerCys SEQ ID NO:11) that has been shown to inhibit the release of growth
hormone, thyroid
stimulating hormone, insulin, and glucagon. In addition, SS-28 and its
analogue Octreotide
may inhibit growth of some tumors. Preliminary studies indicated that RIN 1046-
38 clonai cell
lines were insensitive to SS-28. Described here is the overexpression of mouse
somatostatin
receptor, type V gene (SSTRV) in a clonal derivative of RIN 1046-38 cell
lines. An SSTRV-
expressing cell line is analyzed with regard to the effects of SS-28 on
insulin secretion.
The cell-based delivery of insulin for the treatment of diabetes is a therapy
that requires
precise regulation of insulin release in order to achieve tight glycemic
control. Historically,
BetaGene, Inc. has introduced transgenes to achieve physiolagically relevant
glucose-sensing in
beta-cell lines. More recently as described in the present invention, the
introduction of
transgenic receptors also has been contemplated so that implanted cell lines
can sense and
respond to a variety of post-prandial and/or hypoglycemic signals. Included in
this effort are
the overexpression cDNAs encoding the following cell-surface proteins:
subunits of the KATp
1 S channel, SUR and Kir, alpha-2 adrenergic receptor, pancreatic polypeptide
receptor, glucagon
like peptide receptor, glucocorticoid receptor, and somatostatin receptor.
The mouse somatostatin receptor, type V gene (SSTRV, Genbank accession number
AF004740) ligated into pBluescript and a rabbit polyclonal antibody that
recognizes the
receptor (Ab9462) were received from the Dr. F. Charles Brunicardi, Baylor
Medical Center,
Houston, Texas. Following replication of the plasmid at BetaGene the DNA was
designated
CW000. CW000 was digested with PpmM I and treated with Klenow. The SSTRV DNA
was
ligated in CW102 that had been digested with Bam HI, filled in with Klenow,
and treated with
CIAP, and the resulting plasmid was designated CX503. (3G 40/110 cells (clonal
derivatives of
RIN 1046-38 overexpressing human insulin and glucokinase) were transfected (EP
603) with
plasmid CX503. Following selection in Zeomycin, 13 colonies were selected for
further
analysis and growth. Portions of the clones were plated onto cover slides and
assayed by
immunocytochemistry for the expression of SSTRV. The primary antibody Ab9462
was
diluted 1/1000 and immune complexes were colorimetrically detected following
incubation
with a secondary antibody, goat anti-rabbit linked alkaline phosphatase. Of
the 13 clones, one
was a high expressor of SSTRV (~iG 603/11 ), and two expressed low levels of
the receptor (~iG
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
155
603/8 and 10). In the other clones (including ~3G 603/7) levels of SSTRV were
below detection
limits of the assay and indistinguishable from the unengineered clones.
Two clones (a high expressor, /36603/11 and a non-expressor, (3G 603/7) were
tested at
S basal and stimulatory conditions with various concentrations of SS-28 added
to media under 2
hr. stimulation conditions. As shown in FIG. 11 A, glucose-stimulated ( 10 mM
glucose) insulin
secretion from (3G 603/11 cells were potently inhibited by 50 pM SS-28;
whereas, ~iG 603/7
cells were resistant to all concentrations of SS-28. Furthermore, the effects
of SS-28 were such
that stimulated secretion from /3G 630/1 I could be reduced to levels below
those observed for
basal. In a second set of experiments, SS-28 was tested as an inhibitor of
various secretagogues
of insulin secretion. As shown in FIG. 1 iB, at 5 nM SS-28 effectively
inhibits stimulated
insulin secretion in the presence of BetaGene Medium with no glucose and under
conditions of
maximum stimulation, Stimulatory Cocktail (BetaGene Media supplemented with 10
mM
glucose. 10 mM each of giutamine, leucine, and arginine, 100 pM carbachol, and
100 pM
IBMX,).
EXAMPLE 9
Insulin expression and processing in ~3G H03 cells
Stable transfection of ~iG H03 with BetaGene plasmid AA603 (simian virus
promoter
40 (SV40) driving expression of neomycin phosphotransferase and
cytomegalovirus (CMV)
promoter driving expression of human insulin) resulted in new clonal cell
lines that were
resistant to 6418 and expressed variable levels of human insulin 0100 - fold
differences
among various clones). Three clones expressing relatively high levels of
insulin were selected
for further study: ~iG 498/20, (3G 498/44, and ~3G 498/4: secreting about 100,
20, and 50 ng/
million cells/ 24 hrs, respectively. The cellular contents and culture medium
of ~iG 498/20
were extracted with acetic acid and fractionated by high-performance liquid
chromatography.
Immunoreactive insulin species were quantified by radioimmunoassay using human
insulin
standards. ProinsuIin was effectively processed to mature insulin, with mature
insulin
representing the majority of the total insulin both in whole cell and media
extracts (FIG. 12A
and FIG. 12B). The chromatography in FIG. 12A was derived the cellular
contents of ~iG
498/20, and FIG. 12B is derived from insulin secreted into the media. These
data verify that
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
156
the proconvertases are active and function efficiently to process insulin in
the clonal cell lines.
The stability of insulin output for ~3G 498/4 has been maintained for > ,0
population
doublings.
EXAMPLE 10
Regulated secretory pathway in (3G H03 cells
(3G 498/20, (3G 498/44, and ~3G 498/45 were also studied for the capacity to
secrete
insulin from the regulated pathway and respond to modulators of secretion.
Cells were plated
in 12-well tissue culture dishes (250,000 cellslwell}, maintained for 72 hrs
in BetaGene
Medium, and washed twice, 20 min each, in HEPES/bicarbonate-buffered salt
solution
(HBBSS; in mmol/1: 114 NaCI, 4.7 KCI, 1.21 KH2P04, 1.16 MgS04, 25.5 NaHCO;,
2.5 CaCl2,
10 mM HEPES) supplemented with 0.1% BSA but lacking glucose. Insulin secretion
was
stimulated by incubating the cells for 2 hrs in HBBSS containing 0.1% BSA and
supplemented
with 10 mM 1BMX. 100 pM carbachol, or 10 nM of the phorbol ester, PMA; all in
the presence
of absence of 10 mM glucose. As shown in FIG. 13A, (3G 498/20 respond robustly
to
carbachol and PMA (about 10 - 15 fold over basal), however, the cells were
unresponsive to
glucose and IBMX. (3G 498/44 and (3G 498/45 were nearly identical in their
secretion profiles
as compared to (3G 498/20. These data are consistent with the presence of a
regulated secretory
pathway; and it appears that protein kinase C-mediated events dominate in the
regulation of
secretion. However, as expected, these lung neuroendocrine cell lines do not
mimic the
response of pancreatic (3-cells or (3-cell lines to glucose alone or the
glucose-potentiator, IBMX.
~iG 498/45 was further engineered for increased levels of insulin expression
by the
introduction of number of plasmids, all of which encoded human insulin but
varied in the genes
encoding antibiotic resistance. T'he 793, 794, and 796 cell lines are
resistant to mycophenolic
acid, puromycin. and hygromycin, respectively. The data in FIG. 13B show the
presence of a
regulated secretory pathway in the progenitor cell line (498/45) and the
maintenance of this
capacity through a second round of engineering (793, 794, and 796 cell lines).
Insulin content
and secretion were increased by about 3- to 4-fold in second generation clonal
cell lines. The
insulin secreted from two of these high-producing clones (793/28 and 793/15)
was fractionated
by high-performance liquid chromatography, and immunoreactive insulin species
were
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
157
quantified by radioimmunoassay using human insulin standards. Proinsulin was
effectively
processed to mature insulin. with mature insulin representing the majority of
the total insulin in
media extracts.
EXAMPLE 11
In vivo analysis of ~3G H03 cells
Due to high levels of insulin secretion, efficient prohormone processing, and
stable
transgene expression, (3G 498/20, was analyzed for performance in vivo in
rodent models of
diabetes. Cells were encapsulated in alginate beads prior to implantation.
Following treatment
of cultures with trypsin/EDTA, cells were washed in PBS and resuspended in
unsupplemented
BetaGene media. Cells were mixed and evenly suspended in a 2% final
concentration of
sodium alginate (50:50 mixture of LV low viscosity and HV high viscosity,
Kelco. CA) in
HEPES buffered BetaGene Medium. Cells were transferred to a syringe and the
suspension
was dispensed through a 25 gauge needle at approx. 0.3 mI/min. Droplets were
blown into a
container holding a 1.35% (w/v) CaCl2/20 mM HEPES solution. The beads were
allowed to
fully congeal for approx. 10 min in the CaCl2 solution. Beads were washed
twice in growth
medium without serum and placed a T-flask with regular growth medium and
incubated for
about 72 hours with one feeding at 48 hours.
EXAMPLE 12
Correction of hyperglycemia in diabetic rats by (3G H03 cells.
NIH nude rats (Strain F344/Ncr-rnu form the National Cancer Institute,
Frederick, MC)
were housed in a sterile isolation facility with free access to sterile
standard laboratory diets and
water. Immune-competent Wistar and Zucker rats were housed in standard
facilities and had
free access to standard laboratory diets and water. To create models of
insulin-dependent
diabetes mellitus (IDDM), pancreatic beta cells were selectively destroyed in
nude and Wistar
rats by intracardiac administration of streptozotocin (STZ (70 mg/kg body
weight}. Blood
glucose was monitored to confirm inducement of diabetes; all animals that
received cellular
transplants had blood glucose levels of greater than 375 mg/dl within 2 days
of STZ treatment.
Alginate-encapsulated cells were surgically implanted into the intraperitoneal
cavity of
anesthetized animals.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
1S8 -
For each in vivo study, animals were divided into two groups: a control group
that
received the parental cells, (3G H03 or low doses of (3G 498/20, and an
experimental group that
received high doses of (3G 498/20. Data in FIG. 14A, FIG. 14B, and FIG. 14C
demonstrate that
S (3G 498/20 cells can reverse hyperglycemia in nude and immunocompetent
hosts, and insulin
delivery in vivo by this cell line is an effective treatment for both IDDM and
NIDDM. In FIG.
14A cells were implanted into STZ-treated, diabetic nude NIH rats (2S million/
100 grams body
weight). The blood glucose values of the control group (n=3) show that the
unengineered
parental line (~iG H03) does not impact blood glucose. In contrast, animals
receiving (3G
498/20 (n=S) had a rapid reduction of blood glucose within 2 days implant, and
this effect was
sustained for greater than 20 days.
To study the effectiveness of ~iG 498/20 cells in an immune-competent model of
IDDM,
encapsulated cells were implanted into STZ-treated, diabetic male Wistar rats
(FIG. I4B). (3G
498/20 cells were implanted at two doses, 12.5 million (n = 2) and 2S million
cells (n =1) per
100 grams of body weight. Control cells ((3G H03) were also implanted at 2S
million cells per
100 grams of body weight (n =2). As shown, both doses of ~3G 498/20 affected a
correction in
hyperglycemia with the following differences: ( 1 ) The higher dose of cells
reduced blood
glucose more rapidly; 2 days versus 4 -6 days for the lower dose. (2) The
higher dose of ~3G
498/20 stabilized blood glucose in the normo-glycemic range for a longer
period of time; 27
days post implant, versus 17 days for the lower dose.
Serum analysis of human insulin and C-peptide and rat C-peptide are consistent
with the
effects on hyperglycemia resulting from secretions from ~iG 498/20. In STZ-
treated Wistar rats,
2S rat C-peptide was reduced to about 4% of normal pre-implant, and on day 7,
post-implant, was
less than 10% of normal C-peptide levels. In contrast, secretion by (3G 498/20
of human insulin
and detection of human C-peptide in the serum. correlated well with cell
number (FIG. 1 S) and
the effects observed on blood glucose (FIG. 14B).
The study of in vivo performance of ~iG 498/20 cells was extended to a model
of
NIDDM, Zucker diabetic fatty (ZDF) rats. Encapsulated ~iG 498/20 cells were
implanted at
CA 02318379 2000-07-12
WO 99135495 PCT/US99/00551
159 _
three doses into obese male (fa/fa) rats: 5 (n=3), 15 (n=3). and 2~ (n=2)
million cells per 100
grams body weight, and blood glucose was monitored as shown in FIG. 14C.
Whereas the
lowest dose of (3G 498/20 cells failed to affect hyperglycemia, the two higher
doses of (3G
498/20 were both effective in nearly normalizing blood glucose by day 5 post-
transplantation.
Human C-peptide levels in the serum correlate with both cell dosing and
correction of
hyperglycemia. The lowest dose of (3G 49820/cells, that failed to affect
hyperglycemia, did not
result in detectable human C-peptide in the serum In contrast, two groups
receiving 15 and 25
million cells per 100 grams body weight, created a dose-dependent increase in
serum levels of
human C-peptide.
EXAMPLE 13
Improved Glucose Tolerance by Treatment with Cells Derived from ~iG H03
As shown in FIG. 16A and FIG. 16B, doses of ~iG 498/20 that reverse
hyperglycemia in
STZ-treated Wistar and ZDF rats also result in improved glucose tolerance. For
tolerance tests,
animals were fasted overnight, tested for levels of blood glucose, and given a
bolus of glucose
( 1 ml of 20% glucose/ 100 gm body weight, injected IP). Blood glucose levels
at "time zero" in
FIG. 16 represent pre-bolus values, and the 15 min. time point was the first
measurement of
glucose post-bolus.
Glucose tolerance testing was performed on the STZ-treated Wistar rats on day
19 post-
transplantation. As shown in FIG. 16A, only the higher dose of cells is
functioning to correct
hyperglycemia at this time point. Likewise, with 25 million ~3G 498/20 cells
per 100 gm body
weight, there is a clamping of hyperglycemic excursion following a glucose
bolus. The rats that
received a low dose of ~iG 498/20 and (3G H03 were glucose intolerant. As
shown in FIG. 16B,
treatment of ZDF rats with (3G 498/20 cells results in a similar pattern: low
cell doses that fail
to correct hyperglycemia do not correct glucose intolerance; however cell
doses sufficient to
reduce blood glucose also improve glucose tolerance. The glucose tolerance
test in ZDF rats
was performed on day 13 post-transplantation.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
160 -
EXAMPLE 14
Reduction of Glycated Hemoglobin using øG H03 cells.
A marker that predicts susceptibility to the long-term complications
associated with
diabetes is glycated hemoglobin (GHb). Sustained, poor glycemic control
correlates with an
excessive glycation of hemoglobin and the subsequent development of
retinopathy, neuropathy,
and nephropathy. Consequently, an important criterion for the effectiveness of
any given
therapy for diabetes is a reduction in percent of hemoglobin that is glycated.
Blood samples
were taken from rats and glycated hemoglobin in the blood was determined with
Helena Glyco-
Tek affinity columns (cat number 5351, Helena Laboratories) as recommended by
the
manufacturer. As shown, in FIG. 17A, in STZ-induced nude rats receiving øG H03
cells, GHb
is greater than 13% of total hemoglobin; whereas, rats receiving insulin from
øG 498/20 cells
have normal levels of GHb (5.4 +/- 0.76 % of total hemoglobin is glycated).
Likewise,
measurements at day 20 of post-transplantation in STZ-treated Wistars treated
with øG 498/20
show about a 33% reduction in percent of total hemoglobin that is glycated as
compared to
untreated controls (FIG. 17B).
EXAMPLE 15
Indications of Immuno-Resistance of Engineered øG H03 cells.
Surprisingly. øG 498/20 cells were as effective and durable in immune-
competent rats
as they were in nude rats (FIG. 14A versus FIG. 14B and FIG. 14C). Though
alginate provides
time-limited and partial protection from the immunotoxicity of the host, it
was expected that
graft survival in the Wistar and Zucker rat strains would be much reduced from
that observed in
the nude rat. The prolonged survival of encapsulated øG 498/20 in two immune-
competent
hosts suggests that this cell line may be intrinsically resistant to the
effects of immune-mediated
killing and cytotoxicity. and/or somewhat invisible to immune surveillance. In
an initial set of
experiments to test this possibility, øG 498/20 and øG H03 cells were exposed
to a number of
human cytokines that are known to participate in immune-mediated cytotoxicity
(FIG. 18A).
Cells were plated into 96- well plates (50,000 /well), grown in BetaGene
Medium for 24 hours
and switched into medium supplemented with cytokines for 48 hours. Viability
of the cultures
was determined by an MTT staining assay. As shown, both øG H03 and its clonal
derivative
øG 498/20 were resistant to various concentrations of Interleukin -lbeta (IL-
Iø), interferon
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
161 -
gamma (IFNy), tumor necrosis factor-alpha (TNFa), and the combined actions of
all three of
these cytokines.
The effect of cytokines on insulin secretion from (3G 498/20 was also tested,
and as
shown in FIG. 18B, the cells' secretory function was uneffected by the effects
of cytokines.
Cells were plated in 48-well plates (90,000 cells/well) and cultured for 2
days. For secretion
studies, cells were washed twice, 20 min each, in HEPES/bicarbonate-buffered
salt solution
(HBBSS; in mmol/l: 114 NaCI, 4.7 KC1, 1.21 KH2P04, 1.16 MgS04, 25.5 NaHCO;,
2.5
CaCl2, 10 HEPES) supplemented with 0.1 % BSA but lacking glucose. Insulin
secretion was
stimulated by incubating the cells in HBBSS containing 0.1% BSA and
supplemented with 10
mM glucose, or 10 mM glucose plus either 100 pM carbachol or 10 nM PMA. After
a 2 hr
incubation, medium was collected and assayed for insulin by radioimmunoassay.
Two sets of
cultures were exposed to cytokines for 24 hours, prior to secretion studies
(24h cytokines, and
24h cytokines + HBBSS + cytokines); and two sets of cultures were supplemented
with
cytokines for the 2 hr secretion period (HBBSS + cytokines, and 24h cytokines
+ HBBSS +
cytokines). The control culture (HBBSS) was not exposed to cytokines. As
indicated. cultures
were exposed to the following mixture of human cytokines that have been shown
to impair
cellular function and cause cell-killing in multiple cell types: IL-1 (3 (5
ng/ml) IFNy (200
units/ml), TNFa and TNF~3 ( 10 ng/ml). Surprisingly, neither short-term
exposure during the
secretion period, nor a long-term 24 hr. pre-exposure to cytokines had any
effect on insulin
secretion from (3G 498/20 cells.
An explanation that is consistent with the data shown in the data shown in
FIG. 18 and
that shown in FIG. 14 (comparable function in immune-deficient and immune-
competent
hosts), is that the alginate provides a time-limited barrier against the
cellular-mediated aspects
of immunotoxicity (20 - 25 days in nude and immune-competent hosts). Since (3G
498/20 cells
are resistant to cytokines (small molecules that diffuse freely across the
alginate barrier) the
function of the cells is equivalent in nude and immune-competent hosts as long
as cellular-
mediated immune killing is prevented by the encapsulation device. The results
shown in FIG.
18 are contrary to the studies of rodent beta-cell lines that have been shown
by multiple groups
to have impaired secretory function and diminished viability when exposed to
cytokines.
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
162 -
Previously, the inventors have shown that both INS-1 and RIN beta-cell lines
are susceptible to
cell-killing by IFNy and that IL-1 ~i is cytotoxic to INS-1 cells (Hohmeier et
al., 1998).
Although protection from IL-1 (3 in these studies was induced by the
overexpression of
manganese superoxide dismutase in the INS-1 cells, a cell line that is
inherently cytokine-
resistant may be a preferred starting material for cell-based delivery of
therapeutic products in
immune-competent hosts.
EXAMPLE 16
High levels of transgene expression in (3G H03 and ~iG H04 cells
In addition to human insulin, ~iG H03 cells have been engineered to express
glucagon
like peptide 1 (GLP-1) and human growth hormone (hGH). The former peptide was
efficiently
processed from the precursor pre-proglucagon and amidated. Clonal cell lines
capable of
secreting 1 ng GLP-1/million cells/ 24 hr were isolated.
The human neuroendocrine cell line (3G H04 was stably transfected with
BetaGene
plasmid AA603 (SV40 driving the expression of neomycin phosphotransferase and
CMV
driving expression of human insulin) resulting in monoclonal cell lines (3G
707/55, 707/63,
707/76, 707/94 and 707/96. The clonal cell lines were studied for their
ability to secrete insulin
in response to various modulators of secretion, as previously described. In
each of the 5 clonal
cell lines insulin secretion did not change with respect to basal in response
to stimulation by 10
mM IBMX, 100 mM carbachol, or 10 nM PMA; and 10 mM glucose. In a subsequent
secretion study, the cells were compared at basal (0 mM) and stimulated (25 mM
KCl + 2.5
mM Forskolin + 50 mM IBMX) conditions in HBBSS. A high concentration of KCl
causes
cell membrane depolarization and a subsequent release of all peptides destined
for secretion.
Forskolin and IBMX enhance the cascade by increasing the production of cAMP,
thereby
stimulating secretion. Thus, this combination of secretagogues should cause
the cells to void
any peptides stored in secretory granules. FIG. 19 illustrates the secretion
response of ~iG
707/55, 63, 76, 94, 96 clones and the a clonal derivative of [3G H03 ((3G
498/45) to the
secretagogue cocktail described above. As expected, ~iG 498/45 cellos, secrete
in excess of
S00 ng/flask/hour of insulin. In contrast, ~3G 707 clonal lines secrete a
negligible amount of
insulin under these conditions. Cell content of (3G 707/55 was analyzed by
HPLC for insulin.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
163 -
A small proinsulin peak was detected, however no mature insulin was detected
within these
cells.
In a separate stable transfection of (3G H04 cells. BetaGene plasmid CD303
(CMV
driving expression of human growth hormone, SV40 driving neomycin resistance)
was used to
establish cell lines resistant to 6418. The monoclonal cell line ~3G 785/5 was
analyzed for cell
content versus secreted human growth hormone on a Western blot. The results
indicated a
small fraction of human growth hormone stored within the cells and a large
fraction of this
peptide in the medium.
These data suggest that the (3G H04 cell line. despite the presence of
multiple proteins
associated with a neuroendocrine phenotype is not a preferred candidate for
secretion of
transgenic peptides from the regulated secretory pathway. These cells use a
constitutive mode
of secretion, rather than a regulated secretory pathway. perhaps due to an
inability to depolarize
I S the cell membrane or an absence of dense core granules for peptide
storage. Several factors
controlling peptide trafficking also may be missing in these cells, further
complicating
regulated peptide release. In addition to falling short of the regulated
peptide secretion
requirements, the (3G H04 cells do not process insulin to its mature form.
Unprocessed
proconvertase 1/2 (PC1/PC2) is present in this cell line. and only proinsulin
is detected by
HPLC. These data highlight the inefficiencies of neuroendocrine cells with
respect to creating
a beta-cell phenotype. Although this cell type displays many desirable factors
needed to mimic
the beta-cell, it also may display many undesirable characteristics,
emphasizing the need to
thoroughly study and analyze each candidate neuroendocrine cell line.
In order to express high levels of a processed peptide hormone from clonal
derivatives
of the (3G H04 cell line, it may be necessary to create fusion proteins
containing a furin site
between a given prohormone sequence and the sequence encoding the mature
peptide hormone.
Such a site may provide the capacity for processing of the transgenic fusion
protein through the
constitutive pathway that apparently dominates secretion from these cells.
Alternatively, the
overexpression of PC1 and/or PC2, proteins involved in granule formation such
as
chromagranin A and chromagranin B, or proteins required for trafficking
through the regulated
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
164 -
secretory pathway such as carboxypeptidase E may be required for restoration
of a functional
regulated secretory pathway in the (3G H04 cell line. Carboxypeptidase E is a
particularly
attractive candidate, as carboxypeptidase E is not expressed in (3G H04 cells.
EXAMPLE 17
Overexpression of GLUT-2 transporter in 498/20 cells results in increased
sensitivity to STZ.
For reasons of safety and/or enhanced mechanisms for regulating secretory
function, a
preferred embodiment in the in vivo delivery of peptides via transplantation
of engineered cell
lines, is the installation of a mechanism that allows for the transplanted
cells to be "turned-off'
in both secretory function and growth potential. Scenarios where this "off
switch" may need to
be employed include a malfunction in the graft, an alteration in the
physiology of the host
creating an incapability with the graft, or a breach in the encapsulation
device rendering it
permeable to cells. Ideally, an "off switch" for the transplanted cells will
be non-invasive to the
host; easy to administer; have short-term, immediate effects; and be selective
for the grafted
cells and non-toxic to the host. One "off switch" that can fulfill these
criteria is the installation
of a negative selection system into the transplanted cells. By definition, the
cells would be
engineered to express a protein that converts a non-toxic substance to a
cytotoxic one, through
catalysis. transport, or binding. Examples of negative selection systems
include herpes simples
virus thymidine kinase in combination with gancyclovir; cytosine deaminase in
combination
with S-fluorocytosine; glucose transporter, type 2 (GLUT-2) in combination
with streptozotocin
(STZ) and the use of nitroreductase. U.S. Patent application serial number
08/546,934 and PCT
publication WO 97/15668 are specifically incorporated herein by reference in
that the
referenced documents provide methods and compositions comprising GLUT-2 and
GLUT-2
chimeras, as such the techniques described therein emphasize the utility of
negative selection
aspects with the present invention.
(3G 498/20 cells, a human neuroendocrine cell line engineered to express
insulin, was
tested for sensitivity to STZ and found to be resistant to cell killing at
concentrations up to 10
mM. ~iG 498/20 cells were electroporated (EP642) with plasmid AD402 (CMVp-
GLUT2/SV40p-Hygro), selected for resistance to hygromycin, and tested by
Western blotting
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
165 _
for the expression of the GLUT-2 transporter. ~iG 642 clones expressed
variable levels of the
transgenic GLUT-2, and those cells transfected with a plasmid conferring
hygromycin
resistance alone (~iG 640-v) did not express detectable levels of the
transporter. The levels of
GLUT-2 in the ~iG 642 clones as detected by Western blot analysis, correlate
with functional
transport capacity. High GLUT-2 expressors were most sensitive to STZ, with
some cell lines
effectively killed at less than 3 mM. These data prove the feasibility of
converting a human cell
line such as ~iG 498/20 from one that is STZ-resistant to a STZ-sensitive
phenotype by the
overexpression of the GLUT-2 transporter.
EXAMPLE 18
Methods for Detection of Secretory Function.
Although measuring insulin in the media of cultured cells is a convenient
method for
assessing secretory function. it may be desirable to create additional read-
outs of cellular
performance that require less time, are compatible with assays currently in
use in the drug
discovery industry, and relate to various aspect of beta-cell metabolism. The
present example
discusses such alternative detection methods.
Two important molecules in (3-cell signaling are ATP and Ca2+. The metabolism
of
glucose is converted to a secretory signal in large part by altering ATP/ADP
ratios. Increases in
this ratio, resulting from increased glycolytic flux, cause closing of the
KA~, ~ channel,
depolarization of the plasma membrane, and increases in cytosolic Ca2+.
Increasing cytosolic
Ca2+ is a common mechanism by which secretagogues stimulate insulin
exocytosis.
Intracellular Ca'+ and ATP can both be detected with assays that are
compatible with
HTS. Numerous methods are currently in use for the detection of Ca2+ by
fluorescence
including those that use dyes. or more recent techniques that depend on
transgenic expression
of proteins that fluoresce in a Caz+-dependent fashion (Scheenen and Pozzan,
1998). Calcium-
binding dyes that increase in intensity of fluorescence in a dose-dependent
fashion. such as
Fluo-3 and Calcium green, are widely used in cell-based assays in the
pharmaceutical industry.
In examples of such assays, (3G 49/206 and ~iG 40/110 cells are washed to
achieve a basal state
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
166 _
in secretion, loaded with Calcium green. and stimulated with various
secretagogues. Insulin
secretion should correlate with increases in calcium-dependent fluorescence.
As an alternative to dyes, it may be desirable to stably express the Cap+-
sensitive
photoprotein aequorin in either (3G 49/206 or ~3G 490/110 cells. It has
recently been shown that
this protein could be targeted to either the cytoplasm and/or mitochondria of
the rodent ~i-cell
line INS-1, and stably transfected clonal derivatives provided a model for
studying the effects
of nutrient-stimulated insulin secretion on subcellular Ca2+ (Maechler et al.,
1997; Kennedy et
al., 1996). Studies from this same group have shown that INS-1 cells
transfected with cytosolic
luciferase served as a model to monitor ATP changes in living cells.
Luciferase-expressing
clones were monitored by photon detection. and shown to be a model for
tracking ATP changes
simultaneously with stimulated insulin secretion (Maechler et al., 1998).
Based on these results, it is reasonable to assume that the secretory function
of
engineered RIN cell lines can be monitored by Ca2+-dependent fluorescence or
luciferase/ATP-
dependent luminescence. 96-well and 384-well detection systems for
fluorescence and
luminescence are currently in use; therefore, these assays may provide an
attractive alternative
or adjunct to the detection of insulin. BetaGene has begun studies with
fluorescent Ca2+ dyes in
~iG 49/206 cells, and is poised to express aequorin and/or luciferase as
needed to enable or
enhance HTS of secretory function.
EXAMPLE 19
Methods for Creating a Human ~i-Cell Line
As described in the previous examples, there may be potential drawbacks for
the use of
existing human neuroendocrine cell lines for glucose-regulated delivery of
human insulin. For
this reason, a two-step transformation procedure has been devised to create a
human (3-cell line
(FIG. 22) Preferred starting materials will consist of either a surgically
removed human
neuroendocrine tumor such as an insulinoma. or isolated primary tissue such as
human islets.
The ~i-cells in these tissues proliferate at a very slow rate, therefore, the
first step is to get them
to grow. This will be accomplished by infecting insulinoma and/or islets with
a recombinant
adenovirus expressing an oncogene under the control of the rat insulin I gene
promoter (RIP).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
167
Adenovirus is the preferred viral vector because it will infect and express
its transgene in
nondividing cells. RIP will selectively express the oncogene, in this case.
temperature sensitive
SV40 T-antigen (tsTAG), in only (3 cells. In response to tsTAG expression the
~3 cells should
proliferate while other cell types remain quiescent. The drawback and
advantage is that
adenovirus does not integrate into the genome and thus will not give long-term
expression of
tsTAG, therefore, a second transformation step is required.
The second step is to immortalize the proliferating ~3-cells by infection with
a
recombinant retrovirus also expressing an oncogene like tsTAG under the
control of RIP.
Retroviruses require cellular division in order to integrate into the genome.
Once integrated
the transgene should be stably expressed resulting in an immortalized cell.
EXAMPLE 20
Culturing of Human Insulinomas
The present invention contemplates the use of cell lines derived from human
insulinomas as starting cells for the instant methods to produce immortalized
human
neuroendocrine cells. This example describes the culturing of human
insulinomas.
Patients with insulinomas are treated by surgical excision of the tumor. At
the time of
excision, the tumor tissue is immediately placed in sterile, tissue culture
media (BetaGene
medium supplemented with 3.5% fetal bovine serum (FBS), 200 U and pg/ml
penicillin/streptomycin, and 50 pg/ml gentamycin). The tissue is kept on ice
and sterile,
keeping the transit time to less than 30 minutes. Using sterile techniques,
the tissue is minced
with iris scissors until it is reduced to pieces 1 mm3 or smaller. The tumor
is then transferred to
40 mesh tissue sieve through which the large pieces are forced using rubber
pestle. The cells
are then washed twice for a period of 15 minutes each with fresh culture media
containing
antibiotics.
The tissue is then split onto standard Falcon tissue culture dishes and dishes
coated with
matrigel extracellular matrix. The tissue is maintained under standard tissue
culture
atmospheric conditions of 37°C; 5% C02/95% air; and humidified. The
tissue is then cultured
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
168 -
with media composed of 30% conditioned tissue culture media (BetaGene medium
containing
3.5% fetal bovine serum (FBS) conditioned by culture with ~3G 261/13. a rat ~i-
cell line stably
transfected with pCB6 expressing the full length human growth hormone coding
region), 70%
BetaGene Medium product # 62469-79P, 1% FBS, 50 pg/ml gentamycin. To prevent
loss of
unattached cells, only 75% of media is replaced by removing old media from the
top of the
dish. Using this approach a human insulinoma (HT6#2) was cultured. and has
been found to
secrete insulin for over I50 days (FIG. 23).
EXAMPLE 21
Rat Islet Isolation
Rat islets from adult animals weighing 150-200 g were isolated using the
following
protocol. Rats were anesthetized with i.p. injection of Nembutal. placed on
their back ventral
side up. and the abdominal area was wetted with 70% alcohol. Using large
forceps and large
scissors a midsagittal cut through the skin and musculature from hip level to
xiphoid process
was made to expose the abdominal cavity. Lateral cuts through skin and
musculature were
made at the level of the ribs to fold abdominal walls down. The duodenum was
located under
and adjacent to the liver on the animals right side. The bile duct was clamped
where it enters
the duodenum with a hemostat, which was positioned so the bile duct was
straightened out but
not stretched.
The bile duct was blunt dissected from liver adhesions and connective tissue
at the level
of the liver hilus, while being careful not to rupture the descending aorta
directly beneath bile
duct. The bile duct was held with fine forceps as close to the hilus
bifurcation as possible.
While the bile duct was lifted slightly, microscissors were used to nick the
bile duct just
downstream of the forceps hold. The beveled end of cannula was inserted into
the bile duct
lumen through the nick, and the end of the cannula was worked down the bile
duct to a level
past the bile duct branches to the liver lobes. With slow steady pressure, 6
ml of ice cold
collagenase solution (2 mg collagenase P/ml, Boehringer I 249 002) was
injected into pancreas
through the bile duct. The dorsal aspect of the diaphragm was cut to allow
access to the heart,
and the left ventricle was bisected with the scissors.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
169
Using forceps. the pancreatic attachments to the large intestine, the
mesenteric
attachment of the duodenum, and the spleen attachment to greater curvature of
stomach were
dissected. Then the pancreatic fat from the spleen to the stomach was cut, and
while holding
the duodenum at the pylorus, the gut was bisected on the duodenal side of the
pylorus. The
duodenum and attached pancreas was removed from abdominal cavity by cutting
the
connections to the dorsal cavity wall, the spleen and the gut. The pancreas
was then placed in
weight dish and any remaining fat and lymph nodes were trimmed off. The
pancreas was
transferred to a 50 cc tube on ice, and digested in a 37°C water bath
for 17 minutes. The
digestion was stopped by adding ice cold M199/5% NBS to the 40 ml mark. The
tube was then
shaken sharply for 5 strokes, and then centrifuged at 1000 rpm for 2 minutes.
The supernatant
was decanted, and the 40 ml wash was repeated with ice cold M199/%S NBS a
total of 3 times.
Any remaining undigested connective tissue was removed.
The pellet was resuspended in 20 ml of media, and the digest was poured
through a
tissue sieve and collected in a fresh 50 ml tube. The original tube was rinsed
with 20 ml of
media, and the rinse was poured through the tissue sieve. The sample was
centrifuged at 1000
rpm for 2 min, the media was poured off, and the tube was drained upside down
on a paper
towel to remove as much media as possible. Then 10 ml of Histopaque-1077
(Sigma 1077-I}
was added, and the pellet was resuspend by vortexing maximally for an instant
(2 sec). At this
point, 10 ml of media was slowly added to form the top layer of the gradient.
The sample was
centrifuged in a swinging bucket rotor centrifuge at 2400 rpm for 20 min. The
islet tissue
settled at the interface between the histopaque and the media. The islets were
removed with a
pipette, placed in a fresh 50 cc tube, and washed twice with media. The islets
can be stored for
several hours at 4°C. The islets were transferred to a petri dish and
visualized with a
stereoscopic dissecting microscope and a lateral fiber optic light source. The
islets were
separated from non-islet tissue debris prior to use with an eppendorf
microtip.
1. Islet Cell Dispersal and Culturing of Islets
6000 islet equivalents were placed in a 50 ml tube, brought up in PBS (calcium
and
magnesium free), and then centrifuged to pellet the islets. The islets were
resuspended in 5 ml
of trypsin/DNAse solution ( 1 mg/ml trypsin, 30 pg/ml DNAse final in PBS), and
incubated for
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
170
15 min at 37°C, shaking vigorously every ~ minutes. The sample was
refluxed through a 10 ml
pipet if large pieces were visible. To stop the digestion ~ ml. of ice cold
media was added. and
the sample was placed on ice. The cells were pelleted at 600 rpm for 5 min,
and resuspend in 6
ml fresh media. The islets were cultured on two types of matrices. In some
studies, Matrigel
S (collaborative Biomedical, #40234) was used as described by supplier with
the following
changes. Matrigel was thawed overnight at 4 °C and then diluted 1:4
with Medium 199 without
FBS. 2 ml was added to each well of a 6 well plate, and the excess was
removed. The matrix
was polymerized for 1 hour at room temperature, followed by a rinse with PBS.
Coated plates
were then placed at 50°C for 2 hours to further dry the matrix. Coated
plates are stored at -
20°C, and then thawed and rinsed once with PBS prior to plating cells.
Alternatively, an extracellular matrix produced by the human bladder carcinoma
line.
HTB-9 (American Type Culture Collection. ATCC HTB-9 (5637)) was used. HTB-9
matrix
was prepared by culturing the cells to confluency in RPMI 1640 with 10% FBS as
indicated by
the supplier. Media was aspirated and cells washed and lysed in water. This
was repeated two
times to ensure complete cell lysis. The remaining matrix was incubated for 10
to 15 minutes
in PBS, rinsed two more times with PBS. and then stored indefinitely under PBS
at 4°C. Prior
to plating of dispersed cells, the PBS is aspirated. Cells are plated onto
both Matrigel or the
HTB-9 matrix in Medium 199 containing 4% FBS.
Whole or dispersed rat islets isolated from the pancreas of Sprague-Dawley
rats by
collagenase digestion and density gradient centrifugation were plated on
culture dishes coated
with either matrigel matrix or extracellular matrix derived from the bladder
epithelial cell line
HTB-9. In the case of dispersed and whole islets on HTB-9 matrix, the cells
attached and
spread to form a discontinuous monolayer rapidly. Greater than 90% of the
islet cells in
dispersed islet cultures had formed monoiayer plaques after two days culture.
Whole islets.
probably due to their greater cell mass. formed monolayers slower than
dispersed islets.
Typically in the whole preparations the islet cells spread from the periphery
to form a
monolayer ring comprising approximately 50% of the islet cells with the
remaining islet cells in
the central multilayer islet remnant after 2 days culture on HTB-9 matrix.
Attachment and
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
171
spreading of both dispersed and whole islets on matrigel extracellular matrix
was slower and
less complete than that observed for HTB-9 matrix. After 6 days culture, about
70% of
dispersed islet cells were in monolayer plaques. and peripheral monolayer
zones were just
forming on whole islet plaques. In general islet cells on matrigel matrix
tended to be taller and
rounded in contrast to HTB-9 cultures in which the cells were flattened and
spread over a larger
area. Fibroblasts from the islets were observed in both the matrigel and HTB-9
matrix cultures
but were a minor population ( 1 to 5%) compared to the epithelial like
presumed endocrine cells.
EXAMPLE 22
Human Islet Function in BetaGene Medium
Human islet preparations were obtained from the distribution center of The
Diabetes
Research Institute, Miami FL. The volume of islets received are expressed in
islet equivalents
(IEQ). An islet equivalent is the number of cells/volume that is found in an
islet with a
diameter of a 150 pm. Insulin content and secretory response of the islets was
assayed first
upon receipt and second after culture in BetaGene medium. Proper insulin
processing was also
analyzed before and after culture in BetaGene medium.
Methods
1. Receipt and preparation of islets
Islet preparation suspensions were spun down in a bench top centrifuge at 1000
rpm for
2 minutes at room temperature to pellet the cells. The shipping medium was
aspirated leaving
approximately 5 ml behind to avoid disrupting the pellet. The pellets were
resuspended in the
remaining 5 ml medium and transferred to a new 50 ml conical tube. About 40 ml
of BetaGene
medium supplemented with 2% fetal bovine serum, 500 mg/ml gentamycin, 200
units/ml
penicillin, and 200 mg/ml streptomycin was added to each suspension and
allowed to incubate
at room temperature for 15 minutes. The samples were spun down a second time,
all but 5 ml
of the medium was aspirated, and a fresh aliquot of BetaGene medium with
supplements was
added and allowed to incubate for another 15 minutes. After the second and
final incubation,
the islets were spun down and all of the medium was removed. The pellet was
resuspended in
complete BetaGene medium at a density of 1000 IEQ per milliliter.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
172
2. Alginate Encapsulation of Human Islets
The study of islets in long term culture is facilitated by encapsulating the
cells in
alginate. Islet cells do not divide in culture and may be overrun by various
replicating cells
which are present in islet preps as shipped. Encapsulating the cells
immediately upon receipt
S minimizes the growth of fibroblasts and other cell types.
The islets were resuspended in a 2% sodium alginate solution (50% high
viscosity and
50% low viscosity sodium alginate made up in complete BetaGene medium) at a
concentration
of 1000 IEQ per 1 milliliter of alginate. The suspension is transferred to a
syringe and allowed
to sit at room temperature for 5 minutes to allow all air bubbles to rise to
the surface. A 25
gauge needle is attached to the syringe and the islet/alginate slurry is
dispensed through the
syringe into a 50 ml conical tube containing approximately 35 mls of I.35%
CaCl2 /20 mM
HEPES. Beads are formed as the slurry hits the surface of the CaCl2 solution,
and are
completely polymerized after about 10 minutes. The CaCl2 solution is removed
carefully and
the beads are washed with two volumes of BetaGene medium / 20 mM HEPES. The
encapsulated islets were then cultured with the medium under conditions
described for each
study.
The glucose concentration of BetaGene Medium was based on the glucose
concentration that was provided 50% maximal stimulation during acute secretion
studies. Initial
studies (n=S independent islet preparations) indicated that SO% maximal
stimulation of human
islets was provide by a medium glucose concentration of 7.410.2 mM. The
glucose
concentration of unmodified BetaGene Medium was manufactured at 7.8 mM glucose
(or 140
mg/dl ).
3. Insulin Content and Processing of Human Islets
A portion of each islet preparation was used to assess insulin content of the
islets upon
receipt. Prior to culture in BetaGene medium, 2000 IEQ were removed from the
stock and
spun down to pellet the islets. The medium was removed completely without
disturbing the
cell pellet. The islets were washed one time with phosphate-buffered saline
(PBS) and spun
CA 02318379 2000-07-12
WO 99/35495 PCT/US99100551
173 -
down. The pellet was dispersed in 0.5 ml content buffer ( 1 M acetic acid. 0.1
% BSA) and
frozen at -80°C. The cells were thawed, sonicated (3 bursts at setting
S-6) and the insoluble
debris were pelleted at 14.000 rpm for 10 minutes at 4°C. The
supernatant was then transferred
to a clean tube and a portion was analyzed by HPLC.
The HPLC system used for resolving insulin from its precursor, proinsulin:
Beckman System Gold with 166 Detector, 126 Solvent Module, 502 Autosampler
Gilson FC 204 Fraction Collector (set up to collect in deep 96 well plates)
Columns used for separation:
Merck RP-C 18 LiChroCART 250-4 (250mmx4.6mm)
LiChrospher 100 (S hem)
Guard column:
Merck RP-C 18 LiChroCART 4-4
LiChrospher 100 (S Pm)
Column and guard in column heater set to 30°C.
Ultraviolet absorption was monitored at 213nm. The 2 buffers used were
following:
A= TEAP pH 3.0
mM triethylamine (2.8 ml/1 )
20 50 mM ortho-phosphoric acid (3.4 ml/1)
50 mM sodium perchlorate (7.03g/1)
pH to 3 with NaOH
B= 90% acetonitrile (ACN)/ 10% water (degassed RO/DI water)
Gradient used:
33% B -35% B over 10 minutes and after 40 minutes the gradient was increased
to 40%
B over 90 minutes. Samples were collected from 0-96 minutes.
Flow rate was 1 ml/min and 1-min fractions were collected in deep-well 96 well
plates.
To each well 100~d of O.SM boric acid (31g/1), 1% BSA (lOg/1) pH 9.3 (NaOH)
was added and
samples were frozen at -80°C and lyophilized.
CA 02318379 2000-07-12
WO 99!35495 PCTNS99/00551
174 _
Samples were then reconstituted in lml PBS/0.1% BSA (RIA ~~rade) and
immunoreactive insulin was assayed using a commercially available
radioimmunoassay kit
("Coat-A-Count Diagnostic Products Corp., Los Angeles, CA).
Encapsulated islets were cultured in BetaGene medium and fed 3 times weekly.
The
islets were removed from the alginate to extract the insulin content. To
recover the islets, the
beads were incubated in 6 mM EDTA/10 ml BetaGene medium and the alginate was
dispersed
by pipetting until the mixture became homogeneous. The mixture was centrifuged
at 1 /2 speed
in a benchtop centrifuge for 5 minutes, the supernatant with alginate was
removed and the islets
washed with 10 ml PBS/2mM EDTA. The solution was spun again and the pellet was
resuspended in 5 ml PBS to remove EDTA, spun again and resuspended in content
buffer for
analysis by HPLC as described above.
4. Glucose Dose-responsive Secretion
Alginate encapsulated islets were cultured in 24 well plates for at least 4
days, with X50
IEQ/ well (or 5 beads) in 2 ml of medium. The day before the study the culture
medium was
replaced with fresh medium. The day of the study the islets are equilibrated
for 90 minutes
with BetaGene Medium with low glucose. The medium was then removed and
replaced with 1
ml of RPMI without glucose, or Modified BetaGene Medium, (manufactured without
glucose),
that was supplemented with glucose to provide concentrations between 2.2 and
22 mM glucose,
and 22 mM + IBMX. The islets were then incubated at 37°C for 90 minutes
and samples
collected at the end of 90 minutes for assay of insulin. Each experimental
value usually
represents results from 6 replicate wells. The glucose concentration providing
50% of maximal
stimulation (Stim-50) was calculated from the fitted line of the glucose dose-
response curve.
Results
Cultured Human Islets and Insulin Secretion
Results in the literature indicate that culture of human islets with high
glucose ( l l-22
mM) is deleterious to secretory function. However, others have indicated that
the effects of
high glucose were dependent on culture medium used. Culture (> 2 weeks) of
human islets was
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
17~ -
reported to result in a progressive loss of glucose-responsive insulin
secretion over 2 weeks.
Different media or glucose concentrations slowed but did not prevent this
loss. The glucose
concentration of BetaGene Medium was based on the concentration that gave 50%
of the
maximal glucose-induced response. The effect of different glucose
concentrations were tested
S to ensure that a medium glucose concentration based on 50% stimulation was
appropriate.
Islets were cultured in BetaGene Medium with 3.9. 7.8 and 22 mM glucose for ~2
weeks. The
secretory responses to glucose concentrations of 3.9 mM, 22 mM and 22 mM +50
pM IBMX
were then compared. Although lower glucose was less deleterious than the
higher
concentration, both resulted in impaired secretory response (FIG. 24). The
results demonstrate
that neither lower nor higher concentrations of glucose provide improved
performance. These
results confirm that 7.8 mM glucose in BetaGene Medium is sufficient to
sustain secretory
function of human islets.
The serum requirements of human islets were tested in long term (>_ 2month)
cultures
supplemented with various amounts of serum, 1 %, 3.5%, or 10% FBS and 5% horse
serum
(ES). In four independent isolations the average daily insulin output for 60-
90 days was
minimally affected by amount of serum supplementation. However, the overall
tendency was
for higher FBS to yield lower output. Similarly, in an acute secretion
experiment, insulin
secretion from islets cultured in 10% FBS exhibited lower response to glucose
or to a stronger
mixed secretagogue stimulus (FIG. 25). The sustained insulin output from human
islets with
I% FBS supplementation (in BetaGene Medium) suggested that human islets also
may secrete
insulin and survive under serum-free conditions.
In order to compare the effect of different media, per se, on human islets,
the insulin
output over 2-3 months was studied without serum. Islets were cultured with
BetaGene
Medium, Medium 199, alpha MEM, and CMR1., all with equivalent glucose, and 0.1
% BSA.
In all four isolations the insulin output was the highest with islets cultured
in BetaGene
Medium (FIG. 26). In fact, the average insulin output of BetaGene Medium
without serum-
supplementation was not markedly different from cultures, of the same
isolation, cultured with
3.5 or 10% FBS (average serum-free with 4 isolations studied was 112% of
cultures
supplemented with 3.5 & 10% FBS). Many transplant surgeons consider CMRL the
medium
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
176 -
of choice for use with human islets (Wamock et al.,). However. CMRL performed
the poorest,
essentially with no islet survival past 2 months with all 4 isolations
studied.
The capacity of BetaGene Medium to sustain the dose-responsive nature of the
insulin
secretory response was evaluated with continuous cultures. Human islets were
stimulated with
varied glucose concentrations at intervals to monitor secretory changes that
may occur with
time. It has been previously noted that the capacity of human islets to
respond to glucose is
impacted by isolation methods and conditions, in particular, cold ischemia
time. Cold ischemia
of the preparations studies varied between 10 and 22 h. Variables related to
donors and
isolations produce considerable variation among islet isolations. As a result,
the magnitude of
response shown in FIG. 27 is not found with all preparations. However, a
common finding was
an initially poor response, with increased function with time of culture in
BetaGene Medium,
and a maintained capability to secrete insulin in response to glucose for
times >4 months (FIG.
27).
The sustained secretory function for months in culture was also accompanied by
maintained insulin content and insulin processing. This is illustrated with
both islets that have
initially iow or initially high insulin contents, and with islets that
initially exhibit minimal
insulin processing capacity. The insulin content of islets from HI28 was low
upon arrival, 0.3
ug/1000 IEQ with >90% mature, processed insulin. The islets secreted in
response to glucose,
with 50% stimulation at 7.5 mM. The insulin content of mature, processed
insulin with HI28
islets cultured 1.5 months in BetaGene Medium was increased 4 fold to 1.3
p.g/1000 IEQ. An
islet preparation, HI26, with an initially high insulin content of 5.0 pg/1000
IEQ, and 94%
mature insulin, was cultured long term. The insulin content of these islets
were maintained for
72 d of culture with BetaGene Medium. The final insulin content was 4.97
pg/1000IEQ, with
89% mature. processed insulin. Finally, culture in BetaGene Medium restored
processing with
2 islet isolations that initially had almost no mature insulin. FIG. 28 shows
the fractionation of
insulin extracted from islets of HI21. Initially (FIG. 28A), 99% of the
insulin was unprocessed
insulin, with only 29 ng mature insulin/1000 IEQ. The mature insulin content
was increased
18-fold to 512 ng/1000IEQ after 4 weeks of culture in BetaGene Medium; this
represents >90%
of the insulin content (FIG. 28B). Another islet preparation initially making
only proinsulin
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
177
arrival, HI27. Essentially 100% of the insulin content was proinsulin, prior
to culture. HI27
islets were cultured 8 weeks and then insulin content was fractionated by
HPLC, with this
isolation as well. islets had regained the capacity to process insulin. In
both of these
preparations, while insulin processing improved the total insulin content
(mature + unprocessed
insulin) was decreased.
These data demonstrate that human islets cultured in BetaGene medium exhibit
improved secretory function, maintained glucose-responsiveness, while
maintaining or even
increasing proteolytic processing of insulin and insulin content.
EXAMPLE 23
Expression Plasmid Constructs for Enhanced Proliferation and Immortalization
A temperature-sensitive mutant of the SV40 large T antigen, tsA58 (Bourre and
Sarasin
1983) was isolated from pBS/tsA58. The tsA58 coding region (tsTAG) was
isolated by partial
digestion with Hpal. treatment with Klenow fragment, followed by digestion
with EcoRl. The
resulting 2532 base fragment was ligated into pCMV8/IRES/Neo (Clark et al.,
1995)
previously digested with BamHl, Klenow treated, then digested with EcoRI. The
resulting
expression plasmid, pCMV/tsTAG/IRESINeo, expresses a bicistronic message
driven by the
human cytomegalovirus promoter with the tsTAG upstream of the 6418 resistance
gene. Drug
resistance to 6418 results from translation of the downstream Neo gene due to
the internal
ribosome entry site (IRES, Macejak and Sarnow, 1991). A second tsTAG
expression plasmid
was constructed in which the CMV promoter was replaced with the rat Insulin 1
promoter
(RIP). pCMV/tsTAG/IRES/Neo was digested with SpeI and EcoRI. removing the CMV
promoter, and replaced with RIP on a 440 by SpeIlEcoRI fragment derived from
pRIP7/INS
(Clark et al., 1996), generating pRIP/tsTAG/IRES/Neo.
Recombinant adenoviruses expressing tsTAG under the control of either the RIP
promoter or the CMV promoter were constructed. The tsTAG encoding fragment was
isolated
from pCMV/tsTAG/IRES/Neo by digestion with SaII, treatment with Klenow
fragment,
followed by EcoRl digestion. The fragment was ligated into pAC/RIP that had
been digested
with BamHI, Klenow treated and digested with EcoRI, generating pAC/RIPtsTAG.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
178 -
pAC/CMVtsTAG was constructed by removing tsTAG from pBS/tsA58 and ligatin~~
into
pAC/CMV to produce pAC/RIPtsTAG.
293 cell culture and generation of recombinant adenovirus stocks, conditions
for
adenovirus stocks, as well as conditions for adenovirus infection of cells are
done as described
(Becker et al., 1994b; incorporated herein by reference).
Retroviral expression plasmids were constructed in order to produce
recombinant
retroviruses capable of expressing tsTAG under the control of the tissue-
specific rat insulin
promoter. A fragment containing RIP/tsTAG was isolated from
pRIP/tsTAG/IRES/Neo by
digestion with SaII, Klenow treatment followed by SpeI digestion. This
fragment was ligated
into pBS/hGH PolyA that had been treated with XbaI, Klenow treated and
digested with SpeI,
generating pBS/RIP/tsTAG/hGH PolyA. The hGH PolyA sequence in pBS/hGH PolyA is
a
625 base sequence which directs efficient transcriptional termination and
polyadenylation of
mRNAs. Finally, pBS/RIP/tsTAG/hGH PolyA was digested with SacI, Klenow
treated,
followed by digestion with ,SaII allowing isolation of a RIP/tsTAG/hGH PolyA
containing
fragment. This fragment was ligated into two retroviral plasmids, pBabeNeo and
pBabePuro
(Morgenstern and Land 1990), following digestion with SnaBI and SaII.
generating
pBabeNeolRIPtsTAG and pBabePurolRIPtsTAG, respectively. Additionally, the same
.Sacl,
Klenow treated, SaII digested fragment from pBS/RIP/tsTAG/hGH PolyA was
ligated into
pXTI (Stratagene, Inc.) that had previously been digested partially with SaII,
Klenow treated,
then digested with XhoI, generating pXT 1 /RIPtsTAG. Rat insulin promoter
driven
transcription of tsTAG is in the opposite orientation with respect to the
retroviral LTR in all
three plasmids. Several packaging cell lines for production of recombinant
retroviruses are
available (Miller and Buttimore, 1986; Danos and Mulligan, 1988; Miller,
1992).
An alternate approach to ensure that tsTAG is driven by the RIP promoter and
not by
the viral LTRs is to replace the normal untranslated region (UTR) of the
retrovirus with a
mutated UTR (von Melchner er al., 1990; GenBank accession numbers M33167
through
M33172, inclusive), which results in the loss of promoter/enhancer activity of
the retroviral
LTR. The mutated UTR strategy has been used previously for promoter trapping
(von
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
179 -
Melchner et al., 1990). In the present invention, the inventors contemplate
using this technique
to confer specificity to the RIP promoter incorporated into the mutated
retrovirus.
In addition to tsTAG, two more immortilization genes, the human papilloma
virus 16
E6/E7 genes, were obtained from Dr. Jerry Shay and Dr. Woody Wright at the
University of
Texas Southwestern Medical Center. These genes were cloned into the viral
vector backbone
LXSN (Miller and Rosman, 1989). E6/E7/LXSN was then introduced into the PA317
packaging cell line to produce replication -. defective recombinant
retrovirus.
The full length IGF-1 receptor mRNA (Genbank accession number: X04434) was
reverse
transcribed and amplified by the polymerase chain reaction (RT-PCR). Total RNA
was
isolated from A549 cells using RNAzoI B RNA isolation reagent (Cinna/Biotex
Laboratories
International). RT-PCR was performed using SuperScriptTM Preamplification
System (Life
Technologies) followed by amplification with High Fidelity Platinum Taq
polymerase (Life
Technologies). One microgram of total RNA was transcribed at 42°C
followed by 35 rounds of
amplification with denaturation at 94°C (30 sec), annealing at
55°C (30 sec) and extension at
68°C (4 min and 30 sec) using oligonucleotides AT242;
5'GAGAAAGGGAATTCCATCCCAAATA SEQ ID N0:12 and AT249; 5'
TTCAGGATCCAAGGATCAGCAGG SEQ ID N0:13. The IGF1 receptor cDNA was gel
purified and cloned as an EcoRllBamHl fragment into EcoRllBamHl digested CW102
resulting
in plasmid DM202.
EXAMPLE 24
Cell-Specific Expression of tsTAG and beta-galactosidase
Human islet preparations and insulinomas contain many other cell types besides
(3-cells,
therefore, it is important to target oncogene expression to (3-cells. The use
of RIP or a modified
RIP promoter (discussed in Example 8) linked to an oncogene like tsTAG should
target
expression solely to (3-cells as long as there is not promoter interference
from viral promoters
like retroviral LTRs. LTR interference could result in expression of tsTAG in
other cell types
besides (3-cells, thus creating a more difficult task to isolate an
immortalized ~3-cell line.
CA 02318379 2000-07-12
WO 99135495 PCT/US99100551
180 -
1. Stable Transfection of tsTAG
Cell-specific transcription of tsTAG was determined for both
pBABE/Neo/RIPtsTAG
and pXTl/RIPtsTAG (construction of these plasmids is detailed in Example 6) in
RIN cells and
in 293 human fibroblast cells. The retroviral plasmids were stably transfected
into both cell
types and levels of tsTAG mRNA and protein were determined by Northern and
Western
blotting, respectively. Significant levels of tsTAG mRNA and protein were
detected in RIN
cell extracts containing either retroviral plasmid, whereas. no expression of
tsTAG mRNA or
protein was observed in 293 cell extracts containing either retroviral
construct. Temperature
sensitivity of tsTAG was also observed in RIN cells as significantly more
tsTAG protein was
produced at the permissive temperature of 33.5°C than at the
nonpermissive temperature of
37.0°C. This result corroborates the findings detailed by Frederiksen
et al. (1988) in which
high-level expression of tsTAG was observed by immunostaining at
33.0°C, but almost no
expression was observed at 39.0°C. Because there was no tsTAG present
in 293 cells, these
results confirm that the viral LTR is not interfering with RIP to express
tsTAG in non-(3-cells.
2. Viral Delivery of tsTAG
RIN 1046-38 cells were infected with adeno/RIP-tsTAG at varying multiplicities
of
infection (MOI). The virus was left on the cells fbr 2 hours then washed off
and the cells
received fresh medium. The infected cultures were incubated at 37°C for
48 hours then were
shifted to 33.5°C for an additional 48 - 72 hours. The cells were
washed with PBS and then
fixed in Carnoy's fixative for immunocytochemistry. The anti-TAG antibody used
to detect
TAG expression in RIN cells was from Santa Cruz Biotechnology. Roughly, 10 to
20 % of the
RIN cells were intensely stained for TAG expression at MOIs of approximately
30 to 300 viral
particles per cell.
To provide a higher probability of obtaining ~3-cell lines, recombinant
plasmids utilizing
the insulin promoter engineered for enhanced activity are constructed (see
Example 8). These
constructs provide (3-cell specific expression of the oncogene, and in the
case of the insulin
promoter with enhanced function, also provide a level of gene expression
nearly equivalent to
that achievable with the CMV promoter.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
181 -
3. Adenovirus Infection of Rat Islet Primary Cultures
The media was aspirated off 6 well cluster dishes containing primary cultures
of islets
with the cells well attached to dishes. Then 2 ml of M199 media/10% FBS
containing 1000
pfu/cell was added (estimating 500,000 cells from 500 islets and 5 x 10g pfu/2
ml media). The
sample was incubated at 37°C for I hour, the media was aspirated, and
then 6 ml of M 199/4%
FBS was added. The sample was cultured for 24 hours, and then expression was
checked.
Representative cultures of dispersed and whole islet preparations on both HTB-
9 matrix
(2 day old cultures) and matrigel matrix (6 day old cultures) were infected
with adenovirus
expression vectors for (3-galactosidase under control of either the CMV
promoter (pAC-CMV-
~i-gal) or the rat insulin 2 gene promoter (pAC-RIP-(3-gal). After 24 hours,
cultures were
cytochemically stained using the (i-galactosidase substrate X-gal to
characterize expression
efficiency. Fresh stain containing 1.75 mM K3Fe(CN)6, 1.75 mM KaFe(CN)6, 2 mM
MgCl2,
1 mg/ml X-gal in water was made up. The cells were washed once with PBS, and
then fixed
for 20 min at room temperature in 0.5% formaldehyde. The cells were washed
again with PBS,
1 ml of stain was added, and the sample was incubated for 30 min at
37°C. The cells were then
washed once with PBS. In all culture preparations, dispersed and whole islet
on matrigel or
HTB-9 matrix. staining appeared faster, more intensely, and with higher
frequency (greater than
80% of cells) in cultures infected with pAC-CMV-(3-gal than in cultures
infected with pAC
RIP-(3-gal (about 50% of cells).
These results indicate that CMV is a more efficient gene promoter in cultured
rat islet
cells than the rat insulin promoter although at this time it cannot be ruled
out that the difference
in ~3-gal expression under these promoters was due to differences in the titer
of viable
adenovirus used to infect the islet cultures. It was also observed that f
broblasts stained for the
presence of ~3-galactosidase in cultures infected with pAC-CMV-~i-gal but did
not stain in
cultures infected with pAC-RIP-(3-gal indicating a specificity for RIP
promoter expression in
islet (3-cells. These studies demonstrate the feasibility of maintaining
primary cultures of islet
tissue and using adenovirus expression systems to modify protein production of
these cultures.
CA 02318379 2000-07-12
WO 99/35495 PCT/U599100551
182 -
1. Additional promoters for expression of transgenes in neuroendocrine cells;
the a-
glycoprotein promoter.
The pituitary gland secretes a number of different hormones including
leutenizing
hormone (LH), thyroid stimulating hormone (TSH) and follicle stimulating
hormone (FSH)
S using a regulated secretory pathway. Each of these hormones contain an alpha
and beta
subunit. The beta subunits are expressed only in the appropriate pituitary
cell types, giving
specificity to each hormone. The alpha subunit, called a-glycoprotein, is
common to all
pituitary hormones and is expressed in all pituitary cell types. Although
expression of this
protein is fairly ubiquitous in the pituitary, it is postulated to be specific
to neuroendocrine cell
types only. In transforming pituitary tissue and/or pituitary tumors, the a-
glycoprotein
promoter may aid in expression of transforming proteins within neuroendocrine
cells only and
not within non-neuroendocrine cell types which may be also be present in the
culture or tumor.
The a-glycoprotein promoter (Genbank accession number L05632) was amplified by
PCR from human liver DNA (Clontech) using Taq Plus Long (StrataGene).
Oligonucleotides
AT255 (GGGGAACTAGTAAACTCTTTGTTGAAG SEQ ID N0:14) and AT256
(CTCAGTAACTCGAGTTAATGAAGTCCT SEQ ID NO:15) were used in 40 rounds of PCR
with denaturation at 94°C ( 30 sec), annealing at 55°C (30 sec}
and extension at 72°C (2 min) to
amplify the promoter. The promoter was cloned as a Spe IlXho I fragment into
the SpeI/ SaII
site of BetaGene plasmid BL436 (CMV-neo), creating BetaGene plasmid DM102 (a-
glycoprotein-neo).
AtT20, RIN38, and H03 cells were transfected with BetaGene plasmids BL436
(CMVneo), BY428 (RIPneo) and DM102 (a-glycoprotein-neo} by electroporation as
previously described. Clones resistant to 6418 were counted after 13 days of
selection.
Pituitary cells (AtT20) transfected with BY428 did not survive selection with
6418. DM 102
created about 75% fewer clones than BL436 in the same cell line. In RIN38 (rat
insulinoma)
and H03 (human neuroendocrine) cells, DM102 colony formation was equivalent to
BY428
with BL436 creating 75% more clones. These data indicate that the
a-glycoprotein promoter may provide neuroendocrine-specific gene expression.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
18J -
EXAMPLE 25
Modified Insulin Promoters
The rat insulin 1 gene promoter fragment (RIP) was modified in an attempt to
strengthen its transcriptional activiy. The principal modification involved
the attachment of
varying numbers of Far-FLAT minienhancers (FF minienhancer) (German et al.
1992 ) to
different positions within an intact RIP or to a RIP truncated at -205 (-
205RIP}. FF
minienhancers were constructed by generating oligonucleotides corresponding to
the region of
RIP between -247 and -196: 5'-
GATCCCTTCATCAGGCCATCTGGCCCCTTGTTAATAATCGACTGACCCTAG
GTCTAA-3' (top strand; SEQ ID N0:5}; and 5'-GATCTTAGACCTAGGGTCAGTC.'GATT
ATTAACAAGGGGCCAGATGGCCTGATGAAGG-3' (bottom strand; SEQ ID N0:6). The
underlined sequences at the ends of the oligonucleotides are BamHI and BgIII
recognition sites.
The oligonucleotides were annealed and ligated in the presence of restriction
enzymes BcrmHl
and BgIII. Since BamHI and BgIII produce compatible DNA ends but can no longer
be
digested by BamHI or BgIII, the only multimers that escaped BamHI and BgIII
digestion were
ligated head-to-tail.
Minienhancers in which the three italicized bases in SEQ ID NO:~ and SEQ ID
NO:6
above were mutated are called FFE minienhancers. FFE minienhancers are
constructed
essentially as described above by generating oligonucleotides corresponding to
the region of
RIP between -247 and -196: 5'-GATCCCTTCATCAGGCCATCTGGCCCCTTGTTAA
TAATCTAATTACCCTAGGTCTAA-3' (top strand; SEQ ID N0:7); and
5'-GATCTTAGACCTAGGGTAATTAGATTATTAACAAGGGGCCAGATGGCCTGATGAA
GG-3' (bottom strand; SEQ ID N0:8). The italicized bases represent the mutated
bases. FFE
minienhancers were shown to be more active than FF minienhancers when both are
attached to
a minimal promoter (German et al. 1992). FF and FFE minienhancer dimers,
trimers, etc. were
separated by polyacrylamide gel electrophoresis and blunt-end cloned into the
transient
transfection vector, pBS/RIP/hGH, at either a XhoI site immediately upstream
of -41 ~ of the
intact RIP, into an AvrII site at -206 of an intact RIP, or into an ApaI site
immediately upstream
of -205RIP. The number and orientation of minienhancer repeats were verified
by DNA
sequencing.
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
184 -
FF and FFE minienhancer/RIP-hGH constructs were transiently cotransfected
along
with Rous sarcoma virus-chloramphenicol acetyltransferase (RSV-CAT), an
internal control
plasmid used to monitor differences in transfection efficiencies, into 1 x 10'
RIN cells by
electroporation (Chu and Berg 1987) as modified by Bassel-Duby et al. ( 1992).
The cells were
incubated overnight in 199 medium containing S mM butyrate. The next day 199
medium
containing butyrate was removed and new medium without butyrate was placed on
the cells.
After 48 to 96 hours, expression of the transfected genes was measured by hGH
protein
accumulation in the culture medium (Selden et ul. 1986) using a
radioimmunoassay (Nichols
Institute, San Juan Capistrano, CA). The cells were harvested after these time
points and
extracts were prepared by three successive rounds of freezing and thawing. CAT
activity in the
cell extracts was determined by the method of Nielsen et al. (1989). Promoter
activity as
measured by hGH production was then normalized for transfection efficiency
differences
between samples by the quantitated CAT activity in each sample.
The activities of several FF and FFE/RIP promoters were compared to RIP
activity in
transiently transfected RIN cells. The best results were obtained with one of
the types of FFE
minienhancer-RIP constructs. This type of RIP derivative had either three or
six copies of the
55 by FFE minienhancer fused immediately upstream of -410 of intact RIP
(pFFE3/-
415RIP/hGH and pFFE6/-415RIP/hGH). These modRIP promoters were consistently
five- to
6-fold more active than unmodified RIP in RIN cells (FIG. 29). A number of
other RIP
derivatives were also more active than RIP in transient transfection assays
although not to the
same extent as FFE3/-415RIP and FFE6/-415RIP.
The strength of the modified RIP promoters was also determined in stably
transfected
RIN cells. Tlte stable transfection vector, pFFE3/R1P8/INS/IRES/NEO containing
three copies
of FFE minienhancers (FFE3), was generated by inserting a blunt-ended
KpnIlHindIII
FFE3/RIP into pCMV8/INS/IRES/NEO in which the CMV promoter was removed with
SpeI
and SacI. pFFE6/RIPB/INS/IRES/NEO was constructed by inserting an ApaIlblunt-
endedHindIII FFE6/RIP fragment into pRIPB/hGH polyA in which RIP was removed
by
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
18~ -
ApaIlEcoRV. A BgIIIlSruI 1NS/IRES/NEO fragment was then inserted into
pFFE6/RIPB/hGH
polyA to complete pFFE6/RIP8/INS/IRES/NEO.
In some of the stable transfection vectors, the normally used adenovirus-
immunoglobulin hybrid intron was replaced with the rat insulin 1 gene intron
(RIPi). RIPi was
obtained by polymerase chain reaction from rat genomic DNA using
oligonucleotides
5'-CTCCCAAGCTTAAGTGACCAGCTACAA-3' (SEQ ID N0:9) and 5'-GGGCAA
CCTAGGTACTGGACCTTCTATC-3' (SEQ ID NO:10). These oligos produced a 185 by
product containing the 119 by RIPi (Cordell et al. 1979) and a HirrdIII site
on the 5' end and a
BamHI site on the 3' end. The PCR product was digested with tfindIII and BamHI
and ligated
into pNoTA/T7, whereupon it was removed with XbaI blunt-ended with
Klenow/HindIII and
inserted into EcoRV/HindIII digested pRIPB/INS/IRES/NEO to generate
pRIPB/RIPi/INS/IRES/NEO. pFFE6/RIPB/RIPi/INS/IRES/NEO was constructed by
replacing
the 5' adenovirus-immunoglobulin hybrid intron/INS/IRES of
pFFE6/RIP8/INS/IRES/NEO
with RIPi/INS/IRES from pRIP8/RIPi/INS/IRES/NEO.
As with the transient transfection data, several modRIP promoters also appear
to have
increased activity compared to that obtained for RIP in stably transfected RIN
cells. Both
insulin mRNA and secreted insulin protein levels in stably transfected RIN
cells were three to
four times higher in FFE6 derivatives than levels obtained for RIP alone (FIG.
30A, FIG. 30B,
FIG. 30C). In fact, the activity of FFE6 derivatives approached the level of
activity exhibited
by CMVp in stably transfected RIN cells.
FFE6 promoters also proved to be cell-specific. FFE6 promoters were fused with
the
neomycin gene to generate FFE6/RIP8/NEO. This plasmid was stably transfected
into RIN
cells, 293 cells, and pituitary AtT-20 cells. When challenged with 6418, drug-
resistant
colonies were only present in RIN cells. As a control, CMV/NEO was also stably
transfected
into RIN cells, 293 cells, and pituitary AtT-20 cells. After selection in
6418, a large number of
drug-resistant colonies were present in all three lines.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
186
Therefore, RIP derivatives like FFE6/RIPB/RIPi possess two important
characteristics
necessary for optimal expression of linked transforming genes in human ~3-
cells: 1 ) they will
direct expression of the transforming gene to ~i-cells and remain silent in
other cell types
associated with the islet preparation; and 2) they will deliver high levels of
the transforming
gene similar to those obtained from the very strong, non-cell-specific CMVp.
EXAMPLE 26
Induction of ~i-Cell Growth
1. Background
Although diabetes can be alleviated by insulin injections or sulfonylureas,
the fine
tuning of blood glucose sensing is lost which, more often than not, leads to
unfortunate diabetic
complications. Islet transplantation is a frequently mentioned alternative
treatment for diabetes
that retains glucose sensing, but this remains problematic, mostly because the
quantity, quality
and consistent supply of human isolated pancreatic islets suitable for
transplantation is severely
limited. One possible means of circumventing this problem is to somehow induce
human
[3-cells to grow, either to increase the number of human islet (3-cells or to
produce a human
/3-cell line suitable for transplantation. However, little progress has been
made to find a means
that urges islet (3-cells into a growth phase to such an extent where large
quantities of ~i-cells
can be produced as a potential alleviation of diabetes, and no human (3-cell
lines that retain
essential traits required from in vivo insulin delivery have been created or
isolated.
Pancreatic islet ~3-cell growth can occur from two separate pathways (Swenne,
1992).
New islets can differentiate from budding of pancreatic ductule epithelium
(neogenesis}, or
from the replication of existing islet ~i-cells. Neogenesis of islets is
thought to primarily occur
during fetal and perinatal stages of development, but has also been observed
in the regenerating
adult pancreas (Bonner-Weir, 1992). Replication of existing pancreatic p-cells
has been seen in
the late fetal stages, but is thought to be the principal means of increasing
(3-cell mass in the
adult (Swenne, 199?). In a population of normal islet (3-cells the number that
are under going
cell-division has been measured to be between 0.5-2%.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
187 _
Several factors have been shown to increase the number of replicating ~i-
cells, however these
effects have only been rather slight. Glucose and other nutrients metabolized
by the (3-cell can
increase the number of replicatinY adult (3-cells 2-fold (Hellerstrom et al.,
1988). Several
peptide growth factors have show w stimulation of (3-cell replication (Bonner-
Weir. 1992).
Growth hormone (GH) increases the number of (3-cells replicating in islets to
around 6%
(Nielsen et al., 1989). The expression of the GH-receptor has been identified
on ~3-cells
(Hellerstrom et al., 1991). The GH related peptides, prolactin and placental
lactogen have
similar stimulatory effects on ~3-cell replication reflecting lactagenic as
well as GH-receptors on
the (3-cell surface (Moldrup and Nielsen, 1990).
It has been suggested that GH mediates its growth effect on ~i-cells by
stimulating the
production of IGF-I in islets which in turn mediates a paracrine or autocrine
effect to stimulate
(i-cell replication (Nielsen, 1982 ). While this may in part be so, (indeed
IGF-I alone has been
shown to stimulate fetal (3-cell replication 2-fold (Brelje and Sorenson,
1991)), it also is clear
that GH can exert a stimulation of adult [3-cell replication independently of
IGF-I (Swenne
et al., 1987). Gastrin and cholecystokinin can instigate a small increase in
(3-cell replication
(Bonner-Weir, 1992).
In contrast, EGF does not appear to affect ~i-cell replication even though
significant
EGF binding to (3-cells has been observed (Nielsen, 1989), suggesting that the
EGF signal
transduction pathway is not functional in pancreatic (i-cells. Similarly, PDGF
does not appear
to affect (3-cell replication, but this is due to there being very few PDGF-
receptors on (3-cells.
However, when the PDGF ~i receptor is transfected into ~3-cells only a 50%
increase in DNA
synthesis was observed upon stimulation with PDGF (3-chain (Welsh et al.,
1990). suggesting
that a post-receptor signal transduction mechanism for ~i-cell replication is
only partly present.
Very little work has been done on establishing key elements in mitogenic
signal
transduction pathways in pancreatic ~i-cells. However, insulin promoter driven
SV40 T-antigen
overexpression in transgenic mice has significantly induced (3-cell growth and
dedifferentiation
resulting in the generation of insulinoma cell lines (Efrat et al., 1988;
Miyazaki et al.. 1990). In
other cell types, the T-antigen mitogenic signaling pathway is thought to be
mediated by
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
188 -
inducing Shc tyrosine phosphorylation. recruitment of Grb2 and Ras activation
via induction of
SOS (the Ras guanine exchange factor; Dikworth et al.. 1994). This suggests
that in pancreatic
(3-cells a mitogenic signal transduction pathway mediated via Ras activation
can be induced.
However, in normal islet ~i-cells proto-oncogene expression is undetectable or
extremely low,
but in islets transfected with v-src, or a combination of c-myc and c-Ha-ras,
only a modest SO%
increased cell replication rate was observed (Welsh et al., 1987). Thus, these
studies imply that
it is important to appropriately activate a mitogenic signal transduction
pathway in (3-cells as
well as to overexpress certain key elements within that pathway.
Several growth factors have been shown to modestly induce (3-cell mitogenesis,
but as
of yet no potent stimulators) of (3-cell growth has been identified.
Furthermore, the necessary
stimulators) for signal transduction pathways of growth factor stimulated (3-
cell mitogenesis is
quite poorly defined. Indeed, a given growth factor stimulation of islet (3-
cells could actually be
ineffective because certain elements of the signal transduction pathway are
either not
appropriately expressed and/or activated.
The present Example concerns the identification of mitogenic signal
transduction
pathways in pancreatic (3-cells, which in turn indicates an appropriate growth
factor and
signaling pathway to exploit for inducing (3-cell growth in vitro and/or
establishing novel (3-cell
lines. The inventors have found that IGF-i and activation of a signal
transduction pathway via
IRS-2 and p70s6~ (FIG. 28) can induce up to a 30-fold increase in (3-cell
growth in insulinoma
cells. Recombinant adenoviruses were generated to overexpress the IGF-1
receptor and/or IRS-
2 in primary isolated islets (preferably human islets) to determine the
effects of IGF-1 induced
~i-cell growth.
2. Methodological Approach
Recombinant Adenovirus Construction- In order to obtain high overexpression
and
efficient gene transfer of mitogenic signal transduction proteins in primary
islets, the
recombinant adenovirus system was used. Essentially, replication deficient
recombinant
adenoviruses were constructed as previously described (Becker et al., 1994a;
Becker et al.
1994b). Initially, adenoviral constructs to markedly increase in vitro islet
~i-cell expression of
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
189 -
IRS-1 (as a putative control for IRS-2), IRS-2. IGF-1 receptor. and insulin
receptor (as a
putative control for IGF-1 receptor) were produced. Both human and rat forms
of these genes
(GenBank Accession number 562539 (Rat IRS-1) and X5837 (Human IRS-1)) were
obtained
for expression in both human and rat isolated islets. IRS-1 and IRS-2 cDNAs
were obtained
S from Morris White (Joslin Diabetes Center/Harvard Medical School, Boston,
MA). A series of
constitutively on/off IRS-1 and -2 variants are also available.
Recombinant adenoviruses where IRS-1, IRS-2, IGF-1 receptor, or insulin
receptor
expression is driven by the ubiquitous CMV-promoter (using pAC-CMV) were
generated, and
confirmed by restriction enzyme and sequence analysis. Alternatively,
recombinant
adenoviruses for specific (3-cell expression driven by the insulin promoter
(using pAC-RIP) are
generated. Recombinant adenoviruses expressing (3-galactosidase and luciferase
driven by the
CMV-promoter are used as controls. For insulin promoter driven expression a
pAC-RIP driven
luciferase expressing recombinant adenovirus is used as a control. Recombinant
adenovirus
infection of isolated islets is followed as previously described (Becker et
al., 1994).
Confirmation of IRS-1, IRS-2 IGF-1 receptor and insulin receptor
overexpression in islets by
Northern- and immunoblotting is performed.
Recombination of the pAC and pJMl7 vectors to generate ElA deficient
recombinant
adenovirus can only accommodate an ~3.8 kb insert into pAC shuttle vector.
However, the
IRS-1, IRS-2, IGF-I receptor, and insulin receptor cDNA inserts are all >3.8
kb. Therefore, the
pBHGI l (E3 deficient vector) instead of pJMl7 is used to generate ElA and E3
deficient
recombinant adenovirus. The pBHGI 1 vector enables inserts of up to 9 kb into
pAC to be used
which is suitable for IRS-1, IRS-2, IGF-1 receptor, and insulin receptor
cDNAs. The pBHGI l
vector was obtained from Larry Moss (New England Medical Center, Boston, MA).
Cell Preparations- Isolated rat islets are used as a primary model, which are
isolated as
previously described (Alarcon et al., 1993). The studies are then repeated in
human islets.
Further characterization of mitogenic signal transduction pathways in the RITz
and the INS-1
cell lines is conducted, and these cells are used as positive controls for
investigation of IRS-
2/IGF-1 receptor overexpression in islets. RITz-cells are isolated from the
well granulated line
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
190 -
of NEDH-rat transplantable insulinoma tissue by cellular sieving and PercollTM
centrifugation
gradient purification. They are maintained in culture under identical
conditions for INS-1 cells
(Alarcon et al., 1993). In tenors of insulin secretion, RITz-cells are not
responsive to glucose in
the physiological range, but are when elevating intracellular cAMP, phorbol
esters, and/or
depolarization.
The occurrence of increased IRS-2 expression in human insulinoma tissue when
compared with human islets also is confirmed. Human insulinoma tissue (for
example,
obtained from the Mayo Clinic) is used for this purpose.
Measurement of Cell Growth- Several parameters are used for measurement of
cell
growth. First, the cell number is counted in a standard volume using a
heamocytometer.
3H-thymidine incorporation into cellular DNA is used as a predictor of ~i-cell
growth (Myers
and White, 1996). Following addition of 3H-thymidine(1~C/ml) to cells,
incubations were
performed under various conditions for 2 -4 hrs. at 37° C. Cells were
then washed three times
in ice-cold HBBS, lysed in 2 ml of lmg/ml SDS solution on ice, and transferred
to 12-ml tubes.
Following addition of 2.5 ml ice cold 20% (wt/vol) trichloroacetic acid. the
cell extract was
poured over a Whatman glass-fiber filter in a millipore filtration apparatus.
The filter was
washed twice with ice-cold 10% (wt/vol) trichloroacetic acid, air dried. and
counted by liquid
scintillation counting. The Individual replicating (3-cells in islets or ~i-
cell lines are identified
and counted using a BrdU-staining kit (Amersham Int.). This technique has the
advantage of
readily distinguishing between islet (3-cells and non (3-cells by double
staining with a second
antibody against insulin. An increase in a population of (3-cells could result
in part from an
inhibition of (3-cells entering apoptosis. Thus the number of apoptotic 1RS-
2/IGF-1 receptor
overexpressing cells also is measured by the TUNEL (terminal deoxynucleotidyl
transferase
biotin-dUTP nick end labeling) method (kit obtained from Upstate Biotechnology
Inc.).
Measurement of (3-cell Differentiation- Ideally, when inducing primary islet
~i-cells to
grow, the maintenance of as much of the (3-cell's differentiation state as
possible is desired.
However, when either the growth rate of [3-cells is increased or ~i-cells are
transformed (e.g., by
X-ray exposure (RIN-cell lines) or ~i-cell specific T-antigen expression
((3TC3- and MIN6 cells)
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
191 -
there appears to be some degree of loss of differentiation (e.g., glucose-
regulated insulin release
and biosynthesis). Thus, the differentiation state of primary rat and/or human
islets induced to
grow by in IRS-2/IGF-1 receptor overexpression is determined.
The (de)differentiation state is assessed using three parameters: I) Glucose-
regulated
proinsulin biosynthesis translation- To date all the available transformed ~i-
cell lines (except
the relatively well differentiated low passage MINE cells) do not possess a
phenotype of
specific regulated proinsulin biosynthesis by a physiologically relevant range
of glucose
concentrations. Maintenance of correct glucose stimulated proinsulin
biosynthesis in IRS-
2/IGF-1 receptor overexpressing islet ~3-cells (Alarebn et al., 1993) is an
indication of
maintaining a differentiation state. 2) Regulated (pro)insulin release-
Dedifferentiated
transformed (3-cell lines have a tendency to constitutively secrete an
increased proportion of
proinsulin, and also lose their~response to relevant secretagogues, especially
glucose in the 2-20
mM range. Pulse-chase radiolabeling protocols (Alarcon et al., 1995) are used
to assess the
proinsulin:insulin ratio released from 1RS-2/IGF-1 receptor overexpressing
islet ~i-cells in
response to glucose and a stimulatory cocktail containing multiple
secretogogues and
potentiators of glucose-stimulated insulin secretion and thus assess the
differentiation state. 3)
p7oS6K phosphorylation state- The extent of p70s6K phosphorylation in (3-cell
lines tends to
correlate with dedifferentiation state and growth rate of the cells. A rank
order of serum-
starved cultured (3-cells is seen from differentiation (slow growing) to
dedifferentiation state
(rapid growth rate) of primary islets > MIN6 > INS-1 > RITz > other RIN lines
= ~iTC3 cells.
'The phosphosphorylation of p70s6~ occurs on multiple sites on the molecule,
with S
phosphorylated forms observed by immunoblotting (due to electrophoretic
retardation of the
p.~OS6K phospho-forms on SDS-PAGE); the upper 3-5 multiple phosphorylated
p70ssK forms are
activated. In islets only the non-phosphorylated form of p70s6x is observed,
but in ~3TC3 cells
only the fully phosphorylated active p70s6~ is observed. Other (3-cell lines
rank in between
these extremes. Thus, immunoblot measurement of p70s6K phosphorylation state
is a rapid and
convenient indication of ~i-cell differentiation state.
Characterization of (3-cell MitoRenic Signal Transduction Pathways- Induction
of
~i-cell growth/transformation requires not only overexpression of a particular
element in a
CA 02318379 2000-07-12
WO 99/35495 PCT/US99100551
192 -
mitogenic signal transduction pathway (i.e.. IRS-2). but also activation of
that pathway by an
appropriate growth factor (i.e., IGF-I). Therefore. in IRS-2/IGF-I receptor
overexpressing islet
cells it is important to assess activation of the IGF-I signal transduction
pathway(s). This is
performed using established methods (Myers and White. 1996). Changes in
protein-protein
interactions is measured (e.g., IGF-1 instigated IRS-2-PI3 kinase association
by
immunoprecipitation with p85 PI3 kinase antibody followed by immunoblotting
with either
anti-phosphotyrosine and/or IRS-2 antibodies); the phosphorylation state of a
particular protein
is determined (e.g., using specific antibodies that recognize only
phosphorylated MAP kinase,
or immunoblotting for gel retardation analysis of p70s6K or
immunoprecipitation followed by
anti-phosphotyrosine immunoblotting); and induction of enzyme activity is
measured (e.g.,
MAP kinase or PI3 kinase assays). Necessary reagents or assay kits are
purchased form UBI.
3. Results
To screen for factors that might be important in mitogenic signal transduction
pathways
in pancreatic ~i-cells, the expression of certain genes in a model of rapidly
growing ~3-cells (i.e.,
NEDH-rat transplantable insulinoma cells (Chick et al., 1977)) versus a model
of slow growing
~3-cells (i.e., NEDH-rat normal isolated islet cells) was compared by Northern
blot
hybridization. Preproinsulin mRNA levels drop by 75% in insulinoma cells
compared to islets.
Levels of mRNA for c-jun, c-fos, and IRS-1 did not change when comparing
islets to
insulinoma cells. In contrast to IRS-1, mRNA levels for IRS-2 were increased
>50-fold in
insulinoma cells compared to isolated islets. These very high levels of IRS-2
mRNA were also
found in RIN 1046-38, RIN-mSF, INS-1, ~iTC3, HIT and MIN6 cell lines, but not
in (3TC-1,
AtT20, PC-12, GH-3, 293, Cos, CHO or 3T3-L 1 cell-lines where IRS-2 mRNA
levels were
comparable to those in isolated rat islets.
The elevated IRS-2 levels appear to be peculiar to insulinoma cell lines. The
only other
gene product found so far to be overexpressed to such an extent in insulinoma
cells is a Ha-Ras
containing VL30 transposon element (i.e. an endogenous retroviral like
transposon that
contains the Ha-Ras sequence within it). However, the overexpressed VL30
element mRNA is
not reflected in Ha-Ras expression at the protein level which is unchanged
compared to normal
rat islets. Thus, this particular VL30 is acting like a typical transposon
that is quite common to
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
193 -
tumor cells. The elevated levels of IRS-2 mRNA in insulinoma cells were also
reflected at the
protein level by immunoblot analysis. Furthermore. the levels of other
potential mitogenic
signal transduction proteins in the [3-cell, namely IRS-1, c-Ha-Ras, PI3-
kinase, p70s6h, Shc,
Grb-2, MAP-kinase (erk-1 and -2 isoforms) and CREB were not changed between
islets and
insulinoma cells.
A polyclonal cell line from the NEDH-rat transplantable insulinoma tissue
termed RITz-
cells has been obtained: When starved of serum for 48h RITz-cells continue to
grow, albeit at a
slower rate, so that the rate of 3H-thymidine incorporation drops 4-fold
compared to fed cells.
However, upon refeeding RITz-cells with 10% (v/v) serum the 3H-thymidine
incorporation rate
increases by 20-fold after a further 48h incubation, in line with a parallel
increase in RITz-cell
proliferation. Interestingly, the expression levels of the aforementioned
signaling molecules
(including the IRS-2 overexpression) did not significantly change in these ~
serum studies. In
addition, the differentiation state (as judged by secreted proinsulin:insulin
ratio and regulated
insulin secretory response to a stimulatory cocktail (20 mM glucose, 10 pM
forskolin, 1 mM
IBMX, 30 mM KCI, SO ~tM PMA) did not alter in the same ~ serum studies.
The question as to which growth factors) in the serum is responsible for this
marked
stimulation of (3-cell growth was also addressed. IGF-1 at a concentration of
10-9 M was found
to give a maximum stimulation (>30-fold; ED5°~10-~°M 1GF-1) of
RITz-cell growth (as
analyzed by 3H-thymidine incorporation) after a period of 48h serum
deprivation. There is no
additive or synergism of serum (10% v/v) + IGF-1 (at 10-9 M), suggesting that
it is IGF-I in
serum that is responsible of stimulating RITz-cell growth. Interestingly,
unlike the majority of
other cells in tissue culture, the RITz-cells (and also INS-1 and ~3TC3 cells)
do remarkably well
in the absence of serum for periods up to 5 days, although they do grow at a
slower rate. It is
possible that insulin secreted by such insulinoma cells is 'feeding back' via
the IGF-1 receptor
to maintain the cell line.
Preliminary characterization of the mitogenic signal transduction pathway
stimulated by
IGF-l/serum in RITz-cells was conducted. Identical observations are obtained
whether IGF-1
and/or serum is used as a stimulation, but only IGF-1 stimulation will be
referred to below.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
194 -
Addition of IGF-1 ( 10-9 M) to 48 h serum-starved RITz-cells followed by a 1 h
incubation
induced autophosphorylation of the IGF-1 receptor, gave a marked stimulation
of tyrosine
phosphorylation of IRS-2 and an increased association of PI3 kinase (PI3K; 85
kD subunit)
which in turn activates PI3-kinase activity. This then increased the
phosphorylation state of
p70s6~, and hence its activation. Activation of p70s6~' has been implicated in
mitogenic
stimulation in other cell types (Myers and White, 1996). In contrast. no
increased tyrosine
phosphorylation of Shc or phosphorylation activation of MAPK activity was
found.
Next the serum effects on activation of the IGF-1 signal transduction pathway
in INS-1
cells was investigated. IRS-2 is activated by tyrosine phosphorylation within
the 10-30 min
window, resulting in increased association of PI3'K to IRS-2 in INS-1 cells,
as shown by
immunoprecipitation with a PI3'-kinase 85 kD subunit antibody, and subsequent
antiphospho-
tyrosine and/or IRS2 immunoblotting analyses in 48 h serum-starved INS-1 cells
that have been
re-fed with serum for 10 min or 30 min. Similar results are observed with IGF-
1 stimulation.
In INS-1 cells serum starved for 0-72 h, refeeding with 10% (v/v) serum
induces an increased
activation of p70s6~ by increasing its phosphorylation state, as indicated by
a retarded mobility
on gel electrophoresis.
Similar evidence has been obtained for activation of p70s6~ by IGF-I . Several
bands of
p70sbx can be observed, which correlate to differentially phosphorylated
isoforms of the
enzyme. 1n 48h serum starved cells MAPK is endogenously activated, using
immunoblotting
studies comparing specific antisera that only recognizes the phospho-activated
form of MAPK
versus antisera which recognizes total MAPK whether phosphorylated or not.
However, if
INS1 cells are both serum and glucose starved for 48 h, activation of MAPK
within 10 min
exposure to IS mM glucose alone can be observed. Conversely, also in INSI
cells both serum
and glucose starved for 48 h, adding back 10% serum for 10 min results in
activation of MAPK
by 10% serum. Thus, both glucose and serum (i.e. IGF-1) can activate MAPK in
~i-cells.
Similar effects of IGF-1 are also being observed to that of adding back 10%
serum.
Characterization of IGF-1 activation of signal transduction pathways in the ~3-
cell is being
studied to identify other elements of this cascade that result in ~i-cells
growth.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
195 _
The data suggest that the IGF-I signal transduction pathway in [i-cells occurs
preferably
via a IRS-2/p70sbh route. rather than a route involving activation of Ras.
Because of the
massive overexpression of IRS-2 in insulinoma cells, it appears that IGF-I
signaling is
mediated via IRS-2 rather than IRS-1. As previously stated, IRS-2 expression
levels did not
change in response to adding back serum and/or IGF-1. This latter observation
suggests that it
is not only IRS-2 overexpression, but also activation of IRS-2/p70s6~' signal
transduction
pathway that is important for IGF-1 mediated stimulation of [i-cell growth.
This indicates that
IRS-2 (and possibly IGF-1 receptor) overexpression in primary (human) islets
initiates an IGF-
1 mediated potent stimulation of (3-cell mitogenesis and/or leads to a novel
(human) [3-cell line
(FIG. 31 ).
A background level of glucose is required for IGF-1 to stimulate mitogenesis
of INS-1
cells (as judged by [3H]-thymidine incorporation}. In considering that INS-I
cells respond to
glucose in terms of insulin secretion in the appropriate physiological range.
for any significant
IGF-1 stimulation of INS-1 cell growth glucose must be present > 3 mM glucose
(FIG. 32). At
10 nM to 3 mM glucose IGF-I only has a slight effect in stimulating INS 1 cell
growth.
Glucose alone can instigate INS 1 cell growth in a dose dependent manner ~3-
fold at 6 mM
glucose, ~4-fold at 9 mM glucose and --10-fold at 18 mM glucose. This effect
of glucose on
INS1 cell growth is potentiated by IGF1 in a dose dependent manner >10 pM IGF-
I reaching a
maximum between 10-100 nM IGF-1. The role that glucose plays in IGF-1
mitogenic
signaling pathways in pancreatic [3-cells is investigated by studying
phosphorylation activation
of the 'signal transduction proteins' and protein-protein interactions by IGF-
1 ~ glucose. It is
known that glucose is capable of activating MAPK (via a Ca2+-dependent
process). therefore its
role in activation of other elements in that pathway is investigated.
Like IGF-1, growth hormone (GH) can also stimulate mitogenesis in [i cells.
However,
it does not signal mitogenesis via the IRS-1/2 pathway, but via the JAK/STAT'
pathway. In
particular, JAK2 and STATS A and B are involved in the mitogenic pathway (FIG.
31 ). The
action of rat growth hormone (rGH: from Anne Miller at Eli Lilly) on INS 1
cell growth, like
that of IGF-1, requires a 'background' of glucose (FIG. 30). The rGH has no
effect on INS-1
cell growth until a threshold of 6 mM glucose that reaches a maximum (~50-fold
increase
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
196
compared to "0" glucose) at 1 ~ mM glucose. This is similar to the effect of
IGF-1 on INS 1 cell
growth which has a threshold between 2-4 mM glucose and reaches a maximum at 1
~ mM
glucose. Additionally, there is an additive effect of rGH and IGF-1 on INS-1
cell growth at
glucose concentrations up to a maximum of 12 mM (FIG. 34).
In line with the observed effect of IGF-1, glucose and rGH stimulation of INS-
1 cell
growth, inhibitors of the mitogenic signal transduction pathway were shown to
inhibit INS-1
cell growth. Rapamycin (a p70s6~ inhibitor), wortmannin and LY294002 (PI3K
inhibitors),
and PD29083 (a putative MEK inhibitor) all inhibit IGF-l, rGH and glucose
induced INS1 cell
growth.
Adenoviral-mediated overexpression of IRS-2 in INS1 cells in the presence of
IGF-1
and 1 S mM glucose resulted in an approximately 200-fold increase in
[3H]thymidine
incorporation compared to uninfected INS 1 cells plus no glucose {FIG. 35).
The mitogenic
signal was again specific for IRS-2 and not IRS-1 as INS1 cells infected with
adenovirus-IRS-1
showed no mitogenic response over and above that for uninfected cells or cells
infected with
adenovirus-(3Gal. As before, a background level of glucose was required to
stimulate
mitogenesis in the adenovirus infected cells. Interestingly, the mitogenic
response of INS 1
cells to adenoviral overexpression of IRS-2 was greater than that for large T-
antigen, a protein
known for its ability to induce dedifferentiation and subsequent mitogenesis
(FIG. 32).
Overexpression of an element in the signal transduction pathway downstream of
IRS-2
(e.g., 'constitutively on' variant forms of p70s°" and/or Ras (RasQ81
L)) in islet (3-cells also is
contemplated. IRS-2 is a multiple tyrosine phosphorylated molecule that
appears to be located
at a crossroads for many mitogenic signal transduction pathways in a cell
(Myers and White,
1996). One particular growth factor induces phosphorylation of only certain
IRS-2 tyrosine
residues, and thus limits the number of downstream elements that associate
with IRS-2 and can
then be activated. Furthermore, IRS-2 activation requires exogenous growth
factor stimulation
(even in IRS-2 overexpressing cells), thus activation of mitogenic signal
transduction pathways
via IRS-2 can be turned on and off (unlike overexpression of 'constitutively
on' downstream
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
197
elements). Thus continuing characterization of mitogenic signal transduction
pathways in
(3-cells is being investigated to identify other candidates that induce (3-
cell growth.
EXAMPLE 27
BetaGene Medium Maintains Growth and Function of Neuroendocrine Cells
The biologic activity of peptides considered for biopharmaceutical
applications are
influenced by a number of complex modifications. These post-translational
modifications
include correct proteolytic processing of precursor molecules, amidation,
glycosylation,
disulfide formation, folding, and oligerimization. Production in mammalian
cell systems is
necessary for many therapeutically relevant peptides to ensure bioactivity and
minimize
immunogenicity. The latter issue of immunogenicity may even require the use of
human cell
systems. Neuroendocrine cells are cells that are specialized in the
biosynthesis and export
(secretion) of biologically relevant peptides. A distinguishing characteristic
of neuroendocrine
cells is the dominance of a regulated secretory pathway. This pathway involves
sorting to and
storage of peptides in dense-core or secretory vesicles. in addition to both
relatively high Level
biosynthesis and post-translational modifications of peptides. Neuroendocrine
cells are being
developed as a cellular therapy for in vivo delivery of bioactive peptides.
Such an application
requires large-scale production of the implantable cel Is.
A number of enzymes that are essential for the post-translational
modifications have
been characterized, with many abundantly expressed in neuroendocrine cells.
Whether
manufacturing processes utilizing neuroendocrine cells involve production of
purified peptides
or cells for implantation, the process must sustain the activity of these
enzymes so that
bioactive peptides will be produced. The present invention is directed to
optimized culture
media for neuroendocrine cells, for the purpose of not only growth, but also
function.
Specifically, secretory function, and the functional activity of enzymes
requisite for post-
translational processing. This has involved the use of primary human
neuroendocrine cells, and
neuroendocrine cell lines, (some specifically engineered to express
therapeutically relevant
peptides), to empirically determine components critical to secretion and
processing.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
198 -
Assay of Cell Growth- Neutral Red Uptake Assay
A neutral red uptake assay was used for quantification of viable cell mass to
allow rapid
determinations of cell growth, and for calculation of cell doubling times.
Neutral red diffuses
across cell membranes, while protonated neutral red does not. Accumulation of
neutral red is
dependent on an acidic compartment (maintained by H+/ATPase) in metabolically
active cells.
Accumulation is time and concentration dependent, and with conditions
appropriate to cells of
interest, uptake is linearly related to viable cell number. The assay is
initiated by adding neutral
red (from 1 mg/ml stock in acetic acid) to cells to provide a final
concentration of 25-50 p,g/ml
(a minimum of 2 ml medium/cm2 culture surface in each well is required). The
cells are then
incubated with neutral red for 0.5-1 h at 37°C. The medium with neutral
red is then aspirated,
the cells washed once with medium and the neutral red is extracted from the
cells. Neutral red
is extracted with a solution containing 50% ethanol and 0.1 M NaH,PO~ (pH 5.1-
5.5). The
soluble neutral red is quantified by determining absorbance at 540 nm in a
plate reading
spectrophotometer, with a standard curve of neutral red ( 1-40 pg/ml )
dissolved in the same
extraction solution.
Assay of Peptides
Insulin in the medium was quantified with a commercial radioimmunoassay (DPC,
Los
Angeles CA). that is referenced to USP human insulin in the inventors'
laboratory (lot G; US
Pharmacopeia. Rockville MD). The reference USP human insulin that is included
in each
assay, is validated by HPLC in the inventors' laboratory (see Example 22 for
HPLC methods).
Human growth hormone was determined with a human growth hormone ELISA
(Boehringer Mannheim, Indianapolis, IN). The growth hormone (GH) standard was
validated
by western blotting and HPLC referenced to an independent source of human
growth hormone
(Bachem. Torrance CA).
Cell Culture
Cells: Four different neuroendocrine cell lines were used to evaluate the
impact of the
current medium on growth. Two cell lines are human. BG785/5 is an engineered
version of a
neuroendocrine line derived from a lung tumor (BGH04; ATCC CRL-5803); these
cells have
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
199 -
been engineered to express human growth hormone. The second human line used,
BGH 16. is a
neuroendocrine gastric carcinoma (ATCC CRL-5974). The other 2 lines are rodent
cells,
derived from a rat insulinoma, one, BG18/3E1, was engineered to express human
insulin
(Diabetes 46:958-967. 1997), the other, BG191/26, was engineered to express
preproglucagon
(transfected with BetaGene plasmid BU503; W097/26334 and W097/26321 ).
BGH 16 cells were passaged with a 1:3 split ratio into 12 well plates and fed
2-3
times/week with 4 ml per well of BetaGene Medium supplemented with 2% or 5%
serum or
serum-free.
BG785/5 cells Were plated (1:30 ) into 24 well plates, ~1 x 10~ /well. and fed
2-3
times/week with 2-3 ml per well of either RPMI or BetaGene Medium supplemented
with FBS
or serum-free. Media samples were collected for human GH assay, and cell
growth determined
at 2-3 day intervals for ~ 2 weeks. RPMI is the medium recommended for this
cell type.
BG18/3E1 cells were plated (1:8 to 1:16) into 24 well plates, ~1 x 10' /well.
and fed 2-3
times/week with 2-3 ml per well of BetaGene Medium supplemented with 0.5-5%
FBS or
serum-free. Media samples were collected for human insulin assay, and cell
growth determined
at 2-3 day intervals for approx. 2 weeks.
Medium Supplements- Serum and Serum free. Serum-supplemented media contained
fetal bovine serum (JRH Biosciences, Lenexa KS), supplemented to 2%, unless
otherwise
indicated. The lot of serum used was selected by screening >_5 lots of serum
by assaying
attachment, clonal growth. and maintenance of secretory function (of primary
pancreatic beta
cells and beta cell lines) at serum supplements of 0.5% to 5%.
Serum-free supplement provided 0.1% BSA, 10 pg/ml of transferrin. and ~0 yM
each of
ethanolamine and phosphoethanolamine.
Medium. The performance of cells in BetaGene medium (JRH Biosciences) was
compared to RPM/. a medium recommended for culture of human cells (Methods in
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
200
Enzymology 58, pages 213 and 91: 1979). RPMI is also the medium recommended
for the
BGH04 cell line (the parental cell line engineered to yield the BG785/S cell
line). BGH16 cells
were derived and cultured in DMEM:F12 (50:50) mixture supplemented with a
complex
mixture of hormones, growth factors. selenium, BSA, transferrin, ethanolamine
and
phosphoethanolamine (10 pM each). For the present studies the BGH16 cells were
switched to
BetaGene Medium with either FBS or senim-free supplements and growth was
evaluated in this
medium.
Results: Growth & Function
The BGH16 cell line is a slow-growing suspension culture with a 5-6 day
doubling
time. The BG785/5 cell line is a rapidly growing monolayer culture that
readily reaches
confluence with a 2 day doubling time. The BG18/3E1 cell line is a slower-
growing monolayer
culture that does not readily achieve confluence. Growth in BetaGene Medium
for all these cell
lines was maintained when serum-free supplements (SF) were used in the place
of FBS (Table
IS 11).
TABLE 11
CELL GROWTH IN BETAGENE MEDIUM
Cells Supplement Doubling, days
H16 SF 5.91f0.41
2% FBS 5.0310.14
5% FBS 5.31f0.23
BG785/5 SF 1.970.01
2% FBS 2.0310.01
BG18/3E1 SF 2.4110.01
0.5% FBS 3.8510.14
1 % FBS 2.920.03
2% FBS 2.830.02
5% FBS 2.770.01
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
201
The BG785/5 cell line was derived from BGHO~I. cells which were derived and
routinely cultured in RPMI w/FBS. The growth rate of BG785/~ cells in BetaGene
and RPM1
media, with FBS or SF, is shown in FIG. 36. Although cells grown in RPMI w/FBS
exhibited
S a longer lag phase, the growth of cells in BetaGene medium and RPMI w/FBS
was similar. all
with doubling times of 2 days. However, cells in RPMI w/SF essentially failed
to grow, with
an apparent doubling time of 261 days. Three wells of RPMI w/SF were switched
to
BetaGene Medium w/SF for the last 4 days of the experiment, resulting in a
restart of growth
and a doubling time of 3.20.2 days.
In contrast with growth, the secretory function of cells in RPMI medium did
not keep
pace with cells grown in BetaGene Medium (FIG. 37). The human growth hormone
(hGH)
output of cells grown in BetaGene Medium with FBS was approx. 5 times greater
than growth
hormone output from cells in RPMI w/FBS. Similarly. the hGH output of BetaGene
Medium
IS w/SF was more than 5 times that of RPMI w/SF. While BetaGene Medium
supplemented with
SF sustained hGH output equal to that of RPMI w/FBS. it was not sufficient to
support the
same secretory function as BetaGene Medium with FBS.
The growth of BG18/3E1 cells was slowed only with low serum - at 0.5%, but not
by
SF-supplementation (Table I l). The insulin secretory function of these cells
was maintained
with all supplements until the cells reached the plateau phase of growth.
Cells at plateau phase,
whether supplemented with 0.5% FBS or SF, do not maintain normal secretory
output (FIG.
38). This was confirmed in separate studies with SF and 0.5% FBS cultures. The
secretory
impairment at plateau phase may be due to decreased biosynthesis or processing
of insulin
rather than an impairment of secretion. The ability to respond to a
secretagogue cocktail is
shown in FIG. 39 for SF- and 2% FBS- supplemented cultures in BetaGene Medium
(see
example 30 for composition of trace mineral and amino acid supplements). This
demonstrates
that the capability of the regulated secretory pathway has been maintained,
only the absolute
output has been affected in both unstimulated and stimulated states. while the
fold response is
maintained. RPMI medium is one of the most commonly used media for culture of
rat (and
hamster) beta-cell lines. The present results with BetaGene medium stand in
contrast with the
CA 02318379 2000-07-12
WO 99/35495 PCT/tJS99/00551
202
literature where insulinoma cells cultured in RPMI medium extinguish insulin
production at
plateau phase of cell growth (Karlsen, et al. 1991). Insulin output with
BetaGene medium
supplemented with serum-free supplements is reduced at plateau phase of
growth, although it is
not extinguished.
The capability of BetaGene medium to sustain processing and secretion of a
peptide that
yields proteolytically cleaved and amidated products was evaluated by
measuring GLP-1
(amidated and non-amidated) production. Cells BG191/26, were plated in T25
flasks with
BetaGene Medium and then the medium was switched to RPMI. RPMI with 75 ~eM
ascorbate,
or BetaGene Medium, all with 2% FBS. Both the total GLP-1 and the amidated GLP-
1
output/day of cells in BetaGene Medium was essentially double that of cells in
RPMI. The
addition of ascorbate (in the form of the stable ascorbate-2-phosphate) to
RPMI increased the
amidated GLP-1 output to that of BetaGene Medium, but did not normalize the
total GLP-1
output/day (FIG. 40).
EXAMPLE 28
Effects of Ascorbate 2 - Phosphate and Copper on
Post-translational Modification in Neuroendocrine Cells
Amidation of a carboxy-terminal glycine is one of the later events in post-
translational
processing. This modification is essential for the activity of some peptides,
including about
half of peptide hormones, and appears to be rate-limiting for production of
some peptides
(Eipper, e! ul., 1992; Cuttitta 1993). The bifunctional enzyme responsible for
amidation is
peptidylglycine a-amidating monooxygenase (PAM). The enzyme itself is
proteolytically
processed and is both N- and O- link glycosylated and is targeted to secretory
granules in
neuroendocrine cells (Yun et al., 1994). This enzyme requires copper and
ascorbate to
accomplish amidation; copper is a part of the functional enzyme.
Although several media include ascorbate in the formulation, the value of
ascorbate has
been most typically considered in the context of extracellular matrix and
collagen synthesis.
Even for the purpose of collagen formation the addition of ascorbate has been
considered
impractical in tight of the instability of ascorbate (Ham 1979; Mather, 1998).
There are several
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
203
analogues that are stabilized forms of ascorbate. One of these compounds is
ascorbate-2-
phosphate (A-2-P; Nomura e1 al.. 1969), this compound is used in some pet
foods, and as a
supplement in some types of cell cultures. A-2-P has been shown to stimulate
collagen
synthesis in fibroblast cultures. It has been used for culture of rat
hepatocytes, although rat
(unlike human) hepatocytes synthesize ascorbate. Recently, A-2-P was shown to
acutely
improve glucose-induced insulin secretion from pancreatic islets of scorbutic
guinea pigs
(Wells et al. 1995). The latter authors indicated that normal islets have
intracellular levels of 5
~tM, with scorbutic levels <_10% of normal. In contrast, ascorbic acid has
been reported to be
acutely inhibitory in electrophysiologic and secretory studies with rodent
beta-cells (Bergsten et
al., 1994); these authors indicate that intracellular ascorbate concentrations
in normal mouse
islets are 4 mM. Ascorbic acid has been shown to he diabetogenic in vivo,
toxic to mouse islets
in vitro, and to cultured fibroblasts, hepatocytes and lung carcinoma cells
(discussed in
Anderson & Grankvist. 1995). It is not clear what concentrations of ascorbate
would be
required by islets, whether ascorbate would be toxic with chronic culture, or
whether there may
be species differences in the effect of ascorbate in beta-cells.
Ascorbic acid or a substitute reducing agent is utilized on an essentially
equimolar basis
for each mole of amidated product. The provision of ascorbate would then be
expected to be
important for maintaining peptide amidation with neuroendocrine cells
cultured, particularly, in
the absence of serum, or grown at high-density, production scale. One study of
neuroendocrine
cells engineered to express an amidated peptide (pancreatic polypeptide) was
unable to increase
amidation activity by supplementing with 50 mM ascorbic acid (Takeuchi et al.,
1991 );
maximal production achieved was approx. 6 pmol/million cells-day. The present
studies have
used cultured primary human islets, rat beta-cell lines, and human
neuroendocrine cells to
determine 1 ) the chronic cytotoxic effects of ascorbate, and A-2-P; 2)
whether A-2-P will
support PAM-amidation activity; 3) whether A-2-P has any effect on the
secretion of non-
amidated peptides. such as insulin.
Instability of Ascorbate and Stability of A-2-P in media at 37°C.
The first consideration was to determine whether A-2-P was a more stable form
of
vitamin C in the cell culture environment. To that end a simple assay was
devised that takes
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
204 _
advantage of the dye reducing properties of ascorbic acid. The assay can be
coupled with
alkaline phosphatase to dephosphorylate A-2-P so that it can be measured with
the same assay
system used to measure ascorbate. The assay uses alkaline Tris-Mg buffer (pH
7.8-8.0: 2 mM
MgCl2) and nitroblue tetrazolium for ascorbate alone, or for A-2-P the
solution contains in
addition 10 U/ml of calf intestinal phophatase (C-AIkP). Ascorbate reduces the
pale yellow
NBT resulting in an intense purple color development. The color is developed
whether the
source is sodium ascorbate or ascorbic acid produced by the dephosphorylation
of A-2-P by C-
A1P.
Assay Solution- Nitroblue tetrazolium was dissolved in 70% dimethylformamide
to
provide a 61 mM dye stock solution. Na ascorbate stock solution, and A-2-P
stock solution was
made at 100 mM in RO/DI water or culture medium; ascorbic acid stock are
stored frozen less
than -120° C. These stock solutions are used to construct a standard
curie with a range of 1 to
18 mM in culture medium. The assay reaction mixture consists of 0.1 M Tris
buffer. 1 mM
magnesium, 0.4 ~M nitroblue tetrazolium, with or without 10 U/ml of C-AIkP.
The standards
and samples, 10 pl, are pipetted into individual wells of a 96 well plate. The
reaction is started
by adding 100 ~tl of reaction mixture to each well. The reaction is quantified
as a rate assay,
with kinetic reading of OD at 595 nM at 20s intervals for 15 minutes. The
stability of ascorbate
was determined by spiking medium samples with ascorbic acid or A-2-P, then
incubating the
samples in the dark at 4°C, room temperature, and 37°C. The
change in concentration with
ascorbate and A-2-P, after 1 and 2 days at the various temperatures is
presented in Table 12.
The results indicate that ascorbate in media is degraded quickly, with marked
breakdown
occurring at 4°C. In contrast A-2-P was very stable with little loss of
activity (98% recovery )
after 4 days at 37°C. Refrigerated media exhibited the same A-2-P
concentrations as freshly
manufactured medium for times of >6 months.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
205
TABLE 13
THE CHANGE IN CONCENTRATION WITH ASCORBATE
AND A-2-P, AS A FUNCTION OF TIME (1 AND 2 DAYS) AND
TEMPERATURE.
i emperature Ascorbic Acid, mM Ascorbate Phosphate, mM
C 1 day 2 day 1 day 2 day
-15 8.9 (99%) 6.8 (7~%) 9.2 (102%) 9.6 (107%)
4 7.0 (78%) 5.4 (59%) 9.2 (102%) 9.4 (105%)
37 3.4 (38%) 2.4 (27%) 9.6 (107%) 11.4 (126%)
Toxic Concentrations of Ascorbate with Human Neuroendocrine Cells.
BGH03, a lung neuroendocrine cell line was engineered to express human insulin
by
transfection with BetaGene plasmid AA603. The resultant cell line BG498/45
biosynthesizes,
processes, and secretes human insulin. A suspension culture of BG498/45 cells
(PD33) were
i 0 plated in varying concentrations of ascorbate or A-2-P. Samples were
collected for insulin assay
and medium changed after 2 and 5 days of culture. The insulin RIA is described
herein (see
example 33).
In the initial 2 days of culture ascorbate altered insulin output by reducing
insulin X20%
only at the highest concentration. In the final 3 days cells were dying and
insulin output was
reduced to X20% of controls by the highest concentrations of ascorbate, while
X400 pM
concentrations of both ascorbate and A-2-P enhanced insulin secretion (FIG.
41). The highest
concentration of A-2-P did not inhibit insulin output.
Optimal A-2-P Concentration for PAM-activity of a Rodent ~3-cell Line.
This present assay used the BG 191 /26 cells line engineered to overexpress
the
preproglucagon gene. Production of amidated and nonamidated GLP1 was
determined by
immunoassay of secreted cell products from cells cultured 1 day in IZPMI
medium (with 2%
FBS) supplemented with varying concentrations of A-2-P. The dose-response
shows half max.
and maximal amidation activity with ~l and 10-100 pM of A-2-P (FIG. 42). The
amount of
amidated GLP-1 plateaued from 25-1000 ~M. Concentrations of 10 mM consistently
(4
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
206
separate experiments) resulted in slight decreases in amidated GLP-1. with a
similar tendency
to reduce non-amidated GLP-1 output. Supplementation with A-2-P results in a
decrease in
non-amidated GLP-1, such that amidated/ non-amidated exceeds 100%. Maximal
output of
amidated GLP-1 with this cell line is X12 pmol/million cells-day. representing
5 fold increase
over 0 pM A-2-P. This result demonstrates that supplementation with A-2-P can
effect
increased amidation activity with cultured cells, and that maximal amidation
activity is reached
at lower concentrations (with a related beta-cell line), than the
concentrations that increased
insulin output 0400 pM; FIG. 41).
Optimal Copper Concentration for PAM Activity.
BG 191 /26 cell monolayers in T25 flasks were changed to RPMI medium ~ copper,
or
BG Medium ~ additional copper (the latter medium contains 5 nM copper). Medium
samples
were collected after 24 h and the GLP-1 species were separated and quantified
by HPLC. The
results in FIG. 43 show that supplementing RPMI (which has no copper in its
formulation)
increases the output of amidated GLP-i. Further supplementation of BG medium
with copper
to 250 and S00 nM does not increase amidated GLP-1, whereas 1 pM copper tends
to decrease
amidated GLP-1. These results indicate that S nM copper is adequate for PAM
activity in
cultured neuroendocrine cells. It should be noted that cells in BetaGene
Medium have higher
output of non-amidated GLP-1, and thus a lower ratio of amidated product than
cells with
RPMI. Both forms of GLP-1 are active, so this final processing step is less
critical for GLP-1
production.
A human cell line BGHO1 was found to naturally express GLP-1. This cell line
was
used to test the effect of 5 nM copper on amidation. In medium without copper
these cells
contained 3 ng of GLP-l, with amidated GLP-1 constituting slightly more than
half. In the
presence of copper the GLP-1 content was increased 4 fold, with amidated GLP-1
constituting
more than 80 % of the total. This indicates that with conventional culture
conditions the same
concentration of copper can be used for both rodent and human cells that make
an amidated
product.
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
207 _
Lack of Cytotoxic Effect of A-2-P on Primary Human Islets
Human islets encapsulated in alginate beads, (for method details see Example
22), were
set up in 24 well plates with DSO islet equivalents/well and cultured in
BetaGene Medium with
or without added A-2-P and copper. Secretory function and glucose-sensing was
determined by
incubating the islets with different concentrations of glucose for 90 minutes
(from 2.2 to 22
mM). This glucose dose-response test was performed immediately before adding
ascorbate to
the cultures and at 2 week intervals. In the first 2 weeks 500 pM A-2-P, and 1
pM copper was
supplemented. In the second 2 weeks ascorbate was increased to 2 mM. copper
was kept at 1
~eM.
FIG. 44 shows that A-2-P did not impair function as indicated by sensing of
glucose,
(EC50 for control and A-2-P islets was the same). Additionally, the
maintenance of maximal
insulin secretion indicates that there is minimal toxicity of A-2-P for these
culture times.
IS The above findings demonstrate the stability of A-2-P in media, the
effectiveness of A-
2-P in supporting amidation-activity in cell culture, the beneficial effect on
secretory function,
and the concomitant lack of cytotoxicity with cultures of neuroendocrine cell
lines and primary
human islets.
EXAMPLE 29
Defining Levels of Trace Minerals, Redox, Lipid and Lipid-related Compounds
Several trace elements are important for some of the enzymes involved in
proteolytic
processing. Two neuroendocrine cell lines were used to determine
concentrations of trace
elements that alter secretion, and concentrations that are cytotoxic. Effects
on insulin secretion
apart from cytotoxicity are considered evidence of cytostatic action. In
addition. because of the
importance of redox potential in ER/golgi, cytotoxic and cytostatic
concentrations of
tocopherol, and lipoic acid were also determined. The utility of ethanolamines
are described in
Example 2, and the importance of inositol is suggested by the literature. The
cytotoxic ranges
of these compounds were also defined.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
208
General Methods
Cells were plated as monolayers for short term (3-7 days) studies, for longer
term
studies, (>_ 2 weeks), cells were cultured encapsulated in alginate spheres
(methods describe in
example 6). The cell lines used were 13G18/3E1 and 136498/45, a rat insulinoma
and a human
lung carcinoma, respectively, engineered to synthesize and secrete human
insulin. Cells were
cultured in BetaGene Medium supplemented with 2% FBS or serum-free and the
specific test
material. Samples were collected at 2-3 day intervals to determine effects on
insulin output in
continuous culture. Additionally, cells were acutely stimulated to secrete
insulin ; 1-2 h with
carbachol or carbachol and a cocktail of other secretagogues (cocktail
consisits of 100 ~.M
carbachoI, 50 pM IBMX, and 10 mM each of leucine, arginine, and glutamine in
BetaGene
Medium). Cytotoxicity was quantified by neutral red uptake assay with cells
after exposure to
the specific test supplements. The concentration yielding 50% inhibition
(IC50) was calculated
from fitted lines of the data for viable cell mass or from insulin secretion.
Cytotoxic/Cytostatic Concentrations of Trace Minerals
Toxic effects of the following trace minerals were examined in log increments-
copper,
cobalt, molybdenum, nickel, silicate, tin, vanadate, and zinc in medium with
2% FBS.
Cytotoxicity and cytostatic effects were concordant with the tested
concentrations of cobalt.
molybdenum, nickel, or tin. The ICSOs (tested ranges) were: cobalt=64 pM (
0.005 to 100 pM);
nickel >25, calculated = 169 pM (0.0005 to 25 pM); and vanadate = 17 pM (5-250
pM).
Neither molybdenum in concentrations of 0.001 to 30 pM, nor tin concentrations
of 0.000 to
uM altered viable cell mass. doubling time, or insulin output. These results
indicate that
these minerals can be supplemented at concentration less than 10-25 pM with
minimal
deleterious effects.
Silicate exhibited discordance between cytostatic (insulin output) and
cytotoxic effects.
Silicate concentrations of 0.5 to 1000 pM had no apparent cytotoxic effects,
however. >~00 pM
silicate significantly decreased insulin output (p<0.005 by ANOVA; 74% of
control). Silicate at
5 mM was completely toxic; cytotoxic IC50 was 3 mM. These results indicate
that silicate
should be used at concentrations = 1 mM.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
209
Zinc and copper inhibition of insulin was fairly proportional to the cytotoxic
effects.
Zinc, (3 to 300 ~M), had a cytotoxic IC50 of 178 pM and a cytostatic ICSO of
159 pM. Copper
(0.01 to 100 pM) had a cytotoxic IC50 of 86 ~~M and a cytostatic IC50 of 62
pM. Deleterious
effects of copper and zinc were observed with concentrations greater than 20
and 100 pM,
respectively. In serum-free cultures 30 ~M zinc enhanced secretion 17% over 3
pM zinc; 100
pM did not enhance secretion. Copper had its maximal effect on amidation
between 0.01 and 1
pM (see example 28). In consideration of the potential toxicity of these
compounds, copper
supplementation should be <_ I pM, and zinc between 3 and 30 pM. These
concentrations
should be adequate for enzymes requiring these minerals for activity.
Cytostatic and Cytotoxic Levels of Lipoic Acid and Tocopherol
Lipoic acid was included in the medium because of its antioxidant properties
(BC Scott
et al., 1994. Lipoic and dihydrolipoic acids as antioxidants. A critical
evaluation. Free
Radical Res 20:119-33) and its role in maintaining cellular glutathione (D.
Han et al., 1997.
Lipoic acid increases de novo synthesis of cellular glutathione by improving
cystine utilization,
Biofactors 6:321-328). However, the beneficial effects of lipoic acid must be
balanced against
potential deleterious actions that are related to inhibition of biotin and
pantothenate transport
(Devoe et al., 1998. Cloning and functional expression of a cDNA encoding a
mammalian
sodium-dependent vitamin transporter mediating the upake of pantothenate,
biotin, and lipoate.
J Biol Chem 273:7501-6.) and to toxicity related to its fatty acid structure
(Sen et al., 1997.
Regulation of cellular thiols in human lymphocytes by alpha-lipoic acid: a
flow cytometric
analysis, Free Radical Biol Med 22:1241-57).
In FBS-supplemented medium the cytotoxic IC50 for lipoic acid (0.5 to 1000 ~M}
was
420 p,M, however, it was inhibitory to secretion at lower concentrations; the
cytostatic IC50
was 160 pM. The cytostatic effect was seen at 50 pM in serum-free cultures.
The 0.5 pM
concentration of BetaGene Medium is in the physiologic range, apparently in
serum-free
conditions a log increase in concentration above physiologic has deleterious
actions on cell
function. The inhibitory effect of lipoic acid in serum-free conditions may be
related to
inhibition of biotin or pantothenate uptake, because fatty acid-like toxicity
of lipoic acid is in
the millimolar range (Sen et al. Free Radic Biol Med 22:1241-57). This
indicates that biotin
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
210
and/or pantothenate levels may need to be increased for serum-free cultures,
but are not rate-
limited with FBS-supplemented medium.
Tocopherol (phosphate) supplemented to 1, 5, and 50 pM was compared to BG
Medium
with 6.8 nM tocopherol. High concentrations of tocopherol were more inhibitory
to secretion
than cytotoxic. The cytotoxic IC50 was 62 pM, and the cytostatic IC50 was 38
pM. This in
spite of the fact that 1 and 5 pM enhanced secretory responsiveness 30%. These
results
indicate that tocopherol concentrations of 1 pM should be nontoxic and useful,
particularly with
serum-free cultures.
Cytostatic and Cytotoxic Levels of Ethanolamine, Phosphoethanolamine, and
Inositol.
Ethanolamine (EA) and phosphoethanolamine (PEA} were found to be utilized
rapidly
in bulk-scale cultures, and these compounds promote growth and exert some
protective effects
in serum-free cultures (see Example 32). The current set of experiments
examined the toxic
I S limits of these two compounds. PEA (50, 500, and 1000 pM) exhibited no
cytotoxicity, while
ethanolamine (50, 500 and 1000 pM) reduced viable cell mass with an IC50 of
I.7 mM. Both
compounds inhibited cell function with cytostatic ICSOs of 1.2 and 1.7 mM for
EA and PEA,
respectively. Even though 500 pM PEA alone was neither cytotoxic nor
cytostatic, the
combination of 500 pM EA and 500 ~eM PEA reduced insulin secretion to the same
extent as
1000 pM of EA, but without the cytotoxicity of 1000 pM EA. These results
indicate that these
compounds should be effectively supplemented at concentrations of 50 to less
than 500 pM
each of EA and PEA.
Inositol was tested at 0.6, 0.9, and 1.8 mM with no cytotoxic or cytostatic
effects. Early
studies indicated that inositol was essential for glucose-induced insulin
secretion from rat islets
under serum-free conditions (Pace and Clements, 1981. Myo-inositol and the
maintenance of
beta-cell function in cultured rat pancreatic islets. Diabetca 30(8):621-5).
The present studies
do not address whether inositol is essential for glucose-induced secretion
(all of the present
studies have included inositol in the base media). Nonetheless, the present
results indicate that
inositol can be supplemented to very high concentrations without deleterious
effects.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
211 _
Cytotoxicity of Manganese
In the literature. acute depletion studies of manganese (Mn) indicated that
manganese
was important for O- and N- linked glycosylations of proteins. This effect of
manganese may
be related to the manganese requirement of the transferases involved in
oligosaccharide
S addition (Kaufman et ul., 1994. Depletion of manganese within the secretory
pathway inhibits
O-linked glycosylaton in mammalian cells. Biochemistry 33:9813-9819). Initial
studies with
manganese indicated that 1 mM manganese was completely, and rapidly cytotoxic
(within 24 h)
when supplemented into BG medium. Cytotoxicity was almost complete (>90%) with
100 pM.
With BG49814~ cells 10 pM Mn addition to serum-free medium maintained acute
secretory
responsiveness equal to that of FBS-supplemented cultures for one week.
However, after 2
weeks of culture in serum-free conditions, Mn no longer provided equivalency
with the
secretory response of FBS-supplemented cultures. It is unknown whether 1-10
~Cm Mn is
sufficient to maintain glycosylation in senun-free cultures, (other facets of
this processing may
be rate-limiting). The present results do indicate that 1-10 ~M of Mn. the
more physiologic
concentrations of Mn, are not toxic and effect some benefit for semm-free
cultures.
EXAMPLE 30
Maintenance of Cell Function with Bulk Cell Production
Engineered and unengineered neuroendocrine cell lines (rodent and human) have
been
produced in large scale (bulk produced), harvested and frozen to establish a
homogeneous
repository of cells. Cells under~oinQ this process continue to secrete rnm"lpY
l,in~n~irallv
active polypeptides into the growth media with no significant differences in
the response to
secretagogues as compared to before and after bulk production and after freeze-
thaw.
BG18/3E 1 (see examples 32, 33, 29) and BG498/45 (see examples 32. 29) were
studied as
representative neuroendocrine cell lines for bulk production, harvest. freeze
and thaw. Thawed
aliquots were tested for secretory response to secretagogues. The procedures
and the secretion
studies are described below.
Cell lines are bulk produced in the CellCubeTM system (Corning Costar). The
Cellcube
module provides a large surface area for the growth of substrate dependent
cells. It is a sterile
single-use device that has a series of parallel culture plates with thin
laminar flow spaces
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
212 _
between adjacent plates. The inlet and outlet ports are diagonally placed to
distribute the flow
of media to the parallel plates. The medium is constantly recirculated from
the module through
an oxygenator and back to the cube. The external oxygenator provides a bubble
free
replacement of oxygen to the medium and exchange of C02 to provide control of
the medium
S pH. Fresh medium is added continuously at an adjustable rate and medium with
secreted
product and waste is harvested at the same rate, while retaining the cell
population.
The culture was sustained by the initial amount of BetaGene Medium contained
within
the system for the first 36-60 hours after seeding. Medium circulation was
started twenty-four
IO hours after the initial seeding in order to supply the cube with nutrients.
Fresh medium addition
and 'spent' medium harvest began 48 hours post-seeding. (The amount of time
between
seeding and the start of the media perfusion is dependent on the density of
cells in the seeding
inoculum and the cell growth rate.) A typical CellCubeTM run with a 21.000 cm'
surface,
contains approximately 1.2 liters of media within the module. The final cell
density exceeds
15 2.5 x 106 cell/cm2 or 5 x 10' cells/ml in the culture vessel. In accordance
with the cells' growth
rate, the medium addition is adjusted such that the culture is fed approx. 1-2
ml of fresh
medium per million cells per day. Media feed required to support BG 18/3E 1
cells at
confluence is in the range of 4-16 CelICube module volumes per day. The
nutrient
concentration in the circulating media is measured to indicate the status of
the culture.
Control of each bulk culture was maintained by monitoring pH and dissolved
oxygen
content, as well as glucose, lactate, and ammonia concentrations. Bursts of
C02 were injected
at 30-second intervals and the amount controlled by a pH electrode. Oxygen was
controlled by
adjustment of the partial pressure of oxygen in the oxygenator headspace and
by adjustment of
the medium recirculation rate. Glucose, lactate, and ammonia levels were
measured (IBI
Biolyzer) daily in order to monitor nutrient availability and waste removal.
Samples were taken
prior to the daily increase of medium addition.
Cells were harvested from the CellCube with a sterile, closed system. The
CellCube
was removed from the circulating medium flow and attached to two bottles at
the inlet; one of
which contains trypsin (37°C) the other contains phosphate buffered
saline (PBS, 37°C). The
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
213 _
outlet of the CellCube module was attached to a harness for cell collection
consisting of a vent
bottle, two sterile cell culture bags (Baxter), and four bags containing cold
horse serum-
supplemented (controlled herd. irradiated, JRH Biosciences) or trypsin
inhibitor-supplemented
BetaGene medium. The growth medium in the CelICube module was emptied into the
first
sterile culture bag. The CellCube was subsequently rinsed with one volume of
PBS and the
rinse collected in the second sterile cell culture bag. The CellCube was then
filled with warmed
trypsin, incubated for an additional two minutes, and the trypsin/cell
suspension emptied into
the two bags containing BetaGene medium. Trypsin treatment was repeated and
the suspension
collected into the two remaining bags.
The bags of medium with cells were removed from the collection harness with
the use
of a tubing heat sealer (Sebra). A sterile tube welder (Terumo) was used to
assemble the Cell
Harvester tubing pathway and to attach the bags to the Cell Harvester (Baxter-
Fenwall). The
Cell Harvester system consists of a harvester manifold attached to the cell
bags, a reservoir set
(Baxter), a centrifuge belt (Baxter), a blood collection bag (Baxter), and a
waste collection bag
(Stedim, France). PBS was used to prime the harvester tubing prior to the
addition of the cells.
The cells were pumped into the reservoir set and then into the centrifuge belt
where they were
pelleted. The cell pellet was washed with I liter of cold PBS. The PBS was
exchanged for cold
BetaGene ChillSolution (5 mM KH,POa; 25 mM KOH; 30 mM NaCI; 0.5 mM MgCl2; 20
mM
L(+) lactic acid; 30 mM trehalose: ~ mM glucose; 167 pM myo-inositol; 200 mM
sorbitol. t
mM pyruvate). The cells were resuspended in 250 to 300 ml BetaGene
ChilISolution.
transferred to a sterile Blood Collection Bag. and placed on ice. Cell density
was determined
(by hemocytometer) and the cells were diluted to 40-60 million per milliliter
in BetaGene
ChillSolution. An equal volume of BetaGene CryoSolution (5 mM KH2P04; 25 mM
KOH; 30
mM NaCI; 0.5 mM MgCl2; 20 mM 1_(+) lactic acid; 30 mM trehalose; 5 mM glucose;
167 pM
myo-inositol; 200 mM sorbitol; 1 mM pyruvate; 15% DMSO; 0.4M propylene glycol)
is added
to the cells to yield a final concentration of 20-30 million cells per
milliliter. The serum-free
cell suspension was then dispensed by peristaltic pump from a reservoir in 1
ml aliquots into
ml cryovials (Nalgene) . The cell solution reservoir was kept on ice and
agitated constantly. as
the cells were aliquoted into vials. The filled vials were assembled in a
freezing rack for
transfer to a controlled rate freezer (C ryomed System, Forma Scientific).
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
214
Each rack was placed in the freezing chamber which was pre-cooled to
0°C. A sample
probe was used to record sample temperatures from one vial for each run. The
sample
temperature lagged behind the chamber temperature. The samples were cooled and
frozen with
S the following step changes in temperature:
1 ) Hold at 0°C until all samples have been placed in the chamber
2) Cool at 1 °C decrements until the sample probe reads -I4°C
3) Hold at -14°C for 15 minutes after sample temperature stabilizes
4) Cool at I °C increments until the sample reaches -40°C
S) Transfer to liquid phase nitrogen to provide rapid cooling to storage
temperature.
The frozen vials were stored in liquid phase nitrogen (-196°C).
The cropreservation solutions were developed to minimize deleterious metabolic
effects
of DMSO. This involved two approaches, first, salt solutions with low sodium
and high lactate
were used to suppress cell metabolism (Borrelli. et al. 1987. A method for
freezing
synchronous mitotic and G1 cells. Exp Cell Res 170:363-368). Second, the
solutions included
propylene glycol and sugars with cryoprotectant properties (sorbitol and
trehalose; Honadel and
Killian. 1988. Crypreservation of marine embryos with trehalose and glycerol.
Cryobiology
25:331-337) to allow the lowest DMSO concentrations to be used. In addition,
it was found
that pyruvate protects against the cytotoxic effects of such free radical
generators as hydrogen
peroxide; similar to the protective effects with renal cells (Salahudeen et
al., 1991. Hydrogen
peroxide- induced renal injury. J Clin Invest 88:1886-1893). The rat ~i-cell
line, RIN-38, was
used in dose-response studies of hydrogen peroxide toxicity. Cells in
multiwell dishes were
cultured with hydrogen peroxide, in RPMI medium overnight; cell survival was
determined as
described in Example 32. The concentration at which hydrogen peroxide killed
50% of the
cells (ICso), was calculated from a fitted line of data derived from studies
with 50-200 pM
hydrogen peroxide. In the absence of pyruvate the hydrogen peroxide ICSO was
14 pM.
Pyruvate concentrations of 100-500 pM provided a modest shift in ICSO to about
40 pM, with 1
mM pyruvate shifting to an apparent ICso of 530 pM. No indication of
cytotoxicity was seen
with S mM pyruvate. These studies provided the basis for adding pyruvate to
the
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
215 _
cryopreservation solutions (in addition to the culture medium). to provide
cells some protection
from free radicals during the recovery of cells from the cryopreserved state.
Frozen vials were thawed and plated (see below) to test insulin secretory
responsiveness
and growth. The vials were quickly transferred from the liquid nitrogen and
placed in a 37°C
water bath for rapid thawing (120-135 seconds with gentle shaking). Dilution
of the
cryoprotectants was begun as soon as only a small piece of ice remained in the
cryovial, by
adding 0.5 ml of cold (4°C) BetaGene ChillSolution to the cryovial. The
cells were allowed to
equilibrate for 5 minutes at room temperature. A second 0.5 ml of cold
BetaGene ChillSolution
was added. and the contents were transferred to a sterile 15 ml tube and
equilibrated 5
additional minutes at room temperature. The cryovial was rinsed with 1 ml of
BetaGene
ChillSolution and the rinse was added to the same 15 ml tube and the cells
were equilibrated
the final 5 minutes. An equal volume of growth medium was then added to the
thawed cells
and the contents were spun at X700 rpm (100 x g) in a bench top centrifuge for
2 minutes. The
supernatant containing cryoprotectants was removed and fresh growth media
added. The cells
were dispensed into the appropriate culture vessels for growth.
The cells were plated in 24 well plates at 5-7x104 cells/well (equivalent to a
1:16 split
ratio) to determine doubling times or 1 x105 cells/well to assess secretory
performance.
Doubling times were determined by assaying cell mass (Neutral Red dye uptake
method) after
7-10 days of culture. Response to a mixed cocktail of secretagogues in medium
(see Example
29) was assayed after 2-10 days of culture. The secretory response of pre-
bulk, post
bulk/harvest. and serum-free frozen and thawed cells is shown in F1G. 45.
Repetitive bulk
productions and cryopreservations (2 rounds) have not altered the doubling
time; 46.310.7 h in
plate cultures after 1 bulk run, and 46.810.7 h after a sequential bulk of
these cells. The results
demonstrate that each of the processes described; bulk production. harvest,
freeze and thaw, has
no appreciable effect on the secretory response of BG18/3E 1 cella. The
secretory response of
BG498/45 cells was similarly preserved through bulk production and freeze-
thaw.
In addition to serum-free cryopreservation, neuroendocrine cells were also
bulk
expanded in serum-free BetaGene Medium . The cells were initially seeded in
FBS-
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
216
supplemented BetaGene Medium to provide attachment factors, then the cells
were fed with
serum-free medium. The serum-free supplement provides 0.1% serum albumin
(human or
bovine), transferrin ( 10 mg/liter), ethanolamine (additional 50 pM),
phosphoethanolamine
(additional 50 pM). additional amino acids (additional 1 x MEM essential and
nonessential
amino acids; JRH Biosciences), ascorbate-2 phosphate (additional 0.2 mM),
lipoic acid
(additional 10 pM). myo inositol (additional 100 pM), tocopherol (additional
0.2~ pM),
vitamins K, and K2 (~5 nM), isobutyl methylxanthine (1 pM), cobalt (50 nM).
copper (0.5
pM), molybdic acid (SO nM), manganese (1 pM), nickel (I nM), selenium (30 nM);
silicate (S
p,M), Sn (50 nM), vanadate (5 nM), and zinc (additional 10 p.M).
The results demonstrate that the process developed for neuroendocrine cells
provide a
well controlled method for the bulk production of neuroendocrine cells.
Glucose consumption
rates arid lactate production rates indicated that with BG 18/3E I cells
growth proceeded at a
uniform rate. Glucose concentrations did not decrease below 5 rnM, and lactate
did not exceed
8 mM with either FBS- or SF- supplemented cultures. It was found that ammonia
concentrations that are > 1 mM begin to inhibit insulin secretion. Bulk
cultures supplemented
with either FBS or SF did not have concentrations of ammonia > I mM. Ammonia
with SF
cultures tended to be higher than FBS cultures; the former typically had
ammonia
concentrations of 0.~-0.8 mM, and FBS cultures 0.25-0.45 mM.
Doubling times were similar between plate cultures at bench scale and in the
bulk
production. Doubling times of BG18/3E1 cells were 2-2.5 days with plate
cultures, compared
to 40 and 37 hours when bulk produced with FBS- or serum-free supplements.
respectively.
Doubling times with BG498/45 cells were 39 hours in plate cultures and 24
hours when bulk
produced. The procedure and the medium provide nutrients to sustain cell
growth and maintain
biosynthesis of a secreted product. Peak insulin production with bulk BG498/45
cells was
about 75 pg/h. Both FBS- and SF- cultures of BG18/3E1 cells peaked at insulin
productions
of 80 p.g/h, however, insulin output/cell declined in the plateau phase of
growth. The apparent
fall of insulin output may reflect decreased proteolytic processing rates at
plateau phase of
growth. Serum-supplemented cultures exhibited normal processing from
proinsulin to insulin
with cells in log phase of growth. However, the amount of proinsulin increased
in early plateau
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
217
phase of serum-supplemented bulk cultures. Unprocessed insulin in mid-log
phase with
BG18/3E1 cells represented 5% of the insuiin produced, while in early plateau
13% was
unprocessed insulin. The current serum-free formulation (see above
formulation) resulted in
insulin outputs indistinguishable from serum-supplemented bulk cultures. This
indicates that
the current serum-free formulation maintains the synthetic rate of bulk
cultures as well as
serum-supplemented media. The most significant difference observed between
serum-free and
serum-supplemented cultures was in the completeness of insulin processing.
High-density
phase bulk cultures with serum-free supplementation did not process insulin as
well as serum-
supplemented cultures at high-density. Serum-free cultures had 32% unprocessed
insulin,
compared to 13% with high-density cultures with serum. This represents about
2.~-fold
increase in unprocessed insulin with serum-free cultures. It should be noted
that glucose
concentrations of the serum-free cultures were the lowest of the run for the
high-density
sample. It is possible that some amino acids had become rate-limiting at this
time and
contributed to the inadequate processing.
The late phase reduction in processing efficiency may indicate that further
formulation
improvements will be needed to provide normal insulin processing in serum-free
cultures,
alternatively higher flow rates may achieve a similar result. The finding that
even serum-
supplemented cultures exhibit processing difficulties with high-density
cultures emphasizes that
optimized bench-scale methods will not always translate to bulk scale
procedures. The
inventors consider that increased medium replacement rates may be required to
sustain normal
proteolytic processing in the high density setting of plateau phase with bulk
neuroendocrine-
cell cultures.
Overall, these results demonstrate that the current medium, not only was
designed to
provide an appropriate culture environment for neuroendocrine cell function,
but also is robust
enough to do so both at bench and production scales. In combination with the
serum-free
freezing solutions, serum-free BetaGene Medium provides an approach for growth
and
cryopreservation of cells with minimal exogenous protein.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
218
Example 31
Utilization of amino acids and other components in bulk-scale cultures.
Methods
Cells were seeded into a BabygenTM (New Brunswick Scientific, NJ) bioreactor.
The
S BabygenTM is a small-scale perifusion bioreactor designed to mimic the
larger bench-scale
CelligenTM bioreactor. Anchorage dependent cells are immobilized in a bed of
non-woven
polystyrene mesh-disks called FibraCeIT"' (New Brunswick Scientifc, NJ). The
bed
constitutes a 50 ml volume and will accommodate 10' cells per ml, and the
reactor holds 450
ml of medium. The reactor fits in a regular tissue culture C02 incubator and
is set up to be
perifused; fresh medium is added while 'spent' medium is removed at the same
rate. The
medium is circulated in the reactor by means of a magnetic stir bar.
Perifusion and medium
circulation is performed while retaining the cell population undisturbed. The
reactor is
oxygenated and medium pH controlled by sparging the incubator atmosphere into
the medium
of the vessel.
The cell line BGI/17, a rat insulinoma engineered to express human insulin
(Diabetes
46:958-967, 1997), was used for this study. The medium used was RPMI
supplemented with
S% fetal bovine serum (FBS), and 2 g/L of glucose. The reactor was seeded with
105 cell per
ml of bed and the cells were allowed to settle in the bed over night. The
culture was fed
approx. 1 ml of RPMI medium supplemented with 5% FBS per 106 cell per day
while being
propagated and was allowed to reach approx. 10'' cells per ml of bed in 4
days. At that point,
time "0 hours", the entire medium volume was exchanged with fresh, pre-heated
medium, and
medium perifusion was stopped. A sample of the fresh medium was retained.
After 4 hours, a
sample of spent medium was collected from the reactor, and again at 8 hours a
last sample was
collected. The samples were sent to a clinical laboratory (Roche Laboratories)
for analysis of
"amines" (amino acids and other amines).
Results
Asparagine was the only amino acid supplied by the medium that remained
essentially
unchanged over the 8 hour period. The alanine provided by the serum supplement
was also
unchanged. The remaining amino acids were reduced by 30-40%, with the
exception of
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
219
aspartic acid, serine, and tryptophan which were completely utilized. To
compensate for this
rate of consumption, amino acids should either be supplemented or the feed
rate doubled to >_ 2
ml of medium/million cells-24h. Routinely, the feed volume /million cells-24h
has been
maintained at ? 2 ml of medium/million cells-24h for cultures beyond early log
phase of
growth. In addition, most amino acids were increased 1 ~0-300% in the newly
developed
formulation.
The disappearance of some serum-derived components were also analyzed. The
components that were measured and detected in the initial medium include
phosphoserine,
taurine, phosphoethanolamine, citrulline, L-amino-n-butyric acid, aminobutyric
acid,
hydroxylysine, ornithine, L-3- & L-1- methylhistidine, carnosine, and
anserine. Of these
components, phosphoethanolamine, taurine, phosphoethanolamine, aminobutyric
acid,
hydroxylysine, methylhistidines, carnosine and anserine were apparently
utilized at a rapid rate,
such that these components would be depleted in less than 24 h. Medium supply
at ' 2 m1 of
medium/million cells-24h would potentially prevent this depletion. These
components would
not be available under serum-free conditions. These components represent
candidates for
inclusion in serum-free formulations. Phosphoethanolamine can impact on
phospholipases,
lecithin, choline and other associated pathways, as such this is the only
candidate that has been
tested as a supplement (see examples 29 and 32). The beneficial effects of
phosphoethanolamine indicate that other candidates from this list should be
examined for
beneficial effects with serum-free cultures.
In the 8 hour period 45% of the glucose was consumed, doubling the feed/cell
may
prevent glucose from being a rate-limiting substrate. Notably, when several
amino acids were
depleted. less than half of the available glucose had been used, while other
amino acids would
be depleted at times concordant with glucose depletion. This indicates that
with insulinoma
cells control of bulk cultures can be conveniently effected by measuring
glucose concentrations,
and preventing >40% decreases in glucose concentrations. Reductions of glucose
that exceed
40% are likely to be associated with depletions or rate-limiting
concentrations of some amino
acids.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
220
EXAMPLE 32
Beneficial Effects of Ethanolamine/Phosphoethanolamine
Methods
Cell Culture. Cells were plated in 24 well plates (~4 x 10'/well). allowed to
attach in
BetaGene Medium supplemented with 2% FBS one day, then were changed to serum-
free
conditions. The cell lines used were (3G18/3EI and (36498/45, a rat insulinoma
and a human
lung carcinoma, respectively, engineered to synthesize and secrete human
insulin. The serum-
free media were RPMI- or BetaGene medium with supplements. RPMI serum-free was
supplemented with I mg/ml BSA and 10 p.g/mI transferrin, and either with or
without
ethanolamine (EA) and phosphoethanolamine (PEA) at 50 p.M. BetaGene Medium was
supplemented with 1 mg/ml BSA, 10 pg/ml transferrin, and EA and PEA at ~0 pM.
Doubling
times of cells in these serum-free media were determined. In addition, dose-
responsive
cytotoxicity of linoleic acid (Sigma Chemical, BSA complexed or free acid with
cyclodextrin
as a carrier) was compared in these media by determining the effect of
linoleic acid on cell
doubling time with 4 log doses of linoleic acid (0.03 pM to 30 pM). Serum was
not used in
these studies because it contains undefined amounts of EA, PEA, and linoleic
acid.
Assay o, f Cell Growtl:: Neutral Red Uptake Assay. A neutral red uptake assay
was used
for quantification of viable cell mass to allow rapid determinations of cell
growth, and for
calculation of cell doubling times. Neutral red diffuses across cell
membranes, while
protonated neutral red does not. Neutral red accumulation in metabolically
active cells is
dependent on an acidic compartment (maintained by)H+/ATPase). Accumulation is
time and
concentration dependent, and with conditions appropriate to cells of interest,
uptake is linearly
related to viable cell number. The assay is initiated by adding neutral red
(from 1 mg/ml stock
in acetic acid) to cells to provide a final concentration of 25-50 ~g/ml (a
minimum of 2 ml
mediumlcm'' culture surface in each well is required). The cells are then
incubated with neutral
red for 0.5-1 h at 37°C. The medium with neutral red is then aspirated.
the cells washed once
with medium and the neutral red is extracted from the cells. Neutral red is
extracted with a
solution containing SO% ethanol and 0.1 M NaH2P04. (pH 5.1-5.5). The soluble
neutral red is
quantified by determining absorbance at 540 nm in a plate reading
spectrophotometer, with a
standard curve of neutral red (I-40 Itg/ml) dissolved in the same extraction
solution.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
221
Results
The two serum-free RPMI formulations differed in the content of EA and PEA.
RPMI
does not contain EA, PEA or linoleic acid. BetaGene medium contains EA, PEA
and iinoleic
acid. Addition of EA and PEA to serum-free RPMI medium enhanced the growrth
rate of the
cells. The doubling time of cells in RPMI was 3.8910.12 and 2.1110.05 days for
those without
and with EA and PEA, respectively. The addition of linoleic acid to cells in
RPMI enhanced
growth at the lowest concentration of 0.03 pM (doubling time = 3.2710.47 days.
vs 1.7 310.03
with EA/PEA). A two log higher concentration of linoleic acid was toxic in the
absence of
EA/PEA; apparent doubling times were shifted to 23.710.8 days. The supplements
of EA/PEA
virtually prevented this cytotoxic effect; doubling time was increased to
2.3110.08 days.
Doubling times of cells in BetaGene medium with serum-free supplements, (at
these plating
densities) were slightly more than 1 day (1.04 to 1.09 days), with no
deleterious effect of the 3
pM linoleic acid dose on doubling times; (30 pM was cytotoxic).
These results demonstrate that supplementation of media with EA/PEA exerts
both a
growth-promoting effect and a protective action on neuroendocrine cells. The
use of PEA
offers a greater concentration range for supplementation, as millimolar PEA
(unlike EA) had no
cytotoxic effects (see Example 29).
EXAMPLE 33
Development of BetaGene Medium
The development of a specific medium for neuroendocrine cells proceeded along
the
Iines suggested by Ham and colleagues (Ham and McKeehan 1979. Media and growth
requirements. Methods in Enzymology 58:44-93). Commercially available media
were
compared for performance with a human insulin-engineered beta-cell line, BG
18/3 E 1. The
better media were then compared in mixtures of two media. An objective of the
medium
development was to have a medium that supports neuroendocrine cells,
particularly in serum-
free conditions. To that end a screening methods was implemented to shorten
the time needed
to compare cell performance in different media.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
222
The method involves encapsulating cells in alginate beads and culturing the
cells in
media being tested, in the absence of any supplements. Many cell types do not
attach to culture
dishes in the absence of serum: alginate encapsulation provides a stable
format for studying
cells without attachment, without loss in changes (as would occur with
suspension cultures).
Cells were recovered at the end of the study and viable cell mass quantified
(see example 32 for
assay).
Methods
Cell Encapsulation. The cells were removed from culture flasks with trypsin-
EDTA,
collected in medium with FBS, then pelleted by centrifugation. The pelleted
cells were
resuspended in a 1.5% sodium alginate solution (50% high viscosity and 50% low
viscosity
sodium alginate made up in serumless medium) at a concentration of 5 million
cells per 1
milliliter of alginate. The suspension was transferred to a syringe and
allowed to sit at room
temperature for 5 minutes to allow all air bubbles to rise to the surface. A
25 gauge needle was
attached to the syringe and the cell/alginate slurry dispensed through the
syringe into a SO ml
conical tube containing approximately 35 mls of 1.35% CaCl2 /20 mM HEPES.
Beads formed
in the CaCl2 solution and were polymerized after about 10 minutes. The CaCl2
solution was
removed carefully and the beads were washed with two volumes of serumless
medium/20 mM
HEPES.
Cell Culture. The encapsulated cells were then cultured with the different
medium in
multiwell dishes (12, 24, and 48 wells) without any additives or with FBS.
Medium samples
were collected at 2-3 days intervals, BSA was added to samples of serumless
media (to give
0.1% BSA) to prevent insulin adsorption in freeze thaws. The samples were
frozen for later
assay or assayed immediately. Media that best maintained insulin output, and
cell growth for a
4-7 days were used in further studies, and compared to 1:1 mixtures of the
best media. The
selected media were also studied for recovery of cell performance when FBS was
added back to
the cultures. Results of these studies were subsequently extended to human
cells using human
islets (see Example 22).
34
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
223
All media were purchased from JRH Biosciences (Lenexa, KS), except CMRL 1066
was purchased from Life Technologies (Grand Island. NY).
Assay of Insulin. Insulin in the medium was quantified with a commercial
S radioimmunoassay (DPC, Los Angeles CA), that is referenced to USP human
insulin in the
inventors' laboratory {lot G; US Pharmacopeia, Rockvitle MD). The reference
USP human
insulin that is included in each assay, is validated by HPLC in the inventors'
laboratory (see
Example 22 for HPLC methods).
Results
The following commercial media were compared: CMRL 1066, M199E, alpha MEM,
RPMI, F 12, and DMEM (only in mixtures with F 12 ). Ham recommends M 199E,
alpha MEM,
and RPMI for culture with human cells. F12 has been used for pituitary cells
(see Bottenstein
et al. The growth of cells in serum-free hormone-supplemented media. Methods
in
I S Enzymology 58:94-109), and CMRL 1066 is used for human islets.
CMRL 1066 medium performed the poorest, with insulin output declining >80% in
3
days of culture without serum. Cell performance in CMRL 1066 with FBS was
hardly
discernible from cells in other media with FBS. Cells in M199E or RPMI
decreased insulin
output at a slower rate than with CMRL, but they performed more poorly than
MEM or F12.
Cells in F 12 usually retained a higher insulin output than cells in MEM.
Mixtures of F 12 and
M199 or F12 and MEM were found to perform the best, although DMEM-F12 provided
similar
cell performance. On the basis of these studies components of these media were
included in the
BetaGene Medium formulation, with additions of higher myoinositol, of
phosphoethanolamine,
and of ascorbate 2-phosphate (see Table 1 ). This medium was then custom
manufactured by
JRH Biosciences and cell performance was compared with cells in BetaGene
Medium, MEM,
and F12-MEM with and without FBS. Cells in BetaGene Medium and F12-MEM with
FBS
exhibited the best performance; growth in the two media was indistinguishable,
while insulin
output was highest with BetaGene Medium (F1G. 46). Growth of cells in BetaGene
Medium
without serum did not significantly differ from BetaGene Medium with FBS, but
insulin output
without FBS was reduced 30%; although it was not significantly lower than F12-
MEM with
CA 02318379 2000-07-12
WO 99/35495 PCTNS99/00551
224 _
FBS. Performance of cells in BetaGene Medium without serum surpassed that of
cells MEM
with or without FBS, and of cells in F12-MEM without FBS (FIG. 46).
Furthermore. switching
cells grown in F 12-MEM without FBS to BetaGene Medium without FBS resulted in
increased
insulin output, although not normalization of insulin (FIG. 47). These f
ndings demonstrate
S that the BetaGene Medium formulation provides optimal culture conditions for
this type of
neuroendocrine cell- and that this cell type can be grown in defined Betagene
Medium.
EXAMPLE 34
Altering responsiveness of human neuroendocrine cell lines
to modulators of secretion.
~iG 498/20 cells secrete insulin from a regulated secretory pathway as
evidenced by an
approximate 12-fold increase in basal insulin secretion versus that stimulated
by PMA,
carbachol. or a stimulatory cocktail (Swiss). Also, there is a lack of
responsiveness to glucose
and glucose plus IBMX. A preferred embodiment for the cell-based delivery of
insulin
includes the capacity to modulate release of the peptide in response to post-
prandial (such as
glucose) and/or hypoglycemic signals. The pancreatic beta-cell senses a
variety of extracellular
molecules through metabolism, receptors, and ion channels. Each of these
sensing mechanisms
impacts intracellular calcium levels, with increases in this ion stimulating
the release of insulin.
Two lines a experimental evidence implicate Ca2+ in regulated insulin
secretion from
~iG 498/20 cells: firstly, PMA and carbachol each exert effects on secretion
via the stimulation
of protein kinase C, where "C" is an abbreviation for "calcium"; and secondly,
verapamil
partially inhibits stimulated secretion from (3G 498/20 cells. Verapamil
antagonizes the uptake
of extracellular Ca2+. Efforts are underway to exploit the role of Ca2+-
regulated secretion in
~iG 498/20 cells, and to engineer these cell lines to respond to a variety of
secretory modulators
that are known to be involved in the physiological regulation of insulin
secretion from the
pancreatic beta cell. Table 13 lists potential candidates for engineering and
the molecules to
which they respond.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
225 _
TABLE 13
CAND1DATE TRANSGENES FOR ALTERING SECRETORY RESPONSES
OF NEUROENDOCRINE CELL LINES
Candidate Transgenic Protein Responsive to:
glucokmase glucose
GLUT-2 transporter glucose
SUR ATP, diazoxide
Kir ATP
late rectifying K channelsmembrane polarity, potassium
calcium channels membrane polarity, calcium
GLP-1 receptor GLP-1
muscarinic receptor acetyl choline
pancreatic polypeptide pancreatic polypeptide
receptor
somatostatin receptor somatostatin
alpha 2 adrenergic receptorepinephrine
leptin receptor leptin
All of the compositions and/or methods disclosed and claimed herein can be
made and
executed without undue experimentation in light of the present disclosure.
While the
compositions and methods of this invention have been described in terms of
preferred
embodiments, it will be apparent to those of skill in the art that variations
may be applied to the
compositions and/or methods and in the steps or in the sequence of steps of
the method
described herein without departing from the concept, spirit and scope of the
invention. More
specifically, it will be apparent that certain agents which are both
chemically and
physiologically related may be substituted for the agents described herein
while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to
those skilled in the art are deemed to be within the spirit, scope and concept
of the invention as
defined by the appended claims.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
226 _
REFERENCES
The following references. to the extent that they provide exemplary procedural
or other
details supplementary to those set forth herein, are specifically incorporated
herein by
reference.
ADA Diabetes 1996 Vital Statistics. ADA.
Alarcon et al., J. Clin. Invest. 95:1032-1039, 1995.
Alarcon et al., J. Biol. Chem 268(6}:4276-4280, I 993.
Altman et al., Diabetes 35:625-633. 1986.
Asfari et al., Endocrinology, 130:167-178, 1992.
Ashcroft et al., Diabetologia 29(10):727-33, 1986.
Ashcroft, Diabetalogia 37 (suppl 2): S21-529, 1994.
Bahnemann et al. Abs. Pap. ACS, 180:5, 1980.
Baichwal et al., In: Kucherlapati R, ed. Gene transfer. New York: Plenum
Press, pp. 117-148.
1986.
Bassel-Duby et al., Mol. Cell Biol., 12:5024-5032, 1992.
Beattie et al., J. Clin. Endocrinol. Metab., 73:93-98, 1991.
Beattie et al., Transplant Proc. 1995 Dec; 27(6): 3343, 1995.
Becker et al., Biol Chem., 271 ( 1 ):390-4, 1996.
Becker et al. , J. B. C. , 269:21234-2 I 23 8, I 994a.
Becker et al., Methods in Cell Biology, 43:161-189, Roth, M., Ed. New York,
Academic Press.
1994b.
Bonrler-Weir, Diab. Nutr. Metab. S (Suppl. I ): I -3, 1992.
Borrelli, et al., Exp Cell Res 170:363-368, 1987.
Bottenstein et al., Methods in Enzymology 58:94-109
Bourre and Sarasin, Nature, 305(5929):68-70, 1983.
Brelje and Sorenson, Endocrinology. 128( 1 ): 45-57, I 991.
Bressler and Johnson, Arch Intern Med, 157(8):836-48, 1997.
Brewer, Methods Cell Biol., 43 Pt A:233-45, 1994.
Burgess and Kelley, Ann. Rev. Cell Biology, 3:243-293, 1987.
Capaldi et al., Biochem. Biophys. Res. Comm., 76:425, 1977
CA 02318379 2000-07-12
WO 99/35495 PCT/U599/00551
227
Cavallo et al., Immunology, 75:664-668, 1992.
Challita et al., Proc. Natl. Acad Sci. U.SA, 91:2567-2571, 1994.
Chang et crl., Hepatology, 14:134A, 1991.
Chavez et al., In: Methods in Cell Biology, 43:263-288, Roth, M., Ed. New
York, Academic
Press, 1994.
Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987.
Chen et al., Proc Natl Acad Sci USA, 87( 11 ): 4088-4092, 1990.
Chick et al., Proc Natl Acad Sci USA, 74(2):628-32, 1977.
Chu et al., Nucleic Acids Res., 15:1311-1326, 1987.
Clark and Chick, Endocrinology, 126(4):1895-903, 1990.
Clark et al., Diabetes , 46(6):958-67, 1997.
Clark et al., Human Gene Therapy, 6:1329-1341, 1995.
Clark et al., Endocrinology, 126:1895-1903, 1990.
Clark et al., Endocrinology, 127:2779-2788, 1990.
Coffin, In: Virology, Fields et al. (eds.), New York: Raven Press, pp. 1437-
1500, 1990.
Coniff and Kro, Ther., 19:16-26, 1997.
Cordell et al., Cell, 18:533-543, 1979.
Cotten et al., Proc. Natl. Acad. Sci. USA, 89:6094-6098. I 992.
Couch et al., Am. Rev. Resp. Dis., 88:394-403, 1963.
Coupar et al., Gene, 68:1-10, 1988.
Cryer, P.E., In Williams Textbook of Endodrinology, 8th edition, 1992, eds
Jean D. Wilson and
Daniel W. Foster, W.B. Saunders Company.
Cumo and Oettinger, Nucleic Acids Res., 22(10):1810-1814, 1994.
Curiel, In: Viruses in Human Gene Therapy, J.-M.H. Vos (Ed.), Carolina
Academic Press,
Durham, N.C., pp. 179-212, 1994.
Dai et al., P.N.A.S. USA, 92:1401-1405, 1995.
Danos and Mulligan, Proc. Natl. Acad. Sci. U S A. 85( 17):6460-4, 1988.
Daval li et al. , Diabetes, 44( 1 ):104-11, 1995.
DeFronzo, Neth J Med. SO(5): 191-197, 1997.
Devoe et al., J Biol Chem 273:?SO1-6, 1998.
Dikworth et al., Nature 367:87-90, 1994.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/OOSSI
228
Efrat et ul.. P. N.A.S., 8:9037-9041, 1988.
Efrat e! al.. Proc. Nutl. Acud Sci.. USA, 92: 3576-3580, 199.
Efrat et crl., Diabetes. 42:901-907, 1993.
Eipper e! ul.. Annu. Rev. Neuroscience, 15:57-85, 1992.
Eizirik et ul.. J Clin Invest , 90(4):1263-8., 1992.
Emilsson et ul., Diubetes, 46(2): 313-316, 1997.
EPO 0273085
Evers et ul., Gastroenterology; 101(2): 303-311, 1991.
Fechheimer etul., Proc. Nat'1 Acad Sci. USA, 84:8463-8467, 1987.
Ferber et al.. ,I. Biol. Chem., 269:12523-12529, 1994.
Ferber et ul.. Mol Endocrinol., 5 (3) p319-26, 1991.
Ferkol et ul.. FASEB J., 7:1081-1091, 1993.
Fieck et ul.. " Nucleic Acids Res., 20(7):1785-9I, 1992.
Fiedorek et ul., Mol. Endocrin., 4:990-999, 1990.
Flotte et ul., Gene Therapy, 2:29-37, 1995.
Flotte et ul.. Am. J. Respir. Cell Mol. Biol., 7:349-356, 1992.
Flotte et ul., Proc. Natl: Acad. Sci. USA, 90:10613-10617, 1993.
Fraley et al., Proc. Nat'I Acad. Sei. USA, 76:3348-3352, 1979.
Frieker, Ann. Rev. Physiology, 50:309-321, 1988.
Friedmann, Science, 244:1275-1281, 1989.
Fritschy et ul., Diabetes, 40:37, 1991.
Gainer et ul.. Transplantation, 61(11):1567-1571, 1996.
Gazdar et ul. Proc. Natl. Acad. Sci. USA, 77:3519-3523, 1980.
German et ul, J. Biol. Chem., 265(36):22063-6, 1990.
German et ul., Mol. Cell. Biol., 12:1777-1788, 1992.
Ghosh-Choudhury et al., EMBOJ., 6:1733-1739, 1987.
Ghosh and Bachhawat, In: Wu G. and C. Wu ed. Liver diseases. targeted
diagnosis and therapy
using specific receptors and ligands. New York: Marcel Dekker, pp. 87-104,
1991.
Gomez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992.
Gopal, Mol. Cell Biol., 5:1188-1190, 1985.
Gossen and Bujard, Proc. Natl. Acad Sci. USA, 89:5547-5551 . 1992.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
229 _
Gossen et crl.. Science, 268(5218}:1766-1769. 199.
Graham and Prevec, Biotechnoloy, 20:363-390. 1992.
Graham and Prevec, In: E.J. Murray (ed.), Methods in Molecular Biolo~~v: Gene
Transfer and
Expression Protocol, Clifton, NJ: Humana Press, 7:109-128, 1991.
Graham and van der Eb, virology, 52:456-467, 1973.
Graham et al., J. CJen. Virol., 36:59-72, 1977.
Granner et al., Diabetes Care, 15(3):369-95, 1992.
Gross et al., P.NA.S., 86:4107-4111, 1989.
Grunhaus and Horwitz, " Seminar in Virology, 3:237-252, 1992.
Gueli et al., J. Exp. Clin. C~'ancer Res., 6:281, 1987.
Hakes et al., Endocrinology, 129:3053-3063, 1991.
Halban et al., Diabetologia 29: 893-6, 1986 .
Halban et al., Biochem .I. 15; 212(2): 439-443. 1983.
Ham and McKeehan Methods in Enrymology 58:44-93, 1979
Harland and Weintraub, ".l. Cell Biol., 101:1094-1099, 1985.
Han et al., Biofactors 6:321-328, 1997.
Hayek et al., Diabetes, 44( 12):1458-60, 1995.
Hellerstrom et al., Acta Padiatr. Scand. 377 (Suppl):55-62, 1991.
Hellerstrom et al., in Pathology of the endocrine pancreas (Lefebvre, P. J..
and Pipeleers, D.
G., eds), pp. 141-170, Springer-Verlag., Berlin, Heidelberg, Germany, 1988.
Henry, R. R., Endocrinol Metab Clin North Am 26(3): 553-73, 1997
Hermonat and Muzycska, Proc. Nat'I Acad. Sci. USA, 81:6466-6470, 1984.
Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990.
Herz and Gerard, Proc. Nat'1 Acad. Sci. USA 90:2812-2816, 1993.
Hohmeier et al., Diahetc~.o. 46(6):968-77, 1997.
Norwich et al. J. Y irol. . 64:642-650, 1990.
Hughes et al., Proc. ~'utl. Acad Sci. USA, 89:688-692, 1992.
Hughes et al., J. Biol. C'hc~m., 266:4521-4530, 1991.
Hughes et al., J. Biol. C'hem., 268:15205-15212, 1993.
34 Inagaki et al., Science. 270:1166-1170, 1995.
Jansson et al., J Clin Im~est= 96(2): 721-6, 1995.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
230 _
Johnson et al.. Science. 250:46-x.19. 1990.
Jones and Shenk, Cell, 13:181-188, 1978.
Jonsson et al., Nature, 371:606-609. 1994.
Kaneda et al., Science, 243:37-378. 1989.
Kaplitt et al., Nature Genetics, 8:148-154, 1994.
Karlsson et al., EMBO J, 5:2377-2385, 1986.
Kato et al., J. Biol. Chem., 266:3361-3364, 1991.
Kaufman et al., Biochemistry 33:98 I 3-9819, 1994.
Kelleher and Vos, Biotechnigue.s, 17(6):1110-I 117, 1994.
Kelley et al., Endocrinology 134:1648-1654, 1994.
Kennedy et al., JClin Invest., 98( 11 ): p. 2524-38, 1996
Kieffer et al., Biochem Biophys Re.s C'ommun, 224 (2) 1996.
Klein et al., Nature, 327:70-73, 1987.
Knaack et al., Diabetes, 43(12):1413-7. 1995
Komatsu et al., Diabetes 46:1928-1938, 1997.
Kotin et al., Proc. Natl. Acad. Sci. L:SA, 87:2211-2215, 1990.
Krall and Beaser, Joslin Diabetes Munual, Philadelphia, Lea & Febiger, 1989.
Kruse et al., Genes and Dev., 7:774-786, 1993.
Lacy et al., Science, 254:1782-1784, 1991.
Lacy, Sci. Am., 273(1):50-1, 54-8, 1995.
LaFace et al., Virology, 162:483-486, 1988.
Lambert and Atkins, JEndocrinol 121(3): 479-485, 1989.
Larsson and Litwin, Dev. Biol. Stundard., 66:385-390, 1987.
Laughlin et al., J. Virol., 60:515-524, l 986.
Le Gal La Salle et al., Science, 259:988-990, 1993.
Lebkowski et al., Mol. Cell. Biol.. *:3988-3996, 1988.
Leonard et al., Mol Endocrinoh 7:1275-1283, 1993.
Levrero et al., Gene, 101:195-202. I 991.
Liang et al., Gene Therapy, 3:350-3~6, 1996.
Liang et al., J.B.C., 266:6999-7007. I 991.
Lim, US Patent 4,352,883, October 5, 1982.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
231
Lin et al., Nature. 360:76-768, 1992.
Lipes et al.. Diabetes, 4~(Supp. 2):23A, 1996.
Luo et al., Blood, 82 (Supp.): 1,303A, 1994.
Macejak and Sarnow, Nature, 353:90-94, 1991.
S Madsen et al., J Cell Biol, 103(5):2025-34, I 986.
Madsen et al., Proc. Natl. Acad. Sci. U.S.A., 8.1:6652-6656, 1988.
Mains et al., Mol. Endocrinol., 9 ( 1 ) p3-13, 1995.
Maechler et al., FEBS Lett., 422(3): p. 328-32, 1998.
Maechler et al., Embo J., 16(13): p. 3833-41, 1997
Mains et al., Mol. Endocrinol., 9 (1) p3-13, 1995.
Mann et al., Cell, 33:153-159, 1983.
Marie et al., J. Biol. Chem., 268:23881-23890, 1993.
Markowitz et al., J. Yirol., 62:1120-1124, 1988.
Matschinsky, F. M., Diabetes, 45(2):223-4 I , 1996.
Mayo, Mol. Endocrinol., 1734-1744, 1992.
McCarty et al., J. Yirol., 65:2936-2945, 1991.
McClenaghan et al., Diabetes 45(8): 1 I 32-40, l 996.
McLaughlin et al., J. Yirol., 62:1963-1973, 1988.
Melloul et al., Proc. Natl. Acad. Sci. U S A, 90(9):3865-9, I 993.
Miller and Buttimore, Mol. Cell Biol., 6(8):2895-902, 1986.
Miller et al., EMBOJ, 13:1145-1156, 1994.
Miller, Curr. Top. Microbiol. Immunol., 158:1-24, 1992.
Miyazaki et al., Endocrinology, 127:126-132, I 990.
Mizrahi, Process Biochem., (August):9-12, 1983.
Moldrup and Nielsen, J. Biol. Chem. 26~( I 5):8686-8690, 1990.
Moore et al., Cell, 35:531-538, 1983.
Muzyczka, Curr. Top. Microbiol. Immunol. , 158:97-129, I 992.
Myers and White, Ann. Rev. Pharmacol Toxicol. 36:61 S-658, 1996.
Neisor et al., Biochem. J.. 178:559-568, 1979.
Newgard and McGarry, Ann. Rev. Biochem. , 64:689-719. 1995.
Newgard, C.B., Diabetes Rev , 4:191-206, 1996.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99t00551
232
Nicol et ul., J. Endocrinol., 126(2):255-259, 1990.
Nicolas and Rubinstein, In: Vectors: A ,survey of molecular cloning vectors
and their uses,
Rodriguez and Denhardt (eds.), Stoneham: Butterworth, pp. 494-513, 1988.
Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190. 1982.
Nicolau et ul., Methods Enrymol., 149:157-176, 1987.
Nielsen, Endocrinol. 110:600-606, 1982.
Nielsen, Exptl. Clin. Endokrinol 93:277-285, 1989.
Nylen and Becker, In: Principles and Practice of Endocrinolo~y~ and
Metabolism, K.L. Becker
(Ed.), Lippincott Co., Philadelphia, Chap. 171, 1472-1479. 1995.
O'Rahilly, S., Brit. Med. Jour. 314(7085): 955-959, I997.
O'Shea and Sun, Diabetes ,35:943-946, 1986.
Oettinger et al., Science, 248:1517-1523, 1990.
Ogawa et ul. , Diabetes, 44:75-79, 1995.
Ohi et al.. C:ene, 89L:279-282, 1990.
Ohisson et al., EMBOJ., 12:4251-4259, 1993.
Olesen et ul.. Eur J Pharmacol, 25 I ( 1 )53-9.
Otonkoski et al., J. Clin. Invest., 92:1459-1466, 1993.
Otonkoski et ul., Diabetes, 43(9):1164-6, 1994.
Pace and Clements, Diabetes 30, 8:621-5, 1981.
Palmer et ul , Proc. Natl. Acad. Sci. USA, 88:1330-1334, I 991.
Palmer et ul., Blood, 73:438-445, 1989.
Parekh et al., Pancreas, 9( 1 ): 83-90, 1994.
Paskind et al., Virology, 67:242-248, 1975.
Pearse and Takor, Fed. Proc., 38:2288-2294, 1979.
Peers et ul. , Mol Endocrin, 8:1798- I 806, 1994.
Pelletier and Sonenberg, Nature, 334:320-325, 1988.
Perales et al. , Proc. Natl. Acad. Sci. USA, 91:4086-4090, 1994.
Petricciani, Dev. Biol. Standard., 66:3-12, 1985.
Philippe et al., J. Clin. Invest., 79:351-358, 1987.
Phillips et al., In: Large Scale Mammalian Cell Culture (Feder, J. and
Tolbert, W. R., eds.),
Academic Press, Orlando, FL, U.S.A., 1985.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
233 _
Pieber et crl.. Am J Physiol.; 267( 1 Pt 1 ): E 156-E I 64, 1994.
Poitout et al...I Clin Invest 97(4):1041-6. 1996.
Poitout et al., Diahetes Metab, 22( I ):7-14, 1996.
Poitout et al., Diabetes, 44(3):306-13, 1995.
Polonsky et al.. N Engl J Med, 334( 12):777-83, I 996.
Polonsky, Diubetos, 44(6):705-17, 1995.
Porte, Jr. Diabetes, 40(2):166-80, 1991.
Potter et al., Proc. Ncrtl. Acad Sci. USA, 81:7161-7165, 1984.
Prentki M., Eur. J. Endocrin. 134: 272-286, 1996.
Quaade et ul.. FEB.S Lett. 280:47-52, 1991.
Racher et ul., Biotechnology Technigues, 9:169-174, 1995.
Radvanyi et ul., Molec. and Cell. Biol., 13(7): 4223-4232, 1993.
Ragot et al., Nature, 361:647-650, 1993.
Renan, Radiother. Oncol., 19:197-218, 1990.
Rhodes and Alarcon. Diabetes, 43:511-517, 1994.
Rich et al. , Hum. Gene Ther. , 4:461-476, 1993.
Ricordi et al., Diabetes, 37:413-420, 1988.
Ridgeway, In: Rodriguez RL, Denhardt DT, ed. Vectors: A survey of molecular
cloning
vectors and their uses. Stoneham: Butterworth, pp. 467-492. 1988.
Rippe et al., Mvl. C.'ell Biol., 10:689-695, 1990.
Rosenfeld et al., Science. 252:431-434, 1991.
Rosenfeld et al., Cell, 68:143-155, 1992.
Roux et al., Proc. Natl. Acad Sci. USA, 86:9079-9083, 1989.
Salahudeen et al., J Clin Invest 88:1886-1893, 1991.
Samulski et al.. J. Virol., 63:3822-3828, 1989.
Samulski et al., EMBOJ, 10:3941-3950, 1991.
Santerre et al.. Prvc. Nat'I Acad Sci. U.S.A., 78:4339-4343, 1981.
Sato et al., Proc. Nat'I Acad. Sci. U.S.A. 48:1184-1190, 1962.
Sauer, Methods in Enzymology, 225:890-900, 1993.
Seheenen and Pozzan, Intracellular Measurement of Calcium Usink Flarorescent
Probes. Cell
Biology: A Laboratory Handbook, Second Edition, vol. 3, Academic Press, 1998.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
234 _
Schatz et al., Cell, 59:103-1048. 1989.
Schnedl et crl., Diabetes, 43:1326-1333. 1994.
Scott et al., Free Radical Res 20:119-33, 1994.
Selden et al., Mol. Cell. Biol., 6:3173-3179, 1986.
Sen et al., Free Radical Biol Med 22:1241-57, 1997.
Shelling and Smith, Gene Therapy. 1:165-169, 1994.
Shibata et al., JMoI Endocrinol= 16(3):249-58, 1996.
Shimabukuro et al., Proc Natl Acad Sci USA, 94(9):4637-41, 1997.
Shimabukuro et al., J Clin Invest. 100(7):1750-4, 1997.
Sizonenko et al., Biochem J 278: 621-5, 1991.
Smeekens and Steiner, J.Biol. Chem., 265:2997-3000, 1990.
Soldevila, Buscema et al., J. Autoimmunity, 4:381-396, 1991.
Steiner et al., J.B.C., 267:23435-23438, 1992.
Stratford-Perricaudet and Perricaudet, p. 51-61, In: Human Gene Transfer, Eds,
O.
Cohen-Haguenauer and M. Boiron, Editions John Libbey Eurotext, France, I 991.
Stratford-Perricaudet et al., Hum. Gene Ther., 1:241-256, 1990.
Strobaek et al., Neuropharmaeology. 35(7):903-14, 1996.
Sullivan et al., Science 252:718-721. 1991.
Swenne, Diabetologia 35:193-201, 1992
Swenne et al., Diabetes 36:288-294, 1987.
Takeda et al., Diabetes, 42:773-777, 1993.
Tanizawa et al., Endocrinology. 138( 10):4513-6, 1997.
Temin, In: Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp. 149-
188, 1986.
Thorens et al., J. Clin Invest 90:77-85, 1992.
Thorens, Proc. Natl. Acad Sci.. 89:8641-8646, I 992.
Ting and Lee, DNA. 7(4): 275-286. 1988.
Top et al. , J. Infect. Dis. , 124 :15 5- I 60, 1971.
Tratschin et al., J Yirol. ; S 1 (3 ): 611-619, 1984.
Tratschin et al., Mol. Cell. Biol.. 5:32581-3260, 1985.
Tur-Kaspa et al., Mol. Cell Biol.. 6:716-718, 1986.
U. S. Patent 4,797,368
CA 02318379 2000-07-12
WO 99135495 PCT/US99/00551
235 _
U. S. Patent 4.892,538
U. S. Patent 4,959.317
U. S. Patent 5,011,472
U. S. Patent 5,139,941
S U. S. Patent 5,427,940
U. S. Patent 5,464,758
U.S. Patent 5,399,346
Usdin et al., Endocrinology, 133:2861-2870. 1993.
van Wezel, Nature, 216:64-65, 1967.
Von Melchner et al., Proc. Natl. Acad. Sci. h'. S.A., 87:3733-3737, 1990.
Waeber et al., J. Biol. Chem., 43:26912-26919. 1994.
Wagner et al., Science, 260:1510-1513, 1990.
Walsh et al., Proc. Natl.~ Acad. Sci. USA, 89:7257-7261, 1994;
Walsh et al., J. Clin. Invest., 94:1440-1448. 1994.
Wei et al., Gene Therapy, 1:261-268, 1994.
Welsh et al., Proc. Natl. Acad Sci. USA 87( I 5):5807-5811, 1990.
Welsh et al., Proc. Natl. Acad. Sci. USA 85:1 I 6-120, 1987.
Whitesell et al., Biochemistry, 30:11560-1 1566. 1991.
WO 09/15637
WO 89/01967
WO 90/02580
WO 91 /09939
WO 91/10425
WO 91/10470
WO 95/29989
WO 97/26321
WO 97/26334
Wong et al., Gene, 10:87-94, 1980.
Wu and Wu, Biochemistry, 27:887-892, 1988.
Wu and Wu, J. Biol. Chem., 262:4429-443?, 1987.
Wu and Wu, Adv. Drug Delivery Rev., 12: I 59-167, 1993.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/0055f
236
Wyborski and Short. Nucleic Acids Res., 19(17j:4647-~3. 1991.
Yang et al. . Proc. Nutl. Acad. Sci. USA, 91:4407-441 1, 1994.
Yang et ul., Proc. Nut'I Acud Sci. USA, 87:968-972. 1990.
Yoder et ul.. Blood, 82 (Supp.): 1:347A, 1994.
S Zawalich et ul.. Endocrinology 136:4903-4909, 1995.
Zawalich. W.S.. Diabetes Rev, 4:160-176, 1996.
Zhang et crl.. Diabetes, 38( 1 ):44-8, I 989.
Zhou et al. Pr-oc Natl Acad Sci U S A, 94( 12):6386-90. 1997.
Zhou et ul., E.rp. Hematol. (NY), 21:928-933, 1993.
Zhou et crl.. J.Exp.Med .., 179:1867-1875, 1994.
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
1 -
SEQUENCE LISTING
<110> THIGPEN, ANICE E.
QUAADE, CHRISTIAN
CLARK, SAMUEL A.
<120> RECOMBINANT CELL LINES FOR DRUG SCREENING
<130> BTGN:055/BTGN:055P
<140> Unknown
<141> 1999-O1-11
<150> 60/072,556
<151> 1998-Ol-12
<150> 60/087,848
<151> 1998-06-03
<160> 15
<170> PatentIn Ver. 2.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 1
cagcctgccc tggagggac 19
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 2
ccgagaaggc cagcagtgtg tac 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
2 _
<400> 3
tggtggaatt cctgaactcc ccc 23
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: synthetic
primer
<400> 4
gattggccac ccggcctgca
20
<210> 5
<211> 57
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: synthetic
primer
<400> 5
gatcccttca tcaggccatc tggccccttg 57
ttaataatcg actgacccta ggtctaa
<210> 6
<211> 57
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence: synthetic
primer
<400> 6
gatcttagac ctagggtcag tcgattattaacaaggggcc agatggcctg atgaagg57
<210> 7
<211> 57
<212> DNA
<213> Artificial Sequence
<Z20>
<223> Description of ArtificialSequence: synthetic
primer
<400> 7
gatcccttca tcaggccatc tggccccttgttaataatct aattacccta ggtctaa57
<210> 8
<211> 57
<212> DNA
<213> Artificial Sequence
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
3 -
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 8
gatcttagac ctagggtaat tagattatta acaaggggcc agatggcctg atgaagg 57
<210> 9
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 9
ctcccaagct taagtgacca gctacaa 27
<210> 10
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 10
gggcaaccta ggtactggac cttctatc 2g
<210> 11
<211> 28
<212> PRT
<213> Mus musculus
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 11
Ser Ala Asn Ser Asn Pro Ala Met Ala Pro Arg Glu Arg Lys Ala Gly
1 5 10 15
Cys Lys Asn Phe Phe Trp Lys Thr Phe Thr Ser Cys
20 25
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
CA 02318379 2000-07-12
WO 99/35495 PCT/US99/00551
4 -
<400> 12
gagaaaggga attccatccc aaata 25
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 13
ttcaggatcc aaggatcagc agg 23
<210> 14
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 14
ggggaactag taaactcttt gttgaag 27
<210> 15
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic
primer
<400> 15
ctcagtaact cgagttaatg aagtcct 27
