Note: Descriptions are shown in the official language in which they were submitted.
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
HIGHLY CRYSTALLINE UROKINASE
This application claims priority to U.S. Application Serial Number 09/036,361
filed March 6, 1998.
Technical Field
The present invention relates to polypeptides, crystalline forms of those
polypeptides and polynucleotides encoding the polypeptides. More specifically,
the
invention relates to a modified urokinase capable of forming high resolution
crystals,
as well as polynucleotides which encode modified urokinase and methods for
1o producing modified urokinase.
Background of the Invention
Urinary plasminogen activator (uPA, also known as urokinase or UK) is a
highly specific serine protease which converts plasminogen to plasmin by
catalyzing
the cleavage of a single peptide bond (L. Summaria et al., J. Biol. Chem.,
242(19):
4279-4283 [1967]). UPA is secreted by cells as 411-amino acid single chain
zymogen
termed pro-urokinase (pro-UK) or pro-uPA. Activation of pro-uPA requires
enzymatic cleavage at the Lys158-Ilet59 bond. The active (i.e. cleaved)
protein
contains an N-terminal "A-chain" (amino acid residues 1-158 of SEQ ID NO:1)
and
2o C-terminal '' B-chain" (amino acid residues 159-411 ) which are joined via
a disulfide
bond at Cys residues 148 and 279 (W. A. Guenzler et al., Hoppe-Seyler's Z.
Physiol.
Chem. Bd. 363, S133-141 [1982]). The uPA A-chain comprises a triple disulfide
region of about 40 amino acid residues called the "growth factor domain" and a
larger triple disulfide kringle. B-chain comprises the serine protease domain
having
the catalytic triad (i.e. His'-°°, Ser'S6, and Asp'so) typical
of serine proteases. UPA also
possesses a glycosylation site at amino acid residue 302.
UPA is responsible for plasminogen activation on cell surfaces and is unique
in having its own high affinity receptor, uPAR, which greatly enhances its
action on
plasminogen absorbed to cells. The uPAR also focalizes to cell-cell junctions
and to
the leading edges of invading cells. Thus, uPA is positioned spatially and
metabolically to play a pivotal role in the directed cascade of protease
activity needed
for cancer invasion and metastasis, and angiogenesis. Elevated uPA and/or uPAR
is
strongly associated with malignant tissue, and with poor clinical prognosis in
cancer.
There is substantial evidence from tumor cell invasion and animal metastasis
studies
to suggest that blocking uPA will slow the growth and metastasis of tumors and
their
elicitation of the blood supply. Thus, inhibitors which interact with the
ligand binding
domain (LBD) at the urokinase protein active site and block introduction of
the
natural substrate to the LBD could be useful therapeutically in the treatment
of these
conditions.
CA 02322622 2000-09-06
PCTNS99/04992
WO 99/45105
-2-
It is well established that single crystal X-ray diffraction allows
experimental
determination of protein structures at the atomic level and integration of
these protein
structures into the drug discovery process. A three dimensional structure of a
protein
permits identification of the LBD at a protein active site. Additionally,
identification
of a ligand's relation to binding clefts and/or functionality at the LBD may
be
elucidated by co-crystallizing the ligand with the protein and used to
evaluate the
potential effectiveness of the ligand, in this case a drug candidate, as an
enzyme
inhibitor, agonist, or antagonist. Co-crystal structures indicate which sites
of the drug
candidate should or should not be derivatized as well as the nature and size
of
functional groups most likely to result in increased potency, i.e., better
binding at the
LBD.
The best operating mode of structure-directed drug discovery requires a high-
quality protein crystal which has an accessible, empty binding site and which
reproducibly diffracts to high resolution (<2.0 ~) . As is well known in the
art, an
empty binding site permits introduction of the ligand of interest into the LBD
while
the protein is crystalline, and high resolution diffraction permits accurate
identification of ligand interaction with the LBD.
A low molecular weight urokinase-type plasminogen activator-inhibitor
complex is known in the art (Spraggon et al., Structure 3: 681-691 [1995]).
The data
obtained, however, were of low resolution (3.1 ~), and the crystal contained
irreversibly-bound inhibitor at the LBD. Attempts to incorporate other
inhibitors with
the LBD using co-crystallizing methodology have provided only low-quality
crystals.
Thus there is a need for high-quality urokinase crystals from which ligand-
binding data can be gathered.
Brief Description of the Fisures
FIG. 1 shows the amino acid sequence (SEQ ID NO: 1 ) of human urinary-type
plasminogen (uPA) with the modification that the amino acid residues at
positions
279 and 302 are indicated by Xaa. In native uPA, Xaa at amino acid position
279 is
Cys and at amino acid position 302 is Asn. (In SEQ ID NO:1, residues -1 to -20
represent the native leader sequence of human uPA).
FIG. 2 shows the amino acid sequence (SEQ ID NO: 2) of a preferred
polypeptide.
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-3-
Summar~of the Invention
The present invention provides a polynucleotide(s) which encodes a
biologically active modified urinary-type plasminogen activator (mod-uPA)
having at
s least 70% identity to an amino acid sequence selected from the group
consisting of (a)
amino acid position 159 to amino acid position 404 of SEQ ID NO:1; (b) amino
acid
position 159 to amino acid position 405 of SEQ ID NO:1; (c) amino acid
position 159
to amino acid position 406 of SEQ ID NO:1; (d) amino acid position 159 to
amino
acid position 407 of SEQ ID NO:1; (e) amino acid position 159 to amino acid
position
l0 408 of SEQ ID NO:1; (fJ amino acid position 159 to amino acid position 409
of SEQ
ID NO:1; (g) amino acid position 159 to amino acid position 410 of SEQ ID
NO:1;
and (h) amino acid position 159 to amino acid position 411 of SEQ ID NO:1;
wherein in (a)-(h) above, the amino acid residues designated as Xaa at
position 279
~~279) ~d position 302 (Xaa3o2) can be any amino acid. In a preferred
embodiment,
15 tlfh'e Xaa residue at position 279 is Ala. In another preferred embodiment,
the Xaa
residue at position 302 is Gln. In an even more preferred embodiment, the Xaa
residues at positions 279 and 302 are Ala and Gln, respectively.
In another embodiment, the invention provides a recombinant vector
comprising a polynucleotide as described above. In a preferred embodiment, the
2o vector comprises one of the above-described polynucleotide having Ala at
Xaa
residue 279 and Gln at Xaa residue 302. The invention further provides host
cells
comprising the recombinant vectors.
In yet another embodiment, the invention provides a biologically active non-
glycosylated modified urinary-type plasminogen activatar (mod-uPA) having at
least
zs 70% identity to an amino acid sequence selected from the group consisting
of (a)
amino acid position 159 to amino acid position 404 of SEQ ID NO:1; (b) amino
acid
position 159 to amino acid position 405 of SEQ ID NO:1; (c) amino acid
position
159 to amino acid position 406 of SEQ ID NO:1; (d) amino acid position 159 to
amino acid position 407 of SEQ ID NO:1; (e) amino acid position 159 to amino
acid
3o position 408 of SEQ ID NO:1; (f) amino acid position 159 to amino acid
position 409
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-4-
of SEQ ID NO:1; {g) amino acid position 159 to amino acid position 410 of SEQ
ID
NO:1; and (h) amino acid position 159 to amino acid position 411 of SEQ ID
NO:1;
with the proviso that when said mod-uPA is glycosylated, residue 279 is any
amino
acid residue other than Cys and when said mod-uPA is non-glycosylated, residue
279
is any amino acid. A preferred mod-uPA is one in which the Xaa residue at
position
279 is Ala. A more preferred mod-uPA is one in which the Xaa residue at
position
302 is Gln. In an even more preferred embodiment, the Xaa residues at
positions 279
and 302 are Ala and Gln, respectively. In another embodiment, the invention
provides a crystalline form of mod-uPA wherein the primary structure of said
mod-
1o uPA has the structure of a polypeptide described above. The primary
structure of the
crystalline form also has the preferred embodiments described above.
The invention further provides a method for making mod-uPA comprising the
steps of (a) culturing the host cell of the invention under conditions that
allow the
production of the mod-uPA polypeptide; and (b) recovering the mod-uPA
i s polypeptide.
Detailed Description of the Invention
The practice of the present invention will employ, unless otherwise indicated,
conventional techniques of molecular biology, microbiology and recombinant DNA
technology, which are within the skill of the ordinary artisan. Such
techniques are
2o explained fully in the literature. See, e.g. Sambrook, Fritsch & Maniatis,
Molecular
Cloning: A Laboratory Manual, Second Edition (1989); DNA Cloning, Vols, I and
II
(D.N. Glover ed. 1985); the series, Methods in Enzymology (S. Colowick and N.
Kaplan eds., Academic Press, Inc.); Scopes, Protein Purification: Principles
and
Practice (2nd ed., Springer-Verlag); and PCR: A practical Approach (McPherson
et
25 al. eds ( 1991 ) IRL Press).
All patents, patent applications and publications cited herein, whether supra
or infra, are hereby incorporated by reference in their entirety.
As used in this specification and the appended claims, the singular forms "a",
" an" , and "the" include plural references unless the content clearly
dictates
30 otherwise.
I. Definitions:
CA 02322622 2000-09-06
WO 99/45105
-5-
PC'TNS99/04992
In describing the present invention, the following terms will be employed and
are intended to be defined as indicated below:
The term "polynucleotide" as used herein refers to a polymeric form of
nucleotides of any length, either ribonucleotides or deoxyribonucleotides. The
term
refers only to the primary structure of the molecule. Thus, the term includes
double-
and single-stranded DNA, as well as double- and single-stranded RNA. It also
includes modifications, such as by methylation and/or by capping, and
unmodified
forms of the polynucleotide.
"Polypeptide" and "protein" are used interchangeably herein and indicate a
1o molecular chain of amino acids linked through peptide bonds. The terms do
not refer
to a specific length of the product. Thus, peptides and oligopeptides are
included
within the definition of polypeptide. This term is also intended to refer to
post-
translational modifications of the polypeptide, for example, glycosylations,
acetylations, phosphorylations and the like. In addition, protein fragments,
analogs,
muteins, fusion proteins and the like are included within the meaning of
polypeptide.
Polypeptides and proteins of the invention may be made by any means known to
those
of ordinary skill in the art (i.e. they may be isolated or made by
recombinant,
synthetic or semi-synthetic techniques).
As used herein, the term "analogue" refers to a polypeptide which
2o demonstrates like biological activity to disclosed mod-uPA polypeptides
provided
herein. It is well known in the art that modifications and changes can be made
without substantially altering the biological function of a polypeptide. In
making
such changes, substitutions of like amino acid residues can be made on the
basis of
relative similarity of side-chain substituents; for example, their size,
charge,
hydrophobicity, hydrophilicity and the like. Alterations of the type described
may be
made to enhance the polypeptide's potency or stability to enzymatic breakdown
or
pharmacokinetics. Thus, sequences deemed as within the scope of the invention,
include those analogous sequences characterized by a change in amino acid
residue
sequence or type wherein the change does not alter the fundamental nature and
3o biological activity of the aforementioned .
In general, " similarity" means the exact amino acid to amino acid comparison
of two or more polypeptides at the appropriate place, where amino acids are
identical
or possess similar chemical and/or physical properties such as charge or
hydrophobicity. "Percent similarity" can be determined between the compared
polypeptide sequences using techniques well known in the art. In general,
"identity"
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
-6-
refers to an exact nucleotide to nucleotide or amino acid to amino acid
correspondence of two polynucleotides or polypeptide sequences, respectively.
Two
or more polynucleotide sequences can be compared by determining their "percent
identity." Two amino acid sequences likewise can be compared by determining
their
"percent identity."
The techniques for determining nucleic acid and amino acid sequence identity
as well as amino acid sequence similarity are well known in the art. For
example, one
method for determining nucleic acid and amino acid sequence identity includes
determining the nucleotide sequence of the mRNA for that gene (usually via a
cDNA
to intermediate) and determining the amino acid sequence encoded therein, and
comparing this to a second amino acid sequence. The programs available in the
Wisconsin Sequence Analysis Package (available from Genetics Computer Group,
Madison, WI), for example, the GAP program (with default or other parameters),
are
capable of calculating both the identity between two polynucleotides and the
identity
~ 5 and similarity between two polypeptide sequences, respectively. Other
programs for
calculating identity or similarity between sequences are also known in the
art.
The term " degenerate variant" or " structurally conserved mutation" refers to
a polynucleotide containing changes in the nucleic acid sequence thereof, such
as
insertions, deletions or substitutions, that encodes a polypeptide having the
same
2o amino acid sequence as the polypeptide encoded by the polynucleotide from
which
the degenerate variant is derived.
"Recombinant host cells " "host cells " "cells " "cell lines " "cell cultures
" and
> > > > >
other such terms denoting microorganisms or higher eukaryotic cell lines
cultured as
wnicellular entities refer to cells which can be, or have been, used as
recipients for
25 recombinant vector or other transferred DNA, immaterial of the method by
which the
DNA is introduced into the cell or the subsequent disposition of the cell.
These terms
include the progeny of the original cell which has been transfected.
As used herein "replicon" means any genetic element, such as a plasmid, a
chromosome or a virus, that behaves as an autonomous unit of polynucleotide
30 replication within a cell.
A "vector" is a replicon in which another polynucleotide segment is attached,
such as to bring about the replication and/or expression of the attached
segment. The
term includes expression vectors, cloning vectors and the like.
The term "control sequence" refers to polynucleotide sequence which effects
35 the expression of coding sequences to which it is ligated. The nature of
such control
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
sequences differs depending upon the host organism. In prokaryotes, such
control
sequences generally include a promoter, a ribosomal binding site and a
terminator; in
eukaryotes, such control sequences generally include a promoter, terminator
and, in
some instances, enhancers. The term "control sequence" thus is intended to
include at
a minimum all components whose presence is necessary for expression, and also
may
include additional components whose presence is advantageous, for example,
leader
sequences.
A "coding sequence" is a polynucleotide sequence which is transcribed into
mRNA and/or translated into a polypeptide when placed under the control of
1 o appropriate regulatory sequences. The boundaries of the coding sequence
are
determined by a translation start codon at the 5' -terminus and a translation
stop codon
at the 3' -terminus. A coding sequence can include, but is not limited to,
mRNA,
cDNA, and recombinant polynucleotide sequences. Mutants or analogs may be
prepared by the deletion of a portion of the coding sequence, by insertion of
a
~ 5 sequence, and/or by substitution of one or more nucleotides within the
sequence.
Techniques for modifying nucleotide sequences, such as site-directed
mutagenesis,
are well known to those skilled in the art. See, e.g., Sambrook, et al.,
supra; DNA
Cloning, Vols, I and II, supra; Nucleic Acid Hybridization, supra.
"Operably linked" refers to a situation wherein the components described are
2o in a relationship permitting them to function in their intended manner.
Thus, for
example, a control sequence "operably linked" to a coding sequence is ligated
in such
a manner that expression of the coding sequence is achieved under conditions
compatible with the control sequences. The coding sequence may be operably
linked
tb~ control sequences that direct the transcription of the pol-ynucleotide
whereby said
25 polynucleotide is expressed in a host cell.
The term "open reading frame" or "ORF" refers to a region of a polynucleotide
sequence which encodes a polypeptide; this region may represent a portion of a
coding sequence or a total coding sequence.
The term "transformation" refers to the insertion of an exogenous
3o polynucleotide into a host cell, irrespective of the method used for the
insertion, or the
molecular form of the polynucleotide that is inserted. For example, injection,
direct
uptake, transduction, and f mating are included. Furthermore, the insertion of
a
polynucleotide per se and the insertion of a plasmid or vector comprising the
exogenous polynucleotide are included. The exogenous polynucleotide may be
CA 02322622 2000-09-06
PCT/US99/04992
WO 99/45105
_g_
directly transcribed and translated by the cell, maintained as a non-
integrated vector,
for example, a plasmid, or alternatively, may be integrated into the host
genome.
The term "isolated" as used herein means that the material is removed from its
original environment (e.g., the natural environment if it is naturally
occurring). For
example, a naturally-occurring polynucleotide or polypeptide present in a
living
animal is not isolated, but the same polynucleotide or DNA or polypeptide,
which is
separated from some or all of the coexisting materials in the natural system,
is
isolated. Such polynucleotide could be part of a vector and/or such
polynucleotide or
polypeptide could be part of a composition, and still be isolated in that the
vector or
t o composition is not part of its natural environment.
The term "primer" denotes a specific oligonucleotide sequence
complementary to a target nucleotide sequence and used to hybridize to the
target
nucleotide sequence and serve as an initiation point for nucleotide
polymerization
catalyzed by either DNA polymerase, RNA polymerase or reverse transcriptase.
A "recombinant polypeptide" as used herein means at least a polypeptide
which by virtue of its origin or manipulation is not associated with all or a
portion of
the polypeptide with which it is associated in nature and/or is linked to a
polypeptide
other than that to which it is linked in nature. A recombinant or derived
polypeptide
is not necessarily translated from a designated nucleic acid sequence. It also
may be
2o generated in any manner, including chemical synthesis or expression of a
recombinant
expression system.
The term "synthetic peptide" as used herein means a polymeric form of amino
acids of any length, which may be chemically synthesized by methods well-known
to
an oriiiriarily'skil'I'practitioner. These synthetic peptides are useful
in~various
25 applications.
"Purified polynucleotide" refers to a polynucleotide of interest or fragment
thereof which is essentially free, i.e., contains less than about 50%,
preferably less
than about 70%, and more preferably, less than about 90% of the protein with
which
the polynucleotide is naturally associated. Techniques for purifying
polynucleotides
30 of interest are well-known in the art and include, for example, disruption
of the cell
containing the polynucleotide with a chaotropic agent and separation of the
polynucleotide(s) and proteins by ion-exchange chromatography, affinity
chromatography and sedimentation according to density. Thus, "purified
polypeptide" means a polypeptide of interest or fragment thereof which is
essentially
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
-9-
free, that is, contains less than about 50%, preferably less than about 70%,
and more
preferably, less than about 90% of cellular components with which the
polypeptide of
interest is naturally associated. Methods for purifying are known in the art.
"Purified product" refers to a preparation of the product which has been
isolated from the cellular constituents with which the product is normally
associated.
II. Reagents.
a. Poly~eptides: The present invention provides a modified urokinase
polypeptide (hereinafter termed "mod-uPA") comprising an amino acid sequence
selected from the group consisting of
l0 (a) amino acid position 159 to about amino acid position 404 of SEQ ID
NO:1;
(b) amino acid position 159 to amino acid position 405 of SEQ ID NO:1;
(c) amino acid position 159 to amino acid position 406 of SEQ ID NO:1;
(d) amino acid position 159 to amino acid position 407 of SEQ ID NO:1;
(e) amino acid position 159 to amino acid position 408 of SEQ ID NO:1;
(f) from amino acid position 159 to amino acid position 409 of SEQ ID
NO:1;
(g) amino acid position 159 to amino acid position 410 of SEQ ID NO:1;
(h) amino acid position 159 to amino acid position 411 of SEQ ID NO:1;
2o with the proviso that when said mod-uPA is glycosylated, residue 279
(Xaa2'9)
is any amino acid residue other than Cys and when said mod-uPA is non-
glycosylated, residue 279 is any amino acid and wherein the polypeptide has
like
.. . , .. - biological activity; (~e.g:.catalytic and/or immunological
aotivity) to human urokinase.
In a preferred embodiment shown in FIG. 2 (SEQ ID N0:2), Xaa2'9 is Ala and
Xaa3o2
is Gln. Polypeptides of the invention also include analogs and mutated or
variant
proteins of SEQ ID NO:1 that retain such activity. Generally, a polypeptide
analog of
mod-uPA will have at least about 60% identity, preferably about 70% identity,
more
preferably about 75-85% identity, even more preferably about 90% identity and
most
preferably about 95% or more identity to (a)-(h) above. Thus, included within
the
3o scope of the invention are polypeptides in which one or more of the amino
acid
residues is substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted amino acid
residue
may or may not be one encoded by the genetic code. Since it is known in the
art that
residues His2°~, Asp2ss, Asp3so, and Ser3s6 (as well as all other
cysteine residues in the
CA 02322622 2000-09-06
WO 99!45105 PCT/US99/04992
-10-
B chain with the exception of Cysz'9) are necessary to preserve biological
activity, one
of ordinary skill in the art can readily ascertain the various residues which
can be
altered without affecting the activity of the resulting mod-uPA.
A "conservative change" is one typically in the range of about 1 to S amino
acids, wherein the substituted amino acid has similar structural or chemical
properties,
eg, replacement of leucine with isoleucine or threonine with serine. In
contrast, a
nonconservative change is one in which the substituted amino acid differs
structurally
or chemically from the original residue, eg. replacement of a glycine with a
tryptophan. Similar minor variations may also include amino acid deletions or
insertions or both. Guidance in determining which and how many amino acid
residues may be substituted, inserted or deleted without changing biological
or
immunological activity may be found using computer programs well known in the
art,
for example, DNASTAR software (DNASTAR Inc., Madison WI).
The invention further provides for any of the aforementioned polypeptides in
1 s which one or more of the amino acid residues includes a substituent group;
or is fused
with another compound, such as a compound to increase the half life of the
polypeptide (for example, polyethylene glycol); or it may be one in which the
additional amino acids are fused to the polypeptide, such as a leader or
secretory
sequence or a sequence which is employed for purification of the polypeptide
or a
2o proprotein sequence. Furthermore, a polypeptide of the invention may or may
not be
glycosylated.
Polypeptides of the invention may be made by any means known to those of
ordinary skill in the art such as by isolation or by recombinant, synthetic or
semi-
synthetic techniques. Furthermore, as will be apparent to those of ordinary
skill in the ,.
25 art, the type of residue selected for Xaa positions 279 and 302 as well as
the manner
of making the polypeptide will depend upon whether the polypeptide is to be
glycosylated or not. For example, when a non-glycosylated, recombinantly made
polypeptide of the invention is desired, the user may select any amino acid
for Xaaz'9
and Xaa302. Furthermore, in this case, the user must select a recombinant host
(such as
3o a procaryotic host) which does not glycosylate proteins. In contrast, when
a user
desires a polypeptide of the invention to be glycosylated, then the amino acid
residue
at Xaa2'9 must be one other than Cys. In this situation, one desiring to
produce the
protein by recombinant techniques (i.e. via a recombinant polynucleotide
construct)
will know to express that construct in a host cell which glycosylates proteins
(for
35 example, a eucaryotic cell such as Pichia) and not in a procaryotic cell,
such as E.
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-I I-
coli, which will not glycosylate the protein. Furthermore, when a
recombinantly
generated polypeptide is to be made from native human uPA, and is intended to
contain Cys2'9, the polynucleotide construct which encodes the human uPA must
be
modified so as to prevent the formation of a disulfide bond between Cys'48 and
Cys2'9.
To achieve this result, one must prepare a construct that is modified at the
Cys 148
residue (Cys"8) of SEQ ID NO:1. In addition, such a construct must be
expressed in a
host cell that does not glycosylate the protein. As will also be apparent to
those of
ordinary skill in the art, one desiring to make a protein of the invention in
this
manner, must cleave the A chain from the B chain either in vitro or in vivo.
I o Conversely, when the recombinantly generated polypeptide is to be
generated
from native uPA and is intended to have a non-Cys residue at position 279 of
SEQ ID
NO:I, one must generate a polynucleotide construct that is modified at the
Cys2'9
position but may leave the Cys'4$ position unaffected. Methods for generating
this
and other mutations are considered within the skill limit of the routine
practitioner as
1 s well as all other techniques for producing the polypeptides as described
hereinabove.
The present invention also provides high resolution crystalline forms of the
polypeptides described herein. Methods of making crystalline forms of
polypeptides
of the invention are well known (see for example, U.S. Patent 4,886,646,
issued
December 12) and are considered as within the skill level of the routine
practitioner.
20 Thus, using the polypeptides, polynucleotides and methodologies described
herein, a
sufficient amount of a recombinant polypeptide of the present invention may be
made
available to generate high resolution crystals to perform analytical studies
such as X-
ray crystallography.
b: Polvnuceleotides: The present invention also provides reagents.such as
25 polynucleotides which encode the biologically active mod-uPA polypeptides
described above. A polynucleotide of the invention may be in the form of mRNA
or
DNA. DNAs in the form of cDNA, genomic DNA, and synthetic DNA are within the
scope of the present invention. The DNA may be double-stranded or single-
stranded,
and if single stranded may be the coding (sense) strand or non-coding (anti-
sense)
3o strand. The coding sequence which encodes the polypeptide may be identical
to the
coding sequence provided herein or may be a different coding sequence which
coding
sequence, as a result of the redundancy or degeneracy of the genetic code,
encodes the
same polypeptide as the DNA provided herein. A preferred polynucleotide is SEQ
ID
N0:2 (shown in FIG. 2). The sequences disclosed herein represent unique
3s polynucleotides which can be used for making and purifying mod-uPA.
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
-12-
A polynucleotide of the invention may include only the coding sequence for
the polypeptide, or the coding sequence for the polypeptide and additional
coding
sequence such as a leader or secretory sequence or a proprotein sequence, or
the
coding sequence for the polypeptide (and optionally additional coding
sequence) and
non-coding sequence, such as a non-coding sequence 5' and/or 3' of the coding
sequence for the polypeptide.
In addition, the invention includes variant polynucleotides containing
modifications such as polynucleotide deletions, substitutions or additions;
and any
polypeptide modification resulting from the variant polynucleotide sequence. A
l0 polynucleotide of the present invention also may have a coding sequence
which is a
naturally occurnng allelic variant of the coding sequence provided herein.
In addition, the coding sequence for the polypeptide may be fused in the same
reading frame to a polynucleotide sequence which aids in expression and
secretion of
a polypeptide from a host cell, for example, a leader sequence which functions
as a
~ 5 secretory sequence for controlling transport of a polypeptide from the
cell. The
polypeptide having a leader sequence is a preprotein and will have the leader
sequence cleaved by the host cell to form the polypeptide. Thus, the
polynucleotide
of the present invention may encode for a protein, or for a protein having a
presequence (leader sequence).
2o The polynucleotides of the present invention may also have the coding
sequence fused in frame to a marker sequence which allows for purification of
the
polypeptide of the present invention. The marker sequence may be a hexa-
histidine
tag supplied by a pQE-9 vector to provide for purification of the polypeptide
fused to
" . , ~. the marker in the case of a bacterial host, or; for example, the
marker sequence may - _ .
25 be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is
used. The
HA tag corresponds to an epitope derived from the influenza hemagglutinin
protein.
See, for example, I. Wilson, et al., Cell 37:767 (1984). A variety of
expression
vectors are commercial available for this purpose and are intended as within
the scope
of the invention.
3o It is contemplated that polynucleotides will be considered to hybridize to
the
sequences provided herein if there is at least 50%, and preferably at least
70% identity
between the polynucleotide and the sequence.
III. Recombinant Technolo~v.
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
-13-
The present invention provides host cells and expression vectors comprising
polynucleotides of the present invention and recombinant methods for the
production
of polypeptides they encode. Such methods comprise culturing the host cells
under
conditions suitable for the expression of the mod-uPA polynucleotide and
recovering
a mod-uPA polypeptide from the cell culture.
The polynucleotide(s) of the present invention may be employed for producing
a polypeptide(s) by recombinant techniques. Thus, the polynucleotide sequence
may
be included in any one of a variety of expression vehicles, in particular
vectors or
plasmids for expressing a polypeptide. Such vectors include chromosomal,
to nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40;
bacterial
plasmids; phage DNA; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus,
and pseudorabies. In a preferred aspect of this embodiment, the vector further
comprises regulatory sequences, including, for example, a promoter, operably
linked
15 to the sequence.
The appropriate DNA sequence may be inserted into the vector by a variety of
procedures. In general, the DNA sequence is inserted into appropriate
restriction
endonuclease sites by procedures known in the art. Such procedures and others
are
deemed to be within the scope of those skilled in the art
2o Large numbers of suitable vectors and promoters are known to those of skill
in
the art and are commercially available. The following vectors are provided by
way of
example. Bacterial: pSPORTI (Life Technologies, Gaithersburg, MD), pQE70,
pQE60, pQE-9 (Qiagen) pBs, phagescript, psiX174, pBluescript SK, pBsKS, pNHBa,
pNHl6a;:pNHl8a, pNH46a (Stratagene); pTrc99A; pKK223-3;.pKK233-3, pDR540;
25 pRITS (Pharmacia). Eukaryotic: pWLneo, pSV2cat, pOG44, pXTI, pSG
(Stratagene)
pSVK3, pBPV, pMSG, pSVL (Pharmacia). Also, appropriate cloning and expression
vectors for use with prokaryotic and eukaryotic hosts are described by
Sambrook et
al., supra.
The expression vectors) containing the appropriate DNA sequence as
3o hereinabove described, may be employed to transform an appropriate host to
permit
the host to express the protein. Host cells are genetically engineered
(transduced or
transformed or transfected) with the vectors of this invention which may be a
cloning
vector or an expression vector. For example, introduction of such constructs
into a
host cell can be effected by calcium phosphate transfection, DEAE-Dextran
mediated
35 transfection, or electroporation (L. Davis et al., "Basic Methods in
Molecular
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/0499Z
-14-
Biology" , 2nd edition, Appleton and Lang, Paramount Publishing, East Norwalk,
CT
(1994)). The engineered host cells can be cultured in conventional nutrient
media
modified as appropriate for activating promoters and selecting transformants.
The
culture conditions, such as temperature, pH and the like, are those previously
used
with the host cell selected for expression, and will be apparent to the
ordinarily skilled
artisan. The selection of an appropriate host is deemed to be within the scope
of those
skilled in the art from the teachings provided herein.
In a further embodiment, the present invention provides host cells containing
the above-described construct. The host cell can be a higher eukaryotic cell,
such as a
1 o mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the
host cell can be
a prokaryotic cell, such as a bacterial cell. Representative examples of
appropriate
hosts include bacterial cells, such as E. coli, Salmonella typhimurium;
Streptomyces
sp.; yeast cells such as Pichia sp.; insect cells such as Drosophila and Sf9;
animal
cells such as CHO, COS or Bowes melanoma; plant cells, etc.
~5 The constructs in host cells can be used in a conventional manner to
produce
the gene product encoded by the recombinant sequence. Proteins can be
expressed in
mammalian cells, yeast, bacteria, or other cells under the control of
appropriate
promoters. Cell-free translation systems can also be employed to produce such
proteins using RNAs derived from the DNA constructs of the present invention.
2o Alternatively, the polypeptides of the invention can be synthetically
produced by
conventional peptide synthesizers.
Following transformation of a suitable host strain and growth of the host
strain
to an appropriate cell density, the selected promoter is derepressed by
appropriate
. ~ .. . means (eyg., temperature shift or chemical induction), and cells are
cultured for. an - ,
25 additional period. Cells are typically harvested by centrifugation,
disrupted by
physical or chemical means, and the resulting crude extract retained for
further
purification. Microbial cells employed in expression of proteins can be
disrupted by
any convenient method, including freeze-thaw cycling, sonication, mechanical
disruption, or use of cell lysing agents; such methods are well-known to the
ordinary
30 artisan.
Mod-uPA polypeptide is recovered and purified from recombinant cell
cultures by known methods including ammonium sulfate or ethanol precipitation,
acid
extraction, anion or cation exchange chromatography, phosphocellulose
chromatography, hydrophobic interaction chromatography, hydroxyapatite
35 chromatography or lectin chromatography. It is preferred to have low
concentrations
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-15-
(approximately 0.1-5 mM) of calcium ion present during purification (Price, et
al., J.
Biol. Chem. 244:917 [1969j). Protein refolding steps can be used, as
necessary, in
completing configuration of the protein. Finally, high performance liquid
chromatography (HPLC) can be employed for final purification steps.
III. Drug Design
The goal of rational drug design is to produce structural analogs of
biologically active polypeptides of interest or of the small molecules
including
agonists, antagonists, or inhibitors with which they interact. Such structural
analogs
1o can be used to fashion drugs which are more active or stable forms of the
polypeptide
or which enhance or interfere with the function of a polypeptide in vivo. (see
J.
Hodgson, Bio/Technolo~y 9:19-21 (1991)).
For example, in one approach, the three-dimensional structure of a crystalline
polypeptide, or of a polypeptide-inhibitor complex, is determined by x-ray
t 5 crystallography, by computer modeling or, most typically, by a combination
of the
two approaches. Both the shape and charges of the polypeptide must be
ascertained to
elucidate the structure and to determine active sites) of the molecule. Less
often,
useful information regarding the structure of a polypeptide may be gained by
modeling based on the structure of homologous proteins. In both cases,
relevant
2o structural information is used to design analogous polypeptide-like
molecules or to
identify efficient inhibitors.
Useful examples of rational drug design may include molecules which have
improved activity or stability as shown by S. Braxton et al., Biochemistry
31:7796-
7801 (1992), ~or which act as inhibitors, agonists, or antagonists of native
peptides-as
25 shown by S. B. P. Athauda et al., J Biochem. (Tokyo) 113 (6):742-746
(1993).
Having now generally described the invention, a complete understanding can
be obtained by reference to the following specific examples. The following
examples
are given for the purpose of illustrating various embodiments of the invention
and are
3o not intended to limit the present invention in any fashion.
Example 1. Muta~enesis Analysis of uPA
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-16-
Mutants of human uPA were cloned into a dicistronic bacterial expression
vector pBCFKI2 (Pilot-Matias, T.J. et a1, Gene 128: 219-225 [1993]). The
following
oligo nucleotides were used to generate various uPA mutants by PCR:
SEO ID N0: SEQUENCE OF PCR PRIMER
3 5'-ATTAATGTCGACTAAGGAGGTGATCTAATGTTAAAATTTCAGTGTGGCCAA-3'
4 5'-ATTAATAAGCTTTCAGAGGGCCAGGCCATTCTCTTCCTTGGTGTGACTCCTGATCCA-3'
5'-ATTAATTGCGCAGCCATCCCGGACTATACAGACCATCGCCCTGCCCT-3'
6 5'-ATTAATGTCGACTAAGGAGGTGATCTAATGGGCCAAAAGACTCTGAGGCC-3'
7 5'-ATTAATGTCGACTAAGGAGGTGATCTAATGAAGACTCTGAGGCCCCGCTT-3'
8 5'-ATTAATGTCGACTAAGGAGGTGATCTAATGATTATTGGGGGAGAATTCAC-3'
9 5'-ATTAATGTCGACTAAGGAGGTGATCTAATGATTGGGGGAGAATTCACCACCATCGA-3'
5'-ATTAATAAGCTTTCACTCTTCCTTGGTGTGACTCCTGAT-3'
11 5'-ATTAATAAGCTTTCATTCCTTGGTGTGACTCCTGATCCA-3'
12 5'-ATTAATAAGCTTTCACTTGGTGTGACTCCTGATCCAGGGT-3'
5
The initial cloning of a low molecular weight uPA, hereinafter designated
LMW-uPA (L144-L411) was performed using human uPA cDNA as template and
SEQ ID NOs:3 and 4 as primers in a standard PCR reaction. (The nucleic acid
and
protein sequence of human uPA can be found in U.S. Patent No. 5,112,755,
issued
1o May 12, 1992). The PCR amplified DNA was gel purified and digested with
restriction enzymes SaII and HindIII. The digested; product ~he~ was, ligated
into a , , ,
pBCFKI2 vector previously cut with the same two enzymes to generate expression
vector pBC-LMW-uPA. The vector was transformed in DHSoc cells (Life
Technologies, Gaithersburg, MD), isolated and the sequence confirmed by DNA
sequencing. The production of LMW-uPA in bacteria was analyzed by SDS-PAGE
and zymography (Granelli-Piperno, A. and Reich.E., J. Exp. Med.,148: 223-234,
( 1978)), which measures plasminogen activation by uPA.. LMW-uPA(L 144-L411 )
was expressed in E. coli as shown on a commassie blue stained gel, and was
active in
the zymographic assay.
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-17-
The success of the quick expression and detection of LMW-uPA in E coli
made it possible to perform mutagenesis analysis of uPA in order to determine
its
minimum functional structure. One mutant having a Cys2'9 to Ala2'9 replacement
was
made with SEQ ID Nos:4 and 5 by PCR. The PCR product was cut with AviII and
Hind III, and used to replace a AviII and Hind III fragment in the pBC-LMW-uPA
construct. The resulting LMW-uPA-A'-'9 construct was expressed in E. coli and
the
product shown to be active in zymography (data not shown). Using the
oligonucleotides designated below further mutants with N- or C-terminal
truncations
were generated by PCR:
Mutant Characteristics of Mutants RelativeSEO ID
to LMW-
uPA NOs:
LMW-uPA-N 5 amino acid deletion from the 6 and
5 N-terminus 2
LMW-uPA-N 7 amino acid deletion from the 7 and
7 N-terminus 2
LMW-uPA-N 15 amino acid deletion from the 8 and
N-terminus 2
LMW-uPA-N 16 amino acid deletion from the 9 and
16 N-terminus 2
LMW-uPA-C 5 amino acid deletion from the 10 and
5 C-terminus 1
LMW-uPA-C 6 amino acid deletion from the 11 and
6 C-terminus 1
LMW-uPA-C 7 amino acid deletion from the 12 and
7 C-terminus 1
All mutant constructs were expressed in E. coli as described above and the
resulting synthesized polypeptides were shown to have similar activity to that
of
LMW-uPA in zymographic assays. The results of these experiments indicated that
a
15 functional modified uPA could be made consisting of amino acids 159-404 of
human
uPA with Cys2'9 replaced by Ala.
Example 2. Clonin~and ExQression of micro-uPA[uPA~'I159-K4041A279O3021
in Baculovirus
CA 02322622 2000-09-06
WO 99/45105 PC'fNS99/04992
_18_
Micro-uPA (i.e. truncated uPA containing amino acids Ile'S9-Lys'°4 and
having
substitutions of Ala for Cysz'9 and Gln for Asn3°z in SEQ ID NO:1 ) was
generated by
PCR using the following oligonucleotide primers:
SEO ID NO: SEQUENCE OF PCR PRIMER
13 5'-ATTAATCAGCTGCTCCGGATAGAGATAGTCGGTAGACTGCTCTTTT-3'
14 5'-ATTAATCAGCTGAAAATGACTGTTGTGA-3'
15 5'-ATTAATGTCGACTAAGGAGGTGATCTAATGTTAAAATTTCAGTGTGGCCAA-3'
16 5'-ATTAATGCTAGCCTCGAGCCACCATGAGAGCCCTGCT-3'
17 5'-ATTAATGCTAGCCTCGAGTCACTTGTTGTGACTGCGGATCCA-3'
18 5'-GGTGGTGAATTCTCCCCCAATAATGCCTTTGGAGTCGCTCACGA-3'
s
To mutate the only glycosylation site (Asn3°z) in uPA, oligonucleotide
primers
SEQ ID NOs:l3 and 15, and SEQ ID NOs:14 and 17 were used in two PCR reactions
with pBC-LMW-uPA-Alaz'9 as the template. T'he two PCR products were cut with
the
restriction enzyme PvuII, ligated with T4 DNA ligase, and used as template to
1 o generate LMW-uPA-Ala z'9-Gln'°z. Native uPA leader sequence was
fused directly to
Ile'S9 by PCR with SEQ ID NOs:l6 and 18 using native uPA cDNA as the template.
This PCR product was used as a primer, together with SEQ ID N0:17, in a new
PCR
reaction with LMW-uPA-Ala z'9-Gln3oz DNA as template to generate micro-uPA
cDNA. Micro-uPA was cut with Nhe I and ligated to a baculovirus transfer
vector
~s pJVPlOz (Vialard et al., J. Virology, 64(1): 37-50 [1990]) cut with the
same enzyme.
The resulting construct, pJVPlOz-micro-uPA, was confirmed by a standard DNA
sequencing techniques.
Construct pJVPI Oz-micro-uPA was transfected into Sf9 cells by the calcium
phosphate precipitation method using the BaculoGold kit from PharMingen (San
2o Diego, CA). Active micro-uPA activity was detected in the culture medium.
Single
recombinant virus expressing micro-uPA was plague purified by standard
methods,
and a large stock of the virus was made.
Large scale expression of micro-uPA was performed in another line of insect
cells, High-Five cells (Invitrogen, Carlsbad, CA), in suspension, growing in
Excel
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-19-
405 serum free medium (JRH Biosciences, LeneXa, KS) in 2 liter flasks, with
shaking
at 80 rpm and at a temperature of 28°C. High-Five cells were grown to 2
x 10 6
cells/mL, recombinant micro-uPA virus was added at 0.1 MOI (multiplicity of
infection), and the culture was continued for 3 days. The culture supernatant
was
harvested as the starting material for purification (see Example 4 below). The
activity
of micro-uPA in the culture supernatant was measured by amidolysis of a
chromogenic uPA substrate S2444 ( Claeson et al., Haemostasis, 7: 76, 1978),
which
was at 6-10 mg/L.
t o Example 3. Expression of micro-uPA in Pichia pastoris
To express micro-uPA in Pichia, an expression vector with a synthetic leader
sequence (as described in U.S. Serial No. 08/851,350, filed May 5, 1997 ) was
used.
The Pichia expression vector, pHil-D8, was constructed by modification of
vector
pHil-D2 (Invitrogen) to include a synthetic leader sequence for secretion of a
recombinant protein. The leader sequence, SEQ ID N0:19, (shown below) encodes
a
PHO1 secretion signal (single underline) operatively linked to a pro-peptide
sequence
(bold highlight) for KEX2 cleavage. To construct pHil-D8, PCR was performed
using pHil-S 1 (Invitrogen) as template since this vector contains the
sequence
encoding PHO1, a forward primer (SEQ ID N0:20) corresponding to nucleotides
509-530 of pHil-S 1 and a reverse primer (SEQ ID N0:21 ) having a nucleotide
sequence which encodes the latter portion of the PHO1 secretion signal
(nucleotides
45-66 of SEQ ID N0:19) and the pro-peptide sequence (nucleotides 67-108 of SEQ
ID N0:19). The primer sequences (obtained from Operon Technologies, Inc.
Alameda, CA) were as follows:
SEO ID NO: SEQUENCE OF PCR PRIMER
19 5'-ATGTTCTCTCCAATTTTGTCCTTGGAAATTATTTTAGCTTTGGCTACTTTGCA
ATCTGTCTTCGCTCAGCCAOTTATCTGCACTACCGTTGGTTCCGCTGCCG
AGGGATCC-3'
20 5'-GAAACTTCCAAAAGTCGCCATA-3'
21 5'-ATTAATGAATTCCTCGAGCGGTCCGGGATCCCTCGGCAGCGGAACCAACGGTA
GTGCAGATAACTGGCTGAGCGAAGACAGATTGCAAAGTA-3'
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-20-
Amplification was performed under standard PCR conditions. The PCR
product (approximately 500 bp) was gel-purified, cut with BIpI and EcoRI and
ligated
to pHil-D2 cut with the same enzymes. The DNA was transformed into E. coli
HB 101 cells and positive clones identified by restriction enzyme digestion
and
sequence analysis. One clone having the proper sequence was designated as pHil-
D8.
The following two oligonucleotide primers then were used to amplify micro-
uPA for cloning into pHil-D8.
SEO ID NO: SEQUENCE OF PCR PRIMER
22 5'-ATTAATGGATCCTTGGACAAGAGGATTATTGGGGGAGAATTCACCA-3'
23 5'-ATTAATCTCGAGCGGTCCGTCACTTGGTGTGACTGCGAATCCAGGGT-3'
The PCR product was obtained with SEQ ID NOs: 22 and 23 using pJVPIOz-
l0 micro-uPA as the template. The amplified product was cut with BamHI and
XhoI and
ligated to pHil-D8 cut with the same two enzymes. The resulting plasmid,
pHiIDB-
micro-uPA, was confirmed by DNA sequencing, and used to transform a Pichia
strain
GS 115 (Invitrogen) according to the supplier's instructions. Transformed
Pichia
colonies were screened for micro-uPA expression by growing in BMGY medium and
t s expressing in BMMY medium as detailed by the supplier (Invitrogen). The
micro-
uPA activity was measured with chromogenic substrate 52444. The micro-uPA
expression level in Pichia was higher than that seen in baculovirus-High Five
cells,
ranging from 30-60 mg/L. '
20 Example 4. Purification of micro-uPA
There are two suitable methods capable of purifying u-PA within the scope of
the invention, described below as 4a. and 4b.
4a. The culture supernant of either High Five cells or Pichia were pooled
into a 20 liter container. Protease inhibitors iodoacetamide, benzamidine and
EDTA
25 were added to final concentrations of 10 mM, 5 mM and 1 mM, respectively.
The
supernatant was then diluted 5-fold by adding S mM Hepes buffer pH7.5 and
passed
through I .2 p. and 0.2 p, filter membranes. The micro-uPA was captured onto
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
_2~_
Sartorius membrane adsorber S 100 (Sartorius, Edgewood, NY) by passing through
the membrane at a flow rate of 50 100 mLlmin. After extensive washing with 10
mM Hepes buffer, pH7.5, containing 10 mM iodoacetamide, 5 mM benzamidine, 1
mM EDTA, micro-uPA was eluted from S 100 membrane with a NaCI gradient (20
s mM to 500 mM, 200 mL) in I O mM Hepes buffer, pH7.5, 10 mM iodoacetamide, 5
mM benzamidine, 1 mM EDTA. The eluate (~100m1) was dilutedl0 times in 10 mM
Hepes buffer containing inhibitors, and loaded onto a S20 column (BioRad,
Hercules,
CA}. Micro-uPA was eluted with a 20x column volume NaCI gradient (20 mM to
500 mM). No inhibitors were used in the elution buffers. The eluate was then
diluted
5-fold with 10 mM Hepes buffer, pH7.5, and loaded to a heparin-agarose (SIGMA,
St. Louis, MO) column. Micro-uPA was eluted with a NaCI gradient from 10 mM to
250 mM. The heparin column eluate of micro-uPA (~50 mL) was applied to a
Benzamidine-agarose (SIGMA) column (40 mL) equilkibrated with 10 mM Hepes
buffer, pH7.5, 200 mM NaCI. The column was then washed the equilibration
buffer
is and eluted with 50 mM NaOAc, pH 4.5, 500 mM NaCI. The micro-uPA eluate (~30
mL) was concentrated to 4 mL by ultrafiltration and applied to a Sephadex~ G-
75
column (2.5 x 48 cm, Pharmacia~ Biotech, Uppsala, Sweden) equilibrated with 20
mM NaOAc, pH4.5, 100 mM NaCI. The single major peak containing micro-uPA
was collected and lyophilized as the final product. The purified material
appeared on
2o SDS-PAGE as a single major band.
4b. Step 1. Capture of mUK from the conditioned medium.
Either of two alternative steps may be used for the initial capture. The
choice is a
matter of scale. For small scale purifications the mUK may be captured using
hydrophobic
interaction chromatography such as HiPropyl (J.T.Baker) or equivalent, and for
larger scale
2s purifications it may be captured by cation exchange chromatography using an
S-Sepharose
Fast Flo resin(Pharmacia Biotech) or equivalent.
For the small scale process, the ionic strength of the medium is increased by
the
addition of a particular volume of 4.SM sodium acetate pH7.0 to give a final
solution of
1.1M sodium acetate in the final volume. This sample is applied to a HiPropyl
column
30 previously equilibrated in 1.1 M sodium acetate pH7Ø In this manner, the
desired mUK is
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-22-
bound to the column and other proteins are not bound. The non-bound proteins
are washed
out of the column by rinsing with at least 5 column volumes of 1.1 M sodium
acetate pH7.0
containing 1 mM p-aminobenzamidine (pABA). The mUK is released from the column
by
developing a gradient in 10 column volumes to buffer B which is SOmM Tris,
0.2M NaCI,
1 mM pABA. The location of the mUK in the gradient is found by enzymatic assay
of the
collected fractions and is confirmed by SDS-PAGE. From this a poolof fractions
is made
which is dialyzed against IOvolumes of buffer C (SOmM Tris, O.SM NaCI, 1mM
pABA,
pH7.5) in preparation for Step 2.
For the large scale process, the ionic strength of the medium is decreased by
dilution
into water, and the pH is adjusted to the range pH5.0 to pH5.5 by the addition
of I OmM MES
pH5.0 (buffer D), if necessary. This diluted sample is applied to an S-
Sepharose FastFlo
column previously equilibrated in buffer D. In this manner, the desired mUK is
bound to
the column and other proteins are not bound. The mUK is eluted from the column
by
developing a 10 column volume gradient with IM NaCI in buffer D. The location
of the
mUK in the gradient is found by enzymatic assay of the collected fractions and
is confirmed
by SDS-PAGE. From this a pool of fractions is made which is dialyzed against
lOvolumes
of buffer C (SOmM Tris, O.SM NaCI, 1mM pABA, pH7.5) in preparation for Step 2.
Step 2. Removal of carbohydrate modified forms of mUK.
The dialyzed material from Step 1 is applied to a ConcanavalinA-Sepharose
(Phanmacia Biotech) column previously equilibrated in buffer C. The column
flow is slow to
allow sufficient time and the column volume is large to provide sufficient
capacity to bind
the glycosylated forms of mUK to the resin and allow the desired non-
glycosylated form of
mUK to flow through the column. The location of this desired mUK that is not
bound to the
column is found by enzymatic assay of the collected fractions and is confirmed
by SDS
PAGE.
Step 3. Dialysis to remove pABA.
The pool of fractions from Step 2 is adjusted to pH5.0 by addition of 2M
sodium
acetate pH4.5. This pool is twice dialyzed at 4C against 100 volumes of IOmM
MES, O.SM
NaCI pH5.0 with one change of the dialysate after several hours such that the
concentration
of pABA is greatly decreased overnight. After the dialysis is ended and
immediately before
step 4, the pH of the dialysate is raised to pH 7.5 by the addition of 1 M
Tris base pH8Ø
Step 4. Affinity selection of intact, active mUK on Benzamidine-Sepharose.
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-23-
The mUK in the pH adjusted dialysate contains intact, active molecules of mUK
as
well as less active, partially damaged forms of UK that have lower affinity
for the
Benzamidine-Sepharose (Pharmacia Biotech). The pH7.5 dialysate from Step 5 is
applied to
an Benzamidine-Sepharose affinity column so that the active mUK will bind to
the column
previously equilibrated in SOmM Tris, O.SM NaCI pH7.5 (buffer E). Non-bound
proteins are
washed out of the column with 1.5 column volumes of buffer E, after which the
intact, active
UK is eluted with a 10 column volume gradient of 1M arginine in buffer E, re-
adjusted to
pH7.5. During the development of the gradient, damaged molecules of mUK elute
earlier in
the gradient than intact, active molecules. The location of the intact, active
mUK that is
found by enzymatic assay of the collected fractions and is confirmed by SDS-
PAGE.
Step 5. Removal of arginine by dialysis.
The pool of intact, active UK is twice dialyzed at 4C against 100 volumes of
SOmm
sodium acetate pH4.5 with one change after several hours such that the
concentration of
arginine is greatly decreased overnight.
Example 5. Co-crystallization of Micro-uPA
a. Methods: Micro-uPA was crystallized by the hanging drop vapor diffusion
method, (essentially as described in U.S. Patent 4,886,646, issued December
12,
1989) in the presence of an inhibitor, c-amino caproic acid p-carbethoxyphenyl
ester
2o chloride described by Menigath et al. (J. Enzyme Inhibition, 2: 249-259
[1989]). The
protein solution consisted of 6 mg/mL (0.214 mM) micro-uPA in 10 mM citrate pH
4.0 and 3mM s-amino caproic acid p-carbethoxyphenyl ester chloride in 1 % DMSO
co-solvent. In making the protein solution, the inhibitor (300-400 mM DMSO
stock
solution) was added to the micro-uPA to a final inhibitor concentration of
approximately 3 mM (1% DMSO). Typical well solutions consisted of O.15M
Li2S04, 20% polyethylene glycol (MW 4000) and succinate buffer (pH 4.8-6.0).
On
the cover slip, well solution (2 p,L) was mixed with protein solution (2 uL)
and the
slip sealed over the well. Crystals were grown in Linbro trays (Hampton
Research,
San Franscisco, CA) at 18-24 °C. Under these conditions,
crystallization occurred
within 24 hours.
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
-24-
Because micro-uPA will not crystallize in absence of an inhibitor, the co-
crystallizing entity is believed to be the inhibitor:uPA complex. As a theory,
it is
believed that the inhibitor used in the co-crystallizing procedure is meta-
stable, i.e.
that it acylates the active site serine (amino acid residue 356 of SEQ ID
NO:1) and is
s subsequently deacylated enzymatically, because, the 3-D X-ray structure of
crystals
grown in the presence of this compound shows no inhibitor remaining in the
enzyme
active site. Although the actual mechanism by which the inhibitor dissociates
from
the crystal is unknown, the resultant micro-uPA crystals are composed of
enzyme
with an empty active site.
to b. Results: Crystals obtained under the conditions described above belong
to
the space group P2,2,2, with unit cell dimensions of a=55.16t~, b-53.00,
c=82.30.x,
and a=(3=r90. They diffract to beyond 1.5~ in house and a 1.03 resolution
native
data set was collected on a CCD detector at the Cornell High Energy
Synchrotron
Source in Ithaca, New York. Data were processed by the program package DENZO
15 (Otwinowski and Mino, Methods in Enzymology 276, 1996). Parameters
summarizing data quality for the 1.03 data set are summarized in Table 1
below.
Table 1 shows that data were 85.9% complete in the data shell from 1.04-1.OA
resolution with an I/a of 1.78 although the merging Rsym was high at 0.631.
Hence
the data incorporated into the refinement cycles were cut at 1.04 because in
the 1.08-
20 1.04t~ data shell the Rsym was 0.463 with an I/a of 2.67.
Table 1: Diffraction Data Quality Statistics
No. Unique Reflections % Complete I/a Rsym (square)
overall 108878 91.3 I6.5 0.089
1.08-1.04 10347 87.9 2.67 0.463
1.04-1.00 10157 85.9 1.78 0.631
Phases were determined by the molecular replacement method using the
25 program AMORE (Navaza, J. Acta Cryst., A50: 157-163 [1994]) with the
urokinase
structure of Spraggon et al. (Structure 3: 681-691 (1995), PDB entry 1 LMV~
being
used as the search probe. The rotation and translation functions were
performed using
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
-25-
data between 5 and 30th resolution with the correct solution being among the
top
peaks. The structure was refined using the program package XPLOR by a
combination of rigid body, simulated annealing maximum likelihood refinement,
and
maximum likelihood positional refinement (Brunger, A. X PLOR (version 2.1 )
Manual, Yale University, New Haven, CT, 1990). Electron density maps were
inspected on a Silicon Graphics INDIG02 workstation using the program package
QUANTA 97 (Molecular Simulations Inc., Quanta Generating and Displaying
Molecules, San Diego: Molecular Simulations Inc., 1997). Cycles of model
building
of the protein structure occurred at 2.Ot~ resolution, 1.5~ resolution and
1.03
resolution. At 1.03A resolution constrained individual temperature factor
refinement
was also included in the refinement cycle. Following model building and the
addition
of alternate side chain conformations, cycles of water molecule and bound ion
addition also occurred through the identification of positive peaks in the Fo-
Fc map at
least 46 above noise. The R-factor of the current model is 0.233 and the R-
free is
1 s 0.287.
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
1
SEQUENCE LISTING
<110> Abbott Laboratories
Wang, Jieyi
Nienaber, Vicki L.
Henkin, Jack
<120> Highly Crystalline Urokinase
<130> 6310.PC.01
<150> US 09/036,361
<151> 1998-03-06
<160> 23
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 431
<212> PRT
<213> Homo sapiens
<400> 1
Met Arg Ala Leu Leu Ala Arg Leu Leu Leu Cys Val Leu Val Val Ser
1 5 10 15
Asp Ser Lys Gly Ser Asn Glu Leu His Gln Val Pro Ser Asn Cys Asp
20 25 30
Cys Leu Asn Gly Gly Thr Cys Val Ser Asn Lys Tyr Phe Ser Asn Ile
35 40 45
His Trp Cys Asn Cys Pro Lys Lys Phe Gly Gly Gln His Cys Glu Ile
50 55 60
Asp Lys Ser Lys Thr Cys Tyr Glu GIy Asn Gly His Phe Tyr Arg Gly
65 70 75 80
Lys Ala Ser Thr Asp Thr Met Gly Arg Pro Cys Leu Pro Trp Asn Ser
85 90 95
Ala Thr Val Leu Gln Gln Thr Tyr His Ala His Arg Ser Asp Ala Leu
100 105 110
Gln Leu Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp Asn Arg
115 120 125
Arg Arg Pro Trp Cys Tyr Val Gln Val Gly Leu Lys Pro Leu Val Gln
130 135 140
Glu Cys Met Val His Asp Cys Ala Asp Gly Lys Lys Pro Ser Ser Pro
145 150 155 160
Pro Glu Glu Leu Lys Phe Gln Cys Gly Gln Lys Thr Leu Arg Pro Arg
165 170 175
Phe Lys Ile Ile Gly Gly Glu Phe Thr Thr Ile Glu Asn Gln Pro Trp
180 185 190
Phe Ala Ala Ile Tyr Arg Arg His Arg Gly Gly Ser Val Thr Tyr Val
195 200 205
Cys Gly Gly Ser Leu Ile Ser Pro Cys Trp Val Ile Ser Ala Thr His
210 215 220
Cys Phe Ile Asp Tyr Pro Lys Lys Glu Asp Tyr Ile Val Tyr Leu Gly
225 230 235 240
Arg Ser Arg Leu Asn Ser Asn Thr Gln Gly Glu Met Lys Phe Glu Val
245 250 255
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
2
Glu Asn Leu Ile Leu His Lys Asp Tyr Ser Ala Asp Thr Leu Ala His
260 265 270
His Asn Asp Ile Ala Leu Leu Lys Ile Arg Ser Lys Glu Gly Arg Cys
275 280 285
Ala Gln Pro Ser Arg Thr Ile Gln Thr Ile Xaa Leu Pro Ser Met Tyr
290 295 300
Asn Asp Pro Gln Phe Gly Thr Ser Cys Glu Ile Thr Gly Phe Gly Lys
305 310 315 320
Glu Xaa Ser Thr Asp Tyr Leu Tyr Pro Glu Gln Leu Lys Met Thr Val
325 330 335
Val Lys Leu Ile Ser His Arg Glu Cys Gln Gln Pro His Tyr Tyr Gly
340 345 350
Ser Glu Val Thr Thr Lys Met Leu Cys Ala Ala Asp Pro Gln Trp Lys
355 360 365
Thr Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Ser Leu
370 375 380
Gln Gly Arg Met Thr Leu Thr Gly Ile Val Ser Trp Gly Arg Gly Cys
385 390 395 400
Ala Leu Lys Asp Lys Pro Gly Val Tyr Thr Arg Val Ser His Phe Leu
405 410 415
Pro Trp Ile Arg Ser His Thr Lys Glu Glu Asn Gly Leu Ala Leu
420 425 430
<210> 2
<211> 246
<212> PRT
<213> Homo sapiens
<400> 2
Ile Ile Gly Gly Glu Phe Thr Thr Ile Glu Asn Gln Pro Trp Phe Ala
1 5 10 15
Ala Ile Tyr Arg Arg His Arg Gly Gly Ser Val Thr Tyr Val Cys Gly
20 25 30
Gly Ser Leu Ile Ser Pro Cys Trp Val Ile Ser Ala Thr His Cys Phe
35 40 45
Ile Asp Tyr Pro Lys Lys Glu Asp Tyr Ile Val Tyr Leu Gly Arg Ser
50 55 60
Arg Leu Asn Ser Asn Thr Gln Gly Glu Met Lys Phe Glu Val Glu Asn
65 70 75 80
Leu Ile Leu His Lys Asp Tyr Ser Ala Asp Thr Leu Ala His His Asn
85 90 95
Asp Ile Ala Leu Leu Lys Ile Arg Ser Lys Glu Gly Arg Cys Ala Gln
100 105 110
Pro Ser Arg Thr Ile Gln Thr Ile Ala Leu Pro Ser Met Tyr Asn Asp
115 120 125
Pro Gln Phe Gly Thr Ser Cys Glu Ile Thr Gly Phe Gly Lys Glu Gln
I30 135 140
Ser Thr Asp Tyr Leu Tyr Pro Glu Gln Leu Lys Met Thr Val Val Lys
145 150 155 160
Leu Ile Ser His Arg GIu Cys Gln Gln Pro His Tyr Tyr Gly Ser Glu
165 170 175
Val Thr Thr Lys Met Leu Cys Ala Ala Asp Pro Gln Trp Lys Thr Asp
180 185 190
Ser Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Ser Leu Gln Gly
195 200 205
Arg Met Thr Leu Thr Gly Ile Val Ser Trp Gly Arg Gly Cys Ala Leu
210 215 220
Lys Asp Lys Pro Gly Val Tyr Thr Arg Val Ser His Phe Leu Pro Trp
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
3
225 230 235 240
Ile Arg Ser His Thr Lys
245
<210> 3
<211> 51
<212> DNA
<213> Homo Sapiens
<400> 3
attaatgtcg actaaggagg tgatctaatg 51
ttaaaatttc agtgtggcca a
<210> 4
<211> 57
<212> DNA
<213> Homo Sapiens
<400> 4
attaataagc tttcagaggg ccaggccattctcttccttggtgtgactcc tgatcca 57
<210> 5
<211> 47
<212> DNA
<213> Homo Sapiens
<400> 5
attaattgcg cagccatccc ggactatacagaccatcgccctgccct 47
<210> 6
<211> 50
<212> DNA
<213> Homo Sapiens
<400> 6
attaatgtcg actaaggagg tgatctaatgggccaaaagactctgaggcc 50
<210> 7
<211> 50
<212> DNA
<213> Homo Sapiens
<400> 7
attaatgtcg actaaggagg tgatctaatgaagactctgaggccccgctt 50
<210> 8
<211> 50
<212> DNA
<213> Homo sapiens
<400> 8
attaatgtcg actaaggagg tgatctaatgattattgggggagaattcac 50
<210> 9
<211> 56
<212> DNA
<213> Homo Sapiens
<400> 9
CA 02322622 2000-09-06
WO 99/45105 PCT/US99/04992
4
attaatgtcg actaaggagg tgatctaatg attgggggag aattcaccac catcga 56
<210> 10
<211> 39
<212> DNA
<213> Homo Sapiens
<400> 10
attaataagc tttcactctt ccttggtgtg actcctgat 39
<210> 11
<2I1> 39
<212> DNA
<213> Homo sapiens
<400> 11
attaataagc tttcattcct tggtgtgact cctgatcca 3g
<210> 12
<211> 40
<212> DNA
<213> Homo Sapiens
<400> 12
attaataagc tttcacttgg tgtgactcct gatccagggt 40
<210> 13
<211> 46
<212> DNA
<213> Homo Sapiens
<400> 13
attaatcagc tgctccggat agagatagtc ggtagactgc tctttt 46
<210> 14
<211> 28
<212> DNA
<213> Homo Sapiens
<400> 14
attaatcagc tgaaaatgac tgttgtga 28
<210> 15
<211> 51
<212> DNA
<213> Homo Sapiens
<400> 15
attaatgtcg actaaggagg tgatctaatg ttaaaatttc agtgtggcca a 51
<210> 16
<211> 37
<212> DNA
<213> Homo Sapiens
<400> 16
attaatgcta gcctcgagcc accatgagag ccctgct 37
CA 02322622 2000-09-06
WO 99/45105 PCTNS99/04992
<210> 17
<211> 42
<212> DNA
<213> Homo Sapiens
<400> 17
attaatgcta gcctcgagtc acttgttgtg actgcggatc ca
42
<210> 18
<211> 44
<212> DNA
<213> Homo Sapiens
<400> 18
ggtggtgaat tctcccccaa taatgccttt ggagtcgctc acga
44
<210> 19
<211> 111
<212> DNA
<213> Homo Sapiens
<400> 19
atgttctctc caattttgtc cttggaaatt attttagctt tggctacttt gcaatctgtc60
ttcgctcagc cagttatctg cactaccgtt ggttccgctg ccgagggatc c
111
<210> 20
<211> 22
<212> DNA
<213> Homo sapiens
<400> 20
gaaacttcca aaagtcgcca to
22
<210> 21
<211> 92
<212> DNA
<213> Homo Sapiens
<400> 21
attaatgaat tcctcgagcg gtccgggatc cctcggcagc ggaaccaacg gtagtgcaga60
t
c
aa
tggctg agcgaagaca gattgcaaag to
92
<210> 22
<211> 46
<212> DNA
<213> Homo Sapiens
<400> 22
attaatggat ccttggacaa gaggattatt gggggagaat tcacca
46
<210> 23
<211> 47
<212> DNA
<213> Homo Sapiens
<400> 23
attaatctcg agcggcccgt cacttggtgt gactgcgaat ccagggt
47
