Note: Descriptions are shown in the official language in which they were submitted.
CA 02319247 2000-11-14
MODULATION OF MEIOTIC RECOMBINATION
FIELD OF THE INVENTION
The invention is in the field of genetic manipulation of eukaryotic cells and
organisms,
particularly the modulation of homologous recombination between non-sister
chromatids in
meiosis.
BACKGROUND OF THE INVENTION
Mitosis and meiosis are in some ways opposite processes. Mitosis involves the
faithful
reproduction of a genome in vegatative cells to preserve the fidelity of
genetic information that is
divided between daughter cells. Meiosis on the other hand involves the
reshuffling of the
eukaryotic genome in germ line cells for reductive segregation into gametes,
to facilitate
production of offspring with novel genomes. The different purposes of meiosis
and mitosis are
reflected in the very different rolls and mechanisms of homologous
recombination in each
process [1-8].
There is a fundamental mechanistic distinction between the primary processes
of
homologous recombination in meiotic (germ-line) cells compared to mitotic
(vegetative/somatic)
cells. In meiotic cells, homologous recombination occurs primarily between non-
sister
chromatids (to shuffle the genome), whereas in mitotic cells homologous
recombination occurs
primarily between sister chromatids (to correct genomic errors). Sister
chromatids are replicated
copies of a particular maternal or paternal chromosome. Recombination between
non-sister
chromatids (i.e. between a paternal chromatid and a maternal chromatid) occurs
500-1000 fold
more frequently in meiotic cells versus mitotic cells [48-50]. The meiotic
process of non-sister
chromatid exchange (NSCE) facilitates novel recombination of the genetic
information from two
parents. In contrast, the mitotic process of sister-chromatid exchange (SCE)
resulting from
recombination-mediated repair is a primary mechanism for maintaining genome
fidelity
throughout a mufti-cellular organism
There are a significant number of mechanical distinctions between mitotic SCE
and
meiotic NSCE, as these processes are currently understood. Double strand
breaks in meiotic
recombination are understood to be catalysed by a conserved, specific enzyme,
SPO11 [4;9],
whereas in mitotic SCE spontaneous lesions can lead to double strand breaks
[3;7]. Upon
formation of double strand breaks in either SCE or NSCE, the exposed double-
stranded ends are
CA 02319247 2000-11-14
understood to be resected by an exonuclease activity that degrades the DNA to
generate single-
stranded DNA (ssDNA) ends which have a 3'-hydroxyl group. This resection
process is
understood to be catalysed by a protein complex composed of at least three
known proteins,
MRE11, RAD50 and XRS2/NBS1 which are conserved from yeast to plants and humans
[12-
19]. The ssDNA ends may then be acted upon by another set of proteins so that
the ends invade
the sister chromatid in mitotic cells or, uniquely, the chromatid of the
paired homologous
chromosome from the other parent in meiotic cells.
Strand invasion may be catalysed by a group of proteins which are known as
RecA
homologues as a consequence of their sequence and functional similarity to the
Escherichia coli
RecA protein. RecA has been extensively studied and has been demonstrated in
vitro to catalyse
pairing between homologous DNA molecules and strand invasion [6]. Yeast are
reported to
have at least four proteins with homology to RecA: RAD51; RAD55; RAD57; and
DMC1 [5].
These proteins are also highly conserved in plants and humans
[21;22;24;25;39]. Eukaryotic
RecA homologues also catalyse pairing between homologous DNA molecules and
strand
invasion [51;52]. Genetic studies illustrate the primacy of this group of
proteins mitotic and
meiotic homologous recombination [13;20;23;53-57]. These biochemical and
genetic studies
demonstrate the high conservation of function of RecA homologues from lower to
higher
eukaryotes. Whereas RAD51, RAD55 and RAD57 play a role in both mitotic and
meiotic
homologous recombination [23;58], DMC1 functions in a meiosis-specific manner
[20;54;55].
Biochemical and genetic evidence points to RAD51, RAD55 and RAD57 interacting
in a
common pathway whereas DMC1 acts in a unique but overlapping pathway [53;58].
The
existence of two unique pathways of RecA homologues acting during meiosis is
also supported
by cytological studies whereby DMC1 and RAD51 are found at different nodes
along the
chromosome undergoing recombination [53]. RAD51, RAD55 and RAD57 may only
facilitate
homologous recombination on DNA molecules with a specific structure and
topology unique to
this group of proteins [59]. It has been proposed that DMC1 may act on
specific DNA structures,
potentially not recognized by RAD51 RAD55 or RAD57, to promote pairing and
recombination
between homologous male and female chromosomes to catalyse NSCE [53;60]. These
DNA
structures may be meiosis-specific, again illustrating the unique attributes
of homologous
recombination involving NSCE during meiosis versus SCE in mitotic cells.
2
CA 02319247 2000-11-14
While RADS 1 and DMC 1 can apparently catalyse pairing and strand invasion
alone, they
also act in concert with other proteins that enhance homologous recombination.
For example,
RAD51 physically interacts with RAD54 [61;62] and RAD52 [63] and both of these
proteins are
conserved from yeast to humans [64;65]. Inclusion of RAD54 or RAD52 in in
vitro assays
demonstrate these proteins can stimulate the pairing and strand invasion
activity of RAD51
[23;66]. DMC1 does not physically interact with RAD54 [53] but does interact
with a RAD54
homologue, known as TID1 [53], which acts in NSCE during meiosis [49]. This
again illustrates
the uniqueness of the homologous recombination recombination pathways
catalysed by DMC 1
versus RAD51. In addition to the promoting effects of RAD54 and RAD52,
homologous
recombination is enhanced by a complex of proteins which bind ssDNA. In
eukaryotes, this
protein complex is a heterotrimer known as RPA [26]. ssDNA-binding proteins
function in
DNA recombination and repair by reducing secondary structure in ssDNA thereby
increasing the
ability of RecA-like proteins to bind and act upon the ssDNA [67]. RPA is
conserved from yeast
to humans [26]. RPA has been demonstrated to physically interact with RAD51
and DMC1
[68], as well as associating with RAD52 [69] and may thereby act in recruiting
RecA-
homologues and/or other recombination proteins to recombinogenic ends, or
assist in forming
recombinogenic DNA-protein complexes.
Other participants in the pairing and strand exchange processes leading to
homologous
recombination in meiotic cells include MSH4, MSHS and MLH1[27;29;31]. These
proteins are
also conserved from yeast to to plants and humans [28;30;32;33] . MLH1
functions principally
in mismatch repair to ensure fidelity of DNA replication in vegetative cells
but also plays a role
in homologous recombination in meiotic cells [31]. MSH4 and MSHS are meiosis-
specific
homologues of a set of proteins unique from MLH1 functioning in mismatch
repair in vegetative
cells [27;29] . The biochemical role of MSH4 and MSHS during meiosis is
unclear as yet but
evidence points to participating in DNA exchange between homologous
chromosomes [27;29].
The specificity of MSH4 and MSHS to homologous recombination in meiotic cells
again points
to the uniqueness of this process versus that which occurs in vegetative
cells.
Strand invasion and formation of the initial crossover or chiasma between the
sister
chromatids in vegetative cells and non-sister chromatids in meiotic cells is
followed by branch
migration, DNA replication and strand displacement. This increases the length
of genetic
information exchanged between the two chromatids. A second chiasma then
occurs. The
CA 02319247 2000-11-14
chiasma are acted upon by an enzyme known as a resolvase. This family of
enzymes recognize
and bind the cruciform structure created by the chiasma between the paired
chromatids.
Resolvases have been well characterized in microorganisms, including lower
eukaryotes,[43] and
the activity has been detected in humans [44].
It has been suggested that recombinases may be used to stimulate mitotic
homologous
recombination between sister chromatids in eukaryotes, which has been proposed
as a
mechanism to promote gene targeting in vegetative/somatic cells [63;82;85;86].
Gene targeting
(gene targeting) generally involves the directed alteration of a specific DNA
sequence in its
genomic locus in vivo. Problems have however been reported with mitotic gene
targeting. It has
for example been found that overexpression of RecA-homologues in mitotic cells
may cause cell
cycle arrest [92]. International Patent Publication WO 97/08331 dated 6 March
1997 summarizes
a range of difficulties with earlier suggestions that the E. coli RecA
recombinase would be useful
for stimulating homologous mitotic recombination (as for example had been
suggested in
International Patent Publications WO 93/22443, WO 94/04032 and WO 93/06221).
Utilization
of E. coli RecA in eukaryotic cells is potentially problematic because the
direction of strand
transfer catalysed by RecA is the opposite to the direction of strand transfer
catalysed by
eukaryotic RecA homologues [52]. Nevertheless, overexpression of E. coli RecA
has been
reported to promote gene targeting approximately 10-fold in mouse cells [42]
and less than two-
fold in plants [82]. However, this latter result in plants also demonstrated a
very low overall
frequency of gene targeting, which would tend to cast doubt on the statistical
significance of the
result.
In the face of difficulties associated with the use of E. coli RecA in mitotic
gene
targeting, alternative enzymes have been used to catalyse homologous sister
chromatic exchange
in mitotic cells. For example, U.S. Patent Nos. 5,780,296 and 5,945,339
disclose methods to
promote homologous recombination using Rec2 as an alternative recombinase to
overcome
problems with the use of RecA [86]. It has been reported that overexpression
of human RAD51
(hRAD51) can increase gene targeting frequency by 2-3 fold [85].
In applications other than gene targeting in mitotic cells, other studies have
suggested that
increased expression of E. coli RecA or RADS 1 may increase the resistance of
cells to radiation
or other DNA damaging agents [64;82;85;87-89], and enhance the frequency of
intrachromosomal recombination [88;90;91] and sister-chromatid exchange [82].
It has also
4
CA 02319247 2000-11-14
been suggested that increased RAD51 activity during meiosis has no effect on
the viability of
gametes, although no evaluation of homologous recombination in these cells was
conducted [87].
Identification of mechanistic steps in meiotic homologous recombination has
utilized genetic
analysis of mutants to identify genes involved in homologous recombination and
DNA repair,
and mutants with reduced meiotic homologous recombination have been identified
[9;20;23;93].
Null-mutations typically have a severe effect on the whole meiotic process,
and can affect
viability of gametes [9;20;54;55;93-95] and have pleiotropic effects on the
organism at different
developmental stages or in different tissues. For example, rad51 null mutants
may have
decreased meiotic homologous recombination frequency but they also reportedly
have poor
DNA repair and resistance to environmental stresses and DNA damaging agents
[96;97], as well
as a lethal phenotype in embryos [95].
SUMMARY OF THE INVENTION
The present invention recognizes the need in the art for methods of modifying
the
frequency of non-sister chromatid exchange in meiosis to facilitate heritable
genomic changes
during gamete formation, for example to facilitate breeding of plants and
animals and for meiotic
gene targeting. The invention provides methods of modifying the level of
expression or
functional activity of factors such as enzymes or structural proteins, alone
or in concert, to
modify the frequency of meiotic homologous recombination involving the
exchange of genetic
information between non-sister chromatids from homologous maternal and
paternal
chromosomes. The steps at which modulation may occur include: double strand
break
formation; resection; strand invasion; and resolution.
In one aspect, the invention provides methods of increasing meiotic homologous
recombination in a eukaryote, comprising transforming a eukaryotic cell with a
nucleic acid
encoding an activator of meiotic homologous recombination. The nucleic acid
encoding the
activator of meiotic homologous recombination may be operably linked to a
promoter, so that the
transformed eukaryotic cell is capable of expressing the activator of meiotic
homologous
recombination. The transformed eukaryotic cell, or its progeny, may then be
allowed to undergo
meiosis to produce viable gametes under conditions wherein the activator of
meiotic homologous
recombination is active during meiosis to increase the frequency of homologous
non-sister
chromatid exchange. In alternative embodiments, the activator of meiotic
homologous
5
CA 02319247 2000-11-14
recombination may be an enzyme involved in meiotic homologous recombination,
such as a
eukaryotic homologue of SPO11 [9-11], MRE11 [12-15], RAD50 [16;17], XRS2/NBS1
[18;19],
DMC1 [20-22], RAD51 [21;23-25], RPA [26], MSH4 [27;28], MSHS [29;30], MLH1 [31-
33],
RAD52 [34;35], RAD54 [36;37], RAD55 [38;39], RAD57 [39;40], Rad59 [41;42] or
Resolvase
[43;44]. In some embodiments, the frequency of mitotic homologous sister
chromatid exchange
in the eukaryote is not increased, while the frequency of meiotic homologous
recombination is
increased. The promoter may be inducible or may be a meiosis-specific
promoter. The invention
includes non-human eukaryotes produced by such processes.
In alternative aspects, the invention provides methods of selectively
inhibiting meiotic
homologous recombination in a eukaryote. Such methods may involve transforming
a eukaryotic
cell with a nucleic acid encoding an inhibitor of meiotic recombination. The
nucleic acid
encoding the inhibitor of meiotic recombination may be operably linked to an
inducible or
meiosis-specific promoter, so that the transformed eukaryotic cell may be
capable of expressing
the inhibitor of meiotic recombination. The transformed eukaryotic cell, or a
descendant of the
transformed eukaryotic cell, may then be allowed to undergo meiosis to produce
viable gametes
under conditions wherein the inhibitor of meiotic recombination is active
during meiosis to
decrease the level of homologous non-sister chromatid exchange. The inhibitor
of meiotic
recombination may be a dominant-negative mutant of an enzyme involved in
meiotic
homologous recombination. In some embodiments, the frequency of mitotic
homologous sister
chromatid exchange in the eukaryote may not be decreased, while meiotic
homologous
recombination is increased. The invention includes non-human eukaryotes
produced by such
processes.
In alternative aspects, the invention provides methods of plant and animal
breeding, in
which the frequency of non-sister chromatid exchange in meiotic homologous
recombination is
modulated, prior to crossing a gamete from the parent organism with a second
gamete to obtain
progeny. The invention includes non-human eukaryotes produced by such
processes.
The invention also provides methods of genomic mapping comprising modulating
the
frequency of non-sister chromatid exchange in meiotic homologous recombination
in a first cell,
crossing the first cell with a second cell, and measuring the genetic linkage
between markers in a
progeny cell.
6
CA 02319247 2000-11-14
DETAILED DESCRIPTION OF THE INVENTION
In one aspect of the invention, the frequency of homologous recombination
between non-
sister chromatids during meiosis is increased or decreased by specifically
changing the activity
level of one or more activators or inhibitors of meiotic homologous
recombination, such as
proteins involved in homologous recombination, to affect one or more steps of
the homologous
recombination process.
Taking advantage of the fact that meiotic homologous recombination between
homologous non-sister chromatids first requires a DSB in one of the paired
homologues, one
aspect of the present invention facilitates an increase the potential for
homologous recombination
events by increasing the number of DSB's. This may for example be achieved by
increasing the
level of SPO11 activity during appropriate stages in meiosis or other
appropriate stages in the
cell cycle. Conversely, one may reduce the frequency of homologous
recombination during
meiosis by suppressing the function or expression of SPO11 at appropriate
stages in meiosis, to
decrease the number of DSB's available and, therefore, decrease the frequency
of initiating DNA
exchange between homologous chromosomes during meiosis.
In alternative embodiments, meiotic homologous recombination frequency may be
modified by modifying the activity level of enzymes involved in resection of
double-stranded
DNA (dsDNA) to create ssDNA ends required for strand invasion of the paired
homologous
chromosome. Thus, activity of MRE11, RAD50 and/or XRS2/NBS1 could be increased
to
promote creation of recombinogenic ssDNA by increasing the number of DSB's
created by
SPO11 being converted into recombinogenic ssDNA, to increase the frequency of
meiotic
homologous recombination. Conversely, frequency of meiotic homologous
recombination may
be decreased by reducing the activity of MRE11, RAD50 and/or XRS2/NBS1 so as
to decrease
the conversion of DSB's created by SPO11 into recombinogenic ends. In
addition, modifying
the resection process may be used to increase gene targeting frequency by
promoting conversion
of gene targeting substrates to DNAs having recombinogenic ends, for example
by increased
activity of MRE11, RAD50 and/or XRS2/NBS1.
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the activity of enzymes and structural proteins
involved in pairing of
homologous DNA and strand invasion. Thus, activity of RecA homologues such as
RAD51 and
7
CA 02319247 2000-11-14
DMC 1 may be increased in meiosis to promote homologous DNA pairing of non-
sister
chromatids and initiation of crossovers by strand invasion. Increased activity
levels of these
proteins may increase conversion of recombinogenic ends created by MRE11,
RAD50 and
XRS2/NBS1 into functional crossover events thereby increasing homologous
recombination
frequency. Because RAD51 and DMC1 act in unique but overlapping pathways [53],
one may
modulate the homologous recombination frequency and frequency of NSCE by
increasing the
activity of DMC 1 and RADS 1 individually or in concert. Conversely, the
activity level of
DMC 1 and RADS 1 alone or in concert may be decreased to decrease the
frequency of NSCE.
Other RecA homologues such as RADSS and RAD57 may also be used in this way in
meiosis.
In addition, other proteins participating in homologous DNA pairing and strand-
invasion, such as
MSH4, MSHS and MLH1, may be used to increase or decrease meiotic homologous
recombination frequency through modulating their activity levels at
appropriate stages of
meiosis. ssDNA-binding proteins such as RPA/RFA which function coordinately
with RecA
homologues may also be used to modulate homologous recombination frequency.
For example,
during meiosis, reducing the level of RPA/RFA in the nucleus or the function
of RPA/RFA
within the nucleus may affect the activity of RecA homologues during meiosis
and change the
homologous recombination frequency.
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the activity of proteins that act in conjunction with
RecA homologues
to promote DNA pairing and crossing-over. For example, meiotic homologous
recombination
may be increased by increasing activity level of RAD54 and TID1, alone or in
concert,
independently or coordinately with RAD51 and/or DMC1 (RAD51 activity is
stimulated in vitro
by inclusion of RAD54 [66] and TID1 is a homologue of RAD54 that physically
interacts with
DMC1 [53]). Conversely, meiotic homologous recombination frequency may be
decreased by
reduction of expression or activity level of RAD54 and/or DMC 1. In some
embodiments,
homologous recombination frequency may be modulated by regulating the
expression and
functional activity of these four proteins independently or in different
permutations. This
approach of modulating recombination frequency may also be used with other
proteins that
physically interact directly or indirectly and modify the activity of RecA
homologues functioning
during meiosis.
8
CA 02319247 2000-11-14
In alternative embodiments, meiotic homologous recombination frequency may be
modulated by modifying the activity level of resolvase. Thus, activity of
resolvase may be
increased to promote resolution of crossovers thereby increasing the exchange
of genetic
information between non-sister chromatids. It has been reported that, of the
total number of
crossovers initiated between homologous chromosomes during meiosis, only a
fraction are
resolved to result in actual exchange of genetic information between the
homologous
chromosomes, with the rest dissolving without causing exchange of genetic
information [72]. In
another aspect of the invention, meiotic homologous recombination frequency
may be decreased
by reducing the level or functional activity of resolvase during meiosis.
In alternative embodiments, the activator or inhibitor of meiotic homologous
recombination may be an anti-sense molecule. Anti-sense oligonucleotides,
including anti-sense
RNA molecules and anti-sense DNA molecules, generall act to block the
translation of mRNA
by binding to targeted mRNA and inhibiting protein translation from the bound
mRNA. For
example, anti-sense oligonucleotides complementary to regions of a DNA
sequence encoding an
enzyme involved in meiotic homologous recombination, such as DMCl, may be
expressed in
transformed plant cells during development to down-regulate the enzyme.
Alternative methods
of down-regulating protein expression may include the use of ribozymes or
other enzymatic
RNA molecules (such as hammerhead RNA structures) that are capable of
catalyzing the
cleavage of RNA (as disclosed in U.S. Patent Nos. 4,987,071 and 5,591,610,
incorporated herein
by reference). The mechanism of ribozyme action generally involves sequence
specific
hybridization of the ribozyme molecule to complementary target RNA , followed
by
endonucleolytic cleavage.
It is well known in the art that some modifications and changes can be made in
the
structure of a polypeptide without substantially altering the biological
function of that peptide, to
obtain a biologically equivalent polypeptide. In one aspect of the invention,
proteins that
modulate meiotic recombination may differ from a portion of the corresponding
native sequence
by conservative amino acid substitutions. As used herein, the term "conserved
amino acid
substitutions" refers to the substitution of one amino acid for another at a
given location in the
peptide, where the substitution can be made without loss of function. In
making such changes,
substitutions of like amino acid residues can be made, for example, on the
basis of relative
similarity of side-chain substituents, for example, their size, charge,
hydrophobicity,
9
CA 02319247 2000-11-14
hydrophilicity, and the like, and such substitutions may be assayed for their
effect on the
function of the peptide by routine testing. In some embodiments, conserved
amino acid
substitutions may be made where an amino acid residue is substituted for
another having a
similar hydrophilicity value (e.g., within a value of plus or minus 2.0),
where the following
hydrophilicity values are assigned to amino acid residues (as detailed in
United States Patent No.
4,554,101, incorporated herein by reference): Arg (+3.0); Lys (+3.0); Asp
(+3.0); Glu (+3.0); Ser
(+0.3); Asn (+0.2); Gln (+0.2); Gly (0); Pro (-0.5); Thr (-0.4); Ala (-0.5);
His (-0.5); Cys (-1.0);
Met (-1.3); Val (-1.5); Leu (-1.8); Ile (-1.8); Tyr (-2.3); Phe (-2.5); and
Trp (-3.4). In alternative
embodiments, conserved amino acid substitutions may be made where an amino
acid residue is
substituted for another having a similar hydropathic index (e.g., within a
value of plus or minus
2.0). In such embodiments, each amino acid residue may be assigned a
hydropathic index on the
basis of its hydrophobicity and charge characteristics, as follows: Ile
(+4.5); Val (+4.2); Leu
(+3.8); Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); Gly (-0.4); Thr (-
0.7); Ser (-0.8); Trp (-
0.9); Tyr (-1.3); Pro (-1.6); His (-3.2); Glu (-3.5); Gln (-3.5); Asp (-3.5);
Asn (-3.5); Lys (-3.9);
and Arg (-4.5). In alternative embodiments, conserved amino acid substitutions
may be made
where an amino acid residue is substituted for another in the same class,
where the amino acids
are divided into non-polar, acidic, basic and neutral classes, as follows: non-
polar: Ala, Val, Leu,
Ile, Phe, Trp, Pro, Met; acidic: Asp, Glu; basic: Lys, Arg, His; neutral: Gly,
Ser, Thr, Cys, Asn,
Gln, Tyr.
Various aspects of the present invention encompass nucleic acid or amino acid
sequences
that are homologous to other sequences. As the term is used herein, an amino
acid or nucleic acid
sequence is "homologous" to another sequence if the two sequences are
substantially identical
and the functional activity of the sequences is conserved (for example, both
sequences function
as or encode a selected enzyme or promoter function; as used herein, the term
'homologous' does
not infer evolutionary relatedness). Nucleic acid sequences may also be
homologous if they
encode substantially identical amino acid sequences, even if the nucleic acid
sequences are not
themselves substantially identical, a circumstance that may for example arise
as a result of the
degeneracy of the genetic code.
Two nucleic acid or protein sequences are considered substantially identical
if, when
optimally aligned, they share at least about 70% sequence identity. In
alternative embodiments,
sequence identity may for example be at least 75%, at least 90% or at least
95%. Optimal
CA 02319247 2000-11-14
alignment of sequences for comparisons of identity may be conducted using a
variety of
algorithms, such as the local homology algorithm of Smith and Waterman,1981,
Adv. Appl. Math
2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J.
Mol. Biol.
48:443, the search for similarity method of Pearson and Lipman, 1988, Proc.
Natl. Acad. Sci.
USA 85: 2444, and the computerised implementations of these algorithms (such
as GAP,
BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, Madison, WI, U.S.A.). Sequence alignment may also be carried
out using the
BLAST algorithm, described in Altschul et al., 1990, J. Mol. Biol. 215:403-10
(using the
published default settings). Software for performing BLAST analysis may be
available through
the National Center for Biotechnology Information (through the Internet at
htt~//www.ncbi.nlm.nih.~ov/). The BLAST algorithm involves first identifying
high scoring
sequence pairs (HSPs) by identifying short words of length W in the query
sequence that either
match or satisfy some positive-valued threshold score T when aligned with a
word of the same
length in a database sequence. T is referred to as the neighbourhood word
score threshold. Initial
neighbourhood word hits act as seeds for initiating searches to find longer
HSPs. The word hits
are extended in both directions along each sequence for as far as the
cumulative alignment score
can be increased. Extension of the word hits in each direction is halted when
the following
parameters are met: the cumulative alignment score falls off by the quantity X
from its maximum
achieved value; the cumulative score goes to zero or below, due to the
accumulation of one or
more negative-scoring residue alignments; or the end of either sequence is
reached. The BLAST
algorithm parameters W, T and X determine the sensitivity and speed of the
alignment. The
BLAST programs may use as defaults a word length (W) of 11, the BLOSUM62
scoring matrix
(Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919)
alignments (B) of
50, expectation (E) of 10 (which may be changed in alternative embodiments to
1 or 0.1 or 0.01
or 0.001 or 0.0001; although E values much higher than 0.1 may not identify
functionally similar
sequences, it is useful to examine hits with lower significance, E values
between 0.1 and 10, for
short regions of similarity), M=5, N=4, for nucleic acids a comparison of both
strands. For
protein comparisons, BLASTP may be used with defaults as follows: G=11 (cost
to open a gap);
E=1 (cost to extend a gap); E=10 (expectation value, at this setting, 10 hits
with scores equal to
or better than the defined alignment score, S, are expected to occur by chance
in a database of the
same size as the one being searched; the E value can be increased or decreased
to alter the
11
CA 02319247 2000-11-14
stringency of the search.); and W=3 (word size, default is 11 for BLASTN, 3
for other blast
programs). The BLOSUM matrix assigns a probability score for each position in
an alignment
that is based on the frequency with which that substitution is known to occur
among consensus
blocks within related proteins. The BLOSUM62 (gap existence cost = 11; per
residue gap cost =
1; lambda ratio = 0.85) substitution matrix is used by default in BLAST 2Ø A
variety of other
matrices may be used as alternatives to BLOSUM62, including: PAM30 (9,1,0.87);
PAM70
(10,1,0.87) BLOSUM80 (10,1,0.87); BLOSUM62 (11,1,0.82) and BLOSUM45
(14,2,0.87). One
measure of the statistical similarity between two sequences using the BLAST
algorithm is the
smallest sum probability (P(N)), which provides an indication of the
probability by which a
match between two nucleotide or amino acid sequences would occur by chance. In
alternative
embodiments of the invention, nucleotide or amino acid sequences are
considered substantially
identical if the smallest sum probability in a comparison of the test
sequences is less than about
1, preferably less than about 0.1, more preferably less than about 0.01, and
most preferably less
than about 0.001.
An alternative indication that two nucleic acid sequences are substantially
identical is that
the two sequences hybridize to each other under moderately stringent, or
preferably stringent,
conditions. Hybridization to filter-bound sequences under moderately stringent
conditions may,
for example, be performed in 0.5 M NaHP04, 7% sodium dodecyl sulfate (SDS), 1
mM EDTA at
65°C, and washing in 0.2 x SSC/0.1% SDS at 42°C (see Ausubel, et
al. (eds), 1989, Current
Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc., and
John Wiley &
Sons, Inc., New York, at p. 2.10.3). Alternatively, hybridization to filter-
bound sequences under
stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% SDS, 1
mM EDTA
at 65°C, and washing in 0.1 x SSC/0.1% SDS at 68°C (see Ausubel,
et al. (eds), 1989, supra).
Hybridization conditions may be modified in accordance with known methods
depending on the
sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry
and Molecular
Biology -- Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview
of principles of
hybridization and the strategy of nucleic acid probe assays", Elsevier, New
York). Generally,
stringent conditions are selected to be about 5°C lower than the
thermal melting point for the
specific sequence at a defined ionic strength and pH.
In some embodiments, the invention provides methods of increasing meiotic
homologous recombination in the context of methods for breeding agricultural
species, and
12
CA 02319247 2000-11-14
plants and animals produced by such processes. Increased recombination
frequency may be
desirable to facilitate breeding of agricultural species, for example by
facilitating the
reassortment of alleles at tightly linked genetic loci. Where breeding stock
are modified to
increase the level of meiotic homologous recombination, for example,
identification of progeny
which have lost an undesirable allele at a genetic locus of interest may be
reduced.
One aspect of the invention involves the modulation of meiotic homologous
recombination frequency in plant breeding, for example of Brassica sp. In a
prophetic example of
such an embodiment, the following conditions may apply:
a) Locus 1: -controls a quality trait such as saturated fatty acid content in
seed oil.
-allele "A" confers high saturate content, which is undesirable.
-allele "a" confers low saturate content, which is desirable by the consumer.
b) Locus 2: -controls the agronomic trait of lodging which is related to stem
rigidity.
-allele "B" confers a weak stem which results in lodging of the crop causing
it to be
difficult to harvest.
-allele "b" confers a rigid stem resulting in an upright plant at maturity
that increases
harvestability with reduced seed loss.
c) Variety X under development has the genotype "aB/aB" conferring a desirable
oil
properties but poor harvestiblity because of susceptibility to lodging.
d) Accession line Z has the genotype "Ab/Ab" giving it the properties of poor
oil quality
but lodging resistance.
e) Locus 1 and 2 have tight genetic linkage to each other.
f) Goal: To remove the deleterious "B" allele at Locus 2 from Variety X and
transfer
into Variety X the lodging resistance trait conferred by the "b" allele at
Locus 2 in Accession
Line Z using sexual crosses between Variety X and Accession Z.
In such an example, with natural levels of meiotic recombination frequency, a
large
population may be required to represent a gamete with the desired "ab"
genotype in the progeny
resulting from the F 1 plant. This is because Locus l and 2 are tightly linked
resulting in few
crossover events between the two loci carried by homologous chromosomes from
Variety X and
Accession Z in the F 1 hybrid. Using the present invention to provide an
increased meiotic
homologous recombination frequency, the representation of the "ab" gamete in
the progeny from
the F1 may be increased. This is because increased homologous recombination
potential results
13
CA 02319247 2000-11-14
in more crossover events throughout the genome of the F1 hybrid. As a result,
there is a greater
chance of crossovers to occur between Locus 1 and 2 leading to an increased
frequency of
exchange of the alleles "a" and "b" between the homologous chromosomes from
Variety X and
Accession Z. Thus the frequency of the "ab" gamete in the progeny will be
increased versus that
found under conditions of natural recombination frequency.
In one aspect of the invention, Variety X may be engineered to have increased
meiotic
homologous recombination potential. The 'enhanced recombination factor'
conferring the
increased homologous recombination potential may be detectable by a molecular
marker.
Variety X may then be sexually crossed with Accession Z and the resulting
hybrid will have
increased recombination potential. During gamete formation by this F1,
frequency of crossovers
and exchange of genetic information between homologous chromosomes from
Variety X and
Accession Z will be increased versus the wild-type situation. As a result,
there will be increased
chance of exchange between Locus 1 and 2 resulting in increased frequency of
gametes with the
desired "ab" genotype. Representation of the "ab" genotype in the F 1 progeny
will thus be
increased versus the wild-type situation. When plants of interest carrying the
"ab" genotype are
found in the progeny, the factor conferring increased recombination frequency
can be removed
by backcrossing to Variety X. During gamete formation in this new plant
meiotic homologous
recombination and/or independent assortment of chromosomes during meiosis will
cause the
'enhanced recombination factor' to segregate from Locus 1 and 2. By using
molecular markers,
the resultant progeny can be screened to identify plants which retain the "ab"
genotype but no
longer carry the 'enhanced recombination factor' and, thus, these plants will
be restored to wild-
type levels of meiotic homologous recombination.
If meiotic homologous recombination frequency is artificially increased during
this
breeding procedure, in accordance with the present invention, recombinants
between the two loci
would be at a higher frequency in the progeny, and the breeder may more
rapidly develop a new
variety.
An alternative aspect of the invention involves increasing meiotic homologous
recombination to enhance efficiency of genetic mapping and map-based cloning,
for example in
agricultural species. Genetic distance between chromosomal loci is governed by
meiotic
recombination frequency between homologous chromosomes on which the loci under
consideration are located. By monitoring the frequency of co-inheritance of
phenotypic or
14
CA 02319247 2000-11-14
molecular markers corresponding to the loci under consideration, the distance
and order of the
loci can be estimated. If two loci, 1 and 2, are on the same chromosome but
are physically
separated by a large region of the chromosome, numerous opportunities exist
for recombination
events to occur along this long stretch of DNA to combine alleles carried by
the maternal and
paternal chromosomes at these loci. The loci are considered linked if the
frequency of new
combinations of maternal and paternal alleles at Loci l and 2 observed in the
progeny is less than
50% and the genetic distance between the two loci corresponds to this
frequency. If Loci 1 and 3
are physically closer to one another along the chromosome than Loci 1 and 2,
then there is less
chance of recombination to occur between these loci to make new combinations
of maternal and
paternal alleles at Loci l and 3. Again, this is determined by observing the
frequency of
coinheritance of allelic combinations in the progeny. By determining the
frequency of
combinations of alleles at Loci 1, 2 and 3 in the progeny, genetic distance
and order of the loci
can be determined. For example, if combinations of maternal and paternal
alleles at locus 1 and 2
are found in the progeny at a frequency of 40%, and combinations between locus
2 and 3 are
found to be 25%, but combinations between 1 and 3 are found to be 15%, then
the order of the
loci is 1-3-2 with map distances between the ordered loci being 15 and 25
units. This type of
information can be compiled for loci conferring phenotypic effects as well as
loci corresponding
to molecular markers such as RFLP's RAPD's, AFLP's, SNP's, and microsatellites
[98-100].
Detailed genetic maps can be determined for agricultural organisms. In this
manner, for
example, molecular markers can be linked to desirable traits. The markers can
then be used to
assist breeders in transferring desirable traits to varieties that are
released to producers.
Reliance on natural levels of meiotic homologous recombination frequency to
determine
the distance between markers may present difficulties with existing mapping
techniques. For
example, two markers may be deemed as genetically linked but could still be
physically
separated by very long stretches of DNA. This could cause problems when trying
to exploit the
markers for monitoring the transfer of a desirable trait to a targeted variety
by breeding. For
example, a molecular marker may be deemed to be linked to a trait of interest
even if the
physical distance between the marker and trait is still large enough to allow
recombination
between the marker and loci responsible for the trait, albeit at a level which
was not detectable in
the original experiments linking the marker to the trait. If the marker is
used to monitor the
breeding of the trait into a target variety, inheritance of the marker may not
ensure inheritance of
CA 02319247 2000-11-14
the desired trait because recombination may occur between the marker and the
trait locus. As a
result, several lines may be carried forward through the breeding program
which are believed to
carry the desired trait, as indicated by presence of the molecular marker,
when in fact the lines
actually do not carry the trait due to segregation between the marker and the
trait locus. In an
aspect of the present invention, increased meiotic homologous recombination
frequency may be
used to create genetic maps with higher precision estimates of genetic
distance.
Genetic maps defined with molecular markers may also be used to clone genes
responsible for traits of interest. This process of map-based gene cloning
involves linking
molecular markers to the desired trait by determining the frequency of co-
inheritance of
molecular markers with the trait [98-100]. Once a marker has been found which
is inherited at
high frequency with the target trait, it can be used as a molecular probe to
screen a DNA library
of the organism to identify a fragment of DNA which encodes the cognate gene.
One major
difficulty with map-based gene cloning is that the relationship between
genetic distance and
physical distance can vary between species and even between different regions
of the genome in
a given species. Therefore a molecular marker may show absolute linkage to the
target trait
locus but it may be physically hundreds of kilobases away from the actual gene
of interest. This
makes identifying and cloning the actual gene responsible for the trait
difficult because there
may be vast stretches of DNA to evaluate in order to identify the gene. In
addition, one might
map more than one molecular marker showing absolute linkage to the target
trait locus.
However, using a reasonable population size, it may not be possible to
identify which marker is
physically closer to the target gene. Thus, one marker may be 10 kilobases
from the target gene
and the other is 400 kilobases from the target gene, and with conventional
methods relying on
natural levels of recombination frequency there may be no way of
differentiating which of the
two markers should be used to most efficiently clone the target gene. It would
therefore be
beneficial to map-based cloning projects to utilize the present invention to
provide elevated
meiotic homologous recombination levels so as to increase precision in
determining genetic
distance between molecular markers and target trait loci.
In an alternative aspect, the invention provides methods of decreasing meiotic
homologous recombination, for example to enhance efficiency of breeding
agricultural species.
Decreased recombination frequency may be desirable in directed breeding of
agricultural species
to promote linkage drag, thereby maintaining genotypic integrity during sexual
crosses
16
CA 02319247 2000-11-14
conducted to introgress desirable traits. This may for example reduce the
number of backcrosses
required to restore the genotype of the recurrent parent. For example, in
plant breeding of
Brassica sp., the following conditions may apply:
a) Variety X: -has favourable quality and agronomic characteristics and is an
established
variety in the industry.
-is susceptible to a disease due to allele "A" at Locus 1.
b) Accession Z: -has poor quality and agronomic characteristics.
-is disease resistant due to allele "a" at Locus 1.
c) Goal: To transfer disease resistance trait from Accession Z to Variety X
and maintain
all of the favourable quality and agronomic characteristics of Variety X.
A conventional approach might involve a sexual cross between Variety X and
Accession
Z in an attempt to transfer the disease resistance trait to Variety X. During
meiosis in the F1
plant, natural levels of recombination between Variety X and Accession Z
homologous
chromosomes may result in extensive mixing of the two genomes. This may indeed
combine the
favourable disease resistance allele "a" from Accession Z with a Variety Z
chromosome.
However, many detrimental alleles responsible for poor quality and agronomic
characteristics are
may also be transferred from the X to Z genome. This may necessitate several
rounds of
backcrossing the hybrid plant to Variety Z, the recurrent parent, to restore
the favourable
characteristics of Variety Z while selecting for the disease resistance allele
introduced from
Accession X. To restore the original genotype of Variety X might require in
excess of ten
backcross generations. Using the present invention, it may be desirable to
expedite the process
of variety development through the use of plants with modified meiotic
homologous
recombination frequency. An engineered decrease in meiotic homologous
recombination
frequency may be used to reduce the mixing of genomes and genetic information
between
Variety X and Accession Z, to provide a higher frequency of progeny from the
initial hybrid
which have the "a" allele conferring disease resistance transferred to the
Variety X chromosome
with the rest of the Variety X genome largely intact.
In alternative embodiments, variety X may be engineered to have decreased
meiotic
homologous recombination potential. The 'suppressed recombination factor'
conferring the
decreased homologous recombination potential may be detectable by a molecular
marker.
Variety X may then be sexually crossed with Accession Z, so that the resulting
hybrid will have
17
CA 02319247 2000-11-14
decreased recombination potential. During gamete formation by this F 1 plant,
the frequency of
meiotic crossovers and exchange of genetic information between homologous
chromosomes
from Variety X and Accession Z will be decreased compared to the wild-type
fequency. As a
result, there may be decreased amounts of genetic information transferred from
the Accession Z
genome into the Variety X genome. The frequency of Fl progeny plants
containing high
proportions of the Variety X genome and its favourable characteristics plus
disease resistance
may be increased versus that possible with wild-type levels of meiotic
homologous
recombination. When such plants are identified, they may be backcrossed to
Variety X to
remove vestiges of the Accession Z genome. During gamete formation in such a
plant, meiotic
homologous recombination and/or independent assortment of chromosomes during
meiosis may
cause the inhibitor of meiotic recombination to segregate from the disease
resistance gene. By
using molecular markers, the resultant progeny may be screened to identify
plants which retain
the disease resistance gene in the favourable Variety X genome but no longer
carry the inhibitor
of meiotic recombination, so that these plants may be restored to wild-type
levels of meiotic
homologous recombination.
In an alternative aspect, the invention provides methods to increase meiotic
homologous
recombination leading to enhanced efficiency of gene targeting. Gene targeting
has been
successfully applied in a variety of eukaryotic species including fungi [101],
plants [82;102-104]
and lower [105;106] and higher animals [63;85;107]. Gene targeting strategies
generally involve
only vegetative/somatic cells undergoing mitosis. Gene targeting frequency in
such cells may
for example be promoted by RecA-type enzymes [63;82;85;86]. In contrast, the
present
invention may be used to increase recombination potential in meiotic cells to
enhance gene
targeting frequency. In one aspect of the present invention, increasing more
than one meiotic
homologous recombination function (e.g. RAD51 and DMC1) may have a synergistic
effect on
increasing meiotic homologous recombination. In general, homologous
recombination activities
are at an elevated state in meiotic cells compared to mitotic cells in which
recombination
activities must generally be induced by DNA damage, so that gene targeting
frequency may be
significantly enhanced when a gene targeting substrate is provided to meiotic
cells at appropriate
stages in accordance with the present invention.
In one aspect of the present invention, increasing gene targeting frequency by
performing the process in meiotic cells may facilitate the rapid generation of
homozygous lines
18
CA 02319247 2000-11-14
with targeted changes. In this aspect, the gene targeting event may occur at
meiosis I, resulting in
four gametes, each of which may have the targeted change. In plants and other
monoecious
organisms where both male and female gametes are produced by the same
individual, simply
self crossing the individual may result in a high frequency of diploid progeny
which are
homozygous for the targeted genetic change. In addition, in the case of
plants, one may obtain
individuals homozygous for the targeted genetic change by performing
microspore culture after
delivering gene targeting substrate to the meiotic cells. Microspores are
haploid cells resulting
from meiosis in the plant anther. These cells may be cultured to regenerate
entire plants. The
plants may be chemically treated to create a diploid chromosome content so
that they are
homozgous for all genetic information. Therefore, microspores carrying the
targeted genetic
change as a result of treating meiotic cells with gene targeting substrate may
be cultured and
converted into plants that are homozygous for the targeted change.
Alternatively, where male
and female gametes are produced by different individuals, the gene targeting
process may be
done simultaneously in both a male and female plant, so that the male and
female plants may be
crossed. The gene targeting methods of the invention may be contrasted with
conventional gene
targeting strategies, in which transformed organisms are hemizygous for the
targeted change,
resulting in a need for further crosses to generate homozygous progeny,
conventional gene
targeting strategies also generally rely on methods for regenerating organisms
from transformed
totipotent cells [82;102-104].
In one aspect of the invention, targeted changes in either maternal or
paternal
chromosomes may be obtained by delivering gene targeting substrate
specifically to either
female or male reproductive organs. This is not possible with conventional
strategies that target
somatic cells. Specific targeting of maternal or paternal derived chromosomes
may for example
be used to investigate and exploit such epigenetic processes as parental
genomic imprinting.
In some aspects of the invention, transformed plant cells may be cultured to
regenerate
whole plants having a transformed genotype and displaying a desired phenotype,
as for example
modified by the expression of a heterologous protein mediated by a
transcriptional regulatory
region of the invention. A variety of plant culture techniques may be used to
regenerate whole
plants, such as are described in Gamborg and Phillips, "Plant Cell, Tissue and
Organ Culture,
Fundamental Methods", Springer Berlin, 1995); Evans et al. "Protoplasts
Isolation and Culture",
Handbook of Plant Cell Culture, Macmillian Publishing Company, New York, 1983;
or Binding,
19
CA 02319247 2000-11-14
"Regeneration of Plants, Plant Protoplasts", CRC Press, Boca Raton, 1985; or
in Klee et al.,
Ann. Rev. ofPlant Phys. 38:467 (1987). A cell, tissue, organ, or organism into
which has been
introduced a foreign nucleic acid, is considered "transformed", "transfected",
or "transgenic". A
transgenic or transformed cell or organism also includes progeny of the cell
or organism and
progeny produced from a breeding program employing a transgenic plant as a
parent in a cross
and exhibiting an altered phenotype resulting from the presence of a
recombinant nucleic acid
construct. A transgenic plant is therefore a plant that has been transformed
with a heterologous
nucleic acid, or the progeny of such a plant that includes the transgene. The
invention provides
vectors, such as vectors for transforming plants or plant cells. The term
"vector" in reference to
nucleic acid molecule generally refers to a molecule that may be used to
transfer a nucleic acid
segments) from one cell to another. One of skill will recognize that after the
nucleic acid is
stably incorporated in transgenic plants and confirmed to be operable, it can
be introduced into
other plants by sexual crossing. Any of a number of standard breeding
techniques may be used,
depending upon the species to be crossed.
In various embodiments, the invention comprises plants or animals transformed
with the
nucleic acids of the invention. Accordingly, an aspect of the invention
relates to transformed
embodiments of all higher plants, including monocots and dicots, such as
species from the
genera Fragaria. Lotus, Medicago, Onobrychis, Triforium, Trigonelia, Wgna,
Citrus, Linum.
Geranium, Manihot, Caucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa,
Capsicum,
Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana,
Cichorium,
Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocatlis, Nemesia,
Pelargonium,
Panicum, Penniserum, Ranunculus, Senecio, Salpiglossis, Cucarnis, Browallia,
Glycine, Lolium,
Zea, Triticum, Sorghum, and Datura.
In one aspect, the invention includes mechanisms for achieving meiosis-
specific
expression or activity of factors that modulate meiotic homologous
recombination. In one aspect,
this may involve the use of meiosis-specific promoters operably linked to a
gene of interest for
expression during meiosis. Examples of such promoters may be found in the
meiotic
recombination factor genes described herein, including homologues obtainable
from species
from yeast to plants and animals. Specific examples of published promoters
tested to be meiosis-
specific are DMC1 and MSH4. Additional promoter may be obtainable from genes
that are
expressed in meiosis-specific manner see [21J or genes that are induced during
meiosis [136].
CA 02319247 2000-11-14
Meiosis-specific promoters may include promoters active in penultimate
vegetative cells or
germ-line cells which directly lead to meiotic cells, wherein expression is
mediated sufficiently
close to meiotic onset. New promoters may be engineered to be meiosis-
specific, such as
promoters that are initially active in both mitotic and meiotic cells. Such
promoters may be
modified by deletion of mitotic expression elements so that they become
meiosis-specific.
Certain transcription factors (e.g. NDT80) and promoter consensus sequences
(e.g. URS1) are
understood to be responsible for meiosis-specific expression [136].
Constitutive or vegetatively active promoters may be converted to meiosis-
specific
promoters by modifying the promoter to contain the recognition sequences for
meiosis-specific
transcription factors and to be active only when the promoter binds these
transcription factors.
Bipartite promoters may be used to provide meiosis-specific expression.
Bipartite
systems consists of 1 ) a minimal promoter containing a recognition sequence
for 2) a specific
transcription factor. The bipartite promoter is inactive unless it is bound by
the transcription
factor. The gene of interest may be placed behind the minimal promoter so that
it is not
expressed, and the transcription factor may be linked to a meiosis-specific
promoter. The
transcription factor may be naturally occurring promoter or a hybrid promoter
composed of a
DNA-binding domain and a transcription-activating domain. Because the activity
of the minimal
promoter is dependent upon binding of the transcription factor, the operably-
linked coding
sequence will not be expressed in vegetative cells. In meiotic cells, the
meiosis-specific
promoter will be turned on facilitating expression of the transcription
factor. The transcription
factor will act in trans and bind to the DNA recognition sequence in the
minimal promoter via
the cognate DNA-binding domain. The activation domain of the transcription
factor will then be
in the appropriate context to aid recruitment of RNA polymerase and other
components of the
transcription machinery. This will cause transcription of the target gene.
With this bipartite
system, the gene of interest will only be expressed in cells entering or
undergoing meiosis the
necessary transcription factor is linked to a meiosis-specific promoter and
will only be expressed
at the desired developmental stage (i.e. the target gene will be expressed in
a spatial and
temporal pattern mirroring the meiosis-specific promoter expressing the
transcription factor). In
addition, a bipartite system could be used to coordinate expression of more
than one gene during
meiosis. Different genes could be placed behind individual minimal promoters
all of which have
the same recognition sequence for a specific transcription factor and whose
expression, therefore,
21
CA 02319247 2000-11-14
is reliant upon the presence of the transcription factor. The transcription
factor is linked to a
meiosis-specific promoter. Therefore, when cells enter meiosis, the promoter
expressed the
transcription factor which then can coordinately activate expression of the
suite of target genes.
Use of a bipartite system may have the advantage that if expression of the
target genes is no
longer required in a particular plant or animal line, then the transcription
factor may be bred out,
so that without the transcription factor present, the target genes) will no
longer be expressed in
this line. If the target genes are desired to be expressed at a later stage,
the
promoter: aranscription factor locus may be bred back into the line. In
addition, the bipartite
system may be used to modulate the level of expression of a target gene.
Bipartite promoters
may be operably linked to a variety of sequences, such as:
1 ) positive factors to increase HR frequency: wild-type endogenous genes to
facilitate
overexpression of particular HR enzymes and structural proteins or regulatory
proteins;
heterologous genes which promote HR; or,
2) negative factors to decrease HR frequency: altered proteins causing
dominant-negative
effect; anti-sense RNA to target genes; antibodies which bind and inhibit
action of target
proteins.
Minimal promoter elements in bipartite promoters may include, for example:
1) truncated CaMV 35S (nucleotides -59 to +48 relative to the transcription
start site) [3];
2) DNA recognition sequences: E. coli lac operator, yeast GAL4 upstream
activator
sequence; TATA BOX, transcription start site, and may also include a ribosome
recruitment
sequence.
Bipartite promoters may for example include transcription factors such as: the
yeast
GAL4 DNA-binding domain fused to maize C 1 transcription activator domain; E.
coli lac
repressor fused to yeast GAL4 transcription activator domain; or the E. coli
lac repressor fused to
herpes virus VP16 transcription activator domain.
Meiosis-specific promoters may be used directly to express factors for
promoting or
suppressing meiotic homologous recombination frequency by fusing the factor
coding sequence
to the promoter. However, some meiosis-specific promoters may promote
transcription at too
low of a level (i.e. weakly expresses) or at too high of a level (i.e.
strongly expressed) to achieve
the desired effect on homologous recombination frequency. For example, a weak
meiosis-
specific promoter may be used to express a transcription factor which can
promote a high level
22
CA 02319247 2000-11-14
of expression when it binds to the minimal promoter adjacent to the target
gene. Thus while the
target gene might only be expressed at a low level if it was directly fused to
the meiosis-specific
promoter, this promoter can indirectly facilitate high level expression of the
target gene by
expressing a very active transcription factor. The transcription factor may be
present at low
levels but because it is so effective at activating transcription at the
minimal promoter fused to
the target gene, a higher level of expression of the target gene will be
achieved than if the gene
was directly fused to the weak meiosis-specific promoter. In addition, the
transcription factor
may also be engineered so that its mRNA transcript is more stable or is more
readily translated,
or that the protein itself is more stable. Conversely, if the meiosis-specific
promoter is too strong
for a desired application, it may be used to express a transcription factor
with low ability to
promote transcription at the minimal promoter adjacent to the target gene.
In alternative aspects of the invention, inducible promoters may be provided.
A sequence
encoding an inhibitor or activator of meiotic homologous recombination may be
cloned behind
an inducible promoter. The promoter may then be induced (or de-repressed) when
the cell cycle
proceeds to a point when meiosis is initiated. Alternatively, the promoter may
be induced by
appropriate external treatment with an inducing agent. Induction may be
regulated by
environmental conditions such as heat shock, or chemical stimulus. Examples of
chemically
regulatable promoters active in plants and animals include the ecdysone,
dexamethason,
tetracycline and copper systems.
In alternative embodiments, a meiosis-specific promoter may be used to express
a
heterologous RNA-polymerase which recognizes specific sequences not naturally
present in the
cell. For example, T7 RNA Pol may be used in eukaryotes to specifically
promote transcription
of a target gene linked to the T7 RNA Pol recruitment DNA sequence.
In some aspects, the present invention provides meiosis-specific expression of
inhibitors
or activators of meiotic homologous recombination (meiosis recombination
factors), which may
avoid deliterious effects that may otherwise be caused by expression of such
factors during
vegetative/mitotic growth. Constitutive expression of recombination factors,
as exemplified here
by RAD51, was found to severely inhibit cell proliferation: the growth rate of
cells expressing
the recombinase was reduced by approximately 5-fold versus the control, a
result that is in
accordance with observations made in animal cells where overexpression of
recombinases has
been found to inhibit cell proliferation by arresting cells division.
23
CA 02319247 2000-11-14
In alternative embodiments, the invention provides isolated nucleic acids and
proteins.
By isolated, it is meant that the isolated substance has been substantially
separated or purified
away from other biological components with which it would otherwise be
associated, for
example in vivo. The term 'isolated' therefore includes substances purified by
standard
purification methods, as well as substances prepared by recombinant expression
in a host, as well
as chemically synthesized substances.
In the context of the present invention, "promoter" means a nucleotide
sequence capable
of mediating or modulating transcription of a nucleotide sequence of interest,
when the
transcriptional regulatory region is operably linked to the sequence of
interest. A transcriptional
regulatory region and a sequence of interest are "operably linked" when the
sequences are
functionally connected so as to permit transcription of the sequence of
interest to be mediated or
modulated by the transcriptional regulatory region. In some embodiments, to be
operably linked,
a transcriptional regulatory region may be located on the same strand as the
sequence of interest.
The transcriptional regulatory region may in some embodiments be located 5' of
the sequence of
interest. In such embodiments, the transcriptional regulatory region may be
directly 5' of the
sequence of interest or there may be intervening sequences between these
regions. The operable
linkage of the transcriptional regulatory region and the sequence of interest
may require
appropriate molecules (such as transcriptional activator proteins) to be bound
to the
transcriptional regulatory region, the invention therefore encompasses
embodiments in which
such molecules are provided, either in vitro or in vivo.
The term "recombinant" means that something has been recombined, so that when
made
in reference to a nucleic acid molecule the term refers to a molecule that is
comprised of nucleic
acid sequences that are joined together by means of molecular biological
techniques. The term
"recombinant" when made in reference to a protein or a polypeptide refers to a
protein molecule
which is expressed using a recombinant nucleic acid molecule. The term
"heterologous" when
made in reference to a nucleic acid sequence refers to a nucleotide sequence
which is ligated to,
or is manipulated to become ligated to, a nucleic acid sequence to which it is
not ligated in
nature, or to which it is ligated at a different location in nature. The term
"heterologous"
therefore indicates that the nucleic acid molecule has been manipulated using
genetic
engineering, i.e. by human intervention. Heterologous DNA sequences may for
example be
introduced into a host cell by transformation. Such heterologous molecules may
include
24
CA 02319247 2000-11-14
sequences derived from the host cell species, which have been isolated and
reintroduced into
cells of the host species. Heterologous nucleic acid sequences may become
integrated into a host
cell genome, either as a result of the original transformation of the host
cells, or as the result of
subsequent recombination events. Transformation techniques that may be
employed include
plant cell membrane disruption by electroporation, microinjection and
polyethylene glycol based
transformation (such as are disclosed in Paszkowski et al. EMBO J. 3:2717
(1984); Fromm et al.,
Proc. Natl. Acad. Sci. USA 82:5824 (1985); Rogers et al., Methods Enzymol.
118:627 (1986);
and in U.S. Patent Nos. 4,684,611; 4,801,540; 4,743,548 and 5,231,019),
biolistic transformation
such as DNA particle bombardment (for example as disclosed in Klein, et al.,
Nature 327: 70
(1987); Gordon-Kamm, et al. "The Plant Cell" 2:603 (1990); and in U.S. Patent
Nos. 4,945,050;
5,015,580; 5,149,655 and 5,466,587); Agrobacterium-mediated transformation
methods (such as
those disclosed in Horsch et al. Science 233: 496 (1984); Fraley et al., Proc.
Nat'l Acad. Sci.
USA 80:4803 (1983); and U.S. Patent Nos. 4,940,838 and 5,464,763).
Although various embodiments of the invention are disclosed herein, many
adaptations
and modifications may be made within the scope of the invention in accordance
with the
common general knowledge of those skilled in this art. Such modifications
include the
substitution of known equivalents for any aspect of the invention in order to
achieve the same
result in substantially the same way. Numeric ranges are inclusive of the
numbers defining the
range. In the specification, the word "comprising" is used as an open-ended
term, substantially
equivalent to the phrase "including, but not limited to", and the word
"comprises" has a
corresponding meaning. Citation of references herein shall not be construed as
an admission that
such references are prior art to the present invention. All publications,
including but not limited
to patents and patent applications, cited in this specification are
incorporated herein by reference
as if each individual publication were specifically and individually indicated
to be incorporated
by reference herein and as though fully set forth herein.
EXAMPLES
To demonstrate methods for increasing and decreasing homologous recombination
frequency during meiosis in accordance with various aspects of the present
invention,
Saccharomyces cerevisiae was used as a model system. To demonstrate mechanisms
for
CA 02319247 2000-11-14
engineering modified meiotic homologous recombination frequency, proteins
involved in
different steps of the homologous recombination pathway have been utilized,
including:
a) SPO1 l, which catalyses formation of the initial DSB in one member of a
pair of
aligned homologous chromosomes. The DSB is then processed to become
recombinogenic and
participate in a cross-over event. SPO11 is highly conserve amongst eukaryotic
species from
yeast to plants and humans [9-11].
b) DMC1, which is a meiosis-specific RecA homologue that acts on ssDNA
resulting
from the processing of DSB's created by SPO11. DMC1 facilitates the paring of
homologous
sequences on paired homologous chromosomes and catalyses invasion of the ssDNA
strand into
the paired duplex DNA of a non-sister chromatid. DMC1 accumulates only in
meiotic cells [20]
and appears to have no function in homologous recombination occurring in
mitotic cells
[20;49;53-55]. DMCI is highly conserved amongst eukaryotic species from yeast
to plants and
humans [20-22]. DMC1 acts in a unique but overlapping pathway regarding other
RecA
homologues functioning during meiosis [53;58]. DMC1 is unique from RAD51 in
that it forms
octameric complexes when it binds ssDNA [ 108]. DMC 1 also has proteins that
interact with it
during homologous recombination which are unique from those interacting with
other RecA
homologues [49;53].
c) RAD51, which is a RecA homologue that also acts on ssDNA resulting from the
processing of DSB's created by SPO11. RAD51 functions in both meiotic and
mitotic cells
[23;53;56]. RAD51 is highly conserved amongst eukaryotic species from yeast to
plants and
humans [21;23-25]. It is unique from DMC1 in that it forms a hexameric complex
like E. coli
RecA when it binds ssDNA [ 109;110] . It acts in a unique pathway from DMC 1
and had proteins
that specifically interact with it and not DMC1 [49;53;56].
d) MREl l, which is a nuclease that acts in resection of double-strand breaks
created by
SPO11 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4]. MRE11
is
highly conserved amongst eukaryotic species from yeast to plants and humans
[12-15]. MRE11
functions in both meiotic and mitotic cells [13;93;111;112].
e) ssDNA-binding proteins, which act to maintain ssDNA ends created by MRE11
and
associated proteins free of secondary structure [67]. By doing so, the ssDNA
ends are in an
optimum topology for the action of RecA homologues like RAD51 and DMCl. SSDNA-
binding
proteins are highly conserved from yeast to humans [26]. The ssDNA-binding
protein in E. coli.,
26
CA 02319247 2000-11-14
known as SSB, is an ancestor of the eukaryotic proteins [74;113]. SSB binds
ssDNA principally
as a homotetramer, but may also bind as a monomer [76]. As a result, SSB
provides a clean
system to test the effect of modifying the cellular level of ssDNA-binding
proteins on
homologous recombination, versus studying the effects of each individual
subunit of the
heterotrimeric RPA. A cloned E. coli SSB gene was evaluated for its effect on
meiotic
homologous recombination frequency. To assist movement of this prokaryotic
protein into the
eukaryotic nucleus, it was engineered to encode a nuclear localization
sequence derived from
Simian virus 40 T-antigen [114].
In alternative aspects of the invention, homologous recombination frequency is
increased
by increasing the amount of a limiting factor through increased expression of
the cognate gene,
decreased turnover of the protein or cognate mRNA, or by expressing an altered
form of the
protein with enhanced activity potential.
To reduce meiotic homologous recombination frequency, expression of the
cognate gene
for a target protein may be reduced, for example by antisense or cosuppression
of the gene, by
reducing translation of the cognate mRNA or increasing degradation of the mRNA
or protein.
Alternatively, activity of the target wild-type protein may be inhibited
through coexpression of
an alternative form of the protein that acts in a 'dominant' fashion to
inhibit (i.e. 'negatively'
affect) the activity of the endogenous wild-type protein. This 'dominant-
negative' effect may
result by one or more modes of action. A non-exclusive list of possible modes
of action
includes:
1 ) Titration of substrate, in which an alternate form of the protein binds to
the target
substrate of the wild-type endogenous protein, wherein the alternate-form
protein cannot
complete the catalytic or other normal functions performed by the wild-type
protein. By binding
the substrate, the alternate-form protein titrates the substrate thereby
inhibiting access to the
substrate by the endogenous wild-type protein. The functional activity of the
endogenous wild-
type protein is therefore inhibited.
2) Titration of cofactors or co-members of protein complexes, in which the
alternate-form
protein binds to cofactors required for full activity of the endogenous wild-
type protein; the
cofactors may be organic or inorganic compounds or other proteins which are co-
members of
heteromeric protein complexes (i.e. the complex is composed of more than one
type of protein).
For example, many proteins, including those involved in many DNA recombination
processes,
27
CA 02319247 2000-11-14
act in mufti-protein heteromeric complexes. If one member of the complex is
absent or in
limiting amounts, the function and activity level of the entire complex is
reduced. Therefore if
an alternate-form of a target protein, which may be non-functional or having
reduced function
itself but still capable of interacting with members of its normal protein
complex, is expressed in
a cell it can reduce activity of the endogenous wild-type protein by binding
with and titrating
members of the protein complex. These members of the complex are then no
longer available to
form functional complexes with the wild-type protein and, therefore, the
function of the
endogenous wild-type protein is reduced.
3) Direct inhibition of endogenous wild-type protein, in which the alternate-
form protein
may bind with the wild-type protein directly to inhibit its activity. Many
proteins, including
those participating in different steps of DNA recombination, form homomeric
protein complexes
(i.e. the complex is composed of a single type of protein). If one member of
the homomeric
complex is inactive in the correct biochemical context, it may poison (i.e.
inhibit) the activity of
the entire complex. Therefore, if an alternate-form protein, which has reduced
or absent activity
itself but which can still interact with endogenous wild-type protein to form
complexes, is
expressed in a cell it can reduce activity of the entire complex. The cell
therefore has a
combination of complexes composed of the following:
a) the alternate protein form (which may directly titrate substrate (see "1
"));
b) hybrid complexes of the alternate-protein form and the endogenous wild-type
protein. These complexes may have reduced or absent activity.
c) homogenous endogenous wild-type protein complexes wherein the activity
level and function of the wild-type complexes is reduced because i) there is
decreased number of
functional form homogenous wild-type complexes because of titration of wild-
type protein into
the hybrid complexes composed of alternate-form and wild-type protein
monomers, and ii) there
is decreased function of homogenous wild-type complexes because they may
interact with hybrid
complexes or homogenous alternate-form complexes and/or lose the competition
for substrate
which is titrated by the hybrid complexes or homogenous alternate-form
complexes.
To assess the effect of alternative forms of recombination proteins on meiotic
homologous recombination frequency, heterologous proteins were expressed and
mutant proteins
engineered to have reduced or no function. To demonstrate the effect of
heterologous protein
expression, the DMCI gene from Arabidopsis thaliana (AtDMCl) was expressed
during meiosis
28
CA 02319247 2000-11-14
in S. cerevisiae. AtDMC 1 has 40% similarity to ScDMC 1. In alternative
embodiments,
heterologous expression of AtDMC 1 may, therefore, function to promote
homologous
recombination frequency by compensating for a potentially limiting amount of
endogenous
ScDMCl, or it may decrease homologous recombination frequency by a dominant-
negative
effect, as outlined above, due to direct or indirect inhibition of endogenous
ScDMC 1 activity. To
demonstrate the effect of altered forms of recombination proteins on meiotic
homologous
recombination frequency, novel forms of DMC1, RAD51 and SPO11, and MRE11 were
created
and assessed.
a) RAD51, a RecA homologue that catalyses strand exchange between homologous
DNA
[52]. ATP-binding is necessary for full activity in DNA pairing and strand
exchange in vitro
[115-117]. ATP-binding is facilitated by protein motifs known as Walker A and
Walker B boxes
[118]. Mutations inhibiting ATP binding and/or hydrolysis decrease biological
activity of
RAD51 regarding its role in recombination-mediated repair of DNA damage caused
by radiation
[96]. ScRAD51 and AtRAD51 were cloned and it was found that their protein
sequences have
62% similarity and the conserved Walker A and B Box motifs. We engineered the
genes to
encode proteins with decreased ability for ATP-binding and hydrolysis by
changing a glycine
residue within the Walker A box to aspartic acid (i.e. ScRAD5l: G190D;
AtRAD5l: G135D).
The effect of these mutant protein forms on meiotic homologous recombination
was then
demonstrated. This glycine and other amino acid residues essential for
homologous
recombination activity are highly conserved amongst the RAD51-like family of
proteins in
eukaryotes.
b) DMC1, a RecA homologue that catalyses strand exchange between homologous
DNA
[51]. ATP-binding motifs, Walker A and B boxes, are conserved in this family
of proteins [20].
Genetic analysis demonstrates that wild-type sequence in the Walker A Box is
essential for wild-
type activity in vivo [53]. A mutant form of DMC1, DMC1-G126D which has a
similar amino
acid change at a corresponding residue in the Walker A box as outlined above
for RAD51, was
created. ScDMC 1 and AtDMC 1 were cloned and it was found that their protein
sequences have
40% similarity and the conserved Walker A and B Box motifs. The genes were
engineered to
encode proteins with decreased ATP-binding and hydrolysis ability by changing
a glycine
residue within the Walker A box to aspartic acid (i.e. ScDMCl: G190D; AtDMCI:
G135D).
The effect of these mutant protein forms on meiotic homologous recombination
was then
29
CA 02319247 2000-11-14
demonstrated. In some embodiments, identification of candidate mutations for
interfering with
DMC 1 function may be predicted by alignment of DMC 1 with RADS 1 and EcRecA
protein
sequences. The crystal structure for EcRecA has been determined [ 119;120] so
protein domains
responsible for intra-complex and inter-complex interactions may be
determined. Therefore,
through sequence alignments between DMC 1 with RADS 1 and EcRecA, one may
predict which
domains of DMC 1 are involved in intra- and inter-complex interactions. ScDMC
1 was cloned
and engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation G126D;
ii) ATP-induced conformational change with mutation N263Y; and,
iii) monomer-monomer interactions with mutation A288T.
Combinations of these mutations were also created to evaluate any synergistic
or additive effects
resulting from two or more mutations in the same protein.
c) SPO11, a Type II topoisomerase [121] that is responsible for DSB formation
in
meiotic homologous recombination [9;121 ]. Type II topoisomerases have five
conserved motifs
which are also present in SPO11 proteins from low and high eukaryotic species
[121]. Mutation
of key amino acids in these motifs can inactivate SPO11. When such a mutant is
present in a
homozygous state, DSB formation is prevented [ 121 ] thereby inhibiting
meiotic homologous
recombination. ScSP011 and AtSP011 were cloned to demonstrate the use and
application of
SPO11 in a dominant-negative approach to reduce meiotic homologous
recombination. The two
protein sequences have approximately 20% sequence similarity and possess the
five
characteristic Type II topoisomerase motifs including a key tyrosine residue
essential for
catalytic activity [121]. Genes were engineered to encode proteins with
decreased ability to
generate DSB's by changing the tyrosine residue in "Motif 1" (i.e. ScSP01 l:
Y135F; AtSP011:
Y103F). The effect of these mutant protein forms on meiotic homologous
recombination was
then demonstrated.
d) MRE 11, a nuclease responsible for resection of double-strand breaks
created by
SPO11 to provide ssDNA ends which are acted upon by RAD51 and DMC1 [4].
Phophoesterase
motifs are conserved in this family of proteins. Biochemical analysis
demonstrates mutation of
key amino acids within these motifs can inactivate the nuclease activity of
this protein and
impair its biological activity [ 111;112;122]. Conserved amino acids outside
of the
phosphoesterase domains can also affect function of MRE 11 [ 111 ] . AtMRE 11
was cloned to
CA 02319247 2000-11-14
demonstrate the use of MRE11 in a dominant-negative approach to reduce
homologous
recombination. AtMREI 1 was engineered to encode a protein defective for
phosphoesterase
activity by changing a key amino acid residue in Motif I from aspartate to
alanine (i.e.
AtMREl l: Motif I:D-A).
A. Cloning and evaluation of target ; eg-nes
Target genes were cloned using specific oligonucleotides designed to prime DNA
synthesis in a PCR reaction with either cDNA or gDNA from the appropriate
species as
template. The primers were designed to incorporate convenient restriction
sites into the
amplicon to facilitate initial cloning of the gene and its subcloning into
various expression
vectors. Genes cloned and the oligo primers used to achieve this are described
in TABLE 1.
PCR conditions were as described [123] or as recommended by the supplier of
the thermostable
DNA polymerase Pfu (Stratagene) or Taq (Pharmacia). PCR reactions were
conducted using a
thermocycler (Perkin-Elmer Model 9700).
1 ) AtDMC 1
Template DNA was derived from a commercially available cDNA library of
Arabidopsis
thaliana ecotype Columbia in the vector lambda ZAP II (Stratagene). The
library was mass-
excised following the protocol supplied by the manufacture. The resultant
phagemid suspension
was concentrated by a combination of precipitation with polyethylene glycol as
described by
Ausubel et al. (1998) and desiccation using a Speed Vac. In this manner, the
phagemid
suspension was concentrated at least 5-fold. One hundred microlitres of the
concentrated
phagemid suspension was extracted with phenol and chloroform following
standard procedures
to remove protein and other contaminants from DNA with subsequent
precipitation using ethanol
[123]. In this manner, DNA from approximately 2 ml of phagemid suspension was
concentrated
and resuspended in 20 ~1 of LTE ((1mM Tris-HCl , 0.1 mM EDTA (pH 8.0)) with
RNase A (20
~g/ml)).
A primary PCR reaction was performed with 1 ~l Arabidopsis cDNA library
phagemid,
0.5 pmole OL11434, 0.5 pmole OL11433, 0.2 mM dNTP's (i.e. dATP, dCTP, dGTP,
dTTP;
Pharmacia), 1.25 U Pfu (Stratagene) and Pfu buffer constituents recommended by
the
manufacturer in a volume of 25 ~1. The PCR conditions were 5 min @ 94 C,
followed by 25
cycles of 30 s @ 94 C, 45 s @ 60 C and 2 min @ 72 C, followed by 10 min @ 72 C
and storage
at 4 C or -20 C. A secondary PCR was then performed with 2 ~1 of the above
reaction used as
31
CA 02319247 2000-11-14
template with 1.0 pmol OL 11434 and 1.0 pmol OL 11435 and other constituents
as above except
using 2.5 U Pfu and a final volume of 50 pl. Two independent secondary
reactions were done
with identical PCR conditions as above. The two reactions were pooled and DNA
fragments
were resolved by agarose electrophoresis using a 1 % gel and following
standard procedures
{213}. A DNA fragment of ~ 1 kilobase pair (kb) expected to correspond to
AtDMCI was
excised and the DNA recovered from the agarose using the Qiaquick Gel
Extraction Kit (Qiagen)
and protocol supplied by the manufacturer. DNA was digested with XhoI and
phosphorylated
with T4-polynucleotide kinase following standard procedures [123]. The plasmid
cloning vector
pBluescript II KS- (Stratagene) was digested with EcoRV and XhoI. The amplicon
and vector
DNA were purified by agarose electrophoresis and recovered as above. Amplicon
and vector
DNA were then mixed in the presence of T4 DNA ligase (Gibco-BRL) to covalently
link the two
molecules following standard procedures [123] in a final volume of 25 ~1.
After 2 h at room
temperature, 1 ~1 of glycogen (20 mg/ml) was added to the ligation mixture
made upto 100 ~1
with distilled water. After precipitation with ethanol [ 123], the DNA was
resuspended in 4 ~l of
distilled water. E. coli strain DHSalpha (Gibco-BRL) was transformed with 2.5
pl of the
conentrated ligation following standard procedures [123] and plated on sterile
TYS medium (per
litre distilled water: 10 g Tryptone (Difco); 5 g yeast extract (Difco); 5 g
NaCI (Sigma); 15 g
agar (Sigma)) containing ampicillin (100 ~g/ml). Putative clones were
propagated in liquid TYS
(i.e. without agar) and ampicillin (100 pg/ml). Plasmid DNA was isolated by
standard alkaline-
lysis "mini-prep" procedure [123]. The DNA sequence of the resultant clone,
pKR225, was
determined at a commercial sequencing facility (Plant Biotechnology Institute,
Saskatoon,
Canada). Cloning of all other genes in this invention followed the same
principals as for
pKR225 with noted exceptions.
2) AtSP011
A primary PCR reaction was performed with 2 ~1 Arabidopsis cDNA library
phagemid
(isolated as described for cloning of AtDMC 1 ), 0.5 pmole AtSP011-5' Sma
oligo, 0.5 pmole
AtSP011-3'X oligo, 0.2 mM dNTP's, 1.25 U Pfu (Stratagene) and Pfu buffer
constituents
recommended by the manufacturer in a volume of 25 pl. The PCR conditions were
S min @ 94
C, followed by 30 cycles of 30 s @ 94 C, 30 s @ 60 C and 2.5 min @ 72 C,
followed by 10 min
@ 72 C and storage at 4 C or -20 C. A secondary PCR was then performed with 2
pl of the
32
CA 02319247 2000-11-14
above reaction used as template with 1.0 pmol AtSP011-5'Sma oligo and 1.0 pmol
AtSP011-
3'PstNot oligo and other constituents as per the primary PCR reaction except
using 2.5 U Pfu
and a final volume of 50 ~l. Two independent secondary reactions were done
with identical
PCR conditions as above except replacing the step at 60 C with 63 C. The two
reactions were
pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript
II SK-
(Stratagene) was digested with EcoRV and PstI. DNA fragments of interest
corresponding to
AtP011 (~1.1 kb) and the vector (~3 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The fragments were ligated
together,
transformed into E.coli and putative clones of the gene identified as
described above. The DNA
sequence of the resultant clone, pTK82 was determined to confirm it encoded
AtSP011.
3. AtRAD51
Template for use in amplifying AtRAD51 was obtained from cDNA generated from
RNA isolated from A. thaliana ecotype Columbia total plant tissues treated
with gamma
radiation. Plants were grown in sterile culture as follows. Seeds of A.
thaliana ec. Columbia
were surface sterilized by first rinsing in 70% (v/v) ethanol for one minute
followed by washing
for 5-7 min with a solution of 50% (v/v) bleach , 0.05% (w/v) Tween 20
(Sigma). After rinsing
three times with sterile distilled water, the seeds were resuspended in 0.1 %
(w/v) agarose. Seeds
were then dispensed in a grid pattern (~30 seeds/plate) with 1-2 cm spacing on
sterile growth
medium (O.SX Mirashige and Skoog basal salt media (Sigma) containing 1% (w/v)
sucrose,
nicotinic acid (1 ~y/ml), thiamine-HCl (10 ~y/ml), pyridoxine-HCl (1 ~y/ml),
myo-inositiol (100
~~y/ml) and solidified with 1.0% (w/v) agar) in 100mm x 15 mm or 150 mm x 15
mm petri plates
(Fisher). The plates were then placed at 4 C for 48 h and transferred to a
controlled environment
chamber with temperature of 18-22 C and a light regime of 16 h light and 8 h
dark. After
approximately 3 wk plants were treated with gamma radiation using a Gamma-Cell
40 irradiator
with a Co6° radiation source. Plates containing plants were placed in
the irradiator and left for
time periods corresponding to desired dosages estimated from the calibrated
emission from the
radiation source and accounting for decay over time. Plant tissues were
collected after 5-10 min
recovery time and rapidly frozen using liquid N2. For RNA extraction, plant
tissues were first
ground to a fine powder in the presence of liquid N2 using a mortar and
pestle, and then RNA
was isolated using the Rneasy Plant Kit (Qiagen) following the instructions
provided by the
manufacturer. cDNA was prepared from total RNA extracted from the plants
exposed to 20 or
33
CA 02319247 2000-11-14
40 krad of gamma radiation using a Superscript Preamplification System for
First Strand cDNA
Synthesis following directions of the manufacturer (GIBCO-BRL). First strand
cDNA from 5-
pg total RNA from plants treated with 20 or 40 krad of gamma radiation was
primed using
oligo-dT supplied with the kit.
5 A primary PCR reaction was performed with 4 ~1 first-strand cDNA from either
the 20
krad or 40 krad treated plants, 0.5 pmole AtRAD51-5'Bam oligo, 0.5 pmole
AtRAD51-3'X
oligo, 0.2 mM dNTP's, 2.5 U Taq (Pharmacia) and Taq buffer constituents
recommended by the
manufacturer in a volume of 25 pl. The PCR conditions were 5 min @ 94 C,
followed by 25
cycles of 30 s @ 94 C, 30 s @ 55 C and 75 s @ 72 C, followed by 10 min @ 72 C
and storage at
10 4 C or -20 C. Two secondary PCR reactions were then performed for each of
the above
reactions using either 5 or 10 pl of the primary reactions in separate
reactions as template with
1.0 pmole AtRAD51-5'Bam oligo and 1.0 pmole AtRAD51-3'Pst oligo and other
constituents as
above except using 5 U Taq and a final volume of 50 ~1. Two independent
secondary reactions
were done for each template sample with identical PCR conditions as above. The
two respective
reaction series were pooled and DNA fragments were digested with BamHI and
PstI. The
plasmid cloning vector pBluescript II KS- (Stratagene) was digested with BamHI
and PstI. DNA
fragments of interest corresponding to AtRAD51 (~1.2kb) and the vector (~3 kb)
were purified
by agarose gel electrophoresis and recovered from the agarose as described
above. The
fragments were ligated together, transformed into E.coli and putative clones
of the gene
identified as described above. Two clones were selected: pRH2 and pRH7 derived
from cDNA
from plants treated with 20 or 40 krad of gamma radiation, respectively.
Determination of the
DNA sequence of these clones revealed both had mutations at different
positions of the open
reading frame. To resynthesize a gene encoding a wild-type AtRAD5l,
restriction fragments
from pRH2 and pRH7 were combined as follows: pRH2 was digested with XbaI and
BamHI and
a 400 by fragment was purified; pRH7 was digested with PstI and XbaI and a
~770bp fragment
was purified; both fragments were combined and ligated into pBluescript II
digested with BamHI
and PstI. The resulting clone, pRHlS was sequenced and found to encode a wild-
type
AtRADS 1.
3 . AtMRE 11
Using the first 1000 by of hMREI l cDNA sequence [124] to query public DNA
sequence databanks with the BLAST search algorithm [125], an Arabidopsis
genomic sequence
34
CA 02319247 2000-11-14
(ACCESSION #AB010695) was identified with some sequence homology. Based on
this
genomic DNA sequence, oligonucleotide primers were designed to amplify a 450
by fragment
that would encode the -~-250 by of the 5' region of the putative AtMREI 1
coding sequence and
200 by of a potential intron sequence. The 450 by framgent was amplified by
PCR using
genomic DNA from A. thaliana ec. Columbia which was isolated following the
method of
Junghans and Mezlaff ( 1990) [ 126]. Plants from which DNA was isolated were
first grown at
18-22 C with 16 h light and 8 h dark for 3-4 wk. Aerial tissues were collected
and rapidly frozen
with liquid N2 before storage at -80 C until processing. For PCR a primary
reaction included
1.2 ~g of genomic DNA, 0.5 pmole OL 12414 oligo, 0.5 pmole OL 12413 oligo, 0.2
mM dNTP's,
1.25 U Taq (Pharmacia) and Taq buffer constituents recommended by the
manufacturer in a
volume of 25 ~1. The PCR conditions were 5 min @ 94 C, followed by 30 cycles
of 30 s @ 94
C, 30 s @ 58 C and 1.0 min @ 72 C, followed by 10 min @ 72 C and storage at 4
C or -20 C. A
secondary PCR was then performed with 2 ~1 of the above reaction used as
template with 1.0
pmol OL12414 oligo and 1.0 pmol OL12415 oligo and other constituents as per
the primary PCR
reaction except using 2.5 U Taq and a final volume of 50 ~1. Two independent
secondary
reactions were done with identical PCR conditions as above. The 450 by
fragment was purified
by agarose gel electrophoresis and recovered from the gel as described above.
Approximately
100 ng of this DNA fragment was labeled with alpha-32P-dCTP by random priming
as per
standard procedure [123]. A cDNA library of A. thaliana ec. Columbia obtained
from a
commercial supplier (Stratagene) was plated on 150 mm x 15 mm petri plates
(Fisher) at a
plaque density approaching confluence, following directions of the
manufacturer. Plaque lifts
from six such plates were performed using Hybond-N membranes (Amersham)
following
directions of the supplier. Membranes were probed with the radiolabelled 450
by fragment
following the method of Church et al., {207}, with 1x106 cpm of probe per
millilitre of
hybridization solution. Hybridization was performed overnight at 60 C using a
rotisserie
incubator (Robbins Scientific). Non-specific binding of the probe was reduced
by washing
membranes following standard procedures [123] with two 10 min washes at 22 C
with 60-80 ml
of 4.73xSSC, 0.1% (w/v) SDS, followed by two 30 min washes at 50 C with 60-80
ml of the
same solution prewarmed to 50 C. Filters were then transferred to a solid
support, wrapped in
plastic film and placed in an X-ray cassette. After overnight exposure at -80
C, the film was
developed and twelve putative clones (C 1-C 12) were identified which
hybridized to the 450 by
CA 02319247 2000-11-14
fragment. These clones were purified from contaminating phage following
standard procedures
[123] and using the 450 by fragment as probe and identical conditions as
above. One clone, phi-
C7A, was characterized further. The insert was isolated by conversion to
plasmid vector
following directions of the manufacturer (Stratagene) resulting in pKR242.
pKR242 was
sequenced using primers flanking the multiple cloning site of the vector, as
suggested by the
manufacturer (Stratagene), and OL 12779 and OL 12780 (Table 1 ). The entire
sequence of
pKR242 was determined and shown to encode an homologue MRE11 genes from other
species.
The cDNA, encoding the coding region of the gene was compared to the genomic
sequence in
the public database (ACCESSION #AB010695) which disclosed that the gene
contains twenty
introns. Comparison of predicted amino acid sequence encoded by pKR/242 with
other MRE 11
protein sequences illustrated it was not full-length. Comparison of genomic
DNA sequence to
genes from other species enabled prediction of a putative start codon for
AtMREI 1. To clone
the 5' portion of AtMRE 11 not present in pKR242 PCR was employed. First-
strand cDNA was
synthesized from total RNA isolated from A. thaliana ec. Columbia treated with
30 krad of
gamma radiation as described above. A primary PCR reaction was performed with
2 ~1 first-
strand cDNA, 0.5 pmole OL12414 oligo, 0.5 pmole OL12413 oligo, 0.2 mM dNTP's,
1.25 U
Pfu (Stratagene) and Pfu buffer constituents recommended by the manufacturer
in a volume of
~1. The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94
C, 30 s @
55 C and 60 s @ 72 C, followed by 10 min @ 72 C and storage at 4 C or -20 C.
Two secondary
20 PCR reactions were then performed using 2 pl of the primary reaction as
template with 1.0
pmole OL12414 oligo and 1.0 pmole Ol 12415 oligo and other constituents as
above except
using 2.5 U Pfu and a final volume of 50 ~1. The two reactions were pooled and
DNA was
digested with EcoRI and XbaI. The plasmid cloning vector pBluescript II KS-
(Stratagene) was
digested with EcoRI and XbaI. DNA fragments of interest corresponding to the
5' end of
25 AtMREI 1 0225 bp) and the vector (~3 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The fragments were ligated
together,
transformed into E.coli and putative clones of the DNA fragment identified as
described above.
One clone, pRH 1 was sequenced to confirm it encodes the 5' end of AtMRE 11.
To resynthesize
a gene encoding a full-length AtMREI l, restriction fragments from pRHl and
pKR242 were
combined as follows: pRHI was digested with HindIII and XbaI and a-~-225 by
fragment was
purified; pKR242 was digested with XbaI and XhoI and a ~2. kb fragment was
purified; both
36
CA 02319247 2000-11-14
fragments were combined and ligated into pSPORT2 (Gibco-BRL) digested with
HindIII and
SaII. The resulting clone, pNH2 was sequenced and found to encode a wild-type
AtMREI 1.
Comparison of the conceptual protein encoded by the cloned AtMREI l gene to
other MRE11
proteins from other organisms confirms it is a homologue of this family of
proteins. The
conservation extends to phophoesterase motifs which have been determined to be
essential for
the function of this family of proteins [111;112;122]. Alternate forms of
AtMREl l may be
engineered to confer a dominant-negative effect as described above for other
proteins. For
example, the phosphesterase motifs responsible for nuclease activitye are
highly conserved
within the MRE11 family. Mutations of different amino acids within these
motifs may inactivate
MRE11 function [111;112;122]. Mutations outside of these motifs may also
suppress function
of the protein [ 111 ].
6. ScDMCI
a) genomic clone
ScDMC 1 gene in yeast contains a single intron which may be excised in a
meiosis-
specific manner [20]. Template for amplifying ScDMCl was genomic DNA from
Saccharomycies cerevisiae strain RK1308 [128] isolated by standard procedure
[123]. Two PCR
reactions were performed with approximately 1 ~.g of genomic DNA, 1.0 pmol
yDMC-5'Bam
oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and
Pfu buffer
constituents recommended by the manufacturer in a volume of 50 ~1. The PCR
conditions were
5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 2 min @ 72
C, followed
by 10 min @ 72 C and storage at 4 C or -20 C. The two reactions were pooled
and DNA was
digested with PstI. The plasmid cloning vector pBluescript II KS- (Stratagene)
was digested
with SmaI and PstI. DNA fragments of interest corresponding to ScDMCI (~1.1
kb) and the
vector (~3 kb) were purified by agarose gel electrophoresis and recovered from
the agarose as
described above. The fragments were ligated together, transformed into E.coli
and putative
clones of the gene identified as described above. The DNA sequence of the
resultant clone,
pMWl3 was determined to confirm it encoded ScDMCI-genomic.
b) cDNA clone
Template for use in amplifying ScDMCI-cDNA was obtained from cDNA generated
from RNA isolated from S. cerevisiae cells undergoing meiosis. Strain RK108
[128]was grown
in YPD liquid medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v)
glucose) to cell
37
CA 02319247 2000-11-14
density of ~2x10~ cells/ml at 30 C with shaking at 225 RPM. Cells were
collected by
centrifugation, washed and resuspended in SPM medium ( 0.3% (w/v) potassium
acetate, 0.02%
(w/v) raffmose, 5 ~g/ml uracil, 5 pg/ml histidine, 25 pg/ml leucine) then
cultured as above for
2.5 h. Cells from 10 ml of culture were collected by centrifugation, washed
with sterile distilled
water (SDW) and resuspended in 1 ml SDW before rapid freezing in a dry-ice/
methanol bath
and stored at -80 C. Total RNA was extracted from these cells following a
standard protocol
[123]. Approximately 4 ~g of RNA was used to create cDNA primed with oligo-dT
using the
Superscript Preampification System for First Strand cDNA Synthesis (Gibco/BRL)
following
directions of the manufacturer. Two PCR reactions were performed with 3 ~1 of
first strand
cDNA, 1.0 pmol yDMC-5'Bam oligo and 1.0 pmol yDMC-3'Pst oligo, 0.2 mM dNTP's,
2.5 U
Pfu (Stratagene) and Pfu buffer constituents provided by the manufacturer in a
volume of SO ~.1.
The PCR conditions were 5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30
s @ 55 C and
2 min @ 72 C, followed by 10 min @ 72 C and storage at 4 C or -20 C. The two
reactions were
pooled and DNA was digested with PstI. The plasmid cloning vector pBluescript
II KS-
(Stratagene) was digested with SmaI and PstI. DNA fragments of interest
corresponding to
ScDMCl-cDNA (~1.1 kb) and the vector (-~-3 kb) were purified by agarose gel
electrophoresis
and recovered from the agarose as described above. The fragments were ligated
together,
transformed into E.coli and putative clones of the gene identified as
described above. The DNA
sequence of the resultant clone, pMW 19 was determined to confirm it encoded
ScDMC 1-cDNA.
7. ScRAD51
Template for amplifying ScRAD51 was genomic DNA from Saccharomycies cerevisiae
strain AB972 [129] isolated by standard procedure [123]. Two PCR reactions
were performed
with approximately 1 ~g of genomic DNA, 1.0 pmol yR51-5'Bam oligo and 1.0 pmol
yR51-
3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents
provided by the
manufacturer in a volume of 50 ~l. The PCR conditions were 5 min @ 94 C,
followed by 25
cycles of 30 s @ 94 C, 30 s @ 58 C and 2.5 min @ 72 C, followed by 10 min @ 72
C and
storage at 4 C or -20 C. The two reactions were pooled and DNA was digested
with BamHI and
PstI. The plasmid cloning vector pBluescript II KS- (Stratagene) was digested
with BamHI and
PstI. DNA fragments of interest corresponding to ScRAD51 (~1.2 kb) and the
vector (~3 kb)
were purified by agarose gel electrophoresis and recovered from the agarose as
described above.
The fragments were ligated together, transformed into E.coli and putative
clones of the gene
38
CA 02319247 2000-11-14
identified as described above. The DNA sequence of the resultant clone, pMW35
was
determined to confirm it encoded ScRAD51.
8. ScRAD52
Template for amplifying ScRAD52 was genomic DNA from Saccharomyces cerevisiae
strain Sb792 (REF) isolated by standard procedure [123]. Two PCR reactions
were performed
with approximately 1 ~g of genomic DNA, 1.0 pmol yR52-5'Pme oligo and 1.0 pmol
yR52-
3'Not oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents
recommended
by the manufacturer in a volume of 50 p,l. The PCR conditions were 5 min @ 94
C, followed by
25 cycles of 30 s @ 94 C, 30 s @ 60 C and 2 min @ 72 C, followed by 10 min @
72 C and
storage at 4 C or -20 C. The two reactions were pooled and DNA was digested
with EcoRI and
NotI. The plasmid cloning vector pBluescript II SK- (Stratagene) was digested
with EcoRI and
NotI. DNA fragments of interest corresponding to ScRAD52 (~1.5 kb) and the
vector (~3 kb)
were purified by agarose gel electrophoresis and recovered from the agarose as
described above.
The fragments were ligated together, transformed into E.coli and putative
clones of the gene
identified as described above. The DNA sequence of the resultant clone, pTK50
was determined
to confirm it encoded ScRAD52.
9. ScRAD54
Template for amplifying ScRAD54 was genomic DNA from Saccharomyces cerevisiae
strain AB972 [129] isolated by standard procedure [123]. Two PCR reactions
were performed
with approximately 1 ~g of genomic DNA, 1.0 pmol yR54-5'RI oligo and 1.0 pmol
yR54-3'Pst
oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents
recommended by the
manufacturer in a volume of 50 ~l. The PCR conditions were 5 min @ 94 C,
followed by 25
cycles of 30 s @ 94 C, 30 s @ 60 C and 5 min @ 72 C, followed by 10 min @ 72 C
and storage
at 4 C or -20 C. The two reactions were pooled and DNA was digested with PstI.
The plasmid
cloning vector pBluescript II KS- (Stratagene) was digested with SmaI and
PstI. DNA fragments
of interest corresponding to ScRAD54 (~2.7 kb) and the vector (~3 kb) were
purified by agarose
gel electrophoresis and recovered from the agarose as described above. The
fragments were
ligated together, transformed into E.coli and putative clones of the gene
identified as described
above. The DNA sequence of the resultant clone, pMW34 was determined to
confirm it encoded
ScRAD54.
10. ScSP011
39
CA 02319247 2000-11-14
Template for amplifying ScSP01 lwas genomic DNA from Saccharomycies cerevisiae
strain AB972 [129] isolated by standard procedure [123]. Two PCR reactions
were performed
with approximately 1 ~,g of genomic DNA, 1.0 pmol ySPO-5'Bam oligo and 1.0
pmol ySPO -
3'Pst oligo, 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and Pfu buffer constituents
recommended
by the manufacturer in a volume of 50 ~1. The PCR conditions were 5 min @ 94
C, followed by
25 cycles of 30 s @ 94 C, 30 s @ 63 C and 2.5 min @ 72 C, followed by 10 min @
72 C and
storage at 4 C or -20 C. The two reactions were pooled and DNA was digested
with BamHI and
PstI. The plasmid cloning vector pBluescript II KS- (Stratagene) was digested
with BamHI and
PstI. DNA fragments of interest corresponding to ScSP011 (~1.2 kb) and the
vector (~3 kb)
were purified by agarose gel electrophoresis and recovered from the agarose as
described above.
The fragments were ligated together, transformed into E.coli and putative
clones of the gene
identified as described above. The DNA sequence of the resultant clone, pTK81
was determined
to confirm it encoded ScSP011.
11. EcSSB
Template for amplifying SSB was genomic DNA from E. coli strain CC106 [130].
Genomic DNA from the strain was isolated as follows: 1) cells were cultured to
mid-log phase in
TYS liquid medium at 37 C; 2) cells were pelleted by centrifugation and washed
with sterile
distilled water; 3) 20 ml of cell culture was centrifuged and the cell pellet
resuspended in 0.5 ml
TE/Tween buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.01% (w/v) Tween 20); 4)
cells
were incubated at 85 C for 20-30 min and then pelleted by microcentrifugation
for 5-10 min; 5)
the supernatant was collected and 50 ~1 of TE-RNase (RNase A 20 ~y/ml) was
added before
incubation at room temperature for 30 min; 6) the supernatant was extracted
with phenol and
chloroform and precipitated with ethanol as per standard procedure [123]. 7)
the DNA was
resuspended in 20 ~1 of LTE (TE diluted 1:10 with distilled water).
The SSB gene was amplified with two primer sets to create two clones of the
gene
different restriction sites at the 5' end. PCR reactions were performed with 4
~1 of genomic
DNA, 1.0 pmol SSB-5'Bam oligo and 1.0 pmol SSB-3'Pst oligo, or 1.0 pmol SSB-
Sma oligo
and 1.0 pmol SSB-3'Pst oligo, plus 0.2 mM dNTP's, 2.5 U Pfu (Stratagene) and
Pfu buffer
constituents recommended by the manufacturer in a volume of 50 ~1. The PCR
conditions were
5 min @ 94 C, followed by 25 cycles of 30 s @ 94 C, 30 s @ 55 C and 1.0 min @
72 C,
followed by 10 min @ 72 C and storage at 4 C or -20 C. The amplified DNA from
the PCR
CA 02319247 2000-11-14
reactions using SSB-5'Bam oligo and SSB-3'Pst oligo or SSB-5'Sma oligo and SSB-
3'Pst oligo
was digested with BamHI and PstI or SmaI and PstI, respectively. The
corresponding plasmid
cloning vector pBluescript II KS- (Stratagene) was also digested with BamHI
and PstI or SmaI
and PstI, respectively. DNA fragments of interest corresponding to SSB 00.55
kb) and the
vector (~3 kb) were purified by agarose gel electrophoresis and recovered from
the agarose as
described above. The fragments were ligated together, transformed into E.coli
and putative
clones of the SSB gene identified as described above. The DNA sequence of the
resultant
clones, pTK27 and pTK28, were determined to confirm they encoded SSB with
flanking
restriction sites of BamHI and PstI or SmaI and PstI, respectively.
A SSB derivative was also created so that the resultant protein would encode a
nuclear
localization sequence (i.e. NLS-SSB). A synthetic oligonucleotide was created
which encoded
the nuclear localization sequence (NLS) corresponding to that found in simian
virus 40 T-antigen
[114]. The nucleotide sequence (GGATCCAAAAAAATGGCTCCTAAGAAGAAG-
AGAAAGGTTGGAGGAGGACCCGGG) encodes a BamHI site, in-frame start codon, and
SmaI site (underlined). A plasmid containing this cloned NLS sequence and
derived from
pBluescript II KS- (Stratagene) was digested with SmaI and PstI and the DNA
fragment
corresponding to the vector (~3 kb) was gel purified. pTK28 was also digested
with SmaI and
PstI and the DNA fragment corresponding to the SSB gene 00.55 kb) was also gel
purified. The
DNA fragments were recovered from agarose, ligated together, transformed into
E. coli and
putative clones of the NLS-SSB gene identified as described above. The DNA
sequence of the
resultant clone, pTK29, was determined to confirm it encoded NLS-SSB.
A. Engineering and cloning of altered forms of target genes
Altered forms of genes were engineered to encode proteins with altered amino
acid
sequences and modified function. Site-directed mutagenesis was performed using
the
QuickChange Site-Directed Mutagenesis Kit (Stratagene), unless otherwise
stated, following
directions of the manufacturer using a thermocycler (Perkin-Elmer Model 9700)
and the
thermostable DNA polymerise Pfu (Stratagene). Base-pair changes of interest
were incorporated
into oligonucleotides which were then used to prime replication of an altered
form of the target
gene. Oligonucleotides used to incorporate the desired base changes in target
genes are listed in
TABLE 1.
1. DMC1
41
CA 02319247 2000-11-14
ScDMC 1 was engineered to encode mutations potentially responsible for:
i) ATP-binding and hydrolysis with mutation ScDMC1:G126D;
ii) ATP-induced conformational change with mutation ScDMC1:N263Y;
iii) monomer-monomer interactions with mutation ScDMC1:A288T.
To create these mutations the protocol of the QuickChange Site-Directed
Mutagenesis Kit
(Stratagene) was followed. The mutagenesis reactions contained ~50 ng of pMW
13 as template,
the appropriate oligonucleotides and reaction constituents and Pfu polymerase
(Stratagene) as
recommended by the manufacturer. The reactions were incubated in a
thermocycler for 30 s @
95 C followed by 12 cycles of 30 s @ 95 C, 1 min @ 55 C and 8 min 20 s @ 68 C
before
storage at 4 C or-20 C. ScDMC1:G126D was created using oligos yDMC-G126D-sense
and
yDMC-G126D-antisense resulting in the plasmid pTK68-3. ScDMC1:N263Y was
created using
oligos yDMC-N263Y-sense and yDMC-N263Y -antisense resulting in the plasmid
pTK70-5.
ScDMC1:A288T was created using oligos yDMC-A288T-sense and yDMC-A288T-
antisense
resulting in the plasmid pTK64-1. All clones were sequenced to confirm the
presence of the
mutation.
Combinations of these mutations were also created using two methods. Firstly,
the
QuickChange Site-Directed Mutagenesis Kit (Stratagene) and supplied protocol
were used with
the template being one of the mutant gene forms from above and a
oligonucleotide pair which
confers a mutation at a different site. ScDMCI :G126D+A288T was created in a
reaction
containing ~50 ng of pTK64-1 (i.e. ScDMC1:A288T) as template with
oligonucleotides yDMC-
G126D-sense and yDMC-G126D-antisense resulting in the plasmid pTK67-3.
Likewise
ScDMCI :N263Y +A288T was created in a reaction containing ~50 ng of pTK64-1
(i.e.
ScDMCI :A288T) as template with oligonucleotides yDMC-N263Y-sense and yDMC-
N263Y -
antisense resulting in the plasmid pTK69-6. Secondly, a combination of
restriction fragments
from various constructs was used to create genes with multiple mutations.
ScDMC1:G126D+
N263Y was created by digesting pTK68-3 (i.e. ScDMCl :G126D) with NdeI and
PstI, purifying
~3.5 kb fragment and ligating to this a 550 by fragment purified from pTK70-5
(i.e.
ScDMCI :N263Y) digested with NdeI and PstI resulting in the plasmid pTK71-1.
Likewise
ScDMC1:G126D+ N263Y+A288T was created by digesting pTK68-3 (i.e. ScDMC1:G126D)
with NdEI and PstI, purifying ~3.5 kb fragment and ligating this to a 550 by
fragment purified
42
CA 02319247 2000-11-14
from pTK69-6 (i.e. ScDMCl :N263Y +A288T) digested with NdeI and PstI resulting
in the
plasmid pTK72-1. All clones were sequenced to confirm the presence of the
mutation.
2. RAD51
ScRAD51 was engineered to encode mutations potentially responsible for ATP-
binding
and hydrolysis with mutation ScRAD51:G190D. Site-directed mutatgenesis was
performed as
above with the exception that pMW35 was used as template and the
oligonucleotides were
yRAD51-G190D-sense and yRAD51-G190D-antisense resulting in the plasmid pTK84.
The
clone was sequenced to confirm the presence of the mutation.
3. SPO11
ScSP011 was engineered to encode mutations potentially responsible for
topoisomerase-
like DNA cleavage activity with mutation ScSPO11:Y135F. Site-directed
mutatgenesis was
performed as above with the exception that pTK81 was used as template and the
oligonucleotides were ySPO-Y135F-sense and ySPO-Y135F -antisense resulting in
the plasmid
pTK83-3. The clone was sequenced to confirm the presence of the mutation.
4. MRE 11
AtMREl 1 was engineered to encode mutations responsible for nuclease activity
with
mutation AtMREI l : Motif I:D-A. This was done using PCR and an
oligonucleotide that
incorporates a base change into the gene resulting in the desired changed
amino acid sequence.
The insert of pNH2 corresponding to AtMREl l was first isolated by digesting
the plasmid with
EcoRI and purifying the ~2.2 kb fragment corresponding to AtMREl l by agarose
gel
electrophoresis. This was ligated to pBluescript KS+ previously digested with
EcoRI. The
resultant clone of AtMREl 1 was denoted pF01. A primary PCR reaction was
performed with
~30 ng of pF01 as template DNA, 50 pmol MRE-F1 oligo and 50 pmol OL 12413
oligo, 0.2
mM dNTP's, 2.5 U PfuTurbo (Stratagene) and PfuTurbo buffer constituents
recommended by
the manufacturer in a volume of 50 pl. The PCR conditions were 3 min @
94°C, followed by 25
cycles of 30 s @ 94°C, 1 min @ 52°C and 1 min @ 72°C,
followed by 3 min @ 72°C and
storage at 4°C or -20°C. A secondary PCR reaction was then
performed using a 10 ~1 aliquot of
the primary reaction as template and other conditions identical to above
except that 25 pmol each
of MRE-F2 oligo and OL 12415 oligo were used, and that the extension step was
45 s @ 72°C.
A tertiary PCR reaction was then performed with a 5 ~1 aliquot of the
secondary reaction as
template and all other conditions identical to the secondary reaction except
that the annealing
43
CA 02319247 2000-11-14
step was 30 s @ 58°C. A quaternary PCR reaction was then performed
using a 5 E.tl aliquot of
the tertiary reaction as template and all other conditions identical to the
tertiary reaction. The
amplified DNA was digested with PstI and XbaI and a -~-250 by fragment
corresponding to the
5' portion of AtMREI 1 was gel-purified. The middle region of AtMREl 1 was
isolated by
digestion of pF01 with XbaI and AvaII, and a 1.3 kb fragment was gel-purified.
The 3' end of
AtMREl 1 was amplified by PCR using 25 ng of pF01 as template DNA, 50 pmol MRE-
AVA
oligo and 50 pmol MRE-R1 oligo, 0.2 mM dNTP's, 2.5 U cloned Pfu (Stratagene)
and cloned
Pfu buffer constituents recommended by the manufacturer in a volume of 50 ~1.
The PCR
conditions were 3 min @ 94°C, followed by 10 cycles of 30 s @
94°C, 30 s @ 52°C and 2 min
@ 72°C, followed by 20 cycles of 30 s @ 94°C, 30 s @ 58°C
and 2 min @ 72°C, followed by 2
min @ 72°C and storage at 4°C or -20°C. The amplified DNA
was digested with AvaII and
SaII, and a 650 by DNA fragment was gel-purified. The plasmid cloning vector
pBluescript KS+
(Stratagene) was digested with PstI and SaII, and also gel-purified. To
resynthesize a gene
representing an open reading frame encoding AtMREI l: Motif I:D-A, the
fragments prepared
above were combined and ligated together, transformed into E.coli, and
putative clones of the
gene were identified as described above. The DNA sequence of the resulting
clone, pF012, was
determined to confirm it encodes AtMREI l : Motif I:D-A, with the desired
altered basepair
mutation in the 5' region of AtMREI l, and that 5' and 3' ends amplified by
PCR had the correct
sequence of AtMREl 1.
C. Genetic Assay
To demonstrate alternative mechanisms for increasing and decreasing meiotic
homologous recombination, a genetic assay was employed to examine the effects
of different
proteins on meiotic homologous recombination and non-sister chromatid exchange
in a diploid
strain of S. cerevisiae, BR2495 [27], which possesses heteroalleles at genes
essential for
biosynthesis of different metabolites required for cell growth and/or division
or viability. The
allele for a particular gene carried on the maternal chromosome has a mutation
and encodes a
non-functional protein. The allele for the same gene on the paternal
chromosome also has a
mutation making its gene product non-functional. However, the mutation of the
paternal allele is
at a different position in the gene than the mutation in the maternal allele.
Because both maternal
and paternal alleles are both mutated, the diploid cell cannot make a
functional gene product.
After meiosis, gametes and progeny that inherit only the maternal or paternal
allele also cannot
44
CA 02319247 2000-11-14
make a functional gene product. However, if a recombination event occurs
whereby genetic
information is exchanged between maternal and paternal chromosomes within the
DNA region
between the mutations carried by the two alleles, then a functional allele can
result. Progeny
carrying this recombined allele resulting from exchange between non-sister
chromatids may
therefore encode a functional gene product. Thus we have a genetic assay to
monitor exchange
of genetic information between non-sister chromatids from homologous maternal
and paternal
chromosomes. The system used here employed S. cerevisiae BR2495 strain [27]
with genotype
as follows: Mata leu2-27 his4-280 / Mat alpha leu2-3,112 his4-260; ura3-1 /
ura3-1; trpl -289 /
trpl -I ; CYH10 / cyhl0; arg4-8 thrl -I lARG4 thrl -4; ade2-1 / ade2-1. BR2495
has
heteroalleles to conveniently assay for non-sister chromatid exchange at four
loci:
i) his4 which when functional encodes histidinol dehydrogenase which
participates in
biosynthesis of histidine enabling cells to grow in absence of external
histidine;
ii.) leu2 which when functional encodes 3-isopropylmalate dehydrogenase which
participates in biosynthesis of leucine enabling cells to grow in absence of
external leucine;
iii.) trpl which when functional encodes phosphoribosylanthranilate isomerase
which
participates in biosynthesis of tryptophan enabling cells to grow in absence
of external
tryptophan;
iv.) thrl which when functional encodes homoserine kinase which participates
in
biosynthesis of threonine enabling cells to grow in absence of external
threonine.
The strain or progeny carrying defective alleles are termed auxotrophic for
histidine,
leucine, tryptophan and threonine because they are unable to grow in the
absence of these
compounds being provided externally for them. Recombinants resulting in
genetic exchange
between non-sister chromatids of homologous maternal and paternal chromosomes
leading to
functional alleles are termed prototrophs because they can make their own
histidine, leucine,
tryptophan and threonine and do not require an external source of these
compounds for growth
and cell division.
The exemplified assay system involves growth of a BR2495 strain expressing the
test
gene of interest. The strain is induced to undergo meiosis. Progeny are
assayed for viability and
the ability to grow in the absence of for histidine, leucine, tryptophan or
threonine. By
determining the number of prototrophic and viable progeny in a given
treatment, recombination
frequency can be determined (i.e. # prototrophic progeny per # viable
progeny). By comparing
CA 02319247 2000-11-14
recombination frequency between different test genes, the effect of the test
gene being expressed
on either increasing or decreasing meiotic homologous recombination can be
determined.
D. Gene Expression
To test the effect of different genes in strategies to modulate meiotic
homologous
recombination frequency a gene expression system and plasmid vectors
functional in S.
cerevisiae were employed. The exemplified expression system used was based on
the plasmids
described by Gari et al. (1997). Briefly, a series of S. cerevisiae expression
vectors were created
with variation in vector copy-number per cell and variations in strength of
transcription
promoter. Therefore, by using different vectors combining different cell copy-
number with
different promoter strengths, the effect of expressing genes at different
levels can be evaluated.
The plasmids are based on pCM188 and pCM189 with copy-number of 1-2 plasmids
per cell and
pCM190 with copy-number of upto 40 plasmids per cell [131]. The transcription
promoters on
these plasmids is a hybrid system developed by Gari et al. (1997) which
permits suppressing or
induction of gene expression by varying growth medium constituents. The
promoter system
employs a DNA-binding protein, tetR, fused to a transcription activator
derived from the VP16
protein [132]. tetR us a natural component of the regulatory system
controlling expression of
tetracycline resistance in prokaryotes [132]. In the absence of tetracycline,
tetR is bound to a
defined DNA sequence, tet0, and prevents expression of tetracycline resistance
genes. In the
presence of tetracycline, tetR binds tetracycline resulting in a
conformational change that causes
it to release tet0 and thereby permitting expression of tetracycline
resistance. By fusing tetR
with VP16 and incorporating tet0 sites with basal transcription promoter
sequences, Gari et al.
( 1997) created a regulatable transcription promoter system. In the presence
of tetracycline or
doxycycline, an analogue of tetracycline, transcription of the target gene is
suppressed because
the tetR-VP 16 fusion cannot bind to the promoter to initiate transcription.
Conversely, when
tetracycline or doxycycline is absent the tetR-VP 16 fusion protein can bind
to tet0, recruit RNA
polymerase and facilitate transcription of the target gene. By varying the
number of tet0 sites
from two (pCM188) to seven (pCM189 and pCM190) the promoter strength can be
increased
~2-fold [132]. The combination of vector copy number and promoter strength
allows target gene
expression to be varied ~5-fold (pCM188 versus pCM190).
The exemplified regulatable expression system discloses strategies to affect
meiotic
homologous recombination frequency by enabling the promotion of gene
expression in cells
46
CA 02319247 2000-11-14
preparing for and undergoing meiosis. By promoting transcription in cells
specifically at this
stage one suppresses the effects or any artifactual results due to
constitutive expression of test
genes during all stages of vegetative growth leading to meiosis.
Alternatively, a promoter could
be used which is expressed during meiosis or is meiosis-specific.
In summary, the exemplified system involves cloning genes of interest into
pCM188 or
pCM190. The cells are cultured in the presence of doxycycline to suppress
expression of test
genes during vegetative growth. The cells are prepared to undergo meiosis and
the doxycyline is
removed to enable expression of the test gene. The cells are induced to
undergo meiosis and
resulting progeny cells are tested for viability and frequency of prototrophy
resulting from
recombination between heteroalleles on non-sister chromatids. The frequency of
meiotic
homologous recombination can thus be determined for each test gene enabling
evaluation and
comparison of strategies to modify meiotic homologous recombination.
2. Single gene expression constructs
a) AtDMC 1
To show the effect of heterologous expression of DMC 1 genes on meiotic
homologous
recombination frequency, AtDMC 1 was cloned and expressed in S. cerevisiae
cells undergoing
meiosis. AtDMCI was cloned into the expression vectors pCM188, pCM189 and
pCM190. All
three vectors were digested with PmeI and the free ends were dephosphorylated
using calf
intestinal phosphatase (New England BioLabs) following protocol supplied by
the manufacturer.
pKR225 was digested with SmaI and XhoI and treated with the Klenow fragment of
DNA
polymerase (Gibco/BRL) following standard procedures [123]. The DNA fragment
released
from pKR225 corresponding to AtDMCI (~1.1 kb) was purified by agarose gel
electrophoresis
and recovered from the agarose as described above. The AtDMC 1 fragment was
then ligated to
the prepared vector fragments, transformed into E. coli and putative clones
identified as
described above. The resultant clones of AtDMCI in pCM188, pCM189 and pCM190
were
denoted pTK45, pTKS and pTK6, respectively.
b) ScDMC 1
To show the effect of increased expression of native DMC 1 on meiotic
homologous
recombination frequency, ScDMC 1 was cloned and expressed in S. cerevisiae
cells undergoing
meiosis. ScDMCI was cloned into pCM190 by first digesting this vector with
PmeI and PstI.
pMWl3 was digested with XbaI and treated with T4 DNA polymerase following
standard
47
CA 02319247 2000-11-14
procedures [123] before subsequent digestion with PstI. DNA fragments of
interest
corresponding to ScDMCI (~1.1 kb) and pCM190 (~8 kb) were purified by agarose
gel
electrophoresis and recovered from the agarose as described above. The
fragments were ligated
together, transformed into E. coli and putative clones of the gene in the
expression vector were
identified. The resultant clone of ScDMCl in pCM190 was denoted pTK58.
c) ScRAD51
To show the effect of increased expression of native RAD51 on meiotic
homologous
recombination frequency, ScRAD51 was cloned and expressed in S. cerevisiae
cells undergoing
meiosis. ScRAD51 was cloned into pCM190 by first digesting this vector with
BamHI and PstI.
pMW35 was also digested with BamHI and PstI. DNA fragments of interest
corresponding to
ScRAD51 (~1.2 kb) and pCM190 (~8 kb) were purified by agarose gel
electrophoresis and
recovered from the agarose as described above. The fragments were ligated
together,
transformed into E. coli and putative clones of the gene in the expression
vector were identified.
The resultant clone of ScRAD51 in pCM190 was denoted pTK53.
d) EcSSB
To show the effect of increased ssDNA-binding protein on meiotic homologous
recombination frequency, SSB and NLS-SSB were cloned and expressed in S.
cerevisiae cells
undergoing meiosis. SSB and NLS were cloned individually into pCM190 [132] by
first
digesting this vector with BamHI and PstI. pTK27 (SSB) and pTK29 (NLS-SSB)
were also
digested with BamHI and PstI. DNA fragments of interest corresponding to SSB
or NLS-SSB
(~0.6 kb) and pCM190 (~8 kb) were purified by agarose gel electrophoresis and
recovered from
the agarose as described above. The SSB and NLS-SSB DNA fragments were ligated
independently to the DNA fragment corresponding to pCM190, transformed into E.
coli and
putative clones of the genes in the expression vector were identified. The
resultant clones of
SSB and NLS-SSB in pCM190 were denoted pTK35 and pTK36, respectively.
E. Biological Assay
To demonstrate the effect of different genes on meiotic homologous
recombination
frequency plasmids containing the candidate genes were first created, as
described above, and
then introduced into S. cerevisiae BR2495 to create different strains. These
strains were then
grown, induced to undergo meiosis and the resultant progeny scored for
phenotypic markers to
determine meiotic homologous recombination frequency. Comparison of the
homologous
48
CA 02319247 2000-11-14
recombination frequency in the various strains to control strains containing
only the
corresponding parental vector containing no test gene enabled assessment of
the genetic and
biological effects of the test genes.
Expression vectors containing the test genes were introduced into S.
cerevisiae BR2495
cells following the method of Geitz et al. [133]. Exemplified genes and the
corresponding
expression plasmids are outlined in TABLE 2. Cell lines carrying these plasmid
constructs were
selected for by culturing cells in minimal medium lacking uracil (i.e. SC-URA;
REF): BR2495 is
homozygous for the defective ura3-1 allele [27] and therefore cannot
synthesize this essential
metabolite; expression plasmids based on pCM188, pCM189 and pCM190 have a
functional
URA3 gene and therefore BR2495 cells possessing such plasmids will be able to
synthesize
uracil and be able to grow on medium lacking uracil. Cells were cultured in
the presence of
doxycycline (10 ~,g/ml for solid media; 5 ~g/ml for liquid media) to suppress
expression of test
genes until desired growth stages.
To assay meiotic homologous recombination frequency, single colonies from each
test
strain were used to first inoculate 3 ml of SC-URA+DOX (i.e. SC-URA containing
doxycycline
at 5 ~g/ml) in a 15 ml tube (Falcon) which was then incubated at 30 C with
shaking (200 RPM)
for ~1.5 d. Ten cultures were prepared for each test strain, including BR2495
possessing the
parental expression vector without a test gene and BR2495 possessing the
various expression
plasmids containing the test genes. Cells from 1 ml of culture were pelleted
by centrifugation at
9000 RPM for 2 min in a standard microcentrifuge (Brinkman) and resuspended in
1 ml of
sterile-distilled water (SDW). The cells were used to inoculate 5 ml of SC-A
pre-meiosis
medium (per litre: 1.7 g yeast nitrogen free base (Difco), 5 g ammonium
acetate (Sigma), 20 g
potassium acetate (Sigma), 2 g amino acid drop out mix [134]; and in some
experiments
doxycycline at 5 ~g/ml) in a 50 ml tube (Falcon) at a 1:50 dilution. The
cultures were then
incubated at 30 C with shaking (225 RPM) for 2 d. Aliquots of cells from each
culture were then
collected to assay for mitotic homologous recombination frequency occurring
during vegetative
growth. Dilutions of these cells were plated on YPD (RECIPE) medium to
determine viable cell
number, and plated on minimal media lacking particular amino acids so as to
examine
homologous recombination at different test genomic loci in BR2495 (i.e. SC
minus histidine
(SC-his), leucine (SC-leu), threonine (SC-thr), or tryptophan (SC-trp) [134]).
These plates were
incubated at 30 C for 2-4 d and then colonies were counted. The remaining
cells in each culture
49
CA 02319247 2000-11-14
in pre-meiosis medium were pelleted by centrifugation at 4000 RPM for 10 min
at 4 C. For
cultures containing doxycyline in the pre-meiosis medium, the pellet was
resuspended in 5 ml of
SC-A pre-meiosis medium and incubated at room temperature for 3 h. These
cells, and those
cells incubated in pre-meiosis medium without doxycycline, were then pelleted
by centrifugation
at 4000 RPM for 10 min at 4 C and resuspended in 4 ml SPM meiosis-induction
medium (0.3%
(w/v) potassium acetate, 0.02% (w/v) raffinose, 5 ~g/ml histidine, 25 ~.g/ml
leucine, 5 ~g/ml
tryptophan, 50 ~g/ml threonine, 5 ~,g/ml adenine). The cells were again
pelleted by
centrifugation at 4000 RPM for 10 min at 4 C and resusspended in 3.5 ml SPM
meiosis-
induction medium. Cultures were then incubated at 30 C with shaking (225 RPM)
for 2 d to
enable cells to undergo meiosis. Dilutions of the cells were made using SDW
and cells were
then plated on YPD to determine viable cell number, and on minimal media
lacking particular
amino acids so as to examine meiotic homologous recombination at different
test genomic loci in
BR2495, as described above. Duplicate dilutions and plating of each culture
was performed.
Plates were incubated at 30 C for 2-4 d and then colonies were counted.
Frequency of
recombinants for each culture was determined by dividing the number of
prototrophs conferred
by restoration of function for a particular test locus heteroallele by the
viable cell number, taking
into consideration the dilution factors. Meiotic homologous recombination
frequency for each
culture was corrected when necessary for background recombinants resulting
during vegetative
growth by subtraction of the mitotic homologous recombination frequency
determined prior to
placing the cells in SPM meiosis-induction medium. Means for the 10 replicates
of each test
strain were determined using the corrected values. Inclusion of the values
from all 10 replicates
in determining the mean was evaluated by the Q-test [135] and values from
individual replicates
were excluded from the final mean if the statistic indicated a significant
deviation from the
values of other replicates. Comparison of means of meiotic homologous
recombination
frequency from test genes to that from control strains was done to determine
the effect of the test
gene. Statistical significance of the differences between these values was
confirmed by
evaluation using the t-test [136].
Results
As shown in TABLE 2, results from the exemplified embodiments demonstrate
modification of meiotic homologous recombination frequency and non-sister
chromatid
exchange through modifying the expression and activity of components of the
DNA
CA 02319247 2000-11-14
recombination process. The genetic evidence shows that non-sister chromatid
exchange during
meiosis is modified by the exemplified embodiments.
1. Reduced meiotic homologous recombination frequency
Meiotic homologous recombination may be reduced by a dominant-negative effect
conferred by heterologous expression of a protein or expression of a mutant
form of a native
protein. This reduction occurs at different genomic loci both on the same and
different
chromosomes. In the exemplified embodiments, heterologous expression of AtDMC
1 in S.
cerevisiae results in up to a 34% reduction in meiotic homologous
recombination. The
suppression is found at three different genetic loci , his4 and leu2, located
on chromosome III,
and trill , located on chromosome IV. The level of suppression of meiotic
homologous
recombination may also be regulatable by controlling the level of expression
of the inhibitory
factor, as demonstrated by the estimated 3-fold difference in expression
between pTKS and
pTK6 resulting in ~20% difference in inhibiting meiotic homologous
recombination frequency.
ScDMC 1 expressed in plants or animals may also be used to decrease meiotic
homologous
recombination. These results also demonstrate the efficacy of a dominant-
negative effect to
reduce meiotic homologous recombination frequency. In alternative embodiments,
this may also
be achieved by expressing an altered form of a native protein.
2. Increase meiotic homologous recombination frequency
In the exemplified embodiments, meiotic homologous recombination frequency
occurs at
different genomic loci both on the same and different chromosomes. Increased
expression of
either ScDMC 1 or ScRADS 1 individually is shown to increase meiotic
homologous
recombination frequency by up to ~5- or ~3-fold, respectively. The increase is
shown at three
different genetic loci , his4 and leu2, located on chromosome III, and trill,
located on
chromosome IV.
In alternative exemplified embodiments, expression of prokaryotic proteins is
shown to
increase or decrease homologous meiotic recombination. Heterologous expression
of a ssDNA-
binding protein, SSB, is shown to decrease or increase homologous
recombination frequency
depending upon the genomic locus. A dominant-negative effect results at some
loci to suppress
homologous recombination, as shown at the leu2 locus where a reduction of
homologous
recombination frequency by ~40% was shown. In contrast, a stimulation of
homologous
recombination occurs at some loci, as shown by the his4 locus where homologous
recombination
51
CA 02319247 2000-11-14
frequency was enhanced by 13%. In both cases, the action of SSB in eukaryotes
was promoted
~10% by addition of a nuclear localization sequence to the protein (i.e. NLS-
SSB). In alternative
embodiments, modifying the function or expression of endogenous native ssDNA-
binding
proteins may also be used to modify meiotic homologous recombination
frequency.
52
CA 02319247 2000-11-14
TABLE 1: Oli~onucleotides for amplifying and modifying target genes
Oligo name Target Sequence ( 5' -3' )
Gene
OL11434 AtDMCl CATATGATGGCTTCTCTTAAGGCTG
OL11433 AtDMCl GACATATAAAAGAGTTCGCTCC
OL11435 AtDMCl AAACTCGAGCTAATCCTTCGCGTCAGCAATG
AtSPO-5'Sma AtSP011 GGGTATGGAGGGAAAATTCGCTAG
AtSPO-3'X AtSP011 CCTTGAGTTGGAGACTAGTTATC
AtSPO-3'PstNotAtSP011 ATCCTGCAGGCGGCCGCTCATCAAGGAGAGCTTAC
TTCACG
AtRAD51-5'Bam AtRAD51 GGGGGATCCAAAAAAATGACGACGATGGAGCAGCG
AtRAD51-3'X AtRAD51 GAAGCAAGGCATTGTTGTGG
AtRAD51-3'Pst AtRAD51 AACTGCAGTTATCAATCCTTGCAATCTGTTACAC
OL12414 AtMREII CGGAATTCATGATTGTAAAACTTGACAGGG
OL12413 AtMREII GGTCGCTGACTACTTGAAAC
OL12415 AtMREII TCATTCAGACAGTGGCGACG
OL12779 AtMREII GGCCTGAAGTTCAAGAAG
OL12780 AtMREII GCTCGACTTCTTCGCTTG
MRE-F1 AtMREII GCG CTG CAG CAT ATG CCC GGG GAA
TTC
ATG TCT AGG GAG GAT TTT AGT GAT
ACA
CTT
MRE-F2 AtMREIl GCG CTG CAG CAT ATG CCC GGG GAA
TTC
ATG TCT AGG GAG GAT TTT AGT GAT
ACA
CTT CGA GTA CTT GTT GCA ACT G_CT
TGC
CAC TTG GGC TAC
MRE-Rl AtMREIl CGC GTC GAC CCC GGG TTA AGG CGC
GCC
TCT TCT TAG AGC TCC ATA G
MRE-AVA AtMREII GAT AGG TCC ACT CGA CCC ACT GG
yDMC-5'Bam ScDMCl GGGGGATCCAAAAAAATGTCTGTTACAGGAACTGA
G
DMC-3'Pst ScDMCl AACTGCAGCTACTAGTCACTTGAATCGGTAATACC
YDMC-G126D- ScDMCl GGTGAATTTAGGTGTGATAAGACACAGATGTCTC
sense
YDMC-G126D- ScDMCl GAGACATCTGTGTCTTATCACACCTAAATTCACC
antisense
YDMC-N263Y- ScDMCl GCAGTATTTCTGACATACCAAGTTCAATCAGAC
sense
YDMC-N263Y- ScDMCl GTCTGATTGAACTTGGTATGTCAGAAATACTGC
antisense
YDMC-A288T- ScDMCl GAGGGCACGTTCTGACACATGCGTCAGC
sense
YDMC-A288T- ScDMCl GCTGACGCATGTGTCAGAACGTGCCCTC
antisense
yR51-5'Bam ScRAD51 GGGGGATCCAAAAAAATGTCTCAAGTTCAAGAACA
AC
R51-3'Pst ScRAD51 AACTGCAGTTACTACTCGTCTTCTTCTCTGGGG
YRAD51-G190D- ScRAD51 CGGTGAATTCAGGACAGATAAGTCCCAGCTATGTC
sense
53
CA 02319247 2000-11-14
YRAD51-G190D- ScRAD51 GACATAGCTGGGACTTATCTGTCCTGAATTCACCG
antisense
yR52-5'Pme ScRAD52 AAAGAATTCGTTTAAACATGGCGTTTTTAAGCTAT
TTTG
R52-3'Not ScRAD52 ATCGCGGCCGCTCATCAAGTAGGCTTGCGTGCA
R54-5'RI ScRAD54 GGGGAATTCAAAAAAATGGCAAGACGCAGATTAC
yR54-3'Pst ScRAD54 AAACTGCAGTCATCAATGTGAAATATATTGAAATG
C
SPO-5'Bam ScSP011 ATCGGATCCAAAAAAATGGCTTTGGAGGGATTG
Ys o-3'Pst ScSP011 GGGCTGCAGTCATCATTTGTATTCAAAAATTCTGG
YSPO-Y135F- ScSP011 GTGAGAGATATCTTCTTCTCCAACGTGGAATTG
sense
YSPO-Y135F- ScSP011 CAATTCCACGTTGGAGAAGAAGATATCTCTCAC
antisense
54
CA 02319247 2000-11-14
0
0
o
o
~ _
o
x
~ ao ~ 0 0
Z O
~
~
y _ ~.j
O
Z
T
a
V
00 OO O O O O
Q MO~ h ~ .O O~N
a'
~ M M N
Mh ~ 00 M 'O
O ~ O
. O 4 * 00
~_ ~ N
O O V1 V 7
a
a
:;
v
H ,i~
r O~ .Q ~ N N ~ ~O h y G
.
OG O O O O N o0 N O O ~p,
~ v
O
V _C
n
d T _ T T T T T T ~T ~,v n '~ O
a
O O O O O O O O CO C p O C ~ C CO C
O
4
O ~ X O X X O O X hQ~O~_X ~C~C _ _ _X _
Q ~ ~ ~ X X X ~C O
O 'p N N M ~ N_ ~ON ~ h Y1h Y1~ ,.~.
L '.r
G. _ ~ M N N - h~ N N ? h ~ J~ ~00O
a V V
N _ V
~ V
G O _ ~ 'C a~
L
'~i
O i ~ a
2~ L
T o ,.., M V1 p .n
.; p ' a
r _ ,
o n n a
v
.
c ... v "
_
L
.= G
' '..
G. O
~ ~ ~ ~ '"' N M ~ '
Z o
. o o . ~ = ~
o O O v
L ~
O O O O O O N .. yr
v
~
_ _ ~
9 L
_
'O O
r
p O C CC C C C ~ 0 OO C CO O C ~pp
C
X X X XX ~ ~ X X XX 7 J
~ ~
O ~OM nO vp.p h 'J~O ~n OC x,.. _ a .oa .o 7
~ N N v1 00 O~ N M ~ N
C, ~Cb'V1~ Y1M M M - _ O~ -ef f'1 ~Gt W G~ '~ ~
~ a~
v ~
a ;.
a
e ,r
a~ 3 3 33 3 3 3 3 L LL L LL L L L s L s L=
_
N
3 ~ O? O ~ O ~ C '
J ~
z ~ _
'C
C
G G
U ;J 9
_ 'X~ ~ C C C C G CC G CC C C G C C C C
O ~ ~
E y
O
y ~ ~ O O O O O OO O OO O O O O O O OC .
~' ' L O .
7
v
O ~ r ~ L L~ L L = L L L L~ L
3 3 33 ~nv w v v i
~ ,s, : ;n : :;n r :n:~w ;n ~ ;7: ;i:.n acn~ ~o
g v
o
a
i o
y o000000oa a a c o 0 00 ~ ~ o 00 v '
~ -~ ~ s
o x o0ox o0 00 0oa v r ..
o o w
~ o
~a
~ oc
' _ _ _ _ aa . o aa
3
_
j :JCrsr:J:JU CJ :JJ 'JsJ sJ srs.is,J :JCJ :~v J.r
' .~ 3
L ~
>
'
o ''~' v, v' M
~ ~ x c~ ~ :L rC ~G' ' ' ' LM o '
a a:G_ ~ s ~ t c
-
_ o r-.cr-o ;- ~ ~ o r.o _ a ~ _ ~ ' ~
0 a v a a v
G
V
a a ~ C.
.
3
v >
A ~
E ~ 3
~ =
v
~ N ~ N ~ N ~. N _ J L
C v
O
7 O
X ~ O
a7 C v
T
~ a
~..
i
. ,~ O
L 2
V a
...
a
a ~
~
m r ~ ~
n E o
o
D ~ ~ :n a o
~ o~v
y
55
