Note: Descriptions are shown in the official language in which they were submitted.
CA 02324228 2000-09-28
- 1 -
DESCRIPTION
GENES CODING FOR FLAVONE SYNTHASES
Technical Field
The present invention relates to the control and
utilization of biosynthesis of flavones, which have
effects on flower color, protection from ultraviolet ray,
symbiosis with microorganisms, etc. in plants, by a
genetic engineering technique. More specifically, it
relates to genes encoding proteins with activity of
synthesizing flavones from flavanones, and to their
utilization.
Background Art
The abundance of different flower colors is one of
the pleasant aspects of life that enriches human minds
and hearts. It is expected to increase food production
to meet future population increase by the means of
accelerating the growth of plants through symbiosis with
microorganisms, or by increasing the number of nitrogen-
fixing leguminous bacteria, thus improving the plant
productivity as a result of increasing the content of
nitrogen in the soil. Elimination or reduction of the
use of agricultural chemicals is also desirable to
achieve more environmentally friendly agriculture, and
this requires improvement of the soil by the above-
mentioned biological means, as well as higher resistance
of plants against microbial infection. Another desired
goal is to obtain plants with high protective functions
against ultraviolet rays as a means of protecting the
plants from the destruction of the ozone layer.
"Flavonoid" is a general term for a group of
compounds with a C6-C3-C6 carbon skeleton, and they are
widely distributed throughout plant cells. Flavonoids
are known to have such functions as attracting insects
and other pollinators, protecting plant from ultraviolet
rays, and participating in interaction with soil
microorganisms (BioEssays, 16 (1994), Koes at al., p.123;
CA 02324228 2000-09-28
- 2 -
Trends in Plant Science, 1 (1997), Shirley, B.W., p.377).
Of flavonoids, flavone plays an important role in
interaction of plants with microorganisms, especially in
legumes, where they participate in the initial steps of
the symbiosis with leguminous bacteria (Plant Cell, 7
(1995), Dixon and Paiva, p.1085; Annu. Rev. Phytopathol.,
33 (1995), Spaink, p.345). Flavones in petals play a
role in recognition by insects and act as copigments
which form complexes with anthocyanins. (Gendai Kagaku,
(May, 1998), Honda and Saito, p.25; Prog. Chem. Org.
Natl. Prod., 52 (1987), Goto, T., p.114). It is known
that when flavone forms a complex with anthocyanin, the
absorption maximum of the anthocyanin shifts toward the
longer wavelength, i.e. toward blue.
The biosynthesis pathways for flavonoids have been
widely studied (Plant Cell, 7 (1995), Holton and Cornish,
p.1071), and the genes for all of the enzymes involved in
the biosynthesis of anthocyanidin 3-glucoside and
flavonol, for example, have been isolated. However, the
genes involved in the biosynthesis of flavones have not
yet been isolated. The enzymes that synthesize flavones
include those belonging to the dioxygenase family
(flavone synthase I) that depends on 2-oxoglutaric acid
and monooxygenase enzymes belonging to the cytochrome
P450 family (flavone synthase II). These groups of
enzymes are completely different enzymes with no
structural homology.
It has been reported that in parsley, 2-oxoglutaric
acid-dependent dioxygenase catalyzes a reaction which
produces apigenin, a flavone, from naringenin, a
flavanone (Z. Naturforsch., 36c (1981), Britsch et al.,
p.742; Arch. Biochem. Biophys., 282 (1990), Britsch,
p.152). The other type, flavone synthase II, is known to
exist in snapdragon (Z. Naturforsch., 36c (1981), Stotz
and Forkmann, p.737) and soybean (Z. Naturforsch., 42c
(1987), Kochs and Grisebach, p.343; Planta, 171 (1987),
Kochs et al., p.519). A correlation has been recently
CA 02324228 2000-09-28
- 3 -
reported between a gene locus and flavone synthase II
activity in the petals of gerbera (Phytochemistry, 49
(1998), Martens and Forkmann, p.1953). However, there
are no reports that the genes for these flavone synthases
I and II were isolated or that flavone synthase II was
highly purified.
The properties of a cytochrome P450 protein, which
had licodione-synthesizing activity that was induced when
cultured cells of licorice (Glycyrrhiza echinata) were
treated with an elicitor, were investigated. The protein
is believed to catalyze the hydroxylation of 2-position
of liquiritigenin which is a 5-deoxyflavanone, followed
by non-enzymatic hemiacetal ring opening to produce
licodione (Plant Physiol., 105 (1994), Otani et al.,
p.1427). For cloning of licodione synthase, a cDNA
library was prepared from elicitor-treated Glycyrrhiza
cultured cells, and 8 gene fragments encoding cytochrome
P450 were cloned (Plant Science, 126 (1997), Akashi et
al., p.39).
From these fragments there were obtained two
different full-length cDNA sequences, each encoding a
cytochrome P450, which had been unknown until that time.
Specifically, they were CYPGe-3 (cytochrome P450
No.CYP81E1) and CYPGe-5 (cytochrome P450 No.CYP93B1,
hereinafter indicated as CYP93B1) (Plant Physiol., 115
(1997), Akashi et al., p.1288). By further expressing
the CYP93B1 cDNA in a system using cultured insect cells,
the protein derived from the gene was shown to catalyze
the reaction synthesizing licodione from liquiritigenin,
a flavanone, and 2-hydroxynaringenin from naringenin,
also a flavanone.
2-Hydroxynaringenin was converted to apigenin, a
flavone, by acid treatment with 10~ hydrochloric acid
(room temperature, 2 hours). Also, eriodictyol was
converted to luteolin, a flavone, by reacting eriodictyol
with microsomes of CYP93B1-expressing yeast followed by
acid treatment. It was therefore demonstrated that the
CA 02324228 2000-09-28
- 4 -
cytochrome P450 gene encodes the function of flavanone 2-
hydroxylase activity (FEBS Lett., 431 (1998), Akashi et
al., p.287). Here, production of apigenin from
naringenin required.CYP93B1 as well as another unknown
enzyme, so that it was concluded that a total of two
enzymes were necessary.
However, no genes have yet been identified for
enzymes with activity of synthesizing flavones (such as
apigenin) directly from flavanones (such as naringenin)
without acid treatment. Thus, despite the fact that
flavones have numerous functions in plants, no techniques
have yet been reported for controlling their biosynthesis
in plants, and improving the biofunctions in which
flavones are involved, such as flower color. The
discovery of an enzyme which by itself can accomplish
synthesis of flavones from flavanones and acquisition of
its gene, and introduction of such a gene into plants,
would be more practical and industrially applicable than
the introduction into a plant of genes for two enzymes
involved in the synthesis of flavones from flavanones.
Disclosure of the Invention
It is an aim of the present invention to provide
flavone synthase genes, preferably flavone synthase II
genes, and more preferably genes for flavone synthases
with activity of synthesizing flavones directly from
flavanones. The obtained flavone synthase genes may be
introduced into plants and over-expressed to alter flower
colors.
Moreover, in the petals of flowers that naturally
contain large amounts of flavones, it is expected that
controlling expression of the flavone synthase genes by
an antisense method or a cosuppression method can also
alter flower colors. Also, expression of the flavone
synthase genes in the appropriate organs, in light of the
antibacterial activity of flavones and their interaction
with soil microorganisms, will result in an increase in
the antibacterial properties of plants and improvement in
CA 02324228 2000-09-28
- 5 -
the nitrogen fixing ability of legumes due to promoted
symbiosis with rhizosphere microorganisms, as well as a
protective effect against ultraviolet rays and light.
The present invention therefore provides genes
encoding proteins that can synthesize flavones directly
from flavanones. The genes are, specifically, genes
encoding flavone synthase II that can synthesize flavones
from flavanones by a single-enzyme reaction (hereinafter
referred to as "flavone synthase II").
More specifically, the present invention provides
genes encoding P450 proteins having the amino acid
sequences listed as SEQ.ID. No. 2 of the Sequence Listing
and possessing activity of synthesizing flavones from
flavanones, or genes encoding proteins having amino acid
sequences modified by additions or deletions of one or
more amino acids and/or a substitution with different
amino acids in said amino acid sequence, and possessing
activity of synthesizing flavones from flavanones.
The invention further provides a gene encoding
proteins having amino acid sequences with at least 55$
identity with the amino acid sequences listed as SEQ.ID.
No. 2 of the Sequence Listing and possessing activity of
synthesizing flavones from flavanones.
The invention still further provides genes encoding
proteins possessing activity of synthesizing flavones
from flavanones, and hybridizing with all or a part of
the nucleotide sequences listed as SEQ.ID. No. 1 of the
Sequence List under the conditions of 5 x SSC, 50°C.
The invention still further provides a vector,
particularly an expression vector, containing any one of
the aforementioned genes.
The invention still further provides a host
transformed with the aforementioned vector.
The invention still further provides a protein
encoded by any of the aforementioned genes.
The invention still further provides a process for
producing the aforementioned protein which is
CA 02324228 2000-09-28
- 6 -
characterized by culturing or growing the aforementioned
host, and collecting the protein with flavone-
synthesizing activity from the host.
The invention still further provides a plant into
which any one of the aforementioned genes has been
introduced, or progenies of the plant or a tissue
thereof, such as cut flowers, which exhibit the same
properties.
The invention still further provides a method of
altering amounts and compositions of flavonoid using the
aforementioned genes; a method of altering amounts of
flavones using the aforementioned genes; a method of
altering flower colors using the aforementioned genes; a
method of bluing the color of flowers using the
aforementioned genes; a method of reddening the color of
flowers using the aforementioned genes; a method of
modifying the photosensitivity of plants using the
aforementioned genes; and a method of controlling the
interaction between plants and microbes using the
aforementioned genes.
Embodiments for Carrying out the Invention
Flavanone 2-hydroxylase encoded by the Glycyrrhiza
CYP93B1 gene produces 2-hydroxyflavanones from flavanones
as the substrates, and the products are converted to
flavones by acid treatment. The present inventors viewed
that it would be possible to obtain a gene encoding a
flavone synthase II, which was an object of the
invention, by using the Glycyrrhiza-derived cDNA, CYP93B1
for screening of a cDNA library of, for example, a flower
containing a large amount of flavones, to thus obtain
cDNA encoding proteins with activity of synthesizing
flavones directly from flavanones as substrates.
According to the invention, a cDNA library of
perilla which contains a large amount of flavones is
screened using the Glycyrrhiza-derived cDNA, CYP93B1 as a
probe, to obtain cDNA encoding a novel cytochrome P450
(see Example 1).
CA 02324228 2000-09-28
The perilla-derived cDNA was expressed in yeast and
reacted with naringenin, a flavanone, as a substrate
which resulted in production not of 2-hydroxynaringenin
but rather of the flavone apigenin, without acid
treatment (see Example 2). In other words, this enzyme
directly produced flavones from flavanones without acid
treatment, and its gene was confirmed to be a flavone
synthase II which had never been cloned.
The genes of the present invention may be, for
example, one encoding the amino acid sequence listed as
SEQ.ID. No. 2 of the Sequence Listing. However, it is
known that proteins whose amino acid sequences are
modified by additions or deletions of multiple amino
acids and/or substitutions with different amino acids can
maintain the same enzyme activity as the original
protein. Consequently, proteins having the amino acid
sequence listed as SEQ.ID. No. 2 of the Sequence Listing
wherein the amino acid sequence is modified by additions
or deletions of one or more amino acids and/or
substitutions with different amino acids, and gene s
encoding those proteins, are also encompassed by the
present invention so long as they maintain the activity
of producing flavones directly from flavanones.
The present invention also relates to genes that
have the nucleotide sequence listed as SEQ.ID. No. 1 and
nucleotide sequence encoding the amino acid sequences
listed therein, or that hybridize with portions of the
nucleotide sequence under conditions of 5 x SSC, 50°C,
for example, providing they encode proteins possessing
activity of producing flavones from flavanones. The
suitable hybridization temperature will differ depending
on nucleotide sequences and the length of nucleotide
sequences, and for example, when the probe used is a DNA
fragment comprising 18 bases coding for 6 amino acids,
the temperature is preferably not higher than 50°C.
A gene selected by such hybridization may be a
naturally derived one, such as a plant-derived gene, for
CA 02324228 2000-09-28
_ g _
example, a gene derived from snapdragon, torenia or
perilla; it may also be a gene from another plant, such
as gentian, verbena, chrysanthemum, iris, or the like. A
gene selected by hybridization may be cDNA or genomic
DNA.
The invention also relates to genes encoding
proteins that have amino acid sequences with identity of
at least 55~, preferably at least 70~, such as 80~ or
greater and even 90~ or greater, with the amino acid
sequence listed as SEQ.ID. No. 2 of the Sequence Listing,
and that possess activity of synthesizing flavones from
flavanones.
A gene with the natural nucleotide sequence can be
obtained by screening of a cDNA library, for example, as
demonstrated in detail in the examples. DNA encoding
enzymes with modified amino acid sequences can be
synthesized using common site-directed mutagenesis or a
PCR method, using DNA with a natural nucleotide sequence
as a starting material. For example, a DNA fragment into
which a modification is to be introduced may be obtained
by restriction enzyme treatments of natural cDNA or
genomic DNA and then used as a template for site-directed
mutagenesis or PCR using a primer having the desired
mutation introduced therein, to obtain a DNA fragment
having the desired modification introduced therein.
Mutation-introduced DNA fragments may then be linked to a
DNA fragment encoding another portion of a target enzyme.
Alternatively, in order to obtain DNA encoding an
enzyme consisting of a shortened amino acid sequence, for
example, DNA encoding an amino acid sequence which is
longer than the aimed amino acid sequence, such as the
full length amino acid sequence, may be cut with desired
restriction endonucleases, and if the DNA fragment
obtained thereby does not encode the entire target amino
acid sequence, it may be linked with synthesized DNA
comprising the rest of the sequence.
Thus obtained genes may be expressed in an
CA 02324228 2000-09-28
_ 9 _
expression system using E. coli or yeast and its enzyme
activity measured to confirm that the obtained gene
encodes flavone synthase. By expressing the gene, it is
also possible to obtain the flavone synthase protein as
the gene product. Alternatively, it is also possible to
obtain a flavone synthase protein even using antibodies
for a full or a partial amino acid sequence listed as
SEQ.ID. No. 2, and such antibodies may be used for
cloning of a flavone synthase gene in another organism.
Consequently, the invention also relates to
recombinant vectors, and especially expression vectors,
containing the aforementioned genes, and to hosts
transformed by these vectors. The hosts used may be
prokaryotic or eukaryotic organisms. Examples of
prokaryotic organisms that may commonly be used as hosts
include bacteria belonging to the genus Escherichia, such
as Escherichia coli, and microorganisms belonging to the
genus Bacillus, such as Bacillus subtilis.
Examples of eukaryotic hosts that may be used
include lower eukaryotic organisms, for example,
eukaryotic microorganisms, for example, Eumycota such as
yeast and filamentous fungi. As yeast there may be
mentioned microorganisms belonging to the genus
Saccharomyces, such as Saccharomyces cerevisiae, and as
filamentous fungi there may be mentioned microorganisms
belonging to the genus Aspergillus, such as Aspergillus
oryzae and Aspergillus niger and microorganisms belonging
to the genus Penicillium. Animal cells and plant cells
may also be used, the animal cells being cell lines from
mice, hamsters, monkeys or humans. Insect cells, such as
silkworm cells, or the adult silkworms themselves, may
also be used.
The expression vectors of the invention will include
expression regulating regions such as a promoter and a
terminator, a replication origin, etc., depending on the
type of hosts into which they are to be introduced.
Examples of promoters for bacterial expression vectors
CA 02324228 2000-09-28
- 10 -
which may be used include conventional promoters such as
trc promoter, tac promoter, lac promoter, etc., examples
of yeast promoters that may be used include
glyceraldehyde-3-phosphate dehydrogenase promoter, PH05
promoter, etc., and examples of filamentous fungi
promoters that may be used include amylase promoter,
trpC, etc. Examples of animal cell host promoters that
may be used include viral promoters such as SV40 early
promoter, SV40 late promoter, etc.
The expression vector may be prepared according to a
conventional method using restriction endonucleases,
ligases and the like. The transformation of a host with
an expression vector may also be carried out according to
conventional methods.
The hosts transformed by the expression vector may
be cultured, cultivated or raised, and the target protein
may be recovered and purified from the cultured product,
etc. according to conventional methods such as
filtration, centrifugal separation, cell crushing, gel
filtration chromatography, ion-exchange chromatography
and the like.
The present specification throughout discusses
flavone synthase II derived from perilla that is capable
of synthesizing flavones directly from flavanones, and it
r 25 is also known that the cytochrome P450 genes constitute a
superfamily (DNA and Cell Biology, 12 (1993), Nelson et
al., p.l) and that cytochrome P450 proteins within the
same family have 40~ or greater identity in their amino
acid sequences while cytochrome P450 proteins within a
subfamily have 55~ or greater identity in their amino
acid sequences, and their genes hybridize to each other
(Pharmacogenetics, 6 (1996), Nelson et al., p.l).
For example, a gene for flavonoid 3',5'-hydroxylase,
which was a type of cytochrome P450 and participated in
the pathway of flavonoid synthesis, was first isolated
from petunia (Nature, 366 (1993), Holton et al., p.276),
and the petunia flavonoid 3',5'-hydroxylase gene was used
CA 02324228 2000-09-28
- 11 -
as a probe to easily isolate a flavonoid 3',5'-
hydroxylase gene from gentian (Plant Cell Physiol., 37
(1996), Tanaka et al., p.711), prairie-gentian,
bellflower (W093/18155 (1993), Kikuchi et al.), lavender,
torenia and verbena (Shokubutsu no Kagaku Chosetsu, 33
(1998), Tanaka et al., p.55).
Thus, a part or all of the flavone synthase II gene
of the invention derived from perilla, which is capable
of synthesizing flavones directly from flavanones, can be
used as a probe, in order to obtain flavone synthase II
genes capable of synthesizing flavones directly from
flavanones, from different species of plants.
Furthermore, by purifying the perilla-derived flavone
synthase II enzymes described in this specification which
can synthesize flavones directly from flavanones, and
obtaining antibodies against the enzymes by conventional
methods, it is possible to obtain different flavone
synthase II proteins that react with the antibodies, and
obtain genes coding for those proteins.
Consequently, the present invention is not limited
merely to perilla-derived genes for flavone synthases II
capable of synthesizing flavones directly from
flavanones, but further relates to flavone synthases II
derived from numerous other plants, which are capable of
synthesizing flavones directly from flavanones. The
sources for such flavone synthase II genes may be, in
addition to perilla described here, also gentian,
verbena, chrysanthemum, iris, commelina, centaurea,
salvia, nemophila and the like, although the scope of the
invention is not limited to these plants.
The invention still further relates to plants whose
colors are modified by introducing a gene or genes for
flavone synthases II that can synthesize flavones
directly from flavanones, and to progenies of the plants
or their tissues, which may also be in the form of cut
flowers. By using the flavone synthases II or their
genes which have been cloned according to the invention,
CA 02324228 2000-09-28
- 12 -
it is possible to produce flavones in plant species or
varieties that otherwise produce little or absolutely no
flavones. By expressing the flavone synthase II gene or
the genes in flower petals, it is possible to increase
the amount of flavones in the flower petals, thus
allowing the colors of the flowers to be modified toward
the blue, for example.
Conversely, by repressing synthesis of flavones in
flower petals, it is possible to madify the colors of the
flowers toward the red, for example. However, flavones
have myriad effects on flower colors, and the changes in
flower colors are therefore not limited to those
mentioned here. With the current level of technology, it
is possible to introduce a gene into a plant and express
the gene in a constitutive or tissue-specific manner,
while it is also possible to repress the expression of a
target gene by an antisense method or a cosuppression
method.
As examples of transformable plants there may be
mentioned rose, chrysanthemum, carnation, snapdragon,
cyclamen, orchid, prairie-gentian, freesia, gerbera,
gladiolus, baby's breath, kalanchoe, lily, pelargonium,
geranium, petunia, torenia, tulip, rice, barley, wheat,
rapeseed, potato, tomato, poplar, banana, eucalyptus,
r 25 sweet potato, soybean, alfalfa, lupin, corn, etc., but
there is no limitation to these.
Because flavones have various physiological _
activities as explained above, they can impart new
physiological activity or economic value to plants. For
example, by expressing the gene to produce flavones in
roots, it is possible to promote growth of microorganisms
that are beneficial for the plant, and thus promote
growth of the plant. It is also possible to synthesize
flavones that exhibit physiological activity in humans,
animals or insects.
CA 02324228 2000-09-28
- 13 -
Examples
The invention will now be explained in further
detail by way of the following examples. Unless
otherwise specified, the molecular biological methods
were carried out according to Molecular Cloning (Sambrook
et al., 1989).
Example 1. Cloning of perilla flavone synthase II
gene
RNA was extracted from leaves of red perilla
(Perilla frutescens), and polyA+ RNA was obtained by an
Oligotex. This polyA+ RNA was used as a template to
prepare a cDNA library using a ~.gt 10 (Stratagene) as the
vector according to the method of Gong et al. (Plant Mol.
Biol., 35 (1997), Gong et al., p. 915). The cDNA library
was screened using the full length CYP93B1 cDNA as the
probe. The screening and detection of positive clones
were carried out using a DIG-DNA-labeling and detection
kit (Boehringer) based on the method recommended by the
same company, under a low stringent condition.
Specifically, a hybridization buffer (5 x SSC, 30~
formamide, 50 mM sodium phosphate buffer (pH 7.0), l~
SDS, 2~ blocking reagent (Boehringer), 0.1~
lauroylsarcosine, 80 ug/ml salmon sperm DNA) was used for
prehybridization at 42°C for 2 hours, after which the
DIG-labeled probe was added and the mixture was kept
overnight. The membrane was rinsed in 5 x SSC washing
solution containing 1~ SDS at 65°C for 1.5 hours. One
positive clone was obtained, and it was designated as a
phase clone #3. Upon determining the nucleotide sequence
at the 5' end of #3 cDNA it was expected that #3 cDNA
encodes a sequence with high identity with the flavanone
2-hydroxylase encoded by licorice CYP93B1, and it was
assumed that it encoded a P450 with a function similar to
that of flavanone 2-hydroxylase.
The protein encoded by #3 cDNA obtained here
exhibited 52~ identity on the amino acid level with
flavanone 2-hydroxylase encoded by CYP93B1. The
CA 02324228 2000-09-28
- 14 -
nucleotide sequence of perilla clone #3 cDNA is listed as
SEQ.ID. No. l, and the amino acid sequence deduced
therefrom is listed as SEQ.ID. No.2.
Example 2. Expression of perilla flavone synthase II
gene in yeast
The following experiment was conducted in order to
detect the enzyme activity of the protein encoded by the
perilla cDNA #3 obtained in Example 1.
The phage clone #3 obtained in Example 1 was used as
a template for PCR using Lambda Arm primer (Stratagene).
The PCR conditions were 98°C for one minute, 20 cycles of
(98°C for 15 seconds, 55°C for 10 seconds, 74°C for
30 seconds), followed by 74°C for 10 minutes. The
amplified DNA fragment was subcloned at the EcoRV site of
pBluescript KS(-). A clone with the initiation codon of
the perilla #3 cDNA on the SalI side of pBluescript
KS (-) was selected, and was designated as pFS3. The
nucleotide sequence of the pFS3 cDNA was determined and
the PCR was conducted to confirm the absence of errors.
An approximately 1.8 kb DNA fragment obtained by
digesting pFS3 with SalI and XbaI was ligated with pYES2
predigested with XhoI and XbaI to produce a plasmid
designated as pYFS3. The resultant plasmid was then
introduced into BJ2168 yeast (Nihon Gene). The enzyme
activity was measured by the method described by Akashi
et al. (FEBS Lett., 431 (1998), Akashi et al., p.287).
The transformed yeast cells were cultured in 20 ml of
selective medium (6.7 mg/ml amino acid-free yeast
nitrogen base (Difco), 20 mg/ml glucose, 30 ~rg/ml
leucine, 20 ug/ml tryptophan and 5 mg/ml casamino acid),
at 30°C for 24 hours.
After harvesting the yeast cells with
centrifugation, the harvested yeast cells were cultured
at 30°C for 48 hours in an expressing medium (10 mg/ml
yeast extract, 10 mg/ml peptone, 2 ug/ml hemin, 20 mg/ml
galactose). After collecting the yeast cells, they were
washed by suspending in water and collecting them. Glass
CA 02324228 2000-09-28
- 15 -
beads were used for 10 minutes of disrupting the cells,
after which the cells were centrifuged at 8000 x g for 10
minutes. The supernatant was further centrifuged at
15,000 x g for 10 minutes to obtain a crude enzyme
fraction.
A mixture of 15 ug of (R,S)-naringenin (dissolved in
30 ul of 2-methoxyethanol), 1 ml of crude enzyme solution
and 1 mM NADPH (total reaction mixture volume: 1.05 ml)
was reacted at 30°C for 2 hours. After terminating the
reaction by addition of 30 ul of acetic acid, 1 ml of
ethyl acetate was added and mixed therewith. After
centrifugation, the ethyl acetate layer was dried with an
evaporator. The residue was dissolved in 100 ul of
methanol and analyzed by HPLC. The analysis was carried
out according to the method described by Akashi et al.
(FEES Lett., 431 (1998), Akashi et al., p. 287). The
acid treatment involved dissolution of the evaporator-
dried sample in 150 ul of ethanol containing 10~
hydrochloric acid, and stirring for 30 minutes. This was
diluted with 1.3 ml of water, 800 ul of ethyl acetate was
further added and mixed therewith, and after
centrifugation, the ethyl acetate layer was recovered.
This was then dried, dissolved in 200 ul of methanol, and
analyzed by HPLC.
The yeast expressing pYFS3 yielded apigPnin from
naringenin without acid treatment of the reaction
mixture. This demonstrated that perilla pFS3 cDNA _
encodes a protein with flavone synthase II activity.
Industrial Agplicabilitv
It is possible to alter flower colors by linking
cDNA of the invention to an appropriate plant expression
vector and introducing it into plants to express or
inhibit expression of flavone synthases. Furthermore, by
expressing the flavone synthase genes not only in petals
but also in entire plants or their appropriate organs, it
is possible to increase the resistance agasint
microorganisms of plants or to improve the nitrogen
CA 02324228 2000-09-28
- 16 -
fixing ability of legumes by promoting association with
rhizosphere microorganisms, as well as to improve the
protective effects of plants against ultraviolet rays and
light.
a
CA 02324228 2000-09-28
f/6
SEQUENCE LISTING
<110> SUNTORY LIMITED
<120> Gene coding for flavone synthesizing enzyme
<130>
<160> 2
<210> 1
<211> 1770
<212> DNA
<213> Perilla frutescens
<220>
<223> Nucleotide sequence encoding a protein having an
activity to directly convert flavanone to flavone
<400> 1
tgtcgacgga gcaagtggaa 53
atg
gca
ctg
tac
gcc
gcc
ctc
ttc
ctc
ctg
tcc
Met
Ala
Leu
Tyr
Ala
Ala
Leu
Phe
Leu
Leu
Ser
1 5 10
gccgcc gtggtccgc tccgttctg gatcgaaaa cgcgggcgg ccgccc 101
AlaAla ValValArg SerValLeu AspArgLys ArgGlyArg ProPro
15 20 25
taccct cccgggccg ttccctctt cccatcatc ggccactta cacctc 149
TyrPro ProGlyPro PheProLeu ProIleIle GlyHisLeu HisLeu
30 35 40
ctcggg ccgagactc caccaaacc ttccacgat ctgtcccaa cggtac 197
LeuGly ProArgLeu HisGlnThr PheHisAsp LeuSerGln ArgTyr
45 50 55
gggccc ttaatgcag ctccgcctc gggtccatc cgctgcgtc attget 245
GlyPro LeuMetGln LeuArgLeu GlySerIle ArgCysVal IleAla
60 65 70 75
CA 02324228 2000-09-28
2~6
gcc tcg ccggag ctcgccaag gaatgcctcaag acacac gagctcgtc 293
Ala Ser ProGlu LeuAlaLys GluCysLeuLys ThrHis GluLeuVal
80 85 90
ttc tcc tcccgc aaacactcc accgccattgat atcgtc acctacgat 341
Phe Ser SerArg LysHisSer ThrAlaIleAsp IleVal ThrTyrAsp
95 100 105
tca tcc ttcget ttctctccc tacgggccttac tggaaa ttcatcaag 389
Ser Ser PheAla PheSerPro TyrGlyProTyr TrpLys PheIleLys
110 115 120
aaa tta tgcacc tacgagctg ctcggggcccga aatctc gcccacttt 437
Lys Leu CysThr TyrGluLeu LeuGlyAlaArg AsnLeu AlaHisPhe
125 130 135
cag ccc atcagg actctcgaa gtcaagtctttc ctccaa attcttatg 485
Gln Pro IleArg ThrLeuGlu ValLysSerPhe LeuGln IleLeuMet
140 145 150 155
cgc aag ggtgaa tcgggggag agcttcaacgtg actgag gagctcgtg 533
Arg Lys GlyGlu SerGlyGlu SerPheAsnVal ThrGlu GluLeuVal
160 165 170
aag ctg acgagc aacgtcata tcgcatatgatg ctgagc atacggtgt 581
Lys Leu ThrSer AsnValIle SerHisMetMet LeuSer IleArgCys
175 leo 185
tca gag acggag tcggaggcg gaggcggcgagg acggtg attcgggag 629
Ser Glu ThrGlu SerGluAla GluAlaAlaArg ThrVal IleArgGlu
190 195 200
gtc acg cagata tttggggag ttcgacgtctcc gacatc atatggctt 677
Val Thr GlnIle PheGlyGlu PheAspValSer AspIle IleTrpLeu
205 210 215
tgt aag aacttc gatttccaa ggtataaggaag cggtcc gaggatatc 725
Cys Lys AsnPhe AspPheGln GlyIleArgLys ArgSer GluAspIle
220 225 230 235
cag agg aga tat gat get ctg ctg gag aag atc atc acc gac aga gag 773
Gln Arg Arg Tyr Asp Ala Leu Leu Glu Lys Ile Ile Thr Asp Arg Glu
240 245 250
aag cag agg cgg acc cac ggc ggc ggt ggc ggc ggc ggg gaa gcc aag 821
Lys Gln Arg Arg Thr His Gly Gly Gly Gly Gly Gly Gly Glu Ala Lys
255 260 265
CA 02324228 2000-09-28
3/ 6
gat ttt cttgacatg ttcctcgac ataatg gagagcggg aaagccgaa 869
Asp Phe LeuAspMet PheLeuAsp IleMet GluSerGly LysAlaGlu
270 275 280
gtt aaa ttcacgagg gagcatctc aaaget ttgattctg gatttcttc 917
Val Lys PheThrArg GluHisLeu LysAla LeuIleLeu AspPhePhe
285 290 295
acc gcc ggcaccgac acgacggcg atcgtg tgtgaatgg gcgatagca 965
Thr Ala GlyThrAsp ThrThrAla IleVal CysGluTrp A1aIleAla
300 305 310 315
gaa gtg atcaacaat ccaaatgtg ttgaag aaagetcaa gaagagatt 1013
Glu Val IleAsnAsn ProAsnVal LeuLys LysAlaGln GluGluIle
320 325 330
gcc aac atcgtcgga ttcgacaga attctg caagaatcc gacgcccca 1061
Ala Asn IleValGly PheAspArg IleLeu GlnGluSer AspAlaPro
335 340 345
aat ctg ccctacctt caagccctc atcaaa gaaacattc cggctccac 1109
Asn Leu ProTyrLeu GlnAlaLeu IleLys GluThrPhe ArgLeuHis
350 355 360
cct cca atcccaatg ctggcgagg aaatcg atctccgac tgcgtcatc 1157
Pro Pro IleProMet LeuAlaArg LysSer IleSerAsp CysValIle
365 370 375
gac ggc tacatgatt ccggccaac acgctg ctcttcgtc aacctctgg 1205
Asp Gly TyrMetIle ProAlaAsn ThrLeu LeuPheVal AsnLeuTrp
380 385 390 395
tcc atg gggcggaac cctaaaatc tgggac tacccgacg gcgttccag 1253
Ser Met GlyArgAsn ProLysIle TrpAsp TyrProThr AlaPheGln
400 405 410
ccg gag aggtttctg gagaaggaa aaggcc gccatcgat gttaaaggg 1301
Pro Glu ArgPheLeu GluLysGlu LysAla AlaIleAsp ValLysGly
415 420 425
cag cat ttt gag ctg cta ccg ttc gga acg ggc agg aga ggc tgc cca 1349
Gln His Phe Glu Leu Leu Pro Phe Gly Thr Gly Arg Arg Gly Cys Pro
430 435 440
ggg atg ctt tta gcc att cag gag gtg gtc atc ata att ggg acg atg 1397
Gly Met Leu Leu Ala Ile Gln Glu Val Val Ile Ile Ile Gly Thr Met
445 450 455
CA 02324228 2000-09-28
~ /6
att caa tgc ttc gat tgg ccc gac tcc ggc cat gtt gat 1445
aag ctg ggc
Ile Gln Cys Phe Asp Trp Pro Asp Ser Gly His Val Asp
Lys Leu Gly
460 465 470 475
atg gca gaa cgg cca ggg gca ccg gag acc gat ttg ttt 1493
ctc acg cga
Met Ala Glu Arg Pro Gly Ala Pro Glu Thr Asp Leu Phe
Leu Thr Arg
480 485 490
tgc cgt gtg gtg ccg cga ccg ttg gtt tcc acc cag 1538
gtt gat gtt
Cys Arg Val Val Pro Arg Pro Leu Val Ser Thr Gln
Val Asp Val
495 500 505
tgatcacccc ctttaaattt attaatgatatatttttattttgagaaaaa ataaaaatgc1598
taattgtttt gtttcatgat gtaattgttaattagtttctattgtgcgct gtcgcgtgtc1658
gcgtggctta agataagatt gtatcattggtacctaggatgtattttcat tttcaataaa1718
ttattttgtg ctgtgtatat taaaaaaaaaaaagaaaaaaaaaaaaaaaa as 1770
<210> 2
<211> SOIL
<212> PRT
<213> Perilla frutescens
<220>
<223> Amino acid sequence of a protein having an activity to
directly convert flavanone to flavone
<400> 2
Met Ala Leu Tyr Ala Ala Leu Phe Leu Leu Ser Ala Ala Val Val Arg
1 5 10 15
,,: Ser Val Leu Asp Arg Lys Arg Gly Arg Pro Pro Tyr Pro Pro Gly Pro
20 25 30
Phe Pro Leu Pro Ile Ile Gly His Leu His Leu Leu Gly Pro Arg Leu
35 40 45
His G1n Thr Phe His Asp Leu Ser Gln Arg Tyr Gly Pro Leu Met Gln
- 50 55 60
Leu Arg Leu Gly Ser Ile Arg Cys Val Ile Ala Ala Ser Pro Glu Leu
65 70 75 80
Ala Lys Glu Cys Leu Lys Thr His Glu Leu Val Phe Ser Ser Arg Lys
85 90 95
His Ser Thr Ala Ile Asp Ile Val Thr Tyr Asp Ser Ser Phe Ala Phe
100 105 110
CA 02324228 2000-09-28
/6
Ser Pro Tyr Gly Pro Tyr Trp Lys Phe Ile Lys Lys Leu Cys Thr Tyr
115 120 125
Glu Leu Leu Gly Ala Arg Asn Leu Ala His Phe Gln Pro Ile Arg Thr
130 135 140
Leu Glu Val Lys Ser Phe Leu Gln Ile Leu Met Arg Lys Gly Glu Ser
145 150 155 160
Gly Glu Ser Phe Asn Val Thr Glu Glu Leu Val Lys Leu Thr Ser Asn
165 170 175
Val Ile Ser His Met Met Leu Ser Ile Arg Cys Ser Glu Thr Glu Ser
1B0 185 190
Glu Ala Glu Ala Ala Arg Thr Val Ile Arg Glu Val Thr Gln Ile Phe
195 200 205
Gly Glu Phe Asp Val Ser Asp Ile Ile Trp Leu Cys Lys Asn Phe Asp
210 215 220
Phe Gln Gly Ile Arg Lys Arg Ser Glu Asp Ile Gln Arg Arg Tyr Asp
225 230 235 240
Ala Leu Leu Glu Lys Ile Ile Thr Asp Arg Glu Lys Gln Arg Arg Thr
245 250 255
His Gly Gly Gly Gly Gly Gly Gly Glu Ala Lys Asp Phe Leu Asp Met
260 265 270
Phe Leu Asp Ile Met Glu Ser Gly Lys Ala Glu Val Lys Phe Thr Arg
275 280 285
Glu His Leu Lys Ala Leu Ile Leu Asp Phe Phe Thr Ala Gly Thr Asp
290 295 300
Thr Thr Ala Ile Val Cys Glu Trp Ala Ile Ala Glu Val Ile Asn Asn
305 310 315 320
Pro Asn Val Leu Lys Lys Ala Gln Glu Glu Ile Ala Asn Ile Val Gly
325 330 335
Phe Asp Arg Ile Leu Gln Glu Ser Asp Ala Pro Asn Leu Pro Tyr Leu
340 345 350
Gln Ala Leu Ile Lys Glu Thr Phe Arg Leu His Pro Pro Ile Pro Met
355 360 365
Leu Ala Arg Lys Ser Ile Ser Asp Cys Val Ile Asp Gly Tyr Met Ile
370 375 380
Pro Ala Asn Thr Leu Leu Phe Val Asn Leu Trp Ser Met Gly Arg Asn
385 390 395 400
Pro Lys Ile Trp Asp Tyr Pro Thr Ala Phe Gln Pro Glu Arg Phe Leu
405 410 415
CA 02324228 2000-09-28
6/6
Glu Lys Glu Lys Ala Ala Ile Asp Val Lys Gly Gln His Phe Glu Leu
420 425 430
Leu Pro Phe Gly Thr Gly Arg Arg Gly Cys Pro Gly Met Leu Leu Ala
435 440 445
Ile Gln Glu Val Val Ile Ile Ile Gly Thr Met Ile Gln Cys Phe Asp
450 455 460
Trp Lys Leu Pro Asp Gly Ser Gly His Val Asp Met Ala Glu Arg Pro
465 470 475 480
Gly Leu Thr Ala Pro Arg Glu Thr Asp Leu Phe Cys Arg Val Val Pro
465 490 495
Arg Val Asp Pro Leu Val Val Ser Thr Gln
500 505
