CA 02321223 2000-08-18
WO 99143851 1 PCT/IE99/00012
HLA linked nre-eclamosia and miscarriage susceptibility acne
The present invention relates to a susceptibility gene for pre-eclampsia and
eclampsia, and the use of such
a gene in methods for diagnosing susceptibility to these diseases. The
invention also relates to a test kit
for diagnosis of susceptibility and to pharmaceutical compositions for the
prevention or treatment of the
diseases. The invention can also be used in the diagnosis of susceptibility to
miscarriage and/or
miscarriage-related infertility and/or intrauterine growth retardation.
Specifically. the present invention relates to methods and materials used to
detect a HLA linked human
pre-eclampsia and miscarriage predisposing gene (HLA-G), some alleles of
which, or linked alleles of
linked genes of which, cause susceptibility to pre-eclampsia and miscarriage.
More specifically, the
I o invention relates to sequence variation in the HLA-G gene and linked genes
and their use in the diagnosis
of susceptibility to pre-eclampsia and miscarriage. The invention further
relates to sequence variations in
the HLA-G gene and their use in diagnosis and prognosis of pre-eclampsia and
miscarriage. Additionally.
the invention relates to the therapy for pre-eclampsia and miscarriage and for
susceptibility to pre-
eclampsia and miscarriage including protein therapy, gene therapy and protein
mimetics. The invention
also relates to screening for drugs for pre-eclampsia and miscarriage therapy
and for susceptibility to pre-
eciampsia and miscarriage therapy. Finally, the invention relates to the
screening of the HLA-G gene and
linked genes for sequexrec variations which are useful for diagnosing
suscxptibility to pry-eclampsia and
miscarriage.
Pre-eclampsia is the major cause of foetal and maternal morbidity and
mortality with probable long term
adverse effects on health due to the prolonged associated intrauterine
hvpoxia. Pre-oclampsia occurs in
approrimately five to ten percent of all population births and is uniquely a
disease of pregnancy. Acute
pathological changes begin to resolve soon after delivery. The pathologic
mechanisms causing pre-
eclampsia arc unclear and no marker predictive for the disease prior to
clinical evidence of the disease has
been identified. Furthermore an association has been observed behveen
miscarriage and pre-eciampsia
(Cooper et al.. 1988).
Epidemiological studies show the disease to be highly heritable, mainly
confined to first pregnancies and
largely prevented by normal first pregnancy by the same partner. Patients
affected in first pregnancies
have a 13.1% recurrence risk for their second, whereas with a normal first
preranancy, the incidence in the
second is of the order of 1 %. 'Thus, the first pregnancy appears to have a
significant protective effect
3o against pretclampsia in a subsequent pregnancy. Therefore. it follows that
pro-eclampsia is preventable
in principle (Lie er nl., 1998).
SUBSTITUTE SHEET (RULE 28)
CA 02321223 2000-08-18
WO 99/43851
<210> 4
<211> 460
<212> DNA
<213> Homo sapiens
<400> 4
PCTIIE99/00012
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcaca ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 290
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct 960
<210> 5
<211> 460
<212> DNA
<213> Homo sapiens
<400> 5
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcata ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 240
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct 460
<210> 6
<211> 319
<212> DNA
<213> Homo sapiens
<400> 6
gaccgagggg gtggggccag gttctcacac cctccagtgg atgattggct gcgacctggg 60
gtccgacgga cgcctcctcc gcgggtatga acagtatgcc tacgatggca aggattacct 120
cgccctgaac gaggacctgc gctcctggac cgcagcggac actgcggctc agatctccaa 180
gcgcaagtgt gaggcggcca atgtggctga acaaaggaga gcctacctgg agggcacgtg 240
cgtggagtgg ctccacagat acctggagaa cgggaaggag atgctgcagc gcgcgggtac 300
caggggcagt ggggcgcct 319
<210> 7
<211> 319
<212> DNA
<213> Homo Sapiens
zi9
SUBS11'TUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99100012
2
Several classification schemes have been proposed to aid clinical recognition
of pre-eclampsia. The
classification advocated by the US National Institutes of Health working group
on hypertension in
pregnancy. is a rise in blood pressure of >ISmm Hg diastolic or >30mm Hg
systolic from measurement in
early pregnancy. or to > 140/90 mm Hg in late pregnancy if no early reading is
available; plus proteinuria
(>0.3g per 24 h) and/or odema. However, in practice, prateinuria measurements
may not always be
determined and symptoms additional to a rise in blood pressure such as
headache, visual disturbance
and/or epigastric pain indicate a deterioration in pregnancy consistent with
pre-cclampsia and form a
basis for clinical intervention of early delivery by caesarean section to
resolve the condition. Spinilio er
al. ( 1994) reported that women with pre-eclampsia had a significantly
increased incidence of intrauterine
1 o growth retardation (IUGR) small for gestational age {SGA) infants.
Although the cause of pre-eclampsia is unknown, hypertension is observed in
pre-eclampsia and has been
the focus of a large amount of research on the disorder. However, the
pathological and physiological
changes of pre-eciampsia show that this syndrome is much more than pregnancy-
induced hypertension.
Evidence to date implicates the action of placental trophoblasts as the
underlying cause.
In pre-eclampsia, cytotrophoblast invasion is shallow and spiral arterioi
invasion is abnormal. resulting in
reduced blood perfusion of the intervillous space. Moreover the characteristic
pattern of integrin
switching that takes place during normal trophoblast differentiation does not
occur in pre-eclampsia.
The outermost layer (trophoblasts) of the human placenta is devoid of
classical class I human leukocyte
antigens (HLA-A and HLA-B) and class II proteins {HLA-DR, HLA-DQ and HLA-DP).
Although this
20 prevents recognition by maternal T lymphocytes, the lack of class I
molecules leaves these cells
susceptible to attack by natural killer (NK) cells. However, trophoblast cells
directly in contact with
maternal tissues selectively express a characteristic nonclassical class Ib
molecule. HLA-G. HLA-E and
limited HLA-C expression also occurs . Expression of HLA-G has been shown to
be sufficient to protect
otherwise susceptible target cells from NK cell mediated iysis. NK cells
usually express several different
25 inhibitory receptors of various specificities at the same time. Cross
linking of any single inhibitory
receptor is sufficient to inactivate NK cell activity against all possible
targets. It has been shown that
membrane bound HLA-G molecules were able to inhibit alloreactive NK cells with
NK inhibitory receptor
1 and inhibitory receptor 2 (NK 1 and NK2). It has been shown that CD94 / NKG2
is the predominant
inhibitory receptor involved in recognition of HLA-G by decidual and
peripheral NK cells. Thus. at a
3o functional level, HLA-G is able to protect target cells from destruction by
NKl-,NK2-and NKG2 specific
effector cells (Loke and King, 1997). More recently, HLA-G has been shown to
modulate the ability of
blood mononuclear cells to release cWokines (Maejima et al. 1997) suggesting a
role for HLA-G in
triggering maternal-foetal immune interplay. Specifically, coculturing of HLA-
G expressing cells with
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99100012
peripheral blood mononuclear cells (PBMC) increased the amount of interleukin-
3 (IL-3) and interleukin-
1 beta (IL-1 beta) and decreased the amount of tumour necrosis factor-alpha
(TNF-alpha) release from
the PBMC cells.
HLA-G binds a diverse but limited array of peptides in a manner similar to
that found for classical class I
molecules and it has been reported that HLA-G is expressed in the human thymus
raising the possibility
that maternal unresponsiveness to HLA-Cr expressing foetal tissues may be
shaped in the thymus by
central presentation of this MHC molecule on the medullary epithelium (Crisa
et al. 1997) HLA-G is
known to be capable of stimulating a HLA-G restricted cytotoxic T lymphocyte
response and HLA-G
molecules can serve as target molecules in lytic reaction with cytotoxic T
lymphocytes and HLA-G
to expressed internally in vivo in transgenic animals is involved in education
of the lymphocytic repertoire
(Schmidt et al., 1997).
Major histocompatibility (MHC) mol~ules bind a diverse array of peptides for
presentation to T cells as
part of a mechanism for recognition of self and non-self cells and
pathologically altered cells. A detailed
analysis of peptides bound to the soluble and membrane HLA-G proteins shows
that, like MHC class 1
IS molecules, HLA-G also binds a diverse, although less complex array of
peptides (Lee et al., 1995). Some
of these peptides, which are derived from intracellular proteins, constitute
minor histocompatibility
antigens which in conjunction with MHC molecules provoke an immune reaction by
blood mononuclear
cells such as T cells. HLA bound peptides can readily be fractionated, fully
or partially purified and
sequenced and can be assayed for their capacity to promote an immune reaction
by measurement of their
2o capacity to reconstitute iysis of target cells by eytotoxic T cells (den
Haan et al., 1998).
The entire gene sequence of HLA-G is known and DNA sequence analysis of HLA-G
has shown that the
HLA-G gene exhibits limited polymorphism. van der Van & Ober, 1995 examined
the first six exons of
HLA-G in 45 healthy African-Americans and observed variations in exons 2 and
3, which correspond to
the alpha I and alpha Z domains of the peptide binding grove. The most common
polymorphism observed
25 was a C to T transition at position 1488, corresponding to colon 93.
Another common pohinorphism
was identified by Harrison et al. 1993 and is a 14 by deletion in exon 8 of
the gene. These results indicate
that HLA-G is a polymorphic gene potentially capable of presenting a wide
variety of peptides. Patterns
of variability in HLA-G are similar to those of other class I MHC genes, where
amino acid substitutions
are clustered in the alpha l and alpha 2 domains.
30 Three observations of altered expression of HLA-G in pre-eclampsia have
been reported. Colbern et al..
1994 showed that the level of HLA-G in placental tissue was reduced in pre-
eclampsia and that the
decreased expression appeared to be related to a reduced number of
trophoblasts in pre-eclamptic
placental tissue. Hara er al., 1996. showed that clusters of extravillous
trophoblasts were devoid of HLA-
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
4
G in pre-eclamptic patients. Examination of human preimpantation blastocysts
showed that only 40% of
the blastocysts expressed HLA-G (3urisicova, et al. 1996).
Inheritance
Several bodies of evidence show that pre-eclampsia and eclampsia are largely
under genetic control.
However the genetic mechanisms underlying susceptibility to pre-ecfampsia
remain unclear. This is
largely due to confounding factors peculiar to its inheritance. First, the
condition is specific to pregnancy
and genetic studies to date have not been able to clarify whether the genes
responsible are acting through
the maternal or foetal genotype or through some interaction between the rivo.
Secondly, pre-eclampsia is
largely confined to primagravidas with a much lower incidence in subsequent
pregnancies and thirdly, as
to the condition is specific to pregnancy, the genetic contribution of males
is difficult to assess.
Diagnosis of true pre-eclampsia can be complicated by other hypertensive
disorders such as essential
hypertension and hypertension arising from renal disease. Such hypertensive
disorders are distinct from
true p .re-eclampsia but nonetheless can confound diagnosis and thus pose
problems for genetic studies.
The classification of pre-eclampsia by some investigators as a disease of
immune dysfunction has
l5 prompted a number of studies on the role of the major histocompatibility
complex in the genetics of pre-
eclampsia.
There are numerous published studies on HLA associations with pre-eclampsia
(Cooper et al., 1993).
Besides the fact that the positive associations are, with one exemption, not
reproduced in studies by
others. these studies suffer from other difficulties. The number of
individuals are generally small in
2o comparison to the large number of antigens at each of the HLA loci. There
is a tendency for only
significant associations to be reported and so there may be completed studies
showing no association that
have not been published besides those reported here. The first four
associations reported are with antigen
sharing or homozygosity. The number of antigens recognised has vastly
increased with time. Antigens
have been split as new sera become available, and the use of DNA techniques
has split these further so
25 that there are over 100 HLA-A and 100 HLA-B alleles and over 25 HLA-DRB
alleles (including five
different. common sequences recognised as DR4 serologically). Thus what were
typed as the same allele
in homozvgotes or shared antigens in the early studies cannot be relied on to
be homogenous in sequence
or function. Detecting homozygotes with sera in early studies suffers from the
extra difficulty of
distinguishing them from heterozygotes for another allele for which sera did
not exist (blanks).
At least three studies have further investigated the association between pre-
eclampsia and HLA-DR by
linkage analysis (Winton et al.. 1990: Hayward et al., 1992, Harrison et al..
1997). In these definitive
studies no evidence was found for linkage of the HLA region to pre-eclampsia.
Havward et al. ( 1992)
SUBSTTTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PGT/IE99100012
also investigated several candidate genes and random DNA markers. Overall, no
evidence was found for
linkage to several candidate genes implicated in the pathogenesis of
hypertension and their results
excluded linkage to several markers. In these studies, an autosomal recessive
model was assumed. Winton
et al. ( 1990) also analysed their data for a HLA linkage using the affected
sib pair method and the
5 affected pedigree-member method. Both of these methods make no assumption
about the mode of
inheritance and neither gave any indication of linkage. The majority of pre-
eciampsia cases are considered
sporadic. A familial pregnancy-induced hypertensive disorder has been
described and two loci have been
implicated in the familial form of the disorder, namely, a candidate region on
chromosome 4 and the
eNOS gene region on chromosome 7 (Harrison et nl., 1997, Arngrimsson et al.,
1997). The epidemiology
of PET is consistent with familial pregnancy-inducxd hypertensive disorder and
sporadic PET being
distinct entities.
Humphrey et al., I995, investigated the HLA-G deletion polymorphism for
association with pre-
eclampsia. Specifically, pre-eclamptic.patients, offspring of pre-eclamptic
mothers, blood relatives of pre-
eclamptic patients, husbands of pre-eclamptic patients and a normal control
group were genotyped for the
polymorphism. The was no detectable association between pre-eclampsia in
mothers or in offspring of
pre-eclamptic mothers and the HLA-G deletion polymorphisms.
Karhukorpi et al., 1997 investigated HLA-G polymorphisms for association with
recurrent spontaneous
miscarriage. Specifically, they showed that there was no association between
several HLA-G restriction
fragment length polymorphisms and recurrent spontaneous miscarriage.
In the largest study of monozygotic twins, pre-eclampsia was reported in five
first pregnancies, and all
affected mothers were discordant with their twin. A second well documented
report on an identical set of
twins also showed clear discordance for pre-eclampsia in their first
pregnancies. These observations argue
against a recessive model and further support a role for the foetal paternal
genotype in the disorder.
Furthermore. although the subject of some controversy, pre-eclampsia occurs in
mothers with mono-and
di-zygotic twins arguing against a recessive fotfa1 genotype and in favour of
a dominant paternal gene in
the foetus.
Some studies have considered the possibility of changing paternity as a
contributing factor in the
occurrence of pre-eclampsia in multiparae. Most notably; a strong association
between pre-eclampsia and
changing paternity has been observed (Lie et al., 1998).
Much of the work on pre-eclampsia has been based on the hypothesis of a major
susceptibility locus in the
affected mother and almost all of the genetic studies to date have focused on
linkage or association
between the genotype of the mother and pre-eciampsia. In order to test the
hypothesis that foetal HLA-G
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
6
is the most likely candidate gene for the disorder, we have investigated HLA-
Cr genotypes in pre-
eclamptic and control trios and have shown that HLA-G is linked to both normal
and pre-eclampsia
pregnancy outcome and associated with recurrent spontaneous abortion. We have
also investigated HLA-
G genotypes in second pregnancies of control and pre-eclamptic trios and have
shown that the presence of
specific HLA-G alleles in the foetus in first pregnancy permits the occurrence
of different HLA-G alleles
in second pregnancy showing that HLA-G can induce tolerance to antigens in the
first pregnancy and/or
can modif~~ the maternal immune system to accept foetuses in the second
pregnancy in the absence of
pregnancy related disorders that are selected against and/or cause pregnancy
related disorders in first
pregnancy.
Early pregnancy loss is the most common complication of human gestation of
women attempting
pregnanc~~. The majority of these losses are clinically unrecognised. Using a
highly sensitive assay, the
total incidence of miscarriage was estimated to be 31 %, including 22% of
losses which occurred at the
ven~ early stages of pregnancy i.e. before the pregnancy was clinically
recognised. (Wilcox et al., 1988).
Recurrent spontaneous abortion (RSA) or recurrent miscarriage, defined as the
loss of three or more
I 5 spontaneous pregnancies before 20 weeks gestation, occurs in less than 1 %
of pregnant women. Studies
suggest that the chance of a successful pregnancy in an untreated woman who
has experienced two or
more first trimester miscarriages and no live births is approximately 30% to
50%. It is generally accepted
that RSA is a condition with many different causes. however, about 50% of all
RSA cases are not
explained by structural genetic, endocrine, infectious or anatomic factors.
Within the past few years there
has been a growing recognition that recurrent pregnancy loss may have
autoimmune (immunity against
self) and alloimmune (immunity against another person) causes, even in women
with no clinically
diagnosed autoimmune diseases. This has lead to investigation of the role of
the HLA system and RSA,
in particular. much emphasis has been placid on the degree of sharing of HLA
alleles and hapiotypes
behveen RSA couples. It has been suggested that fetuses whose HLA alleles do
not differ from maternal
alleles (i.e. histocompatible fetuses) are more likely to be aborted than
fetuses with HLA alleles that differ
from maternal alleles (i.e. histoincompatible fetuses). It would follow then
that couples who match for
HLA alleles or haplotypes would produce histocompatible fetuses and hence be
at risk of miscarriage.
Ober et al. ( 1998) conducted a l0 year prospective study of HLA matching and
pregnancy outcome. A
significant increase in fetal loss was observed in couples who matched for a
16-locus haplotype
encompassing the entire HLA locus. Christiansen et al. ( 1997) examined HLA-C
and HLA-Bw in
unexplained RSA couples. They found no variation in HLA-C, but a significantly
higher number of RSA
couples have the HLA-Bw4 haplotype than control couples. lin et al., (1995)
examined the degree of
sharing of HLA-A. HLA-B. HLA-DR and HLA-DQ haplotypes. They found a
significant excess of
SUBSTTTUTE SHEET (RULE Z6)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
7
HLA-DR sharing in couples with RSA, and also a significant excess of HLA-DQ
sharing in couples with
unexplained infertility.
Several groups have recorded conflicting results. Billingard et al., (1995)
examined sharing of HLA-A.
HLA-B. and HLA-DR alleles and found no higher degree of HLA sharing in couples
with RSA than in
fertile couples. Caudle et al., (1983) reported similar findings. HLA-A, HLA-B
and HLA-DR alleles
were typed in a large population of unexplained RSA couples and in control
couples (Sbracia et al.,
1996). No increased sharing in HLA alleles was observed. In addition, there
was no difference in tire
frequency of HLA alleles between RSA couples and control couples. Saski et
al., (1997) reported an
increase in the frequency of the HLA-DR4 allele in women who suffered from RSA
compared to control
women.
'The role of HLA sharing as a risk factor for RSA remains controversial, and
no studies have reported any
diagnostic or prognostic significance to HLA sharing in individual couples. In
addition, reports of
significant sharing of class II genes are difficult to explain as fetal cells
in contact with the maternal
immune system during pregnancy are devoid of HLA class II expression.
t 5 According to the present invention there is provided a method for
diagnosing susceptibility to normal
pregnancy. pre-eclampsia and/or eclampsia and/or intrauterine grrnvth
retardation and/or susceptibility to
miscarriage and/or miscarriage-related infertility comprising the steps of
a) obtaining a fluid and/or tissue sample from a female and/or male and/or
foetus; and either
b) determining the sequence of all or part of the HLA-G nucleic acid, and/or
HLA-G linked nucleic
2o acid; or
c) detecting variant forms of all or part of the HLA-G protein, andlor
proteins encoded by HLA-G
linked genes or:
d) measuring the functional activity of all or part of the HLA-G encoding
protein and/or proteins
encoded by HLA-G linked genes or:
25 e) measuring the size and/or level of all or part of HLA-G mRNA or mRNA
transcribed from HLA-G
linked genes or:
f) measuring the size andlor level of all or part of HLA-G protein andlor
protein encoded by HLA-G
linked genes or:
g) quantifying cells or molecules whose concentration changes as a result of
HLA-G action; and
30 h) comparing any of the parameters b) to g) with those of a female and/or
male and/or fetus of a
normal pregnancy and/or a pregnancy with pre-eclampsia andlor eclampsia and/or
intrauterine growth
retardation and/or susceptibility to miscarriage andlor miscarriage-related
fertility outcome.
SUBSTTI'UTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 g PCT/IE99/00012
Preferably the HLA-G nucleic acid is analysed by the presence of the C andlor
T allele of codon 93 in
eron 3 and/or the insertion andlor deletion allele of exon 8.
Preferable the effect of one or more of the HLA-G sequence variants on the
functional activity of HLA-G
and/or on the size and/or the level of all or part of the HLA-G mRMA andlor
its encoded peptide is
measured.
In its simplest the present invention provides a method of diagnosing
susceptibility to pre-eclampsia
andlor eclampsia and/or intrauterine growth retardation a nd/or susceptibility
to miscarriage and/or
miscarriage-related infertility comprising the steps of:
a) obtaining nucleic acid from a parent and/or a prospective parent and/or
foetus;
t 0 b} establishing the HLA-G sequence variants present in the parent and/or
foetus by analysing the
nucleic acid isolated in step (a); and
c) comparing the HLA-G sequence variants identified in step (b) with known HLA-
G sequence
variants.
Preferably, the HLA-G sequence variants are established by characterising all
or part of the DNA
I 5 sequence of the HLA-G gene by methods selected from DNA sequencing, PCR-
restriction fragment
length polyTnorphism analysis, glycosylase mediated polymorphism detection,
oligonucleotide
hybridisation. gel electrophoretic detection of polymorphisms and
amplification based detection
approaches.
Suitably. a stratified approach is used whereby the CfI"-93 in exon 3 and
insertion/deletion pol3nnorphism
20 in exon 8 are first genotvped, followed by genotyping of other variations
in exon 3, exon 2. intron 2,
followed bc~ exon I and 4, followed by the remainder of the HLA-G gene.
The invention also provides a test kit for the diagnosis of susceptibility to
normal pregnancy, pre-
eclampsia and/or eclampsia andlor intrauterine growth retardation and/or
susceptibility to miscarriage
and/or miscarriage-related infertility comprising:
25 a) oligonucleotide primers for amplification of alI or part of the HLA-G
gene and/or HLA-G linked
DNA:
b) amplification reagents for amplification of genomic DNA and/or RNA
segments, selected from a
DNA / RNA polymerise. a reverse transcriptase, the deoxyribonucleotides dATP,
dCTP, dGTP. dTTP
and dUTP. and/or ribonucleotides ATP, CTP, GTP, TTP and UTP, and reaction
butler;
30 c) reagents for identifying sequence variants in DNA and/or RNA;
d) control DNA and/or RNA.
Preferably the primers of (a) allow specific amplification of all or part of
the HLA-G gene using the
polymerise chain reaction. Several polvmorphisms are known to occur in the HLA-
G gene. A C to T
SUBSTTTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99100012
9
polymorphism occurs at nucletide 1488 in the third position of colon 93 and is
referred to as C/T-93
herein where C-93 is one allele of the polymorphism and T-93 is the other
allele of the polymorphism.
Suitably. the CrT-93 polymorphism is genotyped by PCR amplification of a
section of intron 2 - exon 3
using the primers 5'-TACTCCCGAGTCTCCGGGTCTG-3'(SEQ ID NO. 1 ) as the forward
primer and
5'-AGGCGCCCCACTGCCCCTGGTAC-3'(SEQ ID NO. 2) as the reverse primer giving rise
to the
amplified C-93 allele (SEQ ID NO. 4) and amplified T-93 allele (SEQ ID NO. 5)
followed by by semi-
nested PCR amplification using the fonvard primer 5'-GACCGAGGGGGTGGGGCCAGGTTCT-
3'(SEQ ID NO. 3) and the reverse primer 5'-AGGCGCCCCACTGCCCCTGGTAC-3'(SEQ ID
NO. 1).
In the semi-nested amplification reaction dTTP is replaced by dUTP. The 3' end
of the forward primer is
to designed so that the first U incorporated downstream ofthe forward primer
is at, or distal to, the
polymorphic site in colon 93. Following amplification using end labelled
forward primer, glycosylase
mediated cleavage of the amplified product is performed. Cleavage products are
resolved by denaturing
gel electrophoresis (20% polyacrylamide) and visualised by autoradiography.
The C-93 allele is detected
as a 32 n fragment (SEQ ID N0. 8)and the T-93 allele as a 27 n fragment (SEQ
ID NO. 9).
l5
The common 14 base pair insertion / deletion polymorphism in exon 8 of the HLA-
G gene is
referred to as UD-E8 herein where I-E8 is one allele of the polymorphism and D-
E8 is the other allele of
the polymorphism. Suitably, genotyping of the HLA-G exon 8 deletion
polymorphism is performed by
amplifying a short section flanking the deletion location in exon 8. This is
achieved using the polymerise
20 chain reaction with primers designed to hybridise to known DNA sequence in
exon 8. The for<vard primer
is 5'-TGTGAAACAGCTGCCCTGTGT-3' (SEQ ID NO. 10) and the reverse primer is 5'-
AAGGAATGCAGTTCAGCATGA-3' (SEQ ID NO. 11). The I/D exon 8 polymorphism is
genotyped bv_
size separation of the PCR products on a 10% non denaturing poiyacn~lamide gel
and visualised by
staining with ethidium bromide, the I-E8 insertion allele giving rise to a 151
by product (SEQ ID N0. 12)
25 and the D-E8 deletion allele giving rise to a i37 by product (SEQ ID NO.
13).
Suitably, allele specific genotyping is performed in cases where maternal and
paternal CI1'-93 and I/D-
E8 HLA-G haplotypes cannot he directly assigned. This is achieved using allele
specific primers which
allows selective amplifcation of the I-E8 or D-ES allele. Following allele
specific amplification, the CIT-
93 polymorphism is then genotvped using the GMPD assay described above.
Primers for amplification of
the I-E8 allele are 5'-TACTCCCGAGTCTCCGGGTCTG-3' (SEQ ID NO. 1) as the fonvard
primer and
5'-CAAAGGGAAGGCATGAACAAATCTTG-3' (SEQ ID NO. 14) as the reverse primer.
Primers for
amplification of the D-E8 allele are 5'-TACTCCCGAGTCTCCGGGTCTG-3' (SEQ ID NO.
1 ) as the
forward primer and 5'-GTTCTTGAAGTCACAAAGGGACTTG -3' (SEQ ID NO. 15) as the
reverse
33 primer. Such allele specific amplification gives rise to four possible
haploty~pes. namely I-E8 and ,C-93
SUBSTTTUZ'E SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 1 O PCTIIE99/00012
haplotvpe (SEQ ID NO. 16), I-E8 and T-93 haplotype (SEQ ID NO. 17), D-E8 and C-
93 haplotype
(SEQ ID N0. 18) and D-E8 and T-93 haplotype (SEQ ID NO. 19).
Suitably, haplotypes are constructed and suitably, transmitted and non-
transmitted alleles to offspring /
foetus are assigned.
Preferably. the amplification reagents include a tllermostable DNA polymerase,
amplification buffer and
DNA precursor nucleotides.
All or part of any HLA-G sequence and/or HLA-G linked sequence may also be
amplified. by a method
or combination of methods selected from nucleic acid sequence based
amplification, self sustained
sequence replication, transcription-mediated amplification, strand
displacement amplification and the
ligase chain reaction.
Preferably the comparison of one or more variants identified is performed by
association and/or linkage
analaysis and/or transmission analysis. Preferably all or part of the HLA-G
sequence is cloned into a
vector.
The invention may involve:
a) obtaining nucleic acid or fluid or tissue sample from a parent andlor
prospective parent and/or
foetus:
b) establishing the HLA genotype or serotype of the parentlprospective parent
and/or foetus by
analysing the nucleic acid or fluid or tissue sample isolated in step (a);
c) comparing the HLA genotypes or serotypes identified in step (b) with known
HLA genotypes or
serotypes respectively.
Preferably the method involves the measuring of cellular and/or solubie HLA-G
levels. Preferably HLA-
G levels are measured by immunoassay using an antibody for specific HLA-G
protein.
The invention may involve identifying the variant form of HLA-G protein and/or
the levels thereof present
in the sample. Preferably HLA-G variant proteins and/or levels thereof are
detected and/or quantified by
immunoassay using specific antibodies which detect HLA-G variants, or HLA-G
protein. Alternatively.
antibody specific for HLA-G protein variants and/or electrophoretic separation
methods and/or
chromatographic separation methods may be used. Preferred methods for
detecting HLA-G protein and
variants thereof include, enzyme linked immunosorbent assays (ELISA),
radioimmuno-assays (RIA),
immunoradiometric assays (IRMA) and immunoenzvmatic assays (IEMA), including
sandal ch assays
using monoclonal and/or polyclonal antibodies.
SUBSTTIIVTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99100012
11
The invention may involve measuring of level of molecules whose concentration
changes as a direct
and/or indirect result of HLA-G action. Preferably the molecules are selected
from IL-l, IL-2. IL-3, IL-4,
IL-6. IL-10 beta and tumour necrosis factor alpha. Preferably the levels of
such molecules are measured
by immunoassay using antibodies specific for the molecules.
Alternatively, the method may involve measuring of levels of trophoblast
specific markers. Preferably the
trophoblast markers arc cytokeratins pregnancy specific glycoprotein 1, human
chorionic gonadotrophin
and human placental lactogen. Preferably the levels of such molecules are
measured by immunoassay
using antibodies specifcc for the molecules.
In one embodiment the method may comprise the steps of
io a) incubating blood mononuclear cells and/or a subset of such cells with
one or more HLA-G variants
and/or any combination thereof and/or cells expressing all or part of one or
more variants of the HLA-G
gene and/or a combination of one or more variants thereof, wherein the blood
mononuclear cells and/or
HLA-G variant is from a female and/or mace andlor foetus
b) analysing the activity of the blood mononuclear cells and/or the HLA-G
and/or cells e~cpressing one
I 5 or more HLA-G variant.
Preferably. the blood mononuclear cells are obtained as a blood sample. andlor
tissue sample from the
female and/or are obtained through matching the females blood mononuclear
cells with blood
mononuclear cells from a donor and/or cell line panel. Preferably populations
of T cells and/or NK cells
are isolated from the blood sample by density centrifugation and/or
immunoselection. Preferably, blood
20 mononuclear cells matching the females blood mononuclear cells are
identified from a test panel by
matching the HLA serotype andlor extended HLA genotype and/or HLA-G genotype
of the female with
the HLA serotype andlor extended HLA genotype and/or HLA-G genotype of blood
mononuclear cells.
Preferably. HLA-G matching the male and/or female HLA-G is identified from a
test panel by matching
the HLA-G type and/or HLA-G genotype of the male andlor female with the HLA-G
type and/or HLA-G
25 genot~~pe of HLA-G proteins and/or cells expressing one or more HLA-G gene
variants in the test panel.
Preferably, such a test panel is assembled by growing cells expressing one or
more HLA-G variants. Such
cells may be derived from natural tissue such as placenta and/or created
artificially by the introduction of
one or more vectors bearing HLA-G gene variants which are capable of promoting
the expression of the
HLA-G gene into a cell and/or by inducing the expression of native HLA-G in
cells. Suitably, the vector
3c) used is plasmid. phage, viral. and/or artificial chromosome based.
Preferably HLA-G protein is used as a
crude preparation and/or fully or partially purified from such cells. HLA-G
protein may be loaded with
binding peptides naturally or artificially.
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 12 PCT/IE99100012
Preferably, the HLA-G - blood mononuclear cell interaction is measured by
assessing blood mononuclear
cell activation including assessment of one or more of the following; cell
proliferation, transformation
cy~toto~cic response, surface marker expression, cytokine production,
conjugate formation and target
specificin~.
The method may comprise the steps of
a) cloning the HLA-G gene from a parent and/or prospective parent and/or
foetus;
b) expressing the HLA-G protein from the cloned gene in vitro and/or in vivo;
c) measuring the levels of activity of the express~l HLA-G protein;
d) comparing the levels of activity of the expressed HLA-G protein with the
levels of activity observed
for the normal HLA-G protein.
The method may also comprise:
a) establishing all or part of the HLA-G s~uence and/or HLA-G linked sequences
present in a sample
from a female and/or male and/or foetus by analysing the nucleic acid from
said sample;
b) determining whether one or more of any variants or any combination thereof
identified in step (a) are
t5 indicative of susceptibility to normal pregnancy or pre-eclampsia and/or
eclampsia andlor intrauterine
growth retardation and/or susceptibility to miscarriage and/or miscarriage-
related infertility by
comparative anahsis and/or analysis of the effect of one or more of the
variants on the functional activitv_
of HLA-G and/or on HLA-G mRNA.
Preferably. the HLA-G sequence variants are established by characterising all
or part of the DNA
2o sequence of the HLA-G gene and/or closely linked DNA including HLA-A, HLA-
B, HLA-C, HLA-E,
HLA-F and HLA-H genes by amplifying all or parts HLA-G or closely linked DNAs
and identifying the
sequence variants present using one or more sequence variation detection
methods.
Suitably. one or more copies of all or parts of the HLA-G gene is amplified by
any of several
amplification approaches such as the polymerase chain reaction (PCR), nucleic
acid sequence based
25 amplification (NASBA), self sustained sequence replication (3SR),
transcription-mediated amplifccation
(TMA) and strand displacement amplification. Amplification of a target nucleic
acid molecule may also
be carried out using a the ligase chain reaction (LCR) and a variation of the
LCR which employs a short
PCR step (PLCR). Suitably, DNA or mRNA is used as the amplification substrate.
Suitably. mRNA is
converted into DNA using reverse transcriptase. Suitably, the amplified
molecules are analysed directly
30 and/or may be cloned into a vector to facilitate analysis. Suitably, DNA
sequence variations are detected
by any one or more of a variety of gene variation detection methods including
DNA sequencing,
glycosylase mediated polymorphism detection, restriction fragment length
polymorphism analysis,
enzymatic or chemical cleavage assays, hybridisation to DNA probe arrays,
allele specific oligonucleotide
hybridisation assays. allele specific amplification methods such as the
amplification refracton~ method
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 13 PCT/IE99/00012
(ARMS), electrophoretic detection of polymorphisms based on migration through
a gel matrix. 5'
nuclease assay and ligase chain reaction.
Suitably. it can be determined if one or more variants identified are known
variants associated with
susceptibility to normal pregnancy and/ or susceptibility to pre-eclampsia
and/or eclampsia and/or
intrauterine growth retardation and/or susceptibility to miscarriage and/or
miscarriage-related infertility.
Alternatively. comparative analysis is performed by gene association and/or
gene linkage methods to
determine whether HLA-G variants and/or HLA-G linked variants are associated
with normal pregnancy
and/ or susceptibility to pre-eclampsia and/or eclampsia and/or intrauterine
growth retardation and/or
susceptibility to miscarriage andlor miscarriage-related infertility.
!0 Alternatively. HLA-G variants associated with normal pregnancy and/ or
susceptibility to pre-eclarnpsia
and/or eclampsia and/or intrauterine grrnvth retardation and/or susceptibility
to miscarriage and/or
miscarriage-related infertility can be identified by the effect of HLA-G
variants on HLA-G function.
Suitably. HLA-G variants are functionally analysed by measuring the
interaction of one or more of the
HLA-G variants andlor any combination thereof, with blood mononuclear cells
and/or measuring the size
I 5 and level of the HLA-G messenger RNA and/or the size and level of HLA-G
gene product and/or peptide
binding for one or more of the HLA-G variants and/or any combinations thereof.
HLA-G - blood
mononuclear cell activity is measured by assessing blood mononuclear cell
activation including
assessment of one or more of the follrnving; cell proliferation, cytotoxic
response, surface marker
expression, cytokine production, conjugate formation and target specificity.
2o The invention also relates to a pharmaceutical composition comprising a
pharmaceutically effective
amount of HLA-G protein and/or cells expressing HLA-G and/or one or more
peptides which binds to
HLA-G and/or blood mononuclear cells from a donor and/or a cells from a test
panel known to interact
with HLA-G variants. cytokines and any combination thereof including IL-1 beta
, IL-2. IL-3. IL-4, IL-6.
IL-10 and tumour necrosis factor-alpha and/or inhibitors of cytokines and/or
tumour necrosis factor
25 alpha and/or derivatives of cytokines and/or tumour necrosis factor-alpha.
optionally with
pharmaceutically-acceptable carriers or excipients.
The invention also provides a method for screening for agents which can
potentially be used as diagnostic
indicators and/or drug targets for pre-eclampsia, miscarriage, miscarriage-
related infertility and
intrauterine growth retardation by:
3o a) measuring the expression level of one or more genes and / or proteins in
HLA-G expressing cells and
/or blood mononuclear cells and / or T cell and /or natural killer cell
subsets thereof following interaction
with HLA-G and / or HLA-G expressing cells;
SUBSZ'>fTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 14 PCT/IE99/00012
b) comparing the expression level identified in step (a) with the expression
level in HLA-G expressing
cells and /or the blood mononuclear cells and / or T cell and /or natural
killer cell subsets thereof
following interaction with HLA-G and / or HLA-G expressing cells in normal
pregnancy andl or pre-
eclampsia pregnancy and/or intrauterine growth retardation pregnancy and/or
miscarriage pregnancy
and/or miscarriage-related infertility.
In a further aspect the invention provides a method for screening for
potential pre-eclampsia and
eclampsia and intrauterine growth retardation and miscarriage and miscarriage-
related infertility
therapeutic agents selected from:
a) identif<~ing agents which after the expression of HLA-G;
to b) identifying agents which alter the activity of HLA-G;
c) identifi~ing agents which mimic the action of HLA-G;
d) identifying agents which bind to HLA-G;
e) identifying peptides which bind to HLA-G;
f) identiying agents which bind to HLA-G receptors:
15 g) identifying expressed genes using DNA probe arrays in a cellular
background in HLA-G expressing
cells and/or blood mononuclear cells interacting with HLA-G and/or cells
expressing HLA-G interacting
with blood mononuclear cells;
h) identifi~ing expressed genes using DNA probe arrays in a cellular
background whose expression is
altered in response to HLA-G expression in the cells andlor in response to
interacting cells expressing
2o HLA-G;
i) identifying expressed proteins using mass spectrometry methods in HLA-G
expressing cells andlor
blood mononuclear cells interacting with HLA-G and/or cells expressing HLA-G
interacting with blood
mononuclear cells.
Preferably sperm and/or semen and/or female reproductive tissue are screened
for agents:
25 a) which aster the expression of HLA-G in fertilised eggs and/or embryos;
b) which aster the cell cleavage rate of fertilised eggs and/or embryos;
c) which induce cellular factors in cell in culture andlor cell in vivo that
alter the cell cleavage rate of
fertilised eggs andlor embryos.
The method may involve:
3o a) measuring the expression level of one or more genes and/or proteins in
HLA-G expressing cells
and/or blood mononuclear cells and/or T cell andlor natural killer cell
subsets thereof following
interaction with HLA-G and/or HLA-G expressing cells;
b) comparing the expression level identified in step (a) with the expression
level in HLA-G expressing
cells and/or the blood mononuclear cells and/or T cell and/or natural killer
cell subsets thereof following
35 interaction with HLA-G and/or HLA-G expressing cells associated with normal
pregnancy and/ or pre-
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCTIIE99100012
eclampsia pregnancy andlor intrauterine growth retardation pregnancy and/or
miscarriage pregnancy
and/or miscarriage-related infertility.
Preferably. blood mononuclear cells and/or HLA-G expressing cells are obtained
from a female and/or
male and/or foetus and/or test panel of blood mononuclear cells and/or HLA-G
expressing cells.
Preferably, gene expression is measured by any one or combination of several
methods including
hybridisation between cDNA and/or RNA from the cells and DNA probes and/or RNA
probes and/or
DNA probe arrays, quantitative amplification approaches such as quantitative
(reverse transcriptase -
polymerase chain reaction) RT-PCR, 5' nuclease assay, ribonuclease protection
assay and S 1 nuclease
assay.
l0 Preferably, protein expression is measured by any one or combination of
several methods including one
dimensional and/or two dimensional gel electrophoresis and staining of
proteins and/or detection of one or
more proteins using, enzyme linked immunosorbent assays (ELISA),
radioimmunoassays (RIA),
immunoradiometric assays (IRMA) and immunoenzymatic assays (1EMA), including
sandwich assays
and Western blotting using monoclonal and/or polyclonal antibodies.
15 Alternatively, the method may involve:
a) measuring the expression level of one or more genes andlor proteins in
cells expressing HLA-G; and
b) comparing the expression level identified in step {a) with the expression
level in HLA-G non-
expressing cells.
Preferably, the cells are fertilised animal eggs and/or animal embryos.
2o The invention also provides a method for the prevention of pre-eclampsia
and/or eclampsia and/or
intrauterine growth retardation and/or susceptibility to miscarriage and/or
miscarriage-related infertility
selected from:
a) treatment of a female with ail or part of a pharmaceutically effective
amount of an effective HLA-G
protein and/or peptides which bind to HLA-G and/or cells expressing HLA-G;
b) treatment of a female with all or part of a pharmaceutically effective
amount of molecules or
inhibitors of molecules whose level or activity is directly or indirectly
altered by HLA-G;
c) treatment of a female with all or part of a pharmaceutically effective
amount of an agent which
alters HLA-G expression:
d) treatment of a female with all or part of a pharmaceutically effective
amount of an agent which
alters NK cell activity:
e) treatment of a female with all or part of a pharmaceutically effective
amount of an agent which
mimics all or part of HLA-G action:
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99I00012
16
f) treatment of a female with all or part of a pharmaceutically effective
amount of molecules which
inhibit the interaction between HLA-G and one or more of its receptors:
g) treatment of a female with all or part of a pharmaceutically effective
amount of an agent which
alters the size and/or level of HLA-G mRNA;
h) treatment of a female with all or part of a pharmaceutically effective
amount of an agent which
alters HLA-G related blood mononuclear cell activity;
i) treatment of a female with blood mononuclear cells that recognise foetal
and/or self HLA-G;
j) treatment of a female with HLA-G protein and/or cells expressing HLA-G.
The invention may comprise:
i o a) obtaining blood mononuclear cells and/or T cell and/or natural killer
cell subsets thereof and/or
HLA-G and/or HLA-G expressing cells from a female and/or male andlor foetus
and/or test panel;
b) measuring the expression level of one or more genes and/ar proteins in the
HLA-G expressing cells
and/or blood mononuclear cells following interaction with HLA-G and/or HLA-G
expressing cells;
c) comparing the expression level identified in step (b) with the expression
level in the blood
I 5 mononuclear cells and/or HLA-G expressing cells in normal pregnancy and/
or pre-eclampsia pregnancy
and/or intrauterine growth retardation pregnancy and/or miscarriage pregnancy
and/or miscarriage-related
infertility .
Preferably, the blood mononuclear cells and/or HLA-G expressing cells are
obtained as a blood sample
and/or tissue sample. Preferably populations of T cells and/or NK cells are
isolated from the blood sample
2o by density centrifugation and/or immunoselection. Preferably HLA-G
expressing cells are isolated by
immunoselection.
The invention also provides a method for improving fertility and pregnancy
outcome wherein male and/or
female partners and/or sperm and/or ova and/or recipients of fertilised eggs
and/or zygotes / and/or
embnos are selected on the basis of HLA-G so that their genotypes and/or
serotypes are associated with
25 normal pregnancy outcomes and/or not associated with pre-eclampsia and/or
eclampsia and/or
intrauterine growdh retardation and/or susceptibility to miscarriage and/or
miscarriage-related infertility.
In particular there is provided a method for improving pregnancy success
selected from:
a) pre-treating the female with sperm andlor attenuated forms thereof, and/or
semen and/or fractions
thereof from a male with a known HLA-G genotype, prior to mating with a male
of a different HLA-G
3o genotype, and/or in vitro fertilisation using sperm from a male of a
different HLA-G genotype and/or
embno transfer where the male HLA-G is of a different HLA-G genotype;
b) mixing sperm of a known HLA-G genotype with sperm and/or attenuated foams
thereof. and/or
semen and/or fractions thereof from a male with a dif~'erent HLA-G genotype
prior to in vitro fertilisation.
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 f ~ PCTIIE99100012
Preferably fertility and/or pregnancy outcome are improved by selection of
male and / or female partners
and / or sperm and / or ova and / or recipients of fertilised eggs and / or
rygotes / and / or embryos so that
(a) their HLA-G and /or HLA genotypes and /or serotypes or (b) the activity of
their HLA-G and / or
blood mononuclear cells interacting with HLA-G are indicative of normal
pregnancy outcomes and / or
not associated with pre-eclampsia and/or eclampsia and/or intrauterine growth
retardation and/or
susceptibility to miscarriage andlor miscarriage-related infertility.
Cloning of all or part of one or more HLA-G genes in any of the above methods
may be achieved by
amplification of all or part of one or more HLA-G genes and insertion of all
or part of the amplified
product into a vector capable of expressing the inserted gene. Expression of
the HLA-G protein from the
cloned gene in any of the above methods may be achieved by introduction of the
expression vector into a
suitable host such as a bacterium or an eukaryotic cell in culture. The level
of activity of the expressed
HLA-G protein in any of the above methods may be achieved by a) directly
and/or indirectly measuring
the interaction of the HLA-G protein and/or cells expressing HLA-G protein
with blood mononuclear cells
and/ or b) detecting one or more molecules whose level is altered as a result
of the interaction of the HLA-
l5 G protein and/or cells expressing HLA-G protein with blood mononuclear
cells and/or c) measuring
changes in cell cleavage rate due to direct and/or indirect action of the HLA-
G protein and/or cells
expressing HLA-G protein with blood mononuclear cells.
HLA-G as defined herein refers to any form of HLA-G and / any complex
involving HLA-G including
different isoforms of HLA-G arising from alternative splicing pathways,
combination of different HLA-G
2o isoforms. secreted HLA-G, membrane bound HLA-G HLA-G with peptides bound
and HLA-G
associated with beta -2-microglobulin. HLA-G protein refers to any crude,
partially and/or fully purified
form of HLA-G.
The invention also provides use of a DNA sequence selected from any one of
sequence LD.s 1 to 21 for
diagnosis of susceptibility to or in a test kit for the diagnosis of
susceptibility to normal pregnancy, pre-
25 eclampsia and/or eclampsia and/or intrauterine growth retardation and/or
susceptibility to miscarriage
and/or miscarriage-related infertility, for monitoring progress of pregnancy,
for use in the manufacture of
a medicament. in a method for screening potential therapeutic agents. in a
method for screening for
potential diagnostic indicators and/or drug targets, in a method for improving
pregnancy success or in a
method for the prevention of pre-eclampsia andlor eclampsia and/or
intrauterine growth retardation and/or
30 susceptibility to miscarriage and/or miscarriage-related infertility, for
monitoring progress of pregnancy.
The invention also provides a method for induction of tolerance in a host to a
non-self tissue which
comprises administering HLA-G and /or HLA-G loaded with peptides from the non-
self tissue and /or
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 I g PCT/IE99/00012
HLA-G expressing cells derived from or related to the non-self tissue, and/or
a non-self tissue bearing an
introduced HLA-G gene so that HLA-G is expressed in all or part of the tissue.
In a further aspect the invention provides a method for the treatment of
autoimmune disease which
comprises administering HLA-G and /or HLA-G loaded with peptides from a self
or non-self tissue and
or with specific autoimmune antigen and /or HLA-G expressing cells from a self
and/or non-self tissue
and/or a self and/or non-self tissue bearing an introduced HLA-G gene so that
HLA-G is expressed in all
or part of the tissue.
Methods
Identification of Subjects
l0 In the initial phase of sampling pre-eclamptic patients were identified as
primagravidas who were
delivered by caesarean section at or prior to 36 weeks gestation because of a
deterioration in pregnancy
indicative of pre-eclampsia. Diagnostic symptoms were a rise in blood pressure
>i5mm Hg diastolic or
>30mm Hg systolic from measurement in early pregnancy or to >140/90mm Hg in
late pregnancy, and
one or more of the following: proteinuria, odema, headache, visual
disturbance, epigastric pain. Control
l5 patients wcre identified as primagravidas with nonmal delivery and normal
blood pressure. 5-l0mls of
blood were taken from the offspring of primagravida pre-eclampsia and normal
pregnancies with informed
consent.
In the second phase of sampling. blood samples and/or cheek swab sample for
DNA extraction were
collected from control trios following delivery. The appropriate informed
consent was obtained from all
20 subjects. Control mothers were identified as primagravidas under the age of
thirty three with normal
deliven~ and normal blood pressure. All individuals were Irish and Caucasian
by origin. Mothers were
interviewed to ensure that they were primagravidas. Primagravida (first
pregnancy) pre-eclampsia trios
where the mothers suffered severe pre-eclampsia and a matching control group
of normal primagravida
trios were identified and sampled. Families (mother, father, first and second
offspring) where the mother
25 had hvo or more successful normal pregnancies in the absence of pregnancy
related disorders including
pre-eclampsia and miscarriage were also identified and sampled. Families
(mother, father, first and second
offspring) where the mother had pre-eclampsia in the first pregnancy and a
normal second pregnancy in
the absence of pregnancy related disorders including pre-eclampsia and
miscarriage were also identified
and sampled. Couples with recurrent spontaneous abortion were also identified
and sampled. To minimise
30 the possibility of misdiagnosis of PE, we applied stringent criteria to
ascertainment of samples.
Essentially pre-eclampsia cases were identified as primagravidas under the age
of 35 who were delivered
by caesarean section at. or prior to: 36 weeks gestation because of a
deterioration in pregnancy indicative
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99!43$51 I9 PCTIIE99100012
of pre-eciampsia. Diagnostic sS~nptoms were a rise in blood pressure of >l5mm
Hg diastolic or >30mm
Hg systolic from measurement in early pregnancy or to >140/90mm Hg in late
pregnancy, and one or
more of the following: proteinuria, odema, headache, visual disturbance,
epigastric pain. Diagnostic
symptoms wre completely resolved within 3 months after delivery. A preliminary
survey of the sisters of
the pre-eclamptic women in this study did not reveal an increased incidence of
the condition, indicating
that pre-eclampsia in the cohort of mothers investigated here is sporadic. A
cohort of couples where the
mother had three or more consecutive miscarriages were identified (recurrent
miscarriage).
Genotyping of HLA-G polymorphism
Genomic DNA was extracted from peripheral blood samples and/or cheek swab
samples by standard
t0 methods. DNA concentration was determined by absorbance at 260nm for
samples where DNA was
isolated from blood. The integrity and purity of the genomic DNA was
determined by agarose gel
electrophoresis and OD260:OD280 ratio respectively.
The C-93T HLA-G polymorphism is also known as the Crf codon 93 polymorphism
(and as HLA-G
C 1488T) and referred to as CrT-93 herein where C-93 is one allele of the
polymorphism and T-93 is the
IS other allele of the polymorphism. In order to genotype the C/T-93
polymorphism in the genomic DNA
samples, exon 3 of the HLA-G gene was first amplified using the polymerase
chain reaction with primers
designed to hybridise to the known DNA sequence flanking axon 3. The forward
primer was S'-
TACTCCCGAGTCTCCGGGTCTG-3' (SEQ ID NO. 1) and the reverse primer was 5'-
GAGGCGCCCCACTGCCCCTGGT-3'.
20 The polvmerase chain reaction was carried out in a total volume of 25,1,
with IOOng genomic DNA, Song
of each primer, 0.2mM of each deoxynucieoside triphosphate (dATP. dCTP, dGTP
and dTTP) SOmM
KC1, I UmM Tris-HCI, pH 9.0 at 25°C, 0.1 % Triton X-100, I .SmM MgCI
and O.SU of Taq Polymerase.
Reaction mixtures were covered with an equal volume of mineral oil and
amplification was carried out
using the "hot start" technique in a thermal cycler. The conditions for
amplification involved denaturation
25 at 94 °C for 5 min followed by addition of Taq Polymerase. Thirty
cycles were then performed: 94 °C for
I min. 63°C for 1 min. 72°C for 1 min and finally a 10 min
extension at 72°C.
Genoty~ping of the C/T-93 HLA-G polymorphism was then performed using a semi
nested amplification
approach and the Glycosylase Mediated Polymorphism Detection method (Vaughan
and McCarthy 1998).
A 3196p section of the HLA-G gene encompassing the CST-93 polymorphism
location was amplified
30 using a semi nested polymerase chain reaction approach from the previously
amplified axon 3 of the
HLA-G gene using the axon 3 reverse primer and the internal fornard primer 5'-
GACCGAGGGGGTGGGGCCAGGTTCT-3' (SEQ ID NO. 3). The forward primer vyas end
labelled by
SUBSTTTL1TE SHEET (RULE 25)
CA 02321223 2000-08-18
WO 99143851 20 PCT/IE99100012
incubation with polynucleotide kinase in the manufacturers buffer (New England
Biolabs) and S~Ci 32P-
ATP (3000Ci/mmol) for 30 min at 37°C followed by ethanol precipitation
to remove unused labelled
nucleotide. The semi nested amplification reaction was carried out in a total
volume of IOp.I, with lpl of
a I in 500 dilution of the previously amplified axon 3 product, 3pmoles of
fonvard and reverse primer,
0.2mM of each deoxvnucleoside triphosphate (dATP, dCTP, dGTP and dUTP) 50mM
KCI, IOmM Tris-
HCI, pH 9.0 at 25°C. 0.1 % Triton X-100,1.SmM MgCI and 0.5U of Taq
Polymerase. Reaction mixtures
were covered with an equal volume of mineral oil and amplification was carried
out using the "hot start"
technique in a thermal cycler. The conditions for amplification involved
denaturation at 94°C for 5 min
followed by addition of Taq Pofvmerase. Thirty cycles were then performed:
94°C for 1 min, 64°C for 1
min. 72°C for 1 min and finally a 10 min extension at 72'C. The
reaction mixture tvas then treated with
exonuclease I to digest the primers not extended in the amplification step.
This was achieved by
incubating the PCR reaction mixture with 0.4 units of exonuclease I at
37°C for 30 min. The exonuclease
was subsequently heat inactivated by incubating the reaction at 80°C
for 15 min.
Uracil DNA-glycosylase (0.5 units) was then added and the incubation continued
at 37°C for min.
I S Following treatment with uracil DNA-glycosylase, the AP sites generated in
the amplified product were
cleaved to completion by adding NaOH to a 8na1 concentration of O.OSM and
heating the mixture for 15
min at 95°C. Under these conditions. cleavage occurs on the 5' side of
each AP site. The reaction was
then neutralised by addition to Tris base to 30mM final concentration. Both
Exol and UDG are diluted
containing 0.07M Hepes KOH pH 8.0, ImM EDTA, 1mM DTT and 50% glycerol.
An equal volume of formamide loading dye (90% formamide, 0.025% Bromophenol
blue. 0.025% Xylene
cylanol) was added to the sample which was then heated at 85°C for 5
min. The sample was then loaded
onto a 20% denaturing (7M urea) polyacrylamide gel and electrophoresis was
carried out for 3-4 hours at
60W for size analysis of the cleaved products in the sample. Following
electrophoresis, autoradiography
was carried out by exposing the gel direetiy to X-ray photographic film for 12
hrs at -70°C. During the
second phase of the genotyping, an improved protocol was used. Essentially,
PCR amplification was
carried out in 25 ml reactions, each of which contained 100. ng genomic DNA.
PCR buffer ( 100 mMTris-
HCl pH 8.3 (20°C), 500 mM KCI, 15 mM MgCl2~), 200 mM of each dNTP, 300
nM of each primer and
0.5 U Tng polymerase (Boehringer). Conditions for amplification of axon 3 were
30 cycles at 94°C for
45 s. 6l°C for 45 s, 72°C for 60 s using 5'-
TACTCCCGAGTCTCCGGGTCTG-3'(SEQ ID NO. 1) as
3U the fonvard primer and 5'-AGGCGCCCCACTGCCCCTGGTAC-3'(SEQ ID NO. 2) as the
reverse
primer giving rise to the amplified C-93 allele (SEQ ID NO. 4) and amplified T-
93 allele (SEQ ID NO.
5). Ail of the samples n-ere then genotyped for the HLA-G CIT-93 polymorphism
using the recently
described glycosylase mediated pohmorphism detection (GMPD) method (Vaughan &
McCarthy, 1998).
SUBSTITUTE SHEET (RULE 26}
CA 02321223 2000-08-18
WO 99/43851 2I PCT/IE99/00012
Essentially a 319 by fragment was amplified by semi-nested PCR from axon 3
using the forward primer
5'-GACCGAGGGGGTGGGGCCAGGTTCT-3'(SEQ ID NO. 3) and the reverse primer 5'-
AGGCGCCCCACTGCCCCTGGTAC-3'(SEQ ID NO. 1) giving rise to the amplified C-93
allele (SEQ
ID NO. 6) and amplified T-93 allele (SEQ ID NO. 7). In the semi-nested
amplification reaction dTTP
was replaced by dUTP. The 3' end of the forward primer was designed so that
the first U incorporated
downstream of the forward primer was at, or distal to, the polymorphic site in
codan 93. Following
amplification using P32 end labelled forward primer, glycosylase mediated
cleavage of the amplified
product was performed. Cleavage products were resolved by denaturing gel
electrophoresis (20%
polyacn~lamide) and visualised by autoradiography. The C-93 allele was
detected as a 32 n fragment
to (SEQ ID NO. 8)and the T-93 allele as a 27 n fragment (SEQ ID NO. 9).
The common 14 base pair insertion / deletion polymorphism in axon 8 of the HLA-
G gene is referred to as
I/D-E8 herein (also known as where I-E8 is one allele of the polymorphism and
D-E8 is the other allele of
the polymorphism. Genotyping of the HLA-G axon 8 deletion polymorphism was
performed by
amplifying a short section flanking the deletion location in axon 8. This was
achieved using the
I 5 polymerise chain reaction with primers designed to hybridise to known DNA
sequence in axon 8. The
forward primer was 5'-TGTGAAACAGCTGCCCTGTGT-3' (SEQ ID NO. 10) and the reverse
primer
was 5'-AAGGAATGCAGTTCAGCATGA-3' (SEQ ID NO. 11).
The polymerise chain reaction was carried out in a total volume of 25w1, with
100ng genomic DNA, 50ng
of each primer, 0.2mM of each deoxyribonucieoside triphosphate (dATP, dCTP,
dGTP and dTTP)
20 SOmM KCI. IOmM Tris-HCI, pH 9.0 at 25°C, 0.1 % Triton X-100, 0.5mM
MgCI and 0.5U of Taq
Polymerise. Reaction mixtures were covered with an equal volume of mineral oil
and amplification was
carried out using the "hot start" technique in a thermal eyelet. The
conditions for amplification involved
denaturation at 94°C for 5 min followed by addition of Taq Polymerise.
Thirty cycles were then
performed: 94°C for 1 min. 54°C for 1 min, 72°C for 1 min
and finally a 10 min- e:ctension at 72°C. The
25 i/D axon 8 polymorphism was genotyped by size separation of the PCR
products on a 10% non
denaturing polyacrylamide gel and visualised by staining with ethidium
bromide, the I-E8 insertion allele
giving rise to a 151 by product (SEQ ID NO. 12) and the D-E8 deletion allele
giving rise to a 137 by
product (SEQ ID NO. 13).
Allele specific genotyping. In order to gain more information from the
transmission of HLA-G
3t polymorphisms in the second phase of the work, allele specific genotyping
was performed. In the majority
of cases. maternal and paten~al CIT-93 and I/D-E8 HLA-G haplotypes could be
directly assigned. In
cases where all members of a trio were heterozygous for either C/T-93 or I/D-
E8 polymorphisms, allele
specific amplification was performed in order to assign haplotypes. This was
achieved using allele
SUBSTITUTE SgEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 22 PCT/IE99/00012
specific primers which allowed selective amplification of the I-E8 or D-E8
allele. Following allele specific
amplification. the C!T-93 polymorphism was then genotyped using the GMPD assay
described above.
Conditions for amplification of the I-E8 allele were 30 cycles at 94°C
for 45s, 64°C for 45s, 72°C for 60s
using 5'-TACTCCCGAGTCTCCGGGTCTG-3' (SEQ ID NO. 1) as the forward primer and 5'
s CAAAGGGAAGGCATGAACAAATCTTG-3' (SEQ 1D NO. 14) as the reverse primer.
Conditions for
amplification of the D-E8 allele were 30 cycles at 94°C for 45s,
56°C for 45 s, 72°C for bOs using 5'-
TACTCCCGAGTCTCCGGGTCTG-3' (SEQ ID NO. 1) as the forward primer and 5'-
GTTCTTGAAGTCACAAAGGGACTTG -3' (SEQ ID NO. 15) as the reverse primer. Such
allele
specif c amplification gives rise to four possible haplotypes, namely I-E8 and
C-93 haplotype (SEQ ID
1o NO. 16), I-E8 and T-93 haplotype (SEQ ID NO. 17), D-E8 and C-93 haplotype
(SEQ ID NO. 18) and
D-ES and T-93 haploty~pe (SEQ ID NO. 19).
All individuals in both sets of trios were genotyped for some or all of these
polyznorphisms (table 1 and
2), transmitted and non transmitted alleles were assigned and haplotypes were
constructed. All individuals
were genotvped for the C/T-93 and I/D-E8 polymorphism. Comparative statistical
analysis was
I s performed. In the second phase of the work more elaborate analysis was
performed. Comparison of allele
and haplotype frequencies and genotype distribution for the polymorphisms
between and within the
sample cohorts, and was performed using chi-squared contingency table analysis
and/or log linear model
analysis andlor transmission disequilibrium testing.
In cases where all members of a trio were heterozygous for C/T-93 or 1/D-E8
polymorphisms, allele
20 specific amplification was performed to determine haplotypes and thus
assign transmitted and non-
transmitted alleles. This was achieved using primers which allowed specific
amplification of a section of
the HLA-G gene from either the insertion, or, deletion in exon 8 to a site 5'
of codon 93. The Crf-93
polymorphism tvas then genotyped in the specifically amplified allele. Using
this approach transmitted and
nontransmitted alleles to offspring were assigned.
25 Results
All of the genetic studies to date apart from the one concerning the HLA-G
deletion polymorphism have
examined the genotype of the pre-eclamptic mother. We took the view that
foetal HLA-G is the most
likely candidate gene for pre-eclampsia. Pre-eclampsia trios where the
offspring was the offspring of the
primagravida prc-eclampsia pregnancy and a control group of offspring of
normal primagravida
pregnancies were studied. 54 pre-eciamptic offspring and 48 control offspring
were included in the
investigation.
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCTIIE99/00012
23
Genetic analysis of the HLA-G C/T-93 polymorphism in the pre-eclamptic
offspring group revealed
homozygosity for the C-93 allele in 7 cases (13%),homorygosity for the T-93
allele in 3 cases (5.6%) and
heterozygosity in 44 cases (81.4%). In comparison, control offspring showed
homoaygosity for the C-93
allele in 18 cases (37.5%). homorygosity for the T-93 allele in 8 cases
(16.6%) and heterozygasity in 22
cases (45.8%).
The frequencies of the C-93 and T-93 allele in the pre-eclamptic offspring
were 0.537 and 0.463
respectively. In comparison, the frequencies in the control offspring were
0.604 and 0.396 respectively.
The expected frequency distribution of the C-93 and T-93 alleles can be
estimated with the formula p2 +
2pq + q2 = 1. With the allelic frequencies of p=0.537 and q=0.463 in the pre-
eclamptic offspring group,
the expected distribution of genotypes should be C-93/C-93 = 0.288, C-93lT-93
= 0.502 T-93/T-93 =
0.214. With the allelic frequencies of p=0.604 and q=0.396 in the control
offspring group, the expected
distribution of genotypes should be C-93/C-93 - 0.36. C-93/1'-93 = 0.478. T-
93/T-93 = 0.156. In
comparison with the control group the distribution of genotypes in the pre-
eclamptic offspring group is
significantly different (Chi-square - 11.01, p<0.001, table 1).
t5 It has been reported that no significant association was observed between
the HLA-G exon 8 deletion
polymorphism and pre-eclamptic offspring (Humphrey et al., 1995). In this work
we also genotyped the
pre-eclamptic and control offspring for the HLA-G deletion polymorphism.
Genetic analysis of the HLA-
G deletion polymorphism in the pre-ectamptic (n=5 I) and control offspring
(n=55) groups revealed
homozygosity for the normal allele in 12 cases (23.5%) and 13 cases (23.6%)
respectively. homozygosity
for the deletion allele in 8 cases ( 15.7%) and 12 cases (21.8%) respectively,
and heterozygosity in 31
cases (60.8%) and 30 cases {54.5%) respectively.
The frequencies of the normal and deletion allele in the pre-eclamptic
offspring were 0.539 and 0.46
respectively. 1n comparison, the frequencies in the control offspring were
0.509 and 0.491 respectively.
In the pre-eclamptic offspring group, the expected distribution of genotypes
should be normal
allele/normal allele = 0.291, normal alleie/deletion allele = 0.497, deletion
allele/deletion allele = 0.212.
The expected distribution of genotypes in the control offspring group should
be normal aliele/normal allele
= 0.259. normal allele/deletion allele = 0.500. deletion allele/deletion
allele = 0.241. In comparison tvith
the control group the distribution of genotypes in the pre-eclamptic offspring
group is not significantly
different (Chi-square = 0.69, p<0.30, table 1}.
10 The parents of the pre-eclamptic and control offspring were genotyped for
the HLA-G CIT-93 genotype
and the genotypes were analysed in conjunction with the offspring genotypes.
In this analysis we scored
the number of cases where the offspring had inherited a paternal C/T-93 allele
that was not present in the
maternal genotype. For the pre-eclamptic offspring, 41 % of cases had a
paternal allele of the C/T-93
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 24 PCT/IE99100012
genotype that was not present in the matenlal genotype. By contrast. for the
control offspring, 28% of
cases had a paternal C!T-93 allele not represented in the maternal genotype.
Discussion
In this investigation. two common polymorphisms in the HLA-G gene in the
offspring of pre-eclamptic
and normal mothers were examined for association with pre-eclampsia. 1fie two
offspring groups are
from Southern Ireland and are fiom the same ethnic background.
'this is the first report determining association bet<veen pre-eclampsia in
the mother and the foetal HLA-G
genotype. Our results show a strong association between pre-eclampsia in the
mother and heterozygosity
for the C/T-93 polymorphism in offspring. This indicates that transmission of
HLA-G alleles to offspring
l0 is different in nonmal offspring than in pre-ectampsia offspring. The
result indicates that screening for
susceptibilit~~ to pre-eclampsia can be achieved by genotyping of HLA-G in the
mother and partner.
Furthermore. since pre-eclampsia is associated with intrauterine groWh
retardation and miscarriage, it is
likely that screening for susceptibility to intrauterine growth retardation,
miscarriage and
miscarriage-related infertility may also be achieved by HLA-G genotyping in
the potential parents.
I S Following these results and to lend further support to this key finding,
we expanded the number of
subjects analysed to include additional nonmal primagravida trios where the
mother had no history of
pregnancy related problems, pre-eclampsia primagravida trios, families
(mother, father, first and second
offspring) where the mother had two or more successful normal pregnancies in
the absence of pregnancy
related disorders including pre-eciampsia and miscarriage, families (mother,
father, first and second
20 offspring) where the mother had pre-eclampsia in the first pregnancy and a
normal second pregnancy in
the absence of pregnancy related disorders including pre-eclampsia and
miscarriage. As pre-eclampsia has
been shown to be associated with miscarriage, we also included a cohort of
recurrent miscarriage couples.
The C!T-93 and I/D-E8 polymorphisms were genotyped in all individuals (Table 2
and Table 6),
haploty~pes were assigned and more elaborate statistics were applied to
support our initial finding.
25 Linkage of ~-ILA-G to pregnancy success in normal primagravidas
For transmission analysis of individual polymorphisms, we applied the log
linear model and the
transmission disequilibrium test. We also examined other polymorphisms in the
HLA-G gene. The
freduency of the A/T-31, A!T-107 and C!A-110 polvmorphisms in the sample
cohorts was 1.0/0.0),
0.95/0.05 and 0.94/0.06 respectively. For the analysis, we still utilised the
commonly occurring C/T-93
3o and 1/D-E8 polymorphisms. Using the allele specific amplification approach
we assigned transmitted and
nontransmitted alleles in the trios (Table 3). Since maternal genotye, foetal
genotype (and specifically
the paternal origin of foetal alleles) could potentially influence pregnancy
outcome. a number of different
SUBSTI1 UTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 25 PC'T/LE99/00012
comparisons were made using this data. The log linear model of Weinberg et al.
1998 allows for causal
scenarios in which the foetal genot<~pe, parental genotypes or combinations
thereof are directly relevant to
risk. Maximum likelihood log-linear models of case-parent triad data were
fitted. The log-linear model
predicts the expected numbers of the 16 possible family types observed (for a
bi-allelic marker), allowing
for several "genetic risk factors" i.e. (a) whether the offspring carried one
or more copies of an allele, (b)
whether the mother carried one or more copies of an allele (c) a maternal
origin erect and (d) a paternal
origin effect (Table 4). The analysis was stratified on parental mating type
assuming Hardy-Weinberg
equilibrium. this corrects for the number of a particular allele that is found
among the four parental alleles
in a particular mating tt~pe, which has an obvious but uninteresting effect on
allele distributions among the
offspring. The advantage of this framework is that nested models of differing
complexity are validly
compared. starting with simple allelic effects and adding extra factors. We
use a four-factor model, and
then a stepwise reduced model which has removed the less significant factors
automatically, thus
providing a simpler model that accounts for important departures from
expectations.
Fitting a four-parameter model to the data (Table 4) was significant for both
the C-93 allele (p=0.006)
l5 and especially significant for the I-E8 allele (p=0.0001 ). Stepwise
elimination of parameters which are not
significant revealed that most of this can be accounted for by two effects: an
effect due to foetal HLA-G
alleles and. most strongly, by a parental origin effect for each allele (Table
4). Thus, both the C-93 and I-
E8 alleles are significantly under-represented among offspring, and where they
do occur, tend to be of
patenrial and maternal origin respectively. The maternal alleles in themselves
are not significantly biased
once these other effects are allowed for. The I-E8 allele is over 4 times more
likely to be of maternal
origin than expected (95% confidence interval 2.2-9.8).
When the transmission frequencies of maternal and paten;ial alleles to
offspring were compared using chi-
squared contingency table analysis, highly significant differences were
observed for the CrT-93 and I/D-
E8 alleles (p-1=0.009 and p-1=0.000001 respectively, Table 5, Table 3). This
reflected a deficit in
transmission of maternal C-93, D-E8 and paternal T-93, I-E8 alleles (Table 3).
A significant difference
was also observed between maternal and paternal non-transmitted I/D-E8 alleles
showing that the
maternal genotype plays a role in pregnancy outcome.
We verifced that the highly significant findings from tog-linear modelling by
simpler comparisons. The
transmission disequilibrium test transmission disequilibrium test assesses
whether assess whether
transmission of maternal and paternal alleles from heterozygous parents to
offspring differed from the null
expectation (of 50:50) and is valid even when Hardy-Weinberg equilibrium is
violated by unusual
population structure. When the transmission disequilibrium test was applied.
the transmission of the C!T-
93 and I/D-E8 alleles to offspring did not differ from the null expectation
(Table 5). However, significant
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
26
deviations from the null expectation were observed when maternal and paternal
transmission frequencies
were analysed independently of each other.
Transmission of the maternal T-93 (chi-squared ~~smission disequilibrium test
p-0.032) and I-E8 (chi-
squared transmission disequilibrium test p-0.0005) alleles and also the
paternal D-E8 allele (chi-squared
transmission disequilibrium test p-0.01) to offspring was markedly more
frequent than expected (Table
5). There was an excess transmission of the maternal T-93 allele from
heterozygous mothers to offspring.
Specifically, thirty out of forty four offspring inherited the maternal T-93
allele from C/T-93 heterozygote
mothers and forty out of fifty two offspring inherited the maternal I-E8
allele from I/D-E8 heterozygote
mothers(Table 3). In addition, a contrasting excess transmission of the
paternal D-E8 allele from
heterozygote fathers to offspring (thirty one out of forty three cases) was
observed (Table 3). These
findings closely match the findings of the log-linear model.
We examined the data to determine if the transmission distortion could be
accounted for by transmission
to female or male offspring alone. However, there was no evidence that this
was the case since of the fortv_
out of fifty two offspring inheriting the maternal I-E8 allele from
heterozygote mothers, 19 were females
and 21 were males. Similarly, of the thirty one out of forty three offspring
inheriting the patennai D-E8
allele from heterozygote fathers. 15 were females and 16 were males.
The primagravida mothers investigated here differed significantly from Hardy-
Weinberg expectations
(pl=0.006) for I/D-E8 genotype frequencies (observed genotype frequencies:
III; 17, I/D; 58. D/D; 15,
expected III; 24, I/D; 45. D/D; 21 ). The transmission disequilibrium test
results shows a significant effect
without assuming Hardy-Weinberg equilibrium and thus support the log linear
model results which was
calculated assuming Hardy-Weinberg equilibrium.
Assignment of alleles transmitted and non transmitted to offspring was
determined for five independent
HLA-G polymorphisms permitting hapiotype construction, and comparison of
transmitted and non
transmitted haplotypes. Thirteen haplotypes were observed (Table 6). Four of
these, a-a-a-a-b, a-b-a-a-a
a-a-a-a-a and a-b-a-a-b, were relatively common. Differences between the
frequencies of maternal and
paternal transmission were apparent for all four common haplotypes indicating
that the distortion of
HLA-G allele transmission to primagravida offspring could still be accounted
for by biases in
transmission of the C/T-93 and I/D-E8 polymotphisms. We then constructed
haplotypes for the C/T 93
and I/D-E8 polymorphisms alone for comparison purposes.
3o The C-D and T-I haplotype were most common (Table 7). The strength of
linkage disequilibrium between
the two markers is indicated by the high frequency of the C-D haplotype, for
which the disequilibrium,
expressed as a proportion of the maximum disequilibrium (D/Dmax). is 0.344.
Comparison of maternally
SUBSTTTU'TE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
27
and paternally transmitted haplotypes to offspring using chi-squared
contingency table analysis, revealed
a highly significant difference behveen maternally and paternally transmitted
haplotypes to offspring
(p3=0.000003) reflecting a def cit in transmission of both maternal haplotypes
bearing the D-E8 allele (C-
D and T-D) and both paternal haplotypes bearing the I-E8 allele (C-I and T-I)
(Table 7). A significant
difference was also observed between maternally and patennally non-transmitted
haplotypes to offspring
(p3=0.028) showing that the maternal HLA-G genotype plays a role in pregnancy
outcome.
Maternally and paternally transmitted hapiotypes to individual offspring are
shown in Table 8. The
maternally transmitted T-I haplotype and the paternally transmitted C-D
haplotype combination occurs in
twenty one (34%) of the control offspring. By contrast the possible
alternative combination (maternally
transmitted C-D and paternally transmitted T-I) does not occur in any of the
control offspring even though
twenty two of the matings have this possibility.
In the primagravida offspring, homozygosity did not deviate from Hardy-
Weinberg expectations.
Comparison of the observed and expected number of homozygotes vs.
heterozygotes within the offspring
did not reveal any significant differences (p 1 = 0.256 for C/T-93 and p 1 =
0.82) showing that selection
against homozygotes does not occur in primagravidas.
The significant distortion observed for transmission of HLA-G alleles to
primagravida offspring provides
evidence for maternal and paternal allele specific HLA-G based selection of
foetuses in normal
primagravidas. The selection observed was most pronounced for the HLA-G I/D-E8
polymorphism. The
log linear model and transmission disequilibrium test analysis shows strong
selection for the maternal I-E8
and paternal D-E8 allele in offspring. The selection effect is most dramatic
for foetal combinations of the
I/D-E8 alleles. In the total sample. thirty seven of the eighty four offspring
have a maternal I-E8 paternal
D-E8 allele combination. By contrast. there are only five offspring with the
alternative maternal D-E8
paternal I-E8 allele combination (calculated from Table 8). These results show
that maternal D-E8
paternal I-E8 foetuses are subject to significantly increased postzygotic
prenatal loss and identify HLA-G
as a key gene influencing this process. The deficiency of maternal D-E8
paternal I-E8 offspring is
approximately 29% and closely matches postzygotic prenatal loss in prospective
mothers which has been
estimated to occur at a frequency of about 3 I % and in more than 20% of these
cases, such toss occurs
very early in pregnancy and is clinically unrecognisable.
The dichotomous effect whereby the maternal HLA-G I-E8 allele seemingly
imparts a protective effect to
the foetus while the equivalent paternal allele is detrimental is somewhat
suggestive of genomic
imprinting. however reports to date indicates that imprinting does not occur
at the HLA-G locus.
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
28
It is not clear why there is an excess of heterozygote mother for the UD-E8
genotype. The excess of
heterozygote mother for the I/D-E8 genotype the population of mothers
investigated have been selected on
the basis of normal pregnancy outcome and as such represent a select group of
the female population
since the whole female population would include several other categories of
females including infertile
women (IO-15% incidence), women that had a miscarriage (10-15% incidence) or
pre-eclampsia (5-10%
incidence).
In the primagravida offspring, homozygosity did not deviate from Hardy-
Weinberg expectations.
Comparison of the observed and expected number of homozygotes vs.
heterozygotes within the offspring
did not reveal any significant differences (p 1 = 0.45 for Cn'-93 and p 1 =
0.81 UD-E8) indicating that
selection against homozy~gotes does not occur in primagravidas. The
preferential transmission of a
maternal 1-E8 and paternal D-E8 HLA-G alleles to offspring might be expected
to result in increased
heterozygosity in the offspring. However, as the selection of offspring
appears to be for maternal I-E8 and
paternal D-E8 HLA-G allele combinations and against paternal I-E8 and maternal
D-E8 allele
combinations. the excess of the former heterozygote will be balanced by the
deficiency of the latter.
t 5 As linkage disequilibrium occurs across the HLA locus and the results are
proof that HLA-G and/or a
HLA-G linked gene, cause the selection effects observed here. The Crf-93
polymorphism is a silent
mutation while the UD-E8 polymorphism occurs in the 3' untranslated region
(UTR) of the gene. These
polymorphisms have been considered innocuous. However, the evidence indicates
that the deletion
polymorphism has a functional effect on the HLA-G gene. The l4bp sequence of
UD-E8 polymorphism is
largely conserved in primates and in the 3' tJTR and/or in the last intron of
HLA-B, C, J, A and E. 11 of
the l4bp of the polymorphism is repeated in intron seven of the HLA-G gene.
The core sequence "atttgt"
is repeated one or more times in the 3' UTR of all class I genes but is absent
in coding sequences.
Examination of the secondary structure around the I/D-E8 polymorphism using
the mfold programme
(Zuker, 1994) shows that the 14n sequence is involved in a region of the
3'LTFR having extensive
secondary structure and that the secondary structure is altered depending on
the presence or absence of
the 14n sequence (data not shown}. Thus the presence or absence of the
polymorphism may affect the
stabiliy and/or alternative splicing of HLA-G mRNA through formation of
alternative secondary
structures.
Examination of human preimpantation blastocysts showed that only 40% of the
blastocysts expressed
HLA-G and such expression was associated with an increased cleavage rate by
comparison with embryos
lacking the HLA-G transcript. Thus. polymorphisms affecting expression of HLA-
G are likely to
influence the rate of postzygotic prenatal loss by altering the cleavage rate
in the embryo.
SUBSTTIrUZ'E SKEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
29
Taken together, the results provide evidence that different HLA-G alleles
and/or combinations thereof
and/or variations in DNA in linkage disequilibrium with HLA-G in the foetus
and/or one or both parents
of the foetus are responsible for postzygotic prenatal loss which may manifest
as miscarriage or
undetectable early miscarriage which would manifest as unexplained
infertility.
Identification of HLA-G as the Pre-eclampsia gene
A cohort of pre-eciampsia primagravida trios {mother, father and first
offspring) were identified in
maternity hospitals, sampled and genotyped for the following polymorphisms in
the HLA-G gene: C/T at
colon 93 (C/T-93) (Table 9). A/T at colon 107 (A/T 107), C/A at colon 110 (CIA
110), and the
insertion / deletion polymorphism in the non-translated region of the gene in
exon 8 (UD-E8) (Table 9).
Alleles transmitted and non transmitted to offspring were assigned (Table 10
and Table I 1).
HLA-G genotypes and haplotypes in pre-eclampsia trios were examined
independently using transmission
segregation analysis. pre-eclampsia trios were also compared to the cohort of
control primagravida trios.
A significant difference in CIT-93 allele frequency was observed between
control and pre-eclampsia
mothers {pl= 0.03, Table 12). A significant difference was also observed for
the allele frequency of the
I 5 UD-E8 polymorphism behveen control and pre-~lampsia fathers (p 1= 0.02.
Table 12). The frequency of
the 93-E8 haplotypes differed significantly between control and pre-eclampsia
mothers {p3~.03), control
and pre-eclampsia fathers (p3=0.008, Table 12) and also between control and
pre-eclampsia offspring
(p3=0.03. Table 12).
The distribution of CIT-93 genotypes differed markedly between control and pre-
eclampsia trios (Table
12). with a highly significant difference being observed behveen control and
pre-eclampsia offspring
(p2=0.00 L ), between control and pre-eclampsia fathers (p2=0.02), and also
between control and pre-
eclampsia mothers (p2= 0.05). These differences reflected a signifccant excess
of C!T-93 heterorygotes
over Hardv-Weinberg equilibrium expectations in both pre-eclampsia offspring
(p I=0.0002) and pre-
eclampsia fathers (p l =0.02 ( ). A significant excess of UD-E8 heterozygotes
over Hardy-Weinberg
expectations was also observed in control mothers, pre-eclampsia offspring and
in pre-eclampsia fathers
(Table 12).
Analysis of HLA-G haplotvpe sharing between offspring and mothers was also
performed. No significant
difference between pre-eclamptic cases and controls was observed for foetal-
maternal sharing of HLA-G
alleles or for sharing of the paternally transmitted HLA-G allele. There was
no significant difference
observed for offspring sex between controls and pre-eciampsia cases.
SUBSTITUTE SHEET (RULE Z6)
CA 02321223 2000-08-18
WO 99143851 PCTI1E99/00012
Comparison of the frequency of maternally and paternally transmitted alleles
and haplotypes to control
and pre-eclampsia offspring revealed significant differences (Table 12). In
particular. these differences
showed an excess of the maternally inherited T-93/I-E8 haplotype, and
paternally inherited C-93/D-E8
haplotype and a deficiency of the maternally inherited C-93/D-E8 haplotype,
and paternally inherited T-
93/i-E8 haplotype in control offspring by comparison with pre-eclampsia
offspring (Table 10).
Furthermore. there was a significant difference between non-transmitted
maternal I/D-E8 alleles and 93-
E8 haplot~~pes showing that the maternal non-transmitted alleles are
associated with pregnancy outcome.
Only twelve out of fifty two control offspring inherited the maternal D-E8
allele from heterorygous (I/D-
E8) mothers (Table 3). By contrast, the maternal D-E8 allele was transmitted
to twenty one of thirty six
10 pre-eclampsia offspring (Table 11 ). Taken together. these findings show a
significant deficit of maternal
D-E8 transmission to control offspring and a contrasting excess of maternal D-
E8 transmission to pre-
eclampsia offspring.
Further analysis within control and pre-eclampsia trios was achieved by
comparison of maternally and
paternally transmitted alleles and haplotypes to the offspring. In control
offspring a highly significant
I S difference was observed behveen transmission of maternal and paternal C!T-
93 alleles (Table 5.
pl=0.009. calculated from Table 3). This reflected a deficit of maternal C-93
and paternal T-93
transmitted alleles (Table 3). A highly significant difference was also
observed between transmission of
maternal and paternal I/D-E8 alleles (Table 4, p 1=0.000001, calculated from
Table 3), showing a deficit
of transmission of maternal D-E8 and paternal I-E8 alleles to the offspring
(Table 3}. A significant, but
20 contrasting difference between transmission of maternal and paternal
alleles was present in pre-eclampsia
offspring where an excess of transmission of maternal D-E8 and paternal I-E8
alleles, maternal C-93 and
paternal T-93 was observed (Table 13, Table 10). A significant difference was
present between
maternally and paternally transmitted haplotypes in both control and pre-
eciampsia offspring
(p3=0.000003, Table 5 and p3=0.005 respectively) showing a deficit in
transmission of matenna.l C-93/D-
25 E8 haplotypes and paternal T-9311-E8 haplotypes to the control offspring
and an excess in transmission of
maternal C-93ID-E8 haplotypes and paternal T-93/1-E8 haplotypes to the pre-
eclampsia offspring (Table
10).
Maternally and paternally transmitted haplotypes to individual offspring are
shown in Table 14. The
maternally transmitted C-93/D-E8 haplotype and the paternally transmitted T-
93/I-E8 haplotype
30 combination occurs in twenty tv~o (35%) of the pre-eclampsia offspring but
does not occur in any of the
control offspring. By contrast. the paternal C-931D-E8, maternal T-93/I-E8
haplotvpe combination
occurs in both control and pre-eclampsia offspring but is in excess in the
control offspring. This finding
SUBSTITUTE SHEET (RULE 2b)
CA 02321223 2000-08-18
WO 99143851 PCTIIE99/00012
31
provides evidence that combinations of HLA-G alleles / haplotypes in the
foetus are causative of pre-
eclampsia in the mother.
Taken together, the results provide evidence that different foetal HLA-G
alleles and/or combinations
thereof and/or variations in DNA in linkage disequilibrium with HLA-G in the
foetus and/or one or both
parents of the foetus are responsible for pre-eclampsia
Association o! HLA-G with Recurrent Miscarriage
A cohort of couples where the mother had three or more consecutive
miscarriages were identified.
sampled and genotyped for the ClT-93 and I/D-E8 polymorphisms in the HLA-G
gene and 93-I-E8
haplotypes were assigned. RSA mothers and RSA fathers were compared to the
cohort of control and pre-
eclampsia primagravida trios for C!T-93 and I/D-E8 allele frequency, C/T-93
and I/D-E8 genotype
distribution and 93-E8 haplotype frequency. The genotypes and haplotypes of
the couples are shown in
Table 16.
A significant difference in C/T-93 allele frequency was observed between
control and pre-eclampsia
mothers (pl= U.03) and control and RSA mothers (pl= 0.002} but not between pre-
eclampsia and RSA
l5 mothers. The frequency of the 93-E8 haplotypes differed significantly
between control and pre-eclampsia
mothers (p3=0.03), control and RSA mothers (p3=0.01), but not between pre-
eclampsia and RSA
mothers.
The 93-E8 haplotypes of female and male mating partners were constructed. 50%
of couples have the
possibility of producing foetuses with the maternally transmitted C-93/D-E8
haplotype and the paternally
transmitted T-93/I-E8 haplotype combination. This compares with a 24%
possibility in control couples
and a 44% possibility in pre-eclampsia couples. The possibility of producing
foetuses with the maternally
transmitted D-E8 allele and the patenlally transmitted I-E8 allele is 46% for
control couples, 70% for
pre-eclampsia couples and 85% for recurrent miscarriage couples. Maternally
transmitted C-93/D-E8
haplotype and the paternally transmitted T-93/I-E8 haplotype combinations in
foetuses are only found in
pre-eclampsia offspring. Recurrent miscarriage couple no. 15 must produce such
a foetus. Taken
together. the results provide evidence that foetal genotype associated with
pre-eclampsia are also
associated with miscarriage. Finally, mating couples where the female is
homozygous for the T-93/I-E8
haplotype and the male has the C-93/D-E8 and T-93/1-E8 haplotypes were found
in seven of sixty three
pre-eclampsia cases and were absent in controls. Two of twenty of the
recurrent miscarriage mating
couples (no. 10 and 13. Table 17) also had the same haplotype combinations.
This provides evidence that
partners where the female is homozygous for the T-93/I-E8 haplotype and the
male has the C-93/D-E8
and T-93/1-E8 haplotypes are susceptible to pre-eclampsia and/or miscarriage.
Taken together. the results
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PG"T/IE99/00012
32
provide evidence that miscarriage and pre-eclampsia are closely related and
that miscarriage is a severe
erpression of PE. One offspring of T-931I-E8 and C-93/D-E8 haplotvpe
combination in control trios was
found where the mother was homozygous for T-93/I-E8 and father had the C-93/D-
E8 haplotype and the
C-93/I-E8 haplotype. One offspring of T-93/I-E8 and T-9311-E8 haplotype
combination in control trios
was also found where the mother was homozygous for T-9311-E8 and father had
the T-93/I-E8 haplotype
and the C-93/I-E8 haplotype. This result shows that the non-transmitted male
haplotype has a major
influence on pregnancy outcome and indicates that speim/semen contains a
factor which influences
susceptibility to pre-eciampsia and miscarriage.
Taken together. the results provide evidence that different HLA-G alleles
and/or combinations thereof
to and/or variations in DNA in linkage disequilibrium with HLA-G in the foetus
andlor one or both parents
of the foetus are responsible for miscarriage.
Induction of tolerance to HLA-G pre-eclampsia/miscarriage haplotypes in first
pregnancy
The results show that maternally transmitted D-E8 allele and the paternally
transmitted I-E8 to offspring
are linked to pregnancy outcome and that the maternally transmitted C-93/D-E8
haplotype and the
paternally transmitted T-93/I-E8 haplotype combination cause pre-eclampsia and
miscarriage in
primagravidas. We analysed HLA-G transmission in fifty three couples that have
had two successful
pregnancies W thout a history of miscarriage or PE.
The possibility of producing foetuses with the maternally transmitted D-E8
allele and the paternally
transmitted I-E8 allele was 15% for this cohort of normal couples. The results
thus show a clear
correlation between successful pregnancy outcome and the probability of
possibilities of producing
foetuses with the maternally transmitted D-E8 and the paternally transmitted I-
E8 HLA-G alleles.
Recurrent miscarriage. - 85%, pre-eclampsia - 70%, first pregnancy normal -
46%, first and second
pregnancy non;nai 15%.
The maternally transmitted C-93/D-E8 haplotype and the paternally transmitted
T-93/I-E8 haplotype
combination cause pre-eclampsia and miscarriage in primagravidas. We
determined if primagravida
normal pregnancy induced tolerance to the foetal pre-eclampsia / miscarriage
haplotype combinations
when they) occur in pregnancy two. There were no fast offspring detected
bearing the maternally
transmitted C-93/D-E8 haplotype and the paternally transmitted T-93/I-E8
haplotype combination. There
were five second offspring bearing the maternally transmitted C-93/D-E8
haplotype and the paternally
3o transmitted T-93/I-E8 haplot~~pe combination ('Table 18). We also
determined if primagravida pre-
eclampsia pregnancy induced tolerance to the foetal pre-eclampsia /
miscarriage haplotype combinations
when they occur in pregnancy two. We analysed nine families where the mother
suffered pre-eclampsia in
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
33
her first pregnancy and had a norn~al second pregnancy. There were three
second offspring bearing the
maternally transmitted C-93/D-E8 haplotype and the paternally transmitted T-
93II-E8 haplotype
combination in the absence of pre-eelampsia even though the same combination
caused pre-eclampsia in
the first pregnancy (Table 19).
'This proves that tolerance to the paternal antigens in the foetus is induced
in the first pregnancy. More
specifically. tolerance to the problematic maternally transmitted C-93/D-E8
haplotype and the paternally
transmitted T-93/I-E8 haplotype was induced in first pregnancy. Thus exposure
to HLA-G alleles and/ or
combinations thereof and/or paternal antigens presented to the maternal immune
system by HLA-G in the
first pregnancy induces tolerance to the pre~clampsia / miscarriage haplotype
combination so that these
problematic haplotypes can occur in the second pregnancy without associated
pre-eclampsia or
miscarriage.
The genetic linkage, association and cornlation approaches used in the large
number of subject cohorts
provides proof that HLA-G is a susceptibility gene for normal pregnancy, pre-
eclampsia and miscarriage.
As pre-eclampsia is associated W th infra uterine growth retardation, the HLA-
G gene is also a
susceptibility gene for infra uterine growth retardation. As miscarriage
frequently occurs so early that it is
not detected. the HLA-G is also a susceptibility gene for miscarriage related
unexplained infertility.
Exposure to foetal antigens including HLA-G in the first pregnancy has been
shown to induct tolerance to
antigens that are problematic in first pregnancy and thus provide a means for
potential treatment of pre-
eclampsia. miscarriage, intrauterine growth retardation, miscarriage related
infertility and autoimmune
disease and provide a means to induce tolerance to foreign antigens for
purposes such as transplantation
of foreign tissue.
The HLA-G I/D-E8 polynorphism has been investigated previously in pre-
eclampsia and no detectable
relationship was observed between susceptibility to pre-eclampsia and HLA-G
(24). This result is
consistent with the results reported here in that an HLA-G effect is not seen
when the I/D-E8
polymorphism is independently analysed by association studies alone.
The results presented here show that genetic screening of maternal and/or
paternal andlor foetal DNA is
of value for predictive testing of susceptibility to pre-eclampsia, eclampsia,
intrauterine growth
retardation. miscarriage and miscarriage-related infertility. Furthermore,
transmission of HLA-G alleles
to offspring in normal pregnancy differs from the normal expectation.
Therefore, the results presented
here show that genetic screening of maternal and/or paternal foetal DNA is of
value for predictive testing
of susceptibility to normal pregnancy.
SUBSTTTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99100012
34
Preferably. foetal nucleic acid is isolated from any material containing
nucleic acid of foetal origin in the
mother such as amniotic fluid. maternal blood or chorionic villus.
Furthermore, the results show that
genetic screening of parents will also be of value for predictive testing of
susceptibility to pre-eclampsia.
Although the function of HLA-G apart from its role in regulating NK cell
activity and induction of IL-3
and IL-1 beta in PBMCs is as yet poorly understood; HLA-G is an excellent
candidate for pre-eclampsia
since HLA-G is considered to play a key role in foetal-maternal immune
interactions. The C/T-93 HLA-
G allele associated with pre-eclampsia is a silent polymorphism but its effect
on HLA-G mRNA stability
or splicing is unknown. It is likely that this polymorphism and/or variations
linked to this polymorphism
play a causative role in pre-eclampsia.
In this work. we have demonstrated a difference between pre-eclamptic and
control offspring with respect
to sharing of the paternal CIT-93 allele between the offspring and their
mothers. This result indicates that
pre-eclampsia may arise due to the presence of a HLA-G haplotype in the foetus
that has not previously
been encountered by the mother. Since HLA-G is in tight linkage disequilibrium
with the HLA locus, it is
likely that the paternal HLA-G itself and/or the presence of an extended
paternal HLA haplotype in the
foetus that has not previously been encountered by the mother causes pre-
eclampsia. Furthermore, since
HLA-G is in tight linkage disequilibrium with the HLA locus, determination of
the extended paternal
HLA haplotvpe segregating in the foetus and comparison of the haplotype with
the maternal HLA
haplot<Tes will allow diagnosis of susceptibility to pre-eciampsia.
White other associations have been reported between pre-eclampsia and the
maternal genot<pe, the results
2a reported here are much more consistent with epidemiological studies on pre-
eclampsia. In particular, the
association between a foetal HLA-G genotype is consistent with the observation
that a) pre-eclampsia is
more common in sisters than in the normal population, b) pre-eclampsia is
discordant in identical twin
mothers and c) pre-eclampsia can occur with a change of male partner. Pre-
eclampsia is rare in second or
later pregnancies indicating that initial exposure to functional HLA-G
prevents pre-eclampsia. In
addition. HLA-G is now known to induce synthesis IL-3 and IL-1 beta and down-
regulate tumour
necrosis factor-alpha production. These observations coupled with the results
presented here indicates
that HLA-G protein. IL-3 and/or IL-1 beta or inhibitors of tumour necrosis
factor-alpha mill be useful for
treatment of intrauterine growth retardation, pre-eclampsia, miscarriage and
miscarriage-related
infertility.
The HLA-G genotype associated with pre-eclampsia and miscarriage is likely to
have one of a small
number of consequences:
i) it could result in reduced expression of HLA-G which would be reflected as
decreased levels of
cellular and/or soluble HLA-G (the HLA-G primary transcript is alternatively
spliced to yield several
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
different mRNAs. One of these alternatively spliced forms includes intron 4.
The open reading frame in
this mRNA continues into intron 4. terminating 21 amino acids after the alpha3
domain - encoded by exon
4. Thus, the transmembrane region encoded by exon 5 and the cytoplasmic tail
of HLA-G is excluded.
The resultant protein is hence soluble). Thus measuring of cellular and/or
soluble HLA-G levels and
comparing these levels with the normal observed levels would allow one to
diagnose susceptibility to pre-
eclampsia and miscarriage;
ii) the HLA-G genotypes associated with pre-eclampsia may lead to variations
in HLA-G mRNA and/or
HLA-G protein which in turn could be detected by characterisation of HLA-G
mRNAand/or protein.
Thus. characterisation of HLA-G protein in pregnant females, foetuses and/or
respective male mating
l0 partner would allow one to diagnose susceptibility to pre-eclampsia and
miscarriage;
iii) expression of the HLA-G protein leads directly or indirectly to
alterations in the levels of certain
molecules such as IL-3, IL-I beta and/or tumour necrosis factor alpha. The HLA-
G genotypes associated
with pre-eclampsia may result in changed expression of such molecules. Thus
measuring of the levels of
such molecules and comparing these levels with the normal observed levels
would allow one to diagnose
15 susceptibility to pre-eclampsia and miscarriage;
iv) The HLA-G genotypes associated with pre-eclampsia may result in decreased
expression of HLA-G.
This in turn would lead to increased lysis of trophoblasts by NK cells. Thus
measuring of the levels of
trophoblast specific marker and comparing these levels with the normal
observed levels would allow one
to diagnose susceptibility to pre-eclampsia and miscarriage.
2o The HLA-G variants associated with pre-eclampsia and miscarriage and normal
pregnancy are likely to
have one of a small number of consequences:
i) a variant could result in altered expression of HLA-G splice forms and
levels thereof which would be
reflected as altered levels of HLA-G splice forms including soluble HLA-G in
the serum.. Thus
measuring of size, levels and/or splice forms of HLA-G mRNA and/or protein
including soluble HLA-G
25 levels and comparing these levels with the normal observed levels would
allow one to diagnose
susceptibilit~~ to pre-eclampsia and miscarriage;
ii) the HLA-G variants associated with pre~clampsia and miscarriage may result
in variations in HLA-
G protein which in turn could be detected by protein characterisation of
cellular and/or soluble HLA-G.
Thus characterisation of HLA-G protein in pregnant females, foetuses and/or
respective male mating
3o partner would allow one to diagnose susceptibility to pre-eclampsia and
miscarriage;
iii) expression of the HLA-G protein leads directly or indirectly to
alterations in the levels of certain
molecules such as IL-3. IL-1 beta and/or tumour necrosis factor alpha. The HLA-
G variants associated
with pre-eciampsia may result in changed expression of such molecules. Thus
measuring of the levels of
such molecules and comparing these levels with the normal observed levels
would allow one to diagnose
35 susceptibility to pre-eclampsia and miscarriage;
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99100012
36
iv) the HLA-G variants associated with pre-eclampsia and miscarriage may
result in increased or
decreased expression of paternal and/or maternal HLA-G. This in turn would
lead to increased lysis of
trophobiasts by NK cells and/or cytotoxic T cells. Thus measuring of the
levels of trophobiast specific
marker and comparing these levels with the normal observed levels would allow
one to diagnose
susceptibility to pre-eclampsia.
v) the HLA-G variants associated with pre-eclampsia and miscarriage may result
in increased or
decreased cell cleavage rates in the embryo. Thus measuring of cell cleavage
rates in cells expressing one
or more HLA-G variants and any combinations thereof would allow one to
diagnose susceptibility to pre-
eclampsia and miscarriage.
to The results show that HLA-G polymorphism plays a major role in
predisposition to normal, pre-
eciampsia and miscarriage outcome in pregnancy and that haplotypic
combinations and parent-of-origin
effects mediate the influence of HLA-G polymorphism on these outcomes. The
results show a strong
association beriveen foetal and paternal HLA-G genotypes and PE, and analysis
of heterorygote v.
homozygote mating outcomes indicate that transmission of HLA-G alleles to the
pre-eclampsia offspring.
f 5 but not to control offspring, is distorted. The results provide evidence
for linkage of the maternal HLA-G
I-E8 allele to normal pregnancy outcome in primagravidas and the observed
deficit of maternal D-E8
allele and C-93/D-E8 haplotype transmission to control offspring indicates
selection for foetuses on the
basis of HLA-G genotype in primagravida normal pregnancies. The transmission
distortion of the
maternal D-E8 allele to the foetus indicates that the effect seen in normal
primagravidas is mediated by
20 the maternal allele acting primarily in the foetus. Thus, the maternal HLA-
G imparts a protective effect to
the foetus which enhances normal pregnancy outcome. This finding indicates
that maternal selection of the
HLA-G I-E8 and other protective HLA-G alleles occurs in normal pregnancy. By
contrast, the maternal
D-E8 allele was prevalent in heterorygous pre-eclampsia offspring, indicating
that susceptibility to pre-
eclampsia partly arises through the lack of a protective maternal HLA-G allele
in the foetus. The chi-
25 squared contingency table analysis agreed with the log linear model
analysis in that the C-93 allele was
over-represented in pre-eclampsia offspring and a bias towards maternal
inheritance of I-E8 was present
in controls. Furthermore. the log linear model showed that the foetal C-93
allele is under-represented in
control offspring with a strong bias towards paternal inheritance of the
allele. This indicates that the
paternal C-93 allele also imparts a protective or alternatively does not
introduce a problematic effect to
3o the foetus which improves the prospect of a normal pregnancy outcome. These
results are in good
agreement with the findings observed when maternal and paternal haplotype
combinations were
constructed for individual control and pre-eclampsia offspring where more than
one third of the pre-
cclampsia cases had a maternal C-93/D-E8 paternal T-93/I-E8 haplotype
combination that was absent in
the controls. Taken together. the data indicate a strong association between
both maternal and paternal
35 HLA-G alleles acting through the foetus and norn~al pregnancy outcome and
indicate that pre-eclarnpsia
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 3~ PC'T/IE99/00012
arises through the absence of protective maternal and protective or
problematic paternal HLA-G alleles
in the foetus. Furthermore, considering that there are likely to be several
HLA-G alleles with functional
differences. and as more than one third of pre-eclampsia cases can be
accounted for by a particular
maternal / paternal haplotype combination, the results show that the magnitude
of the effect of HLA-G in
normal and pre-eclampsia pregnancies is large.
Alternatively, a protective foetal-maternal HLA-G allele is likely to arise
through the transmission of a
dominant maternal allele to the foetus which is recognised as self by the
maternal immune system. A
protective foetal-paternal allele is likely to arise through cross recognition
of the paternal allele as self by
the matennal immune system. A problematic foetal-paternal allele is likely to
arise through cross
I o recognition of the paternal allele as non- self by the maternal immune
system. The results indicate
maternal education of the ly~rnphocye repertoire for maternal HLA-G during
and/or prior to pregnancy
and for paternal HLA-G during pregnancy. The results also indicate certain
paternal HLA-G alleles are
compatible with the maternal immune system while others are less compatible.
Combinations of less
compatible/incompatible paternal HLA-G alleles with maternal alleles which do
not protect against the
15 paternal alleles are likely to cause susceptibility to pre-eclampsia and
miscarriage.
The fact that second offspring of primagravida normal and pre-eclampsia
mothers have the maternal C-
93/D-E8 paternal T-93/I-E8 genotype in the absence of pre-eclampsia in the
second pregnancy is evidence
that maternal education for foetal-paternal antigens occurs during the f rst
pregnancy and that this
education is mediated by HLA-G. It is clear from this work that the
polymorphisms analysed and/or
2o closely linked polymorphisms in HLA-G or flanking HLA genes contribute
directly to enhancing normal
pregnancy outcome and to susceptibility to pre-eclampsia and miscarriage. One
likely explanation may be
that the polymorphisms reported here destabilise HLA-G mRNA and/or alter the
splicing pattern and/or
glycosylation pattern of HLA-G. The presence or absence of polymorphism is
likely to effect the stability
and/or alternative splicing of HLA-G mRNA. Thus a protective foetal-maternal
HLA-G allele is likely
25 to arise through the transmission of a maternal allele to the foetus which
may or may not be expressed in
the embno. A protective foetal-paternal allele is likely to arise through the
transmission of a paternal
allele to the foetus which may or may not be expressed in the embryo.
At least t<eelve different haplotypes have been described for the HLA-G gene.
Considering the link
observed between HLA-G and recurrent miscarriage, it is likely that the
combination of HLA-G alleles in
3o the early foetus and/or the combination of the HLA-G alleles in the mother
has serious effects on the
outcome of implantation in general and is likely to account for cases of
unexplained or idiopathic
infertility as well as miscarriage. The previously reported link between pre-
eclampsia and intra-uterine
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
38
growth retardation indicates that the latter is also likely to be linked to
parent of origins effects of foetal
HLA-G alleles and indicate that maternal HLA-G alleles also play a role in the
foetal grov~th outcome.
HLA-G is capable of protecting otherwise susceptible target cells from natural
killer cell mediated lysis
through its interaction with inhibitory receptors on natural killer cells. HLA-
G is also capable of
stimulating an HLA-G restricted l~~mphocy~te response. HLA-G molecules can
serve as target molecules in
lytic reactions with lymphocytes, and HLA-G is involved in education of the
lymphocytic repertoire.
Thus. pre-cclampsia, miscarriage, miscarriage-related infertility and
intrauterine growth retardation is
likely to arise through a mechanism involving blood mononuclear cells such as
natural killer cells and
cvtotoxic T lymphocytes whereby interaction between the female mating
partner's T cells and foetal
1o antigens is compromised by comparison with normal pregnancy. Thus.
compromised interaction leading
to the lack of tolerance leads to cell killing. Compromised interaction also
can lead to lack of stimulation
of cells expressing HLA-G molecules andlor lack of stimulation of cells
interacting with cells expressing
HLA-G molecules. The fact that the maternal C-93ID-E8 paternal T-93/1-E8 HLA-G
genotype can occur
in the second pregnancy of a primagravida pre-eclampsia case without pre-
eclampsia indicates that
t 5 education mediated by foetal HLA-G to foetal antigens occurs in the first
pregnancy of such mothers
which overcomes compromised interactions in second and subsequent pregnancies
. The fact that a deficit
of maternal C-93/D-E8 genotypes and an excess of T-93/1-E8 genotypes are
transmitted to control
offspring but not to pre-eclampsia offspring indicates that selection for
foetuses that express antigens for
which the mother is educated occurs in normal pregnancy. The fact that pre-
eclampsia rarely occurs in a
20 second pregnancy when the first pregnancy has been normal indicates that
induction of education to
foetal antigens mediated by HLA-G also occurs during and prior to the first
pregnancy in normal mothers
and that pre-eciampsia. miscarriage, miscarriage-related infertility and intra-
uterine growth retardation
arises from lack of education andlor inadequate induction of education to the
foetal antigens in the female
mating partner during and/or prior to pregnancy. Lack of and/or compromised
induction of education to
25 paternal antigens such as HLA-G in the foetus and/or a defective HLA-G
interaction with natural killer
cells could lead to lysis of trophoblasts and/or lack of stimulation of
trophoblasts leading to reduced
trophoblast function and/or lack of stimulation of cells interacting with
trophoblasts. Thus. HLA-G linked
conditions such as pre-eclampsia, miscarriage, miscarriage-related infertility
and intrauterine growth
retardation are likely to arise through blood mononuclear cell mediated
killing of accessible foetal tissues
3o such as trophobiasts and/or lack of stimulation of trophoblastic cells
because of compromised HLA-G
interaction with blood mononuclear cells trophoblasts and/or lack of
stimulation of blood mononuclear
cells because of compromised HLA-G interaction with trophoblastic cells. Since
major histocompatibility
(MHC) molecules like HLA-G interact with blood mononuclear cells including
cytotoxic T cells and
natural killer cells. there is likely to be abnormal interaction between
maternal blood mononuclear cells
35 and foetal cells presenting MHC / MHC-antigen complexes andlor MHC / MHC-
antigen complexes
SUBSTITUTE SHEET (RULE 2G)
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99100012
39
secreted from foetal cells in pre-eclampsia, miscarriage and intra-uterine
growth retardation by
comparison with normal pregnancies. Thus, the blood mononuclear cell response
and/or the trophoblast
response to such an interaction is likely to be abnormal in the HLA-G
associated disorders. In particular.
the cytokine response produced as a result of such an interaction is likely to
be abnormal by comparison
with the normal situation.
Thus. diagnosis of susceptibility to pre-eclampsia, miscarriage, miscarriage-
related infertility and
intrauterine growth retardation and prediction of pregnancy outcomes may be
achieved by direct and
indirect measurement of the education in the female mating partner to foetal
antigens and/or direct and
indirect measurement of the interaction between blood mononuclear cells and
HLA-G and/or I-ALA-G
to expressing cells. Furthermore, direct and indirect measurement of the
education in the female mating
partner to foetal antigens and/or direct and indirect measurement of the
natural killer cell activity in the
female mating partner to HLA-G expressing cells and/or direct and indirect
measurement of the
interaction behveen blood mononuclear cells and HLA-G and/or HLA-G expressing
cells offers a means
to monitor the course of pregnancy.
I S Induction of education to foetal antigens in the female mating partner by
treatment with HLA-G and/or
peptides knrnvn to bind to HLA-G constitutes a therapeutic means for
prevention and/or treatment of pre-
eclampsia, miscarriage, miscarriage-related infertility and intrauterine
growth retardation and any other
HLA-G related disorders.
The finding that combinations of HLA-G variants in the foetus are closely
associated with pre-eclampsia
2o and miscarriage coupled to the fact that HLA-G interacts with blood
mononuclear cells offers a further
means to prevent and/or treat pre-eclampsia miscarriage. miscarriage-related
infertility and intrauterine
growth retardation by inhibition andlor alteration of the interaction of HLA-G
and/or HLA-G variants
with blood mononuclear cells. This may be achieved by any one or combination
of approaches including
treatment with one or more molecules which recognise HLA-G and/or variants of
HLA-G and/or one or
25 more HLA-G receptors on blood mononuclear cells, and/or inactivation of the
HLA-G gene and/or HLA-
G gene variants and/or one or more HLA-G receptors on blood mononuclear cells.
For example, this
would be achieved by treatment with HLA-G specific and/or HLA-G receptor
specific antibodies which
interfere with HLA-G - blood mononuclear cell interaction and/or treatment
with one or more enzymes
which recognise and alter HLA-G and/or HLA-G receptors on blood mononuclear
cells and/or treatment
3o with one or more peptides which bind to HLA-G and/or HLA-G receptors on
blood mononuclear cells.
Alternatively. inhibition of the interaction of one or more HLA-G variants
with blood mononuclear cells
may be achieved by inactivating the HLA-G gene or HLA-G gene variant and/or
one or more HLA-G
receptors on blood mononuclear cells. This may be achieved through the use of
one or more gene
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
inactivating approaches such as treatment with one or more nucleic acid
antisense andlor ribozyme
molecules «fiich inhibit expression of the HLA-G gene and/or HLA-G gene
variant and/or one or more
HLA-G receptors on blood mononuclear cells. This may be also be achieved by
inactivating the HLA-G
gene in one or both partners of a mating couple somatically or in the germ
line through the use of gene
5 therapy approaches whereby inhibitory nucleic acid based molecules such as
antisense, and/or ribozyme
are introduced into an individual. This may be also be achieved by
inactivating the HLA-G gene in one or
both partners of a mating couple somatically or in the genm line through the
introduction of all or part of a
HLA-G gene in such a way that it recombines with the endogenous HLA-G in the
cell and inactivates it.
Altennatively, the HLA-G gene and/or variants of the HLA-G gene and/or any of
it's receptors may be
10 employed in gene therapy methods in order to increase the amount of
expression products of such genes in
an individual allowing compensation of any deficiency of HLA-G and/or it's
receptors in an individual.
'thus. alteration of the interaction of HLA-G and/or HLA-G variants with blood
mononuclear cells may
be achieved by introduction of one or more HLA-G gene variants into somatic
cells and/or into the
germline of one of both partners of a mating couple or into the fertilised egg
or cells arising from the
15 fertilised egg prior to implantation. This is of particular importance for
increased fertility for animal
breeding purposes. For example, introduction of one or more HLA-G gene
variants into the germline of
one of both partner of a mating couple or into the fertilised egg or cells
arising from the fertilised egg
where the HLA-G variant is compatible with the prospective mother offers a
means to improve fertility
and pregnancy outcome arising from any incompatibility between foetal HLA-G
and maternal cells in the
20 mother.
HLA-G binds a diverse but limited array of peptides in a manner similar to
that found for classical class 1
molecules and it has bin reported that HLA-G is expressed in the human thymus
raising the possibility
that maternal unresponsiveness to HLA-G expressing foetal tissues may be
shaped in the thymus by
central presentation of this MHC molecule on the modullary epithelium (Crisa
et al. 1997) HLA-G is
25 known to be capable of stimulating a HLA-G restricted cytotoxic T
lymphocyte response and HLA-G
molecules can serve as target molecules in lytic reaction with cytotoxic T
lymphocytes and HLA-G
expressed intenlally in vivo in transgenic animals is involved in education of
the lymphocytic repertoire
(Schmidt e~ al., 1997). The invention shows that the induction of education to
foetal antigens occurs
during pregnancy and arises from exposure of the mother to foetal antigens
during pregnancy. HLA-G
30 allele combinations that were unacceptable in first pregnancy and/or were
linked to pre-eclampsia were
acceptable in second pregnancy without any associated pregnancy complications.
Thus, induction of
education to foetal antigens is likely to arise from a process involving HLA-
G. Thus the invention offers a
means of inducing education including tolerance to HLA-G and/or peptides bound
to HLA-G in an
individual through mimicking the exposure to foetal antigens that occurs
during pregnancy. Thus
35 treatment of an individual with HLA-G and or / peptides known to bind to
HLA-G constitutes a means to
SUBS1ZTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/OOO1Z
41
induce education in an individual to antigens. In particular, this offers a
means to induct tolerance to
antigens that cause susceptibility to pre-eclampsia, susceptibility to
miscarriage, autoimmune disease and
transplant rejection.
In normal pregnancy, direct and indirect alteration of the level and/or
activity of molecules arising from
the interaction of HLA-G expressing foetal cells with blood mononuclear cells
such as lymphocytes and
natural killer cells permit pregnancy to progress properly. In pre-eclampsia,
miscarriage, miscarriage-
related infertility and intrauterine growth retardation and any other HLA-G
related disorders, the
alteration of the level and/or activity of molecules arising from the
interaction of HLA-G and/or HLA-G
expressing foetal cells with blood mononuclear cells such as lymphocytes and
natural kilter cells is likely
to to be compromised by comparison with that occurring during normal
pregnancy. Thus, mimicry of the
alteration of the level and/or activity of one or more molaules arising from
the interaction of HLA-G
and/or HLA-G expressing foetal cells with blood mononuclear cells in an
individual constitutes a
therapeutic means for prevention and/or treatment of pre-eclampsia.
miscarriage, miscarriage-related
infertility and intrauterine growth retardation and any other HLA-G related
disorders.
l5 The deficit of maternal HLA-G C-93/D-E8 genotypes and the excess of T-93/I-
E8 genotypes transmitted
to control offspring but not to pre-eclampsia offspring implies selection of
foetuses in normal pregnancy
dependent on HLA-G genotype. For fertility purposes, and especially in vitro
fertilisation and embryo
transfer in animals. selection of one or both mating partners, sperm. andlor
egg donors and/or embryo
recipients based on male and/or female HLA-G and/or HLA-G homologue genotypes
and/or serotypes
20 and/or activity associated with a successful normal first pregnancy with a
specific mating partner offers a
means to improve fertility and the success rate of in vitro fertilisation and
embryo transfer in animals and
improve pregnancy outcome.
Since HLA-G protects trophoblasts from blood mononuclear cell mediated
killing, direct and indirect
measurement of measurable substances which originate from trophoblast cell
killing should allow
25 diagnosis of susceptibility to pre-eclampsia, miscarriage, intra-uterine
growth retardation , and monitoring
of pregnancy for normal progress. and progress towards pre-eclampsia,
miscarriage and intrauterine
growth retardation in humans and animals. More specifically, the interaction
between MHC molecules
such as HLA-G and blood mononuclear cells is known to directly and indirectly
alter the s~~nthesis and
levels of several cytokines. Similarly, trophoblasts are known to synthesise
and secrete several cytokines.
30 In particular, the altered regulation of some of these cytokines would be
expected to compromise the
foetal - maternal immune interaction and could be manifest as pre-eclampsia
andfor eclampsia and/or
intrauterine growth retardation and/or miscarriage andlor miscarriage-related
infertility. For example, the
interaction of HLA-G expressing cells with blood mononuclear cells increases
the amount of interleukin-
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
42
3 (IL-3) and interleukin-1 beta {IL-1 beta) and decreases the amount of tumour
necrosis factor-alpha
(TNF-alpha) release from the blood mononuclear cells. Trophoblasts are known
to produce the
immunosuppressive cytokine interleukin 10 - a cytokine that potently inhibits
alloresponses in mixed
hznphocye reactions. Trophoblasts are also knov~~n to produce interleukin 2. a
cytokine that both protects
the foetus and in involved in activation of maternal killer cells to protect
against invading trophoblasts,
interleukin 4 and its receptor. which play a role in regulation of umbilical
blood flow mediated through the
induction of cyclooxygenase-2, indicating a role for interleukin 4 in vascular
tone and blood flow
modulation during pregnancy, interleukin 6, which is likely to play a role in
tissue remodelling associated
with placentation.
to Since the indications are that pre-eclampsia, miscarriage, miscarriage-
related infertility and intrauterine
growth retardation arise through a HLA-G mediated mechanism, there are several
obvious methods for
screening for agents which can potentially be used as diagnostic indicators
and therapeutic agents.
Screening of gene expression profiles using DNA probe arrays allows
identification of genes expressed in
HLA-G expressing cells and in blood mononuclear cells and genes whose
expression changes as a result
15 of HLA-G interaction with blood mononuclear cells. Comparison of the gene
expression profile in HLA-
G expressing cells and/or blood mononuclear cells and/or HLA-G expressing
cells interacting with blood
mononuclear cells and/or in blood mononuclear cells interacting with HLA-G
allows identification of
agents which can potentially be used as diagnostic indicators and therapeutic
agents for pre-eclampsia,
miscarriage, miscarriage-related infertility and intrauterine growth
retardation.
2o HLA-G function and HLA-G expression can be measured. Thus screening for
agents which alter the
expression and/or function and/or which mimic the function of HLA-G provide a
method for screening for
potential pre-eclampsia, miscarriage, miscarriage-related infertility and
intrauterine growth retardation
therapeutic agents.
The words "comprises/comprising ' and the words "having/including'' when used
herein with reference to
25 the present invention are used to specify the presence of stated features.
integers. steps or components but
does not preclude the presence or addition of one or more other features.
integers, steps, components or
groups thereof.
SUBSTITUTE SHEET (RULE 26}
CA 02321223 2000-08-18
WO 99/43851 PCT1IE99/00012
43
References
Arngrimsson. R., Hayward, C., Nadaud, S., Baldursdottir, A., Walker, J.J.,
Liston, W.A., Bjarnadottir,
R.L. Brock. D.J.. Geirsson, R.T.. Connor, J.M., Soubrier, F. Evidence for a
familial pregnancy-induced
hypertension locus in the eNOS-gene region. Am. J. Hum. Genet 61,354-362
(1997)
Bellingard. V.. Hedon, B., Eliaou, J., Seignalet,1., Clot, J. and Viala, J.
Immunogenetic study of couples
with recurrent spontaneous abortions. Eur.1. Obstet. Gynecol. Repr~od. Biol.,
60, 53-60 (1995).
Caudle, M., Rote, N., Scott, J., DeWitt, C. and Barney, M. Histocompatibility
in couples with recurrent
spontaneous abortion and normal fertility. Fertil. Steril.. 39, 793-198 (
1983}.
Christiansen. O., Mohapeloa, H., Steffensen, R. and Jersild, C. HLA-C and -Bw
typing of couples with
l0 unexplained recurrent miscarriages. J. Reprod. Immunol., 37, 63-77 (1997).
Colbern. G.T.. Chiang, M.H. & Main; E.K. Expression of the nonclassic
histocompatibility antigen
HLA-G by pre-eclampsia placenta. Am. J. Obstet. Gynecol. 170:1244-1250 (
1994).
Cooper, D.W., Hill, J.A., Chesley, L.C. & Iverson Bryans, C. Genetic control
of susceptibility to
cclampsia and miscarriage. Br. J. Obstet. Gynaecol.. 95:644-653 (I988).
Cooper. D.W.. Brennecke, S.P. & Winton, A.N. Genetics of Pre-eclampsia.
Hypertension in Pregnancy.
I2(1), 1-23 (1993).
Crisa. L.. McMaster, M., Ishii, J., Fisher, S. and Salomon, D. Identification
of a. thvmic epithelial cell
subset sharing expression of the class Ib HLA-G molecule with foetal
trophoblasts. J. Exp. Med. 186,
289-298 ( 1997}
Hara, N., Fuji. T. Yamashita, T.. Kozuma, S., Okai, T. & Taketani, Y. Altered
expression of human
leukocyte antigen (HLA-G) on extravillous trophoblasts in pre-eclampsia:
immunohistological
demonstration with anti-HLA-G specific antibody "87G" and anti-ct~tokeratin
antibody "CAM5.2". Am J
Reprod Immunol 36:349-358 (1996).
Harrison. G.A.. Humphrey, K.E., Jakobsen, LB. & Cooper, D.W. A l4bp deletion
polymorphism in the
HLA-G gene. Hum. Mol. Genet. 2:2200 (1993).
Harrison. G.A.. Humphrey, K.E., Jones, N., Badenhop, R., Gua, G., Elakis, G.,
Kaye, J.A., Turner, R.J.,
Grchan. M.. Wilton, A.N., Brennecke S.P. & Cooper, D.W. A genomewide linkage
study of pre-
SUBS1ZTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
44
eclampsia/eclampsia reveals evidence for a candidate region of 4q.
Am.J.Hum.Genet., 60, 1158-1167
( 1997).
Hatward. C.. Livingstone, J., Holloway, S., Liston, W.A. & Brock, D.H. An
exclusion map for pre-
eclampsia: assuming autosomal recessive inheritance. Am. J. Hum. Genet. 50,
749-757 (i992).
Humphrey. K.E.. Harrison, G.A.. Cooper, D.W., Wilton, A.N., Brennecke S.P. &
Trudinger, B.J. HLA-
G deletion polymorphism and pre-eclampsia/eclampsia. Br. J. Obstet. Gynaecol.
102:707-710 (1995).
Jin, K., Ho. H., Speed, T. and Gill, T. Reproductive failure and the major
histocompatibility complex.
Am. J. Hum. Genet., 56. 1456-1467 (1995).
Jurisicova, A., Casper, R., MacLusky, N., Mills, G. and Librach, C. HLA-G
expression during
l0 preimplantation human embryo development. Pr°C Nail Acad ScJ U.S.A.
93, 161-165 (1996).
Karhukorpi, J., Laitinen. T. & Tiilikainen, A.S. HLA-G polymorphism in Finnish
couples with recurrent
spontaneous miscarriage. Br. J. Obstet. Gynaecol. 104:1212-1214 ( I997).
Lee, N., Malacko, A.R., Ishitani, A., Chen, M., Bajorath, J., Marquardt, H. &
Geraghty, D.E. The
membrane bound and soluble forms of HLA-G bind identical sets of endogenous
peptides but differ with
respect to TAP association. Immunity, 3, 591-600 ( 1995).
Lie. R.T., Rasmussen, S., Brunborg, H., Gjessing, H.K., Lie-Neilsen, E. &
Irgens, L.M. Fetal and
maternal contributions to risk of pre-eclampsia: population based study. Br.
Med. J. 316. 1343-47
( 1998).
Loke, Y.W. & King. A. Immunology of human placental implantation: clinical
implications of our
current understanding. Mot. Med. Today 3(4): 153-159 ( 1997).
Maejima, M., Fuji, T., Kozuma, S., Okai, T., Shibata, Y. & Taketani, Y.
Presence of HLA-G expressing
cells modulates the ability of peripheral blood mononuclear cells to release
cyokines. Am. J. Reprod.
Immunol., 38. 79-82 (1997).
Ober, C. et al. Human leukocyrte antigen matching and fetal loss: results of a
10 year prospective study.
Hum. Reprod.. 13. 33-38 (1998).
Sasaki, T., Yamada, H., Kato, E., Sudo, S., Kishida, T., Sasaki, T..
Nishigaki, F. and Fujimoto, S.
Increased frequency of HLA-DR4 allele in women with unexplained recurrent
spontaneous abortions,
detected by the method of PCR-SSCP. J. Reprod. Immunoi., 32, 273-279 ( 1997).
SUBSTTTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
Sbracia. M., Mastrone, M., Scarpelline, F. and Grasso J. Influence of
histocompatibility antigens in
recurrent spontaneous abortion couples and on their reproductive performances.
Am. J. Reprod.
Immunol., 35, 85-92 (1996).
Schmidt. C.M., Garrett, E: & Orr, H.T. Cytotoxic T lymphocyte recognition of
HLA-G in mice. Hum
5 Immunol., 55. 127-139 (1997).
Spinillo. A., Capuzzo, E., Piazzi, G., Nicola, S., Colonna, L., Iasci, A.
Maternal high-risk factors and
severity of growth deficit in small gestational age infants. Early Hum Dev.
38, 35-43 (1994).
Timbers. K. and Feinberg, R. Recurrent Pregnancy Loss: A Review. Nurse
Practitioner Forum, 8, 77-88
( 1997).
io Van der Ven, K. & Ober, C., HLA-G Polymorphism in African Americans. J.
Immunol., 153, 5628-
5633 (1995).
Vaughan, P. & McCarthy, T. V. A novel process for mutation detection using
uracil DNA-glycosylase.
Nuc. Acids Res., 26, 810-815 ( 1998).
Weinberg; C.R., Wilcox, A.l. & Lie, R.T. A log-linear approach to case-parent-
triad data: assessing
15 etl~ects of disease genes that act either directly or through maternal
effects and that may be subject to
parentalimprinting. Am J Hum Genet 62, 969-978 (1998).
Wilcox AJ, Weinberg CR, O'Connor JF, Baird DD, Schlatterer JP, Canfield RE,
Armstrong EG, Nisula
BCIncidence of early loss of pregnancy. N. Eng. J. Med, 319, 189-194 (1988).
Roman. E. Fetal loss rates and their relation pregnancy order. J. Epidemiol.,
38, 29-43 (1984).
2o Winton. A.N., Cooper, D.W., Brennecke, S.P., Bishop, S.M. & Marshall, P.
Absence of close linkage
behveen maternal genes for susceptibility to pre-eclampsia and HLA DR-beta.
Lancet, 336, 653-657
( 1990).
Zuker, M. Prediction of RNA secondary structure by energy minimization. in
computer analysis of
sequence data A.M. GrifFar and H.G. Griffin eds. Methods in Molecular Biology,
Humans Press Inc.,
25 267-294 ( 1994).
SUBSTPTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
46
Table 1: Senot~rpe and allele distribution of the HI,A-G CIT-93 (C1488T) and
I/D-E8
(exon deletions polyrmorphisms in pre-eciamptic and control offsrping:
Polvmorohismcenotyt~e control preeclamntic
offs rin offs rin
Aa 22 44
HLA-G CIT-93as 8 3 6.11 <0.02
of mor hism
AA 18 7 11.01 <0.001
Aa 30 31
HLA-G CIT-93as 12 8 0.69 0.3
of mor hism
AA 13 12 0.06 <0.8
Table 2: Genotype and allele distribution of the HLA G C/T-93 and I/D-E8
polymorphisms in primigravida trios.
C/T-93 Frequency
n C/C (%) C/T (%) T/T (%) C!T
Mothers 90 19(21.1)50(55.6)21(23.3)0.49/0.51
Fathers 90 34(37.8)39(43.3)17(18.9)0.59/0.41
Offspring90 24(26.7)41(45.5)25(27.8)0.4910.51
- Male 46 13 (28.320(43.4)13 (28.30. 5/0.
) ) 5
- Femate44 11 (25.0)2I (47.7)12(27.3 0.4910 51
)
I/D-Exon Frequency
8
n I/I (%) I/D(%) D/D(%) 1/D -.
Mothers 90 17(18.9)58(64.4)15(16.7)0.51/0.49
Fathers 90 14(15.6)49(54.4)27(30.0)0.43/0.57
Offspring90 21{23.3)47(52.2)22(24.5)0.4910.51
- Male 46 10(21.7)26(56.6)10(21.7)0.5/0.5
- Female44 11 (25.0)21 (47.7)12(27.3 0.49/0 51
)
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
47
Table 3: Genotype mating outcomes for the HLA-G polymorphisms in control and
pre-
eclamnsia trios.
Mother FatherOffspring mt/mnt/ptlpnt 93 Exon 8
* * *
_ AA AA AAAA 7 4
AA
as as as aaaa 6 3
AA as Aa AAaa 6 7
as AA Aa aaAA 8 2
AA Aa AA AAAa 4 1
AA Aa Aa AAaA 2 S
as Aa as aaaA 4 8
as Aa Aa aaAa 3 2
Aa AA AA AaAA 7 7
Aa AA Aa aAAA 12 1
Aa as as aAaa 4 3
Aa as Aa Aaaa 1 14
Aa Aa AA AaAa 6 9
Aa Aa Aa AaaA* 0 10
aAAa* 3 0
(Aa)** 6 6
Aa Aa as aAaA 11 8
total 90 90
mtlmnt/pt/pnt
= maternally
transmitted
I maternally
non-transmitted
l paternally
transmitted assigned from haptotype
/ paternally
non-transmitted.
* Allele
transmitted
analysis, * possible
* to determine
not allele
transmitted,
* * *for
C/T-93
coatings,
A = C-
93, a =
T-93,
* * *
*for UD-E8
coatings,
A = I-E8,
a = D-E8
Table 4: Relative risk of foetal, maternal and parent of origin effects in a
lag linear model
4-factor model Stepwise reduced
models
Risk Factor Relative risks
C-93 I-E8 C-93 I-E8
1 or 2 alleles in offspring0.38 0.43 0.29~~ 0.39
I or 2 alleles in mother0.85 1.17 ---- ~--
maternal origin 0.70 4.03" -~- 4.68~~~
paternal origin 1.59 0.88 2.12 ~~
Chi-square improvement in fit 2 14.6 23.8 12.9 24.5
overall p-value 0.006 0.0001 0.002 0.000005
significance at the 5% level
~~significance at the I % level
... .
significance at the 0.1 % level .
~ The model was reduced by stepwise elimination of parameters whose
significance was
greater than 0. I0.
~ Compared to a model where none of the four factors shown are fitted i.e.
only a term
for mating-type stratification is fitted as it is for all models here.
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99100012
48
Table 5: Comparisons within primigravida trios.
Maternal transmitted vs. paternal transmitted
C!I'-93
p,~.009
I/D-E8 p,=0.000001
93-E8 haplotypc p3~.000003
Maternal non-transmitted vs. paternal non-transmitted
alleles
CJT-93
p,=0.75
I/D E8
py.016
93-E8 haplotype p3=-0.028
Allele transmitted to offspring
C-93 vs. T-93 p~.062
(transmission
disequilibrium test)
F-E8 vs. D-E8 p=0.37
(transmission
disequilibrium test)
Maternal transmitted vs. non-transmitted
alleles
C-93 vs. T-93 p=0.032
(transmission
disequilibrium test)
I-E8 vs. D-E8 p=0.0005
(transmission
disequilibrium test)
Paternal transmitted vs. non-transmitted
alleles
C-93 vs. T-93 p~.87
(transmissian
disequilibrium test)
I-E8 vs. D-E8 p~.01
(transmission
disequilibrium test)
__
Probability values (p) are presented with
the numbers of degrees of freedom as a
subscript.
SUBSTITUTE SHEET (RULE 2G)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
49
Table 6: Extended haplotype transmission and frequency.
Haplotype MT MNT PT PNT Frequency
golymorphic sites
3I-93-107-110-E8
a-a-a-a-b I7 30 36 25 0.321
a-b-a-a-a 4I 18 18 23 0.298
a-a-a-a-a 6 1 10 i9 0. I37
I
a-b-a-a-b 6 16 I4 9 0.134
a-a-a-b-b 2 5 2 2 0.032
a-a-b-a-a 4 2 2 2 0.030
a-a-a-b-a 3 0 0 1 0.012
a-a-b-a-b 1 1 0 I 0.009
a-b-b-a-b 0 1 1 1 0.009
a-b-b-a-a 2 0 0 0 0.006
a-b-a-b-b 1 0 I 0 0.006
a-b-a-b-a 1 0 0 0 0.003
a-a-b-b-b 0 0 0 1 0.003
37, 93, 107,
1 I0, and E8
refer to the
polymorphic
sites in codon
31, 93, 107,
110 and
E8. "a" and "b" and
represent the least
most common common
allele
respectively
of
each
polymorphic site.
MT/MNT/PT/PNT=
maternally transmitted
/ maternally
non-
transmitted !
paternally transmitted
I paternally
non-transmitted.
Table 7: Transmitted and non-transmitted HLA-G haplotypes to offspring in
nrimieravida trios.
HLA-G Maternal Maternal non- Paternal Paternal non-
Haplotype transmitted transmitted transmitted transmitted
haplotype haplotype haplotype haplotype
C-93/I-E8 13 (0.16) 11 (0.13) l I (0.13)22 (0.26)
C-931D-E8 21 (0.25) 38 (0.45) 40 (0.48) 29 (0.34)
T-93/D-E8 6 (0.07) 18 (0.22) 19 (0.22) 9 (0.1
I )
T-93II-E8 44 (0.52) 17 (0.20) 14 (0.17) 24 (0.29)
n 84 84 ~ 84 84
SUBSTTrUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PGTIIE99100012
Table 8: T~~tted and non-transmitted HLA-G haplotypes in trios.
Haplotype OffspringHaplotype Mothers
Fathers
n
MT - n T - n
PT NT
C-I C-I 3 C-I C-I 2 3
C-I C-D 6 C-I C-D 4 3
C-D C-I 2 C-D C-I 2 10
C-I T-D 2 C-I T-D 6 I
T-D C-I 2 T-D C-I 2 7
C-I T-I 2 C-I T-I 1 4
T-I C-I 4 T-I C-I 5 2
C-D C-D I3 C C-D I1 19
D
C-D T-D S C-D T-D 3 2
T-D C-D 0 T-D C-D 0 3
C-D T-I 0 C-D T-I 5 9
T-I C-D 21 T-I C-D 23 4
T-D T-D 4 T-D T-D 2 3
T-D T-I 1 T-D T-I 2 6
T-I T-D 8 T-I T 7 3
D
T-I T-I 11 T-I T-I 9 5
n 84 84 84
=
T: Haplotype transmitted to offspring, NT: Haplotype non-transmitted to
offspring.
MT: Haplotype transmitted from mother to offspring, PT: Haplotype transmitted
from
father to offspring
Table 9: Genotype and allele
distribution of the HLA-G
ClT-93 and I/D-E8
polymorphisms in pre-eclampsia
primigravida trios.
CIT-93 FrequencyUD-Exon Frequency
8
Controls n C/C (%) C/T {%) CJT 1/I I/D(%) DID(%) I/D
TIT (%) (%)
Mothers 90 19(21.1) 50(55.6)0.49/0.5117(18.9)58(64.4)15(16.7) 0.5110.49
21(23.3)
Fathers 90 34{37.8) 39(43.3)0.59/0.4114(15.6)49(54.4)27(30.0) 0.43/0.57
17(18.9)
Offspring 90 24(26.7) 41(45.5)0.49/0.5121(23.3)47(52.2)22{24.5) 0.49/0.51
25(27.8)
PE
Mothers 79 30{37.9) 36(45.6)0.61/0.3913(16.5)47(59.5)19(24.0) 0.46/0.54
13(16.5)
Fathers 76 15(/9.7) 48(63.2)0.51/0.4919(25.0)47(61.8)10(13.2) 0.5610.44
13(17.1)
Offspring 82 18(22.0) 57(69.5)0.57/0.4314(17.1)55(67.1)13(15.8) 0.51/0.49
7(8.5)
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
51
Table IO:Transmitted and non-transmitted HLA-G haplotypes to ogspring in
control and
nre-eclampsia trios.
HLA-G Maternal Maternal non- Paternal Paternal non-
Haplotype transmitted transmitted transmitted transmitted
haplotype haplotype haplotype haplotype
Control Trios
C-93II-E8 13 (O.I6) I1 (0.13) 11 (0.13)22 (0.26)
C-93/D E8 21 (0.25) 38 (0.45) 40 (0.48)29 (0.34)
T-93/D-E8 6 (0.07) 18 (0.22) 19 (0.22)9 (0.1
I )
T-93/I-E8 44 (0.52) 17 (0.20) 14 (0.1?)24 (0.29)
n 84 84 84 84
PE Trios
C-93/I-E8 5 (0.07) 13 (0.18) 12 (0.17)I 1 (0.16)
C-931D E8 42 (0.60) 27 (0.39) 22(0.32) 24 (0.35)
T-93/D-E8 4 (0.06) 5 (0.07) 3(0.04) 11 (O.
I6)
T-93lI-E8 19 (0.27) 25 (0.36) 33(0.47) 22 (0.33)
n 70 70 70 68
Table 11: ~notype mating outcomes for the HLA G polymorphisms in control and
pre-
eciamnsia trios.
Control PE
'trios Trios
Mother Father Offspringmt/mntJptlpnt93' Exon 93' Exon
8' 8'
AA AA AA AA.AA 7 4 4 1
as as as ease 6 3 0 0
AA as Aa AAaa 6 7 8 2
as AA Aa aaAA 8 2 0 7
AA Aa AA AAA.a 4 I 7 5
AA Aa Aa AAaA 2 5 9 4
as Aa as aaaA 4 8 4 5
as Aa Aa aaAa 3 2 9 6
Aa AA AA AaAA 7 7 4 0
Aa AA Aa aAAA 12 I 7 I1
Aa as as aAaa 4 3 0 4
Aa as Aa Aaaa 1 I4 5 4
Aa ' Aa AA AaAa 6 9 2 6
Aa Aa Aa AaaA* 0 10 6 3
aAAa* 3 0 2 5
(Aa)' 6 6 6 7
Aa Aa as aAaA 11 8 2 3
mt/mntlpt/pnt = maternally transmitted / maternally non-transmitted /
paternally
transmitted / paternally non-transmitted. 'For C/T-93 coatings, A = C-93, a =
T-93, ' for
UD-E8 coatings, A = I-E8, a = D-E8. *Allele transmitted assigned from
haplotype,
analysis, ' not possible to determine allele transmitted.
SUBSTTTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT/IE99/00012
52
Table 12: Comparisons between Control and pre-eclamnsia trios
Mothers FathersOffspring
Allele &eauencv
GT-93 p,= 0.03 p,= p,= 0.18
0.14
UD-E8 p,= 0.37 p,= p,= 0.83
0.02
93-E8 haplotype p3~.03 p3~.008p3~.03
frequency
('.re~otwe distribution
C/T-93 pz= 0.05 pi= p2= 0.001
0.02
1JD-E8 pi= 0.49 p~ p2= 0.14
0.02
Deviation from Hard3r-Weinberg e~uiiibrium
Control ControlControl PE PE PE
Offspring MothersFathers OffspringMother Fathers
s
C/T-93 p,~.40 p,~.29p,~.34 p,=0.0002p,~.b9 pt~.021
I/D-E8 pI~.67 p,~.006p1=a.29 p,~.002pI=0.08 p1~.027
Parental transmissionring
to offsp
MT MNT PT PNT
C/T-93 p1~.0007 p1~.88p1~.13 p,~.25
1/D-E8 p1~.00006 p,~.009p,=0.00002pi~.44
93-E8 haplotype p3=0.0002 p3~.02p3r-0.00003p3~.43
MT = maternally transmitted, MNT = maternally non-transmitted
PT = paternally transmitted, PNT = paternally non-transmitted
Probability values (p) are presented with the numbers of degrees of freedom as
a
subscript.
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
53
Table 13: ComP~o~ Within control trios and within pre-eclampsia trios.
a) Com,_"parison of transmitted and non-transmittedControls PE
alleles
Heteroryogte vs. homozygote mating outcome
C/T-93 p1~.256
p,~.002
I/D-E8 pt-0.317
py.014
Allele transmitted to offspring
C-93 v. T-93 (TDT) table p~.49
5
I-E8 v. D E8 (TDT) table 5 p~.77
Maternal transmitted vs. non transmitted
alleles
C-93 v. T-93 (TDT) table p~.65
5
I-E8 v. D-E8 table p~.09
~5
(transmission
disequilibrium test)
Paternal transmitted vs. non-transmitted
alleles
C-93 v. T-93 table p~.60
5
(transmission
disequitibrium test)
I-E8 v. D-E8 table p~.24
5
(transmission
disequilibrium test)
b) ~es~,of difference between parent of
on in
Maternal transmitted vs. paternal transmitted
C-93 v. T-93 table pi~.03
5
I-E8 v. D-E8 table p1~.0007
5
93/E8 haplotypes table p3~.005
5
Maternal non-transmitted vs. paternal non-transmitted alleles
C-93 v. T-93 table 5 p1~.5
I-E8 v. D E8 table 5 pi~.49
93/E8 haplotypes table 5 p3~.43
Probability values (p) are presented with the numbers of degrees of freedom as
a
subscript.
SUBSTTI'UTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCT11E99/00012
54
Table 14: Transmitted and non-transmitted I-E,,A-G haplotypes in control and
pre-
eclamnsia trios.
HI,,A ControlPE HLA-G Control ControlPE PE
G
Haploty~ OffspringOffspringFiap lotypeMothers FathersMothers Fathers
MT PT n n T - NT n n n n
-
C-I C-I 3 1 C-I C-I 2 3 0 2
C-I C-D 6 3 C-I C-D 4 3 3 3
C-D C-I 2 2 C-D GI 2 10 11 I
C-I T-D 2 0 C-I T-D 6 I 0 5
T-D C-I 2 3 T-D C-I 2 7 1 1
C-I T-I 2 1 C-I T-I 1 4 2 2
T-I GI 4 4 T-I C-I 5 2 1 7
GD GD 13 8 C-D C-D 11 19 16 8
GD T-D 5 3 C-D T-D 3 2 2 1
T-D C-D 0 1 T-D C-D 0 3 0 0
C-D T-I 0 22 C-D T-I 5 9 13 12
T-I C-D 21 9 T-I C-D 23 4 8 13
T-D T-D 4 0 T-D T-D 2 3 1 0
T-D T-I 1 0 T-D T-I 2 6 2 1
T-I T 8 0 T-I T-D 7 3 2 S
D
T-I T-I 11 6 T-I T-I 9 5 8 7
n 84 63 84 84 70 68
~
MT: haplotype transmitted from mother to offspring, PT: haplotype transmitted
from
father to offspring
T: haplotype transmitted to offspring, NT: haplotype non-transmitted to
offspring.
Table 15: Relative risk of foetal, maternal and parent of origin effects in a
log linear
model
Risk Factor Relative risks
PE
C-93 I-E8
1 or 2 alleles in offspring3.51 ~ 1.7
1 or 2 alleles in mother 0.66 0.98
maternal origin 1.12 0.59
paternal origin 0.74 1. I 1
* significance at the 5% Ievel
SUBSTITUTE SHEET (RULE 26)
5
CA 02321223 2000-08-18
WO 99143851 PCTIIE99100012
Table 16: Genotype and allele distribution of the FiLA-G C/T-93 and 1/D-ES
polymorphisms in recurrent miscarriage couples.
ClT-93 Frequency
n GC ClT TIT GT
Females 22 I3 7 2 0.75/0.25
Males 20 6 I2 2 0.6/0.4
I/D-Exon 8 Frequency
n Uf (%) UD(%) DID(%) i/D
Females 22 3 11 8 0.39/0.61
Males 21 5 12 3 0.55/0.45
C-93lI-E8 C-93/D-E8 T-93/D-E8 T-93/I-E8
Females 7 25 1 9
Males 7 17 i 15
5 Table 17: HI.A-G haplotypes in recurrent miscarriage couples.
Couple Female partnerMale partner
no. G a lot a HLA-G lot
a
1 t-i I o-d t-i / c-d
2 c-i / c-d c-i / c-d
3 o-i I c-d t-i I c-d
4 c-i / c-d t-i / c-d
5 c-d / c-d t-i / c-d
6 o-i / c-d c-i / c-i
7 o-d I c-d o-i I t-i
8 o-i I t-i t-d I c-i
9 t-i I o-d t-i / t-i
10 t-i I t-i t-i I c-d
11 c-d / c-d c-i / c-i
12 c-d I c-d t-i I c-d
13 t-i / t-i t-i I c-d
14 t-d I c-i c-d I c-d
1 S c-d / c-d t-i / t-i
16 c-i I c-d t-i I c-d
17 c-d I c-d c-d I c-d
18 c-d I c-d c-d I c-d
19 t-i I c-d t-i I c-d
20 t-i / c-d t-i 1 c-d
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCT/IE99/00012
56
Table 18: Transmitted and non-transmitted HLA-G haplotypes (extended
genotypesj in first
and second offspring of normal mothers
haplotypesCMT CFT first offspring second offspring
I I
HINT FNT
C-I / 2 2 2 0
C-D
C-D/ C-I I 2 5
C-I / I 0 0 0
T-D
T D / 0 1 I 1
C-I
C-I / 2 5 3 1
T-I
T-I / 4 0 0 0
C-I
C-D/ T-D 3 1 2 0
T-D / S 3 3
C-D
C-D / 6 3 0
T-I
T-I / 2 2 I 5
C-D
IT-D / 3 3 4 3
T-I
IT-I ! 2 6 6 6
T-D
'C-I / 0 0 0 0
C-I
C-D / 12 14 14 11
C-D
T-D / 1 1 1 0
T-D
'T-I / 4 5 S g
T-I _.
'T-I / 4 5 5 ~,
T-I ~ l
r2r: haplotype transmitted from mother to offspring, PT: haplotype transmitted
from
father to offspring
T: haplotype transmitted to offspring, NT: haplotype non-transmitted to
offspring.
Table 19: Transmitted and non-transmitted HLA G extended genotypes
in first and second offspring of ptimigravida pre-eclampsia mothers
~
first offspringsecond mother father
pre-eclampsiaoffspring
normal re nan
MTIPT MTIPT
1 C-D I C-D C-D I C-D C-1 I C-D I
C-D C-D
2 T (/ C-D C-D l C-D C-D I C-I I
T-I C-D
3 T-(I C-D T-I/ C-D T-I/ T-I C-D I
T-I
4 C-i ! C-D C-D I C-D C-1 ! C-D !
C-D T-1
C-D I T-I C-D I T-I * C-D I C-D I
* C-D T-I
6 C-D I T-l* C-D I T-I* C-D l T-I !
T-D T-I
7 C-D I T-I* C-D I T-I* C-D l C-1 I
C-D T-I
8 T-D I C-I T-D I C-1 T-D / C-I I
C-1 C-I
9 T-!! C-0 T-1/ C-D T-I / C-D /
t _ L_-t_.__ ~_l G_ T-I T-I
lT _ .
a~~a. asa~avy~G «aawuuw.u uvua lllVCIICT TO Ort$pClllg, hT; haplotype
transmitted from
father to offspring
SUBSTITZTTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99100012
SEQUENCE LISTING
<110> National university of Ireland, Cork
<120> HLA Linked Pre-Eclampsia and Miscarriage Susceptihility
Gene
<130> PL977PCT
<190> Not Yet Allocated
<141> 1999-02-25
<150> IE980134
<151> 1998-02-25
<150> IE980668
<151> 1998-08-12
<160> 23
<170> Patentln Ver. 2.1
<210> 1
<211> 22
<212> DNA
<213> Homo Sapiens
<300>
<400> 1
tactcccgag tctccgggtc tg 22
<210> 2
<211> 23
<212> DNA
<213> Homo Sapiens
<400> 2
aggcgcccca ctgcccctgg tac 23
<210> 3
<211> 25
<212> DNA
<213> Homo Sapiens
<400> 3
gaccgagggg gtggggccag gttct 25
1/9
SUBSTTTUTE SHEET (RULE Z6)
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99/00012
<210> 4
<211> 460
<212> DNA
<213> Homo Sapiens
<400> 4
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtqggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcaca ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 240
ctacgatggc aaggattacc tcqccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct 460
<210> 5
<211> 460
<212> DNA
<213> Homo Sapiens
<400> 5
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcata ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 240
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct 460
<210> 6
<211> 319
<212> DNA
<213> Homo Sapiens
<400> 6
gaccgagggg gtggggccag gttctcacac cctccagtgg atgattggct gcgacctggg 60
gtccgacgga cgcctcctcc gcgggtatga acagtatgcc tacgatggca aggattacct 120
cgccctgaac gaggacctgc gctcctggac cgcagcggac actgcggctc agatctccaa 180
gcgcaagtgt gaggcggcca atgtggctga acaaaggaga gcctacctgg agggcacgtg 240
cgtggagtgg ctccacagat acctggagaa cgggaaggag atgctgcagc gcgcgggtac 300
caggggcagt ggggcgcct 319
<210> 7
<211> 319
<212> DNA
<213> Homo Sapiens
2/9
SUBSTTTUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCTIIE99100012
<400> 7
gaccgagggg gtggggccag gttctcatac cctccaqtgg atgattggct gcgacctggg 60
gtccgacgga cgcctcctcc gcgggtatga acagtatgcc tacgatggca aggattacct 120
cgccctgaac gaggacctgc gctcctggac cgcagcggac actgcggctc agatctccaa 180
gcgcaagtgt gaggcggcca atgtggctga acaaaggaga gcctacctgg agggcacgtg 240
cgtggagtgg ctccacagat acctggagaa cgggaaggag atgctgcagc gcgcgggtac 300
caggggcagt ggggcgcct 319
<210>8
<211>32
<212>DNA
<213>Homo sapiens
<400> 8
gaccgagggg gtggggccag gttctcacac cc 32
<210>9
<211>27
<212>DNA
<213>Homo Sapiens
<400> 9
gaccgagggg gtggggccag gttctca 27
<210> 10
<211> 2I
<212> DNA
<213> Homo sapiens
<900> 10
tgtgaaacag ctgccctgtg t 21
<210>11
<211>21
<212>DNA
<213>Homo Sapiens
<400> 11
aaggaatgca gttcagcatg a 21
<210>12
<211>151
<212>DNA
<213>Homo Sapiens
<400> 12
tgtgaaacag ctgccctgtg tgggactgag tggcaagatt tgttcatgcc ttccctttgt 60
gacttcaaga accctgactt ctctttgtgc agagaccagc ccacccctgt gcccaccatg 120
3/9
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99!43851 PC'T/IE99/00012
accctcttcc tcatgctgaa ctgcattcct t 151
<210> 13
<211> 137
<212> DNA
<213> Homo Sapiens
<400> 13
tgtgaaacag ctgccctgtg tgggactgag tggcaagtcc ctttgtgact tcaagaaccc 60
tgacttctct ttgtgcagag accagcccac ccctgtgccc accatgaccc tcttcctcat 120
gctgaactgc attcctt 137
<210> 14
<211> 26
<212> DNA
<213> Homo sapiens
<400> 14
caaagggaag gcatgaacaa atcttg 26
<210> 15
<211> 25
<212> DNA
<213> Homo Sapiens
<900> 15
gttcttgaag tcacaaaggg acttg 25
<210> 16
<211> 2442
<212> DNA
<213> Homo Sapiens
<400> 16
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcaca ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 240
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct ccctgatctc ctgtagacct 480
ctcagcctgg cctagcacaa ggagaggagg aaaatgggac caacactaga atatcgccct 540
ccctctggtc ctgagggaga ggaatcctcc tgggtttcca gatcctgtac cagagagtga 600
ttctgagggc ccgtcctgct ctctgggaca attaagggat gaagtctctg agggagtgga 660
ggggaagaca atccctggaa gactgatcag gggttccctt tgaccccaca gcagccttgg 720
caccaggact tttcccctca ggccttgttc tctgcctcac actcaatgtg tgtgggggtc 7B0
tgactccagc tcctctgagt cccttggcct ccactcaggt cagaaccgga ggtccctgct B40
4/9
SUBSTITUTE SHEET (RULE 2~
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99100012
cccccgctca gagactagaa ctttccaagg aataggagat tatcccaqgt gcccgtgtcc 900
aggctggtgt ctgggttctg tgctcccttc cccaccccag gtatctggtt cattcttagg 960
atggtcacat ccaggtgctg ctggagtgtc ccatgagaga tgcaaagtgc ttgaattttc 1020
tgactcttcc tttcagaccc ccccaagaca cacgtgaccc accaccctgt ctttgactat 1080
gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcat actgacctgg 1140
cagcgggatg gggaggacca gacccaggac gtggagctcg tggagaccag gcctgcaggg 1200
gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagagga gcagagatac 1260
acgtgccatg tgcagcatga ggggctgccg gagcccctca tgctgagatg gagtaaggag 1320
ggagatggag gcatcatgtc tgttagggaa agcaggagcc tctctgaaga cctttaacag 1380
ggtcggtggt gagggctggg ggtcagagac cctcaccttc acctcctttc ccagagcagt 1440
cttccctgcc caccatcccc atcatgggta tcgttgctgg crtggttgtc cttgcagctg 1500
tagtcactgg agctgcggtc gctgctgtgc tgtggagaaa gaagagctca ggtaaggaag 1560
gggtgacaag tggggtctga gttttcttgt cccactgggg gtttcaagcc ccaggtagaa 1620
gtgtgccctg cctggttact gggaagcacc atccacactc atgggcctac ccagcctggg 1680
ccctgtgtgc cagcaccttc tcttttgtaa agcacctgtg acaatgaagg acagatttat 1790
taccttgatg attgtagtga tggggacctg atcccagtaa tcacaggtca ggagaaggtc 1800
cctggctaag gacagacctt aggagggcag ttggtcgagg acccacatct gctttccttg 1860
tttttcctga tcgccctggg tctgcagtca cacatttctg gaaacttctc gagggtccaa 1920
gactaggagg ttcctctagg acctcatggc cctgccacct ttctggcctc tcacaggaca 1980
ttttcttccc acagattgaa aaggagggag ctactctcag gctgcaagta agtatgaagg 2040
aggctgatcc ctgagatcct tcjggatcttg tgtttgggag ccatggggga gctcacccac 2100
cccacaattc ctcctctggc cacatctcct gtggtctctg accaggtgct gtttttgttc 2160
tactctaggc agtgacagtg cccagggctc taatgtgtct ctcacggctt gtaaatgtga 2220
caccccgggg ggcctgatgt gtgtgggttg ttgaggggaa caggggacat agctgtgcta 2280
tgaggtttct ttgacttcaa tgtattgagc atgtgatggg ctgtttaaag tgtcacccct 2340
cactgtgact gatatgaatt tgttcatgaa tatttttctg tagtgtgaaa cagctgccct 2400
gtg~gggact gagtggcaag atttgttcat gccttccctt tg 2492
<210> 17
<211> 2442
<212> DNA
<213> Homo Sapiens
<400> 17
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcata ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 240
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggracgt gcgtggagtg gctccacaga tacctggaga acgggaagga 920
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct ccctgatctc ctgtagacct 480
ctcagcctgg cctagcacaa ggagaggagg aaaatgggac caacactaga atatcgccct 540
ccctctggtc ctgagggaga ggaatcctcc tgggtttcca gatcctgtac cagagagtga 600
ttctgagggc ccgtcctgct ctctgggaca attaagggat gaagtctctg agggagtgga 660
ggggaagaca atccctggaa gactgatcag gggttccctt tgaccccaca gcagccttgg 720
caccaggact tttcccctca ggccttgttc tctgcctcac actcaatgtg tgtgggggtc 780
tgactccagc tcctctgagt cccttggrct ccactcaggt cagaaccgga ggtccctgct 840
5/9
SUBSTITUTE SHEET (RULE Z6)
CA 02321223 2000-08-18
WO 99143851 PGT/IE99100012
cccccgctca gagactagaa ctttccaagg aataggagat tatcccaggt gcccgtgtcc 900
aggctqgtgt ctgggttctg tgctcccttc cccaccccag gtatctggtt cattcttagg 960
atggtcacat ccaggtgctg ctggagtgtc ccatgagaga tgcaaagtgc ttgaattttc 1020
tgactcttcc tttcagaccc ccccaagaca cacgtgaccc accaccctgt ctttgactat 1080
gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcat actgacctgg 1140
cagcgggatg gggaggacca gacccaggac gtggagctcg tggagaccag gcctgcaggg 1200
gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagagga gcagagatac 1260
acgtgccatg tgcagcatga ggggctgccg gagcccctca tgctgagatg gagtaaggag 1320
ggagatggag gcatcatgtc tgttagggaa agcaggagcc tctctgaaga cctttaacag 1380
ggtcggtggt gagggctggg ggtcagagac cctcaccttc acctcctttc ccagagcagt 1440
cttccctgcc caccatcccc atcatgggta tcgttgctgg cctggttgtc cttgcagctg 1500
tagtcactgg agctgcggtc gctgctgtgc tgtggagaaa gaagagctca ggtaaggaag 1560
gggtgacaag tggggtctga gttttcttgt cccactgggg gtttcaagcc ccaggtagaa 1620
gtgtgccctg cctggttact gggaagcacc atccacactc atgggcctac ccagcctggg 1680
ccctgtgtgc cagcaccttc tcttttgtaa agcacctgtg acaatgaagg acagatttat 1740
taccttgatg attgtagtga tggggacctg atcccagtaa tcacaggtca ggagaaggtc 1800
cctggctaag gacagacctt aggagggcag ttggtcgagg acccacatct gctttccttg~1860
tttttcctga tcgccctggg tctgcagtca cacatttctg gaaacttctc gagggtccaa 1920
gactaggagg ttcctctagg acctcatggc cctgccacct ttctggcctc tcacaggaca 1980
ttttcttccc acagattgaa aaggagggag ctactctcag gctgcaagta agtatgaagg 2040
aggctgatcc ctgagatcct tgggatcttg tgtttgggag ccatggggga gctcacccac 2100
cccacaattc ctcctctggc cacatctcct gtggtctctg accaggtgct gtttttgttc 2160
tactctaggc agtgacagtg cccagggctc taatgtgtct ctcacggctt gtaaatgtga 2220
caccccgggg ggcctgatgt gtgtgggttg ttgaggggaa caggggacat agctgtgcta 2280
tgaggtttct ttgacttcaa tgtattgagc atgtgatggg ctgtttaaag tgtcacccct 2340
cactgtgact gatatgaatt tgttcatgaa tatttttctg tagtgtgaaa cagctgccct 2400
gtgtgggact gagtggcaag atttgttcat gccttccctt tg 2442
<210> 18
<211> 2441
<212> DNA
<213> Homo sapiens
<400> 18
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcaca ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aac~agtatgc 240
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct ccctgatctc ctgtagacct 480
ctcagcctgg cctagcacaa ggagaggagg aaaatgggac caacactaga atatcgccct 540
ccctctggtc ctgagggaga ggaatcctcc tgggtttcca gatcctgtac cagagagtga 600
ttctgagggc ccgtcctgct ctctgggaca attaagggat gaagtctctg agggagtgga 660
ggggaagaca atccctggaa gactgatcag gggttccctt tgaccccaca gcagccttgg 770
caccaggact tttcccctca ggccttgttc tctgcctcac actcaatgtg tgtgggggtc 780
tgactccagc tcctctgagt cccttggcct ccactcaggt cagaaccgga ggtccctgct 840
E/9
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PCTIIE99100012
cccccgctca gagactagaa ctttccaagg aataggagat tatcccaggt gcccgtgtcc 900
aggctggtgt ctgggttctg tgctcccttc cccaccccag gtatctggtt cattcttagg 960
atggtcacat ccaggtgctg ctggagtgtc ccatgagaga tgcaaagtgc ttgaattttc 1020
tgactcttcc tttcagaccc ccccaagaca cacgtgaccc accaccctgt ctttgactat 1080
gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcat actgacctgg 1140
cagcgggatg gggaggacca gacccaggac gtggagctcg tggagaccag gcctgcaggg 1200
gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagagga gcagagatac 1260
acgtgccatg tgcagcatga ggggctgccg gagcccctca tgctgagatg gagtaaggag 1320
ggagatggag gcatcatgtc tgttagggaa agcaggagcc tctctgaaga cctttaacag 1380
gytcggtggt gagggctggg ggtcagagac cctcaccttc acctcctttc ccagagcagt 1440
cttccctgcc caccatcccc atcatgggta tcgttgctgg cctggttgtc cttgcagctg 1500
tagtcactgg agctgcggtc gctgctgtgc tgtggagaaa gaagagctca ggtaaggaag 1560
gggtgacaag tggggtctga gttttcttgt cccactgggg gtttcaagcc ccaggtagaa 1620
gtgtgccctg cctggttact gggaagcacc atccacactc atgggcctac ccagcctggg 1680
ccctgtgtgc cagcaccttc tcttttgtaa agcacctgtg acaatgaagg acagatttat 1740
taccttgatg attgtagtga tggggacctg atcccagtaa tcacaggtca ggagaaggtc 1800
cctggctaag gacagacctt aggagggcag ttggtcgagq acccacatct gctttccttg 1860
tttttcctga tcgccctggg tctgcagtca cacatttctg gaaacttctc gagggtccaa 1920
gactaggagg ttcctctagg acctcatggc cctgccacct ttctggcctc tcacaggaca 1980
ttttcttccc acagattgaa aaggagggag ctactctcag gctgcaagta agtatgaagg 2040
aggctgatcc ctgagatcct tgggatcttg tgtttgggag ccatggggga gctcacccac 2100
cccacaattc ctcctctggc cacatctcct gtggtctctg accaggtgct gtttttgttc 2160
tactctaggc agtgacagtg cccagggctc taatgtgtct ctcacggctt gtaaatgtga 2220
caccccgggg ggcctgatgt gtgtgggttg ttgaggggaa caggggacat agctgtgcta 2280
tgaggtttct ttgacttcaa tgtattgagc atgtgatggg ctgtttaaag tgtcacccct 2340
cactgtgact gatatgaatt tgttcatgaa tatttttctg tagtgtgaaa cagctgccct 2400
gtgtgggact gagtggcaag tccctttgtg acttcaagaa c 2441
<210>19
<211>2441
<2I2>DNA
<213>Hotno sapiens
<400> 19
tactcccgag tctccgggtc tgggatccac cccgaggccg cgggacccgc ccagaccctc 60
tacctgggag aaccccaagg cgcctttacc aaaatccccg cgggtgggtc cgggcgaggg 120
cgaggctcgg tgggcggggc tgaccgaggg ggtggggcca ggttctcata ccctccagtg 180
gatgattggc tgcgacctgg ggtccgacgg acgcctcctc cgcgggtatg aacagtatgc 240
ctacgatggc aaggattacc tcgccctgaa cgaggacctg cgctcctgga ccgcagcgga 300
cactgcggct cagatctcca agcgcaagtg tgaggcggcc aatgtggctg aacaaaggag 360
agcctacctg gagggcacgt gcgtggagtg gctccacaga tacctggaga acgggaagga 420
gatgctgcag cgcgcgggta ccaggggcag tggggcgcct ccctgatctc ctgtagacct 480
ctcagcctgg cctagcacaa ggagaggagg aaaatgggac caacactaga atatcgccct 540
ccctctggtc ctgaqqgaga ggaatcctcc tgggtttcca gatcctgtac cagagagtga 600
ttctgagggc ccgtcctgct ctctgggaca attaagggat gaagtctctg agggagtgga 660
ggggaagaca atccctggaa gactgatcag gggttccctt tgaccccaca gcagccttgg 720
caccaggact tttcccctca ggccttgttc tctgcctcac actcaatgtg tgtgggggtc 780
tgactccaqc tcctctgagt cccttgqcct ccactcaggt cagaaccgga ggtccctgct B40
7/9
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99/43851 PC'TIIE99/00012
cccccgctca gagactagaa ctttccaagg aataggagat tatcccaggt gcccgtgtcc 900
aggctggtgt ctgQgttctg tgctcccttc cccaccccag gtatctggtt cattcttagg 960
atggtcacat ccaggtgctg ctggagtgtc ccatgagaga tgcaaagtgc ttgaattttc 1020
tgactcttcc tttcagaccc ccccaagaca cacgtgaccc accaccctgt ctttgactat 1080
gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcat actgacctgg 1140
cagcgggatg gggaggacca gacccaggac gtggagctcg tggagaccag gcctgcaggg 1200
gatggaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagagga gcagagatac 1260
acgtgccatg tgcagcatga ggggctgccg gagcccctca tgctgagatg gagtaaggag 1320
ggagatggag gcatcatgtc tgttagggaa agcaggagcc tctctgaaga cctttaacag 1380
ggtcggtggt gagggctggg ggtcagagac cctcaccttc acctcctttc ccagagcagt 1440
cttccctgcc caccatcccc atcatgggta tcgttgctgg cctggttgtc cttgcagctg 1500
tagtcactgg agctgcggtc gctgctgtgc tgtggagaaa gaagagctca ggtaaggaag 1560
gggtgacaag tggggtctga gttttcttgt cccactgggg gtttcaagcc ccaggtagaa 1620
gtgtgccctg cctggttnct gggaagcacc atccacactc atgggcctac ccagcctggg 1680
ccctgtgtgc cagcaccttc tcttttgtaa agcacctgtg acnatgaagg acagatttat 1740
taccttgatg attgtagtga tggggacctg atcccagtaa tcacaggtca ggagaaggtc 1800
cctggctaag gacagacctt aggagggcag ttgqtcgagg acccacatct gctttccttg 1860
tttttcctga tcgccctggg tctgcagtca cacatttctg gaaacttctc gagggtccaa 1920
gactaggagg ttcctctagg acctcatggc cctgccacct ttctggcctc tcacaggaca 1980
ttttcttccc acagattgaa aaggagggag ctactctcag gctgcaagta agtatgaagg 2040
aggctgatcc ctgagatcct tgggatcttg tgtttgggag ccatggggga gctcacccac 2100
cccacaattc ctcctctggc cacatctcct gtggtctctg accaggtgct gtttttgttc 2160
tactctaggc agtgacagtg cccagggctc taatgtgtct ctcacggctt gtaaatgtga 2220
caccccgggg ggcctgatgt gtgtgggttg ttgaggggaa caggggacat agctgtgcta 2280
tgaggtttct ttgacttcaa tgtattgagc atgtgatggg ctgtttaaag tgtcacccct 2340
cactgtgact gatatgaatt tgttcatgaa tatttttctg tagtgtgaaa cagctgccct 2400
gtgtgggact gagtggcaag tccctttgtg acttcaagaa c 2441
<210> 20
<211> 80
<212> DNA
<213> Homo Sapiens
<400> 20
accctccagt ggatgattgg ctgcgacctg gggtccgacg gacgcctcct ccgcgggtat 60
gaacagtatg cctacgatgg 80
<210>21
<211>14
<212>DNA
<213>Homo Sapiens
<900> 21
atttgttcat gcct 19
<210> 22
<211> 70
8/9
SUBSTITUTE SHEET (RULE 26)
CA 02321223 2000-08-18
WO 99143851 PCTIIE99100012
<212> DNA
<213> Homo sapiens
<400> 22
gatatgaatt tgttcatgaa tatttttctg tagtgtgaaa cagctgccct gtgtgggact 60
gagtggcaag
<210> 23
<211> 80
<212> DNA
<213> Homo sapiens
<400> 23
tccctttgtg acttcaagaa ccctgacttc tctttctgca gagaccagcc cacccctgtg 60
cccaccatga ccctcttcct 80
9/9
SUBSTITUTE SHEET (RULE Z~
