CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
DESCRIPTION
INDUCTION OF APOPTOTIC OR CYTOTOXIC GENE EXPRESSION BY
ADENOVIRAL MEDIATED GENE CODELIVERY
BACKGROUND OF THE INVENTION
S
This application claims priority to and specifically incorporates by
reference,
the content of U.S. Provisional Application Serial No. 60/077,541 filed March
11,
1998. The entire text of each of the above-referenced disclosures is
specifically
incorporated by reference herein without disclaimer. The government owns
rights in
the present invention pursuant to grant number CA70907 from the National
Institutes
of Health.
1. Field of the Invention
The present invention relates generally to viral vectors and their use as
expression vectors for transforming human cells, both in vitro and in vivo.
More
specifically, the invention relates to adenoviral expression constructs
comprising a
proapoptotic member of the Bcl-2 gene family.
2. Description of Related Art
Adenoviral vectors have become one of the leading vectors for gene transfer,
- ~ v - ~ 20 particuiarlywin gene therapy contexts. These vectors have been
studied rigorously in
both in vitro and in vivo contexts because of the ability to generate high
titer stocks,
their high transduction efficiency and their ability to infect a variety of
tissue types in
different species. In addition, the availability of cell lines to complement
defects in
adenoviral replication functions provides for the use of replication defective
mutants
carrying, in the place of selected structural genes, recombinant inserts of
interest.
Several studies have demonstrated the ability of adenovirus-mediated wild-
type p53 replacement gene therapy to induce a G, cell cycle arrest and/or
apoptosis in
malignant cells carrying p53 gene mutations. Though the mechanism of G, arrest
via
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
2
p21 and the cyclin-dependent kinase pathway has been widely studied, little is
known
of the mechanisms by which wild-type p53 induces apoptosis. It appears that
p53
induces apoptosis, at least in part, by up-regulating proapoptotic members of
the Bcl-2
family of proteins.
The Bcl-2 family of proteins and ICE-like proteases have been demonstrated
to be important regulators and effectors of apoptosis in other systems.
Apoptosis, or
programmed cell death, is an essential occurring process for normal embryonic
development, maintaining homeostasis in adult tissues, and suppressing
carcinogenesis (Kerr et al., 1972). The Bcl-2 protein, discovered in
association with
follicular lymphoma, plays a prominent role in controlling apoptosis and
enhancing
cell survival in response to diverse apoptotic stimuli (Bakhshi et dl., 1985;
Cleary and
Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce,
1986).
The evolutionarily conserved Bcl-2 protein now is recognized to be a member of
a
family of related proteins which can be categorized as death agonists or death
antagonists.
Subsequent to its discovery, it was shown that Bcl-2 acts to suppress cell
death
triggered by a variety of stimuli which will be discussed in detail. Also, it
now is
apparent that there is a family of Bcl-2 cell death regulatory proteins which
share in
common structural and sequence homologies. These different family members have
. _.~ -been show . . . ... . . . . . _ . . . . _ _ .
n to either possess similar functions to Bcl-2 or counteract Bcl-2 function
and promote cell death.
One such family member having Bcl-2 counteracting function is Bax. Bax,
Bcl-2 associated X protein, is a death agonist member of the Bcl-2 family of
proteins
(Oltvai et al., 1993}. It has been suggested that Bax may function as a
primary
response gene in a p53 regulated apoptotic pathway (Miyashita et al., 1994).
Indeed,
it has been shown that there is a p53 consensus binding region in the promoter
region
of the proapoptotic Bax gene ( 1995). Bax mRNA and protein expression are
increased
following induction of pS3. However, the observed induction of p53-dependent
SUBSTITUTE SHEET (RUI..E 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
3
apoptosis in Bax knock out mice clearly indicates that other pathways or
proteins are
involved. Bak, a Bcl-2 homologue, is expressed in a variety of tissues and has
been
demonstrated to induce program cell death independent of Bax expression
(Krajewski
et al., 1996; Chittenden et al., 1995). The accumulation of Bak protein in
cells
infected with Adp53, may be an additional mechanism by which p53 can induce
programmed cell death.
However, a recent report has demonstrated an increase in Bcl-x~ expression
following wild-type p53 expression in the human colorectal cancer cell line
HT29
(Merchant et al., 1996). The authors hypothesize that this increase expression
may
lead to an inhibition of program cell death pathways and accounted for lack of
p53-
induced apoptosis observed in these cells. Another potential problem with p53
therapy is that the amount of viral material administered provides risks of
host cell
toxicity andlor immune response. Thus, any method which would increase the
effect
of p53 at low doses, or circumvent the need for high viral doses, would be
advantageous.
Given that p53 gene therapy is a powerful tool in the ftght against cancer,
therapeutic compositions that may augment or complement p53 will serve to
improve
the currently available cancer therapy regimens. Indeed, compositions that
provide
the apoptotic effect of p53 without the need for p53 itself would be
additionally
useful. ...... ..... . .
SUMMARY OF THE INVENTION
The present invention generally is related the use of viral vectors containing
propapoptotic genes and their use in cancer therapy, in order to induce an
apoptotic
effect in cancer cells to either augment, complement or bypass the need for
p53 based
therapy.
In order to achieve the objectives of the present invention, a particular
embodiment provides an adenoviral expression construct comprising a nucleic
acid
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99/05359
4
encoding a proapoptotic member of the Bcl-2 gene family and a first promoter
functional in eukaryotic cells wherein the nucleic acid is under
transcriptional control
of the first promoter. In particularly preferred embodiments, the proapoptotic
Bcl-2
gene is a Bax, Bak, Bim, Bik, Bid or Bad gene. In certain embodiments, it is
contemplated that the adenoviral expression construct may further comprise a
second
nucleic acid encoding a second gene. In particular instances the second
nucleic acid is
under the control of the first promoter.
In particularly preferred embodiments, the proapoptotic Bcl-2 gene and the
second nucleic acid are separated by an IRES. In alternative embodiments, the
second
nucleic acid is under the control of a second promoter operative in eukaryotic
cells. It
is contemplated that the promoter employed herein may be any promoter used in
the
production of expression constructs. In particularly preferred embodiments the
promoter may be selected from the group consisting of CMV IE, SV40 IE, RSV, ~i-
actin, tetracycline regulatable and ecdysone regulatable.
In certain defined aspects, the second gene may encode a protein selected from
the group consisting of a tumor suppresser, a cytokine, a receptor, inducer of
apoptosis, and differentiating agents. By "differentiating agents," the
present
application refers to the function of bcl-2 family members in the induction of
differentiation in cells. Thus, the cells are not induced to die via
apoptosis, but
terminally differentiate and stop growing, which is equally effective as a
cancer
treatment. In particularly preferred embodiments, the tumor suppresser may be
selected from the group consisting of p53, p 16, p21, MMAC 1, p73, zac 1, C-
CAM,
BRCAI and Rb. In certain embodiments, the inducer of apoptosis is selected
from the
group consisting of Harakiri, Ad E 1 B and an ICE-CED3 protease. In those
embodiments employing a cytokine, the cytokine may be selected from the group
consisting of IL-2, IL-2, IL,-3, IL-4, IL-5, IL-6, IL-7, IL,-8, IL-9, IL-10,
IL-11, IL-12,
IL-13, IL-14, IL-15, TNF, GMCSF, ~i-interferon and y-interferon. In those
embodiments where the second gene is a receptor, the receptor may be selected
from
the group consisting of CFTR, EGFR, VEGFR, IL-2 receptor and the estrogen
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
receptor. It is contemplated that the second nucleic acid may be an
antiapoptotic
' member of the Bcl-2 gene family or an oncogene, the second nucleic acid
being
positioned in an antisense orientation with respect to the promoter. In more
preferred
embodiments, the antiapoptotic member of the Bcl-2 gene family is Bcl-2 or Bcl-
xL.
5 In embodiments in which the second gene is an oncogene, the oncogene may be
selected from the group consisting of ras, myc, neu, raf, erb, src, fms, jun,
trk, ret,
gsp, hst, and abl.
In defined embodiments, the expression construct is a replication-deficient
adenovirus. In preferred aspects, the adenovirus lacks at least a portion of
the E 1
region. In other embodiments, the adenovirus further lacks the E3 coding
region. In
prefen;ed embodiments, the expression construct further comprises a
polyadenylation
signal. In particular embodiments, the nucleic acid may be a cDNA, or genomic
DNA.
In particularly preferred embodiments, the proapoptotic member of the Bcl-2
family is Bax. In other preferred embodiments, the proapoptotic member of the
Bcl-2
family is Bak. In more preferred embodiments, the Bax gene expresses a
truncated
Bax protein. In more preferred embodiments, the truncated Bax protein
comprises an
intact death domain. In other preferred embodiments, the truncated Bax protein
comprises SEQ ID N0:2. In other preferred embodiments, the truncated Bax
protein
comprises a BH3 i~egion.
Also contemplated by the present invention is a pharmaceutical composition
comprising a first adenoviral expression construct comprising a promoter
functional in
eukaryotic cells and a first nucleic acid encoding a proapoptotic member of
the Bcl-2
gene family, wherein the first nucleic acid is under transcriptional control
of the
promoter and a pharmaceutically acceptable buffer, solvent or diluent.
In particularly preferred embodiments, the proapoptotic Bcl-2 family gene is a
Bax, Bak, Bik, Bid, or Bad gene. In other preferred embodiments, the promoter
may
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99105359
6
be selected from the group consisting of CMV IE, SV40 IE, RSV, (3-actin,
tetracycline
regulatable and ecdysone regulatable. In other embodiments, the pharmaceutical
composition may further comprise a second expression construct encoding a
second
nucleic acid encoding a second gene operatively linked to a second promoter.
In
certain aspects, the expression construct encoding the proapoptotic gene
further
comprises a second nucleic acid encoding a second gene. The second nucleic
acid
rnay be under the control of the first promoter. In alternative embodiments,
the
second nucleic acid is under the control of a second promoter operative in
eukaryotic
cells. The second gene may encode a protein selected from the group consisting
of a
tumor suppressor, a cytokine, a receptor, inducer of apoptosis, and
differentiating
agents. In particularly preferred embodiments, the second nucleic acid is an
antiapoptotic member of the Bcl-2 gene family or an oncogene, the second
nucleic
acid being positioned in an antisense orientation with respect to the
promoter.
In preferred embodiments, the present invention further contemplates a
method for treating a subject with cancer comprising the steps of providing an
adenoviral expression construct comprising a nucleic acid encoding a
proapoptotic
member of the Bcl-2 gene family and a first promoter functional in eukaryotic
cells
wherein the nucleic acid is under transcriptional control of the first
promoter; and
contacting the expression construct with cancer cells of the subject in a
manner that
allows the uptake of the expression construct by the cells, wherein expression
of the
proapoptotic gene results in the treatment of the cancer. By "treatment," the
present
invention refers to any event that decreases the growth, kills or otherwise
abrogates
the presence of cancer cells in a subject. Such a treatment may also occur by
inhibition of the metastatic potential or inhibition of tumorigenicity of the
cell so as to
achieve a therapeutic outcome.
In other preferred aspects, the method further comprises contacting the cancer
cell with a further cancer therapeutic agent. In particularly preferred
embodiments,
the cancer therapeutic agent may be selected from the group consisting of
tumor
irradiation, chemotherapeutic agent, a second nucleic acid encoding a cancer
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99I05359
7
therapeutic gene. In defined embodiments, the chemotherapeutic agent is a DNA
damaging agent selected from the group consisting of verapamil,
podophyllotoxin,
carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin,
ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin,
daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP
16),
tamoxifen, taxol, transplatinum, 5-fluorouracil, vincristin, vinblastin and
methotrexate. In alternative embodiments, the radiation is selected from the
group
consisting of X-ray radiation, UV-radiation, y-radiation, or microwave
radiation. In
other defined embodiments, the cancer therapeutic agent comprises a second
nucleic
acid. The second nucleic acid may be a cDNA or genomic DNA.
In particular embodiments of the present invention, the second expression
construct is selected from the group consisting of an adenovirus, an adeno-
associated
virus, a vaccinia virus and a herpesvirus. In other embodiments, the
contacting is
effected by regional delivery of the expression construct. In alternative
embodiments,
the contacting is effected by local delivery of the expression construct. In
still further
embodiments, the contacting may be effected by direct injection of a tumor
with the
expression construct. In particularly preferred embodiments, the contacting
comprises
delivering the expression construct endoscopically, intratracheally,
intralesionally,
percutaneously, intravenously, subcutaneously or intratumorally to said
subject. In
certain embodiments, the method may further comprise the step of tumor
resection.
The tumor resection may occur prior to or after the contacting. The tumor
resection
may be performed one, two, three or more times. In particularly preferred
embodiments, the cancer being treated may be selected from the group
consisting of
lung, breast, melanoma, colon, renal, testicular, ovarian, lung, prostate,
hepatic, germ
cancer, epithelial, prostate, head and neck, pancreatic cancer, glioblastoma,
astrocytoma, oligodendroglioma, ependymomas, neurofibrosarcoma, meningia,
liver,
spleen, lymph node, small intestine, blood cells, colon, stomach, thyroid,
endometrium, prostate, skin, esophagus, bone marrow and blood.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
8
The present invention also provides a method of inhibiting the growth of a
cell
comprising the steps of providing an adenoviral expression construct
comprising a
nucleic acid encoding a proapoptotic member of the Bcl-2 gene family and
promoter
functional in eukaryotic cells wherein the nucleic acid is under
transcriptional control
of the first promoter; and contacting the expression construct with the cell
in an
amount effective to inhibit the growth of the cell wherein expression of the
proapoptotic gene by the cell results in a decrease in the growth of the cell
relative to
the growth of the cell in the absence of the proapoptotic gene.
In preferred embodiments, the cell is a cancer cell. In other preferred
embodiments, the inhibition of growth comprises killing of the cancer cell. In
other
embodiments, the inhibition of growth comprises an inhibition of metastatic
growth of
the cancer cell. In defined embodiments, the cancer cell may be selected from
the
group consisting of Lung, breast, melanoma, colon, renal, testicular, ovarian,
lung,
prostate, hepatic, germ cancer, epithelial, prostate, head and neck,
pancreatic cancer,
glioblastoma, astrocytoma, oligodendroglioma, ependymomas, neurofibrosarcoma,
meningia, liver, spleen, lymph node, small intestine, blood cells, colon,
stomach,
thyroid, endometrium, prostate, skin, esophagus, bone marrow and blood. In
other
embodiments, the cell is located within a mammal.
The present invention also provides a method of inducing apoptosis in a cell
comprising the steps of providing an adenoviral expression construct
comprising a
nucleic acid' encoding a proapoptotic member of the Bcl-2 gene family and
promoter
functional in eukaryotic cells wherein the nucleic acid is under
transcriptional control
of the first promoter; and contacting the expression construct with the cell
in an
amount effective to kill the cell; wherein expression of the proapoptotic gene
by the
results in an increase in the rate of death of said cell relative to the
growth of said cell
in the absence of said proapoptotic gene. In particularly preferred
embodiments, the
proapoptotic member of the Bcl-2 gene family is a Bax, Bak, Bim, Bik, Bid or
Bad
gene. In more preferred embodiments, the proapoptotic member of the Bcl-2 gene
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
9
family is a truncated Bax gene. In other preferred embodiments, the
proapoptotic
member of the Bcl-2 gene family is a truncated Bak gene.
Also contemplated by the present invention is a nucleic acid encoding a
truncated Bax gene. In particular embodiments, the Bax gene comprises a
nucleic
acid sequence of SEQ ID NO:1. In other embodiments, the Bax gene encodes a
protein having an amino acid sequence of SEQ ID N0:2. In particularly
preferred
aspects the truncated Bax gene encodes a protein comprising a BH3 region. In
alternative preferred embodiments, the truncated Bax gene encodes a protein
I O comprising an intact death domain.
In yet another embodiment, the present invention further contemplates an
adenoviral expression construct comprising a nucleic acid encoding a truncated
Bax
gene and a first promoter functional in eukaryotic cells wherein the nucleic
acid is
under transcriptional control of the first promoter. The adenoviral expression
construct may further comprise a second nucleic acid encoding a second gene.
The
second gene may be under the control of the first promoter. In alternative
embodiments, the second gene may be under the transcriptional control of a
second
promoter. In a further alternative, the truncated Bax gene and the second
nucleic acid
may be separated by an IRES.
In yet another embodiment, the present invention further contemplates an
adenoviral expression construct comprising a nucleic acid encoding a bak gene
and a
first promoter functional in eukaryotic cells wherein the nucleic acid is
under
transcriptional control of the first promoter. The adenoviral expression
construct may
further comprise a second nucleic acid encoding a second gene. The second gene
may
be under the control of the first promoter. In alternative embodiments, the
second
gene may be under the transcriptional control of a second promoter. In a
further
alternative, the truncated Bak gene and the second nucleic acid may be
separated by
an IRES.
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
In other embodiments there is provided, a method for expressing a polypeptide
in a target cell comprising introducing into the target cell a first vector
comprising a
coding region for a polypeptide under the control of a first promoter
inducible by an
inducer polypeptide not expressed in the target cell and a second vector
comprising a
5 coding region for the inducer polypeptide under the control of a second
promoter
active in the target cell. In certain embodiments, the first and second
vectors are viral
vectors. In other embodiments, the f rst and said second vectors are non-viral
vectors.
In yet other embodiments, the first vector is a viral vector and the second
vector is a
non-viral vector, or the first vector is a non-viral vector and the second
vector is a
10 viral vector. It is contemplated that the second promoter is a constitutive
promoter, an
inducible promoter or a tissue specific promoter.
In certain embodiments, the viral vectors are the same or different and may be
selected from the group consisting of an adenoviral vector, a herpesviral
vector, a
retroviral vector, an adeno-associated viral vector, a vaccinia viral vector
or a polyoma
viral vector.
It is contemplated in one embodiment that the first vector and the second
vector are introduced into the target cell at a ratio of 1:1, respectively. In
other
embodiments, the first vector and the second vector are introduced into the
target cell
at a ratio of 2:1, respectively. In still other embodiments, the first vector
is introduced
at 900 MOI and the second vector at 1500 MOI into the target cell.
In another embodiment, the first promoter is GAL4 and the inducer
polypeptide is GAL4/VP 16, respectively. It is contemplated in other
embodiments,
that the first promoter can be selected from the group consisting of the
ecdysone-
responsive promoter, and Tet-OnT"" and the inducer ecdysone or muristeron A
and
doxycycline, respectively.
In particular embodiments, the target cell is a hyperproliferative cell, a pre-
malignant cell or a malignant cell. In embodiments where the target cell is
malignant,
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
11
it is contemplated that the malignant cell may be selected form the group
consisting of
a lung cancer cell, a prostate cancer cell, a brain cancer cell, a liver
cancer cell, a
breast cancer cell, a skin cancer cell, an ovarian cancer cell, a testicular
cancer cell, a
stomach cancer cell, a pancreatic cancer cell, a colon cancer cell, an
esophageal cancer
cell, head and neck cancer cell.
In certain embodiments, the first and second vectors are introduced into the
target cell at the same time. In one embodiment, the first vector is
introduced into the
target cell prior to the second vector. In other embodiments, the second
vector is
introduced into the target cell within 24 hours, within 12 hours, within 6
hours, within
3 hours or within 1 hour of the first vector. In another embodiment, the
second vector
is introduced into the target cell prior to the first vector. It is
contemplated, that the
first vector is introduced into the target cell within 24 hours, within 12
hours, within 6
hours, within 3 hours or within 1 hour of the second vector.
IS
In other embodiments, the target cell is further contacted with a DNA
damaging agent. It is contemplated that the DNA damaging agent may be
radiotherapy or chemotherapy.
In one embodiment, the second promoter is an inducible promoter and the
inducing factor is present in the target cell. In another embodiment, the
second
promoter is an inducibte promoter and the inducing factor is added to the
target cell.
In particular embodiments, it is contemplated that one or both of the vectors
further
comprise a polyadenylation signal.
2S
In certain embodiments, the polypeptide expressed in the target cell is
cytotoxic. It is contemplated that the cytotoxic polypeptide may selected from
the
group consisting of an inducer of apoptosis, a cytokine, a toxin, a single
chain
antibody, a protease and an antigen. It is further contemplated that the
inducer of
apoptosis maybe selected from the group consisting of Bax, Bak, Bik, Bim, Bid,
Bad
and Harakiri. In preferred embodiments, the inducer of apoptosis is Bax. In
other
SU8ST1TUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
12
embodiments, it is contemplated that the cytokine may be selected form the
group
consisting of oncostatin M, TGF-Vii, TNF-a and TNF-(3. In yet other
embodiments, the
toxin may be selected form the group consisting of ricin A-chain, diphtheria
toxin A-
chain, pertussis toxin A subunit, E. coli enterotoxin A subunit, cholera toxin
A
subunit and pseudomonas toxin c-terminal.. In particularly preferred
embodiments,
the toxin is diphtheria toxin A-chain.
In one embodiment, a kit comprising a first vector comprising a first
promoter,
inducible by an inducer polypeptide, a multipurpose cloning site 3' to the
first
promoter in a suitable container and a second vector comprising a coding
region for
the inducer poiypeptide under the control of a second promoter active in the
target cell
in suitable container. In another embodiment, the first vector further
comprises a
region coding for a polypeptide under control of the first promoter. In yet
another
embodiment, the second promoter is an inducible promoter and the kit fizrther
comprises an agent that induces the second promoter in a suitable container
means.
Also contemplated is a method of treating a disease comprising introducing
into cells of a subject having a disease a first vector comprising a coding
region for
the therapeutic polypeptide under the control of a first promoter inducible by
an
inducer polypeptide not expressed in the target cell and a second vector
comprising a
coding region for the inducer polypeptide under the control of a second
promoter
active in the target cell. In one embodiment, the disease may be selected from
the
group consisting of lung cancer, prostate cancer, brain cancer, liver cancer,
breast
cancer, skin cancer, ovarian cancer, testicular cancer, stomach cancer,
pancreatic
cancer, colon cancer, esophageal cancer and head and neck cancer. In another
embodiment, the therapeutic polypeptide may be selected from the group
consisting of
Bax, Bak, Bik, Bim, Bid, Bad, Harakiri, ricin A-chain, diphtheria toxin A-
chain,
pertussis toxin A subunit, E. coli enterotoxin A subunit, cholera toxin A
subunit,
pseudomonas toxin c-terminal, IL-1, IL-2, IL-3, IL-4, IL-5, IL,-6, IL-7, IL-8,
IL-9, IL,-
10, IL,-11 IL-12, GM-CSF oncostatin M, TGF-Vii, TNF-a, TNF-(i and G-CSF.
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
13
Other objects, features and advantages of the present invention will become
apparent from the following detailed description. It should be understood,
however,
that the detailed description and the specific examples, while indicating
preferred
embodiments of the invention, are given by way of illustration only, since
various
changes and modifications within the spirit and scope of the invention will
become
apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to further demonstrate certain aspects of the present invention. The invention
may be
better understood by reference to one or more of these drawings in combination
with
the detailed description of specific embodiments presented herein.
FIG. 1 Schematic depiction of the protein structures of the BcI-2 family
members. BH1, BH2, BH3, and BH4 are the conserved homology domains. TM
indicates the transmembrane domain, NH2 indicated the amino terminal domain,
and
the PEST domain represents the region which is correlated to an early response
gene
product and is associated with rapid protein turnover. GRS is grouped with the
anti-
apoptotic family members, however, its role in apoptosis is not currently
known.
FIG. 2A and FIG. 2B. Western blot analysis of CPP32 and Parp expression.
Control non-infected cells and cells following infection with Ad5ICMBIp53 were
collected and subjected to western blot analysis using monoclonal antibody
against
CPP32 (FIG. 2B) or polyclonal antibody against pare (FIG. 2A). Fifty
micrograms of
protein was analyzed by SDS-PAGE and visualized by western blotting using the
ECL
chemiluminescence system. Image shown is an optical scan of a representative f
lm
exposure from one of three studies. The arrows indicate expected location of
CPP32
and Parp cleavage product.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
14
FIG. 3A and FIG. 3B. Effect of Ad5/CMV/p53 gene transfer on cell cycle
regulation and induction of apoptosis. Cell cycle analysis and TUNEL were
performed on cells which were treated with control vector DL312 or PBS or
infected
with Ad5/CMV/pS3 and collected at 6 h intervals following infection. Cells
were
tripsinized at the reported time point fixed and analyzed for DNA content by
perpidium iodine staining and analyzed for TiJNEL labeling by fluorescence
using
flow cytorrietry. Infection with AdS/CMV/p53 resulted in a increase in G~
population
of cells and an increase in the 2N population of cells (FIG. 3A). Additionally
infection with Ad5/CMV/p53 resulted in an increased population of TLTNEL-
labeled
cells consistent with increases in apoptotic death (FIG. 3B).
FIG. 4A, FIG. 4B, and FIG. 4C. FACS analysis to measure apoptosis in
MCF-7 cells (FIG. 4A), SKBr3 cells (FIG. 4B) and MDA-MD-468 cells (FIG. 4C).
Cells were either uninfected, infected with an empty adenoviral vector
control, an
adenovirus vector containing the truncated bax gene.
FIG. 5. Plasmid map of the Supercos vector.
FIG. 6. Plasrnid map of pCOS/LJ07.
FIG. 7. Plasmid map of pCOS/Ad/LJ17.
FIG. 8. Plasmid map of pCMV/Bak.
FIG. 9. Plasmid map of pCOS/Ad-Bak.
FIG. 10. Schematic of cloning adenovirus genome into cosmid.
FIG. 11. Schematic of construction of recombinant adenovirus in E. toll.
FIG. 12. Schematic of production of recombinant adenovirus.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99105359
FIG. 13. Schematic of adenovirus-mediated gene co-transfer. The expression
cassettes for the transgene (bax) and the transactivator (GAL4/VP 16) are
cloned into
separate vectors. The expression of the transgene is then induced after co-
infecting a
5 target cell with the two vectors.
FIG. 14. Apoptosis profiles after induction of bax gene expression. Nuclear
fragmentation detected by staining with Hoechst 33432. The treatment for each
sample is indicated above each panel.
FIG. i5. In vivo induction of bax gene expression. Nuclear fragmentation
detected by hematoxylin and eosin staining of liver sections from mice treated
with (a)
PBS, (b) Ad/GT-Bax + Ad/CMV-GFP, (c) Ad/GT-Bax + Ad/PGK-GV 16, and (d)
Ad/GT-LacZ + Ad/CMV-GV 16.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Cancer accounts the death of over half a million people each year in the
United
States alone. The causes for cancer are multifactorial, however, it is known
that
aberrations in controlled cell death result in uncontrolled cell proliferation
and hence
contribute to many cancer.
The p53 gene is well-recognized as possessing tumor suppressor capabilities
and mutations in wild-type p53 are correlated to a variety of cancers.
However, the
interaction of p53 with other cellular factors is not well characterized, in
fact, many of
these factors remain undefined. It is not surprising that, in light of the
lack of
significant information on p53 function, there is an incomplete understanding
of the
pathways through which p53 regulates tumor development. Nevertheless, p53-
based
gene therapy has been remarkably effective in inducing cell cycle arrest
and/or
apoptosis in malignant cells carrying p53 gene mutations.
SUBSTfTUTE 5liEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
16
There now is a great deal of evidence that the apoptotic effect of p53 is
- mediated through the members of the proapoptotic Bcl-2 family. It has been
shown
that the p53 dependent expression of Bax is induced in slow-growing apoptotic
tumors. Further, tumor growth appears accelerated, and apoptosis is decreased,
in
S Bax-deficient mice. This suggests that Bax is required for a full p53-
mediated
response (Yin et al., 1997). The present invention, for the 'first time,
provides
evidence that proapoptotic Bcl-2 genes in adenoviral vectors can be used to
decrease,
diminish, inhibit or otherwise abrogate the growth of cancer cells.
The present invention employs, in one embodiment, an adenoviral expression
construct comprising a gene that encodes a truncated Bax protein. As discussed
herein below, the Bcl-2 family of proteins consists of death antagonists and
death
agonists. that regulate apoptosis and compete through dimerization. All
members of
the Bcl-2 family of proteins contain one or more Bcl-2 homology domains (BH).
It
appears that there are at least 4 BH domains, referred to as BH1, BH2, BH3 and
BH4.
The competition between the proapoptotic and antiapoptotic members is mediated
at
least in part, by competitive dimerization between selective pairs of
antagonists and
agonist molecules. Mutagenesis studies revealed that intact BH1 and BH2
domains of
antagonists are required for repression of cell death. Conversely, the BH3
domain of
Bax is the domain responsible for conferring the death agonist activity to Bcl
proteins.
Thus, in preferred embodiments, the present invention uses a truncated Bax
protein
having an intact "death domain." Of course other Bcl proteins such as Bak,
Bid, Bik,
that comprise the death domain will also be useful in the adenoviral
constructs of the
present invention.
In the present invention, the overexpression of the proapoptotic mediator Bax
has been demonstrated in cancer cell lines transduced with an adenoviral Bax
construct. Morphologically, apoptosis was seen within 4 days post-
transduction.
Thus, the present invention demonstrates that Bax induces apoptosis in cancer
cell
lines and provides evidence that adenoviral constructs containing Bax and/or
other
proapoptotic Bcl-2 gene family members will be useful components of a cancer
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
17
therapy regimen. Methods of producing and using such compositions are
discussed in
fiirther detail below.
In another embodiment, an adenoviral-mediated gene co-transfer system is
described, that permits the regulated expression of cytotoxic gene products
for use in
treating hyperproliferative disease. In one embodiment, a first vector
carrying a gene
encoding a toxic product is under the control of a promoter, not active in the
target
source. A second vector, comprises a transactivator gene, wherein the
transactivator
protein product activates transcription from the promoter in the first
expression
vector. The choice of promoter on the second expression vector can be selected
for
use on an as needed basis (e.g., tissue specificity). It is contemplated
further, that the
co-transfer system can be used with any expression vector or combination
thereof
(e.g., viral, plasmid, piasmid shuttle vector, cosmid), introduced via any
method of
gene transfer desired (i.e., viral or non-viral) and used for both in vivo and
in vitro.
A. The Bcl-2 Gene Family and Apoptosis
Apoptosis is an essential process required for normal embryonic development,
maintenance of adult tissue homeostasis and the suppression of carcinogenesis.
Apoptosis has been defined as a type of cell death which complements mitosis
in the
regulation of cell populations (Kerr et al., 1972). Apoptosis can occur as a
result of
both physiologic and pathologic conditions and is believed to be, in many
developmental contexts, a programmed event. The sequence of events begins with
nuclear and cytoplasmic condensation and ends with the release and
phagocytosis of
apoptotic bodies (Kerr et al., 1972).
A major advance in understanding the regulation of apoptosis came with the
discovery of the Bcl-2 proto-oncogene from the t( 14;18) chromosomal
translocation
breakpoint in follicular lymphoma (Bakhshi et al., 1985; Cleary and Sklar,
1985;
Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). Bcl-2
acts to
suppress cell death triggered by a variety of stimuli and, it is now apparent
that there
is a family of Bcl-2 cell death regulatory proteins which share in common
structural
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
18
and sequence homologies. These different family members have been shown to
either
possess similar functions to Bcl-2 or counteract Bcl-2 function and promote
cell
death. These cell death regulators are discussed in further detail herein
below.
In mammalian development, Bcl-2 and Bcl-2 family members have been
shown to play a role in morphogenesis and normal development. During marine
fetal
development Bcl-2 is expressed in tissues derived from all three germ layers;
however, as the fetus matures, Bcl-2 expression becomes restricted (Novack and
Korsmeyer, 1994). Similar observations were seen in human fetal tissues in
that Bcl-2
was expressed in a wide variety of tissue types and expression became
restricted as the
fetus matured (LeBrun et al., 1993; Chandler et al., 1994). Bcl-2 was detected
in the
human fetal thymus, hematopoietic cells, endocrine glands, and hormonally
regulated
tissues and differential expression of Bcl-2 family members occurs during
neuronal
differentiation. Bcl-xL and Bcl-2 are both expressed in neurons of the
developing
human fetus, however, Bcl-x~ expression persists throughout fetal development
and
into adulthood whereas Bcl-2 expression diminishes between wk 20-39 of
gestation
(Yachnis et al., 1997).
Although Bcl-2 protein is widely expressed in embryonic tissues (Novack and
Korsmeyer, 1994; Lu et al., 1993), absence of Bcl-2 protein in Bcl-2 null mice
does
not interfere with normal prenatal development (Veil et al., 1993). However,
postnatally, these mice display growth retardation, smaller ears, and
polycystic
kidneys, and most die within several months due to kidney failure. In the Bcl-
2
deficient mice, which eventually become ill, the thymus and spleen are
atrophic due to
massive lymphocyte apoptosis. Also, Bcl-2 null thymocytes are more susceptible
to
undergo apoptosis following y-irradiation or treatment with dexamethasone
(Kamada
et al., 1995; Nakayama et al., 1994).
The tissue distribution of Bcl-2 expression also suggests that Bcl-2 plays a
role
in survival in various cell types (Hockenbery et al., 1991).
Immunohistochemistry
reveals that Bcl-2 is expressed in cells that regenerate such as the stem
cells or in cells
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
19
that are long lived. In the lymphatic system, Bcl-2 is strongly expressed in
the thymic
medulla where the T-cells which have survived negative and positive selection
reside,
and in the areas of lymph nodes associated with maintenance of plasma cells
and
memory B-cells (Hockenbery er al., 1991; Nunez et al., 1991). In non-
hematopoietic
tissues, Bcl-2 is restricted to cells that undergo self renewal such as the
basal layer of
the skin, the crypt cells of the small and large intestine, and in long lived
cells such as
the neurons. Bcl-2 also is expressed in tissues such as breast duct epithelium
and
prostate epithelium which undergo hyperproliferation or involution at the
influence of
the hormone or growth factors (Hockenbery et al., 1991; McDonnell et al.,
1992).
IO
The Bcl-2 family continues to expand with the discovery of new members.
Table 1 summarizes the Bcl-2 family of cell death regulators.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
N
H N ~ ~ M
U O ~ t'~~rN..~
d' N N N
~ N M
V~ N N
~ N if ~ 00
~ n'~'-~'~ 00
M ~ ~
G O
N _ _
N
V ~ ~ ~ U U U U
.
C O O O O O O ~ .O 'O O
~r ~, ~.~. ~ A C~C~ y rr
a. c. ~, ~. rs.a. ~ 0 0 0
d z z z a Q d
a Q d d d d
~ C ~ C O O 4 O
C
a a a a a a ~.
o
E 00 z z ~ z z M z
H ~ ~ M
='~' V ~ d.
y = a
.'aU
E
as
La R G (~V1 -~ N M i~F~' .-.~ i4 01 M N
Vii,~ ~ N M N M O ~ N N ~ c' ~ N N
N
CL
G
E .~
,aO~ M M O N v1 N 00 ~'iE O - ~!
C M M O~ ~!'1I~l~ O~-w ~'iF O
N N .-,M .-..-.r-.N ' M N N
~'
a ~ _ d'
sx w
V'7I~ I~~00 ~.~ O N ~!1p O cf' rte,,
~O N M M ,~-;
x ~'D N C~ L L~ ~ D C~
N z N z z Z ~ z ' z
G
..,
E E N iG 3 _~ ..rL3 C'2?- Gp ~ "" N M
U V U U a r~"-~~ ~ ~ C~CU vd ~ c~Cc~~O
a4Aa oa~ m m m m cn m m m Ao
Aa
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 21 PCT/US99/05359
ca
U
w-
~o ~ ~o U
0 0o h a~
In V'1 M CL
v1 ~ ~D
C
c~
cd
,_",
U
N
Ct~
U U U ~
1 U
0 O O ~
,,~,
O O A O m
~
U
O O O N
CdrC~ G, O'
~
U
4~
N
U
N O
~
z z ~ ~~
'
z
a3
Hxw
0
x
~
Z H
E~ ~
o
o
~
Ny
O .
v
M 00 ~h ~
U ~. '
N ~ '*
a.
a
~.o
a
o
~
'
0
~
C~ ~D h ~ tn G.
-. ~ N
. .- ..., ,O O
...
it
4.
U
.K.
U
:~
~F
'fl
O
G_
U
,*
O 00h
-~ d
-, . O O zb~
A
~
~,
'CG.
~
O
.
z z z ~~b
~
z
U
N
O
O
~y
O
iE
.K.
O
~ 'x'
..-.
C/~s
~
oa m c7x
SUBSTITUTE SHEET (RULE 2S)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
22
It is commonly accepted that tumorigenesis is a multistep process which may
involve chromosomal abnormalities and the deregulated expression of proto-
oncogenes (Bishop, 1991 ). This is particularly evident in hematolymphoid
neoplasms
where chromosomal translocations may result in the activation of a proto-
oncogene.
Translocations involve the breakage and reunion of chromosomes where part of
one
chromosome breaks off and becomes reattached to another chromosome. Such
translocations are described by a notation that indicates which two
chromosomes have
been recombined. For example, t(9:22) indicates that a translocation has
occurred
between chromosome 9 and chromosome 22. Further delineation of the exact
regions
or genes that are involved in the translocation lead to the identification of
the resulting
gene fusions or proto-oncogenes involved in each particular translocation
event.
Certain chromosomal translocations are associated with activation of oncogenes
that
lie near the breakpoint of the chromosome.
Characterization of the t(9;22) and t(8;14) translocations in chronic
myelogenous leukemia (Howell and Hungerford, 1960; Rowley, 1973) and Burkitt's
lymphoma (Manalov and Manolova 1972; Zech et al., 1976), respectively,
provided a
paradigm for the deregulation of proto-oncogenes during multistep
carcinogenesis.
B. Bcl-2 Family Members
Many Bcl-2 family member proteins have now been identified (FIG. 1). These
Bcl-2 homologues can be broadly categorized as death antagonists and death
agonists.
The growing list of Bcl-2 gene family members all share highly conserved
domains
referred to as Bcl-2 homology domain 1 and 2 (BH1 and BH2) (Oltvai et al.,
1993;
Yin et al., 1994; Yin et al., 1995) or domains B and C, respectively (Hanada
et al.,
1995; Tanaka et al., 1993). These homology domains seem to be important for
Bcl-2
to form heterodimeric complexes with the family members and to carry out its
anti-
apoptotic function (Yin et al., 1994; Hanada et al., 1995; Yang et al., 1995a;
Korsmeyer et al., 1993; Sedlak et al., 1995). For example, mutations in BH1
and
BH2 prevent Bcl-2 from forming heterodimeric complexes with the Bcl-2
homologue
Bax and can abrogate the survival function of Bcl-2 (Yin et al., 1994). The
Bcl-2
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PC'T/US99/05359
23
protein can also form homodimers with itself via its NH2 terminal region
called the
BH4 domain which spans residues 11 through 33 (Hanada et al., 1995).
Thus, as stated earlier, the Bcl-2 family members are divided into
proapoptotic
and antiapoptotic genes. The proapoptotic genes include Bax, Bak, Bcl-xs, Bad,
Bik,
Bid and Harakiri. The antiapoptotic genes include Bcl-2, Bcl-x~, Mcl-1, Al,
Bcl-w
and GRS (FIG. 1 ). Each of these genes are discussed in further detail herein
below.
i. Bct-2
The t(9;22) results in the formation of a bcr-abl fusion gene and chimeric
protein (Shrivelman et al., 1985) while the t(8;14) results in the
inappropriate
expression of c-myc (Dalla-Favera et al., 1982; Taub et al., 1984; Nishikura
et al.,
1983). Both of these molecular events result in augmented cellular
proliferation
(Langdon et al., 1986).
Bcl-2 was discovered as a novel transcriptional element by its association
with
the t( 14;18) reciprocal chromosomal translocation commonly found in
follicular
lymphoma (Bakhshi et al., 1985; Cleary and Sklar, 1985, Tsujimoto et al.,
1984).
Bcl-2 was shown to be a unique oncogene in that its deregulation did not
result in an
increase in cell proliferation, but rather enhancement of cell survival (Vaux
et al.,
1988; Hockenbery et al., 1990; McDonnell et al., 1989). Thus, Bcl-2 represents
a
class of oncogene that enables neoplastic growth by suppressing cell death
(McDonnell, 1993a).
The Bcl-2 gene, is comprised of three exons and spans approximately 230 Kb.
The open reading frame is in exon 2 and 3, and encodes a 25 kD integral
membrane
protein (Seto et al., 1988; Zutter, et al., 1991). The message can be
alternatively
spliced to give two transcripts, Bcl-2a and the truncated Bcl-2(3 that lacks
the C-
terminus region (Tsujimoto and Croce, 1986). Bcl-2 possesses a very
hydrophobic
stretch of 23 amino acids at the C-terminus which serve as a transmembrane
domain
(Hockenbery et al., 1990). Bcl-2 - protein localizes to the nucleus, rough ER,
and
mitochondria. In mitochondria, the protein is localized to the contact zone of
the
SUBSTITUTE SHEET (RULE 2fi)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
24
inner and outer membranes of the mitochondrial membrane where the transport of
materials from the cytosol into the mitochondrial matrix occurs (Hockenbery et
al.,
1990; deJong et al., 1992).
Bcl-2 is normally expressed in pro and mature B-cells, but is downregulated in
pre and immature B lymphocytes (Merino et al., 1994). This differential
expression
points to the survival role of Bcl-2 in B lymphocyte development. High levels
of
Bcl-2 are needed to ensure the survival of pro-B-cells and mature B-cells in
order to
maintain a population of functional lymphocytes. But low levels of Bcl-2 are
necessary for cells, which do not express functional surface Ig or are self
reactive, to
undergo apoptvsis. Also in T-cells, Bcl-2 is expressed at low levels in double
positive
thymocytes undergoing negative and positive selection, and at high levels in
mature
single positive T-cells which have survived the selection (Gratiot-Deans et
al., 1993).
Thus, Bcl-2 seems to have an important role in lymphocyte development
(McDonnell
et al., 1989; McDonnell et al., 1990; McDonnell and Korsmeyer, 1991;).
The Bcl-2-Ig transgenic mouse model demonstrates that deregulation of Bcl-2
gene causes initially a polyclonal expansion of mature B-cells which can
progress to
an aggressive monoclonal malignancy with an acquisition of additional gene
deregulation, thus confirming the multistep nature of carcinogenesis
(McDonnell,
1993b). In humans also, follicular lymphoma can progress to a high grade
lymphoma
following the acquisition of t(8; 14) translocations and c-myc gene
deregulation, albeit
this appears to be an uncommon event (Gawerky et al., /988).
It also has been demonstrated that Bcl-2 plays a role in the suppression of
p53-
mediated cell death. Splenic mononuclear cells obtained from Bci-2-Ig mice,
which
possess wild-type p53, displayed rates of apoptosis comparable to cells
obtained from
p53 knockout mice following y-irradiation (Marin et al., 1994). Together,
these
results and the results of others utilizing transformed cell lines indicate
that Bcl-2 is
capable of blocking p53 mediated cell death induction (Marin et al., 1994;
Wang et
al., 1993; Chiou et al., 1994).
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
Mutations in the conserved domains of p53 were uncommon in the
lymphomas arising in the Bcl-2-Ig transgenic mice suggesting that there is no
selective advantage of acquiring p53 mutations when Bcl-2 is overexpressed
(Mann et
al., 1994). Additionally, the Bcl-2-Ig transgenic and p53 knockout marine
models
5 were further utilized to determine the extent of genetic complementation
between p53
and Bcl-2. In p53 KO/Bcl-2 hybrid mice, tumor latency and incidence were
unchanged when compared to individual parental strains of mice (Mann et al.,
1994).
Many human tumors, such as breast and prostate, also demonstrate that there is
an
inverse correlation between the presence of p53 mutations and Bcl-2 expression
10 (Silvstrini et al., 1994; McDonnell et al., 1997).
ii. Bax
Bax (SEQ ID N0:3=cDNA; SEQ ID N0:4= wild-type protein), "Bcl-2
associated X protein", is a death agonist member of the Bcl-2 family of
proteins.
1 S Discovered by co-immunoprecipitation with Bcl-2, it was the first Bcl-2
homologue to
be identified {Oltvai et al., 1993). The 4.5 Kb Bax gene maps to 19q13.3-13.4
and is
comprised of six exons (Apte et al., 1995). It shares 21% identity and 43%
similarity
with Bcl-2. The most conserved regions between the two molecules are within
the
BH1 and BH2 domains encoded by exons 4 and 5, respectively (Oltvai et al.,
1993).
Multiple forms of Bax protein can result from various splicing alternatives.
The most prevalent from is Bax-a, whose 1.0 Kb RNA encodes a 192 amino acid,
21
kD transmembrane protein. The 24 kD cytosolic Bax-(i lacks the transmembrane
segment and is encoded by 1.5 Kb RNA transcript. A third form, Bax-y lacks the
exon 2 and can undergo alternative splicing of intron S to yield 1.0 and 1.5
Kb RNA
transcripts (Olsen et al., 1996). Yet another alternatively spliced form of
Bax, BaxF,
has the C-terminal transmembrane anchor as well as the BH 1 and BH2 domains
(Apte
et al., 1995). The functional role of these Bax variants remains to be
elucidated.
The Bax gene promoter contains four p53 binding sites and the expression of
Bax is upreguiated at the transcriptional level by p53 (Miyashita and Reed,
1995). A
temperature sensitive p53 mutant transfected into a myeloid cell line was
associated
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
26
with increased Bax mRNA after shifting to the permissive temperature (Zhan et
al.,
1994). Also in cells obtained from p53-null mice, the level of Bax proteins
was found
to be lower (Miyashita et al., 1994). Moreover, following apoptosis induction
by
ionizing radiation, the Bax mRNA was upregulated only in the cell line that
possesses
S wild-type pS3 (Zhan et al., 1994). These data suggest that Bax may function
as a
primary response gene in a pS3 regulated apoptotic pathway (Miyashita et al.,
1994).
However, thymocytes from the Bax knockout mice were not diminished in their
capacity to undergo apoptosis after y-irradiation, a pathway driven by pS3
(Knudson et
al., 1995). Bax expression can also be modulated by other factors. The mRNA
level
has been shown to be downregulated in myeloid leukemia cell lines treated with
IL-6
and/or dexamethasone (Lotem and Sachs, 1995). The half life of Bax mRNA can be
increased in cell lines expressing higher levels of Bcl-2 (Miyashita et al.,
1995).
However, this increase in stability of Bax mRNA by Bcl-2 protein appears to be
tissue
specific. ,
1S
Mutational analysis has shown that the BH 1 and BH2 domains of Bax are not
required for heterodimerization with Bcl-2, nor is the NH2 terminal amino
acids
needed for Bax homodimerization, unlike the homodimerization requirement for
Bcl-2. Rather a stretch of amino acids spanning residues S9-101 in the BH3
domain
was shown to be essential in both the homodimerization and heterodimer complex
formation with Bcl-2 (Zha et al., i996a). Additionally, in contrast to Bcl-2,
Bax can
function in- its monomeric form to accelerate cell death (Simonian et al.,
1996). Bax
can heterodimerize with other Bcl-2 related proteins, including Bcl-xL, McI-1,
and Al
(Sedlak et al., 1995). The "rheostat" model has been proposed to explain the
role of
2S Bcl-2 family member interactions in controlling cell death. This model
suggests that
the relative amounts of Bcl-2 and Bax may determine the susceptibility of a
cell to
undergo apoptosis (Korsmeyer et al., 1993). According to this model, when Bcl-
2 is
in excess, Bcl-2/Bax heterodimers predominate and cell death is inhibited.
Conversely, when Bax is in excess, Bax homodimers predominate and the cell
becomes susceptible to cell death induction following exposure to an apoptotic
stimulus.
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99146371 PCTNS99/05359
27
The tissue distribution of Bax protein is more widespread than Bcl-2.
(Krajewski et al., 1994a). The immunohistochemical staining of murine tissues
has
revealed that the expression of Bcl-2 and Bax overlap in some tissues, and
that Bax is
not always expressed at high levels in compartments marked by a high turnover
rate.
For example, Bax, as well as Bcl-2, are expressed in the thymic medulla but
not in the
thymic cortex, despite high numbers of cortical thymocytes which undergo
apoptosis.
Also, a high level of Bax protein is observed in neurons, cells that have a
long life.
However, in certain tissues such as colonic epithelium, gastric glands, and
secretory
epithelial cells of prostate, Bax expression corresponds to the cells that are
susceptible
to undergoing apoptotic cell death (Krajewski et al., 1994a).
Evidence that apoptosis is not absolutely dependent on the expression of Bax
is also apparent from an analysis of the Bax knockout mice. In these mice the
absence
of Bax is associated with either tissue specific hyperplasia or hypoplasia
(Knudson et
al., 1995). For example, there was an increase in number of resting mature B-
cells
and thymocytes causing hyperplasia in the spleen and thymus. However, the male
Bax knockout mice were infertile due to atrophic testes, resulting from the
abrogation
of spermatogenesis (Knudson et al., 1995).
Recent evidence suggests that Bax may play a role as a tumor suppressor.
Normally Bax-a is expressed at high levels in breast tissue but is not
detectable, or
expressed at low levels, in breast cancers (Bargou et al., 1995). Furthermore,
in
metastatic breast cancer, patients with reduced Bax expression showed poor
response
to chemotherapy (Krajewski et al., 1995a). Transgenic mice have been generated
,which express a truncated form of the SV40 T antigen (Tg121) resulting in
inactivation of the retinoblastoma protein but not p53. Tg121 mice bearing
targeted
disruptions of either the p53 gene or the Bax gene exhibited an increased rate
of brain
tumor formation compared to Tg121 mice with intact p53 or Bax genes (Yin et
al.,
1997}. Also frequent frame shift mutations of Bax were found in microsatellite
mutator phenotype (MMP) colon adenocarcinomas, suggesting that the wild-type
Bax
gene may play a tumor suppressor role in colorectal carcinogenesis (Rampino et
al.,
1997).
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99/05359
28
iii. Bcl-x
Bcl-x was initially isolated from chicken lymphoid cells using a marine Bcl-2
cDNA probe under low stringency conditions (Boise et al., 1993). The Bcl-x
gene
shares 44% identity with Bcl-2. Bcl-x was shown to interact with other members
of
the Bcl-2 family in a manner similar to that shown for Bcl-2 when analyzed by
the
yeast two-hybrid system (Sato et al., 1994). Two human Bcl-x cDNAs have been
cloned (Boise et al., 1993). Bcl-xL (long form) is a 31 kD protein, with an
open
reading frame of 233 amino acid. This form of Bcl-x contains the BH1 and BH2
domains. The Bcl-x,., cDNA was found to be co-linear with the genomic sequence
denoting the absence of mRNA splicing. Bcl-xs (short form) encodes a 170 amino
acid, 19 kD protein. The carboxy-terminal 63 amino acids encoding the BH 1 and
BH2 domains are deleted from a 5' splice site within exon 1 of the Bci-x gene
(Boise
et al., 1993). A third alternative splice variant of Bcl-x has been isolated
from a
marine cDNA library, Bcl-x(3, (Gonzalez-Garcia et al., 1994}. Bcl-xa, encodes
a 209
amino acid protein that results from an unspliced first coding exon and lacks
the
carboxy-terminal 19 hydrophobic amino acids necessary for transmembrane
insertion.
Both the level and pattern of expression of Bcl-x differ from that of Bci-2.
The levels of Bcl-x expression are generally higher than Bcl-2 in all tissues
examined
except for the lymph nodes where Bcl-2 is predominant (Krajewski et al.,
1994a).
Bcl-xL is mainly expressed irt the cells of the central nervous system,
kidney, and bone
marrow (Gonzalez-Garcia et al., 1994, ; Rouayrenc et al., 1995). Both Bcl-x~
and
Bcl-xs, but not Bcl-2 are expressed in CD34+, CD38-, liri hematopoietic
precursors
(Park et al., 1995). However, the subcellular distribution of Bcl-x protein is
similar to
Bcl-2 in that it localizes to mitochondria and the nuclear envelope. This
suggests that
the function of the two proteins may be similar (alez-Garcia et al., 1994, ).
Further insight into the role of Bcl-x during development was obtained from
Bci-x deficient mice (Motoyama et al., 1995}. Heterozygous mice developed
normally while homozygous, knockout mutants die at approximately day 13 of
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99/05359
29
gestation. The Bcl-x knockout embryos display extensive apoptosis involving
post-
mitotic neurons of the developing brain, spinal cord, dorsal root ganglia, and
hematopoietic cells in the liver. Additionally, lymphocytes from Bcl-x
deficient mice
showed diminished maturation. The life span of immature lymphocytes but not
mature lymphocytes was shortened. This data indicates that Bcl-x is required
for the
embryonic development of the nervous and hematopoietic systems.
Similar to Bcl-2, Bcl-x~ was shown to confer resistance to apoptosis induction
following growth factor deprivation. However, Bcl-xs counteracted the ability
of
Bcl-2 to block apoptosis (Boise et al., 1993). Although Bcl-xL and Bcl-2
initially
seemed to have the same functions, several observations suggest that
biologically
these two proteins are not completely overlapping. The tissue distribution of
Bcl-2
and Bcl-x are not identical and the phenotypes' of the corresponding knockout
strains
of mice are substantially different. Furthermore, it has been shown that WEHI-
231
cells can be protected from apoptosis induced by surface IgM cross-linking by
enforced Bcl-xL expression while enforced Bcl-2 expression exerts no such
protective
effect (Choi and Boise, 1995; Gottschalk et al., 1994).
The crystalline structure of Bcl-x has expanded the inventors' insight into
the
potential mechanisms of function of Bcl-2 family members {Muchmore et al.,
1996).
Bcl-x structure was shown to consist of two central hydrophobic a helices
surrounded
.. . , by twQ, arrlphipatlli<a helices :(Muchmore et al.,.-1996).
Interestingly, the conserved
BH1, BH2 and BH3 domains were in spatial proximity and formed a hydrophobic
cleft. This cleft is believed to form a binding site for other Bcl-2 family
members
(Muchmore et al., 1996). Evidence in favor of this hypothesis was provided
when
Bcl-x and a 16 residue bak peptide derived from the BH3 domain were co-
crystallized. The heterodimeric crystal structure revealed that the bak BH3
domain
interacts with the hydrophobic cleft made by the BH1, BH2, and BH3 domains of
Bcl-x (Sattler et al., 1997). The crystal structure of Bcl-x was also found to
resemble
the translocation domain of the diphtheria toxin and colicins (Muchmore et
al., 1996).
This similarity in structure implies similarity in function and indicates that
Bcl-2
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
family members can be considered channel forming proteins capable of
regulating the
transmembrane trafficking of molecules involved in signaling cell death.
iv. Bak
5 Bak (Bcl-2-homologous antagonist/killer) was first cloned from human heart
and Epstein-Barr transformed human B-cell cDNA libraries (Chittenden et al.,
1995;
Kiefer et al., 1995; Farrow et al., 1995). There are three closely related bak
genes
(bak-1, 2, and 3) which are located on chromosome 6 (bak-1), chromosome 20
(bak-2)
and chromosome 11 (bak-3). The bak genes contain at least three exons and span
6
10 Kb. Bak is a 211 amino-acid, 23 kD protein which shares 53% amino-acid
identity
with Bcl-2. It possesses the same hydrophobic carboxy-terminal domain as Bcl-2
and
Bcl-x L, which suggests that bak is an integral membrane protein. In contrast
to BcI-2,
bak is expressed at high levels in the kidney, pancreas, liver, and fetal
heart, as well as
adult brain (Kiefer et al., 1995). Similar to Bax in the intestine, bak
expression is
15 strongest in the cells in the luminal surface where most apoptosis is
occurnng.
However, in a colorectal carcinoma cell line, only bak expression was shown to
be
modulated following apoptosis induction, indicating that bak may play a
primary role
in enterocyte apoptosis (Moss et al., 1996). This contention is further
supported by
the observation that bak expression is reduced in colorectal adenocarcinoma
samples.
20 Therefore, a downregulation of bak may facilitate the accumulation of
neoplastic cells
in the early stages of colorectal tumorigenesis (Krajewski et al., 1996). Bak
was
shown to accelerate cell .death following IL-3 withdrawal (Chittenden et al.,.
1995;
Kiefer et al., 1995), but inhibits apoptosis induced by serum withdrawal and
menadione treatment (Chittenden et al., 1995).
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99146371 PGT/US99/05359
31
v. Bad
Bad (Bcl-x~/Bcl-2 associated death promoter homologue) a novel member of
the Bcl-2 family that was identified as a Bcl-2 interacting protein using the
yeast two
hybrid system (Yang et al., 1995b). The full-length Bad cDNA sequence encodes
a
novel 204 amino acid protein with a predicted molecular weight of 22 kD. Bad
shares
only limited homology with known Bcl-2 family members in the BHI and BH2
domains. However, the functionally significant W/YGR triplet in BH1, the W at
position 183, the WD/E at the exon junction in BH2 and the spacing between BH1
and BH2 domains is conserved. Unlike many other Bcl-2 family members, Bad does
not contain a transmembrane anchor domain.
Bad was shown to heterodimerize with Bcl-2 and Bcl-x in vivo using co-
immunoprecepitation. Bad's interaction with either Bcl-2 or Bcl-x can displace
Bax
from the heterodimers. Significantly, this was shown to reverse the death
repressor
activity of Bcl-x, but not of Bcl-2. However, Bad does not appear to interact
with
Bax, Mcl-1, or Al nor, apparently, does Bad form homodimers (Yang et al.,
1995b).
Recent studies have shown that Bad may function in intracellular signal
transduction
pathways. Upon IL-3 stimulation of an IL-3 dependent hematopoietic cell line,
Bad
becomes rapidly phosphorylated at two serine residues and is prevented from
forming
heterodimeric complexes with Bcl-x~. The phosphorylated Bad is found to be
complexed with 14-3-3, a phosphoserine binding protein which regulates protein
kinases, and is sequestered in cytosol (Zha et al., 1996b). Therefore,. only
,the non-
phosphorylated Bad is heterodimerized with the membrane bound Bcl-x~ and
counters
the anti-apoptotic activity of Bcl-xL. One of the models to explain the
apoptotic
activity of Bad is that in its non-phosphorylated form, Bad binds to membrane
associated Bcl-x~ which releases Bax to enhance cell death (Zha et al.,
1996b).
Another link between the phosphorylation event and the apoptotic pathway was
shown when it was found that in vitro, Bad is phosphorylated by mitochondria)
membrane targeted Raf 1, but not by the plasma membrane targeted Raf 1.
Moreover, Bcl-2 was shown to target Raf 1 to mitochondria) membrane which
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99105359
32
resulted in phosphorylation of Bad and the subsequent enhancement of cell
survival
(Wang et al., 1996a).
vi. Mcl-1
Mcl-1 (human myeloid cell differentiation protein)was identified by
differentially screening cDNA library of the human myeloid leukemia cell line,
ML-1,
following induction by phorbol 12-myristate 13-acetate {TPA) (Kozopas et al.,
1993).
Mcl-1 has also been detected in normal peripheral blood B cells after
treatment with
IL4 and anti-IgM. Mcl-1 is an early response gene, that reduces its expression
immediately following differentiation induction (Kozopas et al., 1993; Yang et
al.,
1995). A study done using a yeast two-hybrid assay indicates that Mcl-1
interacts
strongly and selectively with Bax, but not with any other Bcl-2 family members
(Sedlak et al., 1995; Sato et al., 1994).
Mcl-1 shares sequence homology to Bcl-2 in the BH1 and BH2 domains and
has a carboxy-terminal transmembrane anchor domain (Yang et al., 1995). In
addition, the Mcl-1 protein possesses PEST sequences (Kozopas et al., 1993),
which
correlate with the its role as an early response gene product (Yang et al.,
1995). The
human Mcl-1 gene maps to chromosome 1 band q21 (Craig et al., 1994), an area
often involved in chromosomal abnormalities in neoplastic and preneoplastic
diseases
(Atkin, 1986; Gendler et al., 1990; Testa, 1990).
Mcl-1 protects against apoptosis induced by constitutive expression of c-myc
or Bax (Reynolds et al., 107). However, in the SAHSmyc cell line, Mcl-1
overexpression is not as effective as Bcl-2 overexpression in preventing myc-
mediated cell death (Reynolds et al., 1994). It has been proposed that Mcl-1
may
function as an alternative to Bcl-2 in situations where Bcl-2 cannot block
apoptosis or
in tissues lacking Bcl-2 expression. For example, in normal peripheral blood B
cells
treated with agents which promote survival (IL-4, anti-p, and TPA) or enhance
rates
of cell death (TGF(31 and forskolin), upregulation of Mcl-1 correlates with
cell
survival and downregulation of Mcl-1 precedes cell death. In contrast, levels
of Bcl-2
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
33
expression are not modulated under the same experimental conditions (Lomo et
al.,
1996).
Additionally, the tissue distribution of Mcl-1 and Bcl-2 expression show
significant differences such as brain and spinal cord neurons in which Bcl-2
predominates compared to skeletal muscle, cardiac muscle, cartilage and liver
where
Mcl-1 predominates over Bcl-2 (Krajewski et al., 1995b). Similarly, Mcl-1
levels in
normal lymph nodes are highest in germinal centers, where the rate of
apoptosis is
high. In contrast, Bcl-2 is most intense in the mantle zone. It has been
postulated that
Mcl-1 temporarily blocks cell death until suppression such as Bcl-2 are
upregulated
(Krajewski et al., 1994b).
vii. Al
A1 was identified by differentially screening a cDNA library of normal
peripheral blood B cells and after treatment with 1L-4 and anti-IgM. The Al
cDNA
was isolated from marine macrophages after GM-CSF induction of differentiation
(Lin et al., 1993). Al is an early response gene that decreases its level of
expression
immediately following differentiation induction {Lin et al., 1993). Yeast two-
hybrid
assay indicates that A 1 interacts strongly and selectively with Bax, with but
not with
any other Bcl-2 family member (Sedlak et al., 1995; Sato et al., 1994). Al
shares
homology with Bcl-2 in the BH1 and BH2 domains, but does not possess the
carboxy
YV, terminal transmembrane domain (Lin et al., 1993).
The correlation of GM-CSF and LPS-induced differentiation with A1
upregulation suggest A 1 could potentially function as a cell death suppressor
(Lin et
al., 1993). Later reports has shown that Al protects against TNF induced
apoptosis in
the presence of actinomycin D in a human microvascular endothelial cells
(Karsan et
al., 1996). A 1 could also inhibit ceramide induced cell death in these
endothelia cells
(Karsan et al., 1996). A 1 expression displays a rather limited tissue
distribution and
appears to be confined to hematopoietic tissues, including helper T-cells,
macrophages, and neutrophils (Lin et al., 1993). .
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99105359
34
viii. Bft-lI
Bfl-1 (Bcl-2 related gene expressed in human fetal liver) was identified
during
a random cDNA sequencing project (Choi et al., 1995). It was found to be
homologous to Bcl-2 family members with the highest homology to the AI gene.
The
S main region of homology was in the conserved BH1, BH2, and BH3 domains. Bfl-
1
is mainly expressed in bone marrow while low levels of expression are detected
in
lung, spleen, esophagus, and liver. Bfl-1 mRNA was detected at relatively high
levels
in six out of eight stomach cancer tumors and metastasis when compared to
normal
stomach tissue from the same patients (Choi et al., 1995). Bfl-1 protein
suppresses
apoptosis induced by p53 in the BRK cell line to the same extent Bcl-2, Bci-
xL. Bfl-1
was also shown to cooperate with Ela in the transformation of primary rodent
epithelial cells (D'Sa-Eipper et al., 1996}.
ix. GRS
GRS was incidentally cloned during the cloning of fibroblast growth factor 4
(FGF-4) from a patient with chronic myelogenous leukemia (Lucas et al., 1994).
The
FGF-4 gene was truncated by a DNA rearrangement with a novel gene named GRS
(Glasgow Rearranged Sequence) with a breakpoint 30 nucleotides downstream from
the translation termination codon of FGF-4. The full length cDNA of GRS was
then
cloned from human activated T cell cDNA library. The GRS cDNA is 824
nucleotides (Kenny et al., 1997). Sequence analysis of GRS revealed 71 %
identity to
the marine A 1 protein at the amino acid level. ...
Northern blot analysis showed a high level of expression of GRS in
hematopoietic cells and to a lesser extent in lung and kidney (Kenny et al.,
1997).
GRS also is expressed in cell lines of hematopoietic origin including HL-60
(promyelocytic leukemia), Raji (Burkitt lymphoma) and K-562 (chronic myeloid
leukemia). However GRS is not expressed in MOLT-4 T lymphoblastic leukemia and
T-cells prior to activation. The melanoma cell line G-361 also expressed high
levels
of GRS. GRS is localized to chromosome 15q24-25. This location positions GRS
adjacent to t{15;17) region translocation frequently observed in acute
promyelocytic
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99I05359
leukemia. The GRS location also places it in the breakpoint described in
Fanconi
anemia that is associated with high incidence of acute leukemia.
x. Bid
5 Bid (BH3 interacting domain death agonist) was initially identified as a
protein
that interacts with both Bcl-2 and Bax proteins. The labeled Bax and Bcl-2
proteins
were used to screen a ~,EXlox expression library constructed from the marine T-
cell
hybridoma line 2B4 (Wang et al., 1996c). Bid is a 23 kD, 195 amino acid
protein.
Sequence analysis of Bid revealed that Bid shares homology only with the BH3
10 domain of the Bcl-2 family and that it lacks the carboxy-terminus
transmembrane
hydrophobic domain. A human homologue of Bid has also been identified. Human
Bid shares 72.3% sequence homology to the marine Bid and has a 195 amino acid
open reading frame (Wang et al., 1996c).
15 In adult mouse tissue, Bid is mainly expressed in the kidneys but is also
present in brain, spleen, liver, testis and lung (Wang et al., 1996c). Low
levels of
expression are detected in the heart and skeletal muscle. The mouse
hematopoietic
cell line, FL5.12, was also found to express high levels of Bid. Subcellular
fractionation has revealed that Bid is predominantly localized to the cytosol
(90%)
20 with a small fraction in the membrane fraction (Wang et al., 1996c).
Expression of Bid in the 1L-3 dependent FL5.12 cell line could induce a subtle
but consistent enhancement of apoptosis following IL-3 withdrawal {Wang et
al.,
1996c). Bid inducible expression as well as transient transfections of Bid in
Rat-1
25 fibroblasts and Jurkat T-cells, results in reducing cell viability to <40%
at 48 h {Wang
et al., 1996c). Bid could also restore apoptosis in FL5.12 clones
overexpressing
Bcl-2. The level of apoptosis was intermediate between the parental and Bcl-2
overexpressing clones. The degree of cell death in all cases corresponded to
the level
of Bid protein expression as detected by Western blot analysis. Bid induced
apoptosis
30 could be inhibited by zVAD-fink, an irreversible inhibitor particularly
effective
against the CPP32-1 ike subset of proteases. This suggests that Bid induced
cell death
involves activation of CPP32-1 ike proteases (Wang et al., 1996c).
SU9STtTUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
36
Bid interacts with both death agonists and antagonists members of the Bcl-2
family. Bid can interact with. Bcl-2, Bcl-x, and Bax but does not form
homodimers.
Bid was unable to form trimoiecular complexes with Bcl-2/Bax heterodimers
suggesting that Bid interacts with monomeric or homodimeric Bcl-2 or Bax.
Several
mutants of Bcl-2, Bax, and Bid were examined to detect the regions of each
molecule
required for their interactions. The BH3 domain of Bid was essential for
interaction
with Bax and Bcl-2. Differential specificity of these mutants was also
detected as
mutant (M97A, D98A) could bind Bax but not Bcl-2, mutant (G9?A) could bind
Bcl-2 but not Bax while other mutants did not bind either protein. Noteworthy
is that
all BH3 mutants of Bid were impaired in their ability to counter Bcl-2
protection
including mutants that could still bind Bcl-2. However, Bid mutant (M97A,
D98A)
that can still bind Bax but not Bcl-2, retained its activity. Conversely, the
BH1
domain of Bcl-2 and Bax were shown to be required for their interaction with
Bid. It
is suggested that the a helix BH3 domain of Bid interacts with the hydrophobic
cleft
contributed by the BH 1 domain of Bcl-x. This interaction might result in a
conformational change in Bid, Bcl-2, or Bax that signals cell death.
xi. Bik
Bik (Bcl-2 interacting killer) is a novel Bcl-2 family member that was
detected
when a human B-cell line cDNA library was used in a yeast two hybrid screen
for
proteins that interact with Bcl-2 (Boyd et al., 1995). Bik is a 160 amino acid
protein
and has a predicted molecular weight of 18 kD encoded by 928 by cDNA and 1 Kb
mRNA. Bik shares homology only within the BH3 domain of the Bcl-2 family and
has a carboxy-terminal transrnembrane hydrophobic domain. Bik was found to
localize to the nuclear envelope and cytoplasmic membrane structures.
Transient co-transfection of Bik and (3-galactosidase expression plasmids in
Rat-1 fibrvblasts resulted in a dramatic reduction in the number of blue
cells,
consistent with reduced viability of Bik transfected cells (Boyd et al.,
1995). Co-
transfection of Bik and Bcl-2, Bcl-x, adenovirus E1B-l9kDa, or EBV-BHRF1
resulted in an increase in blue cell number indicating the ability .of these
proteins to
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99105359
37
reverse cell death by Bik. Deletion of the BH3 domain of Bik resulted in loss
of its
pro-apoptotic activity. Bik induced apoptosis was shown to be inhibited by
zVAD-
fmk. However, CrmA could not inhibit Bik induced cell death. This suggests
that
Bik induced cell death involves selective activation of CPP32-like proteases
(Orth
and Dixit, 1997).
Interactions between Bik and other Bcl-2 family members was examined using
the yeast two hybrid system, GST-fusion protein capture on glutathione agarose
beads,
and transient co-transfection of tagged Bik with other anti-apoptotic Bcl-2
family
members {Boyd et al., 1995). These in vitro and in vivo studies revealed
interactions
between Bik and Bcl-2, Bcl-x, adenovirus E1B-l9kDa, and EBV-BHRF1. Bik also
interacts with Bcl-xs, a death promoting protein that lacks BH 1 and BH2
domains.
This suggests that Bik does not require BH1 and BH2 domain for its interaction
with
Bcl-2 family members. Bcl-2 residues 43-4.8 and ElB-l9kDa residues 90-96 were
shown to be essential for interaction with Bik. Noteworthy is that these
residues are
not within the conserved regions of Bcl-2 family members.
xii. Bcl-w
BcI-w was cloned using degenerate primers to the conserved BHl and BH2
domains in a low stringency PCRT"' reaction (Gibson et al., 1996). These
primers
were used to amplify cDNA from mouse macrophage and mouse brain cell lines.
The
PCR'r'"' product was then used to screen cDNA libraries from mouse brain,
spleen, and
myeloid cell lines. Bcl-w is a 22 Kb gene with a 3.7 Kb mRNA which encodes a
22
kD protein. Human Bcl-w was then isolated from an adult human brain cDNA
library. Bcl-w possesses the BH1, BH2, and BH3 domains. The human and mouse
genes are 99% identical at the amino acid level and 94 % at the nucleotide
level.
Bcl-w mRNA is expressed at high levels in brain, colon, and salivary gland.
Surprisingly, Bcl-w expression is not detected in T- and B-lymphoid cell
lines.
However, mRNA was detected in myeloid cell lines of macrophage, megakaryocyte,
erythroid, and mast cell origin. Bcl-w also has a hydrophobic C-terminal
transmembrane domain. The cytoplasmic localization of Bcl-w is similar to that
of
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
38
Bcl-2. Bcl-w resides in the central region of mouse chromosome 14 and human
chromosome 14 at q11.2. Hematopoetic cell lines expressing Bcl-w were
resistant to
apoptosis induction to the same extent as Bcl-2 and Bcl-x stable
transfectants.
However, Bcl-w did not protect CHI B-lymphoma cells from CD95-induced
apoptosis
while Bcl-2 and Bcl-x~ were able to do so (Gibson et al., 1996).
aiii. Iiarakiri
The Harakiri gene and its protein product Hrk was identified by a yeast two
hybrid screen of a HeLA cDNA library to detect proteins that bind to Bcl-2
(Inohara et
al., 1997). A 9-wk human embryo cDNA library was used to obtain the full
length
Hrk cDNA. Hrk was detected as a 716 by cDNA that was confirmed by the northern
blot analysis using both human and mouse tissue as 0.7 Kb mItNA. The cDNA
encodes an open reading flame of 91 amino acids. Hrk shares homology with Bcl-
2
family member BH3 domain, however, the rest of the protein has no significant
homology to any other protein or Bcl-2 family. A region of 28 hydrophobic
amino
acids that may serve as a membrane-spanning domain was also identified at the
COOH-terminus of Hrk.
Northern blot analysis demonstrates high levels of Hrk expression in all
lymphoid tissues examined including the bone marrow and spleen. Hrk is also
expressed in the pancreas and at low levels in the kidney, liver, lung, and
brain
(Inohara et al., 1997). Hrk was seen as a cytosolic granular staining by
confocal
microscopy of transiently transfected cells with flagged Hrk. This staining is
similar
to the previously reported localization of Bcl-2 and Bcl-x.
Transient transfections of Harakiri in 293T cells, HeLa, and FL5.12 progenitor
B-cells resulted in a dramatic decrease in cell viability by 36 h post-
transfection.
However co-expression of Bcl-2 and Bcl-x could inhibit the death promoting
activity
of Hrk. Interestingly, Hrk appears to interact only with Bcl-2 and Bcl-xL but
not with
the other pro-apoptotic family members Bax, Bak, and Bcl-xs. Deletion mutants
of
Hrk lacking 16 amino acids including the BH3 domain were unable to interact
with
Bcl-2 and Bcl-x. This mutant also failed to induce cell death in 293T cells.
Deletion
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
39
analysis has also revealed the requirement of BH 1 and BH2 domains of Bcl-2
and
Bcl-x to interact with Hrk.
C. Interactions of Bcl-2 family members and mechanisms of function
One of the reasons for the modest understanding of the mechanisms by which
Bcl-2 homologues execute their cellular roles stems from a lack of
identifiable
sequence motifs in the Bcl-2 family which would implicate a mechanism of
action.
What have been defined, however, are shared domains designated as Bcl-2
homology
domain I, 2, 3 and 4. The BH1 domain spans amino acid residues I36-155 of the
Bcl-2 protein, BH2 spans resides 187-202, BH3 spans resides 93-107 and BH4
spans
residues 10-30. The BH3 domain, for its pan appears to be involved in
selective
interactions between Bcl-2 family members.
The BH3 domain appears to be required for the death promoting activity of
Bax and bak are required for their interaction with two death-repressing
members,
Bcl-2 and Bcl-xL (Zha et al., 1996a; Chittenden et al., 1995).
The BH 1 and BH2 domains serve equally important functions. The creation of
point mutations in either domain, can effectively abolish the death repression
function
of Bcl-2 (Yin et al., 1994). Recent evidence suggests, however, that the
formation of
heterodimers is not required for function of family members (Cheng et al.,
1996).
'These same BH1. arid BH2 domain mutants of Bcl-2 fail to heterodimerize with
Bax,
although they do homodimerize well (Yin et al., 1994). Some of the most
compelling
evidence that the BH3 motif represents a "death domain" comes from studies of
Bid
(Wang et al., 1996c). Bid possesses only the BH3 domain, lacks the carboxy-
terminal
signal-anchor segment, and localizes to both cytosolic and membrane
compartments.
Importantly, ectopic expression of Bid abrogates the pro-survival effect of
Bcl-2.
Additionally, expression of Bid, without another death stimulus, induces ICE-
like
proteases and apoptosis. An intact BH3 domain of Bid was required to bind the
BH 1
domain of either Bcl-2 or Bax.
SUBSTITUTE SHEET (RULE 26~
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
The BH4 domain, which is located at the amino-terminus has been far less
characterized. To date, it has been reported that deletion of the BH4 domain
of Bcl-2
nullifies anti-apoptotic function and homodimerization, but does not impair
Bcl-2Bax
heterodimerization (Reed et al., 1996). There is some evidence which indicates
that
5 the BH4 domain may mediate interactions of Bcl-2 family member protein with
non-
Bcl-2-related proteins such as calcineurin (Shibasaki et al., 1997). Thus the
BH4
domain may serve as an tethering domain that bridges Bcl-2 and Bcl-2-related
proteins to important signal transduction proteins.
10 Perhaps, at its simplest level, the expression of various Bcl-2 related
proteins
may determine whether a cell responds to an applied stress by initiating a
cell death
program or surviving. However, another hypothesis, that has substantial
experimental
evidence based on a mutational analysis of the BH domains, suggests that the
cellular
response to injury may be a function of the multiple heterodimerization and
15 homodimerization states between members of this protein family. This model,
commonly known as the "rheostat model" has been advocated by Dr. Stanley
Korsmeyer's group (Oltvai et al., 1993; Korsmeyer et al., 1993). In this
scenario, the
relative levels of dimerization partners available shifts the balance of cell
fate in favor
of viability (e.g., Bcl-2Bcl-2 homodimers favoring cell survival) or cell
death (e.g.,
20 BaxBax homodimers favoring cell death) following exposure to an appropriate
stress.
This ability of Bcl-2-related proteins to hereto- and homodimerize in vivo, is
perhaps
one of the most important features of the family.
Complicating the picture further are reports of the ability of several Bcl-2
25 family members to physically interact with several signaling protein
complexes
containing p21 ras (Chen and Faller, 1996), Raf 1 kinase (Wang et al., 1996b)
and
p23 R-ras proteins (Wang et al., 1995). Another feature, is the conservation
of a
hydrophobic membrane targeting sequence in the carboxy-terminal tail of most
members of the Bcl-2 family. The targeting domain most likely ensures that the
30 various members are correctly routed to the appropriate intracellular
organelle:
Perhaps, this routing domain ensures that the various Bcl-2-related proteins
are
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99/05359
41
localized in close proximity to secure proper physical interactions should the
appropriate stress be detected.
The mechanisms of programmed cell death are far from being completely
elucidated. At present, many different factors such as protease activation
(Yuan, et
al., 1993; Fraser and Evan, et al., 1996; Chinnaiyan et al., 1997), DNA
cleavage, and
calcium signaling (Lam et al., 1994; Marin et al., 1996; Minn et al., 1997)
are known
to participate in apoptosis. The placement of Bcl-2 and Bcl-2 family members
in cell
death regulatory pathways is now being elucidated. It is now known that Bcl-x~
can
form ion channels and it may be that other Bcl-2 family members function in a
similar
manner. The specific interactions that Bcl-2 family proteins have with various
signaling molecules and within the BcI-2 family itself are active areas of
investigation.
D. Engineering Expression Constructs
In certain embodiments, the present invention involves the manipulation of
genetic material to produce expression constructs that encode therapeutic
genes. Such
methods involve the generation of expression constructs containing, for
example, a
heterologous DNA encoding a gene of interest and a means for its expression,
replicating the vector in an appropriate helper cell, obtaining viral
particles produced
therefrom, and infecting cells with the recombinant virus particles.
The gene will be a therapeutic gene such as one or more of the proapoptotic
genes discussed herein above, or the gene may be a second therapeutic gene or
nucleic
acid useful in the treatment of, for example cancer cells. 1n the context of
gene
therapy, the gene will be a heterologous DNA, meant to include DNA derived
from a
source other than the viral genome which provides the backbone of the vector.
Finally, the virus may act as a live viral vaccine and express an antigen of
interest for
the production of antibodies thereagainst. The gene may be derived from a
prokaryotic or eukaryotic source such as a bacterium, a virus, a yeast, a
parasite, a
plant, or even an animal. The heterologous DNA also may be derived from more
than
one source, i.e., a multigene construct or a fusion protein. The heterologous
DNA
SU6STITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
42
also may include a regulatory sequence which may be derived from one source
and the
gene from a different source.
i. Additional Therapeutic Genes
The present invention contemplates the use of a variety of different genes in
combination with adenoviral Bax and the proapoptotic Bcl-2 gene constructs.
For
example, genes encoding enzymes, hormones, cytokines, oncogenes, receptors,
tumor
suppressors, transcription factors, drug selectable markers, toxins and
various antigens
are contemplated as suitable genes for use according to the present invention.
In
addition, antisense constructs derived from oncogenes are other "genes" of
interest
according to the present invention.
a. p53
As stated earlier, p53 currently is recognized as a tumor suppressor gene.
High levels of mutant p53 have been found in many cells transformed by
chemical
carcinogenesis, ultraviolet radiation, and several viruses. The p53 gene is a
frequent
target of mutational inactivation in a wide variety of human tumors and is
already
documented to be the most frequently-mutated gene in common human cancers. It
is
mutated in over 50% of human NSCLC (Hollstein et al., 1991) and in a wide
spectrum of other tumors.
The p53 gene encodes a 393-amino acid phosphoprotein that can form
complexes with host proteins such as large-T antigen and E1B. The protein is
found
in normal tissues and cells, hut at concentrations which are minute by
comparison
with transformed cells or tumor tissue. Interestingly, wild-type p53 appears
to be
important in regulating cell growth and division. Overexpression of wild-type
p53 has
been shown in some cases to be anti-proliferative in human tumor cell lines.
Thus,
p53 can act as a negative regulator of cell growth (Weinberg, 1991 ) and may
directly
suppress uncontrolled cell growth or indirectly activate genes that suppress
this
growth. Thus, absence or inactivation of wild-type p53 may contribute to
transformation. However, some studies indicate that the presence of mutant p53
may
be necessary for full expression of the transforming potential.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99146371 PCTNS99/05359
43
Wild-type p53 is recognized as an important growth regulator in many cell
types. Missense mutations are common for the p53 gene and are essential for
the
transforming ability of the oncogene. A single genetic change prompted by
point
mutations can create carcinogenic p53. Unlike other oncogenes, however, p53
point
mutations are known to occur in at least 30 distinct codons, often creating
dominant
alleles that produce shifts in cell phenotype without a reduction to
homozygosity.
Additionally, many of these dominant negative alleles appear to be tolerated
in the
organism and passed on in the germ line. Various mutant alleles appear to
range from
minimally dysfunctional to strongly penetrant, dominant negative alleles
(Weinberg,
1991).
Casey and colleagues have reported that transfection of DNA encoding wild-
type p53 into two human breast cancer cell lines restores growth suppression
control
in such cells (Casey et al., 1991). A similar effect has also been
demonstrated on
transfection of wild-type, but not mutant, p53 into human lung cancer cell
lines
(Takahasi et al., 1992). p53 appears dominant over the mutant gene and will
select
against proliferation when transfected into cells with the mutant gene. Normal
expression of the transfected p53 does not affect the growth of cells with
endogenous
p53. Thus, such constructs might be taken up by normal cells without adverse
effects.
It is thus proposed that the treatment of p53-associated cancers with wild-
type p53 or
other therapies described herein will reduce the number of malignant cells or
their
growth rate, alternatively the treatment will result in the decrease of the
metastatic
potential of the cancer cell, a decrease in tumor size or a halt in the growth
the tumor.
b. pl6
The major transitions of the eukaryotic cell cycle are triggered by cyclin-
dependent kinases, or CDK's. One CDK, cyclin-dependent kinase 4 (CDK4),
regulates progression through the G,. The activity of this enzyme may be to
phosphorylate Rb at late G~. The activity of CDK4 is controlled by an
activating
subunit, D-type cyclin, and by an inhibitory subunit, .the p 16~K4 has been
biochemically characterized as a protein that specifically binds to and
inhibits CDK4,
SUBSTITUTE SHEET (RULE 26y
CA 02322663 2000-09-07
WO 99/46371 PCTNS99l05359
44
and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano et
al., 1995).
Since the pl6~NKa protein is a CDK4 inhibitor (Serrano, 1993), deletion of
this gene
may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb
protein. p 16 also is known to regulate the function of CDK6.
p 16~K4 belongs to a newly described class of CDK-inhibitory proteins that
also includes pl6B, p2lW'''F~, and p27K~P~. The pl6~Nka gene maps to 9p21, a
chromosome region frequently deleted in many tumor types. Homozygous deletions
and mutations of the p 16~K4 gene are frequent in human tumor cell lines. This
evidence suggests that the p16~K4 gene is a tumor suppressor gene. This
interpretation has been challenged, however, by the observation that the
frequency of
the p16~K4 gene alterations is much lower in primary uncultured tumors than in
cultured cell lines (Caldas et al., 1994; Cheng et al., 1994; Hussussian et
al., 1994;
Kamb et al., 1994; Kamb et al., 1994; Mori et al., 1994; Okamoto et al., 1994;
Nobori
et al., 1995; Orlow et al., 1994; Arap et al., 1995). Restoration of wild-type
pl6~Ka
function by transfection with a piasmid expression vector reduced colony
formation
by some human cancer cell lines (Okamoto, 1994; Arap, I995).
c. GCAM
C-CAM is expressed in virtually all epithelial cells (Odin and Obrink, 1987).
C-CAM, with an apparent molecular weight of 105 kD, was originally isolated
from
the plasma membrane of the rat hepatocyte by its reaction with specific
antibodies that
neutralize cell aggregation (Obrink, 1991 ). Recent studies indicate that,
structurally,
C-CAM belongs to the immunoglobulin (Ig) superfamily and its sequence is
highly
homologous to carcinoembryonic antigen (CEA) (Lin and Guidotti, 1989). Using a
bacuiovirus expression system, Cheung et al. (1993) demonstrated that the
first Ig
domain of C-CAM is critical for cell adhesive activity.
Cell adhesion molecules, or CAM's are known to be involved in a complex
network of molecular interactions that regulate organ development and cell
differentiation (Edelman, 1985). Recent data indicate that aberrant expression
of
CAM's maybe involved in the tumorigenesis of several neoplasms; for example,
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PGT/US99/05359
decreased expression of E-cadherin, which is predominantly expressed in
epithelial
cells, is associated with the progression of several kinds of neoplasms
(Edelman and
Crossin, 1991; Frixen et al., 1991; Bussemakers et al., 1992; Matsura et al.,
1992;
Umbas et al., 1992). Also, Giancotti and Ruoslahti ( 1990) demonstrated that
5 increasing expression of a5~3~ integrin by gene transfer can reduce
tumorigenicity of
Chinese hamster ovary cells in vivo. C-CAM now has been shown to suppress
tumors
growth in vitro and in vivo.
d Other Tumor Suppressors
10 Other tumor suppressors that may be employed according to the present
invention include RB, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73,
VHL, MMAC1, FCC and MCC. Additional inducers of apoptosis in addition to those
of the Bcl-2 family, such as, Ad E1B and ICE-CED3 proteases, similarly could
find
use according to the present invention.
e. Enzymes
Various enzyme genes are of interest according to the present invention. Such
enzymes include cytosine deaminase, hypoxanthine-guanine
phosphoribosyltransferase, galactose-1-phosphate uridyltransferase,
phenylalanine
hydroxylase, glucocerbrosidase, sphingomyelinase, a-L-iduronidase, glucose-6-
phosphate dehydrogenase, HSV thymidine kinase and human thymidine kinase.
f. Cytokines
Other classes of genes that are contemplated to be inserted into the
therapeutic
expression constructs of the present invention include interleukins and
cytokines.
Interleukin 1 (IL,-1 ), IL-2, IL-3, IL-4, IL,-5, IL-6, IL-7, IL-8, IL-9, IL-
10, IL-11 IL-12,
GM-CSF and G-CSF.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
46
g. Antibodies
In yet another embodiment, the heterologous gene may include a single-chain
antibody. Methods for the production of single-chain antibodies are well known
to
those of skill in the art. The skilled artisan is referred to U.S. Patent No.
5,359,046,
(incorporated herein by reference) for such methods. A single chain antibody
is
created by fusing together the variable domains of the heavy and light chains
using a
short peptide linker, thereby reconstituting an antigen binding site on a
single
molecule.
Single-chain antibody variable fragments (Fvs) in which the C-terminus of one
variable domain is tethered to the N-terminus of the other via a 15 to 25
amino acid
peptide or linker, have been developed without significantly disrupting
antigen
binding or specificity of the binding (Bedzyk et al., 1990; Chaudhary et al.,
1990).
These Fvs lack the constant regions (Fc) present in the heavy and light chains
of the
native antibody.
Antibodies to a wide variety of molecules can be used in combination with the
present invention, including antibodies against oncogenes, toxins, hormones,
enzymes, viral or bacterial antigens, transcription factors, receptors and the
like.
ii. Antisense Constructs
Oncogenes such as ras, myc, neu, raf, erb, src, fms, jun, trk, ret, gsp, hst,
and
abl as well as the antiapoptotic member of the Bcl-2 family also are suitable
targets.
However, for therapeutic benefit, these oncogenes would be expressed as an
antisense
nucleic acid, so as to inhibit the expression of the oncogene. The term
"antisense
nucleic acid" is intended to refer to the oligonucleotides complementary to
the base
sequences of oncogene-encoding DNA and RNA. Antisense oligonucleotides, when
introduced into a target cell, specifically bind to their target nucleic acid
and interfere
with transcription, RNA processing, transport and/or translation. Targeting
double-
stranded (ds) DNA with oligonucleotide leads to triple-helix formation;
targeting
RNA will lead to double-helix formation.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
47
Antisense constructs may be designed to bind to the promoter and other
control regions, exons, introns or even exon-intron boundaries of a gene.
Antisense
RNA constructs, or DNA encoding such antisense RNAs, may be employed to
inhibit
gene transcription or translation or both within a host cell, either in vitro
or in vivo,
S such as within a host animal, including a human subject. Nucleic acid
sequences
comprising "complementary nucleotides" are those which are capable of base-
pairing
according to the standard Watson-Crick complementary rules. That is, that the
larger
purines will base pair with the smaller pyrimidines to form only combinations
of
guanine paired with cytosine (G:C) and adenine paired with either thymine
{A:T), in
the case of DNA, or adenine paired with uracil (A:U) in the case of RNA.
As used herein, the terms "complementary" or "antisense sequences" mean
nucleic acid sequences that are substantially complementary over their entire
length
and have very few base mismatches. For example, nucleic acid sequences of
fifteen
1 S bases in length may be termed complementary when they have a complementary
nucleotide at thirteen or fourteen positions with only single or double
mismatches.
Naturally, nucleic acid sequences which are "completely complementary" will be
nucleic acid sequences which are entirely complementary throughout their
entire
length and have no base mismatches.
While all or part of the gene sequence may be employed in the context of
antisense construction, statistically, any sequence 17 bases long should occur
only
once in the human genome and, therefore, suffice to specify a unique target
sequence.
Although shorter oligomers are easier to make and increase in vivo
accessibility,
numerous other factors are involved in determining the specificity of
hybridization.
Both binding affinity and sequence specificity of an oligonucleotide to its
complementary target increases with increasing length. It is contemplated that
oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more
base pairs
will be used. One can readily determine whether a given antisense nucleic acid
is
effective at targeting of the corresponding host cell gene simply by testing
the
constructs in vitro to determine whether the endogenous gene's function is
affected or
whether the expression of related genes having complementary sequences is
affected.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99I05359
48
In certain embodiments, one may wish to employ antisense constructs which
include other elements, for example, those which include C-5 propyne
pyrimidines.
Oligonucleotides which contain C-5 propyne analogues of uridine and cytidine
have
been shown to bind RNA with high affinity and to be potent antisense
inhibitors of
gene expression (Wagner et al., 1993).
iii. lZibozyme Constructs
As an alternative to targeted antisense delivery, targeted ribozymes may be
used. The term "ribozyme" refers to an RNA-based enzyme capable of targeting
and
cleaving particular base sequences in oncogene DNA and RNA. Ribozymes either
can be targeted directly to cells, in the form of RNA oligo-nucleotides
incorporating
ribozyme sequences, or introduced into the cell as an expression construct
encoding
the desired ribozymal RNA. Ribozymes may be used and applied in much the same
1 S way as described for antisense nucleic acids.
iv. Selectable Markers
In certain embodiments of the invention, the therapeutic expression constructs
of the present invention contain nucleic acid constructs whose expression may
be
identified in vitro or in vivo by including a marker in the expression
construct. Such
markers would confer an identifiable change to the cell permitting easy
identification
of cells containing the expression construct. Usually the inclusion of a drug
selection
marker aids in cloning and in the selection of transformants. For example,
genes that
confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and
histidinol are useful selectable markers. Alternatively, enzymes such as
herpes
simplex virus thymidine kinase (tk) may be employed. Immunologic markers also
can
be employed. The selectable marker employed is not believed to be important,
so
long as it is capable of being expressed simultaneously with the nucleic acid
encoding
a gene product. Further examples of selectable markers are well known to one
of skill
in the art and include reporters such as EGFP, ~-gal or chloramphenicol
acetyltransferase (CAT).
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
49
v. Multigene Constructs and IRES
In certain embodiments of the invention, the use of internal ribosome binding
sites (IItES) elements are used to create multigene polycistronic messages.
IRES
elements are able to bypass the ribosome scanning model of S'-methylated; Cap-
s dependent translation and begin translation at internal sites (Pelletier and
Sonenberg,
1988). IRES elements from two members of the picanovirus family (polio and
encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as
well
an IRES from a mammalian message (Macejak and Sarnow, 1991). IR.ES elements
can be linked to heterologous open reading frames. Multiple open reading
frames can
be transcribed together, each separated by an IRES, creating polycistronic
messages.
By virtue of the IRES element, each open reading frame is accessible to
r7bosomes for
efficient translation. Multiple genes can be efficiently expressed using a
single
promoter/enhancer to transcribe a single message.
Any heterologous open reading frame can be linked to IRES elements. This
includes genes for secreted proteins, mufti-subunit proteins, encoded by
independent
genes, intracellular or membrane-bound proteins and selectable markers. In
this way,
expression of several proteins can be simultaneously engineered into a cell
with a
single construct and a single selectable marker.
vi. Control Regions
A. Promoters
Throughout this application, the term "expression construct" is meant to
include any type of genetic construct containing a nucleic acid coding for
gene
products in which part or all of the nucleic acid encoding sequence is capable
of being
transcribed. The transcript may be translated into a protein, but it need not
be. In
certain embodiments, expression includes both transcription of a gene and
translation
of mRNA into a gene product. In other embodiments, expression only includes
transcription of the nucleic acid encoding genes of interest.
The nucleic acid encoding a gene product is under transcr~iptional control of
a
promoter. A "promoter" refers to a DNA sequence recognized by the machinery of
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
the cell, or introduced machinery, required to initiate the specific
transcription of a
gene. The phrase "under transcriptional control" means that the promoter is in
the
correct location and orientation in relation to the nucleic acid to control
RNA
polymerase initiation and expression of the gene.
5
The term promoter will be used here to refer to a group of transcriptional
control modules that are clustered around the initiation site for RNA
polymerase II.
Much of the thinking about how promoters are organized derives from analyses
of
several viral promoters, including those for the HSV thyrnidine kinase (tk)
and SV40
10 early transcription units. These studies, augmented by more recent work,
have shown
that promoters are composed of discrete functional modules, each consisting of
approximately 7-20 by of DNA, and containing one or more recognition sites for
transcriptional activator or repressor proteins.
15 At least one module in each promoter functions to position the start site
for
RNA synthesis. The best known example of this is the TATA box, but in some
promoters lacking a TATA box, such as the promoter for the mammalian terminal
deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a
discrete
element overlying the start site itself helps to fix the place of initiation.
Additional promoter elements regulate the frequency of transcriptional
initiation. Typically, these are located in the region 30-110 by upstream of
the start
site, although a number of promoters have recently been shown to contain
functional
elements downstream of the start site as well. The spacing between promoter
elements frequently is flexible, so that promoter function is preserved when
elements
are inverted or moved relative to one another. In the tk promoter, the spacing
between
promoter elements can be increased to 50 by apart before activity begins to
decline.
Depending on the promoter, it appears that individual elements can function
either co-
operatively or independently to activate transcription.
The particular promoter employed to control the expression of a nucleic acid
sequence of interest is not believed to be important, so long as it is capable
of
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/4b371 PCT/US99/05359
51
directing the expression of the nucleic acid in the targeted cell. Thus, where
a human
cell is targeted, it is preferable to position the nucleic acid coding region
adjacent to
and under the control of a promoter that is capable of being expressed in a
human cell.
Generally speaking, such a promoter might include either a human or viral
promoter.
In various embodiments, the human cytomegalovirus (CMV) immediate early
gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal
repeat,
/3-actin, rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase
can be
used to obtain high-Ievel expression of the coding sequence of interest. The
use of
I O other viral or mammalian cellular or bacterial phage promoters which are
well-known
in the art to achieve expression of a coding sequence of interest is
contemplated as
well, provided that the levels of expression are sufficient for a given
purpose. By
employing a promoter with well-known properties, the level and pattern of
expression
of the protein of interest following transfection or transformation can be
optimized.
Selection of a promoter that is regulated in response to specific physiologic
or
synthetic signals can permit inducible expression of the gene product. For
example in
the case where expression of a transgene, or transgenes when a multicistronic
vector is
utilized, is toxic to the cells in which the vector is produced in, it rnay be
desirable to
prohibit or reduce expression of one or more of the transgenes. Examples of
transgenes that may be toxic to the producer cell line are pro-apoptotic and
cytokine
genes. Several inducible promoter systems are available for production of
viral
vectors where the transgene product may be toxic.
The ecdysone system (Invitrogen, Carlsbad, CA) is one such system. This
system is designed to allow regulated expression of a gene of interest in
mammalian
cells. It consists of a tightly regulated expression mechanism that allows
virtually no
basal level expression of the transgene, but over 200-fold inducibility. The
system is
based on the heterodimeric ecdysone receptor of Drosophila, and when ecdysone
or an
analog such as muristerone A binds to the receptor, the receptor activates a
promoter
to turn on expression of the downstream transgene high levels of mRNA
transcripts
are attained. In this system, both monomers of the heterodimeric receptor are
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PGTNS99/05359
52
constituitively expressed from one vector, whereas the ecdysone-responsive
promoter
which drives expression of the gene of interest is on another plasmid.
Engineering of
this type of system into the gene transfer vector of interest would therefore
be useful.
Cotransfection of plasmids containing the gene of interest and the receptor
monomers
S in the producer cell line would then allow for the production of the gene
transfer
vector without expression of a potentially toxic transgene. At the appropriate
time,
expression of the transgene could be activated with ecdysone or muristeron A.
Another inducible system that would be useful is the Tet-OffTM or Tet-OnTM
system (Clontech, Paio Alto, CA) originally developed by Gossen and Bujard
(Gossen
and Bujard, 1992; Gossen et al., 1995}. This system also allows high levels of
gene
expression to be regulated in response to tetracycline or tetracycline
derivatives such
as doxycycline. In the Tet-OnTM system, gene expression is fumed on in the
presence
of doxycycline, whereas in the Tet-OffrM system, gene expression is turned on
in the
1 S absence of doxycycline. These systems are based on two regulatory elements
derived
from the tetracycline resistance operon of E. toll. The tetracycline operator
sequence
to which the tetracycline repressor binds, and the tetracycline repressor
protein. The
gene of interest is cloned into a plasmid behind a promoter that has
tetracycline-
responsive elements present in it. A second piasmid contains a regulatory
element
called the tetracycline-controlled transactivator, which is composed, in the
Tet-Off~'M
system, of the VP 16 domain from the herpes simplex virus and the wild-type
tertracycline repressor. Thus in the absence of doxycycline, transcription is
constituitively on. Ln the Tet-OnTM system, the tetracycline repressor is not
wild type
and in the presence of doxycycline activates transcription. For gene therapy
vector
production, the Tet-OffrM system would be preferable so that the producer
cells could
be grown in the presence of tetracycline or doxycycline and prevent expression
of a
potentially toxic transgene, but when the vector is introduced to the patient,
the gene
expression would be constituitively on.
In some circumstances, it may be desirable to regulate expression of a
transgene in a gene therapy vector. For example, different viral promoters
with
varying strengths of activity may be utilized depending on the level of
expression
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PC'f/US99/05359
53
desired. In mammalian cells, the CMV immediate early promoter if often used to
provide strong transcriptional activation. Modified versions of the CMV
promoter
that are less potent have also been used when reduced levels of expression of
the
transgene are desired. When expression of a transgene in hematopoetic cells is
desired, retroviral promoters such as the LTRs from MLV or MMTV are often
used.
Other viral promoters that may be used depending on the desired effect include
SV40,
RSV LTR, HIV-1 and HN-2 LTR, adenovirus promoters such as from the EIA, E2A,
or MLP region, AAV LTR, cauliflower mosaic virus, HSV-TK, and avian sarcoma
virus.
Similarly tissue specific promoters may be used to effect transcription in
specific tissues or cells so as to reduce potential toxicity or undesirable
effects to non-
targeted tissues. For example, promoters such as the PSA, probasin, prostatic
acid
phosphatase or prostate-specific glandular kallikrein (hK2) may be used to
target gene
expression in the prostate. Similarly, the following promoters may be used to
target
gene expression in other tissues (Table 2).
SUt3STITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99146371 PC'T/US99/05359
54
Table 2. Tissue specific promoters
Tissue Promoter
Pancreas insulin
elastin
amylase
pdr-1 pdx-1
glucokinase
Liver albumin PEPCK
HBV enhancer
alpha fetoprotein
apolipoprotein C
alpha-1 antitrypsin
vitellogenin, NF-AB
Transthyretin
Skeletal muscle myosin H chain
muscle creatine kinase
dystrophin
calpain p94
skeletal alpha-actin
fast troponin 1
Skin keratin K6
keratin K 1
Lung CFTR
human cytokeratin 18 (K18)
pulmonary surfactant proteins A, B and C
CC-10
P1
Smooth muscle sm22 alpha
SM-alpha-actin
Endothelium endothelin-1
E-selectin
von Willebrand factor
TIE (Korhonen et al., 1995)
KDRIflk-1
Melanocytes tyrosinase
Adipose tissue lipoprotein lipase (Zechner et al., 1988)
adipsin (Spiegelman et al., 1989)
acetyl-CoA carboxylase (Pape and Kim, 1989)
glycerophosphate dehydrogenase (Dani et al.,
1989)
adipocyte P2 (Hunt et al., 1986)
Blood
(3-globin
SUBSTITUTE SHEET (RULE Z6~
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
In certain indications, it may be desirable to activate transcription at
specific
times after administration of the gene therapy vector. This may be done with
such
promoters as those that are hormone or cytokine regulatable. For example in
gene
therapy applications where the indication is a gonadal tissue where specific
steroids
5 are produced or routed to, use of androgen or estrogen regulated promoters
may be
advantageous. Such promoters that are hormone regulatable include MMTV, MT-1,
ecdysone and RuBisco. Other hormone regulated promoters such as those
responsive
to thyroid, pituitary and adrenal hormones are expected to be useful in the
present
invention. Cytokine and inflammatory protein responsive promoters that could
be
10 used include K and T Kininogen (Kageyama et al., 1987), c-fos, TNF-alpha, C-
reactive protein (Arcone et al., 1988), haptoglobin (Oliviero et al., 1987),
serum
amyloid A2, C/EBP alpha, IL-1, IL-6 (Poli and Cortese, 1989), Complement C3
(Wilson et al., 1990), IL-8, alpha-1 acid glycoprotein (Prowse and Baumann,
1988),
alpha-1 antitypsin, lipoprotein lipase (Zechner et al., 1988), angiotensinogen
(Ron et
15 al., 1991 ), fibrinogen, c-jun (inducible by phorbol esters, 'INF-alpha, W
radiation,
retinoic acid, and hydrogen peroxide), collagenase (induced by phorbol esters
and
retinoic acid), metallothionein (heavy metal and glucocorticoid inducible),
Stromelysin (inducible by phorbol ester, interleukin-l and EGF), alpha-2
macroglobulin and alpha-1 antichymotrypsin.
It is envisioned that cell cycle regulatable promoters may be useful in the
present invention. For example, in a bi-cistronic gene therapy vector, use of
a strong
CMV promoter to drive expression of a first gene such as p16 that arrests
cells in the
G1 phase could be followed by expression of a second gene such as p53 under
the
control of a promoter that is active in the G 1 phase of the cell cycle, thus
providing a
"second hit" that would push the cell into apoptosis. Other promoters such as
those of
various cyclins, PCNA, galectin-3, E2F1, p53 and BRCA1 could be used.
Tumor specific promoters such as osteocalcin, hypoxia-responsive element
(HRE), MAGE-4, CEA, alpha-fetoprotein, GRP78IBiP and tyrosinase may also be
used to regulate gene.expression in tumor cells. Other promoters that could be
used
according to the present invention include Lac-regulatable, chemotherapy
inducible
SUBSTITUTE SHEET (RULE 26~
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
56
(e.g. MDR), and heat (hypertherrnia) inducible promoters, Radiation-inducible
(e.g.,
EGR (Joki et al., 1995)), Alpha-inhibin, RNA pol III tRNA met and other amino
acid
promoters, U1 snRNA (Bartlett et al., 1996), MC-1, PGK, -actin and alpha-
globin.
Many other promoters that may be useful are listed in Walther and Stein ( I
996).
It is envisioned that any of the above promoters alone or in combination with
another may be useful according to the present invention depending on the
action
desired. In addition, this list of promoters is should not be construed to be
exhaustive
or limiting, those of skill in the art will know of other promoters that may
be used in
conjunction with the promoters and methods disclosed herein.
B. Enhancers
Enhancers are genetic elements that increase transcription from a promoter
located at a distant position on the same molecule of DNA. Enhancers are
organized
much like promoters. That is, they are composed of many individual elements,
each
of which binds to one or more transcriptional proteins. The basic distinction
between
enhancers and promoters is operational. An enhancer region as a whole must be
able
to stimulate transcription at a distance; this need not be true of a promoter
region or its
component elements. On the other hand, a promoter must have one or more
elements
that direct initiation of RNA synthesis at a particular site and in a
particular
orientation, whereas enhancers lack these specificities. Promoters and
enhancers are
often overlapping and contiguous, often seeming to have a very similar modular
organization.
Below is a list of promoters additional to the tissue specific promoters
listed
above, cellular promoters/enhancers and inducible promoters/enhancers that
could be
used in combination with the nucleic acid encoding a gene of interest in an
expression
construct (Table 3 and Table 4). Additionally, any promoter/enhancer
combination
(as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive
expression of the gene. Eukaryotic cells can support cytoplasmic transcription
from
certain bacterial promoters if the appropriate bacterial polymerise is
provided, either
as part of the delivery complex or as an additional genetic expression
construct.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WU 99146371 PCT/US99105359
57
TABLE 3
ENHANCER
Immunoglobulin Heavy Chain
Immunoglobulin Light Chain
T-Cell Receptor
HLA DQ a and DQ ~
(3-Interferon
Interleukin-2
Interleukin-2 Receptor
MHC Class II 5
MHC Class II HLA-DRa
~i-Actin
Muscle Creative Kinase
Prealbumin (Transthyretin)
Elastase I
Metallothionein
Collagenase
Albumin Gene
a-Fetoprotein
T-Globin
~i-Globin
e-fos
c-HA-ras
Insulin
Neural Cell Adhesion Molecule (NCAM)
a 1-Antitrypsin
H2B (TH2B) Histone
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
5$
TABLE 3 - CONTINUED
Mouse or Type I Collagen
Glucose-Regulated Proteins (GRP94 and GRP78)
Rat Growth Hormone
Human Serum Amyloid A (SAA)
Troponin I (TN I)
Platelet-Derived Growth Factor
Duchenne Muscular Dystrophy
SV40
Polyoma
Retroviruses
Papilioma Virus
Hepatitis B Virus
Human Immunodeficiency Virus
Cytomegalovirus
Gibbon Ape Leukemia Virus
A
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/U599105359
S9
TABLE 4
i
Element Inducer
MT II Phorbol Ester (TPA)
Heavy metals
MMTV (mouse mammary tumorGlucocorticoids
virus)
f3-Interferon poly(rl)X
poly(rc)
Adenovirus S E2 Ela
c-1~ Phorbol Ester (TPA), H202
Collagenase Phorbol Ester (TPA)
Stromelysin Phorbol Ester (TPA), IL-1
SV40 Phorbol Ester (TPA)
Murine MX Gene Interferon, Newcastle Disease
Virus
GRP78 Gene A23187
a-2-Macroglobulin ILr6
Vimentin Serum
MHC Class I Gene H-2kB Interferon
HSP70 EIa, SV40 Large T Antigen
Proliferin Phorbol Ester-TPA
Tumor Necrosis Factor FMA
Thyroid Stimulating HormoneThyroid Hormone
a
Gene
Insulin E Box Glucose
In preferred embodiments of the invention, the expression construct comprises
S a virus or engineered construct derived from a viral genome. The ability of
certain
viruses to enter cells via receptor-mediated endocytosis and to integrate into
host cell
genome and express viral genes stably and efficiently have made them
attractive
candidates for the transfer of foreign genes into mammalian cells (Ridgeway,
1988;
Nicolas and Rubenstein, 1988; Baichwal and Sugden, 198b; Temin, 198b). The
first
viruses used as gene vectors were DNA viruses including the papovaviruses
(simian
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99/05359
virus 40, bovine papilloma virus, and polyoma) (Ridgeway, i 988; Baichwal and
Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986).
These have a relatively low capacity for foreign DNA sequences and have a
restricted
host spectrum. Furthermore, their oncogenic potential and cytopathic effects
in
5 permissive cells raise safety concerns. They can accommodate only up to 8 kB
of
foreign genetic material but can be readily introduced in a variety of cell
lines and
laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
C. Polyadenylation Signals
IO Where a cDNA insert is employed, one will typically desire to include a
polyadenylation signal to effect proper polyadenylation of the gene
transcript. The
nature of the polyadenylation signal is not believed to be crucial to the
successful
practice of the invention, and any such sequence may be employed such as human
or
bovine growth hormone and SV40 polyadenylation signals. Also contemplated as
an
15 element of the expression cassette is a terminator. These elements can
serve to
enhance message levels and to minimize read through from the cassette into
other
sequences.
E. Methods of Gene Transfer
20 In order to mediate the effect transgene expression in a cell, it will be
necessary to transfer the therapeutic expression constructs of the present
invention
into a cell. Such transfer may employ viral or non-viral methods of gene
transfer.
This section provides a discussion of methods and compositions of gene
transfer.
25 i. Viral Vector-Mediated Transfer
The proapoptotic Bcl-2 genes are incorporated into an adenoviral infectious
particle to mediate gene transfer to a cell. Additional expression constructs
encoding
other therapeutic agents as described herein may also be transferred via viral
transduction using infectious viral particles, for example, by transformation
with an
30 adenovirus vector of the present invention as described herein below.
Alternatively,
retroviral or bovine papilloma virus may be employed, both of which permit
permanent transformation of a host cell with a genes) of interest. Thus, in
one
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PC"TIUS99/05359
61
example, viral infection of cells is used in order to deliver therapeutically
significant
genes to a cell. Typically, the virus simply will be exposed to the
appropriate host cell
under physiologic conditions, permitting uptake of the virus. Though
adenovirus is
exemplified, the present methods may be advantageously employed with other
viral
S vectors, as discussed below.
Adenovirus. Adenovirus is particularly suitable for use as a gene transfer
vector because of its mid-sized DNA genome, ease of manipulation, high titer,
wide
target-cell range, and high infectivity. The roughly 36 kB viral genome is
bounded by
100-200 base pair (bp) inverted terminal repeats (ITR), in which are contained
cis-
acting elements necessary for viral DNA replication and packaging. The early
(E) and
late (L) regions of the genome that contain different transcription units are
divided by
the onset of viral DNA replication.
The E 1 region (E 1 A and E 1 B) encodes proteins responsible for the
regulation
of transcription of the viral genome and a few cellular genes. The expression
of the
E2 region (E2A and E2B) results in the synthesis of the proteins for viral DNA
replication. These proteins are involved in DNA replication, late gene
expression, and
host cell shut off (Renan, 1990). The products of the late genes (L1, L2, L3,
L4 and
LS), including the majority of the viral capsid proteins, are expressed only
after
signif cant processing of a single primary transcript issued by the major late
promoter
(MLP). The MLP (located at 16.8 map units) is_particularly efficient during
the late
phase of infection, and all the mRNAs issued from this promoter possess a 5'
tripartite
leader (TL) sequence which makes them preferred mRNAs for translation.
In order for adenovirus to be optimized for gene therapy, it is necessary to
maximize the carrying capacity so that large segments of DNA can be included.
It
also is very desirable to reduce the toxicity and immunologic reaction
associated with
certain adenoviral products. The two goals are, to an extent, coterminous in
that
elimination of adenoviral genes serves both ends. By practice of the present
invention, it is possible achieve both these goals while retaining the ability
to
manipulate the therapeutic constructs with relative ease.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
62
The large displacement of DNA is possible because the cis elements required
for viral DNA replication all are localized in the inverted terminal repeats
(ITR) (100-
200 bp) at either end of the linear viral genome. Plasmids containing ITR's
can
replicate in the presence of a non-defective adenovirus (Hay et al., 1984).
Therefore,
inclusion of these elements in an adenoviral vector should permit replication.
In addition, the packaging signal for viral encapsidation is localized between
194-385 by (0.5-1.1 map units) at the left end of the viral genome (Hearing et
al.,
1987). This signal mimics the protein recognition site in bacteriophage ~, DNA
where
a specific sequence close to the left end, but outside the cohesive end
sequence,
mediates the binding to proteins that are required for insertion of the DNA
into the
head structure. E1 substitution vectors of Ad have demonstrated that a 450 by
(0-1.25
map units) fragment at the left end of the viral genome could direct packaging
in 293
cells (Levrero et al., 1991).
Previously, it has been shown that certain regions of the adenoviral genome
can be incorporated into the genome of mammalian cells and the genes encoded
thereby expressed. These cell lines are capable of supporting the replication
of an
adenoviral vector that is deficient in the adenoviral function encoded by the
cell line.
There also have been reports of complementation of replication deficient
adenoviral
vectors by "helping" vectors, e.g., wild-type virus or conditionally defective
mutants.
Replication-deficient adenoviral vectors can be complemented, in trans, by
helper virus. This observation alone does not permit isolation of the
replication-
deficient vectors, however, since the presence of helper virus, needed to
provide
replicative functions, would contaminate any preparation. Thus, an additional
element
was needed that would add specificity to the replication and/or packaging of
the
replication-deficient vector. That element, as provided for in the present
invention,
derives from the packaging function of adenovirus.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCf/US99/05359
~3
It has been shown that a packaging signal for adenovirus exists in the left
end
of the conventional adenovirus map (Tibbetts, 1977). Later studies showed that
a
mutant with a deletion in the ElA (194-358 bp) region of the genome grew
poorly
even in a cell line that complemented the early (E 1 A) function (Hearing and
Shenk,
1983). When a compensating adenoviral DNA (0-353 bp) was recombined into the
right end of the mutant, the virus was packaged normally. Further mutational
analysis
identified a short, repeated, position-dependent element in the left end of
the Ad5
genome. One copy of the repeat was found to be sufficient for efficient
packaging if
present at either end of the genome, but not when moved towards the interior
of the
Ad5 DNA molecule (Hearing et al., 1987).
By using mutated versions of the packaging signal, it is possible to create
helper viruses that are packaged with varying efficiencies. Typically, the
mutations
are point mutations or deletions. When helper viruses with low efficiency
packaging
are grown in helper cells, the virus is packaged, albeit at reduced rates
compared to
wild-type virus, thereby permitting propagation of the helper. When these
helper
viruses are grown in cells along with virus that contains wild-type packaging
signals,
however, the wild-type packaging signals are recognized preferentially over
the
mutated versions. Given a limiting amount of packaging factor, the virus
containing
the wild-type signals are packaged selectively when compared to the helpers.
If the
preference is great enough, stocks approaching homogeneity should be achieved.
Retrovirus. The retroviruses are a group of single-stranded RNA viruses
characterized by an ability to convert their RNA to double-stranded DNA in
infected
cells by a process of reverse-transcription (Coffin, 1990). The resulting DNA
then
stably integrates into cellular chromosomes as a provirus and directs
synthesis of viral
proteins. The integration results in the retention of the viral gene sequences
in the
recipient cell and its descendants. The retroviral genome contains three genes
- gag,
pol and env - that code for capsid proteins, polymerase enzyme, and envelope
components, respectively. A sequence found upstream from the gag gene, termed
'Y,
functions as a signal for packaging of the genome into virions. Two long
terminal
repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome.
These
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
b4
contain strong promoter and enhancer sequences and also are required for
integration
in the host cell genome (Coffin, 1990).
In order to construct a retroviral vector, a nucleic acid encoding a promoter
is
inserted into the viral genome in the place of certain viral sequences to
produce a virus
that is replication-defective. In order to produce virions, a packaging cell
line
containing the gag, pol and env genes but without the LTR and '>l components
is
constructed (Mann et al., 1983). When a recombinant plasmid containing a human
cDNA, together with the retroviral LTR and 'Y sequences is introduced into
this cell
line (by calcium phosphate precipitation for example), the 'I' sequence allows
the
RNA transcript of the recombinant plasmid to be packaged into viral particles,
which
are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin,
1986;
Mann et al., 1983). The media containing the recombinant retroviruses is
collected,
optionally concentrated, and used for gene transfer. Retroviral vectors are
able to
infect a broad variety of cell types. However, integration and stable
expression of
many types of retroviruses require the division of host cells (Paskind et al.,
1975).
An approach designed to allow specific targeting of retrovirus vectors
recently
was developed based on the chemical modification of a retrovirus by the
chemical
addition of galactose residues to the viral envelope. This modification could
permit
the specific infection of cells such as hepatocytes via asialoglycoprotein
receptors,
should this be desired.
A different approach to targeting of recombinant retroviruses was designed in
which biotinylated antibodies against a retroviral envelope protein and
against a
specific cell receptor were used. The antibodies were coupled via the biotin
components by using streptavidin (Roux et al., 1989). Using antibodies against
major
histocompatibility complex class I and class II antigens, the infection of a
variety of
human cells that bore those surface antigens was demonstrated with an
ecotropic virus
in vitro (Roux et al., 1989).
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99105359
Adeno-associated Virus. AAV utilizes a linear, single-stranded DNA of about
4700 base pairs. Inverted terminal repeats flank the genome. Two genes are
present
within the genome, giving rise to a number of distinct gene products. The
first, the
cap gene, produces three different virion proteins (VP), designated VP-1, VP-2
and
5 VP-3. The second, the rep gene, encodes four non-structural proteins (NS).
One or
more of these rep gene products is responsible for transactivating AAV
transcription.
The three promoters in AAV are designated by their location, in map units, in
the genome. These are, from left to right, p5, p 19 and p40. Transcription
gives rise to
10 six transcripts, two initiated at each of three promoters, with one of each
pair being
spliced. The splice site, derived from map units 42-46, is the same for each
transcript.
The four non-structural proteins apparently are derived from the longer of the
transcripts, and three virion proteins all arise from the smallest transcript.
15 AAV is not associated with any pathologic state in humans. Interestingly,
for
efficient replication, AAV requires "helping" functions from viruses such as
herpes
simplex virus I and II, cytomegalovirus, pseudorabies virus and, of course,
adenovirus. The best characterized of the helpers is adenovirus, and many
"early"
functions for this virus have been shown to assist with AAV replication. Low
level
20 expression of AAV rep proteins is believed to hold AAV structural
expression in
check, and helper virus infection is thought to remove this block.
The terminal repeats of the AAV vector can be obtained by restriction
endonuclease digestion of AAV or a plasmid such as p201, which contains a
modified
25 AAV genome (Samulski et al. 1987), or by other methods known to the skilled
artisan, including but not limited to chemical or enzymatic synthesis of the
terminal
repeats based upon the published sequence of AAV. The ordinarily skilled
artisan can
determine, by well-known methods such as deletion analysis, the minimum
sequence
or part of the AAV ITRs which is required to allow function, i.e., stable and
site-
30 specific integration. The ordinarily skilled artisan also can determine
which minor
modifications of the sequence can be tolerated while maintaining the ability
of the
terminal repeats to direct stable, site-specific integration.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCT/US99105359
66
AAV-based vectors have proven to be safe and effective vehicles for gene
delivery in vitro, and these vectors are being developed and tested in pre-
clinical and
clinical stages for a wide range of applications in potential gene therapy,
both ex vivo
and in vivo (Carter and Flotte, 1996 ; Chatterjee et al., 1995; Ferrari et
al., 1996;
Fisher et al., 1996; Flotte et al., 1993; Goodman et al., 1994; Kaplitt et
al., 1994;
1996, Kessler et al., 1996; Koeberl et al., 1997; Mizukami et al., 1996; Xiao
et al.,
1996).
AAV-mediated efficient gene transfer and expression in the lung has led to
clinical trials for the treatment of cystic fibrosis (Carter and Flotte, 1996;
Flotte et al.,
1993). Similarly, the prospects for treatment of muscular dystrophy by AAV-
mediated gene delivery of the dystrophin gene to skeletal muscle, of
Parkinson's
disease by tyrosine hydroxylase gene delivery to the brain, of hemophilia B by
Factor
IX gene delivery to the liver, and potentially of myocardial infarction by
vascular
endothelial growth factor gene to the heart, appear promising since AAV-
mediated
transgene expression in these organs has recently been shown to be highly
efficient
(Fisher et al., 1996; Flotte et al., 1993; Kaplitt et al., 1994; 1996; Koeberl
et al., 1997;
McCown et al., 1996; Ping et al., 1996; Xiao et al., 1996).
Other Viral Vectors. Other viral vectors may be employed as expression
constructs in the present invention. Vectors derived from viruses such as
vaccinia
virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988) canary
pox
virus, and herpes viruses may be employed. These viruses offer several
features for
use in gene transfer into various mammalian cells.
ii. Non-viral Transfer
DNA constructs of the present invention are generally delivered to a cell, in
certain situations, the nucleic acid to be transferred is non-infectious, and
can be
transferred using non-viral methods.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99146371 PCTNS99105359
67
Several non-viral methods for the transfer of expression constructs into
cultured mammalian cells are contemplated by the present invention. These
include
calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and
Okayama,
1987; Rippe et al., 1990) DEAF-dextran {Gopal, 1985), electroporation (Tur-
Kaspa et
al., 1986; Potter et al., 1984), direct microinjection (Harland and Weintraub,
1985),
DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al., 1979), cell
sonication
(Fechheimer et al., 1987), gene bombardment using high velocity
microprojectiles
(Yang et al., 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu
and
Wu, 1988).
Once the construct has been delivered into the cell the nucleic acid encoding
the therapeutic gene may be positioned and expressed at different sites. In
certain
embodiments, the nucleic acid encoding the therapeutic gene may be stably
integrated
into the genome of the cell. This integration may be in the cognate location
and
orientation via homologous recombination (gene replacement) or it may be
integrated
in a random, non-specific location (gene augmentation). In yet further
embodiments.
the nucleic acid may be stably maintained in the cell as a separate, episomal
segment
of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient
to
permit maintenance and replication independent of or in synchronization with
the host
cell cycle. How the expression construct is delivered to a cell and where in
the cell
the nucleic acid remains is dependent on the type of expression construct
employed.
In a particular embodiment of the invention, the expression construct may be
entrapped in a iiposome. Liposomes are vesicular structures characterized by a
phospholipid bilayer membrane and an inner aqueous medium. Multilamellar
liposomes have multiple lipid layers separated by aqueous medium. They form
spontaneously when phospholipids are suspended in an excess of aqueous
solution.
The lipid components undergo self rearrangement before the formation of closed
structures and entrap water and dissolved solutes between the lipid bilayers
(Ghosh
and Bachhawat, 1991). The addition of DNA to cationic liposomes causes a
topological transition from liposomes to optically birefringent liquid-
crystalline
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
68
condensed globules (Radler et al., 1997). These DNA-lipid complexes are
potential
non-viral vectors for use in gene therapy.
Liposome-mediated nucleic acid delivery and expression of foreign DNA in
vitro has been very successful. Using the ~i-lactamase gene, Wong et al.
(1980)
demonstrated the feasibility of liposome-mediated delivery and expression of
foreign
DNA in cultured chick embryo, HeLa, and hepatoma cells. Nicolau et al. (1987)
accomplished successful liposome-mediated gene transfer in rats after
intravenous
injection. Also included are various commercial approaches involving
"lipofection"
technology.
In certain embodiments of the invention, the liposome may be complexed with
a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with
the cell
membrane and promote cell entry of liposorne-encapsulated DNA (Kaneda et al.,
1989). In other embodiments, the liposome may be complexed or employed in
conjunction with nuclear nonhistone chromosomal proteins (HMG-1) (Kato et al.,
1991 ). In yet further embodiments, the liposome may be complexed or employed
in
conjunction with both HVJ and HMG-1. In that such expression constructs have
been
successfully employed in transfer and expression of nucleic acid in vitro and
in vivo,
then they are applicable for the present invention.
Other vector delivery systems which can be employed to deliver a nucleic acid
encoding a therapeutic gene into cells are receptor-mediated delivery
vehicles. These
take advantage of the selective uptake of macromolecules by receptor-mediated
endocytosis in almost all eukaryotic cells. Because of the cell type-specific
distribution of various receptors, the delivery can be highly specific (Wu and
Wu,
1993).
Receptor-mediated gene targeting vehicles generally consist of two
components: a cell receptor-specific ligand and a DNA-binding agent. Several
ligands have been used for receptor-mediated gene transfer. The most
extensively
characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu, 1987) and
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
69
transferring (Wagner et al., 1990). Recently, a synthetic neoglycoprotein,
which
recognizes the same receptor as ASOR, has been used as a gene delivery vehicle
(Ferkol et al., 1993; Perales et al., 1994) and epidermal growth factor (EGF)
has also
been used to deliver genes to squamous carcinoma cells (Myers, EPO 0273085).
In other embodiments, the delivery vehicle may comprise a ligand and a
liposome. For example, Nicolau et al. (1987) employed lactosyl-ceramide, a
galactose-terminal asialganglioside, incorporated into liposomes and observed
an
increase in the uptake of the insulin gene by hepatocytes. Thus, it is
feasible that a
nucleic acid encoding a therapeutic gene also may be specifically delivered
into a cell
type such as prostate, epithelial or tumor cells, by any number of receptor-
ligand
systems with or without liposomes. For example, the human prostate-specific
antigen
(Watt et al., 1986) may be used as the receptor for mediated delivery of a
nucleic acid
in prostate tissue.
In another embodiment of the invention, the expression construct may simply
consist of naked recombinant DNA or plasmids. Transfer of the construct may be
performed by any of the methods mentioned above which physically or chemically
permeabilize the cell membrane. This is applicable particularly for transfer
in vitro,
however, it may be applied for in vivo use as well. Dubensky et al. (1984)
successfully injected polyomavirus DNA in the form of CaP04 precipitates into
liver
and spleen of adult and newborn mice demonstrating active viral replication
and acute
infection. Benvenisty and Neshif ( 1986) also demonstrated that direct
intraperitoneal
injection of CaP04 precipitated plasmids results in expression of the
transfected
genes. It is envisioned that DNA encoding a CAM may also be transferred in a
similar manner in vivo and express CAM.
Another embodiment of the invention for transferring a naked DNA
expression construct into cells may involve particle bombardment. This method
depends on the ability to accelerate DNA coated microprojectiles to a high
velocity
allowing them to pierce cell membranes and enter cells without killing them
(Klein et
al., 1987). Several devices for accelerating small particles have been
developed. One
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCTNS99105359
such device relies on a high voltage discharge to generate an electrical
current, which
in turn provides the motive force {Yang et al., 1990). The microprojectiles
used have
consisted of biologically inert substances such as tungsten or gold beads
5 F. Gene Delivery System for Toxic Gene Products
It is now known that programmed cell death, or apoptosis, plays an important
role in development, homeostasis, and disease processes. It is contemplated in
the
present invention, that genes involved in apoptotic pathways may be useful in
the
treatment of diseases related to disorders in these pathways. In another
embodiment,
10 the use of non-pro-apoptic, cytotoxic genes are contemplated for use in
treating
hyperproliferative and other disease states in which cell death would be
therapeutic.
The use of proapoptotic genes to treat cancers was proposed several years ago
(Fisher, 1994; Thompson, 1995). However, the expression of pro-apoptic genes
often
15 results in death of the host cell if their expression is not regulated. In
another
embodiment of the present invention, it is contemplated that a novel co-
transfer vector
system is used to permit delivery of vectors that express potentially toxic
genes. For
example, the expression of Bcl-2 family member via gene transfer may be
valuable in
the treatment of a variety of hyperproliferative diseases, such as cancer.
However,
20 constructing an adenoviral vector expressing a pro-apoptic gene driven by a
constitutive promoter becomes problematic in the packaging cell, presumably
because
of its high apoptotic activity (i, e., cell toxicity).
In one embodiment, the inventors demonstrate a system for safely inducing the
25 expression of the bax gene in a host cell by adenovirus-mediated gene co-
transfer.
The system provides a first adenoviral vector containing a human gene wherein
the
expression product is cytotoxic. The cytotoxic gene is driven by a promoter,
not
active in the host or target cell. A second adenoviral vector is provided,
wherein the
gene, under the control of a promoter, encodes a transactivating protein.
Induction of
30 the promoter driving the expression of the transactivating protein,
initiates the
expression of the cytotoxic gene product.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
71
Experimental data demonstrate that the vector expresses a minimal
background level of bax protein in cultured mammalian cells thus preventing
apoptosis of packaging cells. The expression of the bax gene was substantially
induced both in vitro and in vivo by transferring it into target cells along
with of an
S adenoviral vector expressing the transactivator, fusion protein GAL4/VP16.
Thus,
adenovirus-mediated gene co-transfer permits the regulated expression of bax
via the
inducible expression of the GAL4/VP 16 gene. In other embodiments of the
invention,
the pro-apoptic genes Bak, Bim, Bik, Bid, Bad and Harakiri are contemplated
for use
in adenovirus-mediated gene co-transfer
Adenovirus-mediated gene co-transfer is not limited to proapoptotic genes or a
specific promoter. It also is contemplated that co-transfer system could be
used to
treat various hyperproliferative diseases, wherein regulating the expression
of a toxic
gene product is desired. Depending on the tissue being treated, a tissue
specific
1 S promoter could be chosen to permit in vivo transactivation only in the
target tissue.
For example, co-transfer of a tumor suppressor gene linked to a promoter and a
vector
expressing a transactivator that specifically binds to the promoter, would be
useful in
treating hyperproliferative diseases. Thus, in one embodiment of the
invention, a
promoter linked to a particular gene can be selected to provide tissue
specific
expression. Regulated co-transfer expression of other toxic gene products also
are
contemplated and discussed below.
i. Vector Co-transfer and Promoters
The use of proapoptotic genes to treat cancers via gene therapy has not been
2S reported, possibly due to the difficulty in constructing vectors that can
efficiently
transduce target cells with such genes. For example, Larregina et al. showed
that
constructing an adenovirus expressing the Fas-Ligand (Fas-L) was difficult
because
Fas-L induces apoptosis in 293 packaging cells, (Larregina et al., 1998). Arai
et al.
achieved efficient antiturnor activity by adenovirus-mediated Fas-L gene
transfer, but
this required the use of 293 cells resistant to Fas-L or caspase inhibitor for
vector
production, (Arai et al., 1997).
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
72
The gene co-transfer system of the present invention overcomes these
obstacles, by providing a pro-apoptic gene linked to a regulatable, promoter.
The
regulatable promoter prevents expression of the pro-apoptic gene in the host
or
packaging cell, which would result in cell death. The expression of the pro-
apoptic
gene is induced by a transactivator protein, carried by a gene on a second
expression
vector. In one embodiment of the present invention, adenovirus-mediated gene
co-
transfer uses a first adenovirus comprising human bax cDNA driven by a
promoter
consisting of a heptamer of GAL4-binding sites and a TATA box. A second
adenovirus (i.e., co-transfer) comprising the GAL4/VP16 transactivator fusion
protein
linked to a regulatable promoter operable in eukaryotic cells, is provided to
selectively
induce bax expression. It is contemplated in other embodiments, that the first
promoter can be the ecdysone-responsive promoter or Tet-OnT"" and the inducer
of the
first promoter ecdysone or muristeron A and doxycycline, respectively. For a
complete description of the ecdysone system and Tet-OnT"" see section D,
herein. It
also is contemplated, that that the first promoter can be the HIV-1 LTR or HIV-
2 LTR
and the inducer of the first promoter tat. It is contemplated in other
embodiments, that
yeast, E. coli and insect promoters may also be useful in the present
invention for
regulated expression of cytotoxic genes.
For human or mammalian cytotoxic gene therapy via vector-mediated gene co-
transfer, the Bcl-2 genes Bak, Bim, Bik, Bid, Bad and Harakiri are
contemplated as
useful in the present:;invention. Additional cytotoxic gene products
contemplated as
useful in the present invention, are described below.
It is contemplated in the present invention that a gene encoding a
transactivating protein is supplied by a second vector. In certain
embodiments, the
gene encoding the transactivating protein can be linked to a constitutive
promoter. In
other embodiments, the gene encoding the transactivating protein can be under
the
control of an inducible promoter, permitting regulated expression of the
transactivating protein. Pancreatic, liver, skeletal muscle, smooth muscle,
skin, lung,
endothelium and blood are some examples of tissues in which tissue specific
promoters might be selected for use. Table 2, Table 3 and Table 4 provide a
list of
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
73
some useful tissue specific promoters, promoter/enhancers and inducible
promoter/enhancers, respectively, that may be used in combination and are
considered
useful in the present invention.
S An important consideration when selecting a promoter to drive the expression
of the cytotoxic gene product on the first vector, is that the transactivating
protein
(i.e., inducer) is not active in the host cell. For example, if the host cell
expresses a
transactivating protein, capable of activating the promoter on the first
expression
vector, upregulation of the cytotoxic gene may result.
The vector-mediated co-transfer system is particularly useful in vivo. In such
embodiments, it may be desirable that transactivating protein also is not
active in the
target cell. The presence of the transactivating protein in the target cell
would limit
the temporal use of the co-delivery system, as the transactivating protein
would be
present at the time of delivery of the cytotoxic expression construct.
A variety of transactivating genes theoretically can be chosen to express
transactivating protein factors, to drive the expression of a toxic gene on
the first
vector. Another consideration in choosing a transactivating protein factor is
its
efficacy of transcriptional activation in a given tissue type. It may be that
a particular
tissue specific transactivating factor has low levels of cross tissue
activity, which
could potentially be cytotoxic to healthy, normal cell or tissue types.
ii. In Vitro and In Vivo Delivery of Vectors to Target Cells
An adenoviral vector expressing a Blc-2 member gene, would facilitate the
therapeutic evaluation of the Bcl-2 member gene, since such a vector would
have
potentially high transduction efficiencies in a variety of tissues. However,
constructing an adenoviral vector that can express bax for example, has been
problematic, presumably because of the bax gene's high apoptotic activity and
its
toxic effect on packaging 293 cells (Rosse et al., 1998). It is contemplated
that
vector-mediated gene co-transfer of the present invention will be useful for
regulating
both in vitro and in vivo expression of potentially cytotoxic gene products
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
74
In one embodiment of the present invention, the in vitro expression of
therapeutic genes are considered. In one example, shuttle plasmids in which
bax cDNA was driven by a GAL4-responsive promoter consisting of five GAL4-
binding sites and a TATA box (GT) were constructed. Recombinant viral vectors
(Ad) were obtained after a single in vitro transfection of 293 cells with
pAd/GT-Bax
plus a 35-kb CIaI fi-agment from Ad/p53, (Zhang et al., 1993). Virus from a
single
plaque was expanded in 293 cells, twice purified and vector titer determined
to be
3.3x102 viral particles/ml. Thus, the vector-mediated gene co-transfer system
allows
the in vitro replication of Ad/GT-Bax particles (3.3x10'2 viral particles/ml)
in the host
cell (e.g., 293 cells), without killing the host cell (i.e. no Bax
expression). The
functionality of Ad/GT-Bax in vitro was documented by the co-transfer of
Ad/GT-Bax and the transactivator Ad/PGK-GV 16 to the cultured human lung
carcinoma cell line H1299, demonstrating the induction of Bax expression via
co-
transfer. The in vitro expression of Bax in the vector-mediated gene co-
transfer was
also demonstrated to promote apoptosis in human lung cancer cell lines.
In other embodiments, the induction of therapeutic gene expression in vivo is
contemplated for use in the present invention. Thus, in another example, to
test
whether bax gene expression could be similarly induced by adenovirus-mediated
gene
codelivery in vivo, adult Balb/c mice were infused via their tail veins with
Ad/GT-Bax
plus Ad/PGK-GV16, at a total vector dose of 6 x 10~° particles/mouse
and a vector
ratio of 2:1. Mice were then sacrificed at 24 h after treatment, after which
liver
samples were harvested for western blot analysis and histvpathological
examination.
A 14-fold increase in bax protein levels in animals treated with AdIGT-Bax
plus
Ad/PGK-GV 16 relative to control animals was observed as well as apoptosis of
normal liver cells. These results demonstrate that bax expression can
regulated in vivo
by expressing GAL4/VP16 protein via the adenovirus-mediated gene co-transfer
system.
In certain embodiments of the invention, the temporal sequence of vector-
mediated co-transfer delivery is contemplated. In one embodiment, the vectors
are
SU9STtTUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
delivered simultaneously. In other embodiments, the expression vector encoding
the
cytotoxic gene is delivered first, followed by the expression vector encoding
the
transactivating protein. In still other embodiments, the expression vector
encoding the
transactivating protein is delivered first, followed by the expression vector
encoding
5 the cytotoxic gene. The time between delivery of the first vector and the
second
vector is dependent on various parameters. Parameters to be considered when
formulating a protocol include, but are not limited to, vector transducing
efficiency,
transducing cell type, efficiency 'of cytotoxic gene expression, efficiency of
transactivating gene expression, cytotoxic protein stability and
transactivating protein
10 stability.
iii. Viral and Non-Viral Vectors
It is contemplated in the present invention, that gene co-transfer can be
employed using any vector (i.e., viral, plasmid, shuttle vector). The
therapeutic gene
15 as described above, can be incorporated into an adenoviral infectious
particle to
mediate gene transfer to a cell. Alternatively, retrovirus, adeno-associated
virus,
vaccinia virus, canary pox virus, herpes virus, canary pox virus and reovirus
also are
contemplated as gene transfer vectors for use in the present invention.
20 In certain embodiments, non-viral vectors, such as plasmids, shuttle
plasmids
and cosmids are contemplated for use. Non-viral methods for the transfer of
expression constructs into cultured mammalian cells include calcium phosphate
precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et
al.,
1990) DEAE-dextran (Gopal, 1985), electroporation {Tur-Kaspa et al., 1986;
Potter et
25 al., 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded
liposomes (Nicolau and Sene, 1982; Fraley et al., 1979), cell sonication
(Fechheimer
et al., 1987), gene bombardment using high velocity microprojectiles (Yang et
al.,
1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988).
For a more detailed description of both viral and non-viral methods and
applications
30 of gene transfer, refer to section F.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
76
iv. Other Genes Toxic to Host Cells
In other embodiments of the present invention, the use of gene co-transfer
system is contemplated for use in delivering non-pro-apoptic therapeutic genes
that
express potentially cytotoxic gene products. It is contemplated, that cancer,
hyperproliferative (e.g., psoriasis, cytys) and inflammatory conditions (e.g.
rheumatoid arthritis, allergies) could be treated by using the gene co-
transfer system,
by targeting these cells with genes that encode potentially cytotoxic
products. It is
contemplated that genes encoding cytokines (e.g., interferons), toxins
antisense
constructs, ribozymes, single chain antibodies, proteases and antigens would
be useful
in particular therapies, and that the co-transfer method will allow regulated
expression
of these genes.
In certain embodiments, various toxins are contemplated to be useful as part
of
the expression vectors of the present invention, these toxins include
bacterial toxins
such as ricin A-chain (Burbage, 1997), diphtheria toxin A (Massuda et al.,
1997;
Lidor, 1997), pertussis toxin A subunit, E. coli enterotoxin toxin A subunit,
cholera
toxin A subunit and pseudomonas toxin c-terminal. Recently, it was
demonstrated
that transfection of a plasmid containing the fusion protein regulatable
diphtheria
toxin A chain gene was cytotoxic for cancer cells. Thus, gene transfer of
regulated
toxin genes might also be applied to the treatment of cancers or other
hyperproliferative diseases (Massuda et al., 1997).
In certain embodiments, cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6,
IL-7, IL,-8, IL-9, IL-10, IL-11 IL-12, GM-CSF, oncostatin M, TGF-(3, TNF-a,
TNF-~i
and G-CSF are contemplated for use in the vector-mediated co-transfer system.
In other embodiments, antisense constructs are contemplated for use in the
present invention. Antisense methodology takes advantage of the fact that
nucleic
acids tend to pair with "complementary" sequences. Antisense polynucleotides,
when
introduced into a target cell, specifically bind to their target
polynucleotide and
interfere with transcription, RNA processing, transport, translation and/or
stability.
Antisense RNA constructs, or DNA encoding such antisense RNA's, may be
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
77
employed to inhibit gene transcription or translation or both within a host
cell, either
in vitro or in vivo, such as within a host animal, including a human subject.
Engineering antisense constructs is covered in detail in Section D. Particular
oncogenes that are targets for antisense constructs are ras, myc, neu, raf,
erb, src, fms,
jun, trk, ret, hst, gsp and abl. Also contemplated to be useful will be anti-
apoptotic
genes such as Bcl-2, Mcl-1, A1 and Bfl-1
1n still other embodiments, ribozymes are considered for use in the present
invention. Although proteins traditionally have been used for catalysis of
nucleic
acids, another class of macromolecules has emerged as useful in this endeavor.
Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-
specific
fashion. Ribozymes have specific catalytic domains that possess endonuclease
activity (Kim and Cook, 1987; Gerlach et al., 1987; Forster and Syrnons,
1987). For
example, a large number of ribozymes accelerate phosphoester transfer
reactions with
a high degree of specificity, often cleaving only one of several phosphoesters
in an
oligonucleotide substrate (Cook et al., 1981; Michel and Westhof, 1990;
Reinhold-
Hurek and Shub, 1992). This specificity has been attributed to the requirement
that
the substrate bind via specific base-pairing interactions to the internal
guide sequence
("IGS") of the rihozyme prior to chemical reaction.
Ribozyme catalysis has primarily been observed as part of sequence-specific
cleavagelligation reactions involving nucleic acids (Joyce, 1989; Cook et al.,
1981 ).
For example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act
as
endonucleases with a sequence specificity greater than that of known
ribonucleases
and approaching that of the DNA restriction enzymes. Thus, sequence-specific
ribozyme-mediated inhibition of gene expression may be particularly suited to
therapeutic applications (Scanlon et al., 1991; Sarver et al., 1990).
Recently, it was
reported that ribozymes elicited genetic changes in some cells lines to which
they
were applied; the altered genes included the oncogenes H-ras, c-fos and genes
of HIV.
Most of this work involved the modification of a target mRNA, based on a
specific
mutant codon that is cleaved by a specific ribozyme. Targets for this
embodiment will
include oncogenes such as ras, myc, neu, raf, erb, src, fms, jun, trk, ret,
hst, gsp, bcl-2,
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
78
EGFR, grb2 and abl. Other constructs will include overexpression of
antiapoptotic
genes such as bcl-2.
In yet another embodiment, one gene may comprise a single-chain antibody.
S Methods for the production of single-chain antibodies are well known to
those of skill
in the art. The skilled artisan is referred to U.S. Patent No. 5,359,046,
(incorporated
herein by reference) for such methods and section D above.
Antibodies to a wide variety of molecules are contemplated, such as
oncogenes, growth factors, hormones, enzymes, transcription factors or
receptors.
In certain embodiments, it may be useful to express enzymes, that are
potentially cytotoxic. For example, the protease caspase-7, has been
implicated in
apoptosis and thus potentially useful in gene therapy (Marcelli et al., 1999).
One
could express a variety of proteases, which have either been genetically
engineered to
function at physiological pH and/or active without enzymatic processing
(Briand et
al., 1999). Alternatively, proteases can be cloned from thermostable or pH
stable
organisms (Choi et al., 1999; Sundd et al., 1998). Thus, one could express a
protease
in a given cell and potentially inactivate via proteolysis, key metabolic and
signaling
proteins, needed for cell viability.
In another embodiment, treatment of protein folding disorders via the gene co-
transfer system are contemplated. For example, Cruetzfeldt-Jakob disease,
Kuru, the
human transmissible bovine spongiform encephalopathy (e.g., mad cow disease)
and
scrappie in sheep, are diseases related to cellular prion protein misfolding
(Grandien
and Wahren, 1998; Buschmann et al., 1998; Hill et al., 1999) The disease state
ensues when an individual is exposesed to an infectious (mutated) form of the
prion
protein. This infectious prion protein (PrP(Sc)) acts as a misfolding catalyst
or
scaffold, and induces conformational changes in an individuals native prion
proteins
(PrP(C)), leading to the intraneuronal accumulation of a pathological prion
isoform.
Prions replicate in lymphoreticular tissues before neuroinvasion and have been
demonstrated to be detectable via tonsil biopsy (Hill et al., 1999). It might
be possible
SUBSTITUTE SHEET (RULE 26~
CA 02322663 2000-09-07
WO 99/463'II PCTNS99/05359
79
using vector-mediated co-transfer, to provide antisense mRNA to patients who
test
positive for PrP(Sc), to prevent transcription of prion mRNA and thus block
protein
synthesis. Alternatively, expression of cytokines could be targeted to
lymphoreticular
tissues, expression of proteases or specific antigens could be used to tag
these cells for
S destruction, reducing prion protein expression. It is contemplated further
in the
present invention, that Alzheimer's disease could be treated similarly using
vector-
mediated co-transfer
G. Pharmaceuticals And Methods Of Treating Cancer
In a particular aspect, the present invention provides methods for the
treatment
of various malignancies. Treatment methods will involve treating an individual
with
an effective amount of a viral particle, as described above, containing a
therapeutic
gene of interest. An effective amount is described, generally, as that amount
sufficient
to detectably and repeatedly to ameliorate, reduce, minimize or limit the
extent of a
1 S disease or its symptoms. More rigorous definitions may apply, including
elimination,
eradication or cure of disease.
To kill cells, inhibit cell growth, inhibit metastasis, decrease tumor size
and
otherwise reverse or reduce the malignant phenotype of tumor cells, using the
methods and compositions of the present invention, one would generally contact
a
"target" cell with the therapeutic expression construct. This may be combined
with
compositions comprising other agents effective in the treatment of cancer.
These
compositions would be provided in a combined amount effective to kill or
inhibit
proliferation of the cell. This process may involve contacting the cells with
the
2S expression construct and the agents) or factors) at the same time. This may
be
achieved by contacting the cell with a single composition or pharmacological
formulation that includes both agents, or by contacting the cell with two
distinct
compositions or formulations, at the same time, wherein one composition
includes the
expression constrict and the other includes the second agent.
Alternatively, the gene therapy may - precede or follow the other agent
treatment by intervals ranging from minutes to weeks. In embodiments where the
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PC'TIUS99/05359
other agent and expression construct are applied separately to the cell, one
would
generally ensure that a significant period of time did not expire between the
time of
each delivery, such that the agent and expression construct would still be
able to exert
an advantageously combined effect on the cell. In such instances, it is
contemplated
5 that one would contact the cell with both modalities within about 12-24 h of
each
other and, more preferably, within about 6-12 h of each other, with a delay
time of
only about 12 h being most preferred. In some situations, it may be desirable
to
extend the time period for treatment significantly, however, where several d
(2, 3, 4,
5, 6 or 7) to several wk {1, 2, 3, 4, 5, 6, 7 or 8) lapse between the
respective
10 administrations.
Administration of the therapeutic expression constructs of the present
invention to a patient will follow general protocols for the administration of
chemotherapeutics, taking into account the toxicity, if any, of the vector. It
is
15 expected that the treatment cycles would be repeated as necessary. It also
is
contemplated that various standard therapies, as well as surgical
intervention, may be
applied in combination with the described gene therapy.
Where clinical application of a gene therapy is contemplated, it will be
20 necessary to prepare the complex as a pharmaceutical composition
appropriate for the
intended application. Generally this will entail preparing a pharmaceutical
composition that is essentially free of pyrogens, as well as any other
impurities that
could be harmful to humans or animals. One also will generally desire to
employ
appropriate salts and buffers to render the complex stable and allow for
complex
25 uptake by target cells.
Aqueous compositions of the present invention comprise an effective amount
of the compound, dissolved or dispersed in a pharmaceutically acceptable
carrier or
aqueous medium. Such compositions can also be referred to as inocula. The
phrases
30 "pharmaceutically or pharmacologically acceptable" refer to molecular
entities and
compositions that do not produce an adverse, allergic or other untoward
reaction when
administered to an animal, or a human, as appropriate. As used herein,
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
81
"pharmaceutically acceptable carrier" includes any and all solvents,
dispersion media,
coatings, antibacterial and antifungal agents, isotonic and absorption
delaying agents
and the like. The use of such media and agents for pharmaceutical active
substances
is well known in the art. Except insofar as any conventional media or agent is
incompatible with the active ingredient, its use in the therapeutic
compositions is
contemplated. Supplementary active ingredients also can be incorporated into
the
compositions.
The compositions of the present invention may include classic pharmaceutical
preparations. Dispersions also can be prepared in glycerol, liquid
polyethylene
glycols, and mixtures thereof and in oils. Under ordinary conditions of
storage and
use, these preparations contain a preservative to prevent the growth of
microorganisms.
Depending on the particular cancer to be, administration of therapeutic
compositions according to the present invention will be via any common route
so long
as the target tissue is available via that route. This includes oral, nasal,
buccal, rectal,
vaginal or topical. Topical administration would be particularly advantageous
for
treatment of skin cancers. Alternatively, administration will be by
orthotopic,
intradermal, subcutaneous, intramuscular, intraperitoneaI or intravenous
injection.
Such compositions would normally be administered as pharmaceutically
acceptable
compositions that include physiologically acceptable carriers, buffers or
other
excipients.
In certain embodiments, ex vivo therapies also are contemplated. Ex vivo
therapies involve the removal, from a patient, of target cells. The cells are
treated
outside the patient's body and then returned. One example of ex vivo therapy
would
involve a variation of autologous bone marrow transplant. Many times, ABMT
fails
because some cancer cells are present in the withdrawn bone marrow, and return
of
the bone marrow to the treated patient results in repopulation of the patient
with
cancer cells. .ln one embodiment, however, the withdrawn bone marrow cells
could
be treated while outside the patient with an viral particle that targets and
kills the
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
82
cancer cell. Once the bone marrow cells are "purged," they can be reintroduced
into
the patient.
The treatments may include various "unit doses." Unit dose is defined as
containing a predetermined-quantity of the therapeutic composition calculated
to
produce the desired responses in association with its administration, i.e.,
the
appropriate route and treatment regimen. The quantity to be administered, and
the
particular route and formulation, are within the skill of those in the
clinical arts. Also
of import is the subject to be treated, in particular, the state of the
subject and the
protection desired. A unit dose need not be administered as a single injection
but rnay
comprise continuous infusion over a set period of time. Unit dose of the
present
invention may conveniently may be described in terms of plaque forming units
(pfu)
of the viral construct. Unit doses range from 103, 104, 105, 106, 10', 108,
109, 101°,
1011, 1012, 1013 pfu and higher.
Preferably, patients will have adequate bone marrow function (defined as a
peripheral absolute granulocyte count of > 2,000 / mm3 and a platelet count of
100,000 / mm3), adequate liver function (bilirubin < 1.5 mg / dl) and adequate
renal
function (creatinine < 1.5 mg / dl).
i) Cancer Therapy
One of the preferred embodiments of the present invention involves the use of
viral vectors to deliver therapeutic genes to cancer cells. Target cancer
cells include
cancers of the lung, brain, prostate, kidney, liver, ovary, breast, skin,
stomach,
esophagus, head and neck, testicles, colon, cervix, lymphatic system and
blood. Of
particular interest are non-small cell lung carcinomas including squamous cell
carcinomas, adenocarcinomas and large cell undifferentiated carcinomas.
According to the present invention, one may treat the cancer by directly
injection a tumor with the viral vector. Alternatively, the tumor may be
infused or
perfused with the vector using any suitable delivery vehicle. Local or
regional
administration, with respect to the tumor, also is contemplated. Finally,
systemic
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99105359
83
administration may be performed. Continuous administration also may be applied
where appropriate, for example, where a tumor is excised and the tumor bed is
treated
to eliminate residual, microscopic disease. Delivery via syringe or
catherization is
preferred. Such continuous perfusion may take place for a period from about I-
2
hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about
1-2
days, to about 1-2 wk or longer following the initiation of treatment.
Generally, the
dose of the therapeutic composition via continuous perfusion will be
equivalent to that
given by a single or multiple injections, adjusted over a period of time
during which
the perfusion occurs.
For tumors of > 4 cm, the volume to be administered will be about 4-10 ml
(preferably 10 ml), while for tumors of < 4 cm, a volume of about 1-3 ml will
be used
(preferably 3 mi). Multiple injections delivered as single dose comprise about
0.1 to
about 0.5 ml volumes. The viral particles may advantageously be contacted by
administering multiple injections to the tumor, spaced at approximately 1 cm
intervals.
In certain embodiments, the tumor being treated may not, at least initially,
be
resectable. Treatments with therapeutic viral constructs may increase the
resectability
of the tumor due to shrinkage at the margins or by elimination of certain
particularly
invasive portions. Following treatments, resection may be possible. Additional
viral
treatments subsequent to resection will serve to eliminate microscopic
residual disease
at the tumor site.
A typical course of treatment, for a primary tumor or a post-excision tumor
bed, will involve multiple doses. Typical primary tumor treatment involves a 6
dose
application over a two-week period. The two-week regimen may be repeated one,
two, three, four, five, six or more times. During a course of treatment, the
need to
complete the planned dosings may be re-evaluated.
Cancer therapies also include a variety of combination therapies with both
chemical and radiation based treatments. Combination chemotherapies include,
for
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
84
example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine,
cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, bisulfan,
nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin,
mitomycin, etoposide (VP 16), tamoxifen, taxol, transplatinum, 5-fluorouracil,
vincristin, vinblastin and methotrexate or any analog or derivative variant
thereof.
Other factors that cause DNA damage and have been used extensively include
what are commonly known as Y-rays, X-rays, and/or the directed delivery of
radioisotopes to tumor cells. Other foams of DNA damaging factors are also
contemplated such as microwaves and UV-irradiation. It is most likely that all
of
these factors effect a broad range of damage on DNA, on the precursors of DNA,
on
the replication and repair of DNA, and on the assembly and maintenance of
chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200
roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000
to 6000
I S roentgens. Dosage ranges for radioisotopes vary widely, and depend on the
half life
of the isotope, the strength and type of radiation emitted, and the uptake by
the
neoplastic cells.
Various combinations may be employed, gene therapy is "A" and the radio- or
chemotherapeutic agent is "B":
_ ~/A._ B/~.__ BBIA A/A/B A/B/B B/A/A AIBBIB B/ABB
BBB/A BB/A/B A/ABB AB/A/B ABBIA BB/A/A
B/AB/A B/A/AB A/A/AB B/A/A/A AB/A/A A/ABIA
The terms "contacted" and "exposed," when applied to a cell, are used herein
to describe the process by which a therapeutic construct and a
chemotherapeutic or
radiotherapeutic agent are delivered to a target cell or are placed in direct
juxtaposition with the target cell. ~ To achieve cell killing or stasis, both
agents are '
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99/05359
delivered to a cell in a combined amount effective to kill the cell or prevent
it from
dividing.
The therapeutic compositions of the present invention are advantageously
5 administered in the form of injectable compositions either as liquid
solutions or
suspensions; solid forms suitable for solution in, or suspension in, liquid
prior to
injection may also be prepared. These preparations also may be emulsified. A
typical
composition for such purpose comprises a pharmaceutically acceptable carrier.
For
instance, the composition may contain 10 mg, 25 mg, 50 mg or up to about 100
mg of
10 human serum albumin per milliliter of phosphate buffered saline. Other
pharmaceutically acceptable carriers include aqueous solutions, non-toxic
excipients,
including salts, preservatives, buffers and the like. Examples of non-aqueous
solvents
are propylene glycol, polyethylene glycol, vegetable oil and injectable
organic esters
such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous
solutions,
15 saline solutions, parenteral vehicles such as sodium chloride, Ringer's
dextrose, etc.
Intravenous vehicles include fluid and nutrient replenishers. Preservatives
include
antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH
and
exact concentration of the various components the pharmaceutical composition
are
adjusted according to well known parameters.
Additional formulations are suitable for oral administration. Oral
formulations
. include such typical excipients as, for example, pharmaceutical grades of
mannitol,
lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate and the like. The compositions take the form of solutions,
suspensions,
tablets, pills, capsules, sustained release formulations or powders. When the
route is
topical, the form may be a cream, ointment, salve or spray.
H. Examples
The following examples are included to demonstrate preferred embodiments
of the invention. It should be appreciated by those of skill - in the art that
the
techniques disclosed in the examples which follow represent techniques
discovered by
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/I1S99/05359
86
the inventor to function well in the practice of the invention, and thus can
be
considered to constitute preferred modes for its practice. However, those of
skill in
the art should, in light of the present disclosure, appreciate that many
changes can be
made in the specif c embodiments which are disclosed and still obtain a like
or similar
result without departing from the spirit and scope of the invention.
EXAMPLE 1
Apoptotic Mechanisms following Adenovirus-mediated
p53 Replacement Gene Therapy
Induction of program cell death pathway is a critical step in most anticancer
therapies including adenovirus mediated wild-type p53 gene therapy. The
transient
expression of the adenovirus vector requires either induction of apoptosis,
terminal
differentiation, or cellular senescence in order to result in effective
therapy. As the a
further understanding of the mechanisms involved in this process is gained,
this will
enable us to design more effective therapeutic approaches to anticancer
treatment.
Materials and Methods
Cell Culture. H358 and H1299 are non-small cell lung cancer cell lines with
both copies of the p53 deleted and were obtained from A. Gazdar and J. Minna.
H322j is a non-small cell lung cancer cell line with a p53 mutation. Cells
were
maintained in RPMI-1640 medium supplemented with 10% fetal calf serum, 10 mM
glutamine, 100 units/ml of penicillin, 100 pg/rnI of streptomycin, and 0.25
pg/ml of
amphotericin B (Gibco-BRL, Life Technologies, Inc., Grand Island, NY) and
incubated at 37°C in a 5% C02 incubator.
Adenovirus production. The construction and properties of the Adp53 have
been reported elsewhere (Fujiwara et al., 1994; Zhang et al., 1993). The
Ad5/CMV/(3-gal virus was obtained from F. Graham, McMaster University,
Hamilton, Ontario. The E 1 deleted vector dl312 (obtained from T. Shenk,
Princeton,
N.J.) was utilized as a control vector. Adenovirus was prepared as previously
described (Graham and Prevec, 1991 ) and purified by two rounds of cesium
chloride
ultracentrifugation. Purified virus was mixed with 10% glycerol and dialyzed
twice
SU6STITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
87
against 1000 ml of a buffer containing 10 mM Tris HCl (pH 7.5), 1/pM MgCl2,
and
10% glycerol at 4°C for 6 h. Purified virus was aliquoted and stored at
-80°C until
used. Viral titer was determined by LJV-spectrophotometric analysis (viral
particles/ml) and by plaque assay (pfu/ml) (Zhang et al., 1995). Final viral
concentrations for in vitro and in vivo infections were made by dilution of
stock virus
in PBS. Adenovirus preparations were free of replication-competent adenovirus
as
determined by previously described techniques(Zhang et al., 1995).
Gene delivery. In vitro transfection studies for all cell lines were performed
by plating 5 x 105 cells in 100 mm plates (Falcon Plastics, Lincoln Park,
N.J.). Forty-
eight h after plating, cells were incubated for 2 h with purified virus in 2
mls of
RPMI-1640 medium supplemented with 2% fetal calf serum. The multiplicity of
infection (MOI) was based on cell counts of untreated plates. The MOI used for
each
cell line was chosen to result in an approximately 70-80% transduction based
on
preliminary studies using the AdS/CMVI(3-gal vector. These were an MOI of 5
pfu
for the H1299 cell line, 70 pfu for the H358 cell line and SO pfu for the
H322j cell
line. After 2 h, fresh RPMI-1640 medium supplemented with 10% fetal calf serum
was added to the plates. Cells and cell lysate were collected at 6 h intervals
up to 36 h
following infection for western blot, cell cycle, and TI1NEL assay analysis.
This time
course was chosen based on preliminary data indicating a large fraction of
apoptotic
cells were evident at these times and later time points resulted in the
observance of
degraded cellular proteins.
Western blot analysis. Total cell lysates were prepared by lysing monolayered
cells in dishes with sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-
PAGE) sample buffer after rinsing cells with phosphate buffered saline (PBS}.
Each
lane was loaded with 50 pg of cell lysate protein as determined by BCA protein
assay
(Pierce, Rockford, IL). After SDS PAGE at 100 volts for two h, the proteins in
the
gels were transferred to hybond-ECL membrane (Arnersham International PLC,
Little
Chalfont, Buckingham Shire, England). Membranes were blocked with 3% milk and
0.1% Tween 20 (Sigma Chemical Company) in PBS and incubated with antibody
against the specified protein overnight at 4°C. The mouse anti-human
p53 (DO-7)
SU6STITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PGTIUS99105359
$8
(Pharmigen, San Diego, CA), mouse anti-human Bcl-2 ( 124) (Dako Corp.,
Carpintenia, CA), mouse anti-human Bak (Oncogene Science), mouse anti-human
Bax (Pharmigen, San Diego, CA), mouse anti-human Bcl-xL (Pharmigen, San Diego,
CA), and mouse anti-human ((3-actin monoclonal antibody (N350) (Amersham
International PLC, Buckingham Shire, England) were used. The membranes were
developed according to Amershams ECL western blotting protocol.
Flow cytometry analysis for cell cycle. To measure the DNA histogram, cells
were fixed in 70% ethanol at 4°C for greater than 24 h. The cells were
incubated in
propidium iodide (20 p.g/ml) and ribonucleases (20 p.g/ml) for 30 min at
37°C. All
measures were made with an Epics Profile II (Coulter Corp., Hialeath, FL)
equipped
with an air-cooled argon ion laser admitting 488 NM at 15 MW. A minimum of
10,000 events per sample were analyzed and FITC fluorescence was collected
using a
525 BP filter. Coulters cytologic program was used for data analysis. Mean
peak
fluorescence was determined for each histogram.
Terminal deoxynucleotidyl transferase-mediated dUTP biotin nick end
labeling (TUNEL) Assay. The TUNEL assay was performed utilizing the procedure
described by Gorczyca et al. ( 1992). Briefly, fixed cells were washed in PBS
and
resuspended in 50 pl of TdT buffer with 5 units of TdT enzyme (Sigma Chemical
Co.)
and 0.5 nmol biotin-16-dUTP (Boehringer Mannheim Co.). Controls were prepared
without._TdT,enzyme.. Cells were incubated at 37°C for 1 hour, rinsed
in PBS, and
resuspended in 100 ml of avidin-FITC, 2.5 mg/ml, (Boehringer Mannheim Co.) in
saline-citrate buffer containing 0.1% Triton X-100, 0.1% BSA, 0.5 M NaCI, and
0.06
M Na citrate. Specimens were incubated in the dark for 30 min, washed in PBS
with
0.1 % Triton X-100, resuspended in propidium iodine (5 pg/ml) and 0.1 % RNAse
A.
After incubation for 30 min the specimens were analyzed with the use of an
EPICS
Profile II flow cytometer (Coulter Corp., Hialeah, FL). An analysis region was
set
based on the negative controls and the percent of labeled cells was calculated
from
this region.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/4b371 PCT/US99/05359
89
Evaluation of apoptosis. For evaluation of apoptosis induced by the Ad-Bax
vector, the breast carcinoma cell lines MDA-MB-468, MCF-7, and SKBr3 were
used.
The cells were plated at 0.5 x106 and then treated with Ad-Bax or viral
control at an
MOI of 100 viral particles per cell. Media alone was used for mock infection.
At 2
and 4 days post transfection, the cells were harvested and f xed in 80% ETOH.
After
24 hours, propidium iodide was added to each sample and the cells were
analyzed by
flow cytometry. The subdiploid cell population was assessed and the percent
recorded
as apoptotic cells.
Further analysis of apoptosis was determined by a cell death ELISA kit from
Boehringer Mannheim. This is a photometric "sandwich enzyme immunoassay" which
allows quantitative in vitro determination of histone-associated DNA fragments
which
are specific for apoptotic cell death. Briefly, MDA-MB-468 cells and MCF-7
cells
were transfected at an MOI of 100 (Ad-Bax, viral control or media alone) and
cells
collected at 72 hours. Samples were incubated with anti-histone biotin and
anti-DNA
peroxidase in streptavidin coated plates. After removal of unbound antibodies,
the
amount of peroxidase retained was determined photornetrically. The results are
recorded as an enrichment factor which is a photometric quantitation above the
control samples.
SUBSTITUTE SHEET (RULE 26~
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
Results
Adp53 infection results in overexpression of p53 protein and induction of
p21.
Expression of p53 protein in the H1299 cells was measured at 6 h intervals
S following Adp53 infection by western blot analysis. The control cells (mock
infected)
and d1312 (control vector) infected cells expressed no measurable p53 protein.
p53
protein was observed at the 6 h time point following infection with Adp53.
High
expression at multiple phosphorylation states was observed at 24 h and
continued to
the 36 h time point. Induction of p21 was observed following infection with
Adp53.
10 Control cells and d1312 infected cells expressed low levels of p21 by
western blotting
analysis. However, induction of p21 was observed early following infection
with
Adp53. High levels of p21 were observed at the 18 h time point and continued
to
with high expression observed at 36 h. Similar results were observed at the 24
h time
point for the H358 and H322J cell lines.
IS
Adp53 infection results in a G~ cell cycle arrest and induction of apoptosis.
Cell cycle analysis of the H1299 cell line demonstrated an increase in the Gi
population of cells following infection with Adp53 compared to the control and
d1312
infected cells (FIG. 2A. This increase in GI population of cells was observed
as early
20 as 12 h following Adp53 infection and was clearly evident at the 18 h time
point
(percent G,: control = 38%, Adp53 = 59%) and continued to 36 h. Interestingly,
accumulation of the sub 2N population of cells was observed at a time point
slightly
delayed from the time of accumulation of cells in G ~ cell cycle arrest. The
sub 2N
population of cells were observed at 24 h following infection with Adp53 and
25 continued to accumulate up to 36 h following infection. This increase sub
2N
population of cells corresponded to an increase labeling by TLTNEL assay (FIG.
2B.
These data are consistent with increases in apoptotic cell death.
Adp53 infection result in decreased levels of CPP32 and parp cleavage.
30 Levels of the inactive zymogen of CPP32 were observed in control and d13I2
infected cells. Adp53 infection resulted in decreased levels of the inactive
zymogen
form of CPP32. These diminished levels of the CPP32 zymogen were observed at
the
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
91
24 h time point and continued through the 36 h time point (FIG. 3A). This
reduction
in CPP32 levels was accompanied by concomitant evidence of cleavage of its
early
target Parp by western blot analysis. Similar results were observed at the 24
h time
point for the H358 and H322J cell lines (FIG. 3B). The above data is again
consistent
with induction of apoptotic cell death, activation of the ICE-like protease
CPP32, and
cleavage of the CPP32 target Parp.
Adp53 infection did not effect the Bcl 2 or Bcl x~ expression.
No significant changes in the levels Bcl-x, and Bcl-2 proteins were observed
by western blotting following infection with Adp53 as compared to control or
d1312
infected cells. Similar results were observed at the 24 h time point for the
H358 and
H322J cell lines.
Overexpression of p53 results in induction of proapoptotic Bax and Bak
proteins.
Bax protein levels were detectable in control and d13I2 infected cells.
Infection with Adp53 resulted in increased levels of Bax protein. This was
especially
evident at the 24 h time point and continued to 36 h. Bak protein expression
was
detectable by western blot analysis in control and d1312 infected cells.
Following
infection with Adp53, a significant increase in Bak protein levels were
observed
compared to controls. Again, peak levels were present at the 24 h time point
and
continued to the 36 h time point. Similar results were observed at the 24 h
time point
for the H358 and H322J cell lines.
SU8ST1TUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
92
EXAMPLE 2
The Adenoviral Bax Vector
Using the insights gained herein above, the inventors reasoned that the
overexpression of p53 gene induces apoptosis by upregulating Bax. Thus if a
vector
S could be designed that in itself mediated the upregulation of over-
expression of Bax,
there may be enough of an induction of Bax to induce apoptosis. In order to
investigate this further the inventors constructed a new and novel adenoviral
Bax
vector as described herein below.
Cloning of the human Bax cDNA.
Total RNA was isolated from SRB I squamous cell carcinoma cell line using
Ultraspec RNA isolation reagent (Biotecx). First strand cDNA was synthesized
using
S pg of RNA, S00 ng oligo (dT), SX strand buffer, 0.1 M DTT, 10 pM dNTP mix 1
pl
of superscripapt IITM in a RT-PCRTM reaction. Polyrnerase chain reaction was
then
performed to amplify Bax cDNA using forward oligo primer
5'-GGAATTCGCGGTGATGGAC GGGTCCGG-3' (SEQ ID NO:S) and reverse
oligo primer 5'-GGGAATTCTCAGCCCATCTTCTTCCA GA-3' (SEQ ID N0:6).
The reaction was incubated at 95 °C for 1 min, 56 °C for 2 min
and 72 °C for 3 min
for a total of 35 cycles. The PCRTM reaction was then resolved on 1.5% agarose
gel.
The Bax cDNA sequence was assessed with the M13 and T7 primers and was found
to differ from the wildtype Bax sequence in the amino terminus. The highly
_conserved BH3, region which appears necessary for apoptosis was intact but a
frameshift mutation existed which eliminated the BH1 and BH2 regions.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
93
Construction of Adenoviral Bax vector
The TA pCRTMII cloning vector (Invitrogen) containing the truncated Bax
cDNA (SEQ ID NO:1 cDNA encodes protein of SEQ ID N0:2) was amplified and
purified using Qiagen kit. The truncated Bax gene DNA fragment was isolated by
digestion with restriction enzymes EcaRI {for the 5' side) and Not I (for the
3' side)
and electroeluted on a 1.5% agarose gel. The truncated Bax gene was recovered
from
the gel with Qiagen DNA recovery kit and inserted into a polylinker between
the Xba
I and Cla I sites in the pXCJL.I shuttle vector. The shuttle vector contains
the left end
of the adenovirus type 5 genome with the E1 region deleted. The resulting
plasmid,
p 12 Bax, was cotransfected with the recombinant plasmid pJM 17 into 293
kidney
carcinoma cells which provided the deleted E 1 region in ttrqns. pJM 17 carnes
the
bulk of the right side of the adenovirus type 5 genome.
Calcium phosphate mediated cotransfection of the two plasmids (p l2Bax and
pJM 17) was performed with homologous recombination producing the adenoviral
truncated Bax vector (AdBax). Successful adenoviral recombinants were
identified
by cytopathic changes in the transfected 293 cells. The adenoviral
recombinants were
amplified on 293 cells and harvested when a complete cytopathic effect was
evident.
The virus was isolated by free-thawing the cell pellets three times in dry ice
ethanol
bath and a 37 °C water bath.
.,, _ Purification of the virus was performed. with two cesium chloride
gradient
ultracentrifugations. The isolated virus was then dialyzed against a buffer (
l OmM
Tris-HCL, 1mM MgCl2 and 10% glycerol) to remove contaminating cesium chloride.
Quantification of the virus was then performed with O.D. readings ad plaque
assay on
293 cells. The purified virus was then analyzed for the presence of the
truncated Bax
gene by dideoxy DNA sequencing with PCRTM and two primers. The internal
forward
oligo primer 5'-GGGACGAACTGGACAGTAA-3' (SEQ ID N0:7) and reverse oligo
primer 5'-GCACCAGTTTGCTGGCAAA-3' (SEQ ID N0:8) were used to sequence
both strands of the adenoviral Bax gene. Additional confirmations was obtained
with
PCRTM primers located just upstream and downstream of the Bax insert in the
adenovirus genome. These primers included the forward oligo
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 991463'11 PC'TIUS99/05359
94
5'-ACGCAAATGGGCGGTAG-3' (SEQ ID N0:9) and reverse
5'-CAACTAGAAGGCACAGT-3' (SEQ 117 NO:10). Sequencing confirmed that the
truncated Bax gene was correctly inserted in the adenoviral recombinant AdBax.
EXAMPLE 3
Induction of Apoptosis in human Breast Cancer
by Adenoviral Mediated Overexpression of Bax
Apoptosis is controlled, at least in part, by the balance between the
proapoptotic (Bax, Bak, Bcl-xs) and antiapoptotic (Bcl-2, Bcl-xL) members of
the Bcl-
2 family. Altering the balance of these mediators can result in the
suppression or
induction of apoptosis. The present example describes the use of the novel
adenoviral
vector, Ad-Bax, to determine whether overexpression of Bax could induce
apoptosis
in human breast cancer.
The human Bax cDNA was isolated, sequenced and used to construct the Type
5, E 1 deleted adenoviral vector as described herein above. The Ad-Bax vector
contained a truncated Bax with an intact death (BH3) domain. Human breast
cancer
cell lines MDA-MB-468, SKBr3 and MCF-? were transduced with Ad-Bax, E1
deleted viral control (AdV) or media alone (Cont.) at multiplicity of
infection (MOI)
of 100 to achieve an 85% transduction efficiency.
Apoptosis, was evaluated by__changes in cellular morphology, evidence of
DNA-Histone complexes by ELISA and by FACS (FIG. 4A, FIG. 4B and FIG. 4C)
analysis of subdiploid cells with propidium iodide staining.
Western blot analysis confirmed overexpression of the Bax protein in the
transduced cells. Apoptosis, by morphology, occurred four days after
transduction
with Ad-Bax in 468 and SKBr3 cells but not in MCF-? cells (Table 5). FACS
revealed a two-fold increase in apoptosis (FIG. 4A, FIG. 4B, and FIG. 4C). DNA-
Histone complexes increased 40% in 468 cells with no increase in MCF-7 cells.
Further Western analysis revealed similar levels of Bcl-xL in all cell lines.
However,
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCTNS99/05359
there were high levels of Bcl-2 only in the apoptosis-resistant MCF-2 cells
(Table S;
FIG. 4A, FIG. 4B, and FIG. 4C).
Table 5. Adenovirally-mediated Bax induced Apoptosis and the Bcl-2 levels in
5 MDA-MB-468, SKBr3 and MCF-7 cell lines
Apoptosis
Cell lines Cont AdV. Ad-Bax BCL-2 Level
MDA-MB-468 24 26 49 Low
SKBr3 13 10 24 Low
MCF-7 17 12 14 High
The present example demonstrates that adenoviral mediated gene transfer of
Bax induces apoptosis in human breast cancer cell lines. Resistance to Ad-Bax
10 induced apoptosis in MCF-7 cells may be due to the high cellular levels of
Bcl-2.
These results suggest that overexpression of the proapoptotic mediator Bax
will be a
novel and useful gene therapy strategy. Further, such gene therapy may be
combined
with inhibition of endogenous Bcl-2 to shift the proapoptotic/antiapoptotic
equilibrium in favor of death promotion in cancer cells.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
96
EXAMPLE 4
Construction of Wild-Type AdBax and AdBak Using a Cosmid System
Traditional methods of producing recombinant adenoviral vectors involve co
transfection of a plasmid encoding the transgene of interest and a shuttle
vector
carrying adenoviral genome sequences into a cell line such as 293 cells that
express
the E 1 A gene product. This allows for transactivation of adenoviral gene
transcription
and homologous recombination to produce a recombinant adenovirus that is
replication deficient. Some drawbacks of this system are a low efficiency of
homologous recombination, tedious cloning and plaque screening to identify the
desired end product, and the production of a relatively high level of non-
recombinant
viruses in the viral preparation.
A relatively new method of producing recombinant adenoviral particles is the
use of a cosmid adenoviral vector cloning system (Chattier et al., 1996, Fu
and
Deisseroth, 1997). The advantages to such a system high recombination
efficiency in
recA+ E. coli bacteria, high capacity for heterologous DNA, a stable genome,
easy
isolation of recombinant virus, and the ability to construct recombinant
adenoviruses
that carry cytotoxic gene. In the present invention, pro-apoptotic genes such
as bax
and bak are capable of being introduced into the adenoviral genome and
produced by
this system while not killing the producer cell.
" ,, Y The inventors used the Supercos vector (Stratagene, La Jolla, CA) as
the base
vector for this system (FIG. 5). Initially the SV40 origin of replication and
the Neo
gene were removed by restriction digestion to generate pCOS/LJ07 (FIG. 6). The
cloning of the adenovirus genome in to the cosmid was attained by
cotransfection of
pCOS/LJ07 and pAdv-dlEl-dlE3-Gal4 (U.S. application No. 60/030675, herein
incorporated by reference) into NM522 E. coli cells to allow homologous
recombination to occur. The resultant vector, pCOS/Ad/LJ 17 (FIG. 7) was
purified
and the recombinant adenovirus then constructed by co-transfection of
pCOS/Ad/LJ17
and a shuttle plasmid pCMV/Bak (FIG. 8) into NM522 E. coli cells. The
resultant
vector pCOS/Ad-Bak (FIG. 9) contains the Bak gene under the control of the CMV
IE
promoter. Verification of the Ad-CMV-Bak construct by PCRTM confirmed that the
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
97
proper insert was incorporated into the recombinant virus, and sequencing of
the bak
gene confirmed the sequence to be wild-type. Similar procedures were used to
generate the wild-type bax gene adenovirus recombinant. Linearization of the
vector
containing the adenoviral genome, and then transfection into 293/GV 16 cells
results
in the generation of recombinant vectors.
FIG. 10, FIG. 1 l, and FIG. 12 outline these procedures.
Thus it is evident that the use of a system such as this is useful for the
construction of adenoviral vectors, and that a wide variety of transgenes rnay
be
incorporated into the adenoviral genome using this or similar techniques. It
will be
appreciated that those of skill in the art may modify or improve such a system
to
produce better results or achieve greater efficiency.
EXAMPLE 5
Expression of the Bax Gene by Adenovirus Mediated Gene Co-Transfer
Materials and Methods
Cell lines. Human non-small cell lung cancer cell lines H 1299 and A549 were
cultured in RPMI 1640 and HAMIF 12 medium, respectively, supplemented with 10%
FBS and antibiotics. Human embryonic kidney 293 cells were maintained in
Dulbecco's modified Eagle's medium (DMEM) containing 4.5 g/1 of glucose with
10%
FBS and antibiotics and used in the construction and amplification of
adenovirus _..
vectors.
Construction of recombinant adenovirus vectors. The construction of
Ad/PGK-GV 16, Ad/GT-Luc, and Ad/GT-LacZ as described by Fang et al. ( 1998).
Ad/CMV-GFP was obtained from Fueyo et al (1998). Mutations found in the bax
cDNA were corrected by combining two PCR products of the gene. The
authenticity
of the bax-a cDNA sequence was then confirmed by automatic DNA sequencing
performed at M. D. Anderson Cancer Center's Core DNA Sequencing Facility. For
construction of Ad/GT-Bax, the bax gene was first cloned downstream of the GT
promoter to generate the shuttle plasmid pAd/GT-Bax. Then, the vector was
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
98
constructed by cotransfecting 293 cells with a 35-kb cal fragment from Ad/p53
and
pAdIGT-Bax (Zhang et al., 1993). The virus titers cited in this study were
determined
by optical absorbency at A26o (one A26o unit = 1012 viral particle/ml).
Particle/plaque
ratios usually fell between 30:1 and 100:1. All viral preparations were tested
for E1+
adenovirus contamination by PCR {Fang et al., 1996) and for endotoxin
contamination by assays with a third-generation pyrogen testing kit from
BioWhittaker (Walkersville, MD).
PCR analysis. Viral DNA was isolated from the supernatant of viruses
expanded in 293 cells. A primer located in the bax gene was then used with a
second
primer located in the adenoviral backbone in PCR to identify recombinants via
PCR.
The plasmid pAd/GT-Bax was used as a positive control for Ad/GT-Bax. Primers
used for detecting E1+ adenovirus were the same as in Fang et al. (1996).
Transduction of target cells with adenoviral vectors. All cells were seeded
on 100-mm dishes at a density of 2x 106/dish 1 day prior to infection. H 1299
and
A549 cells were infected at a total MOI of 900 and 1500, respectively. For
coadministration of two vectors, the ratio of the first vector to second
vector was 2:1.
A preliminary study showed that such a ratio resulted in optimal transduction
of
H 1299 cells. Cells were either harvested at 24 h and 48 h after infection for
western
blot analysis or morphological observation by Hoechst staining.
Western blot analysis. Cell samples were lysed or liver samples from the in
vivo study were homogenized in a buffer consisting of 62.5 mM Tris, pH 6.8, 6
M
2S urea, 10% glycerol, 2% sodium dodecyl sulfate {SDS), and 0.003% bromophenol
blue. All samples were sonicated for 30 sec on ice before the subsequent
analysis.
Protein concentration was determined using BCA Protein Assay Reagent (Pierce,
Rockford, IL). Fifty micrograms of protein was mixed with 5% 2-
mercaptoethanol,
boiled for 5 min, and then loaded onto a SDS-polyacrylamide gel. After
electrophoresis, the proteins were transferred onto PROTRAN nitrocellulose
membranes (Schleicher & Schuell, Keene, NH), which were then blocked for I h
in
PBS containing 10% milk. To detect various proteins, the membranes were probed
SU6STITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99105359
99
overnight with primary antibodies against bax (N-20; Santa Cruz Biotechnology,
Santa Cruz, CA), PARP (C2-10; PharMingen, San Diego, CA), caspase-3
(PharMingen}, and (3-actin (Amersham, Arlington Heights, IL) at concentrations
recommended by the manufacturers. The membranes were washed 3 times and
probed with horseradish peroxidase-conjugated, species-specific secondary
antibodies
(Amersham). Finally, bands were visualized using the ECL system (Amersham)
according to the manufacturer's instructions and the density of each band was
quantified using Optimas software (Media Cybernetics, Silver Spring, MD).
Hoechst staining. Cells were seeded on 4-chamber slides at a density of
Sx104/chamber 1 day prior to infection. Forty-eight hours after infection at
the MOI
described above, cells were fixed with 4% glutaraldehyde and stained with 100
pg/ml
Hoechst 33342 (Sigma, St. Louis, MO} for 15 min, followed by a gentle washing
with
PBS. Photographs were taken under a fluorescent microscope.
Animal experiments. Balb/c mice 6-8 weeks old were purchased from the
National Cancer Institute (Frederick, MD). Prior to injection, AdIGT-Bax (or
Ad/GT-
LacZ) was mixed with Ad/PGK-GV 16 (or AdICMV-GFP) at a ratio of 1:2. A total
of
6x10I° particles/mouse were injected into the tail vein in a volume of
100 pl. Mice
were killed 1 day after injection. Their livers were then harvested and frozen
at -80°C
for later western blot analysis or fixed in 10% buffered formalin for later
. . .. . _ v . , . . , hiStochemical. ~alysis.. , . Sectioning and staining
was with ematoxylin and eosin.
SUBSTITUTE SHEET (RULE 2B~
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
100
RESULTS
Construction of Adenoviruses Expressing Bay
Shuttle plasrnids were constructed in which bax cDNA was driven by GT.
Recombinant viral vectors were obtained after a single transfection of 293
cells with
pAd/GT-Bax plus a 35-kb CIaI fragment from Ad/p53 and identified by polymerase
chain reaction (PCR) analysis with viral DNA. The functionality of Ad/GT-Bax
was
documented by the coadministration of Ad/GT-Bax and Ad/PGK-GV 16 to the
cultured human lung carcinoma cell line H 1299 (FIG. 13). Virus from a single
plaque
was expanded in 293 cells and twice purified by uitracentrifugation on a
cesium
I 0 chloride gradient. The vector titer ~ determined by optical absorbency at
A26o was
3.3 x 1012 viral particles/ml, equivalent to that of the other E 1-deleted
vectors, such as
Ad/CMV-GFP and Ad/CMV-LacZ. The total yield for Ad/GT-Bax also was the same
as for the other El-deleted vectors produced in our laboratory, about 1.5x104
particles/cell. The vector preparation was free of E1+ adenovirus and
endotoxin.
Induction of Bax Expression After Adenovirus-mediated Gene Codelivery.
To demonstrate induction of the bax gene in cultwed mammalian cells by
adenovirus-mediated gene co-transfer, human lung carcinoma cell lines H 1299
and
A549 were infected with Ad/GT-Bax and Ad/PGK-GV 16 at a vector ratio of 2:1
and
at a total multiplicity of infection (MOI) of 900 and 1500, respectively. A
preliminary
experiment showed that this ratio gave optimal transduction efficiency in H
1299 cells
treated at a fixed total MOI. Cells treated with PBS or infected either with
AdIGT-
Bax plus AdICMV-GFP or with Ad/GT-LacZ plus Ad/PGK-GV16 at the same vector
ratio and MOIs were used as controls. Cells were harvested 24 h after the
treatment
and their lysates subjected to western blot analysis. Levels of (3-actin in
the same
western blots were also analyzed and used to ensure equal protein loading in
all lanes.
Though background levels of the bax protein expression differed between H1299
and
A549 cells and though the treatment with control vectors did not increase
those
background levels, a strong induction of bax expression was detected in both
cell lines
when they were treated with Ad/GT-Bax plus Ad/PGK-GV 16. The induction was
seen to be 67.2- and 8.7-fold in H1299 and A549 cells, respectively, when the
SUBSTIME SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
101
densities of the bax-specific bands were quantified and normalized to the
density of ~i-
actin bands.
Triggering Apoptosis By Induction of the Bax Expression.
Overexpression of the bax gene has been demonstrated to induce the release of
Cyt c from mitochondria (Jurgensmeier et al., 1998; Pastorino et al., 1998;
Rosse et
al., 1998) which leads to cleavage first of caspase-3/CPP32 followed by
cleavage of
poly(ADP ribose)polymerase (PARP) (Tewari et al., 1995). To demonstrate the
induction of bax expression and apoptosis by adenovirus-mediated gene
codelivery in
H1299 and A549 cells, samples of the same cell lysate from the above-mentioned
experiments were subjected to western blot analysis of the cleavage of caspase-
3 and
PARP. The cleavage of caspase-3 into a 17-kD fragment and PARP into a 85-kD
fragment was detected in cells treated with Ad/GT-Bax plus Ad/PGK-GV 16 but
not in
cells from any other experimental groups. To further document the apoptosis in
these
cells, H 1299 and A549 cells were treated with various vectors as mentioned
above
and observed for cytopathology and morphology changes at 48 h after treatment.
Over 80% of the cells treated with Ad/GT-Bax plus AdIPGK-GV 16 showed signs of
cytopatholgy, and became rounded and detached, whereas the cells in all other
treated
groups remained in monolayers with normal morphology. Nuclear fragmentation, a
hallmark of cell apoptosis, was detected only in cells treated with Ad/GT-Bax
plus
Ad/PGK-GV 16
(FIG. 14), indicating that bax expression by this system did activate not only
the ... .
caspase cascade, but ultimately extensive apoptosis in these human lung cancer
cell
lines.
Induction of Bax Gene Expression In »ivo.
To demonstrate bax gene expression by adenovirus-mediated gene codelivery
in vivo, adult Balb/c mice were infused via their tail veins with PBS, Ad/GT-
Bax plus
Ad/CMV-GFP, Ad/GT-Bax plus Ad/PGK-GV 16, or Ad/GT-LacZ plus AdIPGK-
GV 16 at a total vector dose of 6 x 10 ~° particles/mouse and a vector
ratio of 2:1. Mice
were then killed at 24 h after treatment, after which liver samples were
harvested for
western blot analysis and histopathological examination. Western blot analysis
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99!46371 PCTIUS99/05359
102
showed a 14-fold increase in bax protein levels in animals treated with Ad/GT-
Bax
plus Ad/PGK-GV 16, but only background level in all other treatment groups.
These
results clearly demonstrated that the Ad/GT-Bax plus Ad/PGK-GV 16 strictly
regulated bax expression by expressing GAL4/VP 16 protein even in vivo.
Expression
S of the bax gene also induced typical apoptosis in normal liver cells, as
revealed by
nuclear fragmentation and condensation in hematoxylin- and eosin-stained liver
sections (FIG. 15). Together, these results demonstrate that adenovirus-
mediated gene
co-transfer can produce sufficient bax expression and induce apoptosis in
vivo.
All of the compositions and/or methods disclosed and claimed herein can be
made and executed without undue experimentation in light of the present
disclosure.
While the compositions and methods of this invention have been described in
terms of
preferred embodiments, it will be apparent to those of skill in the art that
variations
may be applied to the compositions and/or methods and in the steps or in the
sequence
of steps of the method described herein without departing from the concept,
spirit and
scope of the invention. More specifically, it will be apparent that certain
agents which
are both chemically and physiologically related may be substituted for the
agents
described herein while the same or similar results would be achieved. All such
similar substitutes and modifications apparent to those skilled in the art are
deemed to
be within the spirit, scope and concept of the invention as defined by the
appended
claims.
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
103
References
The following references, to the extent that they provide exemplary procedural
or other details supplementary to those set forth herein, are specif:cally
incorporated
S herein by reference.
U. S. Patent 5,359,046
EPO 0273085
Apte, Mattei, Olsen, "Mapping of the human BAX gene to chromosome
19q13.3-q13.4 and isolation of a novel alternatively spliced transcript, BAX
delta," Genomics 26:592-594, 1995.
Arai, Gordon, Nabel, and Nabel, "Gene transfer of Fas ligand induces tumor
regression in vivo," Proc. Natl. Acad Sci. USA 94:13862-13867, 1997.
Arap et al., Cancer Res., 55:1351-1354, 1995.
Arcone, et al., Nucl. Acids Res., 16(8): 3195-3207, 1988.
Atkin, Cytogenetic, 21:279, 1986.
Baichwal and Sugden, In: Gene Transfer, Kucherlapati R, ed., New York, Plenum
Press, pp. 117-148, 1986.
Bakhshi et al., Cell, 41:899, 1985.
Bargou et al., Int. J. Cancer, 60:854, 1995.
Bartlett et al., Proc. Natl. Acad. Sci. USA, 93:8852-8857, 1996.
Bedzyk et al., ,J. Biol. Chem., 265:18615, 1990
Benvenisty and Neshif, Proc. Nat. Acad. Sci. USA, 83:9551-9555, 1986.
Binder, Marx, Binder, Schauer, Hiddemann, "Expression of Bax in relation to
Bcl-2
and other predictive parameters in breast cancer," Ann. Oncol. 7:129-133,
1996.
Bishop, Cell, 64:235, 1991.
Boise et al., Cell, 74:597, 1993.
Boyd et al., Oncogene, 11:1921, 1995.
Briand, Chobert, Gantier, Declerck, Tran, Leonil, Molle, Haertle, "Impact of
the lysine-1888 and aspartic acid-189 inversion on activity of trypsin,"
FEBS Lett., 442( 1 ):43-47, 1999.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PGT/US99/05359
104
Buschmann, Kuczius, Bodemer, Groschup, "Cellular prion proteins of
mammalian species display an intrinsic partial proteinase K
resistance," Biochem. Biophys. Res. Commun., 253(3):693-702, 1998.
Bussemakers et al., Cancer Res., 52:2916-2922, 1992.
Caldas et al., Nat. Genet., 8:27-32, 1994.
Carter and Flotte, Ann. N Y. Acad. Sci., 770:79-90, 1995.
Casey et al., Oncogene, 6:1791-1797, 1991.
Chandler et al., Human Pathol., 25:789, 1994.
Chatterjee, et al., Ann. N. Y. Acad. Sci., 770:79-90, 1995.
Chaudhary et al. Proc. Natl. Acad Sci., $7:9491, 1990
Chen and Fallen, J. Biol. Chem., 271:2376, 1996.
Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987.
Cheng et al., Nature, 379:554, 1996.
Cheng et al., Cancer Res., 54:5547-5551, 1994.
1 S Cheung et al., J. Biol. Chem., 268:6139-6146, 1993.
Chinnaiyan et al., Science, 275:1122, 1997.
Chiou et al., Mol. Cell. Biol., 14:2556, 1994.
Chittenden et al., Nature, 374:733, 1995.
Choi and Boise, Eur. J. Immunol., 25:1352, 1995.
Choi et al., Oncogene, 11:1693, 1995.
Choi, Bang, Kim, Yu, "Extremely thermostable serine-type protease from
Aquifex pyrophilus. Molecular cloning, expression, and
characterization," J. Biol. Chem., 274(2):881-888, 1999.
Cleary and Sklar, Proc. Natl. Acad. Sci. USA, 82:7439, 1985.
Cleary et al., Cell, 47:19, 1986.
Coffin, In: Virology, ed., New York: Raven Press, pp. 1437-1500, 1990.
Coll, Negoescu, Louis, Sachs, Tenaud, Girardot, Derneinex, Brambilla,
Brambilla,
Favrot, "Antitumor activity of bax and p53 naked gene transfer in lung
cancer: in vitro and in vivo analysis," Hum. Gene Ther. 9:2063-2074, 1998.
Coupar et al., Gene, 68:1-10, 1988.
Craig et al., Genomics, 23:457, 1994.
D'Sa-Eipper et al., Cancer Res., 56:3879, 1996.
SUBSTITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
105
Dalla-Favera et al., Croce, Proc. Natl. Acad. Sci. USA, 79:7824, 1982.
Dani, et al., J. Biol. Chem., 264:10119-10125, 1989.
deJong et al., Curr. Top. Microbiol. Immunol., 182:287, 1992.
Dubensky et al., Proc. Nat. Acad. Sci. USA, 81:7529-7533, 1984.
Edelman and Crossin, Annu. Rev. Biochem., 60:155-190, 1991.
Edelman, Annu. Rev. Biochem., 54:135-169, 1985.
Fang, 3i, Bouvet, Roth, "Evaluation of GAL4/TATA in vivo. Induction of
transgene
expression by adenovirally mediated gene codelivery," J. Biol. Chem.
273:4972-4975, 1998.
IO Fang, Wang, Gordon, Bellinger, Read, Brinkhous, Woo, Eisensmith, "Lack of
persistence of El- recombinant adenoviral vectors containing a temperature-
sensitive E2A mutation in immunocompetent mice and hemophilia B dogs,"
Gene Ther. 3:217-222, 1996.
Farrow et al., Nature, 374:731, 1995.
Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987.
Ferkol et al., FASEB J., 7:1081-1091, 1993.
Ferrari et al., J. Virol., 70:3227-3234, 1996.
Fisher et al., J. Virol., 70:520-532, 1996.
Fisher, "Apoptosis in cancer therapy: crossing the threshold," Cell 78:539-
542, I994.
Flotte et al., Proc. Natl. Acad. Sci. USA, 90:10613-10617, 1993.
Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979.
Fraser and Evan, Cell, 85:781, 1996.
Friedmann, "Progress toward human gene therapy," Science, 244:1275-1281, 1989.
Frixen et al., J. Cell Biol., 113:173-185, 1991.
Fueyo, Gomez-Manzano, Yung, Liu, Alemany, McDonnell, Shi, Rao, Levin,
Kyritsis,
"Overexpression of E2F-1 in glioma triggers apoptosis and suppresses tumor
growth in vitro and in vivo, " Nat. Med. 4:685-690, 1998.
Fujiwara et al., Cancer Res., 54:2287-2291, 1994.
Gawerky et al., Proc. Natl. Acad. Sci. USA, 85:8548, 1988.
Gendler et al., Int. J. Cancer, 45:431, 1990.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
106
Ghosh and Bachhawat, In: Liver diseases, targeted diagnosis and therapy using
specific
receptors and ligands, (Wu G, Wu C ed.), New York: Marcel Dekker, pp. 87-
104, 1991.
Giancotti and Ruoslahti, Cell, 60:849-859, 1990.
Gibson et al., Oncogene, 13:665, 1996.
Gonzalez-Garcia et al., Development, 120:3033, 1994.
Goodman et al., Blood, 84:1492-1500, 1994.
Gopal, Mol. Cell Biol., 5:1188-1190, 1985.
Gorczyca et al., Int'1 J. Oncol., 1:639-648, 1992.
Gossen and Bujard, Proc. Natl. Acad. Sci. USA, 89:5547-5551, 1992.
Gossen et al., Science, 268:1766-1769, 1995.
Gottschalk et al., Proc. Natl. Acad. Sci. USA, 91:7350, 1994.
Graham and Prevec, In: Methods in Molecular Biology: Gene Transfer and
Expression Protocols 7, E.J. Murray (ed.), Clifton, N.J., Humana
Press, pp. 205-225. 1991.
Graham and Van Der Eb, Virology, 52:456-467, 1973.
Grandien and Wahren, "A review of the current research on prions. The
evidence suggests the possibility of transmission of the mad cow
disease to human," Lakartidningen, 95(48):5499-5500, 5503-5505,
1998.
Gratiot-Deans et al., J. Immunol., 151:83, 1993.
Hanada et al., J. Biol. Chem., 270:11962, 1995.
Hay et al., J. Mol. Biol., 175:493-510, 1984.
Hearing and Shenk, J. Mol. Biol. 167:809-822, 1983.
Hearing et al., J. Virol., 67:2555-2558, 1987.
Hill, Butterworth, Joiner, Jackson, Rossor, Thomas, Frosh, Tolley, Bell,
Spencer,
King, Al-Sarraj, Ironside, Lantos, Collinge, "Investigation of variant
Creutzfeldt-Jakob disease adn other human prion diseases with tonsil biopsy
samples," Lancet, 353(9148):183-189, 1999.
Hockenbery et al., Nature, 348:334, 1990.
Hockenbery et al., Proc. Natl. Acad. Sci. USA, 88:6961, 1991.
Hollstein et al., Science, 253:49-53, 1991.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCTNS99/05359
107
Hunt et al., Proc. Natl. Acad. Sci. USA, 83:3786-3790, 1986.
Hussussian et al., Nature Genetics, IS-21, 1994.
lnohara et al., EMBO J., 16:1686, 1997.
Joki, et al., Human Gene Ther., 6:1507-1513, 1995.
Jurgensmeier, Xie, Deveraux, Ellerby, Bredesen, Reed, "Bax directly induces
release
of cytochrome c from isolated mitochondria," Proc. Natl. Acad. Sci.. USA
95:4997-5002, 1998.
Kageyama, et al., J. Biol. Chem., 262(5):2345-2351, 1987.
Kamada et al., Cancer Res., 55:354, 1995.
Kamb et al., Nature Genetics, 8:22-26, 1994.
Kamb et al., Science, 2674:436-440, 1994.
Kaneda et al., Science, 243:375-378, 1989.
Kaplitt et al., Arm. Thor. Surg., 62:1669-1676, 1996.
Kaplitt et al., Nat. Genet., 8:148-153, 1994.
Kapranos, Karaiosifidi, Valavanis, Kouri, Vasilaros, "Prognostic significance
of
apoptosis related proteins Bcl-2 and Bax in node-negative breast cancer
patients," Anticancer Res. 17:2499-2505, 1997.
Karlsson et al., EMBO J., 5:2377-2385, 1986.
Karsan et al., J. Biol. Chem., 271:27201, 1996.
Kato et al, J. Biol. Chem., 266:3361-3364, 1991.
Kenny et al., Oncogene, 14:997, 1997.
Kerr et al., Br. J. Cancer, 26:239, 1972.
Kessler et al., Proc. Natl. Acad. Sci. USA, 93:14082-14087, 1996.
Kiefer et al., Nature, 374:736, 1995.
Klein et al., Nature, 327:70-73, 1987.
Knudsonn et al., Science, 270:96, 1995.
Koeberl et al., Proc. Natl. Acad. Sci. USA, 94:1426-1431, 1997.
Korhonen, et al., Blood, Vol. 86, No. 5, September 1, 1995: pp 1828-1835.
Korsmeyer et al., Sem. Cancer Biol., 4:327, 1993.
Kozopas et al., Proc. Natl. Acad. Sci. USA, 90:3516, 1993.
Krajewski et al., Am. J. Path., 145:515, 1994b.
Krajewski et al., Am. J. Path., 146:1309, 1995b.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCTIUS99l05359
108
Krajewski et al., Cancer Res,. Sb: 2849-2855, 1996.
Krajewski, Blomqvist, Franssila, Krajewska, Wasenius, Niskanen, Nordling,
Reed,
"Reduced expression of proapoptotic gene BAX is associated with poor
response rates to combination chemotherapy and shorter survival in women
with metastatic breast adenocarcinoma," Cancer Res. 55:4471-4478, 1995a.
Krajewski, Krajewska, Shabaik, Miyashita, Wang, Reed, "Immunohistochemical
determination of in vivo distribution of Bax, a dominant inhibitor of Bcl-2,"
Am J. Pathol., 145:1323-1336, 1994a.
Lam et al., Proc. Natl. Acad. Sci. LISA, 91:6569, 1994.
Langdon et al., Cell, 47:1 l, 1986.
Larregina, Morelli, Dewey, Castro, Fontana, Lowenstein, "Fast induces Fas/Apo
1-
mediated apoptosis in human embryonic kidney 293 cells routinely used to
generate El-deleted adenoviral vectors," Gene Ther. 5:563-568, 1998.
LeBrun et al., Am. J. Path., 142:743, 1993.
Levrero et al., Gene, 101:195-202, 1991.
Lin and Guidotti, J. Biol. Chem., 264:14408-14414, 1989.
Lin et al., ,l. Immunol., 151:1979, 1993.
Lomo et al., Cancer Res., 56:40, 1996.
Lotem and Sachs, Cell Growth Diff., 6:647, 1995.
Lu et al., J. Pathol., 169:431, 1993.
Lucas et al., Oncol. Res., 6:139, 1994.
Macejak and Sarnow, Nature, 353:90-94, 1991.
Manalov and Manolova, Nature, 237:33, 1972.
Mann et al., Cell, 33:153-159, 1983.
Marcelli, Cunningham, Walkup, He, Sturgis, Kagan, Mannucci, Nicoletti, Teng,
Denver, "Signaling pathway activated during apoptosis of the prostate cancer
cell line LNCaP: overexpression of caspase-7 as a new gene therapy strategy
for prostate cancer," Cancer Res., 59(2):382-390, 1999.
Marin et al., Oncogene, 11:2259, 1996.
Marin et al., Oncogene, 9:3107, 1994.
Matsura et al., Br-it. J. Cancer, 66:1122-1130, 1992. -
McCown et al., Brain Res., 713:99-107, 1996.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
109
McDonnell and Korsmeyer, Nature, 349:254, 1991.
McDonnell et al., Cell, 57:79, 1989.
McDonnell et al., J. Urology, 157:569, 1997.
McDonnell et al., Mol. Cell. Biol., 10:1901, 1990.
McDonnell, et al., Cancer Res., 52:6940, 1992.
McDonnell, et al., Mol. Carcinogen., 8:209, 1993a.
McDonnell, et al., Transgene, 1:47, 1993b.
Meijerink, Smetsers, Sloetjes, Linders, Mensink, "Bax mutations in cell lines
derived
from hematological malignancies," Leukemia 9:1828-1832, 1995.
Merchant et al., Oncogene, 13:2631-2637, 1996.
Merino et al., EMBO J., 13:683, 1994.
Minn et al., Nature, 385:353, 1997.
Miyashita and Reed, Cell, 80:293, 1995.
Miyashita et al., Cancer Res., 54:3131-3135, 1994a.
Miyashita et al., Cell, 80:293-299, 1995.
Miyashita et al., Oncogene, 9:1799-1805, 1994b.
Mizukami et al., Virology, 217:124-130, 1996.
Mori et al., Cancer Res., 54:3396-3397, 1994.
Moss et al., Biochem. Biophys. Res. Comm., 223:199, 1996.
Motoyama et al., Science, 267:1506, 1995.
Muchmore et al., Nature, 381:335, 1996.
Nakayama et al., Proc. Natl. Acad. Sci. USA, 91:3700, 1994.
Nicolas and Rubenstein, In: Vectors: A survey of molecular cloning vectors and
their
uses, Rodriguez and Denhardt (eds.), Stoneham: Butterworth, pp. 493-513,
1988.
Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982.
Nicolau et al., Methods Enzymol., 149:157-176, 1987.
Nishikura et al., Proc. Natl. Acad. Sci. USA, 80:4822, 1983.
Nobri et al., Nature, 368:753-756, 1995.
Novack and Korsmeyer, Am. J. Path., 145:61, 1994.
Nowell and Hungerford, Science, 132:1497, 1960.
Nunez et al., Nature, 353:71, 1991.
SUBSTITUTE SHEET (RULE 28)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
110
Obrink, BioEssays, 13:227-233, 1991.
Odin and Obrink, Exp. Cell Res., 171:1-15, 1987.
Okamoto et al., Proc. Nat'I Acad. Sci. USA, 91:11045-11049, 1994
Okuyama, Fujino, Li, Funeshima, Kosuga, Saito, Suzuki, Yamada, "Efficient
S Fas-Ligand gene expression in rodent liver after intravenous injection of a
recombinant adenovirus by the use of a Cre-mediated switching system," Gene
Ther. 5:1047-1053, 1998.
Olivierio, et al., EMBO J., 6(7):1905-1912, 1987.
Olsen et al., J. Virol., 70:663, 1996.
Oltvai, Milliman, Korsmeyer, "Bcl-2 heterodimerizes in vivo with a conserved
homolog, Bax, that accelerates programmed cell death," Cell 74:609-619,
1993.
Orlow et al., Cancer Res., 54:2848-2851, 1994.
Orth and Dixit, J. Biol. Chem., 272:8841, 1997.
Ouyang, Furukawa, Abe, Kato, Horii, "The BAX gene, the promoter of apoptosis,
is
mutated in genetically unstable cancers of the colorectum, stomach, and
endometrium," Clin. Cancer Res. 4:1071-1074, 1998.
Pape and Kim, Mol. Cell. Biol., 974-982, 1989.
Park et al., Blood, 86:868, 1995.
Paskind et al., Virology, 67:242-248, 1975.
Pastorino, Chen, Tafani, Snyder, Farber, "The overexpression of Bax produces
cell
death upon induction of the mitochondria) permeability transition," J. Biol.
Chem. 273:7770-7775, 1998.
Pelletier and Sonenberg, Nature, 334:320-325, 1988.
Perales et al., Proc. Natl. Acad. Sci. 91:4086-4090, 1994.
Ping et al., Microcirculation, 3:225-228, 1996.
Poli and Cortese, Proc. Natl. Acad. Sci. USA, 86:8202-8206, 1989.
Potter et al., Proc. Nat. Acad. Sci. USA, 81:7161-7165, 1984.
Prowse and Baumann, Mol Cell Biol, 8(1):42-S1, 1988.
Radler et al., Science, 275:810-814, 1997.
Rampino et al., Science, 275:967, 1997.
Reed et al., Adv. Exp. Med. Biol., 406:99, 1996.
SU9STITUTE SHEET (RULE 2B)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
111
Renan, Radiother. Oncol., 19:197-218, 1990.
Rich et al., Hum. Gene Ther., 4:461-476, 1993.
Ridgeway, In: Vectors: A survey of molecular cloning vectors and their uses,
Rodriguez
RL, Denhardt DT, ed., Stoneham:Butterworth, pp. 467-492, 1988.
Rippe et al., Mol. Cell Biol., 10:689-695, 1990.
Ron, et al., Mol. Cell. Biol., 2887-2895, 1991.
Rosse, Olivier, Monney, Rager, Conus, Fellay, Jansen, Borner, "Bcl-2 prolongs
cell
survival after Bax-induced release of cytochrome c," Nature 391:496-499,
1998.
Rouayrenc et al., Acad. Sci. Ill, 31$:5537, 1995.
Roux et al., Proc. Natl Acad Sci. USA, 86:9079-9083, 1989.
Rowley, Nature, 243:290, 1973.
Sakakura, Sweeney, Shirahama, Igarashi, Hakomori, Nakatani, Tsujimoto,
Imanishi,
Ohgaki, Ohyama, Yamazaki, Hagiwara, Yamaguchi, Sawai, Takahashi,
"Overexpression of bax sensitizes human breast cancer MCF-7 cells to
radiation-induced apoptosis," Int. J. Cancer 67:101-105, 1996
Sakakura, Sweeney, Shirahama, Igarashi, Hakomori, Tsujimoto, Imanishi, Ogaki,
Ohyama, Yamazaki, Hagiwara, Yamaguchi, Sawai, Takahashi,
"Overexpression of bax sensitizes breast cancer MCF-7 cells to cisplatin and
etoposide," Surg. Today 27:676-679, 1997a.
Sakakura, Sweeney, Shirahama, Igarashi, Hakomori, Tsujimoto, Imanishi, Ohgaki,
Yamazaki, Hagiwara, Sawai, Yamaguchi, Takahashi, "Overexpression of bax
enhances the radiation sensitivity in human breast cancer cells," Surg. Today
27:90-93, 1997b.
Samulski et al., .J. Virol., 61(10):3096-3101, 1987.
Sato et al., Proc. Natl. Acad. Sci. USA, 91:9238, 1994.
Sattler et al., Science, 275:983, 1997.
Sedlak et al., Proc. Natl. Acad. Sci. USA, 92:7834, 1995.
Serrano et al., Nature, 366:704-707, 1993.
Serrano et al., Science, 267:249-252, 1995.
Seto et al., EMBD J., 7:123, 1988.
Shibasaki et al., Nature, 386L:728, 1997.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCT/US99105359
112
Shinoura, Ohashi, Yoshida, Asai, Kirino, Saito, Hamada, "Construction,
propagation,
and titer estimation of recombinant adenoviruses carrying proapoptotic genes,"
Hum. Gene Ther. 9:2683-2689, 1998.
Shtivelman et al., Nature, 315:550, 1985.
Silvstrini et al., J. Natl. Cancer Inst., 86:499, 1994.
Simonian et al., J. Biol. Chem., 27 1:32073, 1996.
Speigelman, et al., J. Biol. Chem., 264(3), 1811-1815, 1989.
Strobel, Kraeft, Chen, Cannistra, "BAX expression is associated with enhanced
intracellular accumulation of paclitaxel: a novel role for BAX during
chemotherapy-induced cell death," Cancer Res. 58:4776-4781, 1998.
Strobel, Swanson, Korsmeyer, Cannistra, "BAX enhances paclitaxel-induced
apoptosis through a p53-independent pathway," Proc. Natl. Acad. Sci. USA
93:14094-14099, 1996.
Sundd, Kundu, Pal, Medicherla, "Purification and characterization of a highly
stable
cysteine protease from the latex of Ervatamia coronaria," Biosci. Biotechnol.
Biochem., 62(10):1947-1955, 1998.
Tai, Lee, Niloff, Weisman, Strobel, Cannistra, "BAX protein expression and
clinical
outcome in epithelial ovarian cancer," J. Clin. 4ncol. 16:3211, 1998.
Takahashi et al., Cancer Res., 52:734-736, 1992.
Tanaka et al., J. Biol. Chem., 268:10920, 1993.
Taub et al., Cell, 36:339, 1984.
Temin, In: Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp. 149-
188,
1986.
Testa, Cell Growth Dif~ j':, 1:97, 1990.
Tewari, Quan, K, Desnoyers, Zeng, Beidler, Poirier, Salvesen, Dixit,
"Yama/CPP32
beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that
cleaves the death substrate poly (ADP-ribose) polymerase," Cell 81:801-809,
1995.
Thompson, "Apoptosis in the pathogenesis and treatment of disease," Science
26?:1456-1462, 1995.
Tibbetts Cell, 12:243-249, 1977.
Tsujimoto and Croce, Proc. Natl. Acad. Sci. USA, 83:5214, 1986.
SUBSTITUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
113
Tsujimoto et al., Science, 226:1097, 1984.
Tsujimoto et al., Science, 228:1440, 1985.
Tur-Kaspa et al., Mol. Cell Biol., 6:716-718, 1986.
Umbas et al., Cancer Res., 52:5 I 04-5109, 1992.
Veis et al., et al" Cell, 75:229, 1993.
Wagner et al., Proc. Natl. Acad. Sci. 87(9):3410-3414, 1990.
Wagner et al., Science, 260:1510-1513, 1993.
Walther and Stein, J. Mol. Med, Vol. 74, i 996: pp. 379-392.
Wang et al., Cell, 87:629, 1996a.
Wang et al., Genes. Dev., 10:2859, 1996c.
Wang et al., In: Animal Cell Technology; Basic c~c Applied Aspects, S.
Kaminogawa et al., . (eds), vol. 5, pp463-469, Kluwer Academic
Publishers, Netherlands, 1993.
Wang et al., J. Cell Biol., 129:1103, 1995.
Watt et al., Proc. Natl Acad Sci., 83(2): 3166-3170, 1986.
Weinberg, Science, 254:1 I38-1145, 1991.
Wilson, et al., Mol. Cell. Biol., 6181-6191, 1990.
Wong et al., Gene, 10:87-94, 1980.
Wu and Wu, Adv. Drug Delivery Rev., 12:159-167, 1993.
Wu and Wu, Biochem., 27:887-892, 1988.
Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987.
Xiao et al., J. Yirol., 70:8098-8108, 1996.
Yachnis et al., J. Neuropath. Exp. Neurol., 56:186, 1997.
Yang et al., Cell Biol., 128:1173, 1995a.
Yang et al., Cell, 80:285, I995b.
Yang et al., Proc. Natl. Acad. Sci USA, 87:9568-9572, 1990.
Yin et al., Curr. Top. Microbiol. Immunol., 194:331, 1995.
Yin et al., Nature, 369:272, 1994.
Yin et al., Nature, 385:637, 1997.
Yin, Knudson, Korsmeyer, Van Dyke, "Bax suppresses tumorigenesis and
stimulates
apoptosis in vivo," Nature 385:637-640, 1997.
Yuan et al., Cell, 75:641, 1993.
SUBSTITUTE SHEET (RULE 25)
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
114
Zechner, et al., Mol. Cell. Biol., 2394-2401, 1988.
Zha et al., Cell, 87:619, 1996b.
Zha et al., J. Biol. Chem., 271:7440, I996a.
Zhan et al., Oncogene, 9:3743, 1994.
S Zhang et al., Hum. Gene Ther., 6:155-164, 1995.
Zhang, Fang, Branch, Mazur, French, Roth, "Generation and identification of
recombinant adenovirus by liposome-mediated transfection and PCR
analysis," Biotechnigues. 15:868-872, 1993.
Zutter et al., Blood, 78:1062, 1991.
SU8ST1TUTE SHEET (RULE 26)
CA 02322663 2000-09-07
WO 99146371 PCT/US99/05359
SEQUENCE LISTING
<110> MCDONNELL, TIMOTHY J.
SWISHER, STEVEN G.
S FANG, BINGLIANG
BRUCKHEIMER, ELIZABETH
SARKISS, MONA
JI, LIN
ROTH, JACK A.
<120> INDUCTION OF APOPTIC OR CYTOTOXIC GENE EXPRESSION BY
ADENOVIRAL MEDIATED GENE CODELIVERY
<130> INGN:088/INGN:088P
1S
<140> Unknown
<141> 1999-03-11
<150> 60/077,541
<15i> 1998-03-11 .
<I60> 10
<170> PatentIn Ver.
2.0
2S
<210> 1
<211> 578
<212> DNA
<213> Human
<400> 1
atggacgggt ccggggagcagcccagaggcgggggtcccaccagctctga gcagatcatg 60
aagacagggg cccttttgcttcagggtttcatccaggatcyagcagggcg aatggggggg 120
gaggcacccg agctggccctggacccggtgcctcaggatgcgtccaccaa gaagctgagc 180
3S gagtgtctca agcgcatcggggacgaactggacagtaacatggagctgca gaggatgatt 240
. gccgccgtgg acacagactccccccgagaggtctttttccgagttgcagc tgacatgttt
300.,
_ ,..
tctgacggca acttcaactgggccgggttgtcgcccttttctactttgcc agcaaactgg 360
tgctcaaggc cctgtgcaccaaggtgccggaactgatcagaaccatcatg ggctggacat 420
tggacttcct ccgggagcggctgttgggctggatccaagaccagggtggt tgggacggcc 480
tcctctccta ctttgggacgcccacgtggcagaccgtgaccatctttgtg gcgggagtgc 540
tcaccgcctc gctcaccatctggaagaagatgggctga 578
<210> 2
<211> 131
4S <212> PRT
<213> Human
<400> 2
Met Asp Gly Ser Gly Glu Gln Pro Arg Gly Gly Gly Pro Thr Ser Ser
S0 1 5 10 15
Glu Gln Ile Met Lys Thr Gly Ala Leu Leu Leu Gln Gly Phe Ile Gln
20 25 30
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
Asp Arg Ala Gly Arg Met Gly Gly Glu Ala Pro Glu Leu Ala Leu Asp
35 40 45
Pro Val Pro Gln Asp Ala Ser Thr Lys Lys Leu Ser Glu Cys Leu Lys
$ 50 55 60
Arg Ile Gly Asp Glu Leu Asp Ser Asn Met Glu Leu Gln Arg Met Ile
65 70 75 80
Ala Ala Val Asp Thr Asp Ser Pro Arg Glu Val Phe Phe Arg Val Ala
85 90 95
1$
Ala Asp Met Phe Ser Asp Gly Asn Phe Asn Trp Ala Gly Leu Ser Pro
100 10S 110
Phe Ser Thr Leu Pro Ala Asn Trp Cys Ser Arg Pro Cys Ala Pro Arg
115 120 125
Cys Arg Asn
130
<210> 3
<211> 579
<212> DNA
2$ <213> Human
<400> 3
atggacgggt ccggggagca gcccagaggc ggggggccca ccagctctga gcagatcatg 60
aagacagggg cccttttgct tcagggtttc atccaggatc gagcagggcg aatggggggg 120
gaggcacccg agctggccct ggacccggtg cctcaggatg cgtccaccaa gaagctgagc 180
gagtgtctca agcgcatcgg ggacgaactg gacagtaaca tggagctgca gaggatgatt 240
gccgccgtgg acacagactc cccccgagag gtctttttcc gagtggcagc tgacatgttt 300
tctgacggca acttcaactg gggccgggtt gtcgcccttt tctactttgc cagcaaactg 360
gtgctcaagg ccctgtgcac caaggtgccg gaactgatca gaaccatcat gg~ctggaca 420
3$ ttggacttcc tccgggagcg gctgttgggc tggatccaag accagggtgg ttgggacggc 480
ctcctctcct actttgggac gcccacgtgg cagaccgtga ccatctttgt ggcgggagtg 540
ctcaccgcct cgctcaccat ctggaagaag atgggctga 579
<210> 4
<211> 192
<212> PRT
<213> Human
<400> 4
4$ Met Asp Gly Ser Gly Glu Gln Pro Arg Gly Gly Gly Pro Thr Ser Ser
1 5 10 15
Glu Gln Ile Met Lys Thr Gly Ala Leu Leu Leu Gln Gly Phe Ile Gln
20 25 30
$0
Asp Arg Ala Gly Arg Met Gly Gly Glu Ala Pro Glu Leu Ala Leu Asp
35 40 45
-2-
CA 02322663 2000-09-07
WO 99/46371 PCT/US99/05359
Pro Val Pro Gln Ala Ser LysLysLeu SerGlu CysLeu Lys
Asp Thr
50 55 60
Arg Ile Gly Asp Leu Asp AsnMetGlu LeuGln ArgMet Ile
Glu Ser
65 70 75 80
Ala Ala Val Asp Asp Ser ArgGluVal PhePhe ArgVal Ala
Thr Pro
85 90 95
1~ Ala Asp Met Phe Asp Gly PheAsnTrp GlyArg ValVal Ala
Ser Asn
100 105 110
Leu Phe Tyr Phe Ser Lys ValLeuLys AlaLeu CysThr Lys
Ala Leu
115 120 125
15
Val Pro Glu Leu Arg Thr MetGlyTrp ThrLeu AspPhe Leu
Ile Ile
130 135 140
Arg Glu Arg Leu Gly Trp GlnAspGln GlyGly TrpAsp Gly
Leu Ile
20 145 150 155 160
Leu Leu Ser Tyr Gly Thr ThrTrpGln ThrVal ThrIle Phe
Phe Pro
165 170 175
25 Val Ala Gly Val Thr Ala LeuThrIle TrpLys LysMet Gly
Leu Ser
180 185 190
<210> 5
<211> 27
<212> DNA
<213> Artificial
Sequence
35 <220>
<223> Description ArtificialSequence:
of Synthetic
<400> 5
ggaattcgcg gtgatggacg ggtccgg 27
40
<230> 6
<211> 28
<212> DNA
<213> Artificial
Sequence
45
<220>
<223> Description ArtificialSequence:
of Synthetic
<400> 6
5~ gggaattctc agcccatctt cttccaga 2g
-3-
CA 02322663 2000-09-07 -
WO 99/46371 PCT/US99/05359
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:Synthetic
<400> 7
0 gggacgaact ggacagtaa 1g
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:Synthetic
<400> s
gcaccagttt gctggcaaa 1g
<210> 9
<211> 17
2$ <212> DNA
<213> Artificial Sequence
<220>
<223> Description of ArtificialSequence:Synthetic
<400> 9
acgcaaatgg gcggtag 17
<210> 10
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
4~ <223> Description of ArtificialSequence:Synthetic
<400> 10
caactagaag gcacagt 1~
