Note: Descriptions are shown in the official language in which they were submitted.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
METHOD OF DETERMINING THE FUNCTION OF NUCLEOTIDE.
SEQUENCES AND THE PROTEINS THEY ENCODE BY TRANSFECTING
THE SAME INTO A HOST
This application is a Continuation-In-Part application of U.S. Patent
Application Serial No. 09/008,186, filed on January 16, 1998, which is
incorporated by reference.
FIELD OF THE INVENTION
The present invention relates generally to the field of molecular biology
and plant genetics. Specifically, the present invention relates to a method
for
determining the function of nucleotide sequences and genes by transfecting the
same into a host.
BACKGROUND OF THE INVENTION
Great interest exists in launching genome projects in plants comparable to
the human genome project. Valuable and basic agricultural plants, including by
way of example but without limitation, corn, soybeans and rice are targets for
such projects because the information obtained thereby may prove very
beneficial
for increasing world food production and improving the quality and value of
agricultural products. The United States Congress is considering launching a
com genome project. By helping to unravel the genetics hidden in the corn
genome, the project could aid in understanding and combating common diseases
of grain crops. It could also provide a big boost for efforts to engineer
plants to
improve grain yields and resist drought, pests, salt, and other extreme
environmental conditions. Such advances are critical for a world population
expected to double by 2050. Currently, there are four species which provide
60%
of all human food: wheat, rice, corn, and potatoes, and the strategies for
increasing the productivity of these plants is dependent on rapid discovery of
the
function of unknown gene sequences determined as a result of genomics
research.
Moreover, such information could identify genes and products encoded by genes
useful for human and animal healthcare such as pharmaceuticals.
One strategy that has been proposed to assist in such efforts is to create a
database of expressed sequence tags (ESTs) that can be used to identify
expressed
genes. Accumulation and analysis of expressed sequence tags (ESTs) have
become an important component of genome research. EST data may be used to
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
identify gene products and thereby accelerate gene cloning. Various sequence
databases have been established in an effort to store and relate the
tremendous
amount of sequence information being generated by the ongoing sequencing
efforts. Some have suggested sequencing 500,000 ESTs for corn and 100,000
ESTs each for rice, wheat, oats, barley, and sorghum. Efforts at sequencing
the
genomes of plant species will undoubtedly rely upon these computer databases
to
share the sequence data as it is generated. Arabidopsis thaliana may be an
attractive target for gene function discovery because a very large set of ESTs
have
already been produced in this organism, and these sequences tag more than 50%
of the expected Arabidopsis genes.
Estimates of several of the important grain genome sizes (in reference to
microbes and humans) have been suggested. These include Oryza sativa (rice) at
about 430 million bases or about 20,000 genes, Sorghum bicolor (sorghum) at
about 760 million bases or about 30,000 genes, Zea mays (corn) at about 2
billion
i 5 bases or about 30,000 genes, and Triticum aestivum (wheat) at about 16
billion
bases or about 30,000 genes.
Potential use of the sequence information so generated is enormous if
gene function can be determined. It may become possible to engineer
commercial seeds for agricultural use to convey any number of desirable traits
to
food and fiber crops and thereby increase agricultural production and the
world
food supply. Research and development of commercial seeds has so far focused
primarily on traditional plant breeding, however there has been increased
interest
in biotechnology as it relates to plant characteristics. Knowledge of the
genomes
involved and the function of genes contained therein for both monocotyledonous
and dicotyledonous plants is essential to realizing positive effects from such
technology.
The impact of genomic research in seeds is potentially far reaching. For
example, gene profiling in cotton can lead to an understanding of the types of
genes being expressed primarily in fiber cells. The genes or promoters derived
from these genes may be important in genetic engineering of cotton fiber for
increased strength or for "built-in" fiber color. In plant breeding, gene
profiling
coupled to physiological trait analysis can lead to the identification of
predictive
markers that will be increasingly important in marker assisted breeding
programs.
2
CA 02318662 2000-07-14
WO 99/36516 PCT/ITS99/01164
Mining the DNA sequence of a particular crop for genes important for yield,
quality, health, appearance, color, taste, etc., are applications of obvious
importance for crop improvement.
Work has been conducted in the area of developing suitable vectors for
S expressing foreign DNA and RNA in plant hosts. Ahlquist, U.S. Patent Nos.
4,885,248 and 5,173,410 describes preliminary work done in devising transfer
vectors which might be useful in transferring foreign genetic material into a
plant
host for the purpose of expression therein. Additional aspects of hybrid RNA
viruses and RNA transformation vectors are described by Ahlquist et al. in
U.S.
Patent Nos. 5,466,788, 5,602,242, 5,627,060 and 5,500,360, all of which are
incorporated herein by reference. Donson et al., U.S. Patent Nos. 5,316,931,
5,589,367 and 5,866,785, incorporated herein by reference, demonstrate for the
first time plant viral vectors suitable for the systemic expression of foreign
genetic material in plants. Donson et al. describe plant viral vectors having
heterologous subgenomic promoters for the systemic expression of foreign
genes.
Carrington et al., U.S. Patent 5,491,076, describe particular potyvirus
vectors also
useful for expressing foreign genes in plants. The expression vectors
described
by Carrington et al. are characterized by utilizing the unique ability of
viral
polyprotein proteases to cleave heterologous proteins from viral polyproteins.
These include Potyviruses such as Tobacco Etch Virus. Additional suitable
vectors are described in U.S. Patent No. 5,811,653 and U.S. Patent Application
Serial No. 08/324,003, both of which are incorporated herein by reference.
Construction of plant RNA viruses for the introduction and expression of
non-viral foreign genes in plants has also been demonstrated by Brisson et
al.,
Methods in Enzymology 118:659 (1986), Guzman et al., Communications in
Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, pp. 172-189
(1988), Dawson et al., Virology 172:285-292 (1989), Takamatsu et al., EMBO J.
6:307-311 (1987), French et al., Science 231:1294-1297 (1986), and Takamatsu
et al., FEBS Letters 2_fL9:73-76 ( 1990). However, these viral vectors have
not
been shown capable of systemic spread in the plant and expression of the non-
viral foreign genes in the majority of plant cells in the whole plant.
Moreover,
many of these viral vectors have not proven stable for the maintenance of non-
viral foreign genes. However, the viral vectors described by Donson et al., in
3
CA 02318662 2000-07-14
WO 99/36516 PCTNS99/01164
U.S. Patent Nos. 5,316,931, 5,589,367, and 5,866,785, Tureen in U.S. Patent
No.
5,811,653, Carrington et al. in U.S. Patent No. 5,491,076, and in co-pending
U.S.
Patent Application Serial No. 08/324,003, have proven capable of infecting
plant
cells with foreign genetic material and systemically spreading in the plant
and
expressing the non-viral foreign genes contained therein in plant cells
locally or
systemically. Likely, additional vehicles having greater infectivity and
enhanced
local or systemic expression of foreign genetic material will be developed
either
independently or as improvements of the vectors described in the patents and
pending applications noted above. All patents, patent applications, and
references
cited in the instant application are hereby incorporated by reference.
The recombinant plant viral nucleic acids and recombinant viruses such as
those demonstrated by Donson et al. which have been demonstrated to infect
plant cells and express the foreign genetic material systemically are
generally
characterized as comprising a native plant viral subgenomic promoter, at least
one
non-native plant viral subgenomic promoter, a plant viral coat protein coding
sequence, and at least one non-native nucleic acid sequence. The value of
using
such plant viral nucleic acids to effect systemic expression of non-native
nucleic
acids in a plant host is significant. This tool, if coupled with a rational
design for
elucidating the function of the non-native nucleic acids, would make
significant
strides in understanding the large amount of sequence information produced by
sequencing efforts.
SUMMARY OF THE INVENTION
In one aspect, the present invention is directed to a method of determining
the function of nucleic acid sequences including genes and the proteins they
encode in host organisms such as bacteria, yeast, plants, or animals, by
transfecting the nucleic acid sequences into the organisms in a manner so as
to
effect localized or systemic expression of the nucleic acid sequences. The
present
inventors have determined methods for determining the function of nucleic acid
sequences and the proteins they encode by transfecting organisms with nucleic
acids of interest thereby providing a more rapid means for elucidating the
function of these nucleic acids including genes and subsequently utilizing the
rapidly expanding information in the field of genomics.
4
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
In one embodiment, a nucleic acid is introduced into a plant host wherein
the plant host may be a monocotyledonous or dicotyledonous plant, plant tissue
or plant cell. Preferably, the nucleic acid may be introduced by way of a
plant
viral nucleic acid. Such plant viral nucleic acids are stable for the
maintenance
S and transcription or expression of non-native nucleic acid sequences and are
capable of locally or systemically transcribing or expressing such sequences
in
the plant host. Especially preferred recombinant plant viral nucleic acids
useful
in the methods of the present invention comprise a native plant viral
subgenomic
promoter, a plant viral coat protein coding sequence, and at least one non-
native
nucleic acid sequence.
Some viral vectors used in accordance with the present invention may be
encapsidated by the coat proteins encoded by the recombinant plant virus. The
recombinant plant viral nucleic acid or recombinant plant virus is used to
infect
appropriate hosts such as plants. The recombinant plant viral nucleic acid is
capable of replication in the host, localized or systemic spread in the host,
and
transcription or expression of the non-native nucleic acid in the host to
produce
the desired product. Such products may be for example, useful polypeptides or
proteins including enzymes, complex biomolecules, ribozymes, or polypeptides
or protein products resulting from positive-sense or anti-sense RNA
expression.
Moreover, in alternate embodiments, the nucleic acid of interest may be
expressed with the genomic DNA or RNA of the viral vectors and hence be under
the control of a genomic promoter.
Some other viral vectors used in accordance with the present invention
comprise recombinant animal viruses or portions thereof. Likewise, such animal
viral vectors are useful to infect appropriate hosts such as animals. The
recombinant animal viral nucleic acid is capable if replication in the host,
systemic or localized spread in the host, and transcription or expression of
the
non-native nucleic acid in the host to produce the desired product.
In another embodiment, the present method uses a viral expression vector
encoding for at least one protein non-native to the vector that is released
from at
least one polyprotein expressed by said vector by proteolytic processing.
In yet other preferred embodiments according to the present method,
recombinant plant viruses are used which encode for the expression of a fusion
S
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/OI164
between a plant viral coat protein and the amino acid product of the nucleic
acid
of interest.
In yet other preferred embodiments according to the present method, a
nucleic acid sequence of interest including a gene may be placed within any
suitable vector construct such as a virus for infecting the host organism.
That is,
the present method may be practiced without concern for the position of the
nucleic acid sequence of interest within the vector used to infect the host
organism. The invention is not intended to be limited to any particular viral
constructs but specifically contemplates using all operable constructs. Those
skilled in the art will understand that these embodiments are representative
only
of many constructs which may be useful to produce localized or systemic
expression of nucleic acids in host organisms such as plants. All such
constructs
are contemplated and intended to be within the scope of the present invention.
Those of skill in the art will readily understand that there are many
methods to determine the function of the nucleic acid once localized or
systemic
expression in a host, such as a plant, plant cell, transgenic plant, animal or
animal
cell is attained. In one embodiment the function of a nucleic acid may be
determined by complementation analysis. That is, the function of the nucleic
acid
of interest may be determined by observing the endogenous gene or genes whose
function is replaced or augmented by introducing the nucleic acid of interest.
A
discussion of such phenomenon is provided by Napoli et al., The Plant Cell
2:279-289 ( 1990). In a second embodiment, the function of a nucleic acid may
be determined by analyzing the biochemical alterations in the accumulation of
substrates or products from enzymatic reactions according to any one of the
means known by those skilled in the art. in a third embodiment, the function
of a
nucleic acid may be determined by observing phenotypic changes in the host by
methods including morphological, macroscopic or microscopic analysis. In a
fourth embodiment, the function of a nucleic acid may be determined by
observing any changes in biochemical pathways which may be modified in the
host organism as a result of expression of the nucleic acid. In a fifth
embodiment,
the function of a nucleic acid may be determined utilizing techniques known by
those skilled in the art to observe inhibition of endogenous gene expression
in the
cytoplasm of cells as a result of expression of the nucleic acid. In a sixth
6
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
embodiment, the function of a nucleic acid may be determined utilizing
techniques known by those skilled in the art to observe changes in the RNA or
protein profile as a result of expression of the nucleic acid. In a seventh
embodiment, the function of a nucleic acid may be determined by selection of
organisms such as plants or human cells and tissues capable of growing or
maintaining viability in the presence of noxious or toxic substances, such as,
for
example herbicides and pharmaceutical ingredients.
A second aspect of the present invention is a method of silencing
endogenous genes in a host by introducing nucleic acids into the host by way
of a
viral nucleic acid such as a plant or animal viral nucleic acid suitable to
produce
expression of a nucleic acid in a transfected host. In one embodiment, the
host is
a plant, but those skilled in the art will understand that other hosts such as
bacteria, yeast and animals including humans may also be utilized. This method
utilizes the principle of post-transcription gene silencing of the endogenous
host
gene homolog. Since the replication mechanism of the transfected non-native
nucleic acid produces both sense and antisense RNA sequences, the orientation
of
the non-native nucleic acid insert is not crucial to providing gene silencing.
Particularly, this aspect of the invention is especially useful for silencing
a
multigene family as is frequently found in plants. The prior art has not
demonstrated an effective means for silencing a multigene family in plants.
A third aspect of the present invention is a method for selecting desired
functions of RNAs and proteins by the use of virus vectors to express
libraries of
nucleic acid sequence variants. Libraries of sequence variants may be
generated
by means of in vitro mutagenenisis and/or recombination. Rapid in vitro
evolution can be used to improve virus-specific or protein-specific functions.
In
particular, plant RNA virus expression vectors may be used as tools to bear
libraries containing variants of nucleic acid, genes from virus, plant or
other
sources, and to be applied to plants or plant cells such that the desired
altered
effects in the RNA or protein products can be determined, selected and
improved.
In a preferred embodiment, nucleic acid shuffling techniques may be employed
to
construct shuffled gene libraries. Random, semi-random or known sequences of
virus origin may also be inserted in virus expression vectors between native
virus
sequences and foreign gene sequences, to increase the genetic stability of
foreign
7
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
genes in expression vectors as well as the translation of the foreign gene and
the
stability of the mRNA encoding the foreign gene in vivo. The desired function
of
RNA and protein may include the promoter activities, replication properties,
translational efficiencies, movement properties (local and systemic),
signaling
pathway, or virus host range, among others. The desired function alteration
can
be identified by assaying infected plants and the nature of mutation can be
determined by analysis of sequence variants in the virus vector.
Methods to increase the representation of gene sequences in virus
expression libraries may also be achieved by bypassing the genetic bottleneck
of
propagation in E. coli. For example, in one of the preferred embodiments of
the
instant invention, cell-free methods may be used to clone sequence libraries
or
individual arrayed sequences into virus expression vectors and reconstruct an
infectious virus, such that the final ligation product can be transcribed and
the
resulting RNA can be used for plant or plant cell inoculation/infection with
the
output being gene function discovery or protein production.
Techniques to screen sequence libraries can be introduced into RNA
viruses or RNA virus vectors as populations or individuals in parallel to
identify
individuals with novel and augmented virus-encoded functions in replication
and
virus movement, foreign gene sequence retention in vectors and proper folding,
activity and expression of protein products, novel gene expression, effects on
host
metabolism, and resistance or susceptibility of plants to exogenous agents.
Variation in the sequence of a native virus genes) or heterologous
nucleotide sequences) may be introduced into an RNA virus or an RNA virus
expression vector by many methods as a means to screen a population of
variants
in batch or individuals in parallel for novel properties exhibited by the
virus itself
or conferred on the host plant or cell by the virus vector. Variant
populations can
be transfected as populations or individual clones into "host": 1)
protoplasts; 2)
whole plants; or 3) inoculated leaves of whole plants and screened for various
traits including protein expression (increase or decrease), RNA expression
(increase or decrease), secondary metabolites or other host property gained or
loss
as a result of the virus infection.
For treatment of hosts with agents that result in cell death or down
regulation in general metabolic function, a virus vector, which simultaneously
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
expressed the green fluorescent protein (GFP) or other selectable marker gene
and
the variant sequence, is used to screen quantitatively for levels of
resistance or
sensitivity to the agent in question conferred upon the host by the variant
sequence expressed from the viral vector. By quantitatively screening pools or
individual infection events, those viruses containing unique variant sequences
allowing sustained metabolic life of host are identified by fluorescence under
long wave UV light. Those that do not confer this phenotype will fail to or
poorly fluoresce. In this manner, high throughput screening in multi-well
dishes
in plate readers is possible where the average fluorescence of the well would
be
expressed as a ratio of the adsorption (measuring the cell mass) thereby
giving a
comparable quantitative value. This technique enables screening of populations
or individuals followed by rescue of the sequence from virus vectors
conferring
desired trait by RT-PCR and re-screening of particular variant sequences in
secondary screens.
The functions of transcription factors or factors contributing to the signal
transduction pathway of host cells are monitored by using specific proteomic,
mRNA or metanomic traits to be assayed following transfection with a virus
expression library. The contribution of a particular protein or product to a
valuable trait may be known from the literature, but a new mode of enhanced or
reduced expression could be identified by finding the factors that respand to
cellular signals that in turn alter its particular expression. For example,
transcription factors regulating the expression of defense proteins such as
systemin peptides, or protease inhibitors could be identified by transfecting
hosts
with virus libraries and the expression of systemin or protease inhibitors or
their
RNAs be directly assayed. Conversely, the promoters responsible for expressing
these genes could be genetically fused to the green fluorescent protein and
introduced into hosts as transient expression constructs or into stable
transformed
host cells/tissues. The resulting cells would be transfected with viral vector
libraries. Hosts now could be screened rapidly by following relative GFP
expression following vector transfection. Likewise, coupling the transfecting
of
hosts with virus libraries with the treatment of plants with methyl jasmonate
could identify sequences that reverse or enhance the gene induction events
induced by this metabolite. This approach could be applied to other factors
9
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
involved in promotion of higher biomass in plants such as Leafy or DET2. The
expression of these factors could be directly assayed or via promoters
genetically
fused to GFP. This technique will enable screening of populations or
individuals
followed by rescue of the sequence from virus vectors conferring desired trait
by
RT-PCR and re-screening of particular variant sequences in secondary screens.
A fourth aspect of the present invention is a method for inhibiting an
endogenous protease of a plant host comprising the step of treating the plant
host
with a compound which induces the production of an endogenous inhibitor of
said protease. In a preferred embodiment, jasmonic acid may be used to treat
the
plant host to induce the production of an endogenous inhibitor of an
endogenous
protease. in another preferred embodiment, the treatment of the plant host
with a
compound results an increased representation of an exogenous nucleic acid or
the
protein product thereof. In particular, transgenic hosts expressing protease
inhibitors may be used to decrease the degradation of proteins expressed by
virus
expression vectors. In a preferred embodiment, jasmonic acid may be used to
treat plants infected with virus expression vectors to decrease degradation of
proteins expressed by virus expression vectors.
A fifth aspect of the present invention are genes and fragments thereof,
nucleotide sequences, and gene products obtained by way of the method of the
present invention. The present invention features expressing selected
nucleotide
sequences in a host organism. Those of skill in the art will readily
appreciate that
the gene products of such nucleotide sequences may be isolated using
techniques
known to those skilled in the art. Such gene products may exhibit biological
activity as pharmaceuticals, herbicides, and other similar fimctions.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts the vector TTO1/PSY +.
FIG. 2 represents the vector TTO1 AIPDS+.
FIG. 3 represents the vector TTOIA/Ca CCS+.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
FIG. 4 represents the vector TTU51 CTP CrtB.
FIG. 5 represents the vector TTOSAl CTP Crtl 491.
FIG. 6 represents the Erwinia herbicola phytoene desaturase gene
(plasmid pAU211 ).
FIG. 7 represents the plasmid KS+lCrtl* 491.
FIG. 8 represents the plasmid pBS736.
FIG. 9 represents the plasmid pBS 712.
FIG. 10 represents the 72 kDa gene product of the genomic clone
encoding alcohol oxidase ZZAl.
FIG. 11 represents the plasmid TTOS 1 APE ZZA 1.
FIG. 12 represents the plasmid TTO1 A 103L.
FIG. 13 represents the plasmid TTUS 1 A QSEO #3.
FIG. 14 represents the plasmid KS+ TVCVK #23.
FIG. 15 represents the plasmid pBS735.
FIG. 16 represents the plasmid pBS740.
FIG. 17 represents the plasmid pBS723.
FIG. 18 represents the plasmid pBS731.
FIG. 19 represents the plasmid pBS740 AT #120.
FIG. 20 represents the nucleotide sequence alignment of 740 AT #120 to
human ADP-ribosylation factor (ARF3) M33384.
FIG. 21 represents the plasmid pBS740 AT #88.
FIG. 22 represents the nucleotide sequence alignment of 740 AT #88 to
L33574 mRNA for rhodopsin.
FIG. 23 represents the nucleotide sequence alignment of 740 AT #88 to
X07797 Octopus mRNA for rhodopsin.
FIG. 24 represents the protein sequence alignment of 740 AT #88 to an
Arabidopsis est ORF ATTS2938.
FIG. 25 represents the protein sequence alignment of 740 AT #88 to
Octopus rhodopsin P31356.
FIG. 26 represents amino acid sequence comparison of 740 AT #2441 to
tobacco RAN-B 1 GTP binding protein.
FIG. 27 represents nucleotide sequence comparison of 740 AT #2441 to
human RAN GTP-binding protein.
11
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
FIG. 28 represents a schematic diagram of cell free cloning.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect, the present invention is directed to a method of determining
the function of a nucleic acid sequence including a gene and a protein encoded
thereby in an organism such as bacteria, fungi, yeast, animals and plants by
transfecting the nucleic acid sequence into the organism. The present
inventors
have determined methods for determining the function of nucleic acid sequences
by transfecting organisms with the nucleic acids thereby providing a more
rapid
means for determining gene function and utilizing the rapidly expanding
sequence information in the field of genomics.
In one embodiment, a nucleic acid is introduced into a plant host.
Preferably, the nucleic acid may be introduced by way of a viral nucleic acid.
Such recombinant viral nucleic acids are stable for the maintenance and
transcription or expression of non-native nucleic acid sequences and are
capable
of systemically transcribing or expressing such non-native sequences in the
plant
host. Especially preferred recombinant plant viral nucleic acids useful in the
present invention comprise a native plant viral subgenomic promoter, a plant
viral
coat protein coding sequence, and at least one non-native nucleic acid
sequence.
In a second embodiment, plant viral nucleic acid sequences used in the
method of the present invention are characterized by the deletion of the
native
coat protein coding sequence and comprise a non-native plant viral coat
protein
coding sequence and a non-native promoter, preferably the subgenomic promoter
of the non-native coat protein coding sequence, capable of expression in the
plant
host, packaging of the recombinant plant viral nucleic acid, and ensuring a
systemic infection of the host by the recombinant plant viral nucleic acid.
The
recombinant plant viral nucleic acid may contain one or more additional native
or
non-native subgenomic promoters. Each non-native subgenomic promoter is
capable of transcribing or expressing adjacent genes or nucleic acid sequences
in
the plant host and incapable of recombination with each other and with native
subgenomic promoters. One or more non-native nucleic acids may be inserted
adjacent to the native plant viral subgenomic promoter or the native and non-
native plant viral subgenomic promoters if more than one nucleic acid sequence
12
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
is included. Moreover, it is specifically contemplated that two or more
heterologous non-native subgenomic promoters may be used. The non-native
nucleic acid sequences may be transcribed or expressed in the host plant under
the control of the subgenomic promoter to produce the products of the nucleic
acids of interest.
In a third embodiment, plant viral nucleic acids are used in the present
invention wherein the native coat protein coding sequence is placed adjacent
one
of the non-native coat protein subgenomic promoters instead of a non-native
coat
protein coding sequence.
In a fourth embodiment, plant viral nucleic acids are used in the present
invention wherein the native coat protein gene is adjacent its subgenomic
promoter and one or more non-native subgenomic promoters have been inserted
into the viral nucleic acid. The inserted non-native subgenomic promoters are
capable of transcribing or expressing adjacent genes in a plant host and are
incapable of recombination with each other and with native subgenomic
promoters. Non-native nucleic acid sequences may be inserted adjacent the non-
native subgenomic plant viral promoters such that the sequences are
transcribed
or expressed in the host plant under control of the subgenomic promoters to
produce the product of the non-native nucleic acid. Alternatively, the native
coat
protein coding sequence may be replaced by a non-native coat protein coding
sequence.
The viral vectors used in accordance with the present invention may be
encapsidated by the coat proteins encoded by the recombinant plant virus. The
recombinant plant viral nucleic acid or recombinant plant virus is used to
infect
appropriate hosts such as plants. The recombinant plant viral nucleic acid is
capable of replication in the host, localized or systemic spread in the host,
and
transcription or expression of the non-native nucleic acid in the host to
produce
the desired product. Such products may be for example, therapeutics and other
useful polypeptides or proteins including enzymes, complex biomolecules,
ribozymes, or polypeptides or protein products resulting from positive-sense
or
anti-sense RNA expression. Moreover, the nucleic acid of interest may be under
the control of a genomic promoter and therefore be expressed with the genome
of
the virus.
13
CA 02318662 2000-07-14
WO 99/36516 PC'T/US99/01164
In another embodiment, the present method uses a viral expression vector
encoding at least one protein non-native to the vector that is released from
at least
one polyprotein expressed by said vector by proteolytic processing catalyzed
by
at least one protease in said polyprotein wherein said vector comprises at
least
one promoter, DNA having a sequence which codes for at least one polyprotein
from a polyprotein-producing virus, at least one restriction site flanking a
3'
terminus of said DNA and a cloning vehicle. Additional embodiments use a viral
expression vector encoding for at least one protein non-native to the vector
that is
released from at least one polyprotein expressed by the vector by proteolytic
processing catalyzed by at least one protease in the polyprotein wherein the
vector comprises at least one promoter, DNA having a sequence which codes for
at least one polyprotein from a polyprotein-producing virus, may contain at
least
one restriction site flanking a 3' terminus of said cDNA and a cloning
vehicle.
Preferred embodiments include using a potyvirus as the polyprotein-producing
virus, and especially preferred embodiments may use TEV (tobacco etch virus).
A more detailed description of such vectors useful according to the method of
the
present invention may be found in U.S. Patent No. 5,491,076 which is
incorporated herein by reference.
In yet other preferred embodiments according to the present method,
recombinant plant viruses are used which encode for the expression of a fusion
between a plant viral coat protein and the amino acid product of the nucleic
acid
of interest. Such a recombinant plant virus provides for high level expression
of a
nucleic acid of interest. The location or locations where the viral coat
protein is
joined to the amino acid product of the nucleic acid of interest may be
referred to
as the fusion joint. A given product of such a construct may have one or more
fusion joints. The fusion joint may be located at the carboxyl terminus of the
viral coat protein or the fusion joint may be located at the amino terminus of
the
coat protein portion of the construct. In instances where the nucleic acid of
interest is located internal with respect to the 5' and 3' residues of the
nucleic
acid sequence encoding for the viral coat protein, there are two fusion
joints.
That is, the nucleic acid of interest may be located 5', 3', upstream,
downstream
or within the coat protein. In some embodiments of such recombinant plant
viruses, a "leaky" start or stop codon may occur at a fusion joint which
14
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/Ollb4
sometimes does not result in translational termination. A more detailed
description of some recombinant plant viruses according to this embodiment of
the invention may be found in co-pending U.S. Patent Application Serial No.
08/324,003 the disclosure of which is incorporated herein by reference.
In yet other embodiments according to the present method, a nucleic acid
sequence of interest or a gene may be placed within any suitable vector
construct
such as a virus for infecting the host organism. That is, the present method
may
be practiced without concern for the position of the nucleic acid sequence of
interest within the vector used to infect the host organism. The invention is
not
intended to be limited to any particular viral constructs but specifically
contemplates using all operable constructs. Specifically, those skilled in the
art
may choose to transfer DNA or RNA of any size up to and including an entire
genome into a host organism in order to determine the function thereof.
Those skilled in the art will understand that these embodiments are
representative only of many constructs which may be useful to produce
localized
or systemic expression of nucleic acids in host organisms such as plants. All
such constructs are contemplated and intended to be within the scope of the
present invention.
In order to provide an even clearer and more consistent understanding of
the specification and the claims, including the scope given herein to such
terms,
the following definitions are provided:
Adjacent: A position in a nucleotide sequence proximate to and 5' or 3'
to a defined sequence. Generally, adjacent means within 2 or 3 nucleotides of
the
site of reference.
Animal cell: A single functional cell found within an animal organism.
Animal tissue refers to one or more cells grouped or organized to perform one
or
more functions. Animal organ refers to one or more tissues morphologically
arranged to perform one or more functions within an organism.
Anti-Sense Inhibition: A type of gene regulation based on cytoplasmic,
nuclear or organelle inhibition of gene expression due to the presence in a
cell of
an RNA molecule complementary to at least a portion of the mRNA being
translated. It is specifically contemplated that DNA molecules may be from
either an RNA virus or mRNA from the host cells genome or from a DNA virus.
CA 02318662 2000-07-14
WO 99/36516 PCTlUS99/01164
Cell Culture: A proliferating group of cells which may be in either an
undifferentiated or differentiated state, growing contiguously or non-
contiguously.
Chimeric Sequence or Gene: A nucleotide sequence derived from at least
two heterologous parts. The sequence may comprise DNA or RNA.
Coding Sequence: A deoxyribonucleotide or ribonucleotide sequence
which, when either transcribed and translated or simply translated, results in
the
formation of a cellular polypeptide or a ribonucleotide sequence which, when
translated, results in the formation of a cellular polypeptide.
Compatible: The capability of operating with other components of a
system. A vector or plant or animal viral nucleic acid which is compatible
with a
host is one which is capable of replicating in that host. A coat protein which
is
compatible with a viral nucleotide sequence is one capable of encapsidating
that
viral sequence.
Complementation Analysis: As used herein, this term refers to observing
the changes produced in an organism when a nucleic acid sequence is introduced
into that organism after a selected gene has been deleted or mutated so that
it no
longer functions fully in its normal role. A complementary gene to the deleted
or
mutated gene can restore the genetic phenotype of the selected gene.
Constitutive expression: Gene expression which features substantially
constant or regularly cyclical gene transcription. Generally, genes which are
constitutively expressed are substantially free of induction from an external
stimulus.
Differentiated cell: A cell which has substantially matured to perform one
or more biochemical or physiological functions.
Dual Heterologous Subgenomic Promoter Expression System (DHSPES):
a plus stranded RNA vector having a dual heterologous subgenomic promoter
expression system to increase, decrease, or change the expression of proteins,
peptides or RNAs, preferably those described in U.S. Patent Nos. 5,316,931,
5,811,653, 5,589,367, and 5,866,785, the disclosure of which is incorporated
herein by reference.
Expressed sequence tags (ESTs): Relatively short single-pass DNA
sequences obtained from one or more ends of cDNA clones and RNA derived
16
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
therefrom. They may be present in either the 5' or the 3' orientation. ESTs
have
been shown useful for identifying particular genes.
Expression: The term as used herein is meant to incorporate one or more
of transcription, reverse transcription and translation.
Gene: A discrete nucleic acid sequence responsible for producing one or
more cellular products and/or performing one or more intercellular or
intracellular
functions.
Gene silencing: A reduction in gene expression. A viral vector
expressing gene sequences from a host may induce gene silencing of homologous
gene sequences.
Growth cycle: As used herein, the term is meant to include the replication
of a nucleus, an organelle, a cell, or an organism.
Host: A cell, tissue or organism capable of replicating a nucleic acid such
as a vector or plant viral nucleic acid and which is capable of being infected
by a
virus containing the viral vector or viral nucleic acid. This term is intended
to
include prokaryotic and eukaryotic cells, organs, tissues or organisms, where
appropriate. Bacteria, fungi, yeast, animal (cell, tissues, or organisms), and
plant
(cell, tissues, or organisms) are examples of a host.
Induction: The terms "induce", "induction" and "inducible" refer
generally to a gene and a promoter operably linked thereto which is in some
manner dependent upon an external stimulus, such as a molecule, in order to
actively transcribe and/or translate the gene.
Infection: The ability of a virus to transfer its nucleic acid to a host or
introduce a viral nucleic acid into a host, wherein the viral nucleic acid is
replicated, viral proteins are synthesized, and new viral particles assembled.
In
this context, the terms "transmissible" and "infective" are used
interchangeably
herein. The term is also meant to include the ability of a selected nucleic
acid
sequence to integrate into a genome, chromosome or gene of a target organism.
Multigene family: A set of genes descended by duplication and variation
from some ancestral gene. Such genes may be clustered together on the same
chromosome or dispersed on different chromosomes. Examples of multigene
families include those which encode the histones, hemoglobins,
immunoglobulins, histocompatibility antigens, actins, tubulins, keratins,
17
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
collagens, heat shock proteins, salivary glue proteins, chorion proteins,
cuticle
proteins, yolk proteins, and phaseolins.
Non-Native: Any RNA or DNA sequence that does not normally occur in
the cell or organism in which it is placed. Examples include recombinant plant
viral nucleic acids and genes or ESTs contained therein. That is, an RNA or
DNA sequence may be non-native with respect to a viral nucleic acid. Such an
RNA or DNA sequence would nat naturally occur in the viral nucleic acid. Also,
an RNA or DNA sequence may be non-native with respect to a host organism.
That is, such a RNA or DNA sequence would not naturally occur in the host
organism. Conversely, the term non-native does not imply that an RNA or DNA
sequence must be non-native with respect to both a viral nucleic acid and a
host
organism concurrently. The present invention specifically contemplates placing
an RNA or DNA sequence which is native to a host organism into a viral nucleic
acid in which it is non-native.
Nucleic acid: As used herein the term is meant to include any DNA or
RNA sequence from the size of one or more nucleotides up to and including a
complete gene sequence. The term is intended to encompass all nucleic acids
whether naturally occurring in a particular cell or organism or non-naturally
occurring in a particular cell or organism.
Nucleic acid of interest: The term is used interchangeably with the term
"nucleic acid" and is intended to refer to the nucleic acid sequence whose
function is to be determined. The sequence will normally be non-native to the
viral vector but may be native or non-native to the host organism.
Organism: The term organism and "host organism" as used herein is
specifically intended to include animals including humans, plants, viruses,
fungi,
and bacteria.
Phenotypic Trait: An observable, measurable or detectable property
resulting from the expression or suppression of a gene or genes.
Plant Cell: The structural and physiological unit of plants, consisting of a
protoplast and the cell wall.
Plant Organ: A distinct and visibly differentiated part of a plant, such as
root, stem, leaf or embryo.
18
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Plant Tissue: Any tissue of a plant in plants or in culture. This term is
intended to include a whole plant, plant cell, plant organ, protoplast, cell
culture,
or any group of plant cells organized into a structural and functional unit.
Positive-sense inhibition: A type of gene regulation based on cytoplasmic
inhibition of gene expression due to the presence in a cell of an RNA molecule
substantially homologous to at least a portion of the mRNA being translated.
Promoter: The S'-flanking, non-coding sequence substantially adjacent a
coding sequence which is involved in the initiation of transcription of the
coding
sequence.
Protoplast: An isolated plant or bacterial cell without some or all of its
cell wall.
Recombinant Plant Viral Nucleic Acid: Plant viral nucleic acid which has
been modified to contain non-native nucleic acid sequences. These non-native
nucleic acid sequences may be from any organism or purely synthetic, however,
they may also include nucleic acid sequences naturally occurnng in the
organism
into which the recombinant plant viral nucleic acid is to be introduced.
Recombinant Plant Virus: A plant virus containing the recombinant plant
viral nucleic acid.
Subgenomic Promoter: A promoter of a subgenomic mRNA of a viral
nucleic acid.
Substantial Sequence Homology: Denotes nucleotide sequences that are
substantially functionally equivalent to one another. Nucleotide differences
between such sequences having substantial sequence homology will be de
minimis in affecting function of the gene products or an RNA coded for by such
sequence.
Systemic Infection: Denotes infection throughout a substantial part of an
organism including mechanisms of spread other than mere direct cell
inoculation
but rather including transport from one infected cell to additional cells
either
nearby or distant.
30~ Transposon: A nucleotide sequence such as a DNA or RNA sequence
which is capable of transferring location or moving within a gene, a
chromosome
or a genome.
19
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Transgenic plant: A plant which contains a foreign nucleotide sequence
inserted into either its nuclear genome or organellar genome.
Transcription: Production of an RNA molecule by RNA polymerase as a
complementary copy of a DNA sequence or subgenomic mRNA.
Vector: A self replicating RNA or DNA molecule which transfers an
RNA or DNA segment between cells, such as bacteria, yeast, plant, or animal
cells.
Virus: An infectious agent composed of a nucleic acid which may or may
not be encapsidated in a protein. A virus may be a mono-, di-, tri-, or multi-
partite virus, as described above.
In preferred embodiments, the present invention provides for the infection
of a plant host by a recombinant plant virus containing a recombinant plant
viral
nucleic acid or by the recombinant plant viral nucleic acid which contains one
or
more non-native nucleic acid sequences which are subsequently transcribed or
expressed in the infected tissues of the plant host. The product of the coding
sequences may be recovered from the plant, produce a phenotypic trait in the
plant, effect biochemical pathways within the plant or effect endogenous gene
expression within the plant.
The present invention has a number of advantages. The instant invention
allows practitioners to determine the function of a nucleic acid sequence
which
has been heretofore unknown.
The chimeric genes and vectors and recombinant plant viral nucleic acids
used in this invention are constructed using techniques well known in the art.
Suitable techniques have been described in Sambrook et al. (2nd ed.), Cold
Spring Harbor Laboratory, Cold Spring Harbor (1982, 1989); Methods in
Enzymol. (Vols. 68, 100, 101, 118, and 152-155) (1979, 1983, 1986 and 1987);
and DNA Cloning, D.M. Clover, Ed., IRL Press, Oxford (1985). Medium
compositions have been described by Miller, J., Experiments in Molecular
Genetics, Cold Spring Harbor Laboratory, New York (1972), as well as the
references previously identified, all of which are incorporated herein by
reference. DNA manipulations and enzyme treatments are carried out in
accordance with manufacturers' recommended procedures in making such
constructs.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
An important feature of the present invention is the use of recombinant
plant viral nucleic acids which are capable of replication, local and/or
systemic
spread in a compatible plant host, and which contain one or more non-native
subgenomic promoters which are capable of transcribing or expressing adjacent
nucleic acid sequences in the plant host. The recombinant plant viral nucleic
acids may be further modified to delete all or part of the native coat protein
coding sequence and to contain a non-native coat protein coding sequence under
control of the native or one of the non-native subgenomic promoters, or put
the
native coat protein coding sequence under the control of a non-native plant
viral
subgenomic promoter. The recombinant plant viral nucleic acids have
substantial
sequence homology to plant viral nucleotide sequences. A partial listing of
suitable viruses is described, infra. The nucleotide sequence may be or may be
derived from an RNA, DNA, cDNA or a chemically synthesized RNA or DNA.
The first step in producing recombinant plant viral nucleic acids according
to this particular embodiment for use in the present invention is to modify
the
nucleotide sequences of the plant viral nucleotide sequence by known
conventional techniques such that one or more non-native subgenomic promoters
are inserted into the plant viral nucleic acid without destroying the
biological
function of the plant viral nucleic acid. The subgenornic promoters are
capable of
transcribing or expressing adjacent nucleic acid sequences in a plant host
infected
by the recombination plant viral nucleic acid or recombinant plant virus. The
native coat protein coding sequence may be deleted in some embodiments, placed
under the control of a non-native subgenomic promoter in other embodiments, or
retained in a further embodiment. If it is deleted or otherwise inactivated, a
non-
native coat protein gene is inserted under control of one of the non-native
subgenomic promoters, or optionally under control of the native coat protein
gene
subgenomic promoter. The non-native coat protein is capable of encapsidating
the recombinant plant viral nucleic acid to produce a recombinant plant virus.
Thus, the recombinant plant viral nucleic acid contains a coat protein coding
sequence, which may be native or a nonnative coat protein coding sequence,
under control of one of the native or non-native subgenomic promoters. The
coat
protein is involved in the systemic infection of the plant host.
21
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Some of the viruses which meet this requirement, and therefore have been
shown to be suitable for use according to the methods of the present
invention,
include viruses from the tobamovirus group such as Tobacco Mosaic virus
(TMV), Ribgrass Mosaic Virus {RGM), Cowpea Mosaic virus {CMV), Alfalfa
S Mosaic virus (AMV), Cucumber Green Mottle Mosaic virus watermelon strain
(CGMMV-V~ and Oat Mosaic virus (OMV) and viruses from the brome mosaic
virus group such as Brome Mosaic virus (BMV), broad bean mottle virus and
cowpea chlorotic mottle virus. Additional suitable viruses include Rice
Necrosis
virus (RNV), and geminiviruses such as Tomato Golden Mosaic virus (TGMV),
Cassava Latent virus (CLV) and Maize Streak virus (MSV). Each of these
groups of suitable viruses is characterized below. However, the invention
should
not be construed as limited to using these particular viruses, but rather the
method
of the present invention is contemplated to include all plant viruses at a
minimum.
TOBAMOVIRUS GROUP
Tobacco Mosaic virus (TMV) is a member of the Tobamoviruses. The
TMV virion is a tubular filament, and comprises coat protein sub-units
arranged
in a single right-handed helix with the single-stranded RNA intercalated
between
the turns of the helix. TMV infects tobacco as well as other plants. TMV is
transmitted mechanically and may remain infective for a year or more in soil
or
dried leaf tissue.
The TMV virions may be inactivated by subjection to an environment
with a pH of less than 3 or greater than 8, or by formaldehyde or iodine.
Preparations of TMV may be obtained from plant tissues by (NH4)ZSO4
precipitation, followed by differential centrifugation.
The TMV single-stranded RNA genome is about 6400 nucleotides long,
and is capped at the 5'-end but not polyadenylated. The genomic RNA can serve
as mRNA for protein of a molecular weight of about 130,000 (130K) and another
produced by read-through of molecular weight about 180,000 (180K). However,
it cannot function as a messenger for the synthesis of coat protein. Other
genes
are expressed during infection by the formation of monocistronic, 3'-
coterminal
subgenomic mRNAs, including one (LMC) encoding the 17.SK coat protein and
22
CA 02318662 2000-07-14
WO 99/36516 PCT/~(JS99/01164
another (IZ) encoding a 30K protein. The 30K protein has been detected in
infected protoplasts as described in Miller, J., Virology 1 2:71 (1984), and
it is
involved in the cell-to-cell transport of the virus in an infected plant as
described
by Deom et al., Science 237:389 (1987). The functions of the two large
proteins
are unknown, however, they are thought to function in RNA replication and
transcription.
Several double-stranded RNA molecules, including double-stranded
RNAs corresponding to the genomic, IZ and LMC RNAs, have been detected in
plant tissues infected with TMV. These RNA molecules are presumably
intermediates in genome replication and/or mRNA synthesis processes which
appear to occur by different mechanisms.
TMV assembly apparently occurs in plant cell cytoplasm, although it has
been suggested that some TMV assembly may occur in chloroplasts since
transcripts of ctDNA have been detected in purified TMV virions. Initiation of
TMV assembly occurs by interaction between ring-shaped aggregates ("discs") of
coat protein (each disc consisting of two layers of 17 subunits) and a unique
internal nucleation site in the RNA; a hairpin region about 900 nucleotides
from
the 3'-end in the common strain of TMV. Any RNA, including subgenomic
RNAs containing this site, may be packaged into virions. The discs apparently
assume a helical form on interaction with the RNA, and assembly (elongation)
then proceeds in both directions (but much more rapidly in the 3'- to 5'-
direction
from the nucleation site).
Another member of the Tobamoviruses, the Cucumber Green Mottle Mosaic
virus watermelon strain (CGMMV-W) is related to the cucumber virus. Nozu et
al., Virology x:577 (1971). The coat protein of CGMMV-W interacts with RNA
of both TMV and CGMMV to assemble viral particles in vitro. Kurisu et al.,
Virology 70:214 ( 1976).
Several strains of the tobamovirus group are divided into two subgroups,
on the basis of the location of the assembly of origin. Subgroup I, which
includes
the vulgare, OM, and tomato strain, has an origin of assembly about 800-1000
nucleotides from the 3'-end of the RNA genome, and outside the coat protein
cistron. Lebeurier et al., Proc. Natl. Acad. Sci. USA 74:149 (1977); and
Fukuda
et al., Virology 101:493 (1980). Subgroup II, which includes CGMMV-W and
23
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
cornpea strain (Cc) has an origin of assembly about 300-S00 nucleotides from
the
3'-end of the RNA genome and within the coat-protein cistron. The coat protein
cistron of CGMMV-W is located at nucleotides 176-661 from the 3'-end. The 3'
noncoding region is 175 nucleotides long. The origin of assembly is positioned
within the coat protein cistron. Meshi et al., Virology 127:54 (1983).
BROME MOSAIC VIRUS GROUP
Brome Mosaic virus (BMV) is a member of a group of tripartite, single-
stranded, RNA-containing plant viruses commonly referred to as the
bromoviruses. Each member of the bromoviruses infects a narrow range of
plants. Mechanical transmission of bromoviruses occurs readily, and some
members are transmitted by beetles. In addition to BV, other bromoviruses
include broad bean mottle virus and cowpea chlorotic mottle virus.
Typically, a bromovirus virion is icosahedral, with a diameter of about 26
p,m, containing a single species of coat protein. The bromovirus genome has
three molecules of linear, positive-sense, single-stranded RNA, and the coat
protein mRNA is also encapsidated. The RNAs each have a capped S'-end, and a
tRNA-like structure (which accepts tyrosine) at the 3'-end. Virus assembly
occurs in the cytoplasm. The complete nucleotide sequence of BMV has been
identified and characterized as described by Ahlquist et al., .I. Mol. Biol.
153:23
(1981).
RICE NECROSIS VIRUS
Rice Necrosis virus is a member of the Potato Virus Y Group or
Potyviruses. The Rice Necrosis virion is a flexuous filament comprising one
type
of coat protein (molecular weight about 32,000 to about 36,000) and one
molecule of linear positive-sense single-stranded RNA. The Rice Necrosis virus
is transmitted by Polymyxa oraminis (a eukaryotic intracellular parasite found
in
plants, algae and fungi).
GEMINIVIRUSES
Geminiviruses are a group of small, single-stranded DNA-containing
plant viruses with virions of unique morphology. Each virion consists of a
pair of
24
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
isometric particles (incomplete icosahedral), composed of a single type of
protein
(with a molecular weight of about 2.7-3.4X10°). Each geminivirus virion
contains one molecule of circular, positive-sense, single-stranded DNA. In
some
geminiviruses (i.e., Cassava latent virus and bean golden mosaic virus) the
genome appears to be bipartite, containing two single-stranded DNA molecules.
POTYVIRUSES
Potyviruses are a group of plant viruses which produce polyprotein. A
particularly preferred potyvirus is tobacco etch virus (TEV). TEV is a well
characterized potyvirus and contains a positive-strand RNA genome of 9.5
kilobases encoding for a single, large polyprotein that is processed by three
virus-
specific proteinases. The nuclear inclusion protein "a" proteinase is involved
in
the maturation of several replication-associated proteins and capsid protein.
The
helper component-proteinase (HC-Pro) and 35-kDa proteinase both catalyze
cleavage only at their respective C-termini. The proteolytic domain in each of
these proteins is located near the C-terminus. The 35-kDa proteinase and HC-
Pro
derive from the N-terminal region of the TEV polyprotein.
Other particularly useful viruses according to some embodiments of the
present invention feature viruses which are associated with animal hosts. Some
of these viruses are discussed, infra.
ALPHAVIRUSES
The alphaviruses are a genus of the viruses of the family Togaviridae.
Alinost all of the members of this genus are transmitted by mosquitoes, and
may
cause diseases in man or animals. Some of the alphaviruses are grouped into
three serologicallly defined complexes. The complex-specific antigen is
associated with the E1 protein of the virus, and the species-specific antigen
is
associated with the E2 protein of the virus.
The Semliki Forest virus complex includes Bebaru virus, Chikungunya
Fever virus, Getah virus, Mayaro Fever virus, O'nyongnyong Fever virus, Ross
River virus, Sagiyama virus, Semliki Forest virus and Una virus. The
Venezuelan Equine Encephalomyelitis virus complex includes Cabassou virus,
Everglades virus, Mucambo virus, Pixuna virus and Venezuelan Equine
CA 02318662 2000-07-14
WO 99/36516 PCTNS99/01164
Encephalomyelitis virus. The Western Equine Encephalomyelitis virus complex
includes Aura virus, Fort Morgan virus, Highlands J virus, Kyzylagach virus,
Sindbis virus, Western Equine Encephalomyelitis virus and Whataroa virus.
The alphaviruses contain an icosahedral nucleocapsid consisting of 180
copies of a single species of capsid protein complexed with a plus-stranded
mRNA. The alphaviruses mature when preassembled nucleocapsid is surrounded
by a lipid envelope containing two virus-encoded integral membrane
glycoproteins, called E1 and E2. The envelope is acquired when the capsid,
assembled in the cytoplasm, buds through the plasma membrane. The envelope
consists of a lipid bilayer derived from the host cell.
The mRNA encodes a glycoprotein which is cotranslationally cleaved into
nonstructural proteins and structural proteins. The 3' one-third of the RNA
genome consists of a 26S mRNA which encodes for the capsid protein and the
E3, E2, K6 and E1 glycoproteins. The capsid is cotranslationally cleaved from
the E3 protein. It is hypothesized that the amino acid triad of His, Asp and
Ser at
the COOH terminus of the capsid protein comprises a serine protease
responsible
for cleavage. Hahn et al., Proc. Natl. Acad Sci. USA X2:4648 (1985).
Cotranslational cleavage also occurs between E2 and K proteins. Thus, two
proteins PE2 which consists of E3 and E2 prior to cleavage and an E 1 protein
comprising K6 and E1 are formed. These proteins are cotranslationaily inserted
into the endoplasmic reticulum of the host cell, glycosylated and transported
via
the Golgi apparatus to the plasma membrane where they can be used for budding.
At the point of virion maturation the E3 and E2 proteins are separated. The E1
and E2 proteins are incorporated into the lipid envelope.
It has been suggested that the basic amino-terminal half of the capsid
protein stabilizes the interaction of capsid with genomic RNA or interacts
with
genomic RNA to initiate a encapsidation, Strauss et al., in the To aviridae
and
Flaviviridaei, Ed. S. Schlesinger & M. Schlesinger, Plenum Press, New York,
pp.
35-90 (1980). These suggestions imply that the origin of assembly is located
either on the unencapsidated genomic RNA or at the amino-terminus of the
capsid protein. It has been suggested that E3 and K6 function as signal
sequences
for the insertion of PE2 and E1, respectively, into the endoplasmic reticulum.
26
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Work with temperature sensitive mutants of alphaviruses has shown that
failure of cleavage of the structural proteins results in failure to form
mature
virions. Lindquist et al., Virology 151:10 {1986) characterized a temperature
sensitive mutant of Sindbis virus, is 20. Temperature sensitivity results from
an
A-U change at nucleotide 9502. The t$ lesion present cleavage of PE2 to E2 and
E3 and the final maturation of progeny virions at the nonpermissive
temperature.
Hahn et al., supra, reported three temperature sensitive mutations in the
capsid
protein which prevents cleavage of the precursor polyprotein at the
nonpermissive
temperature. The failure of cleavage resulted in no capsid formation and very
little envelope protein.
Defective interfering RNAs (DI particles) of Sindbis virus are helper-
dependent deletion mutants which interfere specifically with the replication
of the
homologous standard virus. Perrault, J., Microbiol. Immunol. 93:151 (1981). DI
particles have been found to be functional vectors for introducing at least
one
foreign gene into cells. Levis, R., Proc. Natl. Acad. Sci. USA 84:4811 (1987).
It has been found that it is possible to replace at least 1689 internal
nucleotides of a DI genome with a foreign sequence and obtain RNA that will
replicate and be encapsidated. Deletions of the DI genome do not destroy
biological activity. The disadvantages of the system are that DI particles
undergo
apparently random rearrangements of the internal RNA sequence and size
alterations. Monroe et al., J. Virology 49:865 (1984). Expression of a gene
inserted into the internal sequence is not as high as expected. Levis et al.,
supra,
found that replication of the inserted gene was excellent but translation was
low.
This could be the result of competition with whole virus particles for
translation
sites and/or also from disruption of the gene due to rearrangement through
several
passages.
Two species of mRNA are present in alphavirus-infected cells: A 42S
mRNA region, which is packaged into nature virions and functions as the
message for the nonstructural proteins, and a 26S mRNA, which encodes the
structural polypeptides. the 26S mRNA is homologous to the 3' third of the 42S
mRNA. It is translated into a 130K polyprotein that is cotranslationally
cleaved
and processed into the capsid protein and two glycosylated membrane proteins,
E1 and E2.
27
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
The 26S mRNA of Eastern Equine Encephalomyelitis (EEE) strain 82V-
2137 was cloned and analyzed by Chang et al., J. Gen. Virol. 68:2129 (1987).
The 26S mRNA region encodes the capsid proteins, E3, E2, 6K and El. The
amino terminal end of the capsid protein is thought to either stabilize the
interaction of capsid with mRNA or to interact with genomic RNA to initiate
encapsidation.
Uncleaved E3 and E2 proteins called PE2 is inserted into the host
endoplasmic reticulum during protein synthesis. The PE2 is thought to have a
region common to at least five alphaviruses which interacts with the viral
nucleocapsid during morphogenesis.
The 6K protein is thought to function as a signal sequence involved in
translocation of the E1 protein through the membrane. The El protein is
thought
to mediate virus fusion and anchoring of the E1 protein to the virus envelope.
RHINOVIRUSES
The rhinoviruses are a genus of viruses of the family Picornaviridae. The
rhinoviruses are acid-labile, and are therefore rapidly inactivated at pH
values of
less than about 6. The rhinoviruses commonly infect the upper respiratory
tract
of mammals.
Human rhinoviruses are the major causal agents of the common cold, and
many serotypes are known. Rhinoviruses may be propagated in various human
cell cultures, and have an optimum growth temperature of about 33°C.
Most
strains of rhinoviruses are stable at or below room temperature and can
withstand
freezing. Rhinoviruses can be inactivated by citric acid, tincture of iodine
or
phenol/alcohol mixtures.
The complete nucleotide sequence of human rhinovirus 2 (HRV2) has
been sequenced. The genome consists of 7102 nucleotides with a long open
reading frame of 6450 nucleotides which is initiated 611 nucleotides from the
S'-
end and stops 42 nucleotides from the poly(A) tract. Three capsid proteins and
their cleavage cites have been identified.
Rhinovirus RNA is single-stranded and positive-sense. The RNA is not
capped, but is joined at the 5'-end to a small virus-encoded protein, virion-
protein
genome-linked (VPg). Translation is presumed to result in a single polyprotein
28
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
which is broken by proteolytic cleavage to yield individual virus proteins. An
icosahedral viral capsid contains 60 copies each of 4 virus proteins VP 1,
VP2,
VP3 and VP4 and surrounds the RNA genome. Medappa, K., Virology 44:259
(1971).
Analysis of the 610 nucleotides preceding the long open reading frame
shows several short open reading frames. However, no function can be assigned
to the translated proteins since only two sequences show homology throughout
HRV2, HRV 14 and the 3 stenotypes of poliovirus. These two sequences may be
critical in the life cycle of the virus. They are a stretch of 16 bases
beginning at
436 in HRV2 and a stretch of 23 bases beginning at 531 in HRV2. Cutting or
removing these sequences from the remainder of the sequence for non-structural
proteins could have an unpredictable effect upon efforts to assemble a mature
virion.
The capsid proteins of HRV2: VP4, VP2, VP3 and VPl begin at
nucleotide 611, 818, 1601 and 2311, respectively. The cleavage point between
VP1 and P2A is thought to be around nucleotide 3255. Skern et al., Nucleic
Acids Research 13:2111 (1985).
Human rhinovirus type 89 (HRV89) is very similar to HRV2. It contains
a genome of 7152 nucleotides with a single large open reading frame of 2164
condons. Translation begins at nucleotide 619 and ends 42 nucleotides before
the
poly(A) tract. The capsid structural proteins, VP4, VP2, VP3 and VP1 are the
first to be translated. Translation of VP4 begins at 619. Cleavage cites occur
at:
VP4/VP2 825 determined
VP2/VP3 1627 determined
VP3/VP1 2340 determined
VP1/P2-A 3235 presumptive
Duechler et al., Proc. Natl. Acad. Sci. USA X4:2605 (1987).
POLIOVIRUSES
Polioviruses are the causal agents of poliomyelitis in man, and are one of
three groups of enteroviruses. Enteroviruses are a genus of the family
Picornaviridae (also the family of rhinoviruses). Most enteroviruses replicate
primarily in the mammalian gastrointestinal tract, although other tissues may
29
CA 02318662 2000-07-14
WO 99/3651b PCT/US99/Ollb4
subsequently become infected. Many enteroviruses can be propagated in
primarily cultures of human or monkey kidney cells and in some cell lines
(e.g.
HeLa, Vero, WI-e8). Inactivation of the enteroviruses may be accomplished with
heat (about 50°C), formaldehyde (3%), hydrochloric acid (O.1N) or
chlorine (ca.
0.3-0.5 ppm free residual C 1 ~).
The complete nucleotide sequence of poliovirus PV2 (Sab) and PV3 {Sab)
have been determined. They are 7439 and 7434 nucleotide in length,
respectively. There is a single long open reading frame which begins more than
700 nucleotides from the 5'-end. Poliovirus translation produces a single
polyprotein which is cleaved by proteolytic processing. Kitamura et al.,
Nature
291:547 ( 1981 ).
It is speculated that these homologous sequences in the untranslated
regions play an essential role in viral replication such as:
1. viral-specific RNA synthesis;
1 S 2. viral-specific protein synthesis; and
3. packaging
Toyoda, H. et al., J. Mol. Biol. 174:561 (1984).
The structures of the serotypes of poliovirus have a high degree of
sequence homology. Their coding sequences code for the same proteins in the
same order. Therefore, genes for structural proteins are similarly located. In
PV l, PV2 and PV3, the polyprotein begins translation near the 750 nucleotide.
The four structural proteins VP4, VP2, VP3 and VP 1 begin at about 745, 960,
1790 and 2495, respectively, with VPI ending at about 3410. They are separated
in vivo by proteolytic cleavage, rather than by stop/start codons.
SIMIAN VIRUS 40
Simian virus 40 {SV40) is a virus of the genus Polyomavirus, and was
originally isolated from the kidney cells of the rhesus monkey. The virus is
commonly found, in its latent form, in such cells. Simian virus 40 is usually
non-
pathogenic in its natural host.
Simian virus 40 virions are made by the assembly of three structural
proteins, VP1, VP2 and VP3. Girard et al., Biochem. Biophys. Res. Commun.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
40:97 (1970); Prives et al., Proc. Natl. Acad Sci. USA 71:302 (1974); and
Jacobson et al., Proc. Natl. Acad. Sci. USA x:2747 ( 1976). The three
corresponding viral genes are organized in a partially overlapping manner.
They
constitute the late genes portion of the genome. Tooze, J., Molecular Bioloev
of
Tumor Viruses Appendix A The SV40 Nucleotide Sequence, 2nd Ed. Part 2, pp.
799-831 (1980), Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
Capsid proteins VP2 and VP3 are encoded by nucleotides 545 to 1601 and 899 to
1601, respectively, and both are read in the same frame. VP3 is therefore a
subset
of VP2. Capsid protein VP1 is encoded by nucleotides 1488-2574. The end of
the VP2-VP3 open reading frame therefore overlaps the VP 1 by 113 nucleotides
but is read in an alternative frame. Tooze, J., supra. Wychowski et al., J.
Virology 61:3862 (1987).
ADENOVIRUSES
Adenovirus type 2 is a member of the adenovirus family or adenovirus.
This family of viruses are non-enveloped, icosahedral, linear, double-stranded
DNA-containing viruses which infect mammals or birds.
The adenovirus virion consists of an icosahedral capsid enclosing a core
in which the DNA genome is closely associated with a basic (arginine-rich)
viral
polypeptide VII. The capsid is composed of 252 capsomeres: 240 hexons
(capsomers each surrounded by 6 other capsomers) and 12 pentons (one at each
vertex, each surrounded by S 'peripentonal' hexons). Each penton consists of a
penton base (composed of viral polypeptide III) associated with one (in
mammalian adenoviruses) or two (in most avian adenoviruses) glycoprotein
fibres (viral polypeptide IV). The fibres can act as haemagglutinins and are
the
sites of attachment of the virion to a host cell-surface receptor. The hexons
each
consist of three molecules of viral polypeptide II; they make up the bulk of
the
icosahedron. Various other minor viral polypeptides occur in the virion.
The adenovirus dsDNA genome is covalently linked at the 5'-end of each
strand to a hydrophobic 'terminal protein', TP (molecular weight about 55,000
Da); the DNA has an inverted terminal repeat of different length in different
adenoviruses. In most adenoviruses examined, the 5'-terminal residue is dCMP.
31
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
During its replication cycle, the virion attaches via its fibres to a specific
cell-surface receptor, and enters the cell by endocytosis or by direct
penetration of
the plasma membrane. Most of the capsid proteins are removed in the cytoplasm.
The virion core enters the nucleus, where the uncoating is completed to
release
viral DNA almost free of virion polypeptides. Virus gene expression then
begins.
The viral dsDNA contains genetic information on both strands. Early genes
(regions Ela, Elb, E2a, E3, E4) are expressed before the onset of viral DNA
replication. Late genes (regions L1, L2, L3, L4 and LS) are expressed only
after
the initiation of DNA synthesis. Intermediate genes (regions E2b and Iva2) are
expressed in the presence or absence of DNA synthesis. Region E 1 a encodes
proteins involved in the regulation of expression of other early genes, and is
also
involved in transformation. The RNA transcripts are capped (with m7G5ppp5N)
and polyadenylated in the nucleus before being transferred to the cytoplasm
for
translation.
Viral DNA replication requires the tenminai protein, TP, as well as virus-
encoded DNA polymerase and other viral and host proteins. TP is synthesized as
an SOK precursor, pTP, which binds covalently to nascent replicating DNA
strands. pTP is cleaved to the mature SSK TP late in virion assembly; possibly
at
this stage, pTP reacts with a dCTP molecule and becomes covalently bound to a
dCMP residue, the 3' OH of which is believed to act as a primer for the
irritiation
of DNA synthesis. Late gene expression, resulting in the synthesis of viral
structural proteins, is accompanied by the cessation of cellular protein
synthesis,
and virus assembly may result in the production of up to 105 virions per cell.
In addition to the plant and animal viruses described above, viral
expression system in bacteria and yeast cells may also be employed. See
Munishkin et al., Nature x,(6172):473-S (1988) and Priano et al., J. Mol.
Biol.
27(3):299-310 (1997) for viral expression system in bacteria and Janda et al.,
Cell 72(6):961-70 (1993) and Ishikawa et al., J. Yirol. 71(10):7781-90 (1997)
for
viral expression in yeast. The teachings of these references are incorporated
herein by reference.
The nucleic acid of any suitable plant virus can be utilized to prepare a
recombinant plant viral nucleic acid for use in the present invention, and the
foregoing are only exemplary of such suitable plant viruses. The nucleotide
32
._....~..~.... _ _..~. ___ T. __..-..~...~__. _~__._._ _.~.~.._._.._
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
sequence of the plant virus is modified, using conventional techniques, by the
insertion of one or more subgenomic promoters into the plant viral nucleic
acid.
The subgenomic promoters are capable of functioning in the specific host
plant.
For example, if the host is tobacco, TMV, TEV, or other viruses containing
subgenomic promoter may be utilized. The inserted subgenomic promoters
should be compatible with the TMV nucleic acid and cauable of directing
transcription or expression of adjacent nucleic acid sequences in tobacco. The
native coat protein gene could also be retained and a non-native nucleic acid
sequence inserted within it to create a fusion protein.
The native or non-native coat protein gene is utilized in the recombinant
plant viral nucleic acid. Whichever non-native nucleic acid is utilized may be
positioned adjacent its natural subgenomic promoter or adjacent one of the
other
available subgenomic promoters. The non-native coat protein, as is the case
for
the native coat protein, is capable of encapsidating the recombinant plant
viral
nucleic acid and providing for systemic spread of the recombinant plant viral
nucleic acid in the host plant. The coat protein is selected to provide a
systemic
infection in the plant host of interest. For example, the TMV-O coat protein
provides systemic infection in N. benthamiana, whereas TMV-U1 coat protein
provides systemic infection in N. tabacum.
The recombinant plant viral nucleic acid is prepared by cloning a viral
nucleic acid. If the viral nucleic acid is DNA, it can be cloned directly into
a
suitable vector using conventional techniques.. One technique is to attach an
origin of replication to the viral DNA which is compatible with the cell to be
transfected. If the viral nucleic acid is RNA, a full-length DNA copy of the
viral
genome is first prepared by well-known procedures. For example, the viral RNA
is transcribed into DNA using reverse transcriptase to produce subgenomic DNA
pieces, and a double-stranded DNA made using DNA polymerases. The cDNA is
then cloned into appropriate vectors and cloned into a cell to be transfected.
Alternatively, the cDNA's ligated into the vector may be directly transcribed
into
infectious RNA in vitro and inoculated onto the plant host. The cDNA pieces
are
mapped and combined in proper sequence to produce a full-length DNA copy of
the viral RNA genome, if necessary. DNA sequences for the subgenomic
promoters, with or without a coat protein gene, are then inserted into the
nucleic
33
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
acid at non-essential sites, according to the particular embodiment of the
invention utilized. Non-essential sites are those that do not affect the
biological
properties of the plant viral nucleic acid. Since the RNA genome is the
infective
agent, the cDNA is positioned adjacent a suitable promoter so that the RNA is
produced in the production cell. The RNA is capped using conventional
techniques, if the capped RNA is the infective agent. 1n addition, the capped
RNA can be packaged in vitro with added coat protein from TMV to make
assembled virions. These assembled virions can then be used to inoculate
plants
or plant tissues.
Alternatively, an uncapped RNA may also be employed in the
embodiments of the present invention. Contrary to the practiced art in
scientific
literature and in issued patent (Ahlquist et al., U.S. Patent No. 5,466,788),
uncapped transcripts for virus expression vectors are infective on both plants
and
in plant cells. Capping is not a prerequisite for establishing an infection of
a virus
expression vector in plants, although capping increases the efficiency of
infection.
In addition, nucleotides may be added between the transcription start site of
the
promoter and the start of the cDNA of a viral nucleic acid to construct an
infectious viral vector. One or more nucleotides may be added. In a preferred
embodiment of the present invention, the inserted nucleotide sequence contains
a
G at the 5'-end. In a particularly preferred embodiment, the inserted
nucleotide
sequence is GNN, GTN, or their multiples, (GNN)X or (GTN)X.
Another feature of these recombinant plant viral nucleic acids useful in
the present invention is that they further comprise one or more nucleic acid
sequences capable of being transcribed in the plant host. These nucleic acid
sequences may be native nucleic acid sequences which occur in the host
organism
or they may be non-native nucleic acid sequences which do not normally occur
in
the host organism. The nucleic acid sequence is placed adjacent one of the non-
native viral subgenomic promoters and/or the native coat protein gene promoter
depending on the particular embodiment used. The nucleic acid is inserted by
conventional techniques, or the nucleic acid sequence can be inserted into or
adjacent the native coat protein coding sequence such that a fusion protein is
produced. The nucleic acid sequence which is transcribed may be transcribed as
an RNA which is capable of regulating the expression of a phenotypic trait by
an
34
CA 02318662 2000-07-14
WO 99/36516 PCTNS99/01164
anti-sense or a positive-sense mechanism. Alternatively, the nucleic acid
sequence in the recombinant plant viral nucleic acid may be transcribed and
translated in the plant host to produce a phenotypic trait. The nucleic acid
sequences) may also code for the expression of more than one phenotypic trait.
The recombinant plant viral nucleic acid containing the nucleic acid sequence
is
constructed using conventional techniques such that the nucleic acid
sequences)
are in proper orientation to whichever viral subgenomic promoter is utilized.
A double-stranded DNA of the recombinant plant viral nucleic acid or a
complementary copy of the recombinant plant viral nucleic acid is cloned into
the
cell to be transfected. If the viral nucleic acid is a RNA molecule, the
nucleic
acid (cDNA) is first attached to a promoter which is compatible with the
production cell. The recombinant plant viral nucleic acid can then be cloned
into
any suitable vector which is compatible with the production cell. In this
manner,
only RNA copies of the chimeric nucleotide sequence are produced in the
production cell. For example, the CaMV promoter can be used when plant cells
are to be transfected. Alternatively, the recombinant plant viral nucleic acid
is
inserted in a vector adjacent a promoter which is compatible with the
production
cell. If the viral nucleic acid is a DNA molecule, it can be cloned directly
into a
production cell by attaching it to an origin of replication which is
compatible with
the cell to be transfected. In this manner, DNA copies of the chimeric
nucleotide
sequence are produced in the transfected cell.
A further alternative when creating the recombinant plant viral nucleic
acid is to prepare more than one nucleic acid (i.e., to prepare the nucleic
acids
necessary for a multipartite viral vector construct). In this case, each
nucleic acid
would require its own origin of assembly. Each nucleic acid could be prepared
to
contain a subgenomic promoter and a non-native nucleic acid.
Alternatively, the insertion of a non-native nucleic acid into the nucleic
acid of a monopartite virus may result in the creation of two nucleic acids
(i.e.,
the nucleic acid necessary for the creation of a bipartite viral vector). This
would
be advantageous when it is desirable to keep the replication and transcription
or
expression of the nucleic acid of interest separate from the replication and
translation of some of the coding sequences of the native nucleic acid. Each
nucleic acid would have to have its own origin of assembly.
.__,.,~,~"",_.._... ..~~. .._ .. r__._~,_. ~ .. _..~__.....__._
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
The host can be infected with the recombinant plant virus by conventional
techniques. , Suitable techniques include, but are not limited to, leaf
abrasion,
abrasion in solution, high velocity water spray and other injury of a host as
well
as imbibing host seeds with water containing the recombinant plant virus. More
specifically, suitable techniques include:
(a) Hand Inoculations. Hand inoculations of the encapsidated vector are
performed using a neutral pH, low molarity phosphate buffer, with the
addition of celite or carborundum (usually about 1 %). One to four drops
of the preparation is put onto the upper surface of a leaf and gently
rubbed.
(b) Mechanized Inoculations of Plant Beds. Plant bed inoculations are
performed by spraying (gas-propelled) the vector solution into a tractor-
driven mower while cutting the leaves. Alternatively, the plant bed is
mowed and the vector solution sprayed immediately onto the cut leaves.
(c) High Pressure Spray of Single Leaves. Single plant inoculations can also
be performed by spraying the leaves with a narrow, directed spray (SO psi,
6-12 inches from the leaf) containing approximately 1% carborundum in
the buffered vector solution.
(d) Vacuum Infiltration. Inoculations may be accomplished by
subjecting the host organism to a substantially vacuum pressure
environment in order to facilitate infection.
(e) High Speed Robotics Inoculation. Especially applicable when the
organism is a plant, individual organisms may be grown in mass
array such as in microtiter plates. Machinery such as robotics may
then be used to transfer the nucleic acid of interest.
An alternative method for introducing a recombinant plant viral nucleic
acid into a plant host is a technique known as agroinfection or Agrobacterium-
mediated transformation (sometimes called Agro-infection) as described by
Grimsley et al., Nature 325:177 (1987). This technique makes use of a common
feature of Agrobacterium which colonizes plants by transferring a portion of
their
DNA (the T-DNA) into a host cell, where it becomes integrated into nuclear
DNA. The T-DNA is defined by border sequences which are 25 base pairs long,
and any DNA between these border sequences is transferred to the plant cells
as
36
~..~.~.....-...._ .... _ __...~....~~.._. .. ,. .._.._.~.....,.. . _ . _.._-
..........
CA 02318662 2000-07-14
WO 99136516 PCT/US99/01164
well. The insertion of a recombinant plant viral nucleic acid between the T-
DNA
border sequences results in transfer of the recombinant plant viral nucleic
acid to
the plant cells, where the recombinant plant viral nucleic acid is replicated,
and
then spreads systemically through the plant. Agro-infection has been
accomplished with potato spindle tuber viroid (PSTV) (Gardner et al., Plant
Mol.
Biol. 6_:221 (1986); CaV (Grimsiey et al., Proc. Natl. Acad. Sci. USA 83:3282
(1986)); MSV (Grimsley et al., Nature X25:177 (1987)), and Lazarowitz, S.,
Nucl. Acids Res. 16:229 (1988)) digitaria streak virus (Donson et al.,
Virology
_1ø2_:248 (1988)), wheat dwarf virus {Hayes et al., J. Gen. Virol. 69:891
(1988))
and tomato golden mosaic virus (TGMV) (Ehner et al., Plant Mol. Biol. 10:225
(1988) and Gardiner et al.. EMBO J. 7:899 (1988)). Therefore, agro-infection
of
a susceptible plant could be accomplished with a virion containing a
recombinant
plant viral nucleic acid based on the nucleotide sequence of any of the above
viruses. Particle bombardment or electrosporation or any other methods known
in the art may also be used.
Infection may also be attained by placing a selected nucleic acid sequence
into an organism such as E. toll, or yeast, either integrated into the genome
of
such organism or not and then applying the organism to the surface of the host
organism. Such a mechanism may thereby produce secondary transfer of the
selected nucleic acid sequence into the host organism. This is a particularly
practical embodiment when the host organism is a plant. Likewise, infection
may
be attained by first packaging a selected nucleic acid sequence in a
pseudovirus.
Such a method is described in WO 94/10329, the teachings of which are
incorporated herein by reference. Though the teachings of this reference may
be
specific for bacteria, those of skill in the art will readily appreciate that
the same
procedures could easily be adapted to other organisms.
Those of skill in the art will readily understand that there are many
methods to determine the function of a nucleic acid once expression in a host,
such as a plant is attained. In one embodiment the function of a nucleic acid
may
be determined by complementation analysis. That is, the function of the
nucleic
acid of interest may be determined by observing the endogenous gene or genes
whose function is replaced or augmented by introducing the nucleic acid of
interest. A discussion of this principle is provided by Napoli et al., The
Plant
37
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Cell 2_:279-289 ( 1990) which is incorporated herein by reference. Further
teachings in these regards are provided by WO 97/42210, the disclosure of
which
is also incorporated herein by reference. In a second embodiment, the function
of
a nucleic acid may be determined by analyzing the biochemical alterations in
the
accumulation of substrates or products from enzymatic reactions according to
any
one of the means known by those skilled in the art. In a third embodiment, the
function of a nucleic acid may be determined by observing phenotypic changes
in
the host by methods including morphological, macroscopic or microscopic
analysis. In a fourth embodiment, the function of a nucleic acid may be
determined by observing the change in biochemical pathways which may be
modified in the host as a result of the local and/or systemic expression of
the non-
native nucleic acids. In a fifth embodiment, the function of a nucleic acid
may be
determined utilizing techniques known by those skilled in the art to observe
inhibition of gene expression in the cytoplasm of cells as a result of
expression of
the non-native nucleic acid.
A particularly useful way to determine gene function is by observing the
phenotype in a whole plant when a particular gene function has been silenced.
Useful phenotypic traits in plant cells which may be observed microscopically,
macroscopically or by other methods include, but are not limited to, improved
tolerance to herbicides, improved tolerance to extremes of heat or cold,
drought,
salinity or osmotic stress; improved resistance to pests (insects, nematodes
or
arachnids) or diseases (fungal, bacterial or viral) production of enzymes or
secondary metabolites; male or female sterility; dwarfness; early maturity;
improved yield, vigor, heterosis, nutritional qualities, flavor or processing
properties, and the like. Other examples include the production of important
proteins or other products for commercial use, such as lipase, melanin,
pigments,
alkaloids, antibodies, hormones, pharmaceuticals, antibiotics and the like.
Another useful phenotypic trait is the production of degradative or inhibitory
enzymes, such as are utilized to prevent or inhibit root development in
malting
barley or that determine response or non-response to a systemically
administered
drug in a human. The phenotypic trait may also be a secondary metabolite whose
production is desired in a bioreactor.
38
CA 02318662 2000-07-14
WO 99!36516 PCT/US99/01164
Another particularly useful means to determine function of nucleic acids
transfected into a host is to observe the effects of gene silencing.
Traditionally,
functional gene knockout has been achieved following inactivation due to
insertion of transposable elements or random integration of T-DNA into the
chromosome, followed by characterization of conditional, homozygous-recessive
mutants obtained upon backcrossing. Some teachings in these regards are
provided by WO 97/42210 which is herein incorporated by reference. As an
alternative to traditional knockout analysis, an EST/DNA library from an
organism, for example Arabidopsis thaliana, may be assembled into a plant
viral
transcription plasmid. The DNA sequences in the transcription plasmid library
may then be introduced into plant cells as part of a functional RNA virus
which
post-transcriptionally silences the homologous target gene. The EST/DNA
sequences may be introduced into a plant viral vector in either the plus or
minus
sense orientation, and the orientation can be either directed or random based
on
the cloning strategy. A high-throughput, automated cloning scheme based on
robotics may be used to assemble and characterize the library. In addition,
double stranded RNA may also be an effective stimulator of gene silencing/co-
suppression in transgenic plant. Gene silencing/co-suppression of plant genes
may be induced by delivering an RNA capable of base pairing with itself to
form
double stranded regions. This approach could be used with any plant or non-
plant gene to assist in the identification of the function of a particular
gene
sequence.
A particularly troublesome problem with gene silencing in plant hosts is
that many plant genes exist in a multigene family. Therefore, effective
silencing
of a gene function may be especially problematic. According to the present
invention, however, nucleic acids may be inserted into the genome to
effectively
silence a particular gene function or to silence the function of a multigene
family.
It is presently believed that about 20% of plant genes exist in multigene
families.
A single nucleotide sequence of about 20 to 100 or more bases having about 70%
or more homology to a gene may silence an entire plant gene family having two
or more homologous genes.
A detailed discussion of some aspects of the "gene silencing" effect is
provided in co-pending U.S. Patent Application Serial No. 08/260,546
39
__.~.~. __~. _... _.. __._.__. . _~_ __ . _.._.~- w.-..~_
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
(W095/34668 published 12/21/95) the disclosure of which is incorporated herein
by reference. RNA can reduce the expression of a target gene through
inhibitory
RNA interactions with target mRNA that occur in the cytoplasm and/or the
nucleus of a cell.
Full-length cDNAs may be accessed from public and private repositories
or extracted from field samples for insertion of unknown open reading frames
into viral vectors for expression of nucleic acids in the host organism and
thereby
utilized as an alternative to antisense gene knockout. This technology may be
implemented by PCR amplification and cloning of all cDNAs that do not share
I O homology with gene sequences in public and or private databases. The cDNAs
may be expressed in plants transfected with one or more plant viral vectors
for
subsequent analysis of novel phenotype of the whole plant (biochemical and
morphological). Selected cDNA sequences from maize, rice, soybean canola and
other crop species may be used to assemble the cDNA libraries. This method
may thus be used to search for useful dominant gene phenotypes from novel
cDNA libraries through the gene expression.
An EST/cDNA library from an organism such as Arabidopsis thaliana
may be assembled into a plant viral transcription plasmid background. The cDNA
sequences in the transcription plasmid library can then be introduced into
plant
cells as cytoplasmic RNA in order to post-transcriptionally silence the
endogenous genes. The EST/cDNA sequences may be introduced into the plant
viral transcription plasmid in either the plus or anti-sense orientation (or
both),
and the orientation can be either directed or random based on the cloning
strategy.
A high-throughput, automated cloning strategy using robotics can be used to
assemble the library. The EST clones can be inserted behind a duplicated
subgenomic promoter such that they are represented as subgenomic transcripts
during viral replication in plant cells. Alternatively, the EST/cDNA sequences
can be inserted into the genomic RNA of a plant viral vector such that they
are
represented as genomic RNA during the viral replication in plant cells. The
library of EST clones is then transcribed into infectious RNA and inoculated
onto
individual platelets of Arabidopsis thaliana (or other plant species). The
viral
RNA containing the EST/cDNA sequences contributed from the original library
are now present in a sufficiently high concentration in the cytoplasm such
that
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
they cause post-transcriptional gene silencing of the endogenous plant-gene
homologs. Since the replication mechanism of the virus produces both sense and
antisense RNA sequences, the orientation of the EST/cDNA insert is normally
irrelevant in terms of producing the desired gene-silenced phenotype in the
tissue.
Partial cDNA sequences cloned into a plant viral vector in the sense
orientation
have previously been shown to also confer a gene silencing phenotype (Kumagai
et al., Proc. Natl. Acad Sci. USA X2:1679 ( 1995)), the teachings of which are
incorporated herein by reference. The actual mechanism of gene silencing has
not been fully determined. This phenomenon may be similar to the gene
silencing via cosuppression observed in transgenic plants.
The plant tissue may then be taken for sophisticated biochemical analysis
in order to determine which metabolic pathway has been affected by the
EST/DNA gene silencing, and in particular, which steps in a given metabolic
pathway have been affected by the EST/DNA gene silencing. Biochemical
analysis maybe done, for example, in a high-throughput, fully automated
fashion
using robotics. Suitable biochemical analysis may include MALDI-TOF,
LC/MS, GC/MS, two-dimensional IEF/SDS-PAGE, ELISA or other methods of
analyses. The clones in the EST/plant viral vector library may then be
functionally classified based on metabolic pathway affected or
visuaUselectable
phenotype produced in the plant. This process enables the rapid detenmination
of
gene function for unknown EST/DNA sequences of plant origin. Furthermore,
this process can be used to rapidly confirm function of full-length DNA's of
unknown gene function. Functional identification of unknown EST/DNA
sequences in a plant library may then rapidly lead to identification of
similar
unknown sequences in expression libraries for other crop species based on
sequence homology.
Large amounts of DNA sequence information is being generated in the
public domain and may be entered into a relational database. Links may be made
between sequences from various species predicted to carry out similar
biochemical or regulatory functions. Links may also be generated between
predicted enzymatic activities and visually displayed biochemical and
regulatory
pathways. Likewise, links may be generated between predicted enzymatic or
regulatory activity and known small molecule inhibitors, activators,
substrates or
41
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
substrate analogs. Phenotypic data from expression libraries expressed in
transfected hosts maybe automatically linked within such a relational
database.
Genes with similar predicted roles of interest in other crop plants or crop
plant
pests may thereby be more rapidly discovered.
~ A complete classification scheme of gene functionality for a fully
sequenced eukaryotic organism has been established for yeast. This
classification
scheme may be modified for plants and divided into the appropriate categories.
Such organizational structure may be utilized to rapidly identify herbicide
target
loci which may confer dominant lethal phenotypes, and thereby is useful in
helping to design rational herbicide programs.
A second aspect of the present invention is a method of silencing
endogenous genes in a host by introducing nucleic acids into the host by way
of a
viral nucleic acid suitable to produce the local and systemic expression of
the
nucleic acid of interest. In one embodiment, the host is a plant, but those
skilled
in the art will understand that other hosts may also be utilized. This method
utilizes the principle of post-transcription gene silencing of the endogenous
host
gene homolog as described above. Since the replication mechanism produces
both sense and anti-sense RNA sequences as disclosed above, the orientation of
the non-native nucleic acid insert is not crucial to providing gene silencing.
More information describing some aspects of the "gene silencing" effect
is provided in co-pending U.S. Patent Application Serial No. 08/260,546 (WO
95/34668 published 12/21/95) the disclosure of which is incorporated herein by
reference. RNA can reduce the expression of a target gene through inhibitory
RNA interactions with target mRNA that occur in the cytoplasm and/or the
nucleus of a cell.
Silencing of endogenous genes can be achieved with homologous (but not
identical) sequences from distant plant species. For example, the Nicotiana
benthamiana gene for phytoene desaturase (PDS) may be silenced by transfection
with a partial tomato cDNA for PDS (cloned in either the positive or antisense
orientation). The tomato PDS cDNA is 92% homologous at the nucleotide level
yet is still able to confer efficient gene silencing in an unrelated plant
species
(Kumagai et al., Proc. Natl. Acad Sci. USA 92:1679 (1995)). Identification of
EST/cDNA gene function in Arabidopsis thaliana could then be extrapolated to
42
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
similar EST/cDNA sequences of unknown fimction that exist in other libraries
(e.g., soybean, maize, rice, oilseed rape, etc.).
A third aspect of the present invention is a method for selecting desired
filnctions of RNAs and proteins by the use of virus vectors to express
libraries of
nucleic acid sequence variants. Libraries of sequence variants may be
generated
by means of in vitro mutagenenisis and/or recombination. Rapid in vitro
evolution can be used to improve virus-specific or protein-specific fimctions.
In
particular, plant RNA virus expression vectors may be used as tools to bear
libraries containing variants of nucleic acid, genes from virus, plant or
other
sources, and to be applied to plants or plant cells such that the desired
altered
effects in the RNA or protein products can be determined, selected and
improved.
In a preferred embodiment, nucleic acid shuffling techniques may be employed
to
construct shuffled gene libraries. Random, semi-random or known sequences of
virus origin may also be inserted in virus expression vectors between native
virus
sequences and foreign gene sequences, to increase the genetic stability of
foreign
genes in expression vectors as well as the translation of the foreign gene and
the
stability of the mRNA encoding the foreign gene in vivo. The desired function
of
RNA and protein may include the promoter activities, replication properties,
translational efficiencies, movement properties (local and systemic),
signaling
pathway, or virus host range, among others. The desired function alteration
can
be identified by assaying infected plants and the nature of mutation can be
determined by analysis of sequence variants in the virus vector.
Methods to increase the representation of gene sequences in virus
expression libraries may also be achieved by bypassing the genetic bottleneck
of
propagation in E. toll. For example, in one of the preferred embodiments of
the
instant invention, cell-free methods may be used to clone sequence libraries
or
individual arrayed sequences into virus expression vectors and reconstruct an
infectious virus, such that the final ligation product can be transcribed and
the
resulting RNA can be used for plant or plant cell inoculation/infection with
the
output being gene function discovery or protein production.
Techniques to screen sequence libraries can be introduced into RNA
viruses or RNA virus vectors as populations or individuals in parallel to
identify
individuals with novel and augmented virus-encoded functions in replication
and
43
_.",_ , .._ ~ r, .~.,~,
CA 02318662 2000-07-14
WO 99/3b51b PCT/US99/01154
virus movement, foreign gene sequence retention in vectors and proper folding,
activity and expression of protein products, novel gene expression, effects on
host
metabolism, and resistance or susceptibility of plants to exogenous agents.
Variation in the sequence of a native virus genes) or heterologous
nucleotide sequences) may be introduced into an RNA virus or an RNA virus
expression vector by many methods as a means to screen a population of
variants
in batch or individuals in parallel for novel properties exhibited by the
virus itself
or conferred on the host plant or cell by the virus vector. Variant
populations can
be transfected as populations or individual clones into "host": 1)
protoplasts; 2)
whole plants; or 3) inoculated leaves of whole plants and screened for various
traits including protein expression (increase or decrease), RNA expression
(increase or decrease), secondary metabolites or other host property gained or
loss
as a result of the virus infection.
For treatment of hosts with agents that result in cell death or down
regulation in general metabolic function, a virus vector, which simultaneously
expressed the green fluorescent protein (GFP) or other selectable marker gene
and
the variant sequence, is used to screen quantitatively for levels of
resistance or
sensitivity to the agent in question conferred upon the host by the variant
sequence expressed from the viral vector. By quantitatively screening pools or
individual infection events, those viruses containing unique variant sequences
allowing sustained metabolic life of host are identified by fluorescence under
long wave UV light. Those that do not confer this phenotype will fail to or
poorly fluoresce. In this manner, high throughput screening in mufti-well
dishes
in plate readers is possible where the average fluorescence of the well would
be
expressed as a ratio of the adsorption (measuring the cell mass) thereby
giving a
comparable quantitative value. This technique enables screening of populations
or individuals followed by rescue of the sequence from virus vectors
conferring
desired trait by RT-PCR and re-screening of particular variant sequences in
secondary screens.
The functions of transcription factors or factors contributing to the signal
transduction pathway of host cells are monitored by using specific proteomic,
mRNA or metanomic traits to be assayed following transfection with a virus
expression library. The contribution of a particular protein or product to a
44
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
valuable trait may be known from the literature, but a new mode of enhanced or
reduced expression could be identified by finding the factors that respond to
cellular signals that in turn alter its particular expression. For example,
transcription factors regulating the expression of defense proteins such as
systemin peptides, or protease inhibitors could be identified by transfecting
hosts
with virus libraries and the expression of systemin or protease inhibitors or
their
RNAs be directly assayed. Conversely, the promoters responsible for expressing
these genes could be genetically fused to the green fluorescent protein and
introduced into hosts as transient expression constructs or into stable
transformed
host cells/tissues. The resulting cells would be transfected with viral vector
libraries. Hosts now could be screened rapidly by following relative GFP
expression following vector transfection. Likewise, coupling the transfecting
of
hosts with virus libraries with the treatment of plants with methyl jasmonate
could identify sequences that reverse or enhance the gene induction events
induced by this metabolite. This approach could be applied to other factors
involved in promotion of higher biomass in plants such as Leafy or DET2. The
expression of these factors could be directly assayed or via promoters
genetically
fused to GFP. This technique will enable screening of populations or
individuals
followed by rescue of the sequence from virus vectors conferring desired trait
by
RT-PCR and re-screening of particular variant sequences in secondary screens.
A fourth aspect of the present invention is a method for inhibiting an
endogenous protease of a plant host comprising the step of treating the plant
host
with a compound which induces the production of an endogenous inhibitor of
said protease. In a preferred embodiment, jasmonic acid may be used to treat
the
plant host to induce the production of an endogenous inhibitor of an
endogenous
protease. In another preferred embodiment, the treatment of the plant host
with a
compound results an increased representation of an exogenous nucleic acid or
the
protein product thereof. In particular, transgenic hosts expressing protease
inhibitors may be used to decrease the degradation of proteins expressed by
virus
expression vectors. In a preferred embodiment, jasmonic acid may be used to
treat plants infected with virus expression vectors to decrease the
degradation of
proteins expressed by virus expression vectors.
.. _.~....._~.._ _r___.~. .. ._. ~...w_.. .
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
A fifth aspect of the present invention are genes and fi~agments thereof,
nucleotide sequences, and gene products obtained by way of the method of the
present invention. The present invention features expressing selected
nucleotide
sequences in a host organism such as, for example, a plant. Those of skill in
the
art will readily appreciate that the gene products of such nucleotide
sequences
may be isolated using techniques known to those skilled in the art. Such gene
products may exhibit biological activity as pharmaceuticals, herbicides, and
other
similar fiuictions.
EXAMPLES OF THE PREFERRED EMBODIMENTS
The following examples further illustrate the present invention. These
examples are intended merely to be illustrative of the present invention and
are
not to be construed as being limiting.
EXAMPLE 1
Cy~o_plasmic inhibition ofphvtoene desaturase in transfected plant confirms
that
the partial tomato PDS sequence encodes phytoene desaturase.
Isolation of tomato mosaic virus cDNA. An 861 base pair fragment (5524-6384)
from the tomato mosaic virus (fruit necrosis strain F; tom-F) containing the
putative coat protein subgenomic promoter, coat protein gene, and the 3'-end
was
isolated by PCR using primers 5'-CTCGCAA,AGTTTCGAACCAA.ATCCTC-3'
(upstream) (SEQ ID NO: 1) and S'-
CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream)
(SEQ ID NO: 2) and subcloned into the HincII site of pBluescript KS-. A hybrid
virus consisting of TMV-U1 and ToMV-F was constructed by swapping an 874-
bp BamHI-KpnI ToMV fragment into pBGC152, creating plasmid TTO1. The
inserted fragment was verified by dideoxynucleotide sequencing. A unique AvrII
site was inserted downstream of the XhoI site in TTO1 by PCR mutagenesis,
creating plasmid TTOIA, using the following oligonucleotides: S'-
TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA-3'
(upstream) (SEQ ID NO: 3), 5'-
46
._ .._~.,..~......._ . _ ...._w_. _ _ T_ ._ ~,. ~...,_......... .... ~...... ~-
~ -.__. ... ~ ..--..._...._....._. .. .. . .__
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream)
(SEQ ID NO: 4).
Isolation of a cDNA encoding tomato phvtoene synthase and a partial cDNA
S encoding tomato phytoene desaturase. Partial cDNAs were isolated from
ripening tomato fruit RNA by polymerase chain reaction (PCR) using the
following oligonucleotides: PSY, 5'-TATGTATGGTGCAGAAGAACAGAT-3'
(upstream) (SEQ ID NO: 5), 5'-AGTCGACTCTTCCTCTTCTGGCAT C-3'
(downstream) (SEQ ID NO: 6); PDS, 5'-
TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA-3' (SEQ ID NO: 7)
(upstream), S'-AACTCGAGCGCTTTGATTTCTCCGAAGCTT-3' (downstream)
(SEQ ID NO: 8). Approximately 3 X 104 colonies from a Lycopersicon
esculentum cDNA library were screened by colony hybridization using a'ZP
labeled tomato phytoene synthase PCR product. Hybridization was earned out at
42°C for 48 hours in 50% formamide, SX SSC, 0.02 M phosphate buffer, SX
Denhart's solution, and 0.1 mg/ml sheared calf thymus DNA. Filters were
washed at b5°C in O.1X SSC, 0.1% SDS prior to autoradiography. PCR
products
and the phytoene synthase cDNA clones were verified by dideoxynucleotide
sequencing.
DNA seguencing and com,~uter analvsis. A PstI, BamHI fragment containing the
phytoene synthase cDNA and the partial phytoene desaturase cDNA was
subcloned into pBluescript~ KS+ (Stratagene, La Jolla, California). The
nucleotide sequencing of KS+/PDS #38 and KS+/ 5'3'PSY was carried out by
dideoxy termination using single-stranded templates (Maniatis, Molecular
Cloning, 15' Ed.) Nucleotide sequence analysis and amino acid sequence
comparisons were performed using PCGENE~ and DNA Inspector~ IIE
programs.
construction of the tomato pllytoene svnthase expression vector. AXhoI
fragment containing the tomato phytoene synthase cDNA was subcloned into
TTO 1. The vector TTOl/PSY + (FIGURE 1 ) contains the phytoene synthase
47
_..~-..-._. .. _.~,~.._._. . _ ..~_.~~~.a_. ...w.....-...,._,~-..~ a _
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
cDNA in the positive orientation under the control of the TMV-U1 coat protein
subgenomic promoter; while, the vector TTO1/PSY - contains the phytoene
synthase cDNA in the antisense orientation.
instruction of a viral vector containin~a partial tomato phvtoene desaturase
cDNA. A XhoI fragment containing the partial tomato phytoene desaturase
cDNA was subcloned into TTOI . The vector TTOIA/PDS + (FIGURE 2)
contains the phytoene desaturase cDNA in the positive orientation under the
control of the TMV-U1 coat protein subgenomic promoter; while the vector
TTOIA/PDS - contains the phytoene desaturase cDNA in the antisense
orientation.
Transfection and analysis ofN. benthamiana jTT01/PSY+ TTO1/PSY-
TTO10/PDS +. TTOI/PDS -L Infectious RNAs from TTO1/ PSY+ (FIGURE 1),
TTO1/PSY-TTOI/PDS +, TTOI/PDS+ were prepared by in vitro transcription
using SP6 DNA-dependent RNA polymerase as described previously (Dawson et
al., Proc. Natl. Acad. Sci. USA 83:1832 (1986)) and were used to mechanically
inoculate N. benthamiana. The hybrid viruses spread throughout all the non-
inoculated upper leaves as verified by transmission electron microscopy, local
lesion infectivity assay, and polymerase chain reaction (PCR) amplification.
The
viral symptoms resulting from the infection consisted of distortion of
systemic
leaves and plant stunting with mild chlorosis. The leaves from plants
transfected
with TTOIIPSY+ turned orange and accumulated high levels of phytoene while
those transfected with TTO1~/PDS+ and TTO1~/PDS- turned white. Agarose
gel eletrophoresis of PCR cDNA isolated from virion RNA and Northern blot
analysis of virion RNA indicate that the vectors are maintained in an
extrachromosomai state and have not undergone any detectable intramolecular
rearrangements.
Purification and analysis of carotenoids from transfected plants The
carotenoids
were isolated from systemically infected tissue and analyzed by HPLC
chromatography. Carotenoids were extracted in ethanol and identified by their
peak retention time and absorption spectra on a 25-cm Spherisorb~ ODS-1 5- m
48
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
column using acetonitrile/methanol/2-propanol (85:10:5) as a developing
solvent
at a flow rate of 1 ml/min. They had identical retention time to a synthetic
phytoene standard and (3-carotene standards from carrot and tomato. The
phytoene peak from N. benthamiana transfected with TTOI/PSY + had an optical
absorbance maxima at 276, 285, and 298 nm. Plants transfected with viral
encoded phytoene synthase showed a ten-fold increase in phytoene compared to
the levels in noninfected plants. The expression of sense and antisense RNA to
a
partial phytoene desaturase in transfected plants inhibited the synthesis of
colored
carotenoids and caused the systemically infected leaves to turn white. HPLC
analysis of these plants revealed that they also accumulated phytoene. The
white
leaf phenotype was also observed in plants treated with the herbicide
norflurazon
which specifically inhibits phytoene desaturase.
This change in the levels of phytoene represents one of the largest
increases of any carotenoid (secondary metabolite) in any genetically
engineered
plant. Plants transfected with viral-encoded phytoene synthase showed a ten-
fold
increase in phytoene compared to the levels in noninfected plants. In
addition,
the accumulation of phytoene in plants transfected with positive-sense or
antisense phytoene desaturase suggests that viral vectors can be used as a
potent
tool to manipulate pathways in the production of secondary metabolites through
cytoplasmic antisense inhibition. These data are presented by Kumagai et al.,
Proc. Natl. Acad Sci. USA X2:1679-1683 (1995).
EXAMPLE 2
Expression of bell pegper cDNA in transfected plant confirms that it encodes
c~psanthin-capsorubin sxrlthase.
The biosynthesis of leaf carotenoids in Nicotiana benthamiana was
altered by rerouting the pathway to the synthesis of capsanthin, a non-native
chromoplast-specific xanthophyll, using an RNA viral vector. A cDNA encoding
capsanthin-capsorubin synthase (Ccs), was placed under the transcriptional
control of a tobamovirus subgenomic promoter. Leaves from transfected plants
expressing Ccs developed an orange phenotype and accumulated high levels of
capsanthin. This phenomenon was associated by thylakoid membrane distortion
and reduction of grana stacking. In contrast to the situation prevailing in
49
...__-~_~._.~. .~~ ~.~.... _r-...__ _.~_._..
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
chrornoplasts, capsanthin was not esterified and its increased level was
balanced
by a concomitant decrease of the major leaf xanthophylls, suggesting an
autoregulatory control of chloroplast carotenoid composition. Capsanthin was
exclusively recruited into the trimeric and monomeric light-harvesting
complexes
of Photosystem II. This demonstration that higher plant antenna complexes can
accommodate non-native carotenoids provides compelling evidence for
functional remodeling of photosynthetic membranes by rational design of
carotenoids.
Construction of the Ccs expression vector. Unique XhoI, AvrII sites were
inserted into the bell pepper capsanthin-capsorubin synthase (Ccs) cDNA by
polyrnerase chain reaction (PCR) mutagenesis using oligonucleotides: S'-
GCCTCGAGTGCAGCATGGAAACCCTTCTAAAGCTTTTCC-3' (upstream)
(SEQ ID NO: 9), S'-TCCCTAGGTCAAAGGCTCTCTATTGCTAGATTGCCC-
3' (downstream) (SEQ ID NO: 10). The 1.6-kb XhoI, AvrII cDNA fragment was
placed under the control of the TMV-U1 coat protein subgenornic promoter by
subcloning into TTOIA, creating plasmid TTOIA CCS+ (FIGURE 3) in the sense
orientation as represented by FIGURE 3.
Carotenoid analysis. Twelve days after inoculation upper leaves from 12 plants
were harvested and lyophilized. The resulting non-saponified extract was
evaporated to dryness under argon and weighed to deterniine the total lipid
content. Pigment analysis from the total lipid content was performed by HPLC
and also separated by thin layer chromatography on silica gel G using hexane /
acetone (60v / 40v). Plants transfected with TTOIA CCS+ accumulated high
levels of capsanthin (36% of total carotenoids).
EXAMPLE 3
Expression of bacterial CrtB eene in transfected nlantsconfi~ns that it
encodes
~hytoene s3mthase.
We developed a new viral vector, TTU51, consisting of tobacco mosaic
virus strain U1 (TMV-U1) (Goelet et al., Proc. Natl. Acad. Sci. USA x:5818-
5822 (1982)), and tobacco mild green mosaic virus (TMGMV; US strain) (Solis
__ ,__~.,.,..~._~_... _ T_,.__.. . .. ...,_....r..~...--.. _.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
et al., "The complete nucleotide sequence of the genomic RNA of the
tobamovirus tobacco mild green mosaic virus" ( 1990)). The open reading frame
(ORF) for Erwinia herbicola phytoene synthase (CrtB) (Armstrong et al., Proc.
Natl. Acad. Sci. USA 87:9975-9979 ( 1990)) was placed under the control of the
tobacco mosaic virus (TMV) coat protein subgenomic promoter in the vector
TTU51. This construct also contained the gene encoding the chloroplast
targeting peptide (CTP) for the small subunit of ribulose-1,5-bisphosphate
carboxylase (RUBISCO) (O'Neal et al., Nucl. Acids Res. 15:8661-8677 (1987))
and was called TTU51 CTP CrtB as represented by FIGURE 4. Infectious RNA
was prepared by in vitro transcription using SP6 DNA-dependent RNA
polymerase (Dawson et al, Proc. Natl. Acad Sci. USA 81832-1836 (1986));
Susek et al., Cell 74:787-799 (1993)) and was used to mechanically inoculate
N.
benthamiana. The hybrid virus spread throughout all the non-inoculated upper
leaves and was verified by local lesion infectivity assay and polymerase chain
reaction (PCR) amplification. The leaves from plants transfected with TTU51
CTP CrtB developed an orange pigmentation that spread systemically during
plant growth and viral replication.
Leaves from plants transfected with TTU51 CTP CrtB had a decrease in
chlorophyll content (result not shown) that exceeded the slight reduction that
is
usually observed during viral infection. Since previous studies have indicated
that the pathways of carotenoid and chlorophyll biosynthesis are
interconnected
(Susek et al., Cel174:787-799 (1993)), we decided to compare the rate of
synthesis of phytoene to chlorophyll. Two weeks post-inoculation, chloroplasts
from plants infected with TTU51 CTP CrtB transcripts were isolated and assayed
for enzyme activity. The ratio of phytoene synthetase to chlorophyll syntheses
was 0.55 in transfected plants and 0.033 in uninoculated plants (control).
Phytoene synthase activity from plants transfected with TTU51 CTP CrtB was
assayed using isolated chloroplasts and labeled ['4C) geranylgeranyl PP. There
was a large increase in phytoene and an unidentified C4o alcohol in the CrtB
plants.
S1
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Phvtoene synthetase ass~v_
The chloroplasts were prepared as described previously (Camara, Methods
Enzymol. _24:352-365 (1993)). The phytoene synthase assays were carned out in
an incubation mixture (0.5 ml final volume) buffered with Tris-HCL, pH 7.6,
containing [14C] geranylgeranyl PP (100,000 cpm) (prepared using pepper GGPP
synthase expressed in E. coli), 1 mM ATP, 5 mM MnCl2, 1 mM MgCl2, Triton
X-100 (20 mg per mg of chloroplast protein) and chloroplast suspension
equivalent to 2 mg protein. After 2 h incubation at 30°C, the reaction
products
were extracted with chloroform methanol (Camara, supra) and subjected to TLC
onto silicagel plate developed with benzene/ethyl acetate (90/10) followed by
autoradiography.
Chlorophyll synthetase assa_v_
For the chlorophyll synthetase assay, the isolated chloroplasts were lysed
by osmotic shock before incubation. The reaction mixture (0.2 ml, final
volume)
consisting of 50 mM Tris-HCL (pH 7.6) containing ['4C] geranylgeranyl PP
( 100,000 cpm), 5 MgCl2, 1 mM ATP, and ruptured plasmid suspension
equivalent to 1 mg protein was incubated for 1 hr at 30°C. The reaction
products
were analyzed as described previously.
Plasmid Constructions
The chloroplast targeting, phytoene synthase expression vector, TTU51
CTP CrtB as represented in FIGURE 4, was constructed in several subcloning
steps. First, a unique SphI site was inserted in the start codon for the
Erwinia
herbicola phytoene synthase gene by polymerase chain reaction (PCR)
mutagenesis (Saiki et al., Science 230:1350-1354 (1985)) using
oligonucleotides
CrtB M1S 5'-CCA AGC TTC TCG AGT GCA GCA TGC AGC AAC CGC
CGC TGC TTG AC-3' (upstream) (SEQ ID NO: 11) and CrtB P300 5'-AAG
ATC TCT CGA GCT AAA CGG GAC GCT GCC AAA GAC CGG CCG G-3'
(downstream) (SEQ ID NO: 12). The CrtB PCR fragment was subcloned into
pBluescript~ (Stratagene) at the EcoRV site, creating plasmid pBS664. A 938
by SphI, XhoI CrtB fragment from pBS664 was then subcloned into a vector
52
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
containing the sequence encoding the N. tabacum chloroplast targeting peptide
(CTP) for the small subunit of RUBISCO, creating plasmid pBS670. Next, the
tobamoviral vector, TTU51, was constructed. A 1020 base pair fragment from
the tobacco mild green mosaic virus (TMGMV; US strain) containing the viral
subgenomic promoter, coat protein gene, and the 3'-end was isolated by PCR
using TMGMV primers 5'-GGC TGT GAA ACT CGA AAA GGT TCC GG-3'
(upstream) (SEQ ID NO: 13) and S'-CGG GGT ACC TGG GCC GCT ACC
GGC GGT TAG GGG AGG-3' (downstream) (SEQ ID NO: 14), subcloned into
the HincII site of Bluescript KS-, and verified by dideoxynucleotide
sequencing.
This clone contains a naturally occurring duplication of 147 base pairs (SEQ
ID
NO: 15) that includes the whole upstream pseudoknot domain in the 3' noncoding
region. The hybrid viral cDNA consisting of TMV-U1 and TMGMV was
constructed by swapping a 1-Kb XhoI-KpnI TMGMV fragment into TTO1
(Kumagai et al., Proc. Natl. Acad. Sci. USA X2:1679-1683 (1995)), creating
plasmid TTU51. Finally, the 1.1 Kb XhoI CTP CrtB fragment from pBS670 was
subcIoned into the XhoI of TTU51, creating plasmid TTU51 CTP CrtB. As a
CTP negative control, a 942 by XhoI fragment containing the CrtB gene from
pBS664 was subcloned into TTUS 1, creating plasmid TTUS 1 CrtB #15.
EXAMPLE 4
Exnress,_'nn of bacterial nhvtoene desatur SP lrYtIl eene in transfected
plants
confers resistance to norflurazon herbicide
Erwinia phytoene desaturase (PDS), which is encoded by the gene CrtI
(Armstrong et al., 1990), converts phytoene to lycopene through four
desaturation
steps. While plant PDS is sensitive to the bleaching herbicide norflurazon,
Erwinia PDS is not inhibited by norflurazon (Misawa et al., Plant J. _6(4):481-
489 (1994)). The open reading frame (ORF) for CrtI was placed under the
control of the tobacco mosaic virus (TMV) coat protein subgenomic promoter in
the vector TTOSA1. This construct also contained the gene encoding the
chloroplast targeting peptide (CTP) for the small subunit of ribulose-1,5-
bisphosphate carboxylase {RUBISCO) and was called TTOSA1 CTP CrtI 491 #7
Infectious RNA was prepared by in vitro transcription using SP6 DNA-dependent
53
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
RNA polymerase (Dawson et al., Proc. Natl. Acad Sci. USA 83:1832-1836
(1986)) and was used to mechanically inoculate N. benthamiana. The hybrid
virus spread throughout all the non-inoculated upper leaves, conferring
resistance
to norflurazon to the entire plant. TTOSA1 CTP CrtI 491 #7 (FIGURE 5)
inoculated plants remained green instead of bleaching white, and maintained
higher levels of [i-carotene compared to uninoculated control plants.
Plasmid Constructions
The chloroplast targeting, bacterial phytoene desaturase expression vector,
TTOSA1 CTP CrtI 491 #7 (FIGURE 5) was constructed as follows. First, a
unique SphI site was inserted in the start codon for the Erwinia herbicola
phytoene desaturase gene (plasmid pAU211, (FIGURE 6) by polymerase chain
reaction (PCR) mutagenesis using the oligonucleotides CrtI HSM1 5'-GA CAG
AAG CTT TGC AGC ATG CAA AAA ACC GTT-3' (upstream) (SEQ ID NO:
16) and IQ419A 5'-CGC GGT CAT TGC AGA TCC TCA ATC ATC AGG C-3'
(downstream) (SEQ ID NO: 17). The 1504 by CrtI PCR fragment was subcloned
into pBluescript~ (Stratagene) by inserting it between the EcoRV and HindIII
sites, creating plasmid KS+lCrtl* 491 (FIGURE 7). A 1481 by SphI, AvrII CrtI
fragment from plasmid KS+lCrtl* 491 was then subcloned into the tobamoviral
vector TTOSA1, creating TTOSAI CTP CrtI 491 #7.
Treatment of Transfected Plants with Norflurazon and Results
Starting 7 days after viral inoculation, the plants were treated with 5 ml of
a 10 mg/ml Solicam~DF (Sandoz Agro, Inc.) norflurazon herbicide solution [(4-
chloro-5-(methylamino)-2-(alpha, alpha, alpha-trifluoro-m-tolyl)-3(2H)-
pyridazinone)] every 4 days by applying to leaves and soil. Five days after
initiating treatment, uninfected plants were almost entirely white, especially
in
the upper leaves and meristematic areas. Plants infected with TTOSA1 CTP CrtI
491 #7 were still green and were almost identical in appearance to the non-
norflurazon treated infected controls.
54
_._.~.. .r.___
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Leaf nalvsis
The spread of the virally expressed CrtI gene throughout the plant was
verified by Northern blotting (Alwine et al., Proc. Natl. Acad. Sci. USA
74:5350-
5354 (1977)). Viral RNA was purified from uninoculated upper leaves and was
probed with the 1.5 kb CrtI gene. Positive results were obtained from plants
inoculated with TTOSA1 CTP CrtI 491 #7.
Leaf tissue from a TTOSA1 CTP CrtI 491 #7 infected plant was
examined for ~i-carotene levels. Treating an uninoculated control plant with
norflurazon resulted in severely depressed (3-carotene levels (7.8% of the
wild-
type level). However, when a plant which had been previously inoculated with
the viral construct TTOSA 1 CTP CrtI 491 #7 was treated with norflurazon, the
~i-
carotene level were partially restored (28.3% of the wild-type level). This is
similar to the level of ~i-carotene in TTOSA1 CTP CrtI 491 #7 samples not
treated with norflurazon (an average of 38.3% of wild-type), indicating that
the
herbicide norflurazon had little effect on (3-carotene levels in previously
transfected plants. The expression of the bacterial phytoene desaturase in
systematically infected tissue conferred resistance to the herbicide
norflurazon.
EXAMPLE 5
Expression of 5-enolnvruwlshikimate-3-phosphate svnt_hase (EPSPSI senes in
plants confers resistance to Roundup~ herbicide.
Systemic expression via a recombinant viral vector of 5-
enolpyruvylshikimate-3-phosphate synthase (EPSPS) genes in plants confers
resistance to Roundup~ herbicide. See also dells-Cioppa, et al., "Genetic
Engineering of herbicide resistance in plants," Frontiers of Chemistrw
BiotechnoloQV, Chemical Abstract Service, ACS, Columbus, OH, pp. 665-70
(1989). The purpose of this experiment is to provide a method to systemically
express EPSPS genes via a recombinant viral vector in fully-grown plants.
Transfected plants that overproduce the enzyme EPSPS in vegetative tissue
(root,
stem, and leaf) are resistant to Roundup~ herbicide. The present invention
provides a method for the production of plasmid-targeted EPSPS in plants via
an
RNA viral vector. A dual subgenomic promoter vector encoding the full-length
~~...,~.-.,~,...... ._._..~w.~.~..,",~.._.. _r _ _. __._
CA 02318662 2000-07-14
WO 99/3b51b PCTlUS99/Ollb4
EPSPS gene from Nicotiana tabacum (Class I EPSPS) is shown in plasmid
pBS736. Systemic expression of the Nicotiana tabacum Class I EPSPS confers
resistance to Roundup~ herbicide in whole plants and tissue culture. FIGURE 8
shows plasmid pBS736.
EXAMPLE 6
C o 1 is i ition of 5-enoi 1 hikimat -3- hos hate s EPSP
genes in plants blocks aromatic amino acid biosvn hesis
Cytoplasmic inhibition of 5-enolpyruvylshikimate-3-phosphate synthase
(EPSPS) genes in plants blocks aromatic amino acid biosynthesis and causes a
systemic bleaching phenotype similar to Roundup~ herbicide. See also della-
Cioppa, et al., "Genetic Engineering of herbicide resistance in plants,"
Frontiers
of Chemistry: Biotechnology, Chemical Abstract Service, ACS, Columbus, OH,
pp. 665-70 (1989). A dual subgenomic promoter vector encoding 1097 base
pairs of an antisense EPSPS gene from Nicotianan tabacum (Class I EPSPS) is
shown in plasmid pBS712. FIGURE 9 shows plasmid pBS712. Systemic
expression of the Nicotiana tabacum Class I EPSPS gene in the antisense
orientation causes a systemic bleaching phenotype similar to Roundup~
herbicide.
EXAMPLE 7
Exemplary complementation analysis
A transgenic plant or naturally occurring plant mutant may have a non-
functional gene such as the one which produces EPSP synthase. A plant
deficient
or lacking in the EPSP synthase gene could grow only in the presence of added
aromatic amino acids. Transfection of plants with a viral vector containing a
functional EPSP synthase gene or cDNA sequence encoding the same would
cause the plant to produce a functional EPSP synthase gene product. A plant so
transfected would then be able to grow normally without added aromatic amino
acids to its environment. In this transfected plant, the EPSP synthase
mutation in
the plant would be complemented in traps by the viral nucleic acid sequence
containing the native or foreign EPSP synthase cDNA sequence.
56
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
EXAMPLE 8
Expression of methvlotronhic yeast ZZAI eene in transfected plants confirms
that
it encodes alcohol oxidase
A genomic clone encoding alcohol oxidase ZZAI, the first enzyme
involved in methanol utilization, was isolated from a newly described Pichia
pastoris strain. Kumagai et al., BiolTechnology 11:606-610 (1993). Sequence
analysis indicates that gene encodes a polypepide of approximately 72-kDa
(FIGURE 10). Comparison of the amino acid sequence to Pichia pastoris AOXI
and AOX2 alcohol oxidases indicates that they show 97.4% and 96.4% similarity
to each other, respectively. The open reading frame (ORF) for alcohol oxidase,
from the a genomic clone containing ZZAl, was placed under the control of the
tobamoviral subgenomic promoter in TTOIA, a hybrid tobacco mosaic virus
(TMV) and tomato mosaic virus (ToMV) vector. Infectious RNA from
TTOIAPE ZZA1 (FIGURE 11) was prepared by in vitro transcription using SP6
1 S DNA-dependent RNA polymerase and used to mechanically inoculate N.
benthamiana. The 72-kDa protein accumulated in systemically infected tissue
and was analyzed by immunoblotting, using Pichia pastoris alcohol oxidase as a
standard. No detectable cross-reacting protein was observed in the noninfected
N. benthamiana control plant extracts.
Isolation of the alcohol oxidase ene
Three hundred nanograms of the yeast Pichia pastoris genomic DNA
digested with PstI and XhoI was amplified by PCR using a 25-mer
oligonucleotide (5'-TTG CAC TCT GTT GGC TCA TGA CGA T-3') (SEQ ID
NO: 18) corresponding to the nucleotide sequence of AOXI promoter and a 26-
mer oligonucleotide (S'-CAA GCT TGC ACA AAC GAA CGT CTC AC-3')
(SEQ ID NO: 19) corresponding to a nucleotide sequence derived from the AOXI
terminator. The PCR conditions using Thermos aquaticus DNA polymerase
(2.SU; Perkin-Elmer Cetus) consisted of an initial 2 minute incubation at
97°C
followed by two cycles at 97°C (lmin.), 45°C (lmin.),
60°C (1 min.), thirty-five
cycles at 94°C (1 min.), 45°C (1 min.), 60°C (1 min.),
and a final DNA
polymerase extension at 60°C for 7 min. The 3273 base pair fragment
containing
ZZAI gene was phenol/chloroform treated and precipitated with ammonium
57
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
acetate/ethanol. After digestion with SacI the fragment was purified by 1 %
low
melt agarose electrophoresis and subcloned into the SacIlEcoRV sites in
pBluescript KS-. The alcohol oxidise genomic clone KS-A0T8' was
characterized by restriction mapping and dideoxynucleotide sequencing.
Plasmid Constructions.
Unique XhoI, AvrII sites were inserted into the Pichia pastoris clone KS-
A07'8' by polymerise chain reaction (PCR) mutagenesis using oligonucleotides:
5'-CAC TCG AGA GCA TGG CTA TTC CCG AAG AAT TTG ATA TTA
TCG-3' (upstream) (SEQ ID NO: 20) and 5'-TCC CTA GGT TAG AAT CTA
GCA AGA CCG GTC TTC TCG-3' (downstream) (SEQ ID NO: 21 ). The 2.0-kb
XhoI, AvrII ZZA1 PCR fragment was subcloned into pTTOIAPE, creating
plasmid TTOlAPE ZZA1.
EXAMPLE 9
Rapid. hash-level expression of rice OS103 cDNA in transfectedplants confirms
that it encodes elvcosvlated rice a-amylase
The open reading frame (ORF) for rice a-amylase, from the cDNA clone
pOS103 (O'Neill et al., Mol. Gen. Genet. 221:235-244 (1990)), was placed under
the control of the tobamoviral subgenomic promoter in TTOlA (Kumagai et al.,
Proc. Natl. Acid Sci. USA 92:1679-1683 (1995)), a hybrid tobacco mosaic virus
(TMV) and tomato mosaic virus (ToMV) vector. Infectious RNA from TTOlA
103L (FIGURE 12) was prepared by in vitro transcription using SP6 DNA-
dependent RNA polymerise and used to mechanically inoculate N. benthamiana.
The hybrid virus spread throughout the noninoculated upper leaves as verified
by
transmission electron microscopy, local lesion infectivity assay, and PCR
amplification. The viral symptoms consisted of plant stunting with mild
chlorosis and distortion of systemic leaves. The 46-kDa a-amylase accumulated
to levels of at least 5% total soluble protein, and was analyzed by
immunoblotting, using yeast expressed a-amylase as a standard. No detectable
cross-reacting protein was observed in the noninfected N. benthamiana control
plant extracts. The expression level of the recombinant enzyme produced in
58
CA 02318662 2000-07-14
WO 99/36516 PGT/US99/OI164
transfected plants was at least ten times higher than the amount of
thermostable
bacterial a-amylase produced in transgenic tobacco. The a-amylase was purified
using ion exchange chromatography and its structural and biological properties
were analyzed. The secreted protein had an approximate relative molecular mass
of 46 kDa, cross-reacted with anti-a-amylase antibody, and hydrolyzed starch
and oligomaltose in an in vitro assay.
The recombinant enzyme from transfected N. benthamiana was
glycosylated at an asparagine residue via an N glycosidic linkage. The
heterologously expressed a-amylases from transfected N. benthamiana and from
transformed strains of S. cerevisiae and P. pastoris were treated with endo-H
and
were compared by Western biot/SDS-PAGE analysis. There was an equivalent
mobility shift for the enzymes expressed in S. cerevisiae and P. pastoris. The
extent of the change in mobility suggests that the yeast expressed enzymes are
hyperglycosylated while the recombinant protein from transfected plants is
similar to that of the native rice a-amylase. While it is known that mannose-
rich
and complex oligosaccharide side chains are covalently attached to the mature
rice seed a-amylase (Mitsui et al., Plant Physiol. $2_:880-884 (1986)), the
actual
carbohydrate composition and structure of the recombinant plant glycoprotein
remains to be determined.
MALDI-TOF analysis revealed that the relative molecular mass (Mr) of
the N. benthamiana expressed sample was 46,064 Da. The MT of the a-amylase
deternzined by MALDI-TOF was 918 Da larger than the Mr derived from the
amino acid sequence (PCGENE). The change in molecular mass (OIVIr) of the
plant expressed enzyme was smaller than the ~IVIr of a-amylases produced in
yeast. This result suggests that there is a difference in glycosylation
patterns
between foreign proteins expressed in plants and those that are secreted in
yeast.
Plasmid Constructions.
Unique XhoI, AvrII sites were inserted into the rice a-amylase pOS 103
cDNA by PCR mutagenesis using oligonucleotides: 5'-CTC TCG AGA TCA
ATC ATC CAT CTC CGA AGT GTG TCT GC-3' (upstream) (SEQ ID NO: 22)
and S'-TCC CTA GGT CAG ATT TTC TCC CAG ATT GCG TAG C-3'
59
.."....",u.,".~,-,......._..... .....__.~.~",_..,._.T..~.~W, ,. ....
.............~.",~"""""-",_..m.......,
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
(downstream) (SEQ ID NO: 23). The 1.4-kb XhoI, AvrII OS103 PCR fragment
was subcloned into pTTOIA, creating plasmid TTOIA 103L.
Purification LmsnunolQgical Detection and in vitro Assay of a amylase
Ten days after inoculation, total soluble protein was isolated from 10 g of
upper, noninoculated N. benthamiana leaf tissue. The leaves were frozen in
liquid nitrogen and ground in 20 ml of 5% 2-mercaptoethanol/10 mM Tris-bis
propane, pH 6Ø The suspension was centrifuged and the supernatant,
containing
recombinant a-amylase, was bound to a POROS~ 50 HQ ion exchange column
(PerSeptive Biosystems). The a-amylase was eluted with a linear gradient of
0.0-
1 M NaCI in 50 mM Tris-bis propane pH 7Ø The a-amylase eluted in fraction
16, 17 and its enzyme activity was analyzed (Sigma Kit #576-3). Fractions
containing cross-reacting material to a-amylase antibody were concentrated
with
a Centriprep-30~ (Amicon) and the buffer was exchanged by diafiltration (50
mM Tris-bis propane, pH 7.0). The sample was then loaded on a POROS HQ/M
column (Perceptive Biosystems), eluted with a linear gradient of 0.0-1 M NaCI
in
50 mM Tris-bis propane pH 7.0, and assayed for a-amylase activity. Fractions
containing cross-reacting material to a-amylase antibody were concentrated
with
a Centriprep-30 and the buffer was exchanged by diafiltration (20 mM Sodium
Acetate/HEPES/MES, pH 6.0). The sample was finally loaded on a POROS
HS/M column (Perceptive Biosystems), eluted with a linear gradient of 0.0-1 M
NaCI in 20 mM Sodium Acetate/HEPES/MES, pH 6.0, and assayed for a-
amylase activity. Total soluble plant protein concentrations were determined
using bovine serum albumin as a standard. The proteins were analyzed on a 0.1
SDS/10% poiyacrylamide gel and transferred by electroblotting for 1 hour to a
nitrocellulose membrane. The blotted membrane was incubated for 1 hr with a
2000-fold dilution of anti-a-amylase antiserum. Using standard protocols, the
antisera was raised in rabbits against S. cerevisiae expressed rice a-amylase.
The
enhanced chemiluminescence horseradish peroxidase-linked, goat anti-rabbit IgG
assay (Cappel Laboratories) was performed according to the manufacturer's
(Amersham) specifications. The blotted membrane was subjected to film
exposure times of up to 10 sec. The quantity of total recombinant a-amylase in
__ _.
.~. T
__~.. _ . ____ _.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
an extracted leaf sample was determined (using a 1-sec exposure of the blotted
membrane) by comparing the crude extract chemiluminescent signal to the signal
obtained from iaiown quantities of a-amylase. Shorter and longer
chemiluminescent exposure times of the blotted membrane gave the same
quantitative results.
Analysis o~ost-translational modifications of recombinant a amylases
Approximately 5 p,g of recombinant protein was dissolved in 1 M acetic
acid and subjected to matrix-assisted laser desorption/ionization time of
flight
(MALDI-TOF) analysis (Karas et al., Anal. Chem. 60:2299-2301 (1988)). For
treatment with endo-B-N acetylglucosaminidase H (endo H), 2 p.g of the
recombinant a-amylases were denatured in 0.5% SDS/ 1 % [3-mercaptoethanol at
100°C for 10 minutes. After the addition of 500 U of endo H (New
England
Biolabs) the samples were incubated at 37°C for 4 hours in 50 mM sodium
citrate
(pH 5.5 @ 25°C) and then subjected to Western blot analysis using anti-
a-
amylase antiserum.
EXAMPLE 10
Expression of Chinese cucumber cDNA clone pQ2lD in transfected plants
confinms that it encodes a-trichosanthin.
We have developed a plant viral vector that directs the expression of a-
trichosanthin in transfected plants. The open reading frame (ORF) for a-
trichosanthin, from the genomic clone SEO, was placed under the control of the
TMV coat protein subgenomic promoter. Infectious RNA from TTUS lA QSEO
#3 (FIGURE 13) was prepared by in vitro transcription using SP6 DNA-
dependent RNA polymerase and was used to mechanically inoculate N.
benthamiana. The hybrid virus spread throughout all the non-inoculated upper
leaves as verified by local lesion infectivity assay, and PCR amplification.
The
viral symptoms consisted of plant stunting with mild chlorosis and distortion
of
systemic leaves. The 27-kDa a-trichosanthin accumulated in upper leaves (14
days after inoculation) and cross-reacted with an anti-trichosanthin antibody.
61
_......~..~..._._ ....__._ ~ ..
. _~._._, . r ...~...~,..,~_..-~_
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Plasmid Constructio c
An 0.88-kb XhoI, AvrII fragment, containing the a-trichosanthin coding
sequence, was amplified from genomic DNA isolated from Trichosanthes
kirilowii Maximowicz by PCR mutagenesis using oligonucleotides QMIX:
5°_
GCC TCG AGT GCA GCA TGA TCA GAT TCT TAG TCC TCT CTT TGC-3'
(upstream) (SEQ ID NO: 24) and Q1266A 5'-TCC CTA GGC TAA ATA GCA
TAA CTT CCA CAT CA AAGC-3' (downstream) (SEQ ID NO: 25). The a-
trichosanthin open reading frame was verified by dideoxy sequencing, and
placed
under the control of the TMV-U1 coat protein subgenomic promoter by
subcloning into TTU51 A, creating plasmid TTUS 1 A QSEO #3.
In vitro Transcriptions. Inoculations and Analysis of Transfected Plants
N. benthaminana plants were inoculated with in vitro transcripts of Kpn I-
digested TTUS l A QSEO #3 as previously described (Dawson et al., supra).
Virions were isolated from N. benthamiana leaves infected with TTU51A QSEO
#3 transcripts.
Purification ImmunoloQical Detection and in vitro Assay of a Trichosanthin
Two weeks after inoculation, total soluble protein was isolated from
upper, noninoculated N. benthamiana leaf tissue and assayed from cross-
reactivity to a a-trichosanthin antibody. The proteins from systemically
infected
tissue were analyzed on a 0.1% SDS/12.5% polyacrylamide gel and transferred
by electroblotting for 1 hr to a nitrocellulose membrane. The blotted membrane
was incubated for 1 hr with a 2000-fold dilution of goat anti-a-trichosanthin
antiserum. The enhanced chemiluminescence horseradish peroxidase-linked,
rabbit anti-goat IgG assay (Cappel Laboratories) was performed according to
the
manufacturer's (Amersham) specifications. The blotted membrane was subjected
to film exposure times of up to 10 sec. Shorter and longer chemiluminescent
exposure times of the blotted membrane gave the same quantitative results.
62
CA 02318662 2000-07-14
WO 99/3b51b PCT/US99/01164
EXAMPLE 11
Exuression of human (i-globin cDNA clone in trancfP~tPr~~ ~~nts confirms that
it
encodes hemoglobin.
The hemoglobin expression vector, RED1, was constructed in several
subcloning steps. A unique SphI site was inserted in the start codon for the
human ~i-globin and an XbaI site was placed downstream of the stop codon by
PCR mutagenesis by using oligonucleotides 5'-CAC TCG AGA GCA TGC TGC
ACC TGA CTC CTG AGG AGA AG-3' (upstream) (SEQ ID NO: 26) and 5'-
CGT CTA GAT TAG TGA TAC TTG TGG GCC AGC GCA TTA GC-3'
(downstream) (SEQ ID NO: 27). The 452 by SphI-XbaI hemoglobin fragment
was subcloned into the SphI-AvrII site of a modified tobamoviral vector. This
construct consists of a 1020 by fragment from the tobacco mild green mosaic
virus (TMGMV; US strain) containing the viral subgenomic promoter, coat
protein gene, and the 3'-end that was isolated by PCR using TMGMV primers 5'-
GGC TGT GAA ACT CGA AAA GGT TCC GG-3' (upstream) (SEQ ID NO: 28)
and 5'-CGG GGT ACC TGG GCC GCT ACC GGC GGT TAG GGG AGG-3'
(downstream) (SEQ ID NO: 29). In this vector, an artificial 40 base pair 5'
untransiated coat protein leader was fused to a hybrid cDNA encoding rice a-
amylase signal peptide and human (3-globin.
A hybrid sequence encoding rice alpha-amylase signal peptide and (3-
chain of human hemoglobin was placed under the control of the tobacco mosaic
virus (TMV-Ul) coat protein subgenomic promoter. Infectious RNA was made
in vitro and directly applied to N. benthamiana. One to two weeks post-
inoculation transfected plants had accumulated recombinant hemoglobin. The
16-KDa (i-globin accumulated in systemically infected leaves and was analyzed
by immunoblotting, using human hemoglobin as a standard. The recombinant
hemoglobin was detected in transfected plants using a rabbit anti-human
hemoglobin antibody. No detectable cross-reacting protein was observed in the
noninfected N. benthamiana control plants. The (3-globin from transfected
plants
co-migrated with an authentic human standard and appears to form homodimers.
This result suggests that rice a-amylase signal peptide was removed and that
it
may be possible to rapidly secrete functional hemoglobin in transfected
plants.
63
.. ~._..~ r___..,_".~._. ._.m._.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
EXAMPLE 12
~2nstruction of a tohamoviral vector for expression of heteroloaous genes in A
t li
Virions that were prepared as a crude aqueous extract of tissue from turnip
infected with RMV were used to inoculate N. benthamiana, N. tabacum, A.
thaliana, and oilseed rape (canola). Two to three weeks after transfection,
systemically infected plants were analyzed by immunoblotting, using purified
RMV as a standard. Total soluble plant protein concentrations were determined
using bovine serum albumin as a standard. The proteins were analyzed on a 0.1
SDS/12.5% polyacrylamide gel and transferred by electroblotting for 1 hr to a
nitrocellulose membrane. The blotted membrane was incubated for 1 hr with a
2000-fold dilution of anti-ribgrass mosaic virus coat antiserum. Using
standard
protocols, the antisera was raised in rabbits against purified RMV coat
protein.
1 S The enhanced chemiluminescence horseradish peroxidase-linked, goat anti-
rabbit
IgG assay (Cappel Laboratories) was performed according to the manufacturer's
(Amersham) specifications. The blotted membrane was subjected to film
exposure times of up to 10 sec. No detectable cross-reacting protein was
observed in the noninfected N. benthamiana control plant extracts. A 18 kDa
protein cross-reacted to the anti-RMV coat antibody from systemically infected
N. benthamiana, N. tabacum, A. thaliana, and oilseed rape (canola). This
result
demonstrates that RMV can systemically infect N. benthamiana, N. tabacum, A.
thaliana, and oilseed rape (canola).
Plasmid constructions
Ribgrass mosaic virus (RMV) is a member of the tobamovirus group that
infects crucifers. A partial RMV cDNA containing the 30K subgenomic
promoter, 30K ORF, coat subgenomic promoter, coat ORF, and 3'-end was
isolated by RT-PCR using by using oligonucleotides TVCV 183X 5'-TAC TCG
AGG TTC ATA AGA CCG CGG TAG GCG G-3' (upstream) (SEQ ID NO: 30)
and TVCV KpnI 5'-CGG GGT ACC TGG GCC CCT ACC CGG GGT TTA
GGG AGG-3' (downstream) (SEQ ID NO: 31 ), and subcloned into the EcoRV
64
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
site of KS+, creating plasmid KS+ TVCV #23 (FIGURE 14). The RMV cDNA
was characterized by restriction mapping and dideoxy nucleotide sequencing.
The partial nucleotide sequence is as follows:
5'-
S
ctcgaggttcataagaccgcggtaggcggagcgtttgtttactgtagtataattaaatatttgtcagataaaaggttgt
tt
aaagatttgttttttgtttgactgagtcgataATGTCTTACGAGCCTAAAGTTAGTGACTTC
CTTGCTCTTACGAAAAAGGAGGAAATTTTACCCAAGGCTTTGACGAGA
TTAAAGACTGTCTCTATTAGTACTAAGGATGTTATATCTGTTAAGGAG
TCTGAGTCCCTGTGTGATATTGATTTGTTAGTGAATGTGCCATTAGATA
AGTATAGGTATGTGGGTGTTTTGGGTGTTGTTTTCACCGGTGAATGGC
TGGTACCGGATTTCGTTAAAGGTGGGGTAACAGTGAGCGTGATTGAC
AAACGGCTTGAAAATTCCAGAGAGTGCATAATTGGTACGTACCGAGC
TGCTGTAAAGGACAGAAGGTTCCAGTTCAAGCTGGTTCCAAATTACTT
CGTATCCATTGCGGATGCCAAGCGAAAACCGTGGCAGGTTCATGTGC
GAATTCAAAATCTGAAGATCGAAGCTGGATGGCAACCTCTAGCTCTA
GAGGTGGTTTCTGTTGCCATGGTTACTAATAACGTGGTTGTTAAAGGT
TTGAGGGAAAAGGTCATCGCAGTGAATGATCCGAACGTCGAAGGTTT
CGAAGGTGTGGTTGACGATTTCGTCGATTCGGTTGCTGCATTCAAGGC
GATTGACAGTTTCCGAAAGAAAAAGAAAAAGATTGGAggaagggatGTAA
ATAATAATAAGTATAGATATAGACCGGAGAGATACGCCGGTCCTGAT
TCGTTACAATATAAAGAAGAAAaTGGTTTACAACATCACGAGCTCGAA
TCAGTACCAGTATTTCGCAGCGATGTGGGCAGAGCCCACAGCGATGCT
TAAccaGTGCGTGTCTGCGTTGTCGCAATCGTATCAAACTCAGGCGGCA
AgAGATACTGTTAGACAGCAGTTCTCTAACCTTCTGAGTGCGATTGTG
ACACCGAACCAGCGGTTTCCAgAAACAGGATACCGGGTGTATATTAAT
TCAGCAGTTCTAAAACCGTTGTACGAGTCTCTCATGAAGTCCTTTGAT
ACTAGAAATAGGATCATTGAAACTGAAGAAGAGTCGCGTCCATCGGC
TTCCGAAGTATCTAATGCAACACAACGTGTTGATGATGCGACCGTGGC
CATCAGGAGTCAAATTCAGCTTTTGCTGAACGAGCTCTCCAACGGACA
TGGTCTGATGAACAGGGCAGAGTTCGAGGTTTTATTACCTTGGGCTAC
TGCGCCAGCTACATAGgcgtggtgcacacgatagtgcatagtgtttttctctccacttaaatcgaagag
atatacttacggtgtaattccgcaagggtggcgtaaaccaaattacgcaatgttttaggttccatttaaatcgaaacct
gt
.....~.w......_._. _ __w ~..__ T. .. .._.. ~__.... _ ~..~....wfi_._.
._.._.~.~~.~...__ _ _. r _ .__.
CA 02318662 2000-07-14
WO 99/36516 PC"T/US99/01164
tatttcctggatcacctgttaacgtacgcgtggcgtatattacagtgggaataactaaaagtgagaggttcgaatcctc
c
ctaaccccgggtaggggccca-3'(SEQ ID NO: 32).
The 1543 base pair from the partial RMV cDNA was compared
(PCGENE) to oilseed rape mosaic virus (ORMV). The nucleotide sequence
identity was 97.8%. The RMV 30K and coat ORF were compared to ORMV and
the amino acid identity was 98.11% (30K) and 98.73% (coat), respectively. A
partial RMV cDNA containing the 5'-end and part of the replicase was isolated
by RT-PCR from RMV RNA using by using oligonucleotides RGMV 1 5'-GAT
GGC GCC TTA ATA CGA CTC ACT ATA GTT TTA TTT TTG TTG CAA
CAA CAA CAA C-3' (upstream) (SEQ ID NO: 33) and RGR 132 5'-CTT GTG
CCC TTC ATG ACG AGC TAT ATC ACG-3' (downstream) (SEQ ID NO: 34).
The RMV cDNA was characterized by dideoxy nucleotide sequencing. The
partial nucleotide sequence containing the T7 RNA polymerise promoter and part
of the RMV cDNA is as follows:
5'-
~ttaatacQactcactataGTTTTATTTTTGTTG AACAACAACAACAAATTACAA
TAACAACAAAACAAATACAAACAACAACAACATGGCACAATTTCAAC
AAACAGTAAACATGCAAACATTGCAGGCTGCCGCAGGGCGCAACAGC
CTGGTGAATGATTTAGCCTCACGACGTGTTTATGACAATGCTGTCGAG
GAGCTAAATGCACGCTCGAGACGCCCTAAGGTTCATTACTCCAAATCA
GTGTCTACGGAACAGACGCTGTTAGCTTCAAACGCTTATCCGGAGTTT
GAGATTTCCTTTACTCATACCCAACATGCCGTACACTCCCTTGCGGGT
GGCCTAAGGACTCTTGAGTTAGAGTATCTCATGATGCAAGTTCCGTTC
GGTTCTCTGACGTACGACATCGGTGGTAACTTTGCAGCGCACCTTTTC
AAAGGACGCGACTACGTTCACTGCTGTATGCCAAACTTGGATGTA~
GATATA .'t'-3' (SEQ ID NO: 35). The uppercase letters are nucleotide
sequences from RMV cDNA. The lower case letters are nucleotide sequences
from T7 RNA polymerise promoter. The nucleotide sequences from the 5' and
3' oligonucleotides are underlined.
Full length infectious RMV cDNA clones were obtained by RT-PCR from
RMV RNA using by using oligonucleotides RGMV 1 S'-GAT GGC GCC TTA
ATA CGA CTC ACT ATA GTT TTA TTT TTG TTG CAA CAA CAA CAA C-
66
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
3' (upstream) (SEQ ID NO: 36) and RG1 APE 5'-ATC GTT TAA ACT GGG
CCC CTA CCC GGG GTT AGG GAG G-3' (downstream) (SEQ >D NO: 37).
The RMV cDNA was characterized by dideoxy nucleotide sequencing. The
partial nucleotide sequence containing the T7 RNA polymerase promoter and part
of the RMV cDNA is as follows:
5'-
CCTTAATACGACTCACTATAGTTTTATTTTTGTTGCAACAACAACAAC
AAATTACAATAACAACA.A.AACA.AATACAAACAACAACAACATGGCAC
AATTTCAACAAACAGTAAACATGCAAACATTCCAGGCTGCCGCAGGG
CGCAACAGCCTGGTGAATGATTTAGCCTCACGACGTGTTTATGACAAT
GCTGTCGAGGAGCTAAATGCACGCTCGAGACGCCCTAAGGTTCATTAC
TCCAAATCAGTGTCTACGGAACAGACGCTGTTAGCTTCAAACGCTTAT
CCGGAGTTTGAGATTTCCTTTACTCATACCCAAACATGCCGTACACTC
CCTTGCGGGTGGCCTAAGGACTCTTGAGTTAGAGTATCTCATGATGCA
AGTTCCGTTCGGTTCTCTGACGTACGACATCGGTGGTAACTTTGCAGC
GCACCTTTTCAAAGGACGCGACTACGTTCACTGCTGTATGCCAAACTT
GGATGTACGTGATATAGCT-3' (SEQ ID NO: 38). The uppercase letters are
nucleotide sequences from RMV cDNA. The nucleotide sequences from the 5'
and 3' oligonucleotides are underlined. Full length infectious RMV cDNA
clones were obtained by RT-PCR from RMV RNA using oligonucleotides
RGMV 1 S'-gat ggc gcc tta ata cga ctc act ata gtt tta ttt ttg ttg caa caa caa
caa c-3'
(upstream) (SEQ ID NO: 39) and RG1 APE 5'-ATC GTT TAA ACT GGG CCC
CTA CCC GGG GTT AGG GAG G-3' (downstream) (SEQ ID NO: 40).
EXAMPLE 13
Arabidopsis thaliana cDNA library construction in a dual subgenomic promoter
vector.
Arabidopsis thaliana cDNA libraries obtained from the Arabidopsis
Biological Resource Center (ABRC). The four libraries from ABRC were size-
fractionated with inserts of 0.5-1 kb (CD4-13), 1-2 kb (CD4-14), 2-3 kb (CD4-
15), and 3-6 kb (CD4-16). All libraries are of high quality and have been used
by
several dozen groups to isolate genes. The pBluescript~ phagemids from the
67
....._.__. __ ~..",~.-~...,_~.___.-..-. ..~-._._
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Lambda ZAP II vector were subjected to mass excision and the libraries were
recovered as plasmids according to standard procedures.
Alternatively, the cDNA inserts in the CD4-13 (Lambda ZAP II vector)
were recovered by digestion with NotI. Digestion with Noti in most cases
S liberates the entire Arabidopsis thaliana cDNA insert because the original
library
was assembled with NotI adapters. NotI is an 8-base cutter that infrequently
cleaves plant DNA. In order to insert the NotI fragments into a transcription
plasmid, the pBS73S transcription plasmid (FIGURE 1S) was digested with
PacIlXhoI and ligated to an adapter DNA sequence created from the
oligonucleotides S'-TCGAGCGGCCGCAT-3' (SEQ ID NO: 41 ) and S'-
GCGGCCGC-3' (SEQ ID NO: 42). The resulting plasmid pBS740 (FIGURE 16)
contains a unique NotI restriction site for bidirectional insertion of NotI
fragments
from the CD4-13 library. Recovered colonies were prepared from these for
plasmid minipreps with a Qiagen BioRobot 9600~. The plasmid DNA preps
1 S performed on the BioRobot 9600~ are done in 96-well format and yield
transcription quality DNA. An Arabidopsis cDNA library was transformed into
the plasmid and analyzed by agarose gel electrophoresis to identify clones
with
inserts. Clones with inserts may be transcribed in vitro and inoculated onto
N.
benthamiana and/or Arabidopsis thaliana. Selected leaf disks from transfected
plants may be then taken for biochemical analysis.
EXAMPLE 14
Expression and targeting to the chloroplasts of a green fluorescent protein in
Arabidopsis thaliana via a recombinant viral nucleic acid vector
2S The gene encoding green fluorescent protein (GFP) was fused at the N-
terminus to the chloroplast transit peptide (CTP) sequence of RuBPCase to
create
plasmid pBS723 (FIGURE 17). Plasmid pBS723 was modified by PCR
mutagenesis to create a unique PacI site upstream of the ATG start codon of
the
CTP-GFP gene fission. The PCR amplification product obtained from plasmid
pBS723 was digested PacIlSalI and cloned into plasmid GFP-30B/clone 60 (also
digested with PacIlSalI) to create plasmid pBS731 (FIGURE 18). Plasmid
pBS731 was linearized at a unique KpnI restriction site and transcribed into
infectious RNA with T7 RNA polymerase according to standard procedures.
68
......,_..""""",,......... . ""...._,.._. ... ..,..~"~,"-,~""-
"~,.,n.,...._....... _T_...r.~_......... .....
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Infectious RNA transcripts that were inoculated onto Nicotiana benthamiana
plants showed systemic expression in the upper leaves of CTP-GFP within six
days. Plants infected with RNA transcripts from plasmid pBS731 were harvested
by grinding the leaves with a mortar and pestle to obtain recombinant visions
derived from pBS731 infectious RNA transcripts. Visions from pBS731 were
inoculated onto Arabidopsis thaliana leaves. The inoculated leaves of
Arabidopsis thaliana plants showed strong green fluorescence under UV light,
thus indicating successful expression of the CTP-GFP reporter gene.
EXAMPLE 15
Hid h throughput roboti~
Inoculation of subject organisms such as plants may be effected by using
means of high throughput robotics. For example, Arabidopsis thaliana were
grown in microtiter plates such as the standard 96-well and 384-well
microtiter
plates. A robotic handling arm then moved the plates containing the organism
to
a colony picker or other robot that may deliver inoculations to each plant in
the
well. By this procedure, inoculation was performed in a very high speed and
high
throughput manner. It is preferable in the case of plants that the organism be
a
germinating seed at least in the development cycle to enable access to the
cells to
be transfected. Equipment used for automated robotic production line could
include, but not be limited to, robots of these types: electronic multichannel
pipetmen, Qiagen BioRobot 9600~, Robbins Hydra liquid handler, Flexys
Colony Picker, New Brunswick automated plate pourer, GeneMachines HiGro
shaker incubator, New Brunswick floor shaker, three Qiagen BioRobots, MJ
Research PCR machines (PTC-200, Tetrad), ABI 377 sequences and Tecan
Genesis RSP200 liquid handler.
EXAMPLE 16
Genomic DNA library construction in a recombinant viral nucleic ~~cid vector
Genomic DNA represented in BAC (bacterial artificial chromosome) or
YAC (yeast artificial chromosome) libraries may be obtained from the
Arabidopsis Biological Resource Center (ABRC). The BAC/YAC DNA can be
mechanically size-fractionated, ligated to adapters with cohesive ends, and
69
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
shotgun-cloned into recombinant viral nucleic acid vectors. Alternatively,
mechanically size-fractionated genomic DNA can be blunt-end ligated into a
recombinant viral nucleic acid vector. Recovered colonies can be prepared for
plasmid minipreps with a Qiagen BioRobot 9600~. The plasmid DNA preps
done on the BioRobot 9600~ may be assembled in 96-well format and yield
transcription quality DNA. The recombinant viral nucleic acidlArabidopsis
genomic DNA library may be analyzed by agarose gel electrophoresis (template
quality control step) to identify clones with inserts. Clones with inserts can
then
be transcribed in vitro and inoculated onto N. benthamiana and/or Arabidopsis
thaliana. Selected leaf disks from transfected plants can then be taken for
biochemical analysis.
Genomic DNA from Arabidopsis typically contains a gene every 2.5 kb
(kilobases) on average. Genomic DNA fragments of 0.5 to 2.5 kb obtained by
random shearing of DNA were shotgun assembled in a recombinant viral nucleic
acid expression/knockout vector library. Given a genome size of Arabidopsis of
approximately 120,000 kb, a random recombinant viral nucleic acid genomic
DNA library would need to contain minimally 48,000 independent inserts of 2.5
kb in size to achieve 1X coverage of the Arabidopsis genome. Alternatively, a
random recombinant viral nucleic acid genomic DNA library would need to
contain minimally 240,000 independent inserts of 0.5 kb in size to achieve 1X
coverage of the Arabidopsis genome. Assembling recombinant viral nucleic acid
expression/knockout vector libraries from genomic DNA rather than cDNA has
the potential to overcome known difficulties encountered when attempting to
clone rare, low-abundance mRNA's in a cDNA library. A recombinant viral
nucleic acid expression/knockout vector library made with genomic DNA would
be especially useful as a gene silencing knockout library. In addition, the
DHSPES expression/knockout vector library made with genomic DNA would be
especially useful for expression of genes lacking introns. Furthermore, other
plant species with moderate to small genomes (e.g. rose, approximately 80,000
kb) would be especially useful for recombinant viral nucleic acid
expression/knockout vector libraries made with genomic DNA. A recombinant
viral nucleic acid expression/knockout vector library could be made from
existing BAC/YAC genomic DNA or from newly-prepared genomic DNA for
...w.~.~__... .._...~.~.~_.-.~_...____T__.~..._...~,.,..~..r.__
.._...~.~.,._.~~..
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
any plant species. Alternatively, a recombinant viral nucleic acid
expression/knockout vector library could be made with genomic DNA obtained
from yeast, bacteria, or animals including humans.
EXAMPLE 17
Genomic DNA or cDNA libra_rv constrgction in a DHSPES vector and
transfection of individual clones from said vector library onto T DNA tagged
or
transposon tagged or mutated l~
Genomic DNA or cDNA library construction in a recombinant viral
nucleic acid vector, and transfection of individual clones from the vector
library
onto T-DNA tagged or transposon tagged or mutated plants may be performed
according the procedure set forth in Example 16. Such a protocol may be easily
designed to complement mutations introduced by random insertional mutagenesis
of T-DNA sequences or transposon sequences.
EXAMPLE 18
Production of a malarial CTL a i~t gggenetically fused to the C terminus of
the
V P.
Malarial immunity induced in mice by irradiated sporozites of P. yoelii is
also dependent on CD8+ T lymphocytes. Clone B is one ocytotoxic T
lymphocyte (CTL) cell clone shown to recognize an epitope present in both the
P.
yoelii and P. berghei CS proteins. Clone B recognizes the following amino acid
sequence; SYVPSAEQILEFVKQISSQ (SEQ )D NO: 43) and when adoptively
transferred to mice protects against infection from both species of malaria
sporozoites. Construction of a genetically modified tobamovirus designed to
carry this malarial CTL epitope fused to the surface of virus particles is set
forth
herein.
Construction of plasmid pBGC289. A 0.5 kb fragment of pBGC 11 was
PCR amplified using the 5' primer TB2C1aI5' and the 3' primer C/-SAvrII. The
amplified product was cloned into the SmaI site of pBstKS+ (Stratagene Cloning
Systems) to form pBGC214.
71
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
PBGC215 was formed by cloning the 0.15 kb AccI-NsiI fragment of
pBGC214 into pBGC235. The 0.9 kb NcoI-KpnI fragment from pBGC215 was
cloned in pBGC152 to form pBGC216.
A 0.07 kb synthetic fragment was formed by annealing PYCS.2p with
PYCS.2m and the resulting double stranded fragment, encoding the P. yoelii CTL
malarial epitope, was cloned into the AvrII site of pBGC215 made blunt ended
by
treatment with mung bean nuclease and creating a unique AatII site, to form
pBGC262. A 0.03 kb synthetic AatII fragment was formed by annealing
TLS.lEXP with TLS.lEXM and the resulting double stranded fragment,
encoding the leaky-stop sequence and a stuffer sequence used to facilitate
cloning, was cloned into AatII digested pBGC262 to form pBGC263. PBGC262
was digested with AatII and ligated to itself removing the 0.02 kb stuffer
fragment to form pBGC264. The 1.0 kb NcoI-KpnI fragment of pBGC264 was
cloned into pSNC004 to form pBGC289.
The virus TMV289 produced by transcription of plasmid pBGC289 in
vitro contains a leaky stop signal resulting in the removal of four amino
acids
from the C terminus of the wild type TMV coat protein gene and is therefore
predicted to synthesize a truncated coat protein and coat protein with a CTL
epitope fused at the C terminus at a ratio of 20:1. The recombinant TMVCP/CTL
epitope fusion present in TMV289 is with the stop codon decoded as the amino
acid Y (amino acid residue 156). The amino acid sequence of the coat protein
of
virus TMV216 produced by transcription of the plasmid pBGC216 in vitro, is
truncated by four amino acids. The epitope SYVPSAEQILEFVKQISSQ (SEQ
1D NO: 43) is calculated to be present at approximately 0.5% of the weight of
the
virion using the same assumptions confirmed by quantitative ELISA analysis.
Propagation and purification of the epitope expression vector. Infectious
transcripts were synthesized from KpnI-linearized pBGC289 using T7 RNA
polymerase and cap (7mGpppG) according to the manufacturer (New England
Biolabs).
An increased quantity of recombinant virus was obtained by passaging
Sample m No. TMV289.11B1a. Fifteen tobacco plants were grown for 33 days
post inoculation accumulating 595 g fresh weight of harvested leaf biomass not
including the two lower inoculated leaves. Purified Sample ID No.
72
_ . ...~......~.. ~.. _ . ..._ __-__ _ _ .. ~ __._ _. _...~_.... .
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
TMV289.11B2 was recovered (383 mg) at a yield of 0.6 mg virion per gram of
fresh weight. Therefore, 3 g of 19-mer peptide was obtained per gram of fresh
weight extracted. Tobacco plants infected with TMV289 accumulated greater
than 1.4 micromoles of peptide per kilogram of leaf tissue.
Product analy~~s. Partial confirmation of the sequence of the- epitope coding
region of TMV289 was obtained by restriction digestion analysis of PCR
amplified cDNA using viral RNA isolated from Sample ID No. TMV289.11B2.
The presence of proteins in TMV289 with the predicted mobility of the cp
fusion
at 20 kD and the truncated cp at 17.1 kD was confirmed by denaturing
polyacrylamide gel electrophoresis.
EXAMPLE 19
Identification of nucleotide sequences involved in the reeulation
ofj~iant_grLowth
by cvtonlasmic inhibition of ene expression using viral derived RNA
Antisense RNA has been used to down regulate gene expression in
transgenic and transfected plants. The effectiveness of antisense on the
inhibition
of eukaryotic gene expression was first demonstrated by Izant et al. (Cell
36(4):1007-1015 (1984)). Since then, the down-regulation of numerous genes
from transgenic plants has been reported. In addition, there is evidence that
"co-
suppression" of genes occurs in transgenic plants containing sense RNA by
readthrough transcription from distal promoters located on the opposite strand
of
the DNA (Van der Krol et al., Plant Cell 2_(4):291-299 (1990) and Napoli et
al.,
Plant Cell 2_:279-289 ( 1990)).
In this example and examples 20 and 21, we show: ( 1 ) a novel method for
producing sense/antisense RNA using an RNA viral vector, (2) a process to
produce viral-derived sense/antisense RNA in the cytoplasm, (3) a process to
inhibit the expression of endogenous plant proteins in the cytoplasm by viral
antisense RNA, (4) a process to "co-suppress" the expression of endogenous
plant
proteins in the cytoplasm by viral RNA, and (5) a process to produce
transfected
plants containing viral antisense RNA which is much faster than the time
required
to obtain genetically engineered antisense transgenic plants. Systemic
infection
and expression of viral antisense RNA occurs as short as four days post
73
..n~~.w.-..-.-..w._ .~~w~.-.,__.a__.. _T_....~..~".~... ...-.-..,...,~___.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
inoculation, whereas it takes several months or longer to create a single
transgenic plant. This example demonstrates that novel positive strand viral
vectors, which replicate solely in the cytoplasm, can be used to identify
genes
involved in the regulation of plant growth by inhibiting the expression of
specific
endogenous genes. This example will enable one to characterize specific genes
and biochemical pathways in transfected plants using an RNA viral vector.
Tobamoviral vectors have been developed for the heterologous expression
of uncharacterized nucleotide sequences in transfected plants. A partial
Arabidopsis thaliana cDNA library was placed under the transcriptional control
of a tobamovirus subgenomic promoter in a RNA viral vector. Colonies from
transformed E. coli were automatically picked using a Flexys robot and
transferred to a 96 well flat bottom block containing terrific broth (TB) Amp
50
ug/ml. Approximately 2000 plasmid DNAs were isolated from overnight
cultures using a BioRobot and infectious RNAs from 430 independent clones
were directly applied to plants. One to two weeks after inoculation,
transfected
Nicotiana benthamiana plants were visually monitored for changes in growth
rates, morphology, and color. One set of plants transfected with 740 AT #120
were severely stunted. DNA sequence analysis revealed that this clone
contained
an Arabidopsis GTP binding protein open reading frame (ORF) in the antisense
orientation. This demonstrates that an episomal RNA viral vector can be used
to
deliberately manipulate a signal transduction pathway in plants. In addition,
our
results suggest that the Arabidopsis antisense transcript can turn off the
expression of the N. benthamiana gene.
Construction of an Arabidavsis thaliana cDNA library in an F.N~A viral vector
An Arabidopsis thaliana CD4-13 cDNA library was digested with NotI.
DNA fragments between 500 and 1000 by were isolated by trough elution and
subcloned into the NotI site of pBS740. E. toll C600 competent cells were
transformed with the pBS740 AT library and colonies containing Arabidopsis
cDNA sequences were selected on LB Amp 50 ug/ml. Recombinant C600 cells
were automatically picked using a Flexys robot and then transferred to a 96
well
flat bottom block containing terrific broth (TB) Amp 50 ug/ml. Approximately
2000 plasmid DNAs were isolated from overnight cultures using a BioRobot
74
CA 02318662 2000-07-14
WO 99/36516 PGT/US99/0116~t
(Qiagen) and infectious RNAs from 430 independent clones were directly applied
to plants.
I_~olation of a eene encodin~a GTP binding tein
One to two weeks after inoculation, transfected Nicotiana benthamiana
plants were visually monitored for changes in growth rates, morphology, and
color. Plants transfected with 740 AT #120 (FIGURE 19) were severely stunted.
DNA sequencing and computer anal sis
A 782 by NotI fragment of 740 AT #120 containing the ADP-ribosylation
factor (ARF) cDNA was characterized. DNA sequence of NotI fragment of 740
AT #120 (774 base pairs) is as follows: 5'-
CCGAAACATTCTTCGTAGTGAAGCAAAATGGGGTTGAGTTTCGCCAAG
CTGTTTAGCAGGCTTTTTGCCAAGAAGGAGATGCGAATTCTGATGGTT
GGTCTTGATGCTGCTGGTAAGACCACAATCTTGTACAAGCTCAAGCTC
GGAGAGATTGTCACCACCATCCCTACTATTGGTTTCAATGTGGAAACT
GTGGAATACAAGAACATTAGTTTCACCGTGTGGGATGTCGGGGGTCA
GGACAAGATCCGTCCCTTGTGAGACACTACTTCCAGAACACTCAAGGT
CTAATCTTTGTTGTTGATAGCAATGACAGAGACAGAGTTGTTGAGGCT
CGAGATGAACTCCACAGGATGCTGAATGAGGACGAGCTGCGTGATGC
TGTGTTGCTTGTGTTTGCCAACAAGCAAGATCTTCCAAATGCTATGAA
CGCTGCTGAAATCACAGATAAGCTTGGCCTTCACTCCCTCCGTCAGCG
TCATTGGTATATCCAGAGCACATGTGCCACTTCAGGTGAAGGGCTTTA
TGAAGGTCTGGACTGGCTCTCCAACAACATCGCTGGCAAGGCATGAT
GAGGGAGAAATTGCGTTGCATCGAGATGATTCTGTCTGCTGTGTTGGG
ATCTCTCTCTGTCTTGATGCAAGAGAGATTATAAATATTATCTGAACC
TTTTTGCTTTTTTGGGTATGTGAATGTTTCTTATTGTGCAAGTAGATGG
TCTTGTACCTAAAAATTTACTAGAAGAACCCTTTTAAATAGCTTTCGT
GTATTGT-3' (SEQ ID NO: 44)
The nucleotide sequencing of 740 AT #120 was carried out by dideoxy
termination using double stranded templates (Sanger et al., Proc. Natl. Acad.
Sci.
USA 74(12):5463-5467 (1977)). Nucleotide sequence analysis and amino acid
sequence comparisons were performed using DNA Strider, PCGENE and NCBI
...-. ~... T_ _. ~ _ . __ ~......,
r .~,. ... -~ _.. _
CA 02318662 2000-07-14
WO 99/36516 PC"T/US99/01164
Blast programs. The nucleotide sequence from 740 AT #120 was compared the
human ADP-ribosylation factor (ARF3) W3384 (FIGURE 20).
Isolation of a cDNA encoding Nicotiana benthamiana P ribosylation factor
Partial cDNAs from Nicotiana benthamiana leaf RNA may be isolated by
polymerase chain reaction (PCR) using the following oligonucleotides:
ATARFM1X, 5'-GCC TCG AGT GCA GCA TGG GGT TGT CAT TCG GAA
AGT TGT TC-3' (upstream) (SEQ ID NO: 45) and ATARFA181A, S'-TAC CTA
GGC CTT GCT TGC GAT GTT GTT GGA GAG-3' (downstream) (SEQ ID NO:
46). A full-length cDNA encoding ARF may be isolated by screening a cDNA
library by colony hybridization using a'ZP labeled Arabidopsis thaliana ARF
PCR product. Hybridization can be carned out at 42°C for 48h in
50%
formamide, SX SSC, 0.02M phosphate buffer, SX Denhart's solution, and 0.1
mg/ml sheared calf thymus DNA. Filters may be washed at 65°C in O.1X
SSC
and 0.1% SDS, prior to autoradiography. PCR products and the ARF cDNA
clones may be verified by dideoxynucleotide sequencing.
EXAMPLE 20
Identification of nucleotide sequences involved in the regulation of plant
development by cvtonlasmic inhibition of gene expression using viral derived
RNA.
This example again demonstrates that an episomal RNA viral vector can
be used to deliberately manipulate a signal transduction pathway in plants. In
addition, our results suggest that the Arabidopsis antisense transcript can
turn off
the expression of the N. benthamiana gene.
A partial Arabidopsis thaliana cDNA library was placed under the
transcriptional control of a tobamovirus subgenomic promoter in a RNA viral
vector. Colonies from transformed E. toll were automatically picked using a
Flexys robot and transferred to a 96 well flat bottom block containing
terrific
broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DNAs were isolated
from overnight cultures using a BioRobot and infectious RNAs from 430
independent clones were directly applied to plants. One to two weeks after
inoculation, transfected Nicotiana benthamiana plants were visually monitored
76
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/OI164
for changes in growth rates, morphology, and color. One set of plants
transfected
with 740 AT #88 developed a white phenotype on the infected leaf tissue. DNA
sequence analysis revealed that this clone contained an Arabidopsis G-protein
coupled receptor open reading frame (ORF) in the antisense orientation.
Construction of an Arabidopctc thaliana cDNA library in an RNA viral vector
An Arabidopsis thaliana CD4-13 cDNA library was digested with NotI.
DNA fragments between 500 and 1000 by were isolated by trough elution and
subcloned into the NotI site of pBS740. E. coli C600 competent cells were
transformed with the pBS740 AT library and colonies containing Arabidopsis
cDNA sequences were selected on LB Amp SO ug/ml. Recombinant C600 cells
were automatically picked using a Flexys robot and then transferred to a 96
well
flat bottom block containing terrific broth (TB) Amp 50 ug/ml. Approximately
2000 plasmid DNAs were isolated from overnight cultures using a BioRobot
1 S (Qiagen) and infectious RNAs from 430 independent clones were directly
applied
to plants.
Isolation of a eene encoding a CT-,protein coupled recd or
One to two weeks after inoculation, transfected Nicotiana benthamiana plants
were visually monitored for changes in growth rates, morphology, and color.
Plants transfected with 740 AT #88 (FIGURE 21) developed a white phenotype
on the infected leaf tissue.
DNA seauencin and computer analysis
A 750 by NotI fragment of 740 AT #88 containing the G-protein coupled
receptor cDNA was characterized. DNA sequence of NotI fragment of 740 AT
#88 (750 bp) is as follows: 5'-
TTTCGATCTAAGGTTCGTGATCTCCTTCTTCTCTACGAAGTTTACACTT
TTTCTTCAAAGGAAACAATGAGCCAGTACAATCAACCTCCCGTTGGTG
TTCCTCCTCCTCAAGGTTATCCACCGGAGGGATATCCAAAAGATGCTT
ATCCACCACAAGGATATCCTCCTCAGGGATATCCTCAGCAAGGCTATC
CACCTCAGGGATATCCTCAACAAGGTTATCCTCAGCAAGGATATCCTC
CACCGTACGCGCCTCAATATCCTCCACCACCGCAAGCATCAGCAACA
77
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
ACAGAGCAAGTCCTGGCTTTCTAGAAGGATGTCTTGCTGCTCTGTGTT
GTTGCTGTCTCTTGGATGCTTGCTTCTGATTGGAGTCTCTCTCTCTCTG
CATAAAGCTTCGGGATTTATTTGTAAGAGGGTTTTTGGGTTAAACAAA
AACCTTAATTGATTTGTGGGGCATTAAAAATGAATCTCTCGATGATTC
TCTTCGTTTATGTGGTAATGTTCTTCGGTTATAACATTTAACATTGCTA
TCGACGTTCTGCCTAGTTGGATTTGATTATTGGGAATGTAAATTGGTT
GGGAAGACACCGGGCCGTTAATGACAGAACCCGAACTGAGATGGAGT
ATGATCTGAAATATTTAAAACAATCCTCGCGACATAGCCTCCAATCTC
ATCGTAAATATTCTTTTTAAACTATTCCCAATCTTAACTTTTATAGTCT
GGTCGACTGACCACTACTCTTTTTCCTT-3' (SEQ ID NO: 47) The
nucleotide sequencing of 740 AT #88 was carried out by dideoxy termination
using double stranded templates (Sanger et al., Proc. Natl. Acad. Sci. USA
74(12):5463-5467 (1977)). Nucleotide sequence analysis and amino acid
sequence comparisons were performed using DNA Strider, PCGENE and NCBI
1 S Blast programs. The nucleotide sequence from 740 AT #88 was compared to
Brassica rapa cDNA L33574 (FIGURE 22), the octopus rhodopsin mRNA
X07797 (FIGURE 23). The amino acid sequence derived from 740 AT #88 was
compared to an Arabidopsis EST ORF ATTS2938 (FIGURE 24) and octopus
rhodopsin P31356 (FIGURE 25).
EXAMPLE 21
Identification of nucleotide ce~uences involved in the resulation of l~~t
growth
by cvtovlasmic inhibition of ene expressi-on using viral derived RNA.
Antisense RNA has been used to down regulate gene expression in
transgenic and transfected plants. The purpose of this example is again to
demonstrate that novel positive strand viral vectors, which replicate solely
in the
cytoplasm, can be used to identify genes involved in the regulation of plant
growth by inhibiting the expression of specific endogenous genes. This example
will enable one to characterize specific genes and biochemical pathways in
transfected plants using an RNA viral vector.
The protocols of this example are analogous to those of examples 19 and
20. Tobamoviral vectors have been developed for the heterologous expression of
uncharacterized nucleotide sequences in transfected plants. A partial
Arabidopsis
78
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
thaliana cDNA library was placed under the transcriptional control of a
tobamovirus subgenomic promoter in a RNA viral vector. Colonies from
transformed E. coli were automatically picked using a Flexys robot and
transfered
to a 96 well flat bottom block containing terrific broth (TB) Amp 50 ug/ml.
Approximately 2000 plasmid DNAs were isolated from overnight cultures using
a BioRobot and infectious RNAs from 430 independent clones were directly
applied to plants. One to two weeks after inoculation, transfected Nicotiana
benthamiana plants were visually monitored for changes in growth rates,
morphology, and color. One set of plants transfected with 740 AT #2441
developed white leaves and were severely stunted. DNA sequence analysis
revealed that this clone contained an Arabidopsis GTP binding protein open
reading frame (ORF) in the positive orientation. This demonstrates that an
episomal RNA viral vector can be used to deliberately manipulate a signal
transduction pathway in plants.
Construction of a_n Arabidopsis thaliana cDNA library in an RNA viral vector.
An Arabidopsis thaliana CD4-13 cDNA library was digested with NotI. DNA
fragments between S00 and 1000 by were isolated by trough elution and
subcloned into the NotI site of pBS740. E. coli C600 competent cells were
transformed with the pBS740 AT library and colonies containing Arabidopsis
cDNA sequences were selected on LB Amp 50 ug/ml. Recombinant C600 cells
were automatically picked using a Flexys robot and then transfered to a 96
well
flat bottom block containing terrific broth (TB) ~p 50 ug/ml. Approximately
2000 plasmid DNAs were isolated from overnight cultures using a BioRobot
(Qiagen) and infectious RNAs from 430 independent clones were directly applied
to plants.
Isolation of a eene encoding a GTP bindine protein One to two weeks after
inoculation, transfected Nicotiana benthamiana plants were visually monitored
for changes in growth rates, morphology, and color. Plants transfected with
740
AT #2441 developed white leaves and were severely stunted.
79
.,_..,.,..,.~.,.,.~.._.~....r....__..
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
DNA seauencinQ and computer analysis. A NotI fragment of 740 AT #2441
containing the RAN GTP binding protein ORF cDNA was characterized. DNA
sequence of NotI fragment of 740 AT #2441 (350 bp) is as follows: 5'-
CTTCACTTTCGCCGATGGCTCTACCTAACCAGCAAACCGTGGATTACC
CTAGCTTCAAGCTCGTTATCGTTGGCGATGGAGGCACAGGGAAGACC
ACATTTGTAAAGAGACATCTTACTGGAGAGTTTGAGAAGAAGTATGA
ACCCACTATTGGTGTTGAGGTTCATCCTCTTGATTTCTTCACTAACTGT
GGCAAGATCCGTTTCTACTGTTGGGATACTGCTGGCCAAGAGA.AATTT
GGTGGTCTTAGGGATGGTTACTACATCCATGGACAATGTGCTATCATC
ATGTTTGATGTCACAAGCACGACTGACATACAAGAATGTTCCAACATG
GCACCGTGATCTTTG-3' (SEQ ID NO. 48)
The nucleotide sequencing of 740 AT #2441 was carried out by dideoxy
termination using double stranded templates (Sanger et al., Proc. Natl. Acaa:
Sci.
USA 74(12):5463-5467 (1977)). Nucleotide sequence analysis and amino acid
sequence comparisons were performed using DNA Strider, PCGENE and NCBI
Blast programs. The nucleotide sequence from 740 AT #2441 was compared to
tobacco RAN-B 1 GTP binding protein (FIGURE 26). The nucleotide sequence
from 740 AT #2441 was compared to human RAN GTP-binding protein
(FIGURE 27).
EXAMPLE 22
Gene silencinQ/co-sunression of Qenes induced by delivering an RNA capable of
base nairine with itself to form double stranded re ions
Gene silencing has been used to down regulate gene expression in
transgenic plants. Recent experimental evidence suggests that double stranded
RNA may be an effective stimulator of gene silencing/co-suppression
phenomenon in transgenic plant. For example, Waterhouse et al. (Proc. Natl.
Acad. Sci. USA X5:13959-13964 (1998), incorporated herein by reference)
described that virus resistance and gene silencing in plants could be induced
by
simultaneous expression of sense and antisense RNA. Gene silencing/co-
suppression of plant genes may be induced by delivering an RNA capable of base
pairing with itself to form double stranded regions.
.~_. ~.,~ _
_W_ .. _r_~__,
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
This example shows: (1) a novel method for generating an RNA virus
vector capable of producing an RNA capable of forming double stranded regions,
and (2) a process to silence plant genes by using such a viral vector.
Step 1: Construction of a DNA sequence which after it is transcribed
would generate an RNA molecule capable of base pairing with itself. Two
identical, or nearly identical, ds DNA sequences can be ligated together in an
inverted orientation to each other (i.e., in either a head to tail or tail to
head
orientation) with or without a linking nucleotide sequence between the
homologous sequences. The resulting DNA sequence can then be cloned into a
cDNA copy of a plant viral vector genome.
Step 2: Cloning, screening, transcription of clones of interest using known
methods in the art.
Step 3: Infect plant cells with transcripts from clones.
As virus expresses foreign gene sequence, RNA from foreign gene will
1 S base pair upon itself, forming double-stranded RNA regions. This approach
could be used with any plant or non-plant gene and used to silence plant gene
homologous to assist in identification of the function of a particular gene
sequence.
EXAMPLE 23
Preparation of a Non-Infective Eastern Equine Encenhalomvelitis Virus
Nucleotide Sequence.
Methods for genetic manipulation of Eastern Equine Encephalomyelitis
Virus are described in Garoff et al., Curr. Opin. Biotechnol. 9(5):464-9
(1998);
Pushko et al., Virology x(2):389-401 (1997); and Davis et al., J. Virol.
70(6):3781-7 (1996), all of which are incorporated herein by reference. A full-
length cDNA copy of the Eastern Equine Encephalomyelitis Virus (EEEV)
genome is prepared and inserted into the PstI site of pUCl8 as described by
Chang et al., J. Gen. Virol. 68:2129 ( 1987). The sequence for the viral coat
protein and its adjacent E1 and E2 glycoprotein transmissibility factors are
located on the region corresponding to the 26S RNA region. The vector
containing the cDNA copy of the EEEV genome is digested with the appropriate
81
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
restriction enzymes and exonucleases to delete the coding sequence of the coat
protein and the EI and E2 proteins {structural protein coding sequence).
For example, the structural protein coding sequence is removed by partial
digestion with MboI, followed by religation to remove a vital portion of the
structural gene. Alternatively, the vector is cut at the 3'-end of the viral
structural
gene. The viral DNA is sequentially removed by digestion with Ba131 or
Micrococcal S 1 nuclease up through the start codon of the structural protein
sequence. The DNA sequence containing the sequence of the viral 3'-tail is
then
ligated to the remaining 5'-end. The deletion of the coding sequence for the
structural proteins is confirmed by isolating EEEV RNA and using it to infect
an
equine cell culture. The isolated EEEV RNA is found to be non-infective under
natural conditions.
Alternatively, only the coding sequence for the coat protein is deleted and
the sequence for the E1 and E2 glycoproteins remain in the vector containing
the
cDNA copy of the EEEV genome. In this case, the coat protein coding sequence
is removed by partial digestion with MboI followed by religation to reattach
the
3'-tail of the virus. This will remove a vital portion of the coat protein
gene.
A second alternative method for removing only the coat protein sequence
is to cut the vector at the 3'-end of the viral coat protein gene. The viral
DNA is
removed by digestion with Bal31 or Micrococcal S 1 nuclease up through the
start
codon of the coat protein sequence. The synthetic DNA sequence containing the
sequence of the 3'-tail is then ligated to the remaining 5'-end.
The deletion of the coding sequence for the coat protein is confirmed by
isolating EEEV RNA and using it to infect an equine cell culture. The isolated
EEEV RNA is found to be non-infective under natural conditions.
EXAMPLE 24
Preparation of a Non-Transmissible Sindbis Virus Nucleotide S uence
Methods for genetic manipulation of Sindbis viruses are described in
Garoff et al., Curr. Opin. Biotechnol. x(5):464-9 (1998); Agapov et al., Proc.
Natl. Acad. Sci. LISA X5(22):12989-94 (1998); Frolov et al., J. Yirol.
Apr;71{4):2819-29 (1997), all of which are incorporated herein by reference. A
full-length cDNA copy of the Sindbis virus genome is prepared and inserted
into
82
.._
_...~,.~....w . .
CA 02318662 2000-07-14
WO 99/36516 PC1'/US99/01164
the SmaI site of a plasmid derived from pBR322 as described by Lindquist et
al.,
Virology 1:10 (1986). The sequence for the viral coat protein and the adjacent
E1 and E2 glycoprotein transmissibility factors are located on the region
corresponding to the 26S RNA region. The vector containing the cDNA copy of
the Sindbis virus genome is digested with the appropriate restriction enzymes
and
exonucleases to delete the coding sequence for the structural proteins.
For example, the structural protein coding sequence is removed by partial
digestion with BinI, followed by religation to remove a vital portion of the
structural gene. Alternatively, the vector is cut at the 3'-end of the viral
nucleic
acid. The viral DNA is removed by digestion with Bal31 or Micrococcal S 1
nuclease up through the start codon of the structural protein sequence. The
synthetic DNA sequence containing the sequence of the viral 3'-tail is then
ligated to the remaining 5'-end. The deletion of the coding sequence for the
structural proteins is confirmed by isolating Sindbis RNA and using it to
infect an
avian cell culture. The isolated Sindbis RNA is found to be non-infective
under
natural conditions.
Alternatively only the coding sequence for the coat protein is deleted and
the sequence for the E1 and E2 glycoproteins remain in the vector containing
the
cDNA copy of the Sindbis genome. In this case, the coat protein coding
sequence is removed by partial digestion with AfIII followed by religation to
reattach the 3'-tail of the virus.
A second alternative method for removing only the coat protein sequence
is to cut the vector at the 3'-end of the viral nucleic acid. The viral DNA is
removed by digestion with Bal31 or Micrococcal S 1 nuclease up through the
start
codon of the coat protein sequence (the same start codon as for the sequence
for
all the structural proteins). The synthetic DNA sequence containing the
sequence
of the 3'-tail is then ligated to the remaining 5'-end.
The deletion of the coding sequence for the coat protein is confirmed by
isolating Sindbis RNA and using it to infect an avian cell culture. The
isolated
Sindbis RNA is found to be non-infective under natural conditions.
83
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
EXAMPLE 25
Preparation of a Non-Transmissible Western Eauine Enc hep alomvelitis Virus
Nucleotide Seguence.
Methods for genetic manipulation of Western Equine Encephalomyelitis
Virus are described in Garoff et al., Curr. Opin. Biotechnol. 9_(5):464-9
(1998)
and Weaver et al., J. Virol. 71 (1 ):613-23 ( 1997), both of which are
incorporated
herein by reference. A full-length cDNA copy of the Western Equine
Encephalomyelitis Virus (WEEV) genome is prepared as described by Hahn et
al., Proc. Natl. Acad. Sci. USA x:5997 (1988). The sequence for the viral coat
protein and its adjacent E1 and E2 glycoprotein transmissibility factors are
located on the region corresponding to the 265 RNA region. The vector
containing the cDNA copy of the WEEV genome is digested with the appropriate
restriction enzymes and exonucleases to delete the coding sequence of the coat
protein and the E 1 and E2 proteins (structural protein coding sequence).
For example, the structural protein coding sequence is removed by partial
digestion with NacI, followed by religation to remove a vital portion of the
structural protein sequence. Alternatively, the vector is cut at the 3'-end of
the
structural protein DNA sequence. The viral DNA is removed by digestion with
Bal31 or Micrococcal S 1 nuclease up through the start codon of the structural
protein sequence. The DNA sequence of the viral 3'-tail is then ligated to the
remaining 5'-end. The deletion of the coding sequence for the structural
proteins
is confirmed by isolating WEEV RNA and using it to infect a Vero cell culture.
The isolated WEEV RNA is found to be non-infective under natural conditions.
Alternatively, only the coding sequence for the coat protein is deleted and
the sequence for the E1 and E2 glycoproteins remain in the vector containing
the
cDNA copy of the WEEV genome. In this case, the coat protein coding sequence
is removed by partial digestion with HgiAI followed by religation to reattach
the
3'-tail of the virus.
A second alternative method for removing only the coat protein sequence
is to cut the vector at the 3'-end of the viral coat protein sequence. The
viral
DNA is removed by digestion with Bal31 or Micrococcal S 1 nuclease up through
the a vital portion of the coat protein sequence. The DNA sequence containing
the sequence of the 3'-tail is then ligated to the remaining 5'-end.
84
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
The deletion of the coding sequence for the coat protein is confirmed by
isolating WEEV RNA and using it to infect a Vero cell culture. The isolated
WEEV RNA is found to be non-infective, i.e., biologically contained, under
natural conditions.
EXAMPLE 26
Preparation of a Non-Lnfective Simian Virus 40 Nucleotide Sequence
Methods for genetic manipulation of Simian viruses are described in
Piechaczek et al., Nucleic Acids Res. 27(2):426-428 (1999) and Chittenden et
al.,
J. Yirol. 65(11):5944-51 (1991), both of which are incorporated herein by
reference. A full-length cDNA copy of the Simian virus 40 (SV40) genome is
prepared, and inserted into the A~cI site of plasmid pCWl8 as described by
Wychowski et al., J. Virol. 61:3862 (1987). The nucleotide sequence of the
viral
coat protein VPl is located between position 1488 and 2574 of the genome. The
vector containing the DNA copy of the SV40 genome is digested with the
appropriate restriction enzymes and exonucleases to delete the coat protein
coding sequence.
For example, the VP 1 coat protein coding sequence is removed by partial
digestion with BamHI nuclease, and then treated with EcoRI, filled in with
Klenow enzyme and recircularized. The deletion of the coding sequence for the
coat protein VP1 is confirmed by isolating SV40 RNA and using it to infect
simian cell cultures. The isolated SV40 RNA is found to be non-infective,
i.e.,
biologically contained, under natural conditions.
EXAMPLE 27
Novel reguirements for,production of infectious viral vector in vitro derived
RNA
transcripts.
This example demonstrates the production of highly infectious viral
vector transcripts containing S' nucleotides with reference to the virus
vector.
Construction of a library of subgenomic cDNA clones of TMV and BMV
has been described in Dawson et al., Proc. Natl. Acad Sci. USA 8_x:1832-1836
(1986) and Ahlquist et al., Proc. Natl. Acad Sci. USA $x:7066-7070 (1984).
Nucleotides were added between the transcriptional start site of the promoter
for
.. .. ......__",_. _........ ............~" ",. .. ..... r. _....__""-".. ..
CA 02318662 2000-07-14
WO 99/36516 PCT/US99101164
in vitro transcription, in this case T7, and the start of the cDNA of TMV in
order
to maximize transcription product yield and possibly obviate the need to cap
virus
transcripts to insure infectivity. The relevant sequence is the T7 promoter
...TATAG~TATTTT.... where the ~ indicates the base preceding is the start site
for transcription and the bold letter is the first base of the TMV cDNA. Three
approaches were taken: 1 ) addition of G, GG or GGG between the start site of
transcription and the TMV cDNA ( ... TATAGGTATTT... and associated
sequences); 2) addition of G and a random base (GN or N2) or a G and two
random bases (GNN or N3) between the start site of transcription and the TMV
cDNA (...TATAGNTATTT... and associated sequences), and the addition of a
GT and a single random base between the start site of transcription and the
TMV
cDNA (...TATAGTNGTATTT... and associated sequences). The use of random
bases was based on the hypothesis that a particular base may be best suited
for an
additional nucleotide attached to the cDNA, since it will be complementary to
the
normal nontemplated base incorporated at the 3'-end of the TMV {-) strand RNA.
This allows for more ready mis-initiation and restoration of wild type
sequence.
The GTN would allow the mimicking of two potential sites for initiation, the
added and the native sequence, and facilitate more ready mis-initiation of
transcription in vivo to restore the native TMV cDNA sequence. Approaches
included cloning GFP expressing TMV vector sequences into vectors containing
extra G, GG or GGG bases using standard molecular biology techniques.
Likewise, full length PCR of TMV expression clone 1056 was done to add N2,
N3 and GTN bases between the T7 promoter and the TMV cDNA. Subsequently,
these PCR products were cloned into pUC based vectors. Capped and uncapped
transcripts were made in vitro and inoculated to tobacco protoplasts or
Nicotiana
benthamiana plants, wild type and 30k expressing transgenics. The results are
that an extra G, ... TATAGGTATTTT..., or a GTC, ... TATAGTCGTATTTT...,
were found to be well tolerated as additional S' nucleotides on the 5' of TMV
vector RNA transcripts and were quite infectious on both plant types and
protoplasts as capped or non-capped transcripts. Other sequences may be
screened to find other options. Clearly, infectious transcripts may be derived
with extra 5' nucleotides.
86
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Other derivatives based on the putative mechanistic function of the GTN
strategy that yielded the GTC functional vector are to use multiple GTN motifs
preceeding the 5' most nt of the virus cDNA or the duplication of larger
regions
of the 5'-end of the TMV genome. For example: TATA~GTNGTNGTATT... or
TATA~GTNGTNGTNGTNGTATT.... or TATA~GTATTTGTATTT... . In this
manner the replication mediated repair mechanism may be potentiated by the use
of multiple recognition sequences at the 5'-end of transcribed RNA. The
replicated progeny may exhibit the results of reversion events that would
yield
the wild type virus S' virus sequence, but may include portions or entire sets
of
introduced additional base sequences. This strategy can be applied to a range
of
RNA viruses or RNA viral vectors of various genetic arrangements derived from
wild type virus genome. This would require the use of sequences particular to
that of the virus used as a vector.
EXAMPLE 28
Infectivity of uncapped transcripts
Two TMV-based virus expression vectors were initially used in these
studies pBTI 1056 which contains the T7 promoter followed directly by the
virus
cDNA sequence (...TATAGTATT...), and pBTI SBS60-29 which contains the
T7 promoter (underlined) followed by an extra guanine residue then the virus
cDNA sequence (...TATAGGTATT...). Both expression vectors express the
cycle 3 shuffled green fluorescent protein (GFPc3) in localized infection
sites and
systemically infected tissue of infected plants. Transcriptions of each
plasmid
were carried out in the absence of cap analogue (uncapped) or in the presence
of
8-fold greater concentration of RNA cap analogue than rGTP (capped).
Transcriptions were mixed with abrasive and inoculated on expanded older
leaves
of a wild type Nicotiana benthamiana (Nb) plant and a Nb plant expressing a
TMV Ul 30k movement protein transgene (Nb 30K). Four days post inoculation
(dpi) long wave W light was used to judge the number of infection sites on the
inoculated leaves of the plants. Systemic, noninoculated tissues, were
monitored
from 4 dpi on for appearance of systemic infection indicating vascular
movement
of the inoculated virus. Table 1 shows data from one representative
experiment.
87
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
T 1
Construct Local 'nf ction sites Systemic Infection
Nb Nb 30K Nb Nb 30K
pBTI1056
Capped 5 6 yes yes
Uncapped 0 5 no yes
PBTI SBS60-29
Capped 6 6
Unca ed 1 5 Y yes
pp yes yes
Nicotiana tabacum protoplasts were infected with either capped or
uncapped transcriptions (as described above) of pBTI SBS60 which contains the
T7 promoter followed directly by the virus cDNA sequence TATAGTATT...).
This expression vector also expresses the GFPc3 gene in infected cells and
tissues. Nicotiana tabacum protoplasts were transfected with 1 mcl of each
transcriptions. Approximately 36 hours post infection transfected protoplasts
were viewed under UV illumination and cells showing GFPc3 expression.
Approximately 80% cells transfected with the capped PBTI SBS60 transcripts
showed GFP expression while 5% of cells transfected with uncapped transcripts
showed GFP expression. These experiments were repeated with higher amounts
of uncapped inoculum. In this case a higher proportion of cells, >30% were
found to be infected at this time with uncapped transcripts, where >90% of
cells
infected with greater amounts of capped transcripts were scored infected.
These results indicate that, contrary to the practiced art in scientific
literature and in issued patents (Ahlquist et al., U.S. Patent No. 5,466,788),
uncapped transcripts for virus expression vectors are infective on both plants
and
in plant cells, however with much lower specific infectivity. Therefore,
capping
is not a prerequisite for establishing an infection of a virus expression
vector in
plants; capping just increases the efficiency of infection. This reduced
efficiency
can be overcome, to some extent, by providing excess in vitro transcription
product in an infection reaction for plants or plant cells.
The expression of the 30K movement protein of TMV in transgenic plants
also has the unexpected effect of equalizing the relative specific infectivity
of
uncapped verses capped transcripts. The mechanism behind this effect is not
88
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
fully understood, but could arise from the RNA binding activity of the
movement
protein stabilizing the uncapped transcript in infected cells from
prereplication
cytosolic degradation.
Extra guanine residues located between the T7 promoter and the first base
of a virus cDNA lead to increased amount of RNA transcript as predicted by
previous work with phage polymerases. These polymerases tend to initiate more
efficiently at ... TATAGG or ...TATAGGG than ...TATAG. This has an indirect
effect on the relative infectivity of uncapped transcripts in that greater
amounts
are synthesized per reaction resulting in enhanced infectivity.
Data concerning cap dependent transcription ofpBTi1056 GTN#28
TMV-based virus expression vector pBTI 1056 GTN#28 which contains
the T7 promoter (underlined) followed GTC bases (bold) then the virus cDNA
sequence (...TATAGTCGTATT...). This expression vector expresses the cycle 3
shuffled green fluorescent protein (GFPc3) in localized infection sites and
systemically infected tissue of infected plants. This vector was transcribed
in
vitro in the presence (capped) and absence (uncapped) of cap analogue.
Transcriptions were mixed with abrasive and inoculated on expanded older
leaves
of a wild type Nicotiana benthamiana (Nb) plant and a Nb plant expressing a
TMV U1 30k movement protein transgene (Nb 30K). Four days post inoculation
(dpi) long wave UV light was used to judge the number of infection sites on
the
inoculated leaves of the plants. Systemic, non-inoculated tissues, were
monitored from 4 dpi on for appearance of systemic infection indicating
vascular
movement of the inoculated virus. Table 2 shows data from two representative
experiments at 11 dpi.
Table 2
Construct Local infection sites Systemic Infection
- ~ ~ 30K Nb Nb
(~
Experiment 1
pBTI1056 GTN#28
Capped 18 25 yes yes
Uncapped 2 4 yes yes
89
....._..~M~.._. _.~...._.~...._w.__ _._..~_.____~...._. ..~..._.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Experiment 2
pBTI1056 GTN#28
Capped 8 12 yes yes
Uncapped 3 7 yes yes
These data further support the claims concerning the utility of uncapped
transcripts to initiate infections by plant virus expression vectors and
further
demonstrates that the introduction of extra, non-viral nucleotides at the 5'-
end of
in vitro transcripts does not preclude infectivity of uncapped transcripts.
EXAMPLE 29
Methods for inhibiting endogenous r~oteolytic activity in plants in vivo.
Elicitor recognition and the response cascades occurring in plants form an
essential link between the environmental stress and plant survival responses.
Many products are induced following induction by environmental stimuli or
pathogen infection, which include, but are not limited to, proteases, protease
inhibitors, alkaloids and other metabolites. Glazebrook, et al., Annu. Rev.
Gen.
x:547-569 (1997); Grahm, et al., J. Biol. Chem. x:6555-6560 (1985); and
Ryan, et al., Ann. Rev. Cell Dev. Biol. ~:1-17 (1998), all incorporated herein
by
reference. The components of the recognition and response pathways are poorly
understood, yet have tremendous practical value for input traits in
genetically
improved crops. Traditional methods of mutagenesis or biochemistry are leading
to slow and incremental advances in our understanding. However, if these
pathways are to be elucidated, understood and exploited, more rapid discovery
methods must be brought to bear on the problem. Virus expression vectors
capable of either overexpressing gene products or suppressing the expression
of
particular endogenous host genes provide a unique tool to discover the nature
of
the genes whose products contribute to the response pathways.
This example describes methods for inhibiting endogenous plant proteases
which interfere with the expression and purification of recombinant proteins
in
plants. In particular, this example shows methods for inhibiting proteolytic
activity in planta which is responsible for the degradation of a viral vector-
expressed recombinant protein. These methods are also applicable to the
protection of recombinant proteins expressed via a stable transformation
system
or endogenous plant proteins.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Viral vectors have been constructed to include an N-terminal signal peptide
sequence. This sequence directs the recombinant protein through the secretory
pathway to the cell surface and ultimately accumulating in the plant
intercellular
fluid (IF) (Kermode, Critical Reviews in Plant Sciences 15(4):285-423 (1996),
incorporated herein by reference). In some instances, the target protein was
cleaved aberrantly in vivo. Three examples include a mammalian growth
hormone and single chain antibody and an avian interferon. In vivo residence
time in the IF led to the accumulation of the cleavage products) as detected
by
immunoblotting. Cleavage was either complete in vivo or continued in vitro
following IF extraction (Co-pending U.S. Patent Application Serial No.
09/037,751, incorporated herein by reference). Quantitation of western blots
using UVP Gelbase/Geiblot-Pro software revealed as much as 40-50% of the
expressed protein was cleaved.
We designed in vitro experiments to inhibit the plant proteolytic activity.
When we added protease inhibitors to an isolated IF fraction in vitro, we were
able to inhibit further degradation of our recombinant protein. In addition,
when
we treated an IF fraction from an unrelated virally infected plant with
protease
inhibitors and incubated that with a known susceptible protein, we completely
inhibited the protease and protected the protein from degradation.
Following the observation that the cleavage was occunring in vivo by a
plant protease that could be inhibited by proteinase inhibitors, we designed
experiments to inhibit this activity in planta. Three possible methods to
inhibit
the protease are as follows:
1. Recombinant expression of aproteinase inhibitor
The activity of the plant protease may be inhibited by the recombinant
expression of a plant proteinase inhibitor secreted to the IF based on the
following results:
(1) We cloned a tomato proteinase inhibitor gene (Wingate, et al., J. Biol.
Chem.
,24:17734-17738 (1989), incorporated herein by reference) into our viral
vector.
We verified that the expression of the recombinant inhibitor protein was in
the IF
fraction by western detection. Virally-expressed proteinase inhibitor
protected
our recombinant (E. coli-derived) mammalian growth hormone protein standard
that was known to be susceptible to the plant protease in an in vitro assay;
91
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
(2) Virally-expressed proteinase inhibitor specifically inhibited an IF-
localized
protease in vivo as per detection on Zymogram gelatin Tris-glycine gels; and
(3) Co-inoculation of the virus vector proteinase inhibitor construct and the
viral
vector mammalian growth hormone construct resulted in the expression of both
proteins in systemic leaves and partial protection of the growth hormone in
the
IF.
Another possible approach is to combine transgenic plants and virally-
expressed proteins. One could either inoculate the virus vector proteinase
inhibitor construct on transgenic plants expressing a target protein or make a
proteinase inhibitor transgenic plant and inoculate with a viral vector
construct
expressing the target sequence.
2. Induction of endo enous proteinase inhibitors'
One could also induce the endogenous production of plant proteinase
inhibitors using an elicitor. For example, jasmonic acid (JA) is produced as
part
of a general plant defense mechanism and is known to induce specific
proteinase
inhibitors (Lightner et al., .l Mol Gen Genet. 241:595-601 (1993),
incorporated
herein by reference). Exogenous application of JA as been used to induce a
plant
defense response in Nicotiana attenuata to against herbivore attack (Baldwin,
PNAS, X5(14):8113-8118 (1998), incorporated herein by reference). To protect
against specific endogenous proteolysis of a recombinant protein, one could
treat
the plant material with JA to induce the synthesis of the proteinase inhibitor
and
then inoculate with a viral vector construct expressing the target sequence.
The desired phenotype in host plants used for gene discovery program
using virus expression vectors is reduced proteolytic activities in the
cytosol,
secretory pathway or apoplast so to increase the half life of virally produced
proteins. This will allow virally expressed proteins to exert their influence
on
plant biochemistry, development and growth optimally. Rapid or premature
degradation may reduce the amount of the expressed protein below the necessary
threshold to exert a measurable effect. Transgenic expression of protease
inhibitors, such as those induced by the systemin pathway (Ryan, et al., Ann.
Rev.
Cell Dev. Biol. ~:1-17 (1998)), will provide a continuous source of inhibitor
to
92
_...._m ,_~.... . ..~..~..,~.,..-..~_. ._ . r_._.~...~._
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
slow particular degradation processes. Conversely, as outlined in the example
above, treating virus vector infected plants with JA will induce the response
pathways and result in the expression of various inhibitors in
infected/treated
plants. In both ways, by specific protease inhibitor expression or by
induction of
response cascade, the half lives of many proteins, whose presence is requisite
for
detecting the novel functions of gene products, are increased.
EXAMPLE 30
Selection of optimized RNA and umtein activities by use of virus vectors to
express libraries of sequence variants generated lZy means of in vitro
mutasenenisis and/or recombination.
DNA shuffling is a process for recursive mutation and in vitro
recombination, performed by random fractionation and re-assembly of a gene of
interest to generate a pool of related, yet not identical, gene sequences.
Stemmer
et al., U.S. Patent Nos. 5,830,721 and 5,811,238, incorporated herein by
reference. Fractionation occurs through the treatment of DNA sequences with
limiting amounts of nuclease and re-assembly typically requires two steps,
first
primerless PCR to re-align fragments based on local homology and then primer
driven PCR to recover full length assembled fragments. The advantages of this
approach are many: ( 1 ) gene or sequence function can be optimized or
improved
without first determining the sites within the sequence that require
alteration; (2)
several generations of "improved" sequences can be generated, given proper
selection, in time frame unattainable by natural circumstances; (3) mutations
of
every sort are randomly dispersed throughout the gene sequence allowing a
"saturation" approach to determine the genetic potential of a given sequence.
Crameri et al., Nature Biotech. 14:315 (1996); Crameri et al., Nature Biotech.
15:436 (1997); Zhang et al., Proc. Natl. Acad. Sci. USA 94:4504 (1997); Zhao
and Arnold, Proc. Natl. Acad. Sci. USA 94:7997 (1997).
DNA shuffling has been successfully applied to prokaryotic or cell-based
systems to select sequences of desired protein activities. However, the
ability to
introduce shuffled sequences throughout an organism in a rapid and high
throughput manner necessary to harness the full potential of this technology
has
not been demonstrated. In this example, we describe the use of plant virus
93
__.-....~..... _..__....m.._..~.T___.~.._ . w._..~...~_~..
CA 02318662 2000-07-14
WO 99/36516 PC'T/US99/01164
expression vectors to bear populations of shuffled DNA sequences and were
applied to plant hosts and those sequences with desired properties were
selected
and fiuther characterized. The properties conferred by the selected shuffled
sequences were demonstrated to be inherited by progeny viruses.
Two aspects that must be continually improved in virus expression
vectors are: 1 ) their ability to move in a facile manner both locally and
systemically in plants, and 2) the need for greater levels of foreign gene
expression. Both of these fimctions can potentially be affected by
modifications
to the 30 kDa ORF. Functions within the 30 kDa coding region include the
movement protein (MP), the virus origin of virion assembly and the subgenomic
promoter used for coat protein synthesis. This is the promoter used for
expression of foreign gene sequences in most tobamovirus vectors. It has been
demonstrated that natural variation in viral populations can be the substrates
for
selection of improved characters in viral vectors can lead to dramatic
improvements in their performance. This work fizrther showed that single or
multiple amino acid substitutions in the 30 kDa ORF can significantly effect
the
movement properties of virus vectors. Viruses function genomically, as an
integrated whole of RNA and protein sequences, suggesting that either
individual
elements, such as the 30 kDa ORF, or the entire plant virus genomes could be
subjected to shuffling so to improve plant virus vector performance. Obvious
following the application of shuffling in this context is the use of plant
virus
vectors to house shuffled foreign gene populations which,
following.inoculation
onto plants, gene products with optimized activities can be selected. Plant
virus
vectors are the ultimate tool for shuttling genes into plants for selection of
optimized activities. No other tool, transient or stable expression methods,
can
match the ability of plant virus vectors to develop optimized genes for plant
activities.
Experiments to demonstrate the ability of plant viruses to house libraries
of sequence variants focused on optimizing the coding region for the 30 kDa
movement protein from TMV Ul for movement properties in Nicotiana tabacum
and subgenomic promoter activity responsible for coat protein mRNA
production. The base expression vector, p30B GFP, was used as a tool to be
modified as desired for a shuffling vector. p30B GFP vector is the TMV U1
94
_,.. ...W.,_.. __.",..__.....___.r.___"~w.._. _
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
infectious cDNA (bases 1-5756) containing the S' NTR, replicase genes {126 and
183 kDa proteins), movement protein gene with associated subgenomic promoter
and an RNA leader derived from the U1 coat protein gene. Following the RNA
leader is a unique PacI site and the green fluorescent protein (GFP) gene.
Following a unique XhoI site, the clone continues with a portion of the TMV U1
3' NTR followed by a subgenomic promoter, coat protein gene and 3' NTR from
TMV US strain.
The first stage of the project required the construction of a vector into
which shuffled DNA fragments could be reintroduced. The polymerase chain
reaction (PCR) was used to amplify a DNA fragment from the TMV vector p30B
comprising the T7 promoter, 5' non-translated region (NTR), and the reading
frames for the 126 and 183 kDa replicase proteins. The S' primer covered the
T7
promoter and initial bases of the TMV genome while the second primer modified
the context surrounding the start codon for the 30 kDa MP of TMV. This
1 S allowed DNA fragments to be ligated into the modified vector, designated
30B
GFP d30K, as AvrII, PacI restriction endonuclease digested fragments.
I~tive TMV 183/30 kDa function and 30k/GFP 'unction
183 kDa ORF
2O AGT TTG TTT ATA GAT GGC TCT AGT TGT TAA AGG AAA A... GAT TCG TTT TAA
(cont.)
S L F I D G S S C *
M A L V V K G K ... D S F '
30kDa ORF
2S ATggBTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATTAATTAA ATG ...
PacI GFP ORF
Modified TMV 183/30 kDa/GFP function (without 30 kDa eeneO p30B d30k ANP
30 I 83 kDa ORF
AGT TTG TTT ATA G~GC TCT AGT TGT TAA g CCTAGG A GCCGGC TTAATTAA ATG...
GFP ORF
S L F I D G S S C * AvrII NgQ I PacI
Modified TMV 183/30 kDa function and 30k/GFP function (with 30 kDa gene
present)
I 83 kDa ORF
AGT TTG TTT ATA GAT GGC TCT AGT TGT TAA g _ ATG GCT CTA GTT GTT AAA GGA AAA...
S L F I D G S S C * AvrII
4O M A L V V K G K...
_.~...~.... _. _ ..~~,.~..,~.~.m., ~. r. . _.._.._~ ........._..~...~.~ _
CA 02318662 2000-07-14
WO 99/3b516 PCT/US99/01164
..GTTTTAAATAgaTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATTAATTAA ATG ..
Pac1 GFP ORF
This modification allowed the ready insertion of modified 30 kDa gene
fi~agments into a virus vector and have them expressed in plant cells, tissues
or
systemically. The wild type GFP ORF is the reporter gene since the visual
level
of fluorescence as observed under long wave UV light correlates directly with
levels of GFP protein present in plant tissues. This has been demonstrated by
looking at different virus vectors expressing GFP, each having different
strength
subgenomic promoters, that were infected in plants and GFP levels determined
by
UV fluorescence and Western blotting using anti-GFP antibodies.
The procedure for shuffling of the 30 kDa gene is similar to that described
by Crameri et al., Nature Biotech. 15:436 (1997), and contained the following
steps. The 30 kDa gene fragment also containing the coat protein RNA leader
was amplified from tobamovirus expression vectors using primers: TMVLJ1 30K
5'A (5'-GGCCCTAGGATGGCTCTAGTTGTTAAAGG-3') (SEQ ID NO: 49)
and 3-5' Pac primer (5'-GTTCTTCTCCTTTGCTAGCCATTTAATTAATGAC-
3') (SEQ ID NO: 50). The PCR DNA product was gel isolated and then
incompletely digested with DNaseI. DNA fragments of 500 by or smaller were
isolated by using DEAF blotting paper technique and then eluted. Purified DNA
fragments were mixed together with taq DNA polymerise and allowed to
"reassemble" for 40 cycles. "Reassembly" reaction was assayed by gel
electrophoresis for DNA bands of approximately 800-850 bp. Approximately 1
mcl of the "reassembly" reaction was then subjected to PCR using primers TMV
U1 30K 5'A and 3-5' Pac that hybridize to terminal DNA ends of reassembled
fragments. The reassembled fragments will be gel isolated and digested with
restriction enzymes AvrII and PacI (sites present in the terminal primers) to
allow
for facile cloning back into the p30B d30k ANP digested with AvrII and PacI.
Ligations of shuffled genes into p30B d30k ANP resulted in pooled
libraries of sequences containing 100 to 50,000 members in five separate
experiments. Pooled virus vectors with libraries of variant 30 kDa coding
regions
were transcribed with T7 RNA polymerise and then inoculated by standard PEG
transfection into 0.5 x 106 Nicotiana tabacum protoplasts per sample.
Inspection
of cells 24 hours post inoculation revealed varied intensities of GFP
fluorescence
96
CA 02318662 2000-07-14
WO 99/36516 PGT/US99/01164
in individual cells indicating possible different levels of GFP accumulation
and
possible effects in the subgenornic promoter activity as desired. Cells were
incubated for 4$ hours post inoculation, harvested by centrifugation and then
lysed using freeze/thaw and grinding with a mortar and pestle. The virions
that
accumulated in protoplasts were released by the grinding.
The protoplast extracts were then inoculated on leaves of wild type and
transgenic Nicotiana tabacum c.v. MD609 expressing the TMV U1 30 kDa
movement protein. Three to five days post inoculation localized infection
sites
were observed expressing GFP. A variety of intensities of GFP fluorescence
were observed varying from that observed with the wild type GFP gene to much
duller to very bright, as observed from the viral expression of the shuffled
GFP
gene of Crameri et al., Nature Biotech. (1996) (GFPc3). The occurrence of
viruses expressing enhanced GFP fluorescence varied between libraries tested
from 1/200 to 1/50 infection foci depending on libraries tested. These local
infection sites with enhanced GFP fluorescence were excised from the leaves
and
inoculated on Nicotiana benthamiana plants. The bright local infection
variants
were then purified on the inoculated leaves of these plants from contaminating
viruses expressing less GFP protein. These viruses expressing brighter GFP
proteins were found to express larger amounts of GFP protein in systemic
tissues
than the starting p30B GFP virus. Sequencing and genetic studies indicated
that
no mutations accumulated in the GFP genes and that the effects were due to
mutations in the TMV U1 30 kDa ORF that up regulated the subgenomic
promoter. The accumulation of GFP in the shuffled variants with brighter GFP
phenotype was 3.4 fold greater than that produced by p30B GFP as measured by
quantitative Western blotting of plant extracts using an anti-GFP sera. These
data
demonstrated that shuffling could be used to enhance the cis-acting functions
of
RNA sequences and that plant RNA virus expression vectors are effective tools
to
shuttle large diversity of sequence variants in whole plants and plant cells.
The protoplast extracts isolated from transfections with virus libraries
were inoculated on one half of wild type Nicotiana tabacum c.v. MD609 and
Nicotiana benthamiana leaves. To the other leaf half, virus derived from p30B
GFP was inoculated. Some infection sites resulting from infection of viruses
containing shuffled 30 kDa ORFs grew more rapidly than those of the average
97
.....,y,.""-."~..r..,.. .._ ........
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
from p30B GFP. These events occurred at a frequency of 1/100 to 1/500
infection foci depending on the virus library analyzed. These more rapidly
growing infection foci were excised and inoculated on young Nicotiana tabacum
c.v. MD609 plants. As a control, p30B GFP was inoculated on similar sized and
aged plants. The p30B GFP vector does not move systemically on tobacco
plants. However, some shuffled 30 kDa ORF variant vectors, that were
identified
as rapidly growing local infection sites, were able to move systemically on
tobacco plants. The movement was primarily on phloem source tissue and were
localized to veins and circular spots in green lamina. This movement ability
was
reproducible in multiple inoculations of these individual virus variants.
Sequence
analysis of the viruses containing shuffled 30 kDa ORFs capable of systemic
movement on Nicotiana tabacum plants demonstrated that localized amino acid
substitutions were present and responsible for altered movement phenotype.
Further recursive shuffling of the top S-10% of GFP expressing vectors or
I S those that demonstrated an enhanced ability to invade systemic tissues of
tobacco
could be carried out to meld synergistic mutations to lead to greater gains in
expression or virus movement. Likewise, the 30 kDa ORFs that contain the most
potent subgenomic promoters and most enabled movement activities in tobacco
could be shuffled together so to bring both sets of properties into the same
30 kDa
ORF. It is also apparent from these data that by testing virus expression
vectors
containing libraries of these shuffled variants, one can select the variant
with the
protein or RNA activity that one desires. The phenotypes that can be assayed
are
protein activity in plants, as with the movement activities of the 30 kDa
protein,
enzyme activities in plants or in plant extracts or other surrogate features
such as
substrate or product accumulation. These data demonstrate the power of virus
expression vectors to be effective tools for shuttling sequence variants into
plants
and allow the selection of genes encoding the desired altered property. This
tool
allows one to mine the hidden activities, enhance the isolated activities of
enzymes or eliminate allosteric inhibition of enzyme activities. This could be
applied to any plant gene or genes from other sources to optimize the
activities
desired for agronomic, pharmaceutical or developmental effects caused by
altered
genes.
98
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
EXAMPLE 31
Com~~osite cloning to facilitate clonins of libraries in virus vectors and/or
their
introduction into host cells for expression of seguences
Virus vector clones could be integrated into lambda phage or cosmid
clones to facilitate library construction, clone representation, elimination
of cell
based amplification by direct transcription and archiving of individual
clones.
Likewise, cis-acting elements allowing for expression in plant cells or
integration
into plant DNA could be included into such plasmids to facilitate inoculation
of
DNA for direct expression, obviating the need for transcription of vector
cDNA,
or construction of dedicated plant transformation vectors.
Virus vectors are tools housing libraries of sequences that can be screened
for novel gene discovery. However libraries are often first constructed in
plasmid
or phage shuttle vectors before excising and introduction into virus vectors.
Likewise, sequences can be screened in hosts using virus vectors, but must be
subcloned into appropriate eukaryotic expression vectors before the trait
identified in the vector transfected host will become a stable trait in the
host by
gene integration. Additional hurdles to overcome are: (1) construction of
libraries to most efficiently represent the clones in a cDNA library, (2)
obtaining
maximal transfection efficiency into bacterial hosts (if used), and (3)
archiving
DNA samples without the need for transfection into bacteria and transcription
of
ligated DNA. The integration of a virus vector into a cosmid clone, or lambda
phage itself, (both termed phagmids here) could allow a mufti-purpose vector
to
be generated to be both the repository of primary generated library sequences,
source for Iigation transcriptions, high efficiency bacterial transfection and
direct
expression in higher eukaryotic hosts. Using normal cloning procedures, the 5'
half of the virus vector to be inserted into one arm of a phagmid DNA clone
with
a non symmetrical restriction (such as BstXi: CC GG) containing a
unique sticky sequence (the N's). The 3' part of the vector will be inserted
into
another arm with a non-symmetrical restriction (such as BstXI:
CCA,NNNNNNTGG) containing a second unique sticky sequence (the N's). The
vector would be split at the determined restriction site (e.g. BstXl] within
the site
for foreign sequence expression in the virus vector. The 5'-end of the virus
cDNA would be appropriately fused to a promoter for in vitro transcription
(e.g.
99
_~..-.__.... __~... _ .~-T~ . _~,...~~.-... _., .-...~__.._...~.___ ___ ,
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
T7) or for in vivo expression (e.g. an appropriate higher eukaryotic RNA
polymerase promoter). The 3'-end of the virus cDNA would terminate with a
ribozyme for in vitro cleavage and/or a 3' terminator from a gene from host
organism to lead to in vivo termination of transcription. Left and right T-DNA
borders that promote the integration of sequences in between into plant
genomic
DNA, could flank the promoter and terminator sequences. At the terminus of
each arm would be cos sequences to allow complete regeneration of the phagmid
upon ligation in the presence of foreign library DNA containing the two unique
sticky sequences at each respective termini. These library DNA fragments could
be generated by PCR amplification using determined restriction sites (e.g.,
BstXI)
to generate unique sticky ends complementary to those in the phagmid-vector
arms integrated in the PCR primers. The 5' and 3' primers would each have
unique recognition sequences in the BstXI restriction site (the N's) that
would
match the sticky sites on the respective sides of the virus vector. The sites
could
be switched on a second set of PCR primers to allow the amplification of DNA
to
be ligated into the phagmid-viral vector arms in the "sense" and "anti-sense"
orientation. These constructions would allow for efficient in vitro ligation
and
use of crude ligation mix as template for E. coli transformation, plant
transformation, in vitro lambda packaging to 109 pfu/mcg or in vitro
transcription.
In this manner, the vector and flexibility for its screening could be
maximized.
These tools we can directly build complex libraries into and simultaneously be
the enabling tool for analysis.
EXAMPLE 32
Improvement of Host Plant Performance with a Viral Expression ~vstem via
Intersnecific Hybridization.
The goal of this example is to improve the host plant by introducing
foreign genetic material via interspecific hybridization. Host plant species
vary
in their ability to support expression of a sequence inserted into a plant
viral
vector. Some species support expression to a high specific activity, such as
Nicotiana benthamiana, but have relatively low biomass. Other species, such as
N. tabacum, have high biomass and/or other desirable properties for growth in
the
field, but have a relatively low specific activity of the expressed sequence.
In this
100
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
example, the desirable properties of two or more species are combined by
making
an interspecific hybrid by standard methods. After chromosome doubling to
restore fertility, the primary hybrid may have suitable properties, or it may
be
desirable to backcross toward either parent selecting or screening at each
generation for the desired property(ies) of the non-recurrent parent, for
example,
introgress the superior biomass of N. tabacum into N. benthamiana, or
introgress
the superior viral vector performance of N. benthamiana into N. tabacum, among
others. A viral vector expressing the green fluorescent protein (GFP) is one
example of a useful tool for screening the level of systemic expression in
candidate hybrid plants.
Many hybrids are possible, especially within the genus Nicotiana. For
example, we have hybrids between N. benthamiana and N. tabacum. N.
benthamiana and N. clevelandii, N. benthamiana and N. excelsior, N.
benthamiana and N. africana, N. clevelandii and N. africana, N. umbratica and
N. africana, N. umbratica and N. otophora, and N. bigelovii and N. excelsior.
In
addition, hybrids with more than two parents are possible. For example, we
have
N. benthamianaltabacumlafricana and N. benthamianalclevelandiiltabacum.
EXAMPLE 33
Libraries of heterologous nucleic acid sequences in DHSPES constructs
Qenerated in a restriction-endonuclease-free and cell-free manner.
The goal of this example is to generate libraries of DHSPES constructs
containing heterologous sequences while avoiding the potential problems
associated with the use of restriction enzymes for preparation of the inserted
nucleic acids and with passage of the resultant constructions through E. coli.
Normally, DNA fragments are generated by restriction endonuclease
treatment and ligated into a DHSPES vector with compatible termini. However,
when a complex population of DNA molecules, such as that found in a cDNA
library, is used as starting material and a given restriction endonuclease is
used to
treat the insert DNA to render the appropriate termini for ligation to the
cloning
vector, the recognition sequence for that enzyme will occur with a certain
frequency within the population, rendering the molecule bearing that sequence
truncated after digestion.
101
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Passage of certain plasmid-based viral clones through E. coli has been
observed to result in instability of the plasmid a certain proportion of the
time.
The cause of this instability is unclear, but may be related to insert size,
sequence
or to toxicity resulting from expression of the gene from cryptic promoter
sequences present in the DHSPES viral sequences.
In order to avoid the above-mentioned problems, libraries of DHSPES
constructs harboring cDNA molecules in a restriction endonuclease-free and E.
coli-free manner are constructed. Such a system will permit the inclusion into
DHSPES constructs of molecules that harbor inconvenient internal restriction
sites. This method of "cell-free cloning" will also allow us to obtain DHSPES-
derived viruses containing genes that are not well tolerated by E. coli in
traditional cloning approaches.
In essence, cell-free cloning will entail the in vitro assembly of partial
viral sequences with a DNA fragment into a configuration that that will yield
infectious viral RNA molecules upon in vitro transcription. In one system, the
viral sequences are divided into two "arms"; the left arm and the right arm.
The
left arm encodes a T7 RNA polymerase promoter followed by viral sequences
encoding replicase followed by the gene encoding movement protein and the
subgenomic promoter that controls expression of the desired gene. The right
arm
will contain sequences of the viral genome that encode the viral coat protein
and
the sequences that control its expression, the viral 3' untranslated region,
and a
ribozyme sequence for generating the desired 3' terminus on the transcribed
molecules. A schematic diagram for cell free cloning is shown in FIGURE 28.
The left arm and right arm will each have separate asymmetric (non-
palindromic, thus self incompatible) overhangs that will permit the two arms
to
be brought together by an intervening insert that is derived either from PCR
product, cDNA reaction, or elsewhere. The insert will have ternlini that are
compatible with both the left and right arms. The termini of these molecules
are
such that ligation of left and right arms to insert will ensure assembly into
the
proper configuration to yield infectious viral transcripts. The sequence
contained
in the insert will then be in the correct orientation and genomic position to
permit
its expression from the virus in plant cells.
102
.. __..__ . _ ~r. ,~ ...~,-,~....~.
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
Specifically, the right arm will be synthesized by PCR and will have a
biotin group incorporated into the reverse (3') primer. The resulting
biotinylated
PCR product representing the right arm will then be immobilized upon
streptavidin paramagnetic beads. Treatment of the DNA with T4 DNA
polymerise and a single dNTP (in the present case, dGTP) will give a 5'
overhang
as a result of the exonuclease activity of the polymerise. The insert DNA,
being
PCR product, restriction fragment, or cDNA will be treated with T4 DNA
polymerise with a single dNTP to generate S' overhangs on its termini; the 3'
of
which is compatible with the S' of the right arm. The 5' terminus of the
insert
DNA will be compatible with the left arm 3' terminus that had been generated
similarly.
The ligation reactions in the assembly of the virus on the paramagnetic
beads will be carried out sequentially, with the insert being ligated to the
immobilized right arm first, followed by washing of the bead complex and then
ligation of the left arm. Following the subsequent wash, in vitro
transcription
will be carried out to generate infectious RNA transcripts.
In this cell-free manner, replication-competent viruses expressing the GFP
gene were constructed. Using PCR, a biotinylated right arm was prepared.
Following immobilization on avidincoated paramagnetic beads and treatment
with T4 DNA polymerise and a single nucleotide (dGTP) to generate the
appropriate 5' overhang, the right arm was ligated to a PCR product encoding
the
GFP gene that had been treated with T4 DNA polymerise and dCTP to render a
compatible 5' overhang. A DNA fragment comprising the left arm of the virus
was then ligated to the resulting DNA-bead complex to generate a full-length
virus clone that was subsequently used as template for in vitro transcription.
After each step of enzymatic manipulation of the magnetic bead-bound DNA,
DNA-bead complexes were washed by sedimenting them in a magnetic field and
resuspending them in the appropriate buffer. In addition, after each
manipulation,
aliquots were taken for analysis to confirm that the desired reaction had
occurred.
The infectious RNA products of the transcription reaction were introduced into
protoplasts of tobacco cell suspension cultures. At 12-18 hours after
protoplast
infection, fluorescence emitted by the GFP encoded by the virus clone was
observed in a majority of the cells confirming that the RNA transcript derived
103
.~..w.r.._.. e~,~____ .._ ._.. _.._. ~ _ _ . ,~-.- _~,_a
..._.~.~. _. ._.~ .._...
CA 02318662 2000-07-14
WO 99/36516 PCTNS99/01164
from the DNA-bead complexes was infectious, and hence, that the sequentially
assembled virus-encoding DNA molecules had been assembled in the desired
configuration so as to permit virus replication and expression of the inserted
foreign gene sequences.
EXAMPLE 34
Use of undefined sequences to increase the genetic stability of foreign eves
in
virus expression vectors.
Insertion of foreign gene sequences into virus expression vectors can
result in arrangements of sequences that interfere with normal virus function
and
thereby, establish a selection landscape that favors the genetic deletion of
the
foreign sequence. Such events are adverse to the use of such expression
vectors
to stably express gene sequences systemically in plants. A method that would
allow sequences to be identified that may "insulate" functional virus
sequences
from the potential adverse effects of insertion of foreign gene sequences
would
greatly augment the expression potential of virus expression vectors. In
addition,
identification of such "insulating" sequences that simultaneously enhanced the
translation of the foreign gene product or the stability of the mRNA encoding
the
foreign gene would be quite helpful. The example below demonstrates how
libraries of random sequences can be introduced into virus vectors flanking
foreign gene sequences. Upon analysis, a subset of introduced sequences
allowed
a foreign gene sequence that was previously prone to genetic deletion to
remain
stabily in the virus vectors upon serial passage. The use of undefined
sequences
to enhance the stability of foreign gene sequences can be extrapolated to the
use
of undefined sequences to enhance the translation of foreign genes and the
stability of coding mRNAs by those skilled in the art.
The genetic stability of the human growth hormone gene (hGH) or an
Ubiquitin fusion to hGH (LTbiq hGH) in the tobamovirus expression vector p30B
is rather poor, such that no stable virus preparations could not be made to
serially
passage infection onto plants and detect the expression of hGH recombinant
protein. The site of gene insertion is following a PacI site (underlined) in
the
virus vector. This sequence is known as a leader sequence and has been derived
from the native leader and coding region from the native TMV Ul coat protein
104
_._......_. . .~_._._.___~~.~..~._ .
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
gene. In this leader, the normal coat protein ATG has been mutated to a Aga
sequence (underlined in
GTTTTAAATAgaTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTT
GTCATTAATTAA ATG ... (hGH GENE)). A particular subset of this leader
sequence (TCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCA)
has been known to increase genetic stability and gene expression when compared
with virus construct lacking the leader sequence. The start site of subgenomic
RNA synthesis is found at the GTTTT... An oligonucleotide RL-1
(GTTTTAAATAGATCTTAC N(20)TTAATTAAGGCC ) was used with a
primer homologous to the NcoIlApaI region of the TMV genome to amplify a
portion of the TMV movement protein. The population of sequences were cloned
into the ApaI and PacI sites of the p30B hGH vector. Vectors containing the
undefined sequences leading the hGH genes were transcribed and inoculated onto
Nicotiana benthamiana plants. 14 days post inoculation, systemic leaves were
ground and the plant extracts were inoculated onto a second set of plants.
Following the onset of virus symptoms in the second set of plants, Western
blot
analysis was used to detect if hGH or Ubiq-hGH fusions were present in the
serially inocuated plants. Several variants containing novel sequences in the
non-
translated leader sequence were identified that were associated with viruses
that
were genetically stable and allowed successful passage of hGH expression on
plants inoculated with serially passaged virus. Whereas the parental controls,
p30B hGH and p30B Ubiq-hGH, did not. Viruses derived from undefined
sequence library, p30B hGH virus #2 and #5, were shown to genetically stable
upon virion passage and likewise, p30B Ubiq hGH #6 showed expression of the
Ubiq-hGH expression upon serial virion passage. Again, this property was never
observed in each of the starting viruses p30B hGH and p30B Ubiq hGH. The
sequence surrounding the leader was determined and compared with that of the
control virus vectors.
p30B #5 HGH GTTTTAAATAGATCTTAC--TATAACATGAATAGTCATCG
p30B #5 HGH GTTTTAAATAGATCTTAC--TATACCATGAATTAGTACCG
p30B #6 UbiqHGH GTTTTAAATAGATCTTAC-ACTCGGTTGAGATAAAACTAAACTA
p30B #2 HGH GTTTTAAATAGATCTTAC--TCCGACGTATAGTCACCACG
p30B HGH GTTTTAAATAGATCTTAC--
AGTATCACTACTCCATCTCAGTTCGTGTTCT
p30BUbiqHGH GTTTTAAATAGATCTTAC--
AGTATCACTACTCCATCTCAGTTCGTGTTCT
105
_.~,.-.,._.. .._~._.. _ r_.~..._~,....~..~,.. . ."..~,.~_.....
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
***********************
p30B #5 HGH -----TTAATTAAAATGGGA---
p30B #5 HGH -----
TTATTTAAAATGGGAAAAATGGCTTCTCTATTTGCCACA~TiTTA
p30B #6 UbiqHGH -----
TTAATTAAAATGGGAAAAATGGCTCTCTTATTGGCCCCATTTTTA
p30B #2 HGH -----TTAATTAAA.AATGCAGAZTITCGTCAAGAC'ITTGACCGGG
p30B HGH
TGTCATTAATTAAAATGGGAAAAATGGCTTCTCTATTTGCCACATIZTfA
p30B UbiqHGH TGTCATTAATTAAA.ATGCAGATITrCGTCAAGACTTTGACCGGT
****************
* indicates sequences that are idcntical in all viruses.
-- indicates end of defined primer and start of N(20) region of the
oligonucleotide that was
introduced during PCR amplification.
The result was that undefined leader constructs transcribed were
passageable as virus, while the parental 30B vectors with native leaders were
not.
The nature of the random leaders indicates that each are unique and that
multiple
solutions are readily available to solve RNA based stability problems.
Likewise,
such random sequence introductions could also increase the translational
efficiency.
In order to select for undefined sequences that may increase the
translational efficiency of foreign genes or increases the stability of the
mRNA
encoding the foreign gene deriued from a virus expression vector, a selectable
marker could be used to discover which of the undefined sequences yield the
desired filnction. The amount of the GFP protein correlates with the level of
fluorescence seen under long wave LTV light and the amount of herbicide
resistance gene product correlates with survival of plant cells or plants upon
treatment with the herbicide. Therefore introduction of undefined sequences
surrounding the GFP or herbicide resistance genes and then screening for
individual viruses that either express the greatest level of fluorescence or
cells
that survive the highest amount of herbicide. In this manner the cells with
the
viruses with the highest foreign gene activity would be then purified and
characterized by sequencing and more thorough analysis such as Northern and
Western blotting to access the stability of the mRNA and the abundance of the
foreign gene of interest.
106
....._._-..~"_..u.......,.... ... ..W...~."._....... .. ..r..._...._._",.-
""~,~,"_....... .......~. ..",_."~.....
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
EXAMPLE 3 5
Method for using rgporter genes fused to regulated or constitutivepromoters as
a
surroeate marker for identifyin~genes impacting ne reeulation
In this example we will show 1 ) a method to construct transgenic hosts
S expressing a reporter gene under the control of various promoter types; 2)
means
to use such hosts to identify genes from libraries expressed in virus
expression
vectors that alter gene regulation.
The initial construction of the reporter gene expression cassette will
require identification of the appropriate reporter gene, which could include
GFP
(fluorescent in live plants under long wave UV light), GUS (fluorescent and
color-based assay in detected tissue), herbicide resistance genes (live or
death
phenotype upon treatment with herbicide) or other scoreable gene products
known to the art. Promoter sequences can express RNA in constitutive or
induced conditions. An example of a regulated promoter would be that of tomato
or potato protease inhibitor type I gene (Graham, et al., J. Biol. Chem.
xø0:6555-
6560 (1985)). These promoters are up regulated in the presence of jasmonic
acid
or herbivore damage to plant tissues. Constitutive promoters are readily
identifiable from anyone skilled in the art inspecting the relevant
literature. Such
combinations of inducible or constitutive promoters using appropriate reporter
genes would be integrated into binary plant transformation vectors,
transformed
into Agrobacterium and transformed into Nicotiana benthamiana leaf disks.
Upon identification of the appropriate gene construct in regenerated tissues,
the
primary transformants would be selfed to obtain the first stable line of
plants for
assay.
Libraries of cDNAs, full-length for gene overexpression or gene
fragments for sense or anti-sense based gene suppression, would be ligated
into
virus expression vectors by normal molecular biology techniques. These
libraries
would be prepared for inoculation by the methods described in this patent
application. Once inoculated, hosts with inducible promoters fused to reporter
genes, maintained in uninduced state, would be monitored for aberrant
expression
of the reporter gene in tissue that contains replicating virus. If hosts
containing
constitutive promoter fusions to reporter genes are used, monitoring for hyper-
or
hypo-expression conditions of the reporter gene would be the focus. In this
107
.._ ... .__ .-.~
....
CA 02318662 2000-07-14
WO 99/36516 PCT/ITS99/01164
manner, genes that augment pathways that induce or upregulate the activity of
certain promoters could be identified by following the surrogate marker of
reporter gene expression. Conversely, gene that down-regulate or halt reporter
gene expression could be identified as products that negatively effect the
S activities of the promoter or signaling pathway to which it is responsive.
Virus
vectors containing sequences that effected reporter gene expression by
overexpression or suppression positive or negative regulatory factors can be
isolated, and foreign gene contained may be sequenced and analyzed by
bioinformatic methods.
EXAMPLE 36
Method to induce the expression of alternative splicing variants to discover
biological effects in host or~anism~ and to use said host oreanism as a source
for
novel cDNA libraries enriched for alternatively spliced variants ofgenes
Transcription of nuclear genes in higher eukaryotic organisms results in a
primary RNA transcript that contains both coding (exon) and non-coding
(intron)
information. A crucial step in RNA maturation before exporting to the cytosol
for translation is the splicing of introns from the primary transcript and the
rendering of contiguous exons for coding of the desired product. It is
interesting
to note that, although, splicing may occur in defined sites constitutively in
certain
gene, many genes can be spliced to produce multiple protein products, each
with
separate functions. The process of splicing out different sets of intron and
splicing together of different array and order of exons for the same primary
transcript is known is alternative splicing. This is powerful way genetic
economy
can be achieved in higher organisms to encode for multiple functions in a
single
gene cistron. The events of alternative splicing are regulated by families of
small
nuclear RNAs and associated proteins. These factors are responsible for the
choice of splice sites used in primary RNA transcript and the nature of the
mature
mRNA reconstructed from the splicing process. Many alternative splicing events
produce rare or tissue specific RNAs that result in the translation of
specific
protein products that have unique activities. The most famous of which is the
alternative splicing of a Drosophila transcription factor results in the sex
108
~...-,~.w_...
.. ,~,~,-
...~_-_~w___.__ .__r__ _..~. a
CA 02318662 2000-07-14
WO 99/36516 PCT/(JS99/01164
determination of the developing embryo. For a reference describing general
alternative splicing, see Lopez, Ann. Rev. Genetics, ~ (1998), in press.
Since alternatively spliced mRNAs encode for proteins with differing
functions, it would be interesting to investigate hosts that are deficient in
these
factors or hosts that no longer express such factors. It is difficult to
accurately
and effectively represent this diversity in standard cDNA libraries
constructed
from unaltered eukaryotic hosts. However, the use of virus expression vectors
to
overexpress or suppress the expression of factors involved in the splicing
process
will make it possible to increase the proportion of alternatively spliced mRNA
in
the host organism. Focused gene libraries will be constructed for the
overexpression and the sense or antisense suppression of factors with
potential
and actual activities in the RNA splicing process in plants. Gene families can
include the SF2/ASF-like group of splicing factors (Lopato et al., PNAS
92:7672-
7676 (1995)), the RS-rich family of splicing factors (Lapato et al., The Plant
Cell
8_:2255-2264 (1996)) and other splicing families that have been identified in
the
literature in lower or upper eukaryotic systems. The gene libraries will be
sub-
cloned into virus expression vectors and virus libraries will be inoculated as
individuals or pools onto plants or plant cells. Once individual or groups of
splicing factors are overexpressed or have their expression suppressed in
plant
cells, novel forms of splicing will occur due to the role of these proteins in
alternative splicing of many transcription factors, splicing factors or other
gene
products. The high level of expression achieved by virus expression vectors
and
their ability to infect most cell types in plants should raise the overall
level of
aberrantly expressed mRNAs in the plant. The transfected plants will be used
as
the starting point for the isolation of poly A(+) ~A for the construction of
cDNAs enriched for alternatively spliced genes. The alterations in the
alternative
splicing could be the splicing of a greater or lesser number of introns from
the
primary mRNA than normally occurs in non-transfected plants. These enriched
cDNA libraries can now be cloned into virus expression vectors and the
functions
of these novel spliced forms of genes can be assayed on plants transfected
with
these vector libraries.
In this example, one can discover the plietropic functions of factors
effecting alternative or normal splicing functions in plants from primary
directed
109
CA 02318662 2000-07-14
WO 99/36516 PCT/US99/01164
virus libraries with original splicing factor genes, or from virus libraries
derived
from plants containing induced novel spliced mRNAs.
Similar methods could be to derive novel cDNA libraries by using virus
vectors to express factors responsible for transcriptional regulation of genes
in
plants. In this example, targeted cloning of transcription factor families
would be
ligated into virus expression vectors. Families could include homeodomain, Zn
finger, leucine zipper and other transcription factor families appearing in
pro or
eukaryotic genomes. Schwechheimer, et al., Ann. Rev. Plant Phys. and Plant
Mol. Biol. 4_~ (1998), in press. The gene libraries will be sub-cloned into
virus
expression vectors and virus libraries will be inoculated as individuals or
pools
onto plants or plant cells. Once individual or groups of transcription factors
are
overexpressed or have their expression suppressed in plant cells or plants,
novel
patterns of gene expression patterns will be induced. This will result in the
appearance of a higher proportion of cDNAs normally present at low levels in
the
plant tissue or that are normally developmentally regulated. However, with the
high level of expression achieved by virus expression vectors and their
ability to
infect most cell types in plants should induce these tissue specific cDNAs in
aberrant cell types and at much higher than normal levels. The transfected
plants
will be used as the starting point for the isolation of poly A(+) RNA for the
construction of cDNAs enriched for alternatively lowly expressed or
developmentally expressed cDNAs. These cDNAs would be used to construct
expression or gene suppression libraries that will be enriched for these rare
or
aberrantly expressed cDNAs. These enriched cDNA libraries can now be cloned
into virus expression vectors and the fimctions of these novel spliced forms
of
genes can be assayed on plants transfected with these vector libraries.
Although the invention has been described with reference to the presently
preferred embodiments, it should be understood that various modifications can
be
made without departing from the spirit of the invention. It is further
understood
that the instant invention applies to all plus stranded RNA viral vectors.
110
