Note: Descriptions are shown in the official language in which they were submitted.
CA 02321262 2000-08-18
t
. ,
WO 99/42597 PCT/US99/03603
MONOVALENT, MULTIVALENT, AND MULTIMERIC
MHC BINDING DOMAIN FUSION PROTEINS AND CONJUGATES,
AND USES THEREFOR
Field of the Invention
The present invention is directed to the field of immunology. In particular,
the present
invention is directed to the design, production, and use of Major
Iiistocompatibility Complex
binding domain fusion proteins and conjugates.
Background of the Invention
MHC molecules are highly polymorphic dimeric proteins which determine the
specificity
l0 of T cell mediated immune responses by binding peptides from foreign
antigens in an intracellular
processing compartment, and by presenting these peptides on the surface of
antigen presenting
cells, where they may be recognized by specialized T cell receptors (TCRs)
(reviewed in
Strominger and Wiley, 1990. For exampie, the MHC Class II DR p chain gene,
with 137 known
DRBI alleles (Marsh and Bodmer, 1995), is the most polymorphic human gene that
has been
15 identified. Not surprisingly, the polymorphic residues of these proteins
are clustered in peptide
binding domains which define the large repertoire of peptides that may be
presented to T cells
(Bjorkman et al., 1987; Stern et al., 1994). Although T cells should not
normally react to self
peptides presented in syngeneic MHC molecules, some alleles of the MHC genes
are believed to
confer susceptibility to autoimmune diseases through the presentation of
pathogenic self peptides.
20 Thus, for example, the MHC Class II HLA-DR2 subtypes confer an increased
risk for multiple
sclerosis (MS), while subtypes of HLA-DR4 confer susceptibility to rheumatoid
arthritis
(reviewed in Todd et aL, 1988; Wucherpfennig and Strominger, 1995b).
The production of soluble, "empty" MHC Class II molecules (i.e., molecules
which do not
have peptides bound within the MHC Class II peptide binding domains) would be
highly useful in
25 producing homogeneous preparations of MHC/peptide complexes "loaded" with a
single variety
CA 02321262 2000-08-18
w
WO 99/42597 PCT/US99/0360-3
-2-
of peptide. Such soluble, MHC/peptide complexes have several important
investigational and
therapeutic uses. For example, soluble MHC Class II molecules are required for
crystallographic
studies of single MHC/peptide complexes, and for studying the biochemical
interaction of
particular MHC/peptide complexes with their cognate TCRs. Structural
characterization of the
MHC/peptide/TCR recognition unit will provide important insights into the
mechanisms by which
MHC molecules confer susceptibility to autoimmunity. In addition, soluble
MHC/peptide
complexes are useful for the treatment of autoimmune diseases. For example,
studies in the
murine experimental autoimmune encephalomyelitis (EAE) model have demonstrated
that an
autoimmune disease can be treated by the administration of'soluble MHC/peptide
complexes
loaded with the autoantigenic peptide (Sharma et al., i 991 ). Such complexes
are expected to be
useful in the treatment of several human autoimmune diseases, including
multiple sclerosis (MS)
and rheumatoid arthritis (RA).
A number of approaches have been followed to obtain purified, soluble, empty
MHC Class
II molecules. For example, MHC Class II molecules can be purified from
mammalian cells by
affinity chromatography following detergent solubilization of B cell membranes
(Gorga et al.,
1987). MHC molecules purified from B cell lines, however, have already passed
through the
intracellular MHC Class II peptide loading compartment and, therefore, are
already loaded with a
diverse set of peptides (Chicz et al., 1992). Furthermore, removal of these
peptides from B cell
derived MHC complexes (e.g., by low pH treatment) is very difficult and
typically results in MHC
protein denaturation. In another approach, soluble, truncated HLA-DR1 and HLA-
DR4
molecules have been expressed in the baculovirus/insect cell system using cDNA
constructs for
the DRoc and DRp extracellular domains without the hydrophobic transmembrane
domains (Stern
and Wiley, 1992). These molecules were assembled and secreted but had a
tendency to aggregate
unless they were loaded with a high affinity peptide. Moreover, this approach
has not been
successful with HLA-DR2 molecules. For example, the product of the DRA,
DRBS*0101 genes
showed a strong tendency to aggregate even when high affnity peptides were
added (Vranovsky
and Strominger, unpublished observations). In addition, when this approach was
attempted with
the DR2 molecules formed by the DRA and DRB 1 * 1501 gene products, the DRoc
and DR(3
chains failed to assemble (Wucherpfennig, unpublished observations). In yet
another approach,
Wettstein et al. ( 1991 ) expressed a murine Class II heterodimer (Ek) as a
glycan-phosphatidyl-
inositol linked chimera which could be cleaved from CHO cells by phospholipase
C to yield a
CA 02321262 2000-08-18
WO 99!42597 PCTIUS99/03603
-3-
soluble form, but this form required 100-fold higher concentrations of peptide
to yield two- to
four-fold lower levels of T cell stimulation. The expression of soluble mouse
I-A molecules (I-Au
and I-Age, which confer susceptibility to EAE and diabetes, respectively) has
also been difficult.
When the extracellular domains of these MHC molecules were fused with a glycan-
phosphatidyl
inositol anchor and then cleaved from the surface of transfected cells,
irreversible aggregation
occurred even if the cells had been incubated with I-A binding peptides prior
to cleavage (L.
Fugger and H. McDevitt, personal communication). All of these observations
with truncated
MHC molecules suggest that, for some but not all of these proteins, the a-
helical transmembrane
regions of the MHC Class II a and (3 chains are essential to the normal
assembly of the oc(3
heterodimer (Cosson and Bonifacino, 1992).
It has been suggested that "dimerization domains" of known, stable dimeric
proteins may
be genetically engineered into fusion proteins to promote the formation of
stable dimeric fusion
proteins. For example, synthetic peptides of the isolated Fos and Jun leucine
zipper dimerization
domains, with added N-terminal cysteine residues and (Gly)2 linkers, were
shown to assemble as
soluble heterodimers with interchain disulfide bridges (0'Shea et al., 1989).
Fusion proteins
including artificial leucine zipper dimerization domains were also employed to
express a.~i
heterodimers of the TCR extracellular domains with interchain disulfide
bridges (Chang et al.,
1994). Although these TCR chimeras were bound by antibodies to native TCRs,
they were not
shown to retain MHC/peptide complex specificity. In another approach, Gregiore
et al. (1991)
produced soluble a(i heterodimers of TCR extracellular domains by co-
expressing proteins in
which the variable and constant (first exon only) domains of cc and (i TCR
chains were each fused
to the same constant domain of an immunoglobulin ~: light chain. Again,
although the fusion
heterodimers were recognized by antibodies to the native TCR, these authors
were unable to
measure direct binding of the fusion heterodimer to its cognate MHC antigen,
and found that the
fusion heterodimer failed to reproducibly inhibit T cells bearing the native
TCR from recognizing
cells bearing the cognate MHC antigen. Finally, Weber et al. (1992), using a
similar approach,
failed to detect direct MHC binding of a TCR fusion heterodimer but inferred
low affinity binding
from binding competition experiments.
CA 02321262 2000-08-18
0
WO 99/42597 PCT/US99103603
-4-
Summary of the Invention
The present invention is directed to monovalent and multivalent fusion
proteins, and
multimeric protein conjugates, comprising human Major Histocompatibility
Complex binding
domains, with or without bound MHC binding peptides, v,~hich are useful in
diagnostic and
therapeutic methods, as well as laboratory assays.
In one aspect, the present invention provides MHC binding domain fusion
proteins of
MHC Class II a and ~i chain proteins in which substantially all of the C-
terminal transmembrane
and cytoplasmic domains have been replaced by dimerization domains and,
optionally, interposing
linker sequences.
Thus, a Class II MHC binding domain fusion protein is provided comprisin; a
fusion of,
toward the N-terminus, at least an NR-IC Class II binding domain of an MHC
Class II a chain and,
toward the C-terminus, a dimerization domain. In preferred embodiments, the
MHC Class II
binding domain comprises an extracellular domain of an MHC Class II a chain,
preferably at least
residues 5-180 of an MHC Class II a chain, more preferably residues S-190, and
most preferably
residues S-200. The 1\RIC Class II a chains from which the fusion proteins of
the invention may
be derived include HLA-DR1, HLA-DR2, HLA-DR4, HL.A-DQ1, HLA-DQ2 and HLA-DQ8 a
chains, and particularly a chains encoded by DRA*0101, I)RA*0102, DQAI *0301
or
DQA1 *OS01 alleles.
Similarly, a Class II MHC binding domain fusion protein is provided comprising
a fusion
of, toward the N-terminus, at least an MHC Class II binding domain of an MHC
Class II ~3 chain
and, toward the C-terminus, a dimerization domain. In preferred embodiments,
the MHC Class II
binding domain comprises an extracellular domain of an MHC Class II (i chain,
preferably at least
residues S-18S of an MHC Class II ~3 chain, more preferably residues S-195,
and most preferably
residues S-205. The MHC Class II ~i chains from which the fusion proteins of
the invention may
be derived include HLA-DR1, HLA-DR2, HLA-DR4, HLA-DQ1, HL,A-DQ2 and HLA-DQ8 ~i
chains, and particularly ~3 chains encoded by DRB 1 *O1, DRB 1 * I 5, DRB 1 *
16, DRBS*O1,
DQB 1 *03 and DQB I *02 alleles.
In some preferred embodiments, the dimerization domains of the Class II MHC
binding
domain fusion proteins comprise coiled-coil dimerization domains, such as
leucine zipper
CA 02321262 2000-08-18
WO 99142597 PCTIUS99/036Q3
-5-
domains. Preferably, the leucine zipper domains include at least four leucine
heptads. In one
preferred embodiment, the leucine zipper domain is a Fos or Jun leucine zipper
domain.
In other embodiments, the dimerization domain is an immunoglobulin Fab
constant
domain, such as an immunoglobulin heavy chain CH1 constant region or an
immunoglobulin light
chain constant region.
In each of the foregoing embodiments, a flexible molecular linker optionally
may be
interposed between, and covalently join, the h~-IC Class II binding domain and
the dimerization
domain. Preferably, the flexible molecular linker comprises a peptide sequence
of I-15 amino
acid residues, more preferably 5-7 amino acid residues. In addition, when
polypeptide linkers are
employed, it is preferred that a majority of the amino acid residues in the
linker are alanine,
giycine, serine, leucine, isoleucine, or valine residues.
In addition, in each of the foregoing embodiments, an MHC Class II binding
peptide
optionally may be covalently joined to the N-terminus of the MJ-IC Class II a
or ~3 chain binding
domain, such that the binding peptide is capable of selectively binding to an
MHC Class II binding
I ~ domain formed by the a or J3 chain and another (~3 or a, respectively) MHC
Class II chain. Thus,
the MHC binding peptide and the MHC Class II binding domain form an
MIHC/peptide complex.
Preferably, the 1\gIC binding peptide is joined to the N-terminus of the p
chain. Essentially any
MHC binding peptides may be joined to the N-termini of MHC Class II chains
with which they
selectively bind in nature. In particularly preferred embodiments with medical
importance to
multiple sclerosis, however, the MHC Class II binding domain is an HLA-DR2
binding domain
and the binding peptide is selected from residues 85-99, 84-102 and 148-162 of
human myelin
basic protein. Similarly, in particularly preferred embodiments with medical
importance to
pemphigus vulgaris, the MHC Class II binding domain is an HLA-DR4 or HLA-DQl
binding
domain and said binding peptide is selected from residues ?8-93, 97-I 11, 190-
204, 206-220,
251-265, S 12-526 and 762-786 of the human desmoglein 3 protein.
In each ef the foregoing embodiments employing a covalently bound MHC binding
peptide in the fusion protein, a flexible molecular linker optionally may be
interposed between,
and covalently join, the MHC Class II chain and the MHC binding peptide.
Preferably, the linker
is a polypeptide sequence of 10-20 amino acid residues, more preferably 12-18
amino acid
residues. When a polypeptide linker is employed, it is preferred that a
majority of the amino acid
residues are alanine, glycine, serine, leucine, isoleucine, and valine
residues.
CA 02321262 2000-08-18
-E
WO 99!42597 PC'f/US99I03603
-6-
In another aspect, the present invention provides Class II MHC binding domain
fusion
proteins comprising a heterodimer of a first polypeptide chain and a second
polypeptide chain, in
which the first polypeptide chain comprises a fusion of, toward the N-
terminus, at least an MHC
binding domain of an MHC Class II a chain and, toward the C-terminus, a fcrst
dimerization
domain, and the second polypeptide chain comprises a fusion of, toward the N-
terminus, at least
an MHC binding domain of an MHC Class II p chain and, toward the C-terminus, a
second
dimerization domain. In these embodiments, the first dimerization domain and
the second
dimerization domain associate in solution at physiological conditions to form
a heterodimer
capable of selectively binding an MHC binding peptide. The dimerization
domains, as described
above, may be coiled-coil dimerization domains and, preferably, leucine zipper
domains. Flexible
molecular linkers, as described above, may be interposed between and
covaiently join the lV»iC
chains and dimerization domains, and MHC binding peptides may be covalently
joined to one of
the MHC chains.
In another aspect, a Class II MHC binding domain fusion protein is provided
comprising a
heterodimer of a first polypeptide chain and a second polypeptide chain, in
which the first
polypeptide chain comprises a fusion of, toward the N-terminus, at least an
MHC binding domain
of an MHC Class II a chain and, toward the C-terminus, an immunoglobulin heavy
chain CH1
constant region, and the second polypeptide chain comprises a fusion of,
toward the N-terminus,
at least an MHC binding domain of an MHC Class II (3 chain and, toward the C-
terminus, an
immunoglobulin light chain constant region. In these embodiments, the
immunoglobulin heavy
chain CH 1 constant region and the immunoglobulin light chain constant region
dimerize in solution
at physiological conditions to form a heterodimer capable of selectively
binding an MHC binding
peptide. Alternatively, a Class II MHC binding domain fusion protein is
provided comprising a
heterodimer of a first polypeptide chain and a second polypeptide chain, in
which the first
polypeptide chain comprises a fusion of, toward the N-terminus, at least an
extracellular domain
of an MHC Class II a chain and, toward the C-terminus, an immunoglobulin light
chain constant
region, and the second polypeptide chain comprises a fusion of, toward the N-
terminus, at least an
extracellular domain of an MHC Class II ~i chain and, toward the C-terminus,
an immunoglobulin
heavy chain CH1 constant region. In these embodiments, as above, the
immunoglobulin heavy
chain CHI constant region and the immunoglobulin light chain constant region
dimerize in solution
at physiological conditions to form a heterodimer capable of selectively
binding an MHC binding
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
peptide. In each of these embodiments, the Class II MHC fusion protein may
further comprise an
immunoglobulin Fc region covalently joined to the immunoglobulin heavy chain
CHl constant
region. Such Fc regions may be IgE or IgM Fc regions, and a flexible molecular
linker may
optionally be interposed between, and covalently join, the immunogIobulin
heavy chain CHl
constant region and immunoglobulin Fc region. Alternatively, the Fc regions
may be IgA, IgD or
IgG Fc regions. As before, a flexible molecular linker may be optionally
interposed between, and
covalently join, the immunoglobulin heavy chain CHI constant region and
immunoglobulin Fc
region and, in these embodiments, may be immunoglobulin hinge regions.
In particularly preferred embodiments, a multivalent Class II MHC binding
domain fusion
protein is provided comprising two Class II W-IC binding domain fusion
proteins as described
above, in which the Fc regions are covatently joined by at least one disulfide
bond. Most
preferably, a multivalent Class II MHC bindin_ domain fusion protein is
provided comprising five
pairs of Class II MHC binding domain fusion proteins in which the Fc regions
are IgM regions,
each pair is covalently joined by at least one disulfide bond between Fc
regions of each pair, and
I > the five pairs are covalently joined by disulfide bridges to form a ring
structure such that each
adjacent pair in the ring is joined by at least one disulfide bond.
In each of the foregoing embodiments, the Class II MHC binding domain fusion
proteins
may further comprise an N-terminal secretory signal sequence covalently joined
to the N-terminus
of the fusion protein. In preferred embodiments, the secretory signal sequence
comprises a yeast
a-mating factor secretion signal or a human MHC Class II protein secretion
signal.
In another aspect, the present invention provides for multimeric MHC binding
domain
conjugates comprising a carrier conjugated to a multiplicity of MHC binding
domains, with or .
without peptide bound thereto.
In some preferred embodiments, the multimeric MHC binding domain conjugates
comprise about 5 to about S00 MHC binding domains per carrier, preferably
about 10 to about
200 MHC binding domains per carrier, and most preferably about 20 to about 100
MHC binding
domains per carrier.
In some preferred embodiments, the multimeric MI-IC binding domain conjugates
are
characterized by the presence of MHC binding domains at an average density of
about 4 x 10'3 to
3D 20 MHC binding domains/nmz on the surface of the carrier, preferably about
4 x 10'2 to 20 MHC
02321262 2000-08-18
WO 99142597 PCTNS99/036U3
_g_
binding domains/nm2, and most preferably about 0.4 to 20 MHC binding
domainslnm2 on said
surface.
In some preferred embodiments, the multimeric MHC binding domain conjugates
comprise a carrier having a maximum diameter of about 5 to about 1000 nm,
preferably about 5 .
to about 500 nm, and most preferably about 5 to about 100 nm. In some
embodiments, the
multimeric MHC binding domain conjugates define a minimal surface area of less
than
approximately 3.1 x 106 nm2, preferably less than 7.9 x 105 nm2, and more
preferably less than 3.1
x 104 nmz. In most preferred embodiments, MHC binding domain conjugates define
minimal
surface areas of approxiamtely 78.5 to 5.0 x 10~ nm2. In some embodiments, the
multimeric
l0 MHC binding domain conjugates define a minimal volume of less than
approximately 5.2 x 10~
nm3, preerably less than 6.5 x 10' nm3, and more preferably less than 5.2 x 1
OS nm3. In most
preferred embodiments, IVffiC binding domain conjugates define minimal volumes
of 65.4 to 3.4 x
10° nm3.
In some preferred embodiments, the multimeric MHC binding domain conjugates
15 comprise a carrier weighing about 100 ILDa to about 10,000 hDa, preferably
about 100 kDa to
about 5,000 kDa, more preferably about 100 ILDa to about 1,000 I:Da, and most
preferably about
100 ILDa to about 500 I:Da.
In some preferred embodiments, the multimeric MHC binding domain conjugates
weigh
about 400 kDa to about 10,000 kDa, preferably about 400 kDa to about 5,000
kDa, more
20 preferably about 400 kDa to about 1,000 kDa, and most preferably about 400
l:Da to about 500
kDa.
In some preferred embodiments, the multimeric MHC binding domain conjugate is
particulate, the carrier is biodegradable, the carrier is non-immunogenic, the
carrier has a net
neutral or negative charge, and/or the carrier is fluorescently labeled. The
carrier may be
25 covalently or non-covalently bound to the MHC binding domains.
In some embodiments, the multimeric MHC binding domain conjugate comprises a
carrier
which is a substantially spherical bead or a porous bead. In preferred
embodiments in which the
carrier is a bead, the bead preferably comprises a material selected from the
group consisting of
glass, silica, polyesters of hydroxy carboxylic acids, polyanhydrides of
dicarboxyIic acids, or
30 copolymers of hydroxy carboxylic acids and dicarboxylic acids.
CA 02321262 2000-08-18
WO 99/42597 PCTNS99103603
-9-
In some embodiments, the multimeric MHC binding domain conjugate comprises a
carrier
which is a branched polymer, such as a dendrimer. In preferred embodiments
when the carrier is a
dendrimer, the dendrimer comprises a material selected from the group
consisting of a
polyamidoamine, a polyamidoalcohol, a polyalkyleneimine, a polyalkylene, a
polyether, a
polythioether, a polyphosphonium, a polysiloxane, a polyamide, and a polyaryl
polymer.
In some embodiments, the multimeric MHC binding domain conjugate comprises a
carrier
which is a liposome. In these embodiments, the Iiposome preferably comprises a
material selected
from the group consisting of phosphatidyl choline, phosphatidyl serine,
phosphatidyl inositol,
phosphatidyl glycerol, phosphatidyl ethanolamine, phosphatidic acid, dicetyl
phosphate, .
monosialoganglioside, polyethylene glycol, stearyl amine, ovolecithin and
cholesterol.
In each of the foregoing embodiments, the multimeric 1~1HC binding domain
conjugates
may further comprise a multiplicity of MHC binding peptides bound to the MHC
binding
domains, either covalently or non-covalently.
In each of the foregoing embodiments of multimeric MHC binding domain
conjugates,
I~ each MHC binding domain preferably comprises a heterodimer of at least the
peptide binding
domain of an MHC Class I a chain and an MHC Class I ~i chain, or a heterodimer
of at least the
peptide binding domain of an MHC Class II a, chain and an MHC Class II ~i
chain. Further, in
each of these embodiments, the MHC binding domains may comprise a part of a
monovalent or
multivalent R~-IC binding domain fusion protein of the invention.
In another aspect, the present invention provides a method for detecting T
cells having a
defined MHC/peptide complex specificity comprising providing a monovalent,
multivalent or
multimeric MHC binding domain fusion protein or conjugate, as described above
and comprising
the defined Ivil-IC/peptide complex, contacting a population of T cells with
the fusion protein or
conjugate, and detecting the presence or absence of binding of the fusion
protein or conjugate and
T cells in the population. Also provided is a method further comprising
isolating T cells reactive
with the defined MHC/peptide complex from the population of T cells by, for
example, means of
fluorescence activated cell sorting.
In another aspect, the present invention provides a method of conferring to a
subject
adoptive immunity to a defined MHC/peptide complex comprising providing a
monovalent,
multivalent or multimeric MHC binding domain fusion protein or conjugate, as
described above
and comprising the defined MHC/peptide complex, contacting a population of T
cells with the
CA 02321262 2000-08-18
. _
WO 99/42597 PCT/US99/03603
- 10-
fusion protein or conjugate, isolating T cells reactive with the defined
MHC/peptide complex
from the population of T cells, and administering the isolated T cells to the
subject to provide
adoptive immunity.
In another aspect, the present invention provides a method for stimulating or
activating T
cells reactive to a defined MHC/peptide complex comprising providing a
monovalent, multivalent
or multimeric MHC binding domain fusion protein or conjugate, as described
above and
comprising the defined MHC/peptide-complex, and contacting a population of T
cells with an
immunogenic amount of the fusion protein or conjugate. In preferred
embodiments, the fusion
protein or conjugate is contacted with the population of T cells in vivo in a
human subject, and
the MHC fusion protein or conjugate comprises an MHC binding domain which is
syngeneic to
the subject.
In another aspect, the present invention provides a method for selectively
killing T cells
reactive to a defined MHC/peptide complex comprising providing a monovalent,
multivalent or
multimeric MHC binding domain fusion protein or conjugate, as described above
and comprising
the defined I~'I)<iC/peptide-complex, and contacting a population of T cells
with the fusion protein
or conjugate, in which the fusion protein or conjugate comprises a domain of
an immunoglobuiin
effective to activate the complement system and cause the complement system to
kill the T cells.
In another aspect, the present invention provides a method for selectively
killing T cells
reactive to a defined MHC/peptide complex comprising providing a monovalent,
multivalent or
multimeric MHC binding domain fusion protein or conjugate, as described above
and comprising
the defined MHC/peptide-complex, and contacting a population of T cells with
the fusion protein
or conjugate, in which the fusion protein or conjugate comprises a cytotoxic
substance associated
with the protein or conjugate and capable of killing T cells to which the
fusion protein or
conjugate selectively binds.
In another aspect, the present invention provides a method for tolerizing a
human subject
to a defined MHC/peptide complex comprising providing a monovalent,
multivalent or multimeric
MHC binding domain fusion protein or conjugate, as described above and
comprising the defined
MHC/peptide-complex, and administering to the subject an amount of the fusion
protein or
conjugate effective to induce tolerization to said MHC/peptide complex. In
certain preferred
embodiments, the MHC fusion protein or conjugate comprises an MHC binding
domain which is
CA 02321262 2000-08-18
..,
WO 99/42597 PGT/US99/03603
-11-
syngeneic to the subject. In other preferred embodiments, however, the MHC
fusion protein or
conjugate comprises an MHC binding domain which is allogeneic to the subject.
In another aspect the present invention provides nucleic acid seguences
encoding the
above-described MHC binding domain fusion proteins.
CA 02321262 2000-08-18
WO 99/42597 PCTNS99I03603
- 12-
Brief Description of the Drawines
Figure 1. This figure is a schematic representation of one embodiment of a
monovalent
MHC binding domain fusion protein of the invention. Here, an extracellular or
peptide binding
domain of an MHC Class II a chain 10 is joined to a first dimerization domain
30, an extracellular
or peptide binding domain of an MHC Class II (3 chain 20 is joined to a second
dimerization
domain 40, and these two fusion constructs form a heterodimeric molecule which
binds an MHC
binding peptide 110 in the cleft formed by the MHC Class II binding domains of
the a and ~i
chains, 10 and 20. Optionally, flexible molecular linkers, not shown, are
interposed between the
MHC domains (10, 20) and the dimerization domains (30, 40).
IO Figure 2. This figure is a schematic representation of one embodiment of a
divalent IV1HC
binding domain fusion protein construct of the invention. Here, an
extracellular or peptide
binding domain of an MHC Class II a chain 10 is joined to either a first
coiled-coil or
dimerization domain or an immunoglobulin heavy chain CH1 constant region 30,
and an
extracellular or peptide binding domain of an MHC Class II J3 chain 20 is
joined to a second
IS coiled-coil dimerization domain or an immunoglobulin light chain constant
region 40. As shown,
the domain 30 fused to the M~-IC a chain domain 10 is further fused to a hinge
region 50
(optional) and Fc region 60 of an immunoglobulin chain. Alternatively, not
shown, the MHC a
and ~i chain domains 10 and 20 may be switched such that the MHC ~3 chain
domain is fused to
the immunoglobulin heavy chain domains 50 and 60. The dimerization domains 30
and 40
20 promote the assembly of these two fusion constructs to form a heterodimeric
structure which
binds an MHC binding peptide 110 in the cleft formed by the MHC Class II
binding domains of
the a and (3 chains, 10 and 20. Optionally, flexible molecular linkers, not
shown, are interposed
between the MHC domains (10, 20) and the dimerization domains (30, 40), and/or
between the
dimerization domain 30 and the immunoglobulin hinge 50 or Fc region 60. The Fc
regions 60 and
25 60' of two of these heterodimeric MHC-imrryunoglobulin fusion proteins
associate in the manner
of an antibody to form a divalent MHC binding domain fusion protein construct.
Horizontal lines
between the Fc regions 60 and 60' represent disulfide bridges between the
immunoglobulin heavy
chain domains.
Figure 3. This figure is a schematic representation of one embodiment of a
decavalent
30 MHC binding domain fusion protein construct of the invention. Here, an
extracellular or peptide
binding domain of an MHC Class II a chain 10 is joined to either a first
coiled-coil dimerization
CA 02321262 2000-08-18
WO 99142597 PCT/US99103603
-13-
domain or an IgM immunoglobulin heavy chain CH1 (CSI) constant domain 30, an
extracellular
or peptide binding domain of an MHC Class II ~3 chain 20 is joined to either a
second coiled-coil
dimerization domain or an IgM immunoglobulin light chain constant region 40,
and these two
fusion constructs assemble to form a heterodimeric molecule which binds an MHC
binding
peptide 110 in the cleft formed by the MHC Class II binding domains of the a
and ~3 chains, 10
and 20. As shown, the domain 30 fused to the MHC a chain domain 10 is further
fused to an
IgM Fc domain (CH2, CH3, CH4) 60. Alternatively, not shown, the MHC a and (3
chain domains
and 20 may be switched such that the MHC (3 chain domains are fused to the
immunoglobulin
heavy chain domains 60. The Fc regions 60 and 60' of two heterodimeric ri~-IC-
immunoglobulin
10 fusion proteins associate in the manner of a single IgM subunit to form a
divalent MHC-IgM
fusion structure joined by a disulfide bond. Five of these divalent MJ-IC-IgM
fusion subunits
assemble to form a characteristic IgM pentamer, joined by disulfide bonds 90
between IgM
subunits and including a J-chain peptide 100, and resulting in a decavalent
MHC-IgM fusion
structure. Optionally, flexible molecular linkers, not shown, are interposed
between the MHC
domains (10, 20) and the coiled-coil or IgM dimerization domains (30, 40),
and/or between the
dimerization domains (30) and the IgM Fc domains (60).
Figure 4. This figure is a schematic representation of one embodiment of a
tetravalent
MHC binding domain fusion protein construct of the invention. Here, an
extracellular or peptide
binding domain of an MHC Class II a chain 10 is joined to a first dimerization
domain 30, an
extracellular or peptide binding domain of an MHC Class II p chain 20 is
joined to a second
dimerization domain 40, and these two fusion constructs assemble to form a
heterodimeric
molecule which binds an MHC binding peptide 110 in the cleft formed by the MHC
Class II
binding domains of the a and /3 chains, 10 and 20. As shown, the domain 30
fused to the MHC a
chain domain 10 is further fused to a Iigand tag 70 which binds to anti-ligand
80. Alternatively,
not shown, the MHC a and (3 chain domains 10 and 20 may be switched such that
the MHC (3
chain domain is fused to the ligand tag 70. As shown, each anti-ligand binds
four ligand moieties,
and the MHC binding domain fusion protein complex is tetravalent. Optionally,
flexible molecular
linkers, not shown, are interposed between the MHC domains (10, 20) and the
dimerization
domains (30, 40), and/or between the dimerization domain 30 and the ligand tag
70.
Figure 5. This figure is a schematic representation of one embodiment of a
multimeric
MHC binding domain conjugate of the invention. Here, an extracellular or
peptide binding
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/0360~3
- 14-
domain of a first MHC chain (a or (3) 10 and an extracellular or peptide
binding domain of a
second MHC chain ((3 or a) 20 assemble to form a heterodimeric molecule which
binds an MHC
binding peptide 110 in the cleft formed by the MHC binding domains of the a
and j3 chains, 10
and 20. A conjugating moiety Z00 conjugates, covalently or non-covalently, one
of the MHC
chains 10 to a carrier 300.
Figure 6. This figure is a schematic representation of one embodiment of a
multimeric
MHC binding domain conjugate of the invention. Here, an extracellular or
peptide binding
domain of an MHC a chain 10 is joined to a first dimerization domain 30, an
extracellular or
peptide binding domain of an MHC (3 chain 20 is joined to a second
dimerization domain 40, and
these two fusion constructs assemble to form a heterodimeric molecule which
binds an MHC
binding peptide 110 in the cleft formed by the MHC binding domains of the a
and ~3 chains, 10
and 20. As shown, the domain 30 fused to the ~~IC a chain domain 10 is bound,
covalently or
non-covalently, to a conjugating moiety 200 which is bound, covalently or non-
covalently, to a
carrier 300. Here, the carrier 300 is shown as a dendrimer. Alternatively, not
shown, the MHC a
and (3 chain domains 10 and 20 may be switched such that the NJTIC Ji chain
domain is bound to
the conjugating moiety 200. Optionally, flexible molecular linkers, not shown,
are interposed
between the IV»-1C domains (10, 20) and the dimerization domains (30, 40),
and/or between the
dimerization domain 30 and the conjugating moiety 200, and/or between the
conjugating moiety
200 and the carrier 300.
Figure 7. This figure is a schematic representation of one embodiment of a
multimeric
MHC binding domain conjugate of the invention. Here, an extracellular or
peptide binding
domain of an MHC a chain 10 is joined to a first dimerization domain 30, an
extracellular or
peptide binding domain of an MHC (i chain 20 is joined to a second
dimerization domain 40, and
these two fusion constructs assemble to form a heterodimeric molecule which
binds an MHC
binding peptide 110 in the cleft formed by the MHC binding domains of the a
and (3 chains, 10
and 20. As shown, the domain 30 fused to the MHC a chain domain 10 is further
fused to a
ligand tag 70 which binds to anti-ligand 80, which is bound to the surface of
a carrier 300.
Alternatively, not shown, the MHC a and ~i chain domains 10 and 20 may be
switched such that
the MHC (3 chain domain is fused to the ligand tag 70. Optionally, flexible
molecular linkers, not
shown, are interposed between the MHC domains (10, 20) and the dimerization
domains (30, 40),
CA 02321262 2000-08-18
y-
WO 99142597 PGT/US99/03603
-15-
and/or between the dimerization domain 30 and the ligand tag 70, and/or
between the anti-ligand
80 and the carrier 300.
Figure 8. This figure graphically presents the results of experiments
demonstrating the
assembly and secretion of recombinant HLA-DR2 fusion proteins by Pichia
pastoris. Expression
of DR2 fusion proteins (DRa-Fos and DR(3-Jun) were examined by sandwich ELISA
of cell
culture supernatants (top graph) or cell culture lysates (bottom graph) using
a mAb (L243)
specific for the DR2 a~ heterodimer for capture, and a polyclonal DR antiserum
for detection.
Binding of the secondary antibody was quantitated with a peroxidase conjugated
anti-rabbit IgG
antiserum, with ABTS as the peroxidase substrate and detection at 405 nm.
Results are from
cells transfected with: DRa-Fos only, open squares; DR(3-Jun only, solid
circles; and both DRa-
Fos and DRj3-Jun, open circles.
Figure 9. This figure presents the results of experiments demonstrating the
specificity of
peptide binding to recombinant HLA-DR2 (rDR2) fusion proteins. Peptide binding
was examined
using a biotinylated MBP(85-99) peptide ("MBP") that was previously shown to
bind with high
affcnity to detergent soluble DR2. rDR2-MBP complexes were captured on an
ELISA plate using
a DR specific mAb (L243) and DR bound biotinylated MBP was quantitated using
peroxidase
labeled streptavidin, with ABTS as the peroxidase substrate and detection at
405 nm. The top
graph shows the effect of rDR2 concentration on peptide binding with: 2 yM
biotinylated MBP
peptide, open circles; 2~NI biotinylated MBP peptide with 100 pM
unbiotinylated MBP as a
competitor, solid triangles; and no peptide, solid squares. The same ELISA
assay was used with
200 nM rDR2 and 2 uM biotinylated MBP to demonstrate binding specificity. The
bottom graph
shows the effect of varying concentrations of competitor peptides on
biotinylated MBP peptide
binding to rDR2 fusion proteins: unbiotinylated MBP competitor, open squares;
Va189-Asp
MBP competitor, closed circles.
Figure 10. This figure presents the results of experiments demonstrating the
kinetics of
peptide binding to recombinant HLA-DR2 fusion proteins (rDR2). The kinetics of
peptide
binding were compared for rDR2 and for detergent soluble DR2 purified from an
EBV
transformed B cell line. The DR2 proteins (200 nM) were incubated with
biotinylated MBP
peptide (2 ~tM) at 37°C for different periods of time; the amount of DR
bound peptide was
examined by ELISA using a DR specific antibody for capture and streptavidin-
peroxidase for
quantification of bound peptide, with ABTS as the peroxidase substrate and
detection at 405 nm.
CA 02321262 2000-08-18
WO 99/42597 PCT/US99103603
- 16-
The graph shows biotinylated MBP peptide binding over time for: recombinant
DR2 fusions, open
squares; detergent solubilized B cell DR2 molecules, closed triangles.
Detailed Description of the Invention
I. Definitions.
In order to more clearly and concisely describe and point out the subject
matter of the
claimed invention, the following definitions are provided for specific terms
which are used in the
following description and the claims appended hereto.
As used herein, the term "Major Histocompatibility Complex" and the
abbreviation
"MHC" means the complex of genes, found in all vertebrates, which function in
signaling between
lymphocytes and antigen presenting cells in normal immune responses by binding
peptides and
presenting them for possible recognition by T cell receptors (TCRs). MHC
molecules bind
peptides in an intracellular processing compartment and present these peptides
on the surface of
antigen presenting cells to T cells. The human MHC region; also referred to as
HLA, is found on
chromosome six and includes the Class I region (including the Class I a genes
HLA-A, HLA-B
and HLA-C) and the Class II region (including the subregions for Class II a
and (3 genes DP, DQ
and DR).
As used herein the term "MHC Class I" or "Class I" refers to the human Major
Histocompatibility Complex Class I proteins, binding peptides, or genes.
Within the MHC Class I
region are found the HLA-A, HLA-B and HLA-C subregions. As used herein, the
term "MHC
Class I molecule" means a covalently or non-covalentIy joined complex of an
MHC Class I a
chain and a (32-microglobulin chain.
As used herein, the term "MHC Class II" or "Class II" refers to the human
Major
Histocompatibility Complex Class II proteins, binding peptides, or genes.
Within the MHC Class
II region are found the DP, DQ and DR subregions for Class II a chain and (3
chain genes (i.e.,
DPa, DP(3, DQa, DQ~3, DRa, and DR~3). As used herein, the term "MHC Class II
molecule"
means a covalently or non-covalently joined complex of an MHC Class II a chain
and an MHC
Class II (3 chain.
As used herein the term "MHC Class I a chain" means a naturally occurring
polypeptide,
or one encoded by an artificially mutated a gene, essentially corresponding to
at least the a~ and
a2 domains of one of the gene products of an MHC Class I a gene (e.g. HLA-A,
HLA-B or
HLA-C gene). As C-terminal transmembrane and cytoplasmic portions of the a
chain are not
CA 02321262 2000-08-18
r
WO 99/42597 PCT/US99/03603
- I7-
necessary for membrane binding in the present invention, they may be omitted
while retaining
biological activity. In addition, the term "MHC Class I a chain" is intended
to include variants
with and without the usual glycosylation of the a2 domain. The term is
particularly intended to
embrace all allelic variants of the Class I a genes, as well as any
equivalents, including those
which may be produced synthetically or recombinantly by, for example, site-
directed mutagenesis
of a naturally occurring variant. An MHC Class I a chain may also be referred
to herein as an
"I~~-iC Class I heavy chain."
As used herein the term "Class I (3 chain" or "p,-microglobulin" means a
naturally
occurring polypeptide, or one encoded by an artificially mutated ~3,-
microglobulin gene,
essentially corresponding to the gene product of a /3z-microglobulin gene. The
term is particularly
intended to embrace all allelic variants of [32-microglobulin, as well as any
equivalents, including
those which may be produced synthetically of recombinantly by, for example,
site-directed
mutagenesis of a naturally occurring variant. When the term "MHC j3 chain" is
used without
specifying whether the chain is Class I or Class II, the term is intended to
include (32-
microglobuiin as well as MHC Class II ~3 chains. A j3z-microglobulin or MHC
Class I (3 chain
may also be referred to herein as an "MHC Class I light chain."
As used herein, the term "MHC Class II a chain" means a naturally occurring
polypeptide,
or one encoded by an artificially mutated a gene, essentially corresponding to
at least the a, and
az extracellular domains of one of the gene products of an MHC Class II a gene
(e.g., a DP, DQ
or DR a gene). As the C-terminal transmembrane and cytoplasmic portions of the
a chain are not
necessary for antigenic peptide binding in the present invention, they may be
omitted while
retaining biological activity. In addition, the term "MHC Class II a chain" is
intended to include
variants with and without the usual glycosylation of the a, and a2 domains.
The term is
particularly intended to embrace all allelic variants of the Class II a genes,
as well as any
equivalents which may be produced synthetically or recombinantly by, for
example, site-directed
mutagenesis of a naturally occurring variant.
As used herein, the term "MHC Class II (3 chain" means a naturally occurring
polypeptide,
or one encoded by an artificially mutated (3 gene, essentially corresponding
to at least the /3~ and
p~ extracellular domain of one of the gene products of an MHC Class II (3 gene
(e.g., DP, DQ or
DR (3 gene). As the C-terminal transmembrane and cytoplasmic portions of the
(3 chain are not
CA 02321262 2000-08-18
WO 99/42597 PCTNS99/036o-3
-18-
necessary for antigenic peptide binding in the present invention, they may be
omitted while
retaining biological activity. In addition, the term "MHC Class II ~3 chain"
is intended to include
variants with and without the usual glycosylation of the Ji, domain. The term
is particularly
intended to embrace all allelic variants of the Class II j3 genes, as well as
any equivalents which
may be produced synthetically or recombinantly by, for example, site-directed
mutagenesis of a
naturally occurring variant.
As used herein the term "MHC binding domain" means an MHC Class I binding
domain
and/or an MHC Class II binding domain.
As used herein the term "MHC Class I binding domain" refers to the region of
an MHC
Class I molecule which is necessary for binding an antigenic peptide. An MHC
Class I binding
domain is formed primarily by the a, and a2 domains of the MHC Class I a
chain. Although the
a~ domain of the a chain and ~i2-microglobulin are not essential parts of the
binding domain, they
are believed to be important in stabilizing the over-all structure of the MHC
Class I molecule and,
therefore, an MHC Class I binding domain of the present invention preferably
includes these
regions. An MHC Class I binding domain may also be essentially defined as the
extracellular
domain of an MHC Class I molecule, distinguishing it from the transmembrane
and cytoplasmic
domains, although it is likely that some portion of the extracellular domain
may be omitted while
retaining biological activity.
As used herein, the term "MI-IC Class II binding domain" refers to the region
of an MHC
Class II molecule which is necessary for binding an antigenic peptide. An MHC
Class II binding
domain is formed primarily by the a, and Vii, domains of the MHC CIass II a
and (3 chains and,
therefore, an MFiC Class II binding domain minimally includes these regions.
The az and (32
domains of these proteins, however, are also believed to be important to
stabilizing the over-all
structure of the MHC binding cleft and, therefore, an MHC Class II binding
domain of the present
invention preferably includes these regions. An MHC Class II binding domain
may also be
essentially defined as the extracellular domain of an MHC Class II molecule,
distinguishing it from
the transmembrane and cytoplasmic domains, although it is likely that some
portion of the
extracellular domain may be omitted while retaining biological activity.
As used herein the term "MHC binding peptide" or "binding peptide" means an
MHC
CIass I binding peptide and/or an MHC Class II binding peptide.
CA 02321262 2000-08-18
WO 99/42597 PCTIUS99/0360'3
-19-
As used herein the term "MHC Class I binding peptide" means a polypeptide
which is
capable of selectively binding within the binding cleft formed by a specified
MHC Class I
molecule to form a Class I MHC/peptide complex. An MHC Class I binding peptide
may be a
processed self or non-self peptide or may be a synthetic peptide. For Class I
MHC/peptide
complexes, the binding peptides are typically 8-10 amino acid residues in
length, although longer
and shorter ones may be effective.
As used herein, the term "MHC Class II binding peptide" means a polypeptide
which is
capable of selectively binding within the binding cleft formed by the oc and
(3 chains of a specified
MHC Class II molecule to form a Class II MHC/peptide complex. An MHC Class II
binding
peptide may be a processed self or non-self peptide or may be a synthetic
peptide. For Class II
MHC/peptide complexes, the binding peptides are typically 10-25 amino acids in
len~~th, and more
typically I3-18 residues in lenv~th, although longer and shorter ones may be
effective.
As used herein, the term "MHC/peptide complex" means a covalently or non-
covalently
joined ternary complex of either (a) the binding domain of an MHC Class I
molecule and an MHC
I ~ Class I binding peptide which binds to that W-IC Class I binding domain or
(b) the binding
domain of an MHC Class II molecule and an WIC Class II binding peptide which
binds to that
MHC Class II binding domain.
As used herein, the term "multimeric Major Histocompatibility Complex binding
domain
conjugate" or "multimeric MHC binding domain conjugate" means a conjugate of a
multiplicity of
MHC binding domains directly or indirectly joined, bound (covalently or
noncovalently), attached,
adsorbed, or otherwise conjugated to a carrier. The MHC binding domains may
be, but need not
be, part of the monovalent or multivalent MHC fusion proteins of the
invention.
As used herein, the term "carrier" means a molecule, particle, composition, or
other
microscopic object to which may be conjugated, directly or indirectly, a
multiplicity of MHC
2s binding domains, so as to form a multimeric MHC binding domain conjugate.
The MHC binding
domains may be, but need not be, part of the monovalent or multivalent MHC
fusion proteins of
the invention.
As used herein, the term "dendrimer" refers to a branched polymer in which a
multiplicity
of core polymer branches extend outwards from a core or initiator molecule,
each branch forming
additional sub-branches as it extends further outward, thereby forming a
structure in which the
CA 02321262 2000-08-18
. x~
WO 99142597 PCT/US99l03603
-20-
number of terminal branches exceeds the number of core polymer branches by at
least a factor of
two.
As used herein, the term "liposome" refers to an aqueous compartment enclosed
by at
least one bilayer of amphipathic molecules (e.g., phospholipids). The term
liposome, as used
herein, is intended to embrace unilamellar and multilamellar liposomes.
As used herein, the term "porous" means, with respect to a carrier, that there
are a
multiplicity of openings in the surface of the carrier which are in fluid
communication with each
other, and which define passages within said carrier of sufficient diameter to
permit diffusion of
low molecular weight compounds (e.g., less than 5 kDa) therethrough, but are
of insufficient
diameter to permit unimpeded movement of higher molecular weight compounds
therethrough.
As used herein, the term "flexible molecular linker" or "linker" means a
chemical moiety
having a length equal to or greater than that of three carbon to carbon bonds
and including at least
one freely rotating bond along said length. Preferably, a flexible molecular
linker is comprised of
one or more amino acid residues but this need not be the case. In certain
preferred embodiments,
the flexible molecular linkers of the invention comprise at least three and,
more preferably, at least
seven amino acid residues.
As used herein the term "conjugating moiety" refers to a chemical moiety which
directly
or indirectly joins, binds (covalently or noncovalently), attaches, adsorbs,
or otherwise conjugates
an MHC binding domain, or a fusion protein comprising an MHC binding domain,
and a carrier.
As used herein, the term "selectively binding" means capable of binding in the
electro- and
stereospecific manner of an antibody to antigen or ligand to receptor. With
respect to an MHC
binding peptide, selective binding entails the non-covalent binding of
specific side chains of the
peptide within the binding pockets present in the MHC binding domain in order
to form an
MHC/peptide complex (see, e.g., Brown et al., 1993; Stern et al., 1994).
As used herein, the term "substantially pure" means, with respect to the MHC
binding
peptides and various MHC binding domain fusion proteins of the invention, that
these peptides or
proteins are essentially free of other substances to an extent practical and
appropriate for their
intended use. In particular, the peptides and proteins are sufficiently pure
and are sufficiently free
from other biological constituents of their hosts cells so as to be useful in,
for example, generating
antibodies or producing pharmaceutical preparations. A substantially pure
preparation of the
peptides or proteins of the invention need not be absolutely free of all other
proteins or cell
CA 02321262 2000-08-18
WO 99142597 PCT/US99/0360-3
-21 -
components and, for purposes of administration, may be relatively dilute. One
of ordinary skill in
the art may produce such substantially pure preparations by application or
serial application of
well-known methods including, but not limited to, HPLC, affinity
chromatography or
electrophoretic separation. The substantially pure preparations of the
invention may also
comprise other active ingredients and, therefore, the percentage by weight of
the MHC binding
peptides and/or various MHC binding domain fusion proteins of the invention
may be reduced in
such a preparation.
As used herein, the term "particulate" describes a structure which extends in
three
dimensions and defines a minimal surface area and a minimal volume, and which
includes at least
one surface capable of being conjugated to a multiplicity of MHC binding
domains in a
substantially two dimensional array. The term "particulate" is intended to
embrace carriers which
are generally spherical, ellipsoidal, rod-shaped, globular, or polyhedral.
As used herein, the term "minimal surface" means, with respect to a carrier,
the surface
area of the smallest continuous surface which defines a volume which may
contain the carrier. As
used herein, the term "minimal volume" means the volume contained within a
minimal surface.
II. Preferred Embodiments
A. Monovalent and Multivalent MHC Binding Domain Fusion Proteins
In one aspect, the present invention depends, in part, upon the discovery that
fusion
proteins, comprising M~-IC Class II binding domains and coiled-coil and/or
immunoglobulin
constant domains, may be recombinantly produced, and that these fusion
proteins may form
heterodimers which include biologically functional W-IC Class II binding
domains in monovalent
or multivalent fusion proteins. In particular, it is disclosed that (1)
heterodimeric MHC Class II
binding domains, including those of certain MHC Class II molecules which
previously could not
be produced as empty, soluble, stable heterodimers, may be produced using
fusion proteins
2~ incorporating dimerization domains, and (2) heterodimeric MHC Class II
binding domains, with
or without dimerization domains, may be produced in the form of multivalent
fusion protein
constructs by incorporating them as fusions in multivalent immunoglobulin or
ligand/anti-ligand
structures. Of particular importance, is the surprising result that the MHC
Class II binding
domains of these fusion proteins retain their biological activity despite the
functional requirement
for highly specific tertiary and quaternary structural interactions within and
between the oc and (3
chains of the MHC molecule, and despite the substitution of relatively large,
relatively hydrophilic
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-22-
fusion domains for the natural, hydrophobic transmembrane domains of the MHC
Class II
proteins.
Thus, in a first series of embodiments, the present invention provides for the
production of
fusion proteins of MHC Class II a and p chain proteins in which substantially
all of the C-terminal
transmembrane and c~~toplasmic domains have been replaced by coiled-coil
dimerization domains
and, optionally, interposing linker sequences. Figure 1 schematically
illustrates such a monovalent
MHC Class II binding domain fusion protein. At least the peptide binding
domain, and preferably
the entire extracellular domain, of an MHC Class II a chain 10 may be fused to
a first
dimerization domain 30 (e.g., a leucine zipper domain or an immunoglobulin Fab
constant
domain}. Similarly, at least the peptide binding domain, and preferably the
entire extracellular
domain, of an MHC Class II ~i chain 20 may be fused to a second dimerization
domain 40 (e.g., a
leucine zipper domain or an immunoglobulin Fab constant domain). The
dimerization domains
(30 and 40) associate in solution to promote formation of a heterodimeric
fusion protein in which
the MHC Class II a and /3 chain components (10 and 20) stably associate to
form a biologically
active MHC Class II binding domain which is capable of binding, or being
"loaded" with, an MHC
binding peptide 110 so as to form a stable W-IC/peptide complex which can
selectively bind to
cognate T cell receptors and/or selectively activate T cell clones bearing
cognate TCRs.
Optionally, flexible molecular linkers may be interposed between the MHC
components (10 and
20) and dimerization domains (30 and 40) so as to better approximate the
normal distance
between the MHC components and their natural MHC transmembrane domains, and/or
to provide
for free rotation between the MHC components and the dimerization domains such
that the
geometry of the association between dimerization domains does not constrain or
interfere with the
geometry of association of the MHC binding domains.
In another series of embodiments, the present invention provides for the
production of
divalent fusion proteins of MHC Class II a and (3 chain proteins in which
substantially all of the
C-terminal transmembrane and cytoplasmic domains have been replaced by
immunoglobulin
constant chain domains and, optionally, interposing linker sequences and/or
coiled-coil
dimerization domains. The immunoglobulin constant domains are chosen so as to
promote the
formation of divalent antibody-like molecules bearing two MHC Class II binding
domains and,
optionally, to promote certain effector functions (e.g., complement
activation, cell binding).
Figure 2 schematically illustrates such a divalent MHC Class II binding domain
fusion protein. At
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
- 23 -
least the peptide binding domain, and preferably the entire extracellular
domain, of an MHC CIass
II a chain 10 may be fused to a first dimerization domain 30 (e.g., a leucine
zipper domain or an
immunoglobulin Fab constant domain). Similarly, at least the peptide binding
domain, and
preferably the entire extracellular domain, of an MHC Class II /3 chain 20 may
be fused to a
second dimerization domain 40 (e.g., a leucine zipper domain or an
immunoglobulin Fab constant
domain). The dimerization domains (30 and 40) associate in solution to promote
formation of a
heterodimeric fusion protein in which the MHC Class II a and ~i components (10
and 20) stably
associate to form a biologically active MHC Class II binding domain which is
capable of binding,
or being "loaded" with, an MHC binding peptide 110 so as to form a stable
I~iHC/peptide
complex which can selectively bind to cognate T cell receptors and/or
selectively activate T cell
clones bearing cognate TCRs. As noted above, however, some MHC Class II
molecules (e.g.,
HLA-DRI, HLA-DR4) can be expressed by the method of Stern and Wiley (1992) as
stable,
soluble heterodimers without their transmembrane and cytoplasmic domains. For
such molecules,
coiled-coil dimerization domains are not necessary to the formation of
heterodimeric MHC
binding domains and, therefore, may be omitted entirely from these embodiments
or may be
replaced by Fab constant domains (i.e., heavy chain Ct~1 domains or light
chain CL domains).
Next, one of the two MHC fusion proteins further comprises an immunoglobulin
Fc region 60,
with or without an interposing immunoglobulin hinge region 50 appropriate to
the Fc region (IgA,
IgD and IgG molecules include hinge regions; IgE and IgM molecules do not).
Preferably, it is
the MHC Class II a chain fusion protein which is fused to the immunoglobulin
heavy chain Fc
region because the MHC Class II a chains are less variable than the (3 chains
and, therefore, such
an a chain fusion protein can be used with a number of different MHC Class II
(3 chain fusion
proteins to form a variety of different divalent molecules with different HLA
specificity. It
should, however, be noted that there is no reason that the (3 chain construct
can not include the
immunoglobulin Fc regions. Finally, flexible molecular linkers may be
optionally interposed
between the MHC components (10 and 20), dimerization domains (30 and 40),
and/or
immunoglobulin components (50 and/or 60) so as to better approximate the
normal distance
between the MHC components and their natural MHC transmembrane domains, and/or
to provide
for free rotation between the MHC components, the dimerization domains, and/or
the
immunoglobulin domains such that the geometry of the association between any
pair of dimerizing
components does not constrain or interfere with the geometry of association or
dimerization of
CA 02321262 2000-08-18
WO 99142597 PCT/US99103603
-24-
the others. As shown in Figure 2, the immunoglobulin heavy chain Fc regions GO
and 60' of two
such MHC Class II fusion proteins associate and form a divalent structure,
with one or more
disulfide linkages between chains, analogous to the stmcture of natural
antibodies.
In another series of embodiments, the present invention provides for the
production of
decavalent fusion proteins of MHC Class II a, and ~ chain proteins in which
substantially all of the
C-terminal transmembrane and cytoplasmic domains have been replaced by IgM
immunoglobulin
constant chain domains and, optionally, interposing linker sequences and/or
coiled-coil
dimerization domains. These embodiments are essentially the same as those
described
immediately above except that (1) the immunoglobulin constant domains are
specifically chosen to
be IgM chains, which form divalent subunits which are then assembled into
decavalent pentamers,
and {2) that the cells producing these MHC-IgM fusions are cotransfected with
a J-chain gene in
order to facilitate the assembly and secretion of IBM molecules (Matsuuchi et
al., 1986). Figure 3
schematically illustrates such a decavalent MHC Class II fiction protein. As
before, at least the
peptide binding domains, and preferably the entire extracellular domains, of
MHC Class II a 10
and ~3 20 chains may be fused to dimerization domains 30 and 40 (e.g., a
leucine zipper domain or
an immunoglobulin Fab constant domain). The dimerization domains (30 and 40)
associate in
solution to promote formation of a heterodimeric fusion protein in which the
MHC Class II a and
JJ components (10 and 20) stably associate to form a biologically active MHC
Class II binding
domain which is capable of binding, or being "loaded" with, an MHC binding
peptide 110. Again,
as noted above, some MHC Class II molecules (e.g., HLA-DR1, HLA-DR4) can be
expressed by
the method of Stern and Wiley ( 1992) as stable, soluble heterodimers without
their
transmembrane and cytoplasmic domains and, therefore, for such molecules,
coiled-coil
dimerization domains may be omitted entirely or may be replaced by Fab
constant domains (i.e.,
heavy chain CHl domains or light chain CL domains). Next, as above, either the
a, or (3 chain
construct further comprises an immunoglobulin Fc region GO which, in these
embodiments, is an
IgM Fc region (CH2, CH3, CH4). Finally, as before, flexible molecular linkers
may be optionally
interposed between the MHC components (10 and 20), dimerization domains (30
and 40), and/or
IgM Fc components (GO) so as to better approximate the normal distance between
the MHC
components and their natural MHC transmembrane domains, and/or to provide for
free rotation
between the MHC components, the dimerization domains, and/or the
immunoglobulin domains.
As shown in Figure 3, the immunoglobulin heavy chain Fc regions 60 and 60' of
two such MHC-
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-25-
IgM fusion proteins are associated to form a divalent structure with one or
more disulfide
linkages between chains. These divalent subunits, however, will further
associate to form a
multimer with one or more disulfide bonds 90 between divalent subunits. In the
presence of the J-
chain protein 100, IgM subunits are assembled into decavalent pentamers as
shown in Figure 3,
analogous to naturally occurring IgM pentamers.
In another series of embodiments, the present invention provides for the
production of
tetravalent fusion proteins of MHC Class II a and (3 chain binding domains in
which substantially
all of the C-terminal transmembrane and cytoplasmic domains have been replaced
by dimerization
domains and, optionally, interposing linker sequences, and in which a C-
terminal ligand "tag"
sequence allows a multiplicity ofMHC-tag fusions to bind to an anti-ligand and
form a
multivalent MHC binding domain fusion protein complex. The ligand tag sequence
may be any
sequence for which an anti-Iigand is available, or any sequence which
facilitates the addition of a
ligand to the tag. For example, the tag sequence may be a poly-His sequence,
which may serve as
a ligand for a Ni'-bearing anti-ligand. Alternatively, the tag sequence may be
the epitope of an
antibody, and the anti-ligand may be that antibody. In a preferred embodiment,
the tag is a
recognition sequence which may be biotinylated by biotin lipase, and the anti-
ligand may be avidin
or streptavidin. Figure 4 schematically illustrates a tetravalent MHC binding
domain fusion
protein complex in which a biotinylated tag serves as the li~~and, and avidin
or streptavidin serves
as the anti-ligand. As in previous embodiments, at Least the peptide binding
domain, and
preferably the entire extracellular domain, of n~-IC Class II a chains 10 and
a chains 20 may be
fused to dimerization domains (30 and 40) (e. j., a leucine zipper domain or
an immunoglobulin
Fab constant domain). The dimerization domains (30 and 40) associate in
solution to promote
formation of a heterodimeric fusion protein in which the MHC Class II a and ~3
components (10
and 20) stably associate to form a biologically active MHC Class II binding
domain which is
capable of binding, or being "loaded" with, an MHC binding peptide 110. In
addition, a biotin
ligase recognition sequence or "tag" is fused to the C-terminus of at least
one of the MHC binding
domain fusion chains. This sequence tag may be biotinyIated by enzymes within
the cells which
produce these MHC binding domain fusion proteins, or may be subsequently
biotinylated in vitro.
The biotinylated tag 70 can be used to cause the monovalent MHC binding domain
fusion
proteins to bind to avidin (or streptavidin) 80. As each avidin (or
streptavidin) molecule is
capable of binding up to four biotin moieties, an MHC-biotin/(strept)avidin
fusion protein
CA 02321262 2000-08-18
,
WO 99142597
PCTIUS99/03603
-26-
complex can be produced which is tetravalent (with lower valencies at lower
molar ratios of
biotin:(strept)avidin). As before, flexible molecular linkers may optionally
be interposed between
the MHC components (10 and 20), the dimerization domains (30 and 40) and/or
the biotin
sequence tag so as to better approximate the normal distance between the MHC
components and
their natural MHC transmembrane domains, and/or to provide for free rotation
between the MHC
components, the dimerization domains, and/or biotinylated tag. As will be
apparent to one of
ordinary skill in the art, a great variety of other ligand tags and anti-
ligands may be employed
instead of biotin/(strept)avidin to produce similar multivalent MHC binding
domain fusion protein
complexes.
In each of the foregoing embodiments, the MHC binding peptide 110 may be
covalently
joined to either the MHC Class II a or j3 components (10 and 20) with a
flexible molecular linker
(not shown in the Figures). Preferably, such flexible molecular linkers are
polypeptide sequences
of 10-20 amino acid residues, more preferably I2-18 amino acid residues. When
the flexible
molecular linkers are polypeptides, the MHC binding peptide, linker and MHC
Class II a or ~i
1~ components may all be expressed as a single fusion protein, further
comprising dimerization
domains toward the C-terminus.
In connection with each of the above-described embodiments, the present
invention
provides (a) isolated nucleic acid sequences encoding such fusion proteins;
(b) vectors for
transiently or stably transfecting host cells with these nucleic acids; (c)
host cells transformed with
these sequences or vectors; (d) methods for producing the fusion proteins
employing these
sequences, vectors and host cells; and (e) the substantially purified fusion
proteins themselves. In
addition, the present invention provides for a number of utilities for these
products and processes
including, but not limited to, the treatment of allergic and autoimmune
diseases, the detection
and/or isolation of T cells with defined MHC/peptide specificities, and the
selective activation,
anergization, or killing of T cells with defined MHC/peptide specificities.
1. Choice of MHC Com onents for Monovalent and Multivalent MHC Fusion Proteins
The methods and products of the present invention may be practiced with any
mammalian
MHC Class II proteins. Primarily, however, it is anticipated that the present
invention will have
greatest utility in the diagnosis and treatment of human disease and,
therefore, the MHC Class II
proteins are preferably human HLA Class II proteins. Thus, for example, the
present invention
may be practiced with either of the known HLA-DRA alleles (DRA*0101 and
DRA*0102), any
CA 02321262 2000-0.8-18
WO 99142597 PCT/US99103603
-27-
of the approximately 160 known HLA-DRB alleles (including at least 137 known
HLA-DRB 1
alleles), any of the approximately 1 S known HLA-DQA1 alleles, any of the
approximately 25
known HLA-DQB 1 alleles, any of the approximately 8 known HLA-DPA1 alleles, or
any of the
approximately 65 known HLA-DPB 1 alleles. A compilation of known human HLA
Class II
nucleotide sequences has been published by Marsh and Bodmer (1995), and a
compilation of
known HLA Class II nucleotide and amino acid sequences is available via
electronic transfer from
the EMBL Data Library, Cambridge, IIK (request "HELP HLA" by e-mail to
"netserv@ebi.ac.uk"). All of these sequences are not, therefore, reproduced
herein. In addition,
all sequence nomenclature used herein conforms to that used in Marsh and
Bodmer ( 1995), and in
Bodmer et al. (1995).
Embodiments employing coiled-coil dimerization domains are particularly
preferred for
use with those MHC Class II binding domains which, without their transmembrane
and
cytoplasmic domains, do not form stable heterodimers in solution. For these
proteins, the coiled-
coil domains add stability to the heterodimer while allowing for the
production of soluble, non-
aggregated proteins. Amongst these are the HLA-DR2 serotypes (e.g., those
encoded by DRA
and DRB 1 * 15 or DRB 1 * 16 alleles), HLA-DQ8 (encoded by, for example, the
DQA1 *0301 and
DQB 1 *0302 alleles), and HLA-DQ2 (encoded by, for example, DQA 1 *0501 and
DQB 1 *0201
alIeies). Nonetheless, coiled-coil dimerization domains may be employed with
any of the human
MHC Class II binding domains, including those which have previously been
successfully
expressed as stable, soluble heterodimers without their transmembrane domains
(e.g., DRl and
DR4).
2. Choice of MHC Class 1I Binding Domain Splice Points
In accordance with the present invention, splice points for the MHC components
of the
MHC Class II binding domain fusion proteins must be chosen so as to include
sufficient N-
terminal sequence for proper formation of an MHC binding domain while
excluding most if not all
of the C-terminal transmembrane and cytoplasmic domains of the MHC chains. As
is well known
in the art, the MHC Class II a and ~i chains are each characterized by two N-
terminal, globular,
extracellular domains (al and a2, or (31 and (32), followed by a short loop or
connecting peptide,
a hydrophobic transmembrane domain, and a C-terminal hydrophilic cytoplasmic
domain. The
binding cleft of the MHC Class II molecules is formed primarily by the
interaction of the al and
(31 domains in the heterodimer and, therefore, these domains must minimally be
included in the
CA 02321262 2000-08-18
WO 99/42597 PC7"/US99103603
-28-
fusion proteins of the present invention. The a2 and p2 damains, however, are
also preferably
included because they may aid in stabilizing the MHC binding domain, are
believed to be involved
in the formation of dimers of the MHC chains, and are believed to be involved
in CD4 receptor
binding.
Thus, in preferred embodiments, the splice points for the MHC Class II fusion
peptides
are chosen to be in the regions approximately between the ends of the a2 or
(32 domains and the
beginnings of the transmembrane domains. For most MHC Class II a chains, this
corresponds to
approximately amino acid residue positions 180-200, and for most (i chains
this corresponds to
approximately amino acid residue positions I 85-205. For example, for the HLA-
DR a chains
encoded by the DRA alleles (DRA*OI01 or DRA*0102), the transmembrane domains
essentially
begin after the Glu residue at position 19l or the Asn residue at position
192. For the HLA-DR (3
chains encoded by the DRI subtype DRB 1 *01 (e.g., DRB 1 *0I OI ) alleles and
the DR2 subtype
DRB 1 * 15 and DRB I * 16 alleles (e.g., DRB 1 * 1501 ), the transmembrane
domains essentially begin
after the Lys residue at position 198 or the Met residue at position 199.
Similarly, for the DQ2
and DQ8 subtypes, the HLA-DQA1 transmembrane domains essentially begin after
the Glu
residue at position 195 or the Thr residue at position 196, and the HLA-DQB 1
transmembrane
domains essentially begin after the Lys residue at position 200 or the Met
residue at position 201.
For some allelic variants, of course, there may be amino acid insertions or
deletions prior to these
sites which alter the residue numbering. The connecting peptide and
transmembrane regions of
the MHC Class II a and (3 chains are not, however, highly polymorphic and,
indeed, appear
invariant for all known DRA and DRB alleles (see Marsh and Bodmer, 1995).
Therefore,
working with any given MHC Class II a and (3 chains, one of ordinary skill in
the art can easily
identify the transmembrane domains both by homology to the above-described
alleles, and by their
essential hydrophobic nature.
Although not preferred, it is. acceptable that the fusion proteins of the
present invention
include several residues from the transmembrane domain or that several
residues of the a2 or j32
domains be omitted. For example, the inclusion of 1-5 residues of the
transmembrane domain
may be included in the present invention and still yield a soluble fusion
protein, but this is not
preferred. Similarly, the omission of, for example, I-5 residues from the az
or (32 domains may
not result in structural alterations which disrupt MHC peptide binding,
heterodimer formation, or
T cell interactions. Indeed, if replaced by suitable residues which conserve
the over-all structure
CA 02321262 2000-0.8-18
r
WO 99/42597 PC'f/US99/03b0'3
-29-
of the MHC molecule, larger portions of the a2 and ~i2 structural domains may
be omitted in
accordance with the present invention (e.g., replacing portions of the Class
II a2 or (3z domains
with equivalent portions of the Class I a3 or /3z-microglobuiin proteins).
Thus, recognizing that
one may also include or omit all or part of the 5-7 amino acid loop or
connecting peptide which
naturally joins the a2 and øz domains to their respective transmembrane
domains, one may
produce fusion proteins in which the splice point is anywhere from
approximately residues 180-
200 of the a chain and approximately residues 185-205 of the (3 chain, with
larger C-terminal
omissions tolerated if appropriate replacement sequences are provided.
Finally, 1-5 residues may
be omitted or substituted at the N-terminus of an MHC Class II a or (3 chain
binding domain,
although this is not recommended.
In preferred embodiments, however, the splice points are chosen to be within
the loop or
connecting peptide sequence near the N-terminal end of the transmembrane
domain. In the most
preferred embodiments, the entire extracellular domains of the MHC Class II a
and ~i chains are
included in the MHC fusion proteins of the invention.
IS 3. I~gIC Class II Binding Peptide Fusions
In connection with any of the foregoing embodiments, one may also create a
fusion
protein in which an MHC binding peptide is covalently joined to the N-terminus
of either the a or
(3 chain such that the binding peptide is capable of selectively binding
within the binding domain
formed by the given MHC Class II a and (3 chains. Preferably, the MHC binding
peptide is joined
to the N-terminus of the ~i chain because, when the a and p chains associate
to form a
heterodimeric MHC molecule, the N-terminus of the (3 chain is more accessible
than the N-
terminus of the a chain. In addition, the j3 chains of MHC Class II molecules
are more
polymorphic than the a chains and, therefore, the specificity of an MHC
binding domain is more
dependent upon which (i chain is included in the molecule.
The MHC binding peptide is preferably linked to the MHC binding domain using a
flexible
molecular linker, as described below. In preferred embodiments, the flexible
molecular linker is a
polypeptide sequence of approximately 10-20 amino acid residues, more
preferably 12-18 amino
acid residues, which joins the binding peptide and MHC binding domains by
standard polypeptide
linkages to form a larger fusion protein which may be encoded by a single
nucleic acid construct
and expressed as a single fusion protein. In addition, it is preferred that
the amino acids be chosen
CA 02321262 2000-08-18
WO 99142597 PC'fIUS99/03603
-30-
from the relatively small residues (e.g., alanine, glycine, serine, leucine,
isoleucine, valine) in order
to minimize the potential for steric hindrance.
As noted above, the MHC binding peptide is chosen such that it is capable of
selectively
binding to the MHiC molecule to which it is attached. Thousands of
combinations of MHC
S binding peptides and 1V»IC molecules are known in the art and can be
identified by standard
methods (see, e.g., Chicz et al., 1993). Of particular interest are those
pairs of MHC binding
peptides and MHC molecules which are implicated in diseases, including
infections and
autoimmune diseases. For example, specific MHC binding peptides derived from
the human
myelin basic protein (e.g., residues 8S-99, 84-102 and 148-162) and particular
MHC alleles (e.g.,
HLA-DR2 or DRA~DRB 1 * 1501 ) have been implicated in the development of
multiple sclerosis.
Therefore, in one preferred embodiment, monovalent or multivalent MHC Class II
binding
domain fusion proteins are produced in which an immunogenic myelin basic
protein (MBP)
peptide is covalently joined by a polypeptide linker sequence to the N-
terminus of the peptide
binding domain of an HLA-DRB 1 * 1 S01 protein, and this fusion is covalently
joined, with or
IS without an interposing flexible molecular linker, to a dimerization domain.
Such a fusion protein
may then be dimerized with a corresponding HLA-DRA a chain fusion protein such
that the MBP
peptide binds in the cleft formed by association of the MHC Class II a and ~
chain binding
domains. Similarly, certain residues of the human desmoglein 3 protein (e.g.,
residues 78-93,
97-111, 190-204, 206-220, 2S I-265, S 12-S26 and 762-786) and certain MHC
alleles (e.g., HLA-
DR4 or DRA~DRB 1 *0402, and HLA-DQ1 or DQA/DQB 1 *OS032) have been implicated
in the
development of pemphigus vulgaris (see, e.g., WO 96/27387). For other
autoimmune diseases,
including rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE),
immunodominant
self peptides may be identified which selectively bind to particular MHC Class
II molecules. For
each of these, monovalent or multivalent MHC Class II binding domain fusion
proteins may be
2S produced, having the autoimmunogenic MHC binding peptides covalentiy joined
to the MFIC
binding domains, and these may be used, as further described below, in
identifying, sorting,
selecting or targeting autoreactive T cells, or in tolerizing or anergizing
the immune response to
the autoantigens.
4. Choice of Linker Domains
In accordance with the present invention, MHC binding domain fusion proteins
may be
produced which optionally include flexible molecular linkers which covalently
join, as described
CA 02321262 2000-08-18
t.
WO 99/42597 PCTIUS99/03603
-31 -
above, ( 1 ) MHC binding domains to dimerization domains; (2) dimerization
domains to
immunoglobulin Fc domains or ligand tag domains; or (3) IViI-IC binding
peptides to MHC
binding domains. Appropriate linkers include, but are not limited to, short
polypeptide chains
which can be encoded with the MHC domains, dimerization domains,
immunoglobulin domains,
and/or tag domains in recombinant DNA constructs. More generally, however,
appropriate
linkers include any relatively small (e.g., < 2 kDa, preferably < 1 kDa)
organic chemical moieties
which are flexible because they include at least one single bond located
between their termini and
about which there is free rotation. Thus, for example, bifunctional molecules
(e.g., an a,w-
dicarboxylic acid or an a,~-diamine) of a lower alkyl chain may be employed,
and such flexible
molecular linkers may be reacted with the C-termini of the MHC components and
the N-termini
of the coiled-coil, immunoglobulin or ligand tag components (or with reactive
groups of the
amino acid side chains of any of these). Many other cross-linking agents, of
course, are well
known in the art and may be employed as substantial equivalents.
Preferably, however, the flexible molecular linkers of the present invention
comprise a
series of amino acid residues which can be encoded in a fusion gene construct.
For example, a
linker of 1-15 generally small amino acid residues (e.g., alanine, glycine,
serine, leucine,
isoleucine, valine), optionally including one or more hydrophilic residues
(e.g., aspartate,
glutamate, lysine), may be employed as a linker. For linkers between MHC
binding domains and
dimerization domains, the length of the linker may be chosen so as to
maintain, approximately, the
spacing naturally found between the MHC binding domains and the transmembrane
domains of
the MHC proteins and, therefore, the length of the linker may depend upon
whether some or all of
the naturally occurring loop or connecting residues between the binding
domains and
transmembrane domains have been included or omitted. In addition, as will be
apparent to one of
skill in the art, linker sequences may be particularly chosen so as to
introduce specific proteinase
cleavage sites in the fusion protein or, for ease of recombinant DNA
manipulations, to introduce
specific restriction endonuclease sites into the recombinant construct. Thus,
for example, one
may include the naturally occurring S-7 amino acid loop or connecting peptides
of an MHC
molecule and also include a 5-7 amino acid linker. Alternatively, the included
portion of the loop
or connecting peptide may be varied, the linker length may be varied, or the
loop peptide and/or
linker may be omitted entirely. Using standard techniques of site-directed
mutagenesis, or
restriction and ligation of recombinant constructs with a variety of different
endonucleases, one of
CA 02321262 2000-08-18
yj
WO 99!42597 PC'T/US99l03603
-32-
ordinary skill in the art can easily produce many variations on the fusion
protein constructs and, as
described below, rapidly test them for cognate TCR binding and/or T cell
activation. Thus,
although some presently preferred embodiments employ the entire extracellular
domains of the
MHC molecules joined by particular linkers to dimerization, immunoglobulin or
ligand tag .
domains, the invention is not limited to such embodiments.
5. Choice of Dimerization Domains
Coiled-coils are common structural features of dimeric proteins in which two a-
helical
polypeptides ("coils") are twisted ("coiled") about each other to form a
larger quaternary
structure or "coiled-coil" (see, e.g., I-Iu et al., 1990; Oas and Endow,
1994). Indeed, the
transmembrane regions of HLA-DR a and ~3 chains are thought to be a helices
that assemble as a
coiled-coil within the hydrophobic environment of the cell membrane (Cosson
and Bonifacino,
1992). Other coiled-coils, however, are hydrophilic and may be found in
secreted, cytosolic and
nuclear proteins. For example, "leucine zippers" are coiled-coil domains which
are present in a
large number of DNA binding proteins and which may mediate either homodimer or
heterodimer
formation (see, e.g., Ferre-D'Amare et al., 1993; O'Shea et al, 1989; O'Shea
et al., 1991). In
addition, several researchers have now designed artificial coiled-coil
domains, including pairs of
basic and acidic amphipathic helices and artificial leucine zippers, which
have been expressed and
assembled in recombinant homodimeric and heterodimeric proteins (see, e.g.,
Pack and
Pluckthun, 1992; Chang et al., 1994).
In preferred embodiments of the present invention, the dimerization domains
are leucine
zipper domains. These leucine zippers are characterized by at least 4 and,
preferably, at least 5-7
leucine residues that are spaced periodically at approximately every seventh
residue (heptad
repeat), with each heptad repeat contributing two turns of the a-helix (3.5
residues/turn). The
leucine residues appear to have a special function in coiled-coil
dimerization, and form part of the
hydrophobic interface between the two a-helices in the coiled-coil. The 40
amino acid leucine
zipper domains of the proteins Fos and Jun are preferred examples of leucine
zipper dimerization _
domains. These domains each have five leucine residues spaced exactly every
seventh residue
with a number of hydrophilic residues in the intervening positions (the Fos
sequence includes
three additional Ieucines which do not fall in the heptad repeat pattern and
which, therefore, are
assumed not to contribute to heterodimer formation). Modifications of these
domains, or even
completely artificial sequences, which maintain the over-all helical nature of
these sequences (e.g.,
CA 02321262 2000-08-18
WO 99142597 PCTIUS99/03603
- 33 -
which do not include proIine or hairpin turns), which preserve the over-all
hydrophilicity of the
helixes, and which preserve the approximate heptad repeat of leucine residues,
may also be
employed in accordance with the invention. (Note that the scHLX amphipathic
helix of Pack and
Pluckthun (199?) was tested in a recombinant HLA-DR2 fusion construct but did
not lead to
successful heterodimer formation.)
Finally, as noted above, some MHC Class II molecules (e.g., HLA-DR1, HLA-DR4)
have
been successfully produced as soluble, stable heterodimers without their
transmembrane domains
(see, e.g., Stern and Wiley, 1992). For such molecules, or for others which
assemble with
moderate stability, a coiled-coil dimerization domain may not be necessary.
Thus, in some
embodiments of the present invention, such domains may be omitted entirely or,
alternatively,
other domains which promote dimerization may be substituted. In particular, it
is contemplated
that the constant domains of the Fab fragments of immunoglobuIins (i.e., the
CIiI and CL
domains) may be employed as heterodimer-forming dimerization domains.
6. Choice of Immuno~lobulin Domains for MHC Bindin~ Domain Fusion Proteins
Human immuno~lobulins are divided into five broad classes (IgA, IgD, IgE, IgG
and IgM)
and any of these may be employed in the MHC-immunoglobulin constructs of the
present
invention. The basic structures of these molecules are extremely well
characterized disulfide-
linl:ed homodimers of heavy and light chain heterodimers. Thus, the basic
immunoglobulin unit
resembles the protein of Figure 2 in which a pair of heavy chains,
corresponding to elements 10,
30, 50 and G0, are disulfide linked to each other, and the N-terminal end of
each heavy chain is
associated with a light chain, corresponding to elements 20 and 40. The light
chain and the
portion of the heavy chain associated with it, corresponding to elements 10,
20, 30 and 40, are
referred to as the Fab fragment. The portions of the two heavy chains which
are closely
associated with each other, 60 and 60', are referred to as the Fc fragment. In
some classes of
immunoglobulins (i.e., IgA, IgD, and IgG), there is a hinge region 50 between
the Fab and Fc
fragments. Finally, within both the light and heavy immunoglobulin chains,
there are regions of
great variability and regions of great constancy. Thus, the immunoglobulin
light chains include a
variable domain VL, corresponding essentially to element 20 of Figure 2 (but
not to scale), and a
constant domain CL, corresponding essentially to element 40 (but not to
scale). Similarly, each
heavy chain includes an N-terminal variable domain VH, corresponding
essentially to element 10
CA 02321262 2000-08-18
,:
WO 99142597 PCT/US99/03603
-34-
(but not to scale), and three or four constant domains CH1 through CH4,
corresponding essentially
to elements 30, 50 and 60 (but not to scale). (See, generally, Kuby, 1994).
The immunoglobulin
constant domains, as their name implies, are relatively invariant in the human
population. On the
basis of differences in their constant regions, light chains are broadly
classified as either K or ~.
and, in humans, ~, chains are further divided into four subtypes. Similarly,
differences in the
constant regions of immunoglobulin heavy chains are the basis of the division
of these molecules
into five broad classes (a, 8, e, y and a chains in IgA, IgD, IgE, IgG and
IgM, respectively).
Based on minor differences in amino acid sequences in humans, the y chains
have been further
subdivided into four subclasses, and the a chains into two. The amino acid
sequences of these
various immunoglobulin light and heavy chain constant domains have long been
known in the art
(see, e.g., Kabat et al., 1979) and will not be reproduced here.
In some preferred embodiments, the MHC-immunoglobu(in fusion proteins of the
present
invention include the Fc regions of either IgG (subtypes 1, 2 or 3) or IgM
because these Fc
domains are capable of activating the classical complement pathway and,
therefore, are more
1S useful in some of the therapeutic methods described below. For utilities in
which complement
activation is not desired or is irrelevant, however, any of the immunoglobulin
isotypes may be
employed. In addition, as shown in Figure 3, the IgM isotypes are preferred in
some
embodiments because they can form pentamers of divalent MHC-IgM fusion
proteins.
7. Expression Systems for MHC Binding Domain Fusion Proteins
The MHC binding domain fusion proteins of the present invention may be
expressed in
any standard protein expression system which allows for proper folding and
secretion of the
desired molecules, or which allows for their recovery as properly folded
molecules from inclusion
bodies. As a general matter, eukaryotic expression systems are
preferred'because they are most
likely to produce a high yield of properly folded, glycosylated and disulfide-
linked molecules.
Mammalian cell lines, especially those which are well characterized for
protein expression (e.g.,
CHO cells, COS cells) or those which are known to secrete properly folded,
glycosylated and
disulfide linked immunoglobulins (e.g., any mAb producing cell line), may be
preferred for some
uses. Generally, however, these cell lines express too little protein for
therapeutic and commercial
applications. Therefore, other eukaryotic expression systems, such as the
Pichia pastoris yeast
system, described below, may be preferred. In addition, preliminary results
have shown high
levels of expression of an MHC binding domain fusion protein in a Drosophila
Schneider cell
CA 02321262 2000-08-18
f . ,....
WO 99/42597 PCTNS99/03603
-35-
system. It is well within the abilities and discretion of the skilled artisan,
without undue
experimentation, to choose an appropriate or favorite expression system.
Similarly, once a design (i.e., primary amino acid sequence) for the MHC
binding domain
fusion proteins of the present invention is chosen, one of ordinary skill in
the art can easily design
appropriate recombinant DNA constructs which will encode the desired proteins,
taking into
consideration such factors as codon biases in the chosen host, the need for
secretion signal
sequences in the host (e.g., an a-mating factor secretory signal for yeast
expression), the
introduction of proteinase cleavage sites within the signal sequence, and the
like. These
recombinant DNA constructs may be inserted in-frame into any of a number of
expression vectors
appropriate to the chosen host. The choice of an appropriate or favorite
expression vector is,
again, a matter well within the ability and discretion of the skilled
practitioner. Preferably, of
course, the expression vector will include a strong promoter to drive
expression of the
recombinant constructs and, optionally, a number of marker genes which will
simplify the
identification and/or selection of transformants.
1~ B. Multimeric MHC Binding Domain Conjugates
In another aspect, the present invention depends, in part, upon the discovery
that
multimeric MHC binding domain conjugates comprising a multiplicity of IvlhiC
binding domains
conjugated to a carrier may be produced, and that these multimeric conjugates
have far greater
avidity for their cognate TCRs, and far greater biological activity, than
monovalent MHC binding
domains, or even divalent or tetravalent MHC binding domain constructs.
Without being bound
to any particular theory of the invention, it is believed that a great
increase in avidity of T cell
binding and/or activation may be achieved by providing a multiplicity of MHC
binding domains on
a single carrier such that a substantially two-dimensional array of MHC
binding domains may
make contact with an area of a T cell membrane bearing a multiplicity of T
cell receptors.
Thus, in one series of embodiments, the present invention provides for the
production of
multimeric MHC binding domain conjugates in which about 5-500 MHC binding
domains,
preferably about 10-200 MHC binding domains, and more preferably about 20-100
MHC binding
domains, are conjugated to a single carrier. The carrier can be characterized
as defining a minimal
surface area and, preferably, the average density of the MHC binding domains
on that surface is
between about 4 x 10'3 to 20 MHC binding domains/nmZ; more preferably about 4
x 10-2 to 20
MHC binding domains/nm2, and most preferably about 0.4 to 20 MHC binding
domains/nm2.
CA 02321262 2000-08-18
WO 99/42597 PGTNS99/03603
-36-
Moreover, in preferred embodiments, the size and weight of the multimeric MHC
binding
conjugates are limited to aid in maintaining solubility, and to avoid possible
complications caused
by aggregation in vivo. Thus, it is preferred that the largest cross-sectional
diameters of the MHC
binding domain conjugates of the invention are less than about 1,000 nm,
preferably less than
about 500 nm, and more preferably less than about 100 nm. If perfectly
spherical, such
conjugates would define a minimal surface area of less than approximately 3 .1
x I 0~ nmz, 7.9 x
1 OS nm2, and 3.1 x I 04 nm2, respectively, and would define a minimal volume
of 5.2 x 1 Og nm3,
6.5 x 10' nm3, and 5.2 x 105 nm3. In the most preferred embodiments, as
described below, the
MHC binding domain conjugates have maximum diameters of about 5-40 nm. If
perfectly
spherical, such conjugates would define minimal surface areas of approxiamtely
78.5 to 5.0 x 103
nm2, and would define minimal volumes of 65.4 to 3.4 x 10° nm3. In
addition, it is preferred that
the overall weights of the MHC binding domain conjugates are less than about
10,000 lcDa,
preferably less than about 5,000 kDa, and more preferably less than about
1,000 I:Da. In the most
preferred embodiments, as described below, the MHC binding domain conjugates
have weights of
about 200-500 I:Da.
Figure 5 schematically illustrates one embodiment of a multimeric MI-IC
binding domain
conjugate comprising a multiplicity of MHC binding domains conjugated to a
carrier. Thus, the
conjugate comprises at least the binding domains, and preferably the entire
extraceIlular domains,
of a multiplicity of MHC a chains 10 which are stably associated with at least
the binding
domains, and preferably the entire extracellular domains, of MHC (3 chains 20
to form biologically
active MHC binding domains which are capable of binding, or being "loaded"
with, MHC binding
peptides 110. In this figure, the MHC a chain 10 is shown as being conjugated
to a carrier 300
by a conjugating moiety 200. Alternatively, however, the h~-iC (3 chain 20 may
be conjugated to
the carrier 300 by a conjugating moiety 200. In other embodiments, the
conjugating moiety 200
may be omitted and one of the MHC chains (10 or 20) may be directly conjugated
to the carrier
300. The MHC binding domains are conjugated to the carrier in an orientation
which allows
interaction of the MHC/peptide complexes with the TCRs on cognate T cells. As
shown in
Figure 5, the carrier 300 is depicted as a substantially spherical particle,
but this need not be the
case.
Figure 6 schematically illustrates another embodiment of a multimeric MHC
binding
domain conjugate of the invention. In this figure, the conjugate comprises a
multiplicity of MHC
CA 02321262 2000-08-18
WO 99/42597 PGTIUS99/03603
-37-
binding domain fusion proteins, such as those described above. Thus, in this
embodiment, at least
the peptide binding domains of a multiplicity of MHC a chains 10 have been
joined to first
dimerization domains 30, at least the peptide binding domains of a
multiplicity of MHC p chains
20 have been joined to second dimerization domains 40, and these fusion
proteins have assembled
to form heterodimeric MHC binding domains which may bind MHC binding peptides
110.
Flexible molecular linkers, not shown, optionally may be interposed between
the MHC domains
(10, 20) and the dimerization domains (30, 40). In this figure, the first
dimerization domains 30
are shown as being conjugated to a carrier 300 by a conjugating moiety 200.
Alternatively,
however, the second dimerization domains 40 may be conjugated to the carrier
300 by a
conjugating moiety 200. In other embodiments, the conjugating moiety 200 may
be omitted and
one of the dimerization domains (30 or 40) may be directly conjugated to the
carrier 300. The
MHC binding domain fusion proteins are conjugated to the carrier in an
orientation which allows
interaction of the MHC/peptide complexes with the TCRs on cognate T cells. As
shown in
Figure 6, the carrier 300 is depicted as a substantially spherical branched
polymer or dendrimer,
but this need not be the case.
Figure 7 schematically illustrates another embodiment of a multimeric MHC
binding
domain conjugate of the invention. In this figure, the conjugate comprises a
multiplicity of MHC
binding domain fusion proteins, such as those described above, and the
numbered elements 10,
20, 30, 40 and 110 are as described in Figure 6. In this embodiment, however,
the conjugating
moiety 200 of Figure 6 has been replaced by two elements, 70 and 80. Thus, a
first conjugating
moiety 70 is bound, covalently or non-covalently, to the second dimerization
domain 40, and the
second conjugating moiety 80 is bound, covalently or non-covalently, to the
carrier 300. For
example, the first conjugating moiety 70 may be a biotin-tag, as described
above, and the second
conjugating moiety 80 may be avidin or streptavidin. Alternatively, and as
described below, the
conjugating moieties 70 and 80 may be any pair of molecules which are capable
of binding to each
other, covalently or non-covalently, so as to conjugate the MHC binding
domains to the carrier.
In other embodiments, the various elements depicted in Figures 1-7 may be
interchanged
or mixed. Thus, for example, the monovalent MHC binding domain fusion protein
of Figure I,
the divalent MHC binding domain fusion protein of Figure 2, the decavalent MHC
binding domain
fusion protein of Figure 3, or the tetravalent MHC binding domain fusion
protein of Figure 4, may
be conjugated by conjugating moieties as in Figures 5 or 6, or by first and
second conjugating
CA 02321262 2000-08-18
'.
WO 99142597 PCT/US99/03603
-38-
moieties as in Figure 7, to a particulate carrier as in Figures 5 or 7, or to
a branched polymer or
dendrimer carrier as in Figure 6. In addition, and as described herein, other
embodiments not
depicted in the figures may be employed.
1. Choice of MHC Components for Multimeric MHC Binding Domain Coniusates
In contrast to the previously described monovalent and multivalent MHC binding
domain
fusion proteins, in which MHC Class II binding domains were employed with
dimerization
domains to produce stable and soluble heterodimers of the fusion proteins, the
multimeric MHC
binding domain conjugates of the present invention may employ either Class I
or Class II MHC
binding domains. As before, essentially any mammalian MHC proteins may be
employed but, as it
is anticipated that the present invention will have greatest utility in the
diagnosis and treatment of
human disease, the MHC Class I and MHC Class II proteins are preferably human
MHC proteins.
Thus, any of the MHC binding domains which were described above for use in MHC
binding domain fusion proteins may also be used in the production of
multimeric MHC binding
domain conjugates. Similarly, the same MHC splice points, described above, may
be employed to
obtain the complete extracellular portion of MHC Class II oc and (3 chains, or
just the minimal
portions of those chains which include the MHC binding domain.
Furthermore, any of the above-described monovalent or multivalent MHC binding
domain
fusion proteins may be employed as the MHC component in a multimeric MHC
binding domain
conjugate. Thus, for example, divalent MHC binding domain fusion proteins
comprising at least
the MHC binding domain of an MHC Class II molecule joined to immunoglobulin
domains (with
or without intervening coiled-coil dimerization domains or interposing
flexible molecular linkers)
may be conjugated to a carrier to produce a multimeric MHC binding domain
conjugate of the
invention. Similarly, the tetravalent and decavalent MHC binding domain fusion
protein
constructs described above may be conjugated to a carrier to produce a
multimeric MHC binding
domain conjugate. More simply, the monovalent MHC binding domain fusion
proteins,
employing coiled-coil or other dimerization domains as described above, may be
conjugated to a
carrier to produce a multirneric MHC binding domain conjugate.
In addition, however, multimeric MHC binding domain conjugates may be produced
using
MHC Class II binding domains which are free of exogenous coiled-coil or
dimerization domains.
Thus, for example, the extracellular or peptide binding domains of those MHC
Class II molecules
which are stable under physiological conditions without exogenous dimerization
domains, such as
t~
CA 02321262 2000-08-18
WO 99/42597 PC'r/US991036~3
-39-
those which may be produced by the methods of Stern and Wiley (1992), also may
be conjugated
to a carrier to produce a multimeric MHC binding domain conjugate of the
invention. The MHC
binding domains of the Class II I-ILA-DR1 and HLA-DR4 molecules may, for
example, be
produced in truncated form, and may be conjugated to a carrier without
dimerization domains to
aid in the stabilization of the heterodimer. The considerations in the choice
of splice points for
such truncated MHC Class II proteins are the same as those described above for
the MHC
binding domain fusion proteins and will not be repeated here.
Moreover, multimeric MHC binding domain conjugates may be produced in which
the
MHC binding domains are derived from MHC Class I as well as MHC Class II
proteins. In
particular, Class I MHC binding domains do not require stabilization by
dimerization domains
because the light chains of these molecules (i.e., ~i2-microglobulin) lack a
transmembrane domain
in nature, but are nonetheless able to stably associate with Class I a chains
under physiological
conditions. Therefore, MHC binding domain conjugates may be produced employing
~iz_microglobulin in association with at least the peptide binding domain of
an MHC Class I a
chain conjugated to a carrier. The choice of splice points for MHC Class I a
chains, like that of
MHC Class II a chains, is within the ability of one of ordinary skill in the
art. Specifically,
however, the splice point is preferably chosen between residues at the C-
terminus of the a3
domain and residues at the N-terminus of the transmembrane domain (e.g.,
between about
residues 273-283 of the mature HLA-A2 protein, preferably after the Pro
residue at position 283
or the Ile residue at position 284). Preferably, the entire extracellular
domain of an MHC Class I
a chain is employed.
2. Choice of Carriers for MHC Binding Domain Conjugates
The MHC binding domain conjugates of the present invention may be produced
with any
of a large variety of carriers including, but not limited to, particles,
beads, branched polymers,
dendrimers, or liposomes. The carriers must be capable of being conjugated,
either directly or
indirectly, to a multiplicity of MHC binding domains and, therefore,
preferably comprise a
multiplicity of reactive groups near the surface which can be used in
conjugation reactions.
Alternatively, however, the carrier may have a surface to which conjugating
moieties may be
adsorbed without chemical bond formation. Preferably the carrier is
particulate, and generally
spherical, ellipsoidal, rod-shaped, globular, or polyhedral in shape.
Alternatively, however, the
carrier may be of an irregular or branched shape. In preferred embodiments,
the carrier is
CA 02321262 2000-08-18
~;,
WO 99142597 PCT/US99/03603
-40-
composed of material which is biodegradable and non-immunogenic. It is further
preferred that
the carrier have a net neutral or negative charge, in order to reduce non-
specific binding to cell
surfaces which, in general, bear a net negative charge.
As described above with respect to the MFiC binding conjugates, the overall
size and
weight of the carriers are important considerations. Preferably, the carriers
are microscopic or
nanoscopic in size, both to enhance solubility, and to avoid possible
complications caused by
aggregation in vivo. Thus, it is preferred that the largest cross-sectional
diameters of the carriers
of the invention are less than about 1,000 nm, preferably less than about S00
nm, and more
preferably less than about 100 nm. In the most preferred embodiments, as
described below,
carriers have maximum diameters of about S-40 nm. Similarly, it is preferred
that the overall
weights of the carriers are less than about 10,000 kDa, preferably less than
about 5,000 kDa, and
more preferably less than about 1,000 kDa. In the most preferred embodiments,
as described
below, the carriers have weights of about 200-500 kDa.
(a) Microbead or Nanobead Carriers
In one series of embodiments, the present invention provides for the
production of
multimeric MHC binding domain conjugates in which a multiplicity of MHC
binding domains are
conjugated to a substantially spherical microbead or nanobead. The beads may
be solid, hollow,
or porous. For certain embodiments, in which it is desired to deliver a marker
(e.g., a fluorescent
agent) or therapeutic agent (e.g., a cytotoxin or lymphokine) to T cells
bearing a particular TCR,
it is preferred that the beads are porous.
Carrier beads can be formed from a wide range of materials. For example, beads
may be
composed of glass, silica, polyesters of hydroxy carboxylic acids,
polyanhydrides of dicarboxylic
acids, or copolymers of hydroxy carboxylic acids and dicarboxylic acids. More
generally, the
carrier beads may be composed of polyesters of straight chain or branched,
substituted or
unsubstituted, saturated or unsaturated, linear or cross-linked, alkanyl,
haloallyl, thioalkyl,
aminoalkyl, aryl, aralkyl, alkenyl, aralkenyl, heteroaryl, or alkoxy hydroxy
acids, or
polyanhydrides of straight chain or branched, substituted or unsubstituted,
saturated or
unsaturated, linear or cross-linked, alkanyl, haloalkyl, thioallyl,
aminoalkyl, aryl, aralkyl, alkenyl,
aralkenyl, heteroaryl, or alkoxy dicarboxyIic acids. Carrier beads including
mixtures of ester and
anhydride bonds (e.g., copolymers of glycolic and sebacic acid) may also be
employed. Thus, for
example, carrier beads may comprise materials including polyglycolic acid
polymers (PGA),
CA 02321262 2000-08-18
WO 99!42597 PCTlUS99/03603
-41 -
polylactic acid polymers (PLA), polysebacic acid polymers (PSA), poly(lactic-
co-glycolic) acid
copolymers (PLGA), poly(lactic-co-sebacic) acid copolymers (PLSA),
poly(glycolic-co-sebacic)
acid copolymers (PGSA), etc. Other biocompatible, biodegradable polymers
useful in the present
invention include polymers or copolymers of caprolactones, carbonates, amides,
amino acids,
orthoesters, acetals, cyanoacrylates and degradable urethanes, as well as
copolymers of these with
straight chain or branched, substituted or unsubstituted, alkanyl, haloalkyl,
thioalkyl, aminoallyl,
aIkenyl, or aromatic hydroxy- or di-carboxylic acids. In addition, the
biologically important amino
acids with reactive side chain groups, such as lysine, arginine, aspartic
acid, glutamic acid, serine,
threonine, tyrosine and cysteine, or their enantiomers, may be included in
copolymers with any of
the aforementioned materials to provide reactive groups for conjugating to MHC
binding domains
or conjugating moieties. Currently preferred biodegradable materials include
PLA, PGA, and
PLGA polymers. See, generally, U.S. Pat. Nos. 1,995,970; 2,703,316; 2,758,987;
2,951,828;
2,676,945; 2,683,136 and 3,531,561. Biocompatible but non-biodegradable
materials may also be
used in the carrier beads of the invention. For example, non-biodegradable
polymers of acrylates,
ethylene-vinyl acetates, acyl substituted cellulose acetates, non-degradable
urethanes, styrenes,
vinyl chlorides, vinyl fluorides, vinyl imidazoles, chlorosulphonated olefins,
ethylene oxide, vinyl
alcohois, TEFLON~ (DuPont, Wilmington, DE), and nylons may be employed. See,
generally,
U.S. Pat. Nos. 2,609,347; 2,653,917; 2,659,935; 2,664,366; 2,664,367; and
2,846,407.
In currently preferred embodiments, the beads are composed of polystyrene,
silica, PGA,
PLA, PSA, PLGA, PLSA, or PGSA. Suitable beads which are currently available
commercially
include polystyrene beads such as FluoSpheresTh~ (Molecular Probes, Eugene,
OR), and silica
beads such as SpherisorbTM (Phase Separation, North Wales, UK).
In currently preferred embodiments, carrier beads are employed having an
average
diameter of about 10-400 nm, more preferably 20-100 nm, and most preferably
about 40 nm.
(b) Branched Polymer Carriers
In another series of embodiments, the present invention provides for the
production of
conjugates wherein a multiplicity of MHC binding domains are conjugated to a
branched polymer.
Branched polymers are preferable to linear polymers because they have numerous
chain-ends or
termini which can be functionalized and, therefore, can be conjugated to a
multiplicity of MHC
binding domains, either directly or indirectly through conjugating moieties.
CA 02321262 2000-08-18
WO 99142597 PCT/US99103603
-42-
Preferably, the branched polymer carriers of the invention are dendrimers.
Dendrimers,
also known as arborols, cascade molecules, dendritic polymers, or fractal
polymers, are highly
branched macromolecules in which the branches emanate from a central core. In
one method of
dendrimer production, dendrimers are synthesized outward from a core molecule
by sequential
addition of layers of monomers. The first round of dendrimer synthesis adds a
single layer or
"generation" of monomers to the core, with each monomer having at least one
free, reactive
terminus. Each subsequent round of polymerization results in the expansion of
the dendrimer by
one layer and increases the number of free, reactive termini. This process can
be repeated
numerous times to produce dendrimers of desired diameter or mass. As the
density of the
branches increases, the outermost branches arrange themselves in the form of a
sphere
surrounding a lower density core. See, for example, U.S. Pat. No. 5,338,532.
In addition, by
varying the shape of the core molecules, dendrimers may be produced in rod-
shaped, disk-like,
and comb-like forms. The resulting dendrimers may possess an arbitrarily large
number of free,
reactive termini, to which a multiplicity of MHC binding domains may be
conjugated, either
directly or indirectly. Figure 6 provides a schematic depiction of a
multimeric MHC binding
domain conjugate comprising a dendrimer carrier 300.
In preferred embodiments, the dendrimer comprises a polyamidoamine; a
polyamidoalcohol; a polyalkyleneimine such as polypropyleneimine or
polyethyleneimine; a
polyalkylene such as polystyrene or polyethylene; a polyether; a
polythioether; a
polyphosphonium; a polysiloxane; a polyamide; or a polyaryl polymer.
Dendrimers have also
been prepared from amino acids (e.g., polylysine). Suitable dendrimers which
are currently
available commercially include polyamidoamine dendrimers such as StarburstTM
dendrimers
(Dendritech, Midland, MI). The StarburstTM dendrimers terminate in either
amine groups or
carboxymethyl groups which may be used, with or without further modification,
and with or
without interposing conjugating moieties, to conjugate MHC binding domains to
the surface of
these carriers. Preferably, dendrimers are employed which terminate in
carboxyl or other
negatively charged reactive groups.
The different "generations" of dendrimers differ in weight, size and number of
terminal ,
reactive groups. For example, Generation 1 polyamidoamine StarburstTM
dendrimers have a
molecular weight of ~ 1.0 kDa, a diameter of ~ l .b nm, and 6 terminal groups;
Generation 2 have
a molecular weight of ~ 2.4 kDa, a diameter of - 2.2 nm, and 12 terminal
groups; Generation 3
CA 02321262 2000-08-18
WO 99/42597 PCT/US99103603
- 43 -
have a molecular weight of ~ 5.1 kDa, a diameter of - 3.1 nm, and 24 terminal
groups;
Generation 4 have a molecular weight of ~ 10.6 kDa, a diameter of - 4.0 nm,
and 48 terminal
groups; Generation 5 have a molecular weight of ~ 21.6 kDa, a diameter of ~
5.3 nm, and 96
terminal groups; Generation 6 have a molecular weight of ~ 43.5 kDa, a
diameter of - 6.7 nm,
and 192 terminal groups; Generation 7 have a molecular weight of- 87.2 kDa, a
diameter of
8.0 nm, and 384 terminal groups; Generation 8 have a molecular weight of ~
174.8 kDa, a
diameter of- 9.2 nm, and 768 terminal groups; Generation 9 have a molecular
weight of
349.9 kDa, a diameter of ~ 10.5 nm, and 1536 terminal groups; and Generation
10 have a
molecular weight of- 700 kDa, a diameter of -- 12.4 nm, and 3072 terminal
groups (Roberts et
al., 1996).
Non-dendrimer branched polymers may also be employed in the invention, and may
be
produced from the same general classes of materials as dendrimers. The
synthesis of such
branched polymers is also well known in the art. As used herein, a "branched
polymer" means a
polymer having at least 5 termini, preferably at least 10 termini, and more
preferably 20-500
termini, formed by branching of a carbon and/or heteroatom backbone.
(c) ~osome Carriers
In another series of embodiments, the present invention provides for the
production of
multimeric MHC binding domain conjugates in which a multiplicity of MHC
binding domains are
conjugated to the outer surface of a liposome. Liposomes, also called lipid
vesicles, are aqueous
compartments enclosed by lipid membranes, and are typically formed by
suspending a suitable
lipid in an aqueous medium, and shaking, extruding, or sonicating the nuxture
to yield a
dispersion of vesicles. Various forms of liposomes, including unilamellar
vesicles and
multilamelIar vesicles, may be used in the present invention.
Liposomes may be prepared from a variety of lipid materials including, but not
limited to,
2~ lipids of phosphatidyl choline, phosphatidyl serine, phosphatidyl inositol,
phosphatidyl glycerol,
phosphatidyl ethanolamine, phosphatidic acid, dicetyl phosphate,
monosialoganglioside,
polyethylene glycol, stearyl amine, ovolecithin and cholesterol, as well as
mixtures of these in
varying stoichiometries. Liposomes, as used herein, may also be formed from
non-lipid
amphipathic molecules, such as block copolymers of poly(oxyethylene-b-isoprene-
b-oxyethylene)
and the like. In preferred embodiments, the liposomes are prepared from lipids
that will form
CA 02321262 2000-08-18
'"s
WO 99142597 PCT/US99/0360-3
-44-
negatively charged Iiposomes, such as those produced from phosphatidyl serine,
dicetyl
phosphate, and dimyristoyl phosphatidic acid.
The surfaces of liposomes may also be modified to reduce immunogenicity or to
provide
convenient reactive groups for conjugation. For example, sialic acid or other
carbohydrates, or
polyethylene glycol or other alkyl or alkenyl polymers, may be attached to the
surface of a
Iiposome to reduce immunogenicity. Alternatively, liposomes may be produced
bearing a
conjugating moiety such as biotin by inclusion of a small molar percentage of,
for example, biotin-
X-dipalmitoylphosphatidyIethanolamine (Molecular Probes, Eugene, OR) in the
liposome.
3. Means of Coniuoatine MHC Binding Domains to a Carrier
A great variety of means, well known in the art, may be used to conjugate MHC
binding
domains to carriers to produce the MHC binding domain conjugates of the
invention. These
methods include any standard chemistries which do not destroy or severely
limit the biological
activity of the MHC binding domains, and which allow for a sufficient number
of MHC binding
domains to be conjugated to the carrier an orientation which allows for
interaction of the MHC
binding domain with a cognate T cell receptor. Generally, methods are
preferred which conjugate
the C-terminal regions of an MHC binding domain, or the C-terminal regions of
an MHC binding
domain fusion protein, to the carrier. The exact chemistries will, of course,
depend upon the
nature of the carrier material, the presence or absence of C-terminal fusions
to the MHC binding
domain, and/or the presence or absence of conjugating moieties.
In one series of embodiments, the MHC binding domains are bound to the carrier
via a
covalent chemical bond. For example, a reactive group or moiety near the C-
terminus of the
MHC a or ~3 chain (e.g., the C-terminal carboxyl group, or a hydroxyl, thiol,
or amine group from
an amino acid side chain) may be conjugated directly to a reactive group or
moiety on the surface
of the carrier (e.g., a hydroxyl or carboxyl group of a PLA or PGA polymer, a
terminal amine or
carboxyl group of a dendrimer, or a hydroxyl, carboxyl or phosphate group of a
phospholipid) by
direct chemical reaction. Alternatively, there may be a conjugating moiety
which covalently
conjugates to both the MHC binding domains and the carrier, thereby linking
them together.
In some preferred embodiments, reactive carboxyl groups on the surface of a
carrier may
be joined to free amines (e.g., from Lys residues) on MHC binding domains, or
MHC binding
domain fusion proteins, by reacting them with, for example, I-ethyl-3-[3,9-
dimethyl aminopropyl)
carbodiimide hydrochloride (EDC) or N-hydroxysuccinimide ester (NHS).
Similarly, the same
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-45-
chemistry may be used to conjugate free amines on the surface of a carrier
with free carboxyls
(e.g., from the C-terminus, or from Asp or GIu residues) on MHC binding
domains, or MHC
binding domain fusion proteins. Alternatively, free amine groups on the
surface of a carrier may
be covalently bound to MHC binding domains, or MHC binding domain fusion
proteins, using
sulfo-SIAB chemistry, essentially as described by Arano et al. (1991).
In another series of embodiments, a non-covalent bond between a ligand bound
to the
MHC binding domain and an anti-Iigand attached to the carrier may conjugate
the MHC binding
domains to the carrier. For example, as described above, a biotin ligase
recognition sequence tag
may be joined to the C-terminus of either (or both) of the 11~-IC a or j3
chain binding domains, or
to the C-terminus of an MHC binding domain fusion protein, and this tag may be
biotinylated by
biotin Iigase. The biotin may then serve as a Iigand to non-covalently
conjugate the MHC binding
domain to avidin or streptavidin which is adsorbed or otherwise bound to the
surface of the
carrier as an anti-ligand. Alternatively, if the MHC binding domains are fused
to an
immunoglobulin domain bearing an Fc region, as described above, the Fc domain
may act as a
1~ ligand and protein A, either covalently or non-covalently bound to the
surface of the carrier, may
serve as the anti-ligand to non-covalently conjugate the MHC binding domain to
the carrier.
Other means are well known in the art which may be employed to non-covalently
conjugate MHC
binding domains to carriers, including metal ion chelation techniques (e.g.,
using a poly-His tag at
the C-terminus of the MHC binding domain or MHC binding domain fusion
proteins, and a Ni~'-
coated carrier), and these methods may be substituted for those described
here.
4. Accessory Molecules Associated with MHC Binding Domain ConL ates
The MHC binding domain fusion proteins and conjugates of the present invention
may
also be associated with, or bound to, various accessory molecules or moieties
which are suitable
to particular utilities. For example, the fusion proteins or canjugates may be
associated with, or
bound to, molecules or moieties including cytotoxins (e.g., genistein, ricin,
diphtheria toxins,
Pseudomonas toxins, the Fas Iigand, and radioactive isotopes) for killing T
cells, or to T cell-
modulating molecules (such as the B7-1, B7-2, LFA-3, CD40 or I-CAM proteins)
for activating
or anergizing T cells. In addition, the MHC binding domain fusion proteins and
conjugates may
be associated with, or bound to, various molecules or moieties which are
useful for detecting the
presence of the fusion proteins or conjugates, such as radioactive or
fluorescent labels.
CA 02321262 2000-08-18
. ,'.
WO 99142597 PCTIUS99I036U3
-46-
For MHC binding domain fusion proteins, such accessory molecules or moieties
are
preferably attached to the C-terminal region of the fusion protein or at some
other point which is
not expected to interfere with its ability to bind its cognate TCR (e.g.,
along an Fc domain,
dimerization domain or flexible molecular linker). For MHC binding domain
conjugates, the
accessory molecules may be similar attached to the MHC binding domain or a
fusion protein
component (e.g., dimerization domains), to flexible molecular linkers or
conjugating moieties, or
to the carrier. For MHC binding domain conjugates in which the carrier is
hollow (e.g., a
liposome or hollow bead) or porous (e.g., a dendrimer or porous bead), an
accessory molecule or
moiety may be included within the interior or pores of the carrier. Inclusion
within the interior of
a carrier is particularly preferred for cytotoxic agents which may exert their
effect after the MHC
binding domain conjugate is endocytosed within a T cell. For accessory
molecules which exert T
cell moduIatory effects (e.g., B7-1, B7-2, and CD40, which are co-stimulatory
molecules which
aid in the activation of naive T cells) or accessory molecules which may
promote adhesion of
MHC binding domain conjugates to T cells (e.g., LFA-3 or I-CAM), the accessory
molecule is
i5 preferably bound to the exterior of a carrier such as a bead, dendrimer, or
liposome.
Accessory molecules may be bound to MHC binding domain conjugates by standard
chemical techniques known in the art, including those described above for
binding MHC binding
domains, or MHC binding domain fusion proteins, to carriers. Accessory
molecules may be
associated within porous carriers, or included within hollow carriers, by
standard techniques
which are known in the art.
III. Uses for MHC Binding Domain Fusion Proteins and Conjugates
In one aspect, the present invention provides a method for detecting and/or
isolating T
cells of a defined MHC/peptide complex specificity comprising contacting a
population of T cells
with monovalent, multivalent or multimeric MHC binding domain fusion proteins
or conjugates of
the invention, as described above, which are loaded with a particular MHC
binding peptide and
which, therefore, define a particular MHC/peptide complex. The activation or
proliferation of the
T cells may then be determined and used, with an appropriate control, as an
indication of whether
the T cell population includes T cells specif c for the defined MHC/peptide
complex.
Alternatively, the monovalent, multivalent or multimeric MHC binding domain
fusion proteins and
conjugates of the invention, having a defined specificity, may be immobilized
on a substrate and a
population of T cells may be contacted with the immobilized MHC binding
domains. After
CA 02321262 2000-08-18
. .
WO 99/42597 PCT/US99/03603
-47-
allowing a period of time for the binding, if any, of T cells specif c for the
defined MHC/peptide
complex, unbound cells may be washed away and the presence or absence of bound
T cells may
be used as an indication of whether the T cell population includes T cells
specific for the defined
MHC/peptide complex. In another embodiment, the monovalent, multivalent or
multimeric MHC
binding domain fusion proteins and conjugates of the invention may be
contacted with a T cell
population and, after allowing a period of time for the binding, if any, of
the MHC binding
domains to T cells specific for the defined MHC/peptide complex, unbound
fusion proteins or
conjugates may be washed away and the presence or absence of bound fusion
proteins or
conjugates may be used as an indication of whether the T cell population
includes T cells specific
for the defined MHC/peptide complex. In all such embodiments, the labeling of
the T cells, fusion
proteins or conjugates, or complexes of the MHC/peptide complex with a
reactive T cell receptor
with fluorescent, radioactive or other markers is preferred to simplify
detection. In particular,
fluorescent labels may be used in conjunction with FACS (fluorescence-
activated cell sorting)
techniques to isolate a desired subpopulation of T cells with a defined
MHC/peptide specificity.
In a particularly preferred embodiment, T cells which are reactive to a
specifcc, defined
MHC/peptide complex are detected and isolated as described above, and are then
used, preferably
after proliferation in vitro, for adoptive immunotherapy. Thus, a population
of T cells may be
obtained from a host (either the subject to be treated or a syngeneic donor).
T cells which are
reactive for a particular MHC/peptide complex are then detected and isolated
using the methods
described above. The cells, preferably after several rounds of proliferation
to increase their
numbers, are then administered (e.g., intravenously, intraperitoneally) to the
subject to confer
adoptive immunity. Such a procedure may be of particular utility in
stimulating adoptive
immunity against weak antigens such as tumor-associated antigens.
In another aspect, the present invention provides methods for stimulating or
activating T
cells, in vivo or in vitro. As noted above, the present invention provides for
the production of
soluble Class II MHC fusion proteins for which no soluble counterparts had
previously existed,
and for the production of multivalent and multimeric Class I and Class II MHC
binding domains
at higher valencies than previously obtained. Thus, these monovalent,
multivalent and multimeric
MHC binding domain fusion proteins and conjugates, loaded with appropriate MHC
binding
peptides and defining a specific MHC/peptide complex, may now be contacted
with T cells in
solution, in vivo or in vitro, to specifically stimulate or activate T cells
which are reactive to the
CA 02321262 2000-08-18
. ,
..s
WO 99142597 PCT/US99/036U3
-48-
defined MHC/peptide complex. As noted above, the multivalent and multimeric
MHC binding
domain fusion proteins and conjugates of the invention are expected to be
particularly potent for
these purposes. When conducted in vivo (e.g., when the MHC binding domain
fusion proteins or
conjugates of the invention are administered as a pharmaceutical preparation),
this serves as a
method of vaccination against the MHC binding peptide when presented in the
defined
MHC/peptide complex. When used for vaccination purposes against pathogens
including the
MHC binding peptide, of course, the MHC binding domain components of the
fusion proteins or
conjugates are chosen to syngeneic to the subject being vaccinated.
In another aspect, the monovalent, multivalent or multimeric MHC binding
domain fusion
proteins and conjugates of the present invention may be used to kill or
energize T cells reactive to
a defined MHC/peptide complex, or to tolerize an individual to a particular
MfICJpeptide
complex. For example, the MHC binding domain fusion proteins may include Fc
regions which
activate the complement system and, thereby, cause the destruction of T cells
to which they bind.
Alternatively, the fusion proteins may be designed to include a cytotoxic
substance attached to,
for example, the C-terminus, or at some other point which does not interfere
with the binding of
the MHC/peptide complex to cognate T cell receptors (e.g., to a dimerization
domain, Fc domain,
Iigand tag domain, or flexible molecular linker). Similarly, the MHC binding
domain conjugates
may be designed to include a cytotoxic substance attached to the MHC binding
domains, to fusion
protein components (e.g., a dimerization domain, Fc domain, ligand tag
domain), to flexible
molecular linkers or conjugating moieties, or to the carrier. For MHC binding
domain conjugates
in which the carrier is hollow (e.g., a liposome or hollow bead) or porous
(e.g., a dendrimer or
porous bead), a cytotoxic substance may be included within the interior or
pores of the carrier.
For these embodiments, useful cytotoxic substances include, for example,
genistein, ricin,
diphtheria toxins, Pseudomonas toxins, and radioactive isotopes (e.g., ~ZSI).
It is also known in
the art that high doses of many antigens have a T cell tolerizing or
energizing effect rather than a
T cell stimulating effect. Therefore, administration of high doses of a
monovalent, multivalent or
multimeric MHC binding domain fusion protein or conjugate of the invention can
cause
tolerization to the MHC/peptide complex, even when lower doses would cause
sensitization (i.e., .
vaccination or immunization). In cases where the goal is to tolerize an
individual to an antigen
which is normally presented by the subject's own MHC molecules, the MHC
binding domain
components of the fizsion protein or conjugate are chosen so as to be
syngeneic with the subject.
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-49-
Such cases would include tolerization to the antigens which cause allergic
reactions, as well ~as
autoantigens which are implicated in autoimmune disease. In other cases,
however, the MI-iC
components may be specifically allogeneic so as to tolerize the subject to an
MHC/peptide
complex which is foreign. Such cases would include tolerization to foreign
tissue before or after
organ or tissue transplantation in which the donor and recipient are not
identical with respect to
one or more MHC alleles.
By the term "effective amount," with respect to tolerizing an individual to an
MHC/peptide complex, is meant an amount sufficient to render T cells,
otherwise specific for the
MHC/peptide complex, unresponsive to the MHClpeptide complex. T cells which
are
unresponsive fail to activate or proliferate when presented with the complex
for which they are
specific. By the term "effective amount," with respect to immunizing an
individual to an antigen,
is meant an amount sufficient to induce an immune response which results in
activation or
proliferation of T cells specific for the antigen in an MHC/peptide complex.
Typical ranges of
dosages are from 1 nanogram/kilogram to 100 milligrams/lilogram or even 500
milligrams/kilogram of body weight. Effective amounts will vary according to
such factors as
age, sex and sensitivity to the antigen.
Particular alleles ofthe MHC have been associated with a variety of diseases,
including
multiple sclerosis (MS), rheumatoid arthritis (RA), pemphigus vulgaris (PV)
and systemic lupus
erythematosus (SLE), and it has been postulated that these diseases are, at
least in part,
autoimmune in nature. That it, is has been suggested that particular MHC
proteins "improperly"
recognize processed self peptides presented to T cells in the form of
complexes with MHC Class I
or Class II molecules. In order to demonstrate this, MHC binding domain fusion
proteins or
conjugates which can be loaded with a single self peptide implicated in the
disease can be used.
For example, using such MHC/peptide complexes, in the form of fusion proteins
or conjugates,
one can probe lesions in MS patients to determine whether the infiltrating T
cells are reactive
against a particular self peptide bound to a particular syngeneic MHC
molecule. More generally,
the MHC binding domain fusion proteins and conjugates of the invention may be
used to detect T
cells having any defined specificity by constructing an MHC binding domain
fusion protein or
conjugate loaded with the appropriate MHC binding peptide (covalently or non-
covalently joined)
and detecting the binding and/or activation of T cells contacted with the MHC
binding domains.
CA 02321262 2000-08-18
. ~
....
WO 99/42597 PCT/US99103603
- 50 -
Thus, as an example only, consider the diagnostic and therapeutic utilities of
the present
invention with respect to MS. The contribution of the MPIC to MS
susceptibility has been
examined in a large number of studies (reviewed in Spielman and Nathenson,
1982; Hillert et al.,
1994). These studies demonstrated that susceptibility is associated with the
MHC class II region
and that particular MHC class II haplotypes confer an increased risk. The
strongest association is
with the HLA-DR2 haplotype (DRB 1 * 1501 ); approximately 50 to 60% of MS
patients and 20%
of normal subjects carry this haplotype. The DR2 haplotype is most common in
MS patients from
Western Europe, the U.S. and Canada; the haplotype is also increased among MS
patients
worldwide. Other MHC class II haplotypes (DR4, DR6) have been associated with
susceptibility
to MS in particular populations (Italians, Jordanian Arabs); however, these
associations are not as
strong as the association with DR2 (Marrosu et al., 1988; Kurdi et al., 1977).
HLA-DR2 (encoded by the DRA, DRB I * 1501 genes) has been shown to present at
least
two peptides ofhuman myelin basic protein (residues 85-99 and 148-162) to T
cells. The
MBP(85-99) peptide binds with high affinity to purified DR2, and the affinity
ofthe MBP(148-
162) peptide is lower but significant. DR2 transfectants (DRA, DRB 1 * 1501 )
were found to
present these MBP peptides to T cell clones that had been generated from blood
lymphocytes of
MS patients (Chou et al., 1989; Pette et al., 1990, Martin et al., 1990; Ota
et al., 1990;
Wucherpfennig et al., 1990; Valli et al., 1993, Wucherpfennig et al., 1994).
These studies support
the hypothesis that T cells specific for MBP and other myelin antigens are
involved in the
inflammatory response in MS. Direct identification of such T cells in MS
lesions is, however,
required to prove this hypothesis and this will require soluble, stable MHC
complexes with single
peptides, such as those provided by the present invention. In addition,
therapeutic intervention,
whether by tolerization or killing of T cells, will require soluble, stable
MHC complexes with a
high avidity for binding T cells specific for particular MHC/peptide
complexes, such as the
multivalent and multimeric MHC binding domain fusion proteins and conjugates
provided by the
present invention.
A principal difficulty with using soluble MHC/peptide complexes as probes and
therapeutics is that the affinity for the TCR is relatively low. T cells
compensate for the relatively
low af$nity of TCRs for MHC/peptide complexes by the interaction of multiple
TCR molecules
with MHC/peptide complexes on the surface of antigen presenting cells. Indeed,
such
dimerization of MHC Class II molecules may be important in T cell activation
since HLA-DRI is
CA 02321262 2000-08-18
WO 99/42597 PCTIUS99103603
-51 -
found as a dimer when crystallized (Brown et al., 1993). The present
invention, by providing
multivalent and multimeric MHC fusion proteins and conjugates addresses this
problem. Classical
studies with antibodies and their Flab) fragments have demonstrated that
bivalent/multivalent
binding results in a striking increase in the 'functional affinity' (also
termed the 'avidity'). IgG
molecules and Flab) fragments bind monovalent antigen in solution with equal
affinity; however,
the binding to multivalent antigens (i.e. cell surface antigens) is greatly
strengthened by the
bivalent nature of the IgG molecule (Crothers and Metzger, 1972; Dower et al.,
1984; Hornick
and Karush, I 972). Indeed, the 'functional affinity' of IgG antibodies was
found to be
approximately 100-fold greater for bivalent than for monovalent binding, and
this enhancement
factor was even greater for multivalent binding by IgM antibodies (factor of
103 to 10'). Thus,
the multivalent and multimeric MHC binding domain fusion proteins and
conjugates of the present
invention are expected to have far greater avidity for their cognate TCRs than
standard,
solubilized MHC proteins.
EXAMPLES
A. Monomeric MHC Bindin~ Domain-Coiled Coil Dimerization Domain Fusion
Proteins
1. DNA Constructs for Monomeric MHC Bindine Domain Fusion Proteins. The
extracellular domains of the HLA-DR2 a chain (residues I-I91 of DRA*O101) and
~i chain
(residues 1-198 of DRB 1 * 1501) were expressed as fusions with the 40 amino
acid leucine zipper
dimerization domains of Fos or Jun, respectively (van Straaten et al., 1983;
Angel et al., 1988).
The entire extracellular domains, rather than C-terminally truncated domains,
were employed
because charge-charge interactions between the DRa Glu at position 191 and the
DR~i Lys at
position 198 are thought to facilitate assembly (Cosson and Bonifacino, 1992)
of these molecules.
The extracellular domains of DRa and DR(3 as well as the Fos and Jun
dimerization domains were
generated by PCR with primers designed to include a seven amino acid linker
(VDGGGGG,
residues 199-205 of SEQ 117 NO: 2) with a SaII restriction site at the C-
terminus of the MHC
extracellular domains and at the N-terminus of the Fos or Sun leucine zipper
domains. The MHC
segments were then joined with the Fos or Jun segments through the SaII
restriction site. This
linker was included between the DR and leucine zipper segments both to
facilitate cloning
(through the SaII site) and to allow for greater rotational freedom of the
chains (through the poly-
Gly sequence). These constructs were reamplified by PCR to permit cloning into
the XhoI-EcoRI
sites of pPIC9 as in frame fusions with the a-mating factor secretion signal.
The in-frame cloning
CA 02321262 2000-08-18
WO 99142597 PCT/US99/03603
-52-
into this vector preserved the Lys-Arg-Glu recognition sequence (cleavage C-
terminal to Arg)
required far cleavage of the a-mating secretion signal by the KEX2 gene
product (Brake, I 990).
The following oligonucleotides were used for the construction: DRa forward
primer 5'
GTA TCT CTC GAG AAA AGA GAG ATC AAA GAA GAA CAT GTG ATC 3', XhoI site
underlined (SEQ 1D NO: 5); DRa reverse primer 5' GTC ATA GAA TTC TCA ATG GGC
GGC
CAG GAT GAA CTC CAG 3', EcoRI site underlined (encodes 3' end of Fos segment,
stop
codon and EcoRI restriction site) (SEQ ID NO: 6); DR~i forward primer 5' GTA
TCT CTC GAG
AAA AGA GAG GGG GAC ACC CGA CCA CGT TTC _i', XhoI site underlined (SEQ iT7 NO:
7); DR(3 reverse primer 5' GTC ATA GAA TTC TCA ATG GTT CAT GAC TTT CTG TTT
AAG 3' EcoRI site underlined {encodes 3' end of Jun segment, stop codon and
EcoRI restriction
site) (SEQ >D N0: 8). The resulting PCR products are disclosed as SEQ ID NO: I
and SEQ ID
NO: 3. These PCR products were cloned into the XhoI-EcoRI sites of pPIC9 and
were verified
by restriction mapping and dideoxy-sequencing.
These constructs were first tested in CHO cells (using the native DR a and p
chain signal
peptides). CHO transfectants were found to assemble and secrete DR a(3
heterodimers indicating
that the Fos/Jun leucine zipper promoted the proper assembly of DR2 molecules
(data not
shown). As described below, however, higher levels of expression were obtained
in a yeast
expression system employing Pichia pastoris. Recent work has demonstrated that
Drosoohila
Schneider cells give the highest Ieve1 of protein production (-1 m.,,~/liter,
compared to 0.3 mg/liter
in Pichia pastoris).
2. Transformation of Pichia with MHC Bindin Domain Fusion Protein Constructs.
For
protein production, the DRa-Fos and DR~3-Jun constructs were expressed in
Pichia pastoris
under the control ofthe alcohol oxidase (AOX1) promoter. Pichia pastoris was
chosen because
stable transformants can be rapidly generated and screened; in addition,
several secreted proteins
have been produced at very high levels in this system (Cregg et al., 1993).
To direct expression to the secretory pathway, DRa and (3 chains were cloned
into Pichia
astoris expression vector pPIC9 as in frame fusions with the a-mating factor
secretion signal
(Brake, 1990). The a-mating factor secretion signal is cleaved by the KEX2
gene product at the
sequence Leu-Glu-Lys-Arg-Glu (residues 3-7 of SEQ n7 NO: 2 and SEQ ID NO: 4),
with the
cleavage C-terminal to the Arg residue. Although this design results in the
addition of a glutamic
acid residue to the N-terminus of the mature DRa and DR(i chains, the N-
termini of these chains
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-53-
are located in a manner that this additional residue should not affect the
assembly of the
heterodimer. Molecules expressed as fusions with the a-mating factor secretion
signal were
efficiently secreted while usage of the PHO 1 secretion signal (vector pHIL-S
1, Invitrogen, San
Diego, CA) resulted in little or no secretion. For transformation, the
expression cassette of
pPIC9 can be excised as a BgIII fragment; the cassette carries 5' and 3'
sequences of the AOX1
gene to allow for integration into the AOXI locus as well as the HIS4 gene
that allows for
selection of transformants in histidine deficient media. Genes integrate into
the AOXI locus by
homologous recombination; integration into the AOXI gene disrupts the gene and
leads to slow
growth if methanol is the only carbon source (methanol utilization deficient
phenotype, Muts)
{Cregg et al., 1987).
Thus, pPIC9 plasmid DNA was purified on CsCI gradients and digested with BgIII
to
release the expression cassette (5' end of AOX 1 gene-DRa or DR~i chain
construct-
polyadenylation signal-HIS4 gene-3' end of the AOXI gene). Transformations
were done by
spheroptasting of the GS I 1 S strain (following the procedure provided by
Invitrogen, San Diego,
CA). Briefly, GS 115 cells were grown to mid-log phase in '1'PD media and
spheroplasts were
prepared by limited digestion of the yeast cell wall with zymolase
(approximately 70% of
spheroplasting) (Cregg et al., 1987). Cells were transfected with 5 mg of DRa
and DR(i plasmid
DNA and transfectants that expressed the HIS4 gene (present in the pPIC9
expression cassette)
were selected on HIS- plates. Integration of plasmids into the AOXI locus was
confirmed by
replica plating of colonies on minimal media plates with methanol or dextrose
as the sole carbon
source. Transformants that had integrated the plasmid DNA into the AOXI locus
showed little
or no growth on methanol plates due to disruption of the alcohol oxidase gene.
3. Identification of Recombinant Colonies A major advantage of the Pichia
pastoris
system is that transformants can be readily identified: Integration into the
AOXI locus confers a
methanol utilization deficient (Muts) phenotype that can be determined by
comparing the growth
of duplicate colonies on plates with methanol or dextrose as the sole carbon
source. Muts
colonies obtained after cotransformation of plasmids carrying the DRa and DR/3
chain constructs
were tested by PCR analysis of genomic DNA for the integration of DRa and (3
chain genes. 27
of 28 colonies with a Muts phenotype carried DRa and/or DR(~ chain genes; four
of these
colonies (14.2%) had integrated both genes.
CA 02321262 2000-08-18
WO 99/42597 PCT/US99103603
-54-
Thus, briefly, integration of DRa and DR(i chain constructs was examined by
PCR
analysis of genomic DNA isolated from individual Muts colonies. Replica
colonies were
transferred into 200 ml of Iysis buffer (2.5 M LiCI, SO mM Tris, pH 8.0, 4%
triton X-100, 62 mM
EDTA) using a sterile toothpick. Acid washed glass beads and an equal volume
of
phenol/chloroform (l:l) were added and samples were vigorously vortexed.
Following
centrifugation, the upper phase was transferred to a clean tube and genomic
DNA was
precipitated by addition of 2.5 vol of cold EtOH. Following incubation at -
20°C for 20 minutes,
the pellet was collected by centrifugation, washed with cold 70% EtOH and air-
dried. DNA was
resuspended in 40 ml of sterile water and denatured at 94°C for 10
minutes; 10 ml of DNA was
used for each PCR reaction. DRa and DR~3 chains were amplified by PCR for 35
cycles (94°C I
min, 55°C 2 min, 72°C 2 min) using the oligonucleotides that had
been used to generate the DNA
constructs; PCR products were resolved on 1% agarose gels stained with
ethidium bromide.
4. Expression and Purification of Monomeric MHC Binding Domain Fusion Proteins
The four transformants that carried both DRa and p chain genes were examined
for the
expression of DR2 binding domain heterodimers. Cells were grown for two days
in media
containing glycerol as the sole carbon source and were then switched to media
containing 0.5%
methanol. Supernatants and cell lysates were examined by sandwich ELISA using
a mAb specific
for the DR a~i heterodimer (mAb L243) for capture and a polyclonal DR
antiserum (CHAMP) for
detection. DR a(i heterodimer was detected in the cell lysates and
supernatants of DR a(3
transfectants. Transformants that carried only DRa or DR(i chain genes were
used as controls;
cell lysates and supernatants from these cells were negative in the assay
(Figure 8). These
experiments demonstrated that the DR a(3 binding domain heterodimer was
assembled and
effciently secreted. The four Pichia clones showed similar expression levels;
this is not surprising
because all four transformants had integrated the genes into the AOX1 locus.
For large scale expression, cells were grown in a high density fermenter and
DR2 MHC
binding domain fusion proteins were purified from concentrated supernatants by
affinity
chromatography with the L243 mAb. The mAb used for purification (L243) binds
to the DRa
chain but only when properly assembled with the DR(3 chain. Affinity
purification yielded
approximately 300-400 mg of HLA-DR2 fusion protein per Liter of culture. SDS-
PAGE revealed
two bands, the identity of these bands (upper band DRa, lower band DR(3) and
appropriate
CA 02321262 2000-08-18
WO 99/42597 PCTNS99/03603
-SS-
cleavage of the a-mating factor signal peptide were confirmed by N-terminal
sequence analysis
following separation of DRa and a chains by SDS-PAGE and transfer to a PVDF
membrane.
HPLC gel filtration analysis (Bio-Gel SEC 300 mm x 7.8 mm; flow rate I ml/min,
PBS pH
6.8) of 10 ~g of the HLA-DR2 fusion protein demonstrated that the recombinant
fusion protein
eluted as a single symmetric peak and only very small amounts of higher
molecular weight
aggregates were detected. In contrast, HLA-DR1 expressed in a Baculovirus
system was found
to aggregate unless these molecules were loaded with a high affinity peptide
(Stern and Wiley,
1992). These data demonstrated that the DR2 a(3 heterodimer was assembled and
secreted in the
Pichia pastoris expression system even in the absence of a high affinity
peptide. Importantly, the
purified molecules did not ajgregate even though they had not been loaded with
a high afynity
peptide.
Induction of high density cultures was carried out using a Inceltech LH series
fermenter
equipped with monitors and controls for pH, dissolved 02, agitation,
temperature, and air flow.
A 100 ml YNB-glycerol overnight culture was used to inoculate the fermenter
which contained
10 liters of fermentation basal salts medium (0.93 g/L calcium sulfate 2 H20,
18.2 g/L potassium
sulfate, 14.9 g/L magnesium sulfate 7 H20, and 6.5 g/I, potassium hydroxide)
containing 4%
glycerol (w/v) plus 43.5 ml of PTMI trace salts (24 mM CuS04, 0.53 mM NaI,
19.87 mM
MnS04, 0.83 mM Na2Mo04, 0.32 mM boric acid, 2.1 mM CoCl2, 0.15 mM ZnCl2, 0.23
mM
FeS04, and 0.82 mM biotin) at 30°C. Dissolved 02 was maintained above
20% by adjusting
aeration and agitation, and pH was maintained at 6.0 by the addition of 28%
(v/v) ammonium
hydroxide. Growth was continued until the glycerol was exhausted (20 hours). A
glycerol fed-
batch phase was initiated by the limited addition of 50°~0 (w/v)
glycerol and 12 ml PTMI salts per
liter of glycerol at 18.15 mI/hr/L initial fermentation volume until the
culture reached a wet cell
weight (wcw) of 200 g/L (22 hours). After the glycerol fed-batch phase, the
culture was induced
by replacing the glycerol feed with a,methanol-batch feed (100% methanol
containing 12 ml
PTM1 trace salts per liter of methanol) at 1 ml/hr/L. The methanol feed was
gradually increased
in 10% increments every 30 minutes to a rate of 3 mI/hr/L and the fermentation
continued for a
duration of 96 hours.
Supernatants were concentrated by ultrafiltration on a YM30 membrane (Amicon)
and
passed over an anti-DR (mAb L243) affinity column at a flow rate of
approximately 10 ml/hour.
Following extensive_washing with PBS, heterodimers were eluted with 50 mM
glycine, pH 11.5.
CA 02321262 2000-08-18
WO 99/42597 PCTNS99/03603
-56-
Eluates were immediately neutralized by addition of 2 M Tris, pH 8.0, dialyzed
against PBS and
concentrated by ultrafiltration. Protein concentrations were determined by
Coomassie Plus
Protein Assay (Pierce, Rockford, IL,) using bovine serum albumin as a
standard.
5. Peptide Loadine of MHC Binding Domain Fusion Proteins A human myelin basic
protein fragment (residues 85-99) that is recognized by DR2 restricted T cell
clones from MS
patients was previously shown to bind with high af~'mity (ICSO of 4.2 nM) to
detergent soluble
DRZ purified from L cell transfectants (Wucherpfennig et al., 1994 and 1995a).
A biotinylated
peptide with an SGSG linker between the biotin moiety and the MBP sequence
(i.e., biotin-
SGSG-MBP(85-99)) was used to examine the specificity of peptide binding to the
recombinant
DR2 fusion proteins. Peptide binding was assessed by incubating DR2 fusion
proteins (50-400
nM) with the biotinylated peptide (2 ~M) at 37°C for different periods
of time; non-biotinylated
peptide was used as a competitor to demonstrate the specificity of binding
(Figure 9).
DR2Ipeptide complexes were then captured on an ELISA plate using the L243 mAb,
and the
amount of bound biotinylated peptide was quantitated using peroxidase-labeled
streptavidin and
IS ABTS as a peroxidase substrate (detection at 405 nm).
Peptide binding to the DR2 fusion proteins was strongly dependent on the pH,
with a
maximum observed at pH 7 to pH 8; relatively little binding was observed at pH
5. A similar pH
optimum had previously been observed for binding of the MBP peptide to
detergent soluble DR2
(Wucherpfennig et al., 1994). Binding of peptide was dependent on the relative
molar ratio of
DR versus peptide, with a maximum of binding at a 10-fold molar excess of
peptide over DR2
(Figure 9). Binding was shown to be specific because it could be blocked by an
excess of non-
biotinylated MBP(85-99) peptide, but not by an analog peptide in which the P1
anchor residue
(Val 89) of MBP(85-99) had been substituted by aspartic acid (Figure 9).
To determine what fraction of the MHC binding domain fusion proteins could be
loaded
with a single peptide, complexes of the DR2 fusion proteins and the
biotinylated MBP peptide
were precipitated with streptavidin beads. Following precipitation, DRa and (3
chains were
resolved by SDS-PAGE and detected by Western blotting using a polyclonal DR
antiserum.
Approximately 50% of the molecules were precipitated with streptavidin beads
and 50% remained
in the supernatant. Control experiments demonstrated that precipitation of the
DR2/peptide
complexes was specific as the molecules were not precipitated when control
agarose beads, an
CA 02321262 2000-08-18
,
WO 99/42597 PCT/US99103603
-57-
unlabeled MBP peptide or an excess of unlabeled peptide over biotinylated
peptide were used;
rather, the DR2 fusion proteins remained in the unbound fraction.
For immunoprecipitation experiments, the DR2 fusion protein (400 nM) was
incubated
with biotinylated peptide (2 ~M) in a 50 ml volume in PBS, 1 mM EDTA, 1 mM
PMSF, pH 7.2
for 24 hours at 37°C. DR2-peptide complexes were precipitated with
streptavidin-agarose beads.
Beads were first blocked with 3% bovine serum albumin in PBS, 0.1% NP40 for 1
hour at 4°C;
beads were then pelleted and the DR2/peptide samples added. Following a 1 hour
incubation,
beads were washed three times with blocking buffer. DR2-peptide complexes were
eluted from
streptavidin beads by heating in IxSDS-PAGE buffer at 94°C for 3
minutes. Samples were
resolved on a 12.5% SDS-PAGE and transferred to immobilon membrane
(Millipore). Blots
were blocked overnight with 5% non-fat dry milk in 50 mM Tris, pH 8.0, 150 mM
NaCI, 0.2%
Tween 20 {TBST buffer). Precipitated DR a and (3 chain fusions were detected
with a polycional
DR antiserum (CHAMP, 1:50,000 in blocking buffer for 90 min). Blots were
washed in TBST
buffer and incubated for 30 min with a peroxidase conjugated anti-rabbit IgG
antibody (1:10,000
in blocking buffer). Following extensive washing in TBST, bands were detected
by enhanced
chemiluminescence (Amersham, Arlington Heights, IL).
In a separate set of experiments, peptide binding to recombinant DR2 fusion
proteins was
quantitated by capturing DR2 fusions to ELISA plates with an immobilized DR
antibody.
Standard binding conditions were: 37°C for 24 hours in PBS, pH 7.2, 1
mM EDTA, 1 mM
PMSF. Following peptide binding, bound peptide was quantitated by ELISA.
Plates were coated
with 200 ng/well of the purified L234 mAb in 0.1 M bicarbonate, pH 9.6
overnight at 4°C. Non-
specific binding sites were blocked with 3% BSA in PBS, 0.05% Tween 20 for 2
hours. Samples
were diluted in blocking buffer and added to the wells (1 hour). HLA-DR2 bound
biotinylated
peptide was quantitated with streptavidin-peroxidase using ABTS as a
peroxidase substrate;
absorbance was read at 405 nm.
6. Kinetics of Peptide Bindine to MHC Bindine Domain Fusion Proteins. The
kinetics of
peptide binding by detergent soluble DR2 purified from an EBV transformed B
cell line (Gorga et
al., 1987) and by recombinant DR2 MHC binding domain fusion proteins were
compared (Figure
10). Equimolar amounts of both DR2 preparations (200 nM) were incubated with
the
biotinylated MBP peptide (2 ~tM) at 37°C for different periods of time;
the amount of DR-bound
peptide was examined by ELISA using the DR specific L243 mAb for capture and
streptavidin-
CA 02321262 2000-08-18
~i
WO 99142597 PCTNS99I03603
-58-
peroxidase for detection of DR-bound peptide. The kinetics of peptide binding
were strikingly
different: With the recombinant MHC binding domain fusion proteins of the
invention, the
kinetics of binding were much faster and a much larger fraction of the
molecules were loaded
(50% maximum binding after only 3 hours with a plateau after 18 hours). In
contrast, the kinetics
of peptide binding to DR2 from B cells were slow; the fraction of peptide
loaded molecules
slowly increased over a 48 hour period without reaching a plateau (Figure 10).
These results may
be explained by the fact that the majority of DR molecules purified from B
cells are already
occupied with high affinity peptides, as demonstrated by peptide elution
studies and crystallization
of HLA-DR1 (Chicz et al., 1993; Brown et al., 1993). In contrast, the peptide
binding site of a
large fraction of the recombinant DR2 fusion proteins is empty and readily
available for binding by
a high affinity peptide.
7. Production of- HL,A-DO MhiC Binding Domain Fusion Proteins The leucine
zipper
dimerization domains of Fos and Jun were also used to express soluble HLA-DQ
MHC binding
domain fusion proteins for DQ 1 and DQ8 alleles, which are associated with
susceptibility to
pemphigus vulgaris and insulin dependent diabetes, respectively. The same
design was used as
described above for recombinant DR2 (including splice points). Stable
transfectants were
generated using Drosoahila Schneider cells and soluble DQ molecules were
affinity purified.
Peptide binding studies using peptides that were previously shown to bind to
DQl or DQ8
demonstrated that the molecules were functional.
B. Divalent MHC Binding Domain-ImmunoUlobulin Fusion Proteins
1. DNA Constructs for Divalent MHC Bindin~ Domain Fusion Proteins. Divalent
HL,A-
DR2 MHC binding domain fusion proteins were expressed by fusing the Fc part of
IgG2a to the
3' end of the DRoc-Fos cDNA construct described above. In this design, the DRa-
Fc chain
corresponds to an antibody heavy chain and the DR/i-Jun construct to an
antibody light chain.
The DR2-IgG design was chosen both to increase the affinity for the T cell
receptor by increasing
valency, and to attach an effector domain, the Fc region of IgG2a. Complement
fixation may
result in the lysis of target T cells following binding of DR2-IgG molecules
to the T cell receptor.
DR2-IgG molecules may therefore be useful for the selective depletion of
autoaggressive T cells.
The nucleic acid sequence encoding the DR2-IgG construct is disclosed as SEQ
11?? NO:11 and
the encoded fusion protein is disclosed as SEQ ID N0:12.
CA 02321262 2000-08-18
i ..
WO 99/42597 PCT/US99103603
-59-
The Fc part of IgG2a was amplified by RT-PCR from a mouse hybridoma (L243)
that
secretes an IgG2a mAb. The PCR product was fused in frame with the DRa-Fos
construct by
overlapping PCR with a primer for the Fc part that overlapped by 20 by with
the 3' end of the
DRa-Fos construct. DRa-Fos and Fc were amplified separately, gel purified,
mixed and
amplified using oligos representing the S' end of DRa and the 3' end of IgG2a.
The construct
was cloned into the EcoRI-BamHI sites of the pRmHa-3 expression vector under
the control of
the metalothionein promoter. The insert was checked by restriction mapping and
dideoxy-
sequencing.
2. Expression of Divalent MHC Binding Domain Fusion Proteins. DR2-IgG fusion
proteins were expressed in the Drosophila Schneider cell system. The
Drosophila Schneider cell
system was chosen for the expression of the DR2-IgG fusion protein for the
following reasons:
( I ) recombinant antibodies have previously been expressed in insect cells,
(2) in the pRmHa-3
expression vector, genes are under the control of the strongly inducible
metalothionein promoter,
(3) Schneider cells can be grown to a high cell density in serum free media,
and (4) large scale
IS production of protein is more straightforward than in another insect cell
system (the Baculovirus
system) since stable transfectants are generated.
Stable transfectants were generated by the contransfecting Schneider cells
with the DRa-
IgG and DR~i chains vectors as well as with plasmid pH8C0. This vector confers
resistance to
selection by methotrexate. Transfectants were selected with 0. I ~tM
methotrexate in Schneider
media, 10% fetal calf serum. Transfectants were cloned by limiting dilution,
and the secretion of
DR2-IgG fusion proteins was examined by ELISA using an antibody specific for
the Fc segment
of IgG, as well as an antibody specific for the DRa(3 heterodimer.
Transfectants were grow to a density of-1Ox106/ml and expression was induced
by
adding CuSO.~ to a final concentration of lmM. Supernatants were harvested
five days following
induction and concentrated by ultrafiltration. DR2-IgG fusion proteins were
purified by affinity
chromatography using the L243 mAb. Purity was examined by SDS-PAGE; for
comparison,
purified mouse IgG was also run on the gel. Western blot analysis with a
poIyclonal antiserum
confirmed the identity of the two bands. Peptide binding experiments
demonstrated that DR2-
IgG fusion proteins were properly folded and functional.
C. Decavalent MHC Binding Domain-ImmunoQlobulin Fusion Proteins
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-60-
DR2-IgM fusion proteins molecules comprise ten MHC binding domains (five IgM
monomers per IgM pentamer; two MHC binding domains per IgM monomer). Since DR2-
IgG
fusion proteins have only two MHC binding domains, the functional affinity of
DR2-IgM fusion
proteins for cognate T cell receptors is expected to be much higher. A
significant increase in
affinity would improve the sensitivity for immunohistochemical staining as
well as the therapeutic
effectiveness of these molecules. DR2-IgM fusion proteins may be particularly
useful for
immunotherapy for the following reasons: ( 1 ) higher avidity for the T cell
receptors on cognate
T cells, (2) complement fixation by the Fc segment of IgM, and (3) longer
serum half life.
The Fc segment of IgM is fused in frame to the 3' end of the DRa-Fos segment,
as
previously described for the DRa-IgG construct. The nucleic acid sequence
encoding the
DR2-IgM construct is disclosed as SEQ ID N0:13 and the encoded fusion protein
is disclosed as
SEQ ID N0:13. The DRa-IgM construct is cloned into, for example, the EcoRI-
BamHI sites of
the pRmHa-3 expression vector, under the control of the inducible
metalothionein promoter
(Bunch et al., 1988). The DRa-IgM and DR~i chain fusion constructs are
cotransfected with a
gene encoding the J-chain. The J-chain facilitates assembly and secretion of
IgM molecules by
mammalian cells (Matsuuchi et al., 198G). The J-chain may be cloned into, for
example,
expression vector pUC-hygMT which confers resistance to hygromycin. Stable
transfectants may
then be selected using hygromycin at 100 ~g/ml in Schneider cell media (Sigma)
supplemented
with 10% insect cell tested fetal calf serum. Transfectants are cloned by
limiting dilution and
tested for expression of DR2-IgM fusion proteins following induction with
CuSOa.
Secretion ofDR2-IgM fusion proteins may be assessed by immunoprecipitation
with mAb
L243, followed by Western blot analysis with antibodies specific for the Fc
segment of the IgM.
For protein production, transfectants can be adapted to serum free media
(ExCell 400, JRH
Biosciences).
These constructs also can be transfected into CHO cells or into a murine B
cell line
(M12.C3). CHO cells were previously shown to secrete recombinant IgM
antibodies at high
levels and have been used for the expression of a CD2-IgM fusion protein (Wood
et al., 1990;
Arulanandam et al., 1993). For expression in these cells lines, the DRa-IgM
and DR(J chain
constructs are cloned into eukaryotic expression vectors. The DRa-IgM
construct can be cloned
into, for example, pcDNA3, which carries the neomycin resistance gene, and the
DR/3-Jun
construct can be cloned in the pcDNAI vector (Invitrogen, San Diego, CA).
Cells can be
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
-61 -
transfected by electroporation and stable transfectants can be selected with
6418. Secretion~of
DR2-IgM fusion proteins can be assessed by immunoprecipitation with mAb L243
and by
Western blot analysis.
In initial experiments, DR2-IgM fusion proteins were not secreted by
Drosophila
Schneider cells and, therefore, expression in COS cells was performed. DR2-IgM
fusion proteins
were secreted when COS cells were transfected with the cDNA constructs.
D. Multivalent MHC Binding Domain-Li~and-T~ Fusion Proteins
1. DNA Constructs for MHC Binding Domain-Biotin-Tai Fusion Proteins. Biotin
ligase
specifically biotinylates a lysine residue within a 14-amino acid recognition
sequence
(LGGIFEAMI~MELRD, SEQ 1D NO: 9) (Shatz, 1993) and, therefore, a DNA sequence
encoding this sequence was added to the DRoc-Fos construct. This "DRa-Fos-tag"
construct was
cloned into the EcoRI and SaII sites of Drosophila expression vector pRmHa-3
under the control
of the inducible metalothionein promoter. Drosoohila Schneider cells stably co-
transfected with
the DRoc-Fos-tag and DR(3-Jun constructs were generated as described above for
the DR2-IgG
l~ fusion proteins. The resulting "DR2-tag" fusion molecules differ from the
DR2-FoslJun fusion
proteins only by the addition of the biotinylation sequence tag to the C-
terminus of the DRct-Fos
construct. The DR2-tag fusion proteins were affinity purified from
supernatants using the L243
mAb as described above.
Site specific biotinylation of these DR2-tag molecules allows assembly of DR2-
tag-biotin
tetramers on avidin or streptavidin because avidin and streptavidin have four
biotin binding sites.
Thus, tetramers are made by mixing the DR2-tag-biotin molecules and
streptavidin at a 4:1 molar
ratio.
2. Biotinvlation of MHC Binding Domain-Biotin-Ta~ Fusion Proteins. A biotin
Iigase
cDNA (provided by S. Lesley, Promega Corporation) was cloned as a NdelI-XhoI
fragment into
the prokaryotic expression vector pET22b under the control of the T7 promoter.
This construct
was transfected into E. coli strain BL21/DE3 which is lysogenic for the T7 RNA
polymerise gene
under the control of the lacZ promoter. Protein expression was induced by
addition of IPTG to
1 mM for 4 hours. Cells were then harvested by centrifugation, resuspended in
20 mM Tris, pH
8.0, 100 mM NaCI. Cells were sonicated and insoluble material was removed by
centrifugation,
yielding 5 ml of a soluble cytoplasmic protein fraction from 100 ml of
culture.
CA 02321262 2000-08-18
~~t
WO 99142597 PCTNS99/03603
-62-
Biotinylation was performed at 37°C in a 100 ~tl volume with 0.1 to 101
of enzyme, 1
mM of ATP and 1 or 10 ELM of biotin. Following the reaction, recombinant DR2-
tag-biotin
molecules were captured on a 96-well plate coated with the L243 mAb and the
degree of
biotinylation was quantitated using peroxidase conjugated streptavidin. A
Western btot was
sequentially probed with a polyclonal DR antiserum and with streptavidin
peroxidase. This
experiment demonstrated specific biotinylation of the DRa chain (which carried
the 14-amino acid
biotin ligase recognition sequence) by biotin ligase.
Fluorescein-labeled streptavidin was used to examine the formation of DR2-tag-
biotin
tetramers. Fluorescein absorbs at 492 nm, allowing detection during HLPC gel
filtration
chromatography (Bio-Gel SEC 300 mm x 7.8 mm; flow rate 1 ml/min, PBS pH 6.8).
Streptavidin
(MW 60 kDa) eluted as a single peak at 8.3 minutes on the HPLC gel filtration
column. The
streptavidin-DR2-tag-biotin complex eluted at 5.8 minutes. Intermediates with
one, two or three
DR2 fi.~sion molecules bound to streptavidin were observed when smaller
amounts of DR2-tag-
biotin were used for complex formation. MW standards confirmed the predicted
molecular
IS weight of streptavidin and the streptavidin-DR complex.
3. Peptide Loadins of MHC Bindin~Domain Fusion Proteins A (His)-tagged MBP(85-
99) peptide was used to purify DR2 fusion proteins loaded with a single
peptide by metal affinity
chromatography. DR2-tag molecules were incubated with the (His)-tagged MBP
peptide and
precipitated with the metal affnity resin (Talon Metal Affinity Resin,
Clontech). DR2/peptide
complexes were eluted under mild conditions (1 mM EDTA). Eluted DR2 molecules
were
analyzed by Western blot analysis, using a polyclonal DR antiserum for
detection These
experiments demonstrated that defined DR2/peptide complexes can be generated
at a yield of
---50%.
4. Bindine of T Cells to MHC Binding Domain Biotin Tai Fusion Proteins The
binding
of T cell receptors on the surface of human T cell clones to tetravalent MHC
binding domain
biotin-tag fusion proteins was examined. Biotinylated DR2-tag molecules were
loaded with the
MBP(85-99) peptide and captured on a streptavidin coated plate; the binding of
fluorescent-
labeled T cells to immobilized DR2/peptide complexes was quantified. As a
positive control,
wells were coated with an anti-CD3 mAb.
Binding was examined using a human DR2 restricted T cell clone (Ob.lAl2)
specific for
MBP(85-99) and a DR4 restricted control clone (Go.P3.1) specific for residues
190-204 of
CA 02321262 2000-08-18
WO 99/42597 PCTNS99/03603
-63-
human desmoglein 3 protein. Specific binding to DR2/MBP(85-99) complexes was
only
observed with the MBP(85-99) specific T cell clone. Furthermore, binding was
observed only
with the DR2/MBP(85-99) complex, and not with empty DR2.
Binding was examined by capturing biotinylated DR2-tag molecules on a
streptavidin
coated plate. Non-specifcc binding sites were blocked with 0.1% BSA in PBS. T
cells were
labeled with BCEFC-AM, a fluorescent membrane probe, for 30 minutes at
37°C, washed and
added to the plate for 20 minutes at 37°C. Following three washes, the
fraction of T cells that
bound to DR2/peptide complexes or to the anti-CD3 mAb was determined in a
fluorescent plate
reader.
E. MHC Bindins Domain Conjugates with Bead Carriers
DR2-biotin tag molecules were used to generate highly multimeric MHC binding
domain
conjugates for the specific staining of antigen specific T cells. DR2/peptide
complexes were
bound to highly fluorescent microbeads, purchased from Molecular Probes
(Eugene, OR), to
which streptavidin had been conjugated. Polystyrene beads similar in size to
viral particles (40
nm) were selected based on their ability to remain soluble; these beads pellet
in an ultracentrifuge
but not under the low G-forces used to wash cells. Staining of antigen
specific T cells was
examined by FACS. For FACS staining, biotinylated mAbs specific for CD4
(positive control)
and a murine MHC class II (10-2.16) (nejative control) were used as controls.
Approximately
106 T cells were used for each assay. T cells were pelleted and resuspended in
cold PBS, 0.1%
sodium azide. Staining was observed with both DR2/NIBP(85-99) specific T cell
clones and
multivalent DR2/MBP(85-99) peptide complexes; the staining intensity was
similar to that
observed with the CD4 mAb. Binding was highly specific because a single amino
acid
substitution in the MBP peptide at a TCR contact residue greatly reduce the
staining intensity.
No staining was observed for control T cell clones specific for other MHC
class II/peptide
combinations. These control clones were specific for MBP(85-99) bound to HLA-
DQ1 (clone
HY.IB1 I), a desmoglein 3 peptide (190-204) bound to HLA-DR4 (clone Go.P3) and
a tetanus
toxoid peptide (830-843) bound to HLA-DR2a (clone Kw-TT1).
F. MHC Bindine Domains with Covalently Bound Peptides
DR2-Ig fusion proteins are generated to allow multivalent binding to TCRs on
target T
cells (2 DR2/peptide arms in the DR2-IgG fusion protein, 10 DR2/peptide arms
in the DR2-IgM
fusion protein). In order to ensure that all binding sites in these molecules
will be loaded with the
CA 02321262 2000-08-18
WO 99/42597 PC'T/US99103603
-64-
same peptide, DR2 molecules were expressed with a covalently linked MBP
peptide. The
MBP(85-99) sequence was attached to the N-terminus of the mature DR /3 chain
through a 16-
amino acid linker (linker sequence: SGGGSLVPRGSGGGGS, SEQ ID NO: 10). This
cDNA
construct was used to express DR2 molecules and DR2-IgG molecules with a
linked MBP
peptide in Drosophila Schneider cells.
G. Uses for MHC Binding Domain Fusion Proteins and Coniueates
1. Use of DR2-Ie Fusion Proteins for the Selective Depletion of T Cells DR2-Ig
fusions
proteins may be useful for the selective depletion of T cells that recognize
DR2 bound self
peptides. Binding of DR2-Ig fusion proteins by the T cell receptor may lead to
complement
fixation and lysis of target T cells. Multivalent DR2 molecules could also be
conjugated to
genistein, a tyrosine kinase inhibitor that induces apoptosis following uptake
by target cells.
2. Affinity of Multivalent DR2/Pet~tide Complexes for the T Cell Receptor The
binding
of multivalent DR2/peptide complexes to the TCR will be examined using human
DR2 restricted
T cell clones. DR2 molecules will be loaded with the MBP(85-99) peptide and
labeled with [ZSI]
using immobilized chloramine T (Iodobeads, Pierce). In the binding assay, a
fixed number of
T cells (1x106 cells, 1 ml) will be incubated with 6-10 different
concentrations ofradiolabeled
DR2/peptide complexes in PBS, 1.0% BSA, 0.02% NaN3. Radiolabeled molecules
will be used
at concentrations at which only a small fraction (less than 10%) of TCRs on
target cells will be
occupied.
First, the incubation time required to reach equilibrium will be determined;
cell-bound and
unbound DR2/peptide complexes will be separated by rapid (10-15 sec.)
centrifugation through a
layer of 84% silicone (d=1.050), I 6% paraffin oil (d=0.838}. Cell bound
radioactivity will be
quantitated in a y-counter and data will be analyzed on Scatchard plots to
determine K
(dissociation constant) and n (number of TCR molecules on target cells).
Several of controls will
be included to demonstrate specificity of binding: ( 1 ) T cell clones with an
unrelated
MHC/peptide specificity, (2) DR2/peptide complexes that were loaded with
control peptides,
and (3) Competition of binding by an excess of unlabeled DR2/peptide
complexes.
It will be of particular interest to determine the kinetics of binding by
monovalent (DR2),
bivalent (DR2-IgG) and multivalent (DR2-IgM, DR2-tetramers) molecules to the
TCR. "On"
rates will be determined by incubating target cells with radiolabeled ligands
for different time
periods at 37°C (in the presence of 0.02% sodium azide to prevent
internalization of the TCR),
CA 02321262 2000-08-18
WO 99142597 PCT/US99/036o-3
-65-
followed by rapid separation of reactants. "Off' rates will be determined by
incubating T cells
with labeled ligands until equilibrium is reached. Cells will then be washed,
incubated for different
periods of time and the amount of cell bound radioactivity will be determined.
Off rates are
expected to be significantly different for monovalent, bivalent and
multivalent ligands. Classical
studies with IgM antibodies have shown that multivalent attachment
dramatically slows the
dissociation of bound antibody (Crothers and Metzger, 1972; Hornick and
Karush, 1972).
3. Complement-Mediated Lysis of T Cells Specific for DR2 Ig Fusion Proteins
The Fc
segment of IgG2a was chosen for the DR2-IgG fusion protein because IgG2a fixes
complement.
IgM also fixes complement, allowing complement mediated lysis of target T
cells by fusion
proteins to be assessed. T cells will be incubated with DR2-IgG or DR2-IgM
complexes; cells
will then be washed and incubated with rabbit serum complement diluted in
media (1:5 to 1:20
dilution). Rabbit serum complement will be obtained form Cedarlane
Laboratories and will be
pretested to ensure that the lot does not have nonspecific cytotoxicity
against human T cells;
complement will be aliquoted and stored at -70°C. Cytotoxicity will be
determined after 30 and
60 minutes of incubation at 37°C by trypan blue staining (%
cytotoxicity = jnumber of dead cells
number of live + dead cells) x 100). A mAb specific for human CD3 (OKT3,
IgG2a) that fixes
complement will be used as a positive control. Specificity of lysis will be
assessed using control
T cell clones as well as DR2 molecules loaded with control peptides.
4. CouolinQ of DR2/Peptide Complexes to Toxins to Induce Aooptosis Multivalent
DR2
molecules of all three designs, DR2-IgG, DR2-IgM and DR2-tetramers, will be
conjugated to
toxin moieties as another means of mediating selective T cell death.
Genistein, a tyrosine kinase
inhibitor, may be particularly effective for this purpose. In a recent study,
genistein coupled to
CD19 mAb was found to be highly effective in eradicating a human B cell
Leukemia from SCm
mice (Uckun et al., 1995). A single dose of 25 p,g of a genistein-mAb
conjugate provided
complete protection from a lethal challenge with the B cell leukemia. CD19 is
a B lineage specific
surface molecule; the antibody conjugate was shown to induce apoptosis
following internalization
by receptor mediated endocytosis. T cell receptors are endocytosed following
recognition of
DR2/peptide complexes (Valitutti et al., 1995); it is therefore likely that
multivalent DR2/peptide
complexes will be taken up target T cells following binding to the T cell
receptor.
Genistein will be conjugated in multivalent DR2/peptide complexes by
photoaffinity
crosslinking using a photosensitive I 8.2 ~ long non-cleavable hetero-
bifunctional crosslinking
CA 02321262 2000-08-18
..
<J
WO 99/42597 PCTlUS99I03603
-66-
agent (Sulfo-SANPAH) as described by Uckun et al. (1995). The DR2-toxin
conjugates will be
tested using the human DR2 restricted T cell clones. T cells will be incubated
with the DR2-toxin
conjugates and the induction of apoptosis will be assessed by agarose get
electrophoresis of
genomic DNA. Nucleosomal fragmentation of DNA will be examined by ethidium
bromide
staining. DR2 molecules loaded with control peptides as well as control T cell
clones will be used
to demonstrate the specificity of apoptosis induction.
Apoptosis induction by DR2-toxin conjugates will be quantitated by flow
cytometry
following end labeling of fragmented DNA ends (TUNEL procedure). The free ends
of nuclear
DNA fragments will be labeled with dioxygenin-conjugated nucleotides, using
the enzyme
terminal deoxynucleotidyl transferase (TdT). Cells will be fixed and
permeabilized by treatment
with 70% EtOH. The 3'-OH ends of nuclear DNA fragments will be labeled with
dioxygenin-
dUTP, dioxygenin-dATP and TdT, followed by detection of labeled DNA ends with
a fluorescein
labeled anti-dioxygenin antibody (ApopTag, in situ apoptosis detection kit,
Oncor). FACS
analysis will be used to determine the fraction of cells that have undergone
apoptosis. Cells
I S grown for 12 hours at a low serum concentration ( 1 % serum) will be used
as a positive control.
Specificity of apoptosis induction will be demonstrated by using control T
cells clones and DR2
molecules loaded with control peptides.
5. T Cell Binding to Immobilized DR2/Peptide Complexes Previous studies had
demonstrated that recombinant, soluble DR2 molecules specifically bind
peptides. To examine if
recombinant DR2/peptide complexes are recognized by T cell receptors, T cell
adhesion assays
were performed using biotinylated DR2/peptide complexes that were captured on
streptavidin
coated microtiter plates. MBP(85-99) specific T cell clones and control T cell
clones were
labeled with BCEFC-AM, a fluorescent membrane probe, washed and incubated for
30 minutes at
37°C with immobilized DR2/peptide complexes. Following washing, the
fraction of bound T cells
was determined in a fluorometer. Binding of MBP(85-99) specific, DR2
restricted T cells was
only observed when DR2/MBP(85-99) complexes were used, but not when DR2
molecules were
loaded with a control peptide. Also, a single amino acid substitution at a
primary TCR contact
residue in the peptide abolished T cell binding. Binding to DR2/MBP(85-99)
complexes was not
observed with control T cell clones.
CA 02321262 2000-08-18
WO 99/42597 pCTlU599/03603
-67-
References
Acha-Orbea et al. (1988) Cell 54:263-273.
Angel et al. (1988) Nature 332:166-171.
Arano et al. (1991) Bioconi. Chem. 2:71-76.
Arulanandam et al. (1993) J. Exp. Med. 177:1439-1450.
Awa and Cresswell ( 1994) Immunity 1:763-774.
Bjorkman et al. (1987) Nature 329:512-518.
Bodmer et al. (1995) Tissue Antigens 46:1-18.
Brake (1990) Meth. Enzymol. 185:408-421.
Brown et al. (1993) Nature 364:33-39.
Bunch et al. (I988) Nucl. Acid Res. 16:1043-1061.
Chang et al. (1994) Proc. Natl. Acad. Sci (USA 91:11408-11412.
Chicz et al. (1992) Nature 358:764-768.
Chicz et al. (1993) J. Exp. Med. 178:27-47.
Chou et al. ( 1989) J. Neurosci. Res. 23:207-216.
Corr et al. (1994) Science 265:946-949.
Cosson and Bonifacino (1992) Science 258:659-662.
Cregg et al. (1987) Bio/Technolo~v 5:479-485.
Crothers and Metzger (1972) Immunochemistry 9:341-357.
Davies et al. (1994) Nature 371:130-136.
Dower et al. (1984) J. Immunol. 132:751-758.
Ebers (1996) IBC's Fourth Annual International Conference: Advances in the
Understanding and
Treatment of Multiple Sclerosis. Meeting Abstract, San Francisco 3une 1996.
Ferre-D'Amare et al. (1993) Nature 363:38-45.
Gorga et al. (1987) J. BioI. Chem. 262:16087-16094.
Gregiore et al. (1991) Proc. Natl. Acad Sci (USA) 88:8077-8081.
Hammer et al. (1994) J. Exp. Med. 180:2353-2358.
Hammer et al. (1995) J. Exp. Med. 181:1847-1855.
Hauler (1996) IBC's Fourth Annual International Conference: Advances in the
Understanding
and Treatment of Multiple Sclerosis. Meeting Abstract, San Francisco June
1996.
Heldin (1995) Cell 80:213-223.
CA 02321262 2000-08-18
WO 99142597 PCT/US99/03603
-68-
Hilbert et al. (1994) J. Neuroimmunol. 50:95-100.
Holz et al. ( 1996) J. Neurosci. 16:467-477.
Hornick and Karush (1972) Immunochemistrv 9:325-340.
Hu et al. (1990) Science 250:1400-1403.
Jardetzky et al. (1996) Proc. Natl. Acad. Sci (USA) 93:734-738.
Kabat et al. ( 1979) "Sequences of Immunoglobulin Chains: Tabulation and
Analysis of Amino
Acid Sequences of Precursors, V-Regions, C-Regions, J-Chain and ~i2-
Microglobulins,"
NIH Publication No. 80-2008, U.S. Dept. of Health Education and Welfare.
Kuby (1994) Immunolow, 2nd Edition, W.H. Freeman and Company, New York.
Leonard et al. (1984) Nature 311:626-631.
Manolios et al. (1990) Science 249:274-277.
Marrosu et al. (1988) Neu- rolo;v 38:1749-1753.
Marsh and Bodmer (1995) Tissue Antigens 45:258-280.
Matsui et al. (199I) Science 254:1788-1791.
Matsuuchi et al. (1986) Proc. Natl. Acad Sci (USA) 83:456-460.
Oas and Endow (1994) TIBS 19:51-54.
O'Shea et al. (1989) Science 245:646-648.
O'Shea et al. (1991) Science 254:539-544.
Pack and Pluckthun (1992) Bioch- emistry 31:1579-1584.
Pette et al. (1990) Proc. Natl. Acad Sci (USA) 87:7968-7972.
Potter et al. (1993) Int. Rev. Immunol 10:103-112.
Roberts et al. (1996) J. Biomed. Mat. Res 30:53-56.
Sato et al. (1989) Biochem. Biophys Res Comm 163:1473-1480.
Schatz (1993) Bio/TechnoloQV 11:1138-I 143.
Sharma et al. (1991) Proc. Natl. Acad Sci (USA) 88:11465-I 1469.
Spielman and Nathenson (1982) Epidemiol. Rev 4:45-65.
Steinman (1996) Cell 85:299-302.
Stern and Wiley ( 1992) Cell 68:465-477.
Stern et al. (1994) Nature 368:215-221.
Strominger and Wiley (1995) JAMA 274:1074-1076.
Suda et al. (1993) CeII 75:1169-1178.
CA 02321262 2000-08-18
WO 99142597 PCT/US99/0360'3
-69-
Sykulev et al. (1994) Proc. Natl. Acad. Sci.,~USAI 91:'11487-11491.
Todd et al. {1988) Science 240:1003-1009.
Uckun et al. (1995) Science 267:886-891.
Valitutti et al. (1995) Nature 375:148-151.
Valli et al. (1993) J. Clin. Invest. 91:616-628.
van Straaten et al. (1983) Proc. Natl. Acad. Sci (USA) 80:3183-3187.
Viskochil et al. (1991) Mol. Cell. Biol. I1:906-912.
Weber et al. (1992) Nature 356:793-796.
Wettstein et al. ( 1991 ) J. Exp. Med. 174:219-228.
Wood et al. (I990) J. Immunol. 145:301 I-3016.
Wucherpfennig and Strominger (1995a) Cell 80:695-705.
Wucherpfennig and Strominger (1995b) J. Exp. Med. 18I:1597-1601.
Wucherpfennig et al. (1991) Immunol. Today 12:277-282.
Wucherpfennig et al. ( 1994a) J. Exp. Med. I 79:279-290.
Wucherpfennig et al. (1994b) J. Immunol. 150:5581-5592.
Wucherpfennig et al. ( I 995) Proc. Natl. Acad. Sci (USA) 92:8896-8900.
CA 02321262 2000-08-18
WO 99!42597 PCTNS99103603
SEQUENCE LISTING
<110> WUCHERPFENNIG, Kai W
STROMINGER, Jack L
<120> MONOVALENT, MULTIVALENT AND MULTIMERIC MHC fiINDING
DOMAIN FUSION PROTEINS AND CONJUGATES, AND USES
THEREFOR
<130> HAR-005PC
<190>
<141>
<160> 19
<170> Patentln Ver. 2.0
<210> 1
<211> 750
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DR2-Fos fusion
<220>
<221> CDS
<222> (1)..(735)
<220>
<221> mist feature
<222> (1).-(21)
<223> 3' end of secretory signal
<220>
<221> misc_structure
<222> (22) .(594)
<223> DRA*0101 ertracellular domain
<220>
<221> mist feature
<222> (595T..(615)
<223> Linker sequence
<220>
<221> mist feature
<222> f616>..(735)
<223> Fos leucine zipper domain
<400> 1
gta tct ctc gag aaa aga aag atc aaa gaa gaa cat gtg atc atc tag 48
Val Ser Leu Glu Lys Arg Glu Ile Lys Glu Glu His Val Ile Ile Gln
1 5 10 15
gccgagttctatctgaat cctgaccaatcaggcgagtttatgtttgac 96
AlaGluPheTyrLeuAsn ProAspGlnSerGlyGluPheMetPheAsp
20 25 30
tttgatggtgatgagatt ttccatgtggatatggcaaagaaggagacg 144
PheAspGlyAspGluIle PheHisValAspMetAlaLysLysGluThr
35 90 45
gtctggcggcttgaagaa tttggacgatttgccagctttgaggetcaa 192
ValTrpArgLeuGluGlu PheGlyArgPheAlaSerPheGluAlaGln
50 55 60
ggtgcattggccaacata actgtggacaaagccaacttggaaatcatg 290
GlyAlaLeuA1aAsnIle AlaValAspLysAlaAsnLeuGluIleMet
65 70 75 80
acaaagcgctccaactat actccgatcactaatgtacctccagaggta 288
ThrLysArgSerAsnTyr ThrProIleThrAsnValProProGluVal
85 90 95
actgtgctcacgaacagc cctgtggaactgagagagcccaacgtcctc 336
ThrValLeuThrAsnSer ProValGluLeuArgGluProAsnValLeu
100 105 110
CA 02321262 2000-08-18
WO PCT/US99I03603
99/42597
2
atctgtttcatagacaagttcacccca ccaatggtcaatgtcacg tgg384
IleCysPheIleAspLysPheThrPro ProValValAsnValThr Trp
115 120 125
cttcgaaatggaaaacctgtcaccaca ggagtgtcaaagacagtc ttc432
LeuArgAsnGlyLysProValThrThr GlyValSerGluThrVal Phe
130 135 190
ctgcccagggaagaccaccttttccgc aagttccactatctcccc ttc480
LeuProArgGluAspHisLeuPheArg LysPheHisTyrLeuPro Phe
145 150 155 160
ctgccctcaactgaggacgtttacgac tgcagggtggagcactgg ggc528
LeuProSerThrGluAspValTyrAsp CvsArgValGluHisTrp Gly
165 170 175
ttggatgagcetettctcaagcactgg gagtttgatgetceaagc eet576
LeuAspGluProLeuLeuLysHisTrp GluPheAspAlaProSer Pro
180 185 190
ctcccagagactacagaggtcgacgga ggtggcggcggtttaact gato24
LeuProG1uThrT_hrGluValAspGly GlyGlyGlyGlvLeuThr Asp
195 200 205
acactccaagcggagacagatcaactt gaagacgagaagtctgcg ttg672
ThrLeuGlnAlaGluThrAspGlnLeu GluAspGluLysSerAla Leu
210 215 220
cagaccgagattgccaatctactgaaa cagaagaaaaaactggag ttc720
GlnThrGluIleAlaAsnLeuLeuLys GluLvsGluLysLeuGlu Phe
225 230 235 240
atcctggccgcccattgagaattct atgac 750
IleLeuAlaAlaHis
245
<210> 2
<211> 245
<212> PRT
<213> Artificial Seouence
<400> 2
Val Ser Leu Glu Lys Arg Glu Ile Lys Glu Glu His Val Ile Ile Gln
1 5 10 15
nla Glu Phe Tyr Leu Asn Fro Asp Gln Set Gly Glu Phe Met Phe Asp
20 25 30
Phe Asp Glv P.sp Glu T_le Phe His Val Asp Met Ala Lys Lys Glu Thr
35 40 45
Val Trp Arg Leu Glu Glu Phe Gly Arg Phe Ala Ser Phe Glu Ala Gln
50 55 60
Gly Ala Leu Ala Asn Ile Ala Val Asp Lys Ala Asn Leu Glu Ile Met
65 70 75 80
Thr Lys Arg Ser Asn Tyr Thr Pro Ile Thr Asn Val Pro Pro Glu Val
85 90 95
Thr Val Leu Thr Asn Ser Pro Val Glu Leu Arg Glu Pro Asn Val Leu
100 105 110
Ile Cys Phe Ile Asp Lys Phe Thr Pro Pro Val Val Asn Val Thr Trp
115 120 125
Leu Arg Asn Gly Lys Pro Val Thr Thr Gly Val Ser Glu Thr Val Phe
130 135 140
Leu Pro Arg Glu Asp His Leu Phe Arg Lys Phe His Tyr Leu Pro Phe
145 150 155 160
Leu Pro Ser Thr Glu Asp Val Tyr Asp Cys Arg Val Glu His Trp Gly
165 170 175
Leu Asp Glu Pro Leu Leu Lys His Trp Glu Phe Asp Ala Pro Ser Pro
180 185 190
CA 02321262 2000-08-18
WO 99/42597 PCTIUS99/0360'3
3
Leu Pro Glu Thr Thr Glu Val Asp Gly Gly Gly Gly Gly Leu Thr Asp
195 200 205
Thr Leu Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys Ser Ala Leu
210 215 220
Gln Thr Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lys Leu Glu Phe
225 230 235 24C
Ile Leu P.la Ala His
295
<210> 3
<211> 771
<212> DNA
<213> Artificialuence
Seq
<220>
<223> DescriptionArtificial Sequence:
of DR2-Jun
fusion
<220>
<221> CDS
<222> (1)..(756)
<220>
<221> mist feature
<222> ill.-;21)
<223> 3' end etorl gnal
c_ sect si
<220>
<221> misc
feature
_
<222> (22) .(615)
<223> DRB11501 acellular
extr domain
<22C>
<22i> mist feature
<222> (616l..S636)
<223> Linker e
sequenc
<220>
<221> mist feature
<222> (637j..(7561
<223> Jun leucinepperdomain
:.i
<900> 3
ata tct ctc gag agagagggggacactcgaccacgtttcctgtgg 48
aaa
Val Ser Leu Glu ArgGluGlyAspThrArgProArgPheLeuTrp
Lys
1 5 i0 15
tag cct aag agg tatcatttcttcaatgggacggagcgggtgcgg 96
gag
Gln Pro Lys Arg CysHisPhePheAsnGlyThrGluArgValArg
Glu
~20 25 30
ttc ctg gac aga ttctataactagaagaagtccgtgcgcttcgac 144
tat
Phe Leu Asp Arg PheTyrAsnGlnGiuGluSerValArgPheAsp
Tyr
35 40 45
agc gac gtg ggg ttccgggcggtgacggagctggggcggcctgac 192
gag
Ser Asp Val Gly PheArgAlaValThrGluLeuGlyArgProAsp
Glu
50 55 60
get gag tat tgg agctagaaggacatcctggagtaggcgegggce 240
aac
Ala Glu Tyr Trp SerGlnLysAspIleLeuGluGlnAlaArgAla
Asn
65 70 75 80
gcg gtg gac act tgcagacataactatggggttgtggagagcttc 288
tat
Ala Val Asp Thz CysArgHisAsnTyrGlyValValGluSerPhe
Tyr
85 90 95
aca gtg tag cgg gtccaacctaaggtgactgtatatccttcaaag 336
cga
Thr Val Gln Arg ValGlnProLysValThrValTyrProSerLys
Arg
100 105 110
act tag ccc ctg catcataacctcctggtctgctctgtgagtggt 384
tag
Thr Gln Pro Leu HisHisAsnLeuLeuValCys5erValSerGly
Gln
115 120 125
ttc tat cca ggc attgaagtcaggtggttcctgaacggctaggaa 432
agc
CA 02321262 2000-08-18
WO 99/42597 PCTIUS99/03603
4
Phe Tyr Pro Gly Ser Ile Glu Val Arg Trp Phe Leu Asn Gly Gln Glu
130 135 140
gag aag get ggg atg gtg tec aca ggc etg ate cag aat gga gac tgg 980
Glu Lys Ala Gly Met Val Ser Thr Gly Leu Ile Gln .sn Gly Asp Trp
145 150 155 160
acc ttc cag acc ctg gtg atg ctg gaa aca gtt cct cga agt gga gag 528
Thr Phe Gln Thr Leu Val Met Leu Glu Thr Val Pro Arg Ser Gly Glu
i65 170 175
gtt tac acc tgc caa gtg gag cac cca agc gtg aca agc cct ctc aca 576
Val Tyr Thr Cvs Gln Val Glu His Pro Ser Val Thr Ser Pro Leu Thr
180 185 190
gtg gaa tgg aga gca cgg tct gaa tct gca cag agc aag gtc gac gga 624
Val Glu igp Arg Ala Arg Ser Glu Ser Ala G1n Ser Lvs Val Asp Gly
200 205
ggt ggc ggc ggt cgc atc gcc cgg ctc gag gaa aaa gLg aaa acc ttg 672
Gly Gly Gly Gly Arg Ile .wla Arg Leu Glu Glu Lt's Val Lys Thr Leu
210 215 2?p
aaa get cag aac tcg gag ctc gcg tcc aeg gcc aac atg ctc agg gaa 720
Lys Ala Gin Asn Ser Glu Leu Ala Se. Thr Ala Asn Net Leu Arg Glu
225 230 235
290
cag gtg gca cag ctt aaa cag aaa gtc atg aac cat ~gagaattct atgac 77i
Gln Val .yla Gln Leu Lys Gln Lys Val Met Asn His
295 250
<210> 4
<211> 252
<212> PRT
<213> Artificial Seauence
<400> 9
Vai Ser Leu Glu Ly5 Arg Glu Gly Asp Thr Arg Pro Arg Phe Leu Trp
10 15
Gln Pro Lys Ara Glu Cys His Phe Phe Asn Gly Thr Glu Arg Val Arg
20 25 30
Phe Leu A3p Arg Tyr Phe Tyr Asn Gln Glu Glu Ser Val Arg Phe Asp
90 q5
Ser ASpO Val Gly Glu Phe Arg Ala Val Thr Glu Leu Gly Arg Pro Asp
... 5 6 O
Ala G1u T_.~r Trp .~.sn Ser Gln Lys Asp Ile Leu Glu Gln Ala Arg Ala
65 70 75 80
Ala Val Asp Thr Tyr Cys Arg His Asn Tyr Gly Val Val Glu Ser Phe
85 90 95
Thr Val Gln Arg Arg Val Gln Pro Lys Val Thr Val Tyr Pro Ser Lys
loo los llo
Thr Gln Pro Leu Gln His His Asn Leu Leu Val Cys Ser Val 5er Gly
115 120 125
Phe T3r0 Pro Gly Ser Ile Glu Val Arg Trp Phe Leu Asn Gly Gln Glu
135 lq0
Glu Lys Ala Gly Met Val Ser Thr Gly Leu Ile Gln Asn Gly Asp Trp
145 150 155
160
Thr Phe Gln Thr Leu Val Met Leu Glu Thr Val Pro Arg Ser Gly Glu
165 170 175
Val Tyr Thr Cys Gln Val Glu His Pro Ser Val Thr Ser Pro Leu Thr
1B0 185 190
Val Glu i95 Arg Ala Arg Ser Glu Set A1a Gln Ser ~OyS Val Asp Gly
200
Gly Gly Gly Gly Arg Ile Ala Arg Leu Glu Glu Lys Val Lys Thr Leu
210 - 215 220
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
5
Lys Ala Gln Asn Ser Glu Leu F;la Se_- Thr Ala Asn Met Leu Arg Glu
225 230 235 2q0
Gln Val Ala Gin Leu Lys Gln Lys Val Met Asn His
245 250
<210> 5
<211> 42
<212> DNA
<213> P.rtificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic PCR
primer
<900> 5
gtatctctcg agaaaagaga gatcaaagaa aaacatgtga tc q2
<210> 6
<211> 35
<212> DNA
<213> Artificial 5eauence
<220>
<223> Description of Artificial Sequence: Synthetic PCR
primer
<400> 6
gtcatagaat tctcaatggg cggccaggat gaactccag 39
<210> 7
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic PCR
primer
<400> 7
gtatctctcg agaaaagaga gggggacacc cgaccacgtt tc q2
<210> 8
<211> 39
<212> DNA
<213> Arti_icial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic PCR
primer
<400> 8
gtcatagaat tctcaatggt tcatgacttt ctgtttaag 39
<210> 9
<211> 14
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic,
biotin ligase recognition sequence
<900> 9
Lei Gly Gly Ile Ph5 Glu Ala Met Lys Met Glu Leu Arg Asp
10
<210> 10
<211> 16
<212> PRT
<213> Artificial Sequence
CA 02321262 2000-08-18
WO 99/42597 PCTIUS99/03603
6
<220>
<223> Description of Artificial Sequence: Synthetic,
linker sequence
<400> 10
Sei Gly Gly Gly Se5 Leu Val Pro Arg Gly Ser Gly Gly Gly Glv Ser
10 15
<210> 11
<211> 1446
<212> DNA
<213> Artificial Sequence
<220>
<223> Description tificialSequence: gG
of Ar DR2-I
fusion
<220>
<221> CDS
<222> (1)..(1437)
<220>
<221> mist feature
<222> (1).-(15)
<223> 3' end ry ignal
of secreto s
<220>
<221> mist feature
<222> (16)-.(588)
<223> DRA*0101 acellular
extr domain
<220>
<221> mist feature
<222> (589'.
. ( 609 )
<223> Linker
<220>
<221> mist feature
<222> (610)..(729)
<223> Fos leucineipper
s domain
<220>
<221> mist feature
<222> (7301..(1437)
<223> IgG domain
<900> 11
ctc gag aaa atc aaagaagaacatgtgatcatctaggccgag 98
aga gag
G
Leu Ile LysGluGluHisVa_IleIleGlnAlaGlu
lu Lys Arg Glu
1 5 10 15
ttc tat ctg gac caatcaggcgagtttatgtttgactttgat 96
aat cct
Phe Tyr Leu Asp GlnSerGlyGluPheMetPheA PheAsp
Asn Pro p
20 25 3
0
ggt gat gag cat gtggatatggcaaagaaggagacggtctgg 149
att ttc
Gly Asp Glu His ValAQpMetAlaLysLysGluThrValTrp
Ile Phe
35 O 45
cgg ctt gaa gga cgatttgccagctttgaggetcaaggtgca 192
gaa ttt
Arg Leu Glu Gly ArgPheAlaSerPheGluAlaGlnGlyAla
Glu Phe
SO 55 60
ttg gcc aac gtg gacaaagccaacttggaaatcatgacaaag 240
ata get
Leu Al
a Asn Ile Ala Val AspLysAlaAsnLeuGluIleMetThrLys
65
70 75 80
cgc tcc aac ccg atcactaatgtacctccagaggtaactgtg 288
tat act
Arg 5er Asn Pro IleThrAsnValProProGluValThrVal
Tyr Thr
85 90 95
ctc acg aac gtg gaactgagagagcccaacgtcctcatctgt 336
agc cct
Leu Thr Asn Val GluLeuArgGluProAsnValLeuIleCys
Ser Pro
100 105 110
ttc ata gac act ccaccagtggtcaatgtcacgtggcttcga 3B4
aag ttc
Ph
e Ile Asp Lys Thr ProProValValAsnValThrTrpLeuArg
Phe
115 _ 120 125
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
7
aat gga aaa cct gtc a~c aca gga gtg tca gag aca ctc ttc ctg ccc 432
Asn Gly Lys Pro Val Thr Thr Gly Val Ser Glu Tht Vai Phe Leu Pro
130 135 140
agg gaa gac cac ctt ttc cgc aag ttc cac tat ctc ccc ttc ctg ccc 9B0
Arg Glu Asp His Leu Phe Arg Lys Phe His Tyr Leu Fzo Phe Leu Pro
145 150 155
160
tca act gag gac gtt tac gac tgc agg gtg gag cac tgg ggc ttg qat 528
Ser Thr Glu Asp Val Tyr Asp Cys Arg Val Glu His Trp Gly Leu Asp
165 170 175
gag cct ctt ctc aag cac tgg gag ttt gat get cca agc cct ctc cca 576
Glu Pro Leu Leu Lys His Trp Glu Phe Asp Ala Pro Set Pro Leu Pro
180 185 190
gag act aca gag gtc gac gga ggt ggc ggc ggt tta act gat aca ctc 624
Glu Thr Thr Glu Val Asp Gly Glv Gly Gly Gly Leu Thr Asp Thr Leu
195 200 205
caa gcg gag aca gat caa ctt gaa gac gag aag tct gcg ttg cag acc 672
Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys Ser Ala Leu Gln Thr
210 215 220
gag att gcc aat cta ctg aaa gag aag gaa aaa ctg gag ttc atc ctg 720
Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lvs Leu Glu Phe Ile Leu
~25 230 235
40
gcc gcc cat gca gca tct gag ccc aga ggg ccc aca atc aag ccc tgt 768
Ala Ala His Aia Ala Ser Glu Pro Arg Glv Pre Thr Ile Lys Pro Cys
245 250 255
cct cca tgc aaa tgc cca gca cct aac ctc ttg ggt gga cca tcc gtc 816
Pro Pro Cys Lys Cys Fro Ala Pro Asn Leu Leu Gly Gly Pro Ser Val
260 265 270
ttc atc ttc cct cca aag atc aag gat gta ctc atg atc tcc ctg agc 869
Phe Ile Phe Pro Pro Lys Ile Lvs Asp Val Leu Met Ile Ser Leu Ser
275 280 285
ccc ata gtc aca tgt gtg gtg gtg gat gtg agc gag gat gac cca gat 912
Fro Ile Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro Asp
290 295 300
gtc cag atc agc tgg ttt gtg aac aac gtg gaa gta cac aea get cag 960
Val Gln Ile Ser Trp Phe Val Asn Asn Vai Glu Val His Thr Ala Gln
305 310 315 320
aca caa acc cat aga gag gat tac aac agt act ctc cgg gtg gtc agt 1008
Thr Gln Thr His 325 Glu Asp Tyr Asn Ser Thr Leu Arg Val Val Se=
330 335
gcc ctc ccc atc cag cac cag gac tgg atg agt ggc aag gag ttc aaa 1056
Ala Leu Pro _Tle Gin His Gln Asp Trp Met Ser Gly Lys Glu Phe Lys
340 345 350
tgc aag gtc aac aac aaa gac ctc cca gcg ccc atc gag aga acc atc 1104
Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro Ile Glu Arg Thr Ile
355 360 365
tca aaa ccc aaa ggg tca gta aga get cca cag gta tat gtc ttg cct 1152
Ser Lys Pro Lys Gly Ser Val Arg Ala Pro Gln Val Tyr Val Leu Pro
370 375 380
cca cca gaa gaa gag atg act aag aaa cag gtc act ctg acc tgc atg 1200
Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cys Met
385 390 395 400
gtc aca gac ttc atg cct gaa gac att tac gtg gag tgg acc aac aac 1248
Val Thr Asp Phe Met Pro Glu Asp Ile Tyr Val Glu Trp Thr Asn Asn
405 410 415
ggg aaa aca gag cta aac tac aag aac act gaa cca gtc ctg gac tct 1296
Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr Glu Pro Val Leu Asp Ser
420 425 430
gat ggt tct tac ttc atg tac agc aag ctg aga gtg gaa aag aag aac 1344
Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val Glu Lys Lys Asn
CA 02321262 2000-08-18
WO 99142597 PCT/US99/03603
8
435 940 445
tgg gtg gaa aga aat agc tac tcc tgt tca atg gtc cac gag agt ctg 1392
Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val Val His Glu Giy Leu
450 455 960
cac aat cac cac acg act aag agc ttc tcc cgg act ccg ggt aaa 1437
His Asn His His Thr Thr Lys Ser Phe Ser Arg Thr Pro Gly Lys
465 970 975
tgagaattc 1996
<210> 12
<211> 979
<212> PRT
<213> Artificial Sequence
<900> 12
Leu Glu Lys Arg Glu Ile Lys Glu Glu His Val Ile Ile Gln- Ala Glu
i0 15
Phe Tyr Leu Asn Pro Asp Gln Ser Glv Glu Phe Met Phe Asp Phe Asp
20 25 30
Gly Asp Glu Ile Phe His Val AQpO Met Ala Lys Lys Glu Thr Val Trp
35 45
Arg Leu Glu Glu Pile Gly Ara Phe .via Ser Phe Glu Ala Gln G1V Ala
50 55 60
Leu Ala Asn Ile :.la Val Asp Lys A1~ Asn Leu Glu Ile Met Thr Lvs
65 70 75 80
Arg Ser Pan Tyr Thr Pro Ile Thr Asn Val Pro Pro Glu Val Thr Val
85 , 90 45
Leu T2:r Asn Ser Pro Val Glu Leu .~.rg Glu Pro Asn Val Leu Ile Cvs
100 105 110 -
Phe Ile Asp L_~s Phe Thr Pzo Pro Val Val Asn Val Thr Trp Leu Arg
115 120 125
Asn Gly Lys Pro Val Thr Thr Gly Val Ser Glu Thr Val Phe Leu Pro
130 135 140
Azg Glu Asp His Leu Phe Arg Lys Phe His Tvr Leu Pro Phe Leu Pro
195 150 155 160
Ser Thr Glu Asp Val T=r Asp Cys .=,rg Val Giu His Trp Gly Leu Asp
165 170 175
Glu Pro Leu Leu Lys His Trp Glu Phe Asp Ala Pro Ser Pro Leu Pro
1B0 185 190
Glu Thr Thr Glu Val Asp Gly Gly Gly Gly Gly Leu Thr Asp Thr Leu
195 200 205
Gln Ala Glu Thr Asp Gln Leu Glu Asp Glu Lys Ser Ala Leu Gln Thr
210 2I5 220
Glu Ile A1a Asn Leu Leu Lys Glu Lys Glu Lvs Leu Glu Phe Ile Leu
225 230 235 240
Ala Ala His Ala Ala Ser Glu Pro Arg Gly Pro Thr Ile Lys Pro Cys
245 250 255
Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Leu Gly Gly Pro Ser Val
260 265 270
Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu Met Ile Ser Leu Ser
275 280 285
Pro Ile Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro Asp
290 295 300
Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala Gln
305 310 315 320
CA 02321262 2000-08-18
WO 99/42597 PCTIUS99/03603
9
Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Leu Arg Val Val Ser
325 330 335
Ala Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe L_vs
340 345 350
Cys Lys Val Asn Asn Lys Asp Leu Pro Ala pro Ile Glu Arg Thr Ile
355 360 365
5er 3~o Pro Lys Gly Ser Val Arg R1a Pro Gln Val Tyr Val Leu Pro
375 380
Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cus Met
385 390 395 -
400
Val Thr Asp Phe Me: Pro Glu Asp Ile Tyr Val Glu Trp Thr Asn Asn
405 410 415
Gly Lys Thr Glu Leu Asn Tyr Lys 425 Thr Glu pro Val Leu Asp Ser
420 930
Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val Glu Lys Lys Asn
935 440 995
Trp Val Glu P.rg Asn Ser Tyr Ser Cys Ser Val Val His Glu Gly Leu
450 455 960
His Asn His His Tt;r T!:_ Lys Ser Phe Ser Are Thr Fro Gly Lys
465 470 47c
<210> 13
<211> 1851
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: DR2-IgM
fusion
<220>
<221> CDS
<222> (1)..(1936)
<220>
<221> mist feature
<222> (1).-(75)
<223> 3' end of secretory signal
<220>
<221> mist feature
<222> (76)-.(648)
<223> DRA*OlOl~extracellular domain
<220>
<221> mist feature
<222> (6491..1669?
<223> Linker
<220>
<221> mist feature
<222> (6701..(789)
<223> Fos leucine zipper domain
<220>
<221> mist feature
<222> (790..(1836)
<223> IgG domain
<400> 13
atg gce ata agt gga gtc cet gtg eta gga ttt ttc atc ata get gtg 98
Met Ala Ile Ser Gly Val Pro Val Leu Gly Phe Phe Ile Ile Ala Val
1 5 10 15
ctg atg agc get tag gaa tca tgg get atc aaa gaa gaa cat gtg atc 96
Leu Met Ser Ala Gln Glu Ser Trp Ala Ile Lys Glu Glu His Val Ile
20 25 30
atc tag gcc gag ttc tat ctg aat cct gac caa tca ggc gag ttt atg 144
CA 02321262 2000-08-18
WO 99/42597 PCT/US99103603
10
Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp Gln Ser Gly Glu Phe Met
35 90 95
ttt gac ttt gat ggt gat gag at. ttc cat eta gat atg gca aag aag 19~
Phe Asp Phe Asp Gly Asp Glu Ile Phe His Val Asp Met Ala Lys Lys
50 55 60
gag acg gtc tgg cgg ctt gaa gaa ttt gga cga ttt gcc agc ttt oag 240
Glu Thr Val Trp Arg Leu Glu Glu Phe Gly Arg Phe Ala Ser Phe Glu
65 70 75 80
g~t caa ggt gea ttg gec aac ata get gta gac aaa acc aac ttg aaa 286
Ala Gln Gly Ala Leu Ala Asn Ile Ala Val Asp Lys A1a Asn Leu Giu
85 90 95
atc atg aca aag cgc tcc aac tat act ccg atc acc aat gta cct cca 330
Ile Met Thr Lvs Arg 5er Asn Tyr Thr Pro Ile Thr Asn Val Pro Pro
100 105 110
gag gta act gtg ctc acg aac agc cct gtg gaa ctg aga gag ccc aac 384
Glu Val Thr Va; Leu Thr Asn Ser Pro Val Glu Leu Arg Giu Prc I-~.sn
115 120 125
gtc ctc atc tgt ttc ata gac aag ttc acc cca cca gtg gtc aat gtc 932
Val i30 Ile Cys Phe Ile A~p Lys Phe T:r Pro Pro Val Val Asn Val
1..5 190
acg tag ctt cca aat gga aaa cct gtc acc aca ~ga gtg tca gag acu 980
r Trp Leu Arg Asn Giy Lys Pro Val Thr Thr Gly Val Ser Glu Thr
145 150 155
160
gtc ttc ctg ccc agg gaa gac cac ctt ttc cgc aag ttc cac tat ctc 528
Val Phe Leu Pro Arg Glu Asp His Leu Phe Arg Lys Phe His Tvr Leu
165 1 70 1'75
ccc ttc ctg ccc tca act gag gac gtt tac gac tgc agg gtg gag cac 570
Pro PhE Leu Pro Ser Thr Glu ysp Val Tyr Asp Cys Arg Val Glu His
180 165 i90
tgg ggc ttg gat gag cct ctt ctc aag cac tgg gag ttt gat act cca 624
Trp Glv Leu Asp Glu Pro Leu Leu Lys His Trp Glu Phe Asp Ala Pro
195 200 205
agc cct ctc cca gag act aca gag gtc gac gga ggt ggc ggc ggt tt~ 672
Ser Pro Leu Pro Glu Thr Thr Glu Val Asp Gly 22y0 Gly Gly Gly Leu
210 215
act gat aca ctc caa gcg gag aca gat caa ctt gaa gac gag aag tct 720
Thr Asp Thr Leu Gln A1a G1U ThL ASD Gin Leu Glu Asp Glu Lys Ser
225 230 2
35 290
gcg ttg cag acc gag att gcc aat cta ctg aaa gag aag gaa aaa ctg 768
Ala Leu Gln Thr Glu Ile Ala Asn Leu Leu Lys Glu Lys Glu Lvs Leu
245 250 255
gag ttc atc ctg gcc gcc cac gtc gca gaa atg aac ccc aat gta aat 816
Glu Phe I1e Leu Ala Ala His Val Ala Giu Met Asn Pro Asn Val Asn
260 265 270
gtg ttc gtc cca cca cgg gat ggc ttc tct ggc cct gca cca cgc aag B69
Val Phe Val Pro Pro Arg Asp Gly Phe Ser Gly Pro Ala Pro Arg Lys
275 260 285
tct aaa ctc atc tgc gag gcc acg aac ttc act cca aaa ccg atc aca 912
Ser Lys Leu Ile Cys Glu Ala Thr Asn Phe Thr Pro Lys Pro Ile Thr
290 295 300
gta tcc tgg cta aag gat ggg aag ctc gtg gaa tct ggc ttc acc aca 960
Val Ser Trp Leu Lys Asp Gly Lys Leu Val Glu Ser Gly Phe Thr Thr
305 310 315
320
gat ccg gtg acc atc gag aac aaa gga tcc aca ccc caa acc tac aag 1008
Asp Pro Val Thr Ile Glu Asn Lys Gly Ser Thr Pro Gln Thr Tyr Lys
325 330 335
gtc ata agc aca ctt acc atc tct gaa atc gac tgg ctg aac ctg aat 1056
Val Ile Sez Thr Leu Thr Ile Ser Glu Ile Asp Trp Leu Asn Leu Asn
390 345 350
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
11
gtg tac acc tgc cgt gtg gat cac agg ggt ctc acc ttc ttg aag aac 1104
Val Tyr Thr Cys Arg Val Asp His Arg Giy Leu Thr Phe Leu Lys Asn
355 360 365
gtg tcc tcc aea tgt get gce agt ecc tcc aca gat atc ctt aat ttt 115?
Val Ser 5er Thr Cys Ala Ala Ser Pro Ser Thr Asp Iie Leu Asn Phe
370 375 380
act att eet cet tcc ttt gcc gac atc ttc ctt agc aag tcc get aac 1200
Thr Ile Pro Pro Ser Phe i-.la Asp Ile Phe Leu Ser Lys Ser Ala Asn
385 390 395
400
ctg acc tat ctg gtc tca aac ctg gca acc tat gaa acc ctg agt atc 1248
Leu Thr Cys Leu Val Ser Asn Leu Ala Thr Tyr Glu Thr Leu Ser Ile
405 410 415
tcc tgg get tct caa agt ggt gaa cca ctg gaa acc aaa att aaa atc 1296
Ser Trp P.la Ser Gln Ser Gyy Glu Pro Leu Glu Thr Lys Ile Lys Ile
420 425 430
atg gaa agc cat cec aat ggc aec ttc agt act aag gat gtg get agt 1349
Met Glu Ser His Pro Asn Giy Thr Phe Ser Ala Lys Glv Vai Ala Ser
435 940 445
gtt tgt gtg gaa gac tgg ast aac agg aag gaa ttt gtg tat act gtg 1392
Val Cys Val Glu Asp Trp Asn Asn Arg Lys Glu Phe Val Cvs Thr Val
450 455 460
act cac agg cat ctg cct tca cca cag aag aaa ttc atc tca aaa ccc 1440
Thr His Arg Asp Leu Fro Ser Fro Gln Lys Lvs Phe Ile Ser Lys Pro
465 47C 475
480
aat gag gtg cac aaa cat eca ect get gta tac ctg ctg cca cca get 1488
Asn Glu Val His Lys His Pre Pro Ala Val Tyr Leu Leu Pro Pre Ala
485 490 495
cgt gaa caa ctg aac ctg agg gag tca gcc aca gtc acc tgc ctg gtg 1536
Arg Glu Gln Leu Asn Leu Arg Glu Ser .~.la Thr Val Thr Cys Leu Val
500 505 510
aag ggc ttc tct cct gca gac atc tct gtg caa tgg aag cag agg ggc 1589
Lys Gly Phe Ser Pro ,'-,la Asp Ile Ser Val Gln Trp Lys Gln Arg Gly
515 520 525
cag ctc tta ccc cag gag aag tat gtg acc agt gcc ccg atg cca gag 1632
Gln Leu Leu Pro Gin Glu Lvs Tyr Val Thr Ser Ala Pro Met Pro Glu
530 535 590
cct ggg gcc cca ggc ttc tac ttt acc cac agc atc ctg act gtg aca 1680
545 Gly Ala Pro Gly Phe Tyr Phe Thr His Ser Ile Leu Thr Val Thr
550 555 560
gag gag gaa tgg aac tcc gaa gag acc tat acc tat gtt gta ggc cac 1728
Glu Glu Glu Trp Asn Ser G7.y Glu Thr Tvr Thr Cys Val Val Glv His
565 570 575
gag gcc ctg cca cac ctg gtg acc gag agg acc gtg gac aag tcc act 1776
Glu A1a Leu Pro His Leu Val Thr Glu Arg Thr Val Asp Lys Ser Thr
580 585 590
ggt aaa ccc aca ctg tac aat gtc tcc ctg atc atg tct gac aca ggc 1829
Gly Lys Pro Thr Leu T~~r Asn Val Ser Leu Ile Met Ser Asp Thr Gly
595 600 605
ggc acc tgc tat tgaagatctg tcgac 1851
Gly Thr Cys Tyr
610
<210> 14
<211> 612
<212> PRT
<213> Artificial Sequence
<400> 19
Met Ala Ile Ser Gly Val Pro Val Leu Gly Phe Phe Ile Ile Ala Val
1 5 10 15
Leu Met Ser Ala Gln Glu Ser Trp Ala Ile Lys Glu Glu His Val Ile
CA 02321262 2000-08-18
WO 99/42597 PCT/US99I03663
12
20 25 30
Ile Gln Ala Glu Phe Tyr Leu Asn Pro Asp Gln Ser Gly Glu Phe Met
35 90 45
Phe A5p0 Phe Asp Gly Asp Glu Ile Phe His Vai Asp Met A1a Lys Lys
55 60
Glu Thr Val Trp Arg Leu Glu Glu Phe Gly Arg Phe Ala Ser Phe Glu
65 70 75 80
Ala Gln Gly Ala Leu Ala Asn Ile Ala Val Asp Lys Ala Asn Leu Glu
85 90 95
Ile Met Thr Lys Arg Ser Asn Tyr Thr Pro ile Thr Asn Val Pro Pro
100 105 110
Glu Val Thr Val Leu Thr Asn Ser Pro Val Glu Leu Arg Glu Pro Asn
115 120 125
Val Leu I_e Cys Phe Ile Asp Lys Phe Thr Pro Pro Val Val Asn Val
130 135 140
Thr Trp Leu Arg Asn Gly Lys Pre Val Thr Thr Gly Val Ser Glu Thr
195 150 155
160
Val Phe Leu Pre Arg Glu Asp His Leu Phe Arg Lys Phe His Tvr Leu
165 170 175
Pre Phe Leu Pro Ser Trr Glu Asp Val Tyr Asp Cys Arg Val Glu His
1B0 185 190
Trp Gly Leu ASp Glu Pro Leu Leu Lys His Trp Glu Phe Asp Ala Pro
195 200 205
Ser Pro Leu Pro Glu Thr Thr Glu Val Asp Gly Glv Gly Gly Gly Leu
210 X15 ' 220
Thr Asp Thr Leu Gln Ala Giu Thr Asp Gln Leu Glu Asp Glu Lys Ser
225 230 235
240
F.la Leu Gln Thr Glu Ile A1a Asn Leu Leu Lys Glu Lys Glu Lys Leu
295 _250 255
Glu Phe Ile Leu Ala Ala His Val Ala Glu Met Asn Pro Asn Val Asn
260 265 270
Val Phe V~5 Pro Pto Arg Asp 68o Phe Ser Gly Pro Ala Pro Arg Lys
285
Ser Lys Leu Ile Cys Glu Ala Thr Asn Phe Thr Pro Lys Pro Ile Thr
290 295 300
Val Ser Trp Leu Lys Asp Gly Lys Leu Val Glu Ser Gly Phe Thr Thr
305 310 315
320
Asp Pro Val Thr Ile Glu Asn Lys Gly Ser Thr Pro Gln Thr Tyr Lys
325 330 335
Val Ile Ser Thr Leu Thr Ile Ser Glu Ile Asp Trp Leu Asn Leu Asn
390 395 350
Val Tyr Thr Cys Arg VaI Asp His Arg Gly Leu Thr Phe Leu Lys Asn
355 360 365
Val Ser Ser Thr Cys Ala Ala Ser Pro Ser Thr Asp Ile Leu Asn Phe
370 375 380
Thr Ile Pro Pro Ser Phe Ala Asp Ile Phe Leu Ser Lys Ser Ala Asn
385 390 395
400
Leu Thr Cys Leu Val Ser Asn Leu Ala Thr Tyr Glu Thr Leu Ser Ile
405 410 415
Ser Trp Ala Ser Gln Ser Gly Glu Pzo Leu Glu Thr Lys Ile Lys Ile
420 425 430
Met Glu Ser His Pro Asn Gly Thr Phe Set Ala Lys Gly Val Ala Ser
935 _ 940 445
CA 02321262 2000-08-18
WO 99/42597 PCT/US99/03603
13
Val Cys Val Glu Asp Trp Asn Asn Arg Lys Glu Phe Val Cys Thr Val
450 455 460
Thr His Arg Asp Leu Pro Ser Pro Gln Lys Lvs Phe Ile Ser Lys Pro
965 470 975
980
Asn Glu Val His Lys His Pro Pro Ala Val Tyr Leu Leu Pro Pro Ala
485 490 495
Arg Glu Gln Leu Asn Leu Arg Glu Ser Ala Thr Val Thr Cvs Leu Val
500 505 510
Lys Gly 5ie Ser Pro Ala Asp Ile Ser Val Gln ~'rp Lvs Gln Arg Gly
520
525
Gln Leu Leu Pro Gln Glu Lys Tyr Val Thr Ser A1a Pro Met Pro Glu
530 535 540
Pro Gly Ala Pro Gly Phe Tyr Phe Thz His Ser Ile Leu Thr Val Thr
545 550 555
560
Glu Glu Glu Trp Asn Ser Gly Glu Thr Tyr Thr Cys Val Val Gly His
565 5?0 575
Glu Ala Leu Pro His Leu Val Thr Glu Arg Thr Val Asp Lys Ser Thr
580 585 590
Gly Lys Pro Thr Leu Tyr Asn Val Ser Leu Tle Met Ser Asp Thr Glv
5°5 600 605 -
G1 V Thr C_:~s Tyr
610
