Note: Descriptions are shown in the official language in which they were submitted.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
REFERENCE MATERIAL FOR NUCLEIC ACID AMPLIFICATION
This invention relates to a nucleic acid reference material
useful as a control in nucleic acid amplification reactions and for testing
nucleic acid amplification systems. The invention also relates to methods
of performing amplification reactions and methods of testing amplification
systems using the reference material as a control. The invention further
~o relates to kits containing the reference material.
Background
The polymerase chain reaction (PCR) was first described in
the mid 1980s (Saiki et a! 1985 and Saiki et al 1988). Since then, it has
~s developed into a highly versatile and widely used detection,
identification,
manipulation and analysis tool in the field of molecular biology. In brief,
two
short synthetic oligonucleotides or primers are used to define an
intervening DNA sequence which is then amplified in vitro using a
thermostable DNA polymerase, DNA precursors, suitable reaction buffer
2o and a thermal cycler. Correct amplification requires a specific interaction
of
the primers with their target sequence. The specificity of the reaction is
generally assessed by gel analysis or by hybridisation which determines
whether the size or internal sequence is consistent with correct
amplification.
2s However, such quality control procedures do not answer the
questions "What if a closely related sequence was in the sample with, for
instance, a single base difference at a given position within the priming
site? Would it amplify to give a false positive result?" Such questions
become more pertinent as unknown samples are analysed. Additionally,
~o as nucleic acid amplification techniques are applied to "environmental" or
mixed samples rather than clean and standardised laboratory test samples,
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-2-
a range of inhibitors and contaminants may affect both the ability of the
PCR to amplify a target under those conditions and the specificity of
interaction of the primer with any correct or incorrect targets leading to
false
negative or false positive results. Furthermore, differences in samples and
s variation in sample preparation can lead to differences in the amplification
conditions between individual reaction tubes. Other possible variations can
result from errors in pipetting, difference in reaction tube thickness, poor
calibration of the thermal cycler with respect to temperature and
temperature uniformity, quality of reagents, and other factors again leading
~o to false negative or false positive results.
An internal standard for monitoring PCR analysis for certain
food-borne pathogens has been developed (Lambertz et al 1998). The
internal standard is a DNA fragment flanked by the same primer recognition
sites as the primer sites in the target sequence. It is thus referred to as a
~s "mimic". However, while this mimic can help deal with the problem of false
negative PCR results, it is of no use in monitoring the specificity of the
PCR. Also, because the mimic competes with the intended target, it by
definition decreases the sensitivity of the assay. Elsewhere such mimics
have been used for quantification purposes using competitive PCR (Wang
2o et al 1989).
It is an aim of the invention to provide reagents and methods
for dealing with the problem of false negative and false positive results in
nucleic acid amplification reactions.
It is a further aim of the invention to provide means for
2s assessing specificity in nucleic acid amplification systems.
The Invention
In one aspect, the invention provides a nucleic acid reference
material comprising:
30 (i) a first reference sequence having a pair of primer binding
sites;
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-3-
(ii) a second reference sequence having a pair of primer binding sites;
wherein the primer binding sites of (ii) are as for (i) except for the
substitution of one or a few nucleotide bases.
In a particular, preferred embodiment the primer binding sites
of the first and second reference sequences flank a first and second
intervening sequence, respectively.
Preferably, the respective intervening sequences of the first
and second reference sequences are of different lengths. This means that
they can be separately identified on the basis of length, for example using a
~o size separation technique.
The primer binding sites of the first and second reference
sequences are preferably identical except for a single base substitution in
one of the primer binding sites. Thus, one priming site is conserved
between the two reference sequences and the other is variable.
~s The reference material may comprise one or more additional
reference sequences, each of which has a pair of primer binding sites
flanking an intervening sequence. Each of the second and additional
reference sequences has a number of base substitutions in the variable
primer binding site relative to the primer binding sites of the first
reference
2o sequence, and in each case the number of base substitutions is different.
Each of the reference sequences is distinguishable from the other
reference sequences, preferably on the basis of size.
In another aspect the invention provides a kit comprising:
(i) the reference material described herein; and
2s (ii) a pair of oligonucleotide primers complementary to the first
reference sequence primer binding sites. Thus, there will be one or more
base pair mismatches between the primers and the primer binding sites of
the second and any successive reference sequences present in the kit.
In still another aspect the invention provides a method for
o amplifying a nucleic acid target sequence which method comprises:
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-4-
(i) providing a pair of oligonucleotide primers complementary to
the target sequence to be amplified;
(ii) providing a reference nucleic acid sequence having a pair of
primer binding sites, which primer binding sites are complementary to the
s primers in (i) except for one or a few base pair mismatches in at least one
of the primer binding sites;
(iii) performing an amplification reaction on a sample containing
or suspected of containing the target nucleic acid sequence, using the
primers of (i) and in the presence of the reference nucleic acid of (ii); and
~o (iv) monitoring amplification of the target sequence and/or of the
reference nucleic acid sequence.
In a preferred embodiment, the primer binding sites of the
reference nucleic acid sequence flank an intervening sequence.
Preferably, the amplified target sequence and the reference
~s nucleic sequence are of different lengths. This means that they can be
separately identified on the basis of length, for example using a size
separation technique.
In a further aspect the invention provides a method for
monitoring a PCR system which method comprises performing an
2o amplification reaction on a nucleic acid reference material according to
the
invention, using the said PCR system and a pair of primers complementary
to the primer binding site of the first reference sequence, and determining
which of the reference sequences are amplified.
Thus, the invention is useful in, but not limited to, two
2s particular areas of application which are:
1. To ensure the correct performance of a user's amplification
systems.
2. To control for amplification specificity (a lack of which can
potentially lead to false positive results) and at the same time to control
for
~o amplification efficiency (a reduction in which leads to false negative or
weak results, for example as a result of inhibition of amplification).
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-5-
The invention described herein is concerned in particular with
a PCR reference material designed to be used in isolation in PCR systems
or simultaneously within PCR assays, to control for and allow the
measurement of PCR specificity and sensitivity.
s Thus, the reference sequences described herein provide a
control which may be employed either as an internal control for a PCR, or
as a stand alone control for monitoring a PCR system. Ln the context of an
internal control, the reference sequences can take one of two possible
forms. Firstly, they may be designed to be integral with an existing PCR for
~o which they are functioning as a control. In this case, they have primer
binding sites which are related to the primer binding sites in an existing
target sequence to be amplified, such that depending upon the reaction
conditions there may be amplification of one or more of the reference
sequences in addition to the amplification of the target sequence, if
~s present. Secondly, the reference sequences of an internal control system
may be entirely unrelated to the existing target sequence. In this case,
separate pairs of primers will be provided for amplification of the target
sequence and the reference sequences. It will be evident that in the first
example, it is not necessarily essential to include a reference sequence
2o having primer binding sites which are exactly complementary to the primer
sequences, but it will be advantageous to include such a reference
sequence to provide a direct control for false negatives. On the other hand,
in the second case it will be necessary to include a reference which has
primer binding sites exactly complementary to the amplifying primers, to
2s provide a reference point for assessing specificity of the reaction.
In a particular embodiment of the invention there is provided a
reference material which includes several e.g. three or four different
reference sequences. The first and second sequences preferably differ by
a single base substitution in one of the primer binding sites and each
3o successive additional reference sequence preferably has an additional
base substitution in the same primer binding site. This provides a set of
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-6-
reference sequences in which one primer binding site is conserved and
matches the primer, while the other primer binding site is variable with
sequences that are matched and progressively mismatched to the other
primer. A set of reference sequences of this kind can provide a control for
a range of mismatch amplifications, by demonstrating whether defined
mismatches are tolerated by the system in use. Conveniently, all of the
reference sequences have a different length so that their amplification
products can therefore be easily distinguished by using a size
determination technique.
o Suitable size determination techniques for analysing the
amplified products range from simple agarose or polyacrylamide gel
electrophoresis in the presence of a DNA stain such as ethidium bromide to
those using more specialised equipment such as capillary electrophoresis
and automated fluorescence DNA analysers such as those used in
~s automated DNA sequencing and genotyping as well as a range of
hybidisation and mass spectroscopy formats. However, currently preferred
are simpler techniques such as separation in a gel using gel
electrophoresis, in which the results are easily visualised without the
requirement for sophisticated equipment. For the purposes of size
2o separation on a gel, it is convenient to have amplification products which
can be separated to form a ladder in the gel which corresponds to a
standard marker ladder such as the 50 or 100 base pair ladders which are
available commercially. Thus, a desirable difference in length between the
reference sequences is 50 or a multiple of 50 nucleotides.
2s Advantageously, the reference sequences are also themselves 50 or a
multiple of 50 nucleotides in length. The precise length of the amplification
products of the reference sequences will depend upon the actual size of
the primers employed.
Sets of reference sequences are envisaged which include
so sequences ranging from 50 to 1000 nucleotides in length, more preferably
from 100 to 500 nucleotides in length. For example, a set of reference
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
_7_
sequences may include sequences of 100, 150, 200 and 250 nucleotides in
length.
The position of a base mismatch between a primer and its
primer binding site can have a significant effect both on the stability of
s hybridisation of the primer to its binding site and on the likelihood of
primer
extension and therefore needs to be taken into account when designing the
reference sequences. In general, a mismatch in the middle of the
primer/primer binding site has the greatest effect on the stability of the
interaction, while the primer extension reaction is most prevented by a
~o mismatch at the 3' end of the primer. In the context of the invention, the
preferred position for mismatches is between the centre and the 3' end of
the primer, most preferably within a few bases e.g. within half a dozen
bases of the 3' end of the primer. In a reference material which contains a
series of mismatches, the mismatches are preferably adjacent to one
~ s another.
For the mismatches to be in the desired position, the
reference sequences have their base substitutions located in the site at
which the primer binds, between the centre of that site and the innermost
end of that site, and preferably within a few bases of the innermost end of
2o the site. A distinction needs to be made here between possible primer
binding sites and actual primer binding sites. This is because it may be
desirable to retain flexibility as to the primers which can be used in
conjunction with a reference material according to the invention. Thus,
while for example 30 by of possible primer binding site may be provided at
2s each end of the reference sequences, it may be desirable to use primers
which are shorter than 30 nucleotides, e.g. 15 to 20 nucleotides in length.
The location of the base pair differences between the reference sequences
in the reference material can be chosen to enable the user to have a
degree of selection relating to the length (and thus annealing temperature)
30 of the primer and also the position of the mismatch of the primer to the
primer binding site. For example, rather than being close to the 5' or
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
_8_
innermost end of the available primer binding site, the location of the base
pair substitution or substitutions may be closer to the middle of the
available primer binding site.
Further factors which need to be taken into account when
designing suitable reference sequences are the stability of the
primer/primer binding site interaction which can be adjusted for example by
altering the GC content or distribution within the primer binding site or the
length of the primer/primer binding site, as well as by the use of nucleotide
analogues within the primer.
~o In the case of a reference sequence for use as an internal
control in a PCR, the hybridisation properties of the reference
sequence/reference sequence primers are preferably similar to or
compatible with the hybridisation properties of the target sequence/target
sequence primers. Where the same pair of primers is amplifying both the
~s target and the reference sequences, this is especially important. The
melting temperature (Tm) of a primer can be adjusted if necessary by
techniques known in the art, such as by altering its length, or by the use of
DNA nucleotide analogues which affect primer Tm. Such nucleotide
analogues include for example C5-propyne-dU and 2-amino-purine which
2o can be substituted for dT and dA residues giving bases which form 3 rather
than 2 hydrogen bonds and therefore make a higher than normal
contribution to Tm (Lebedev et al 1996 and Nguyen et al 1997).
It is also preferable that the reference materials according to
the invention which are not related to any existing target sequences are, as
2s far as possible, unrelated to known sequences. This reduces the chances
of cross-reactivity with other PCR assays and means that the reference
materials are of potentially universal use as internal reference standards.
Two or more reference sequences may be provided
according to the invention in a single molecule rather than as separate
ao molecules. The provision of the sequences together in this way, for
example in a plasmid or other self-replicating vector, has the advantage of
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
_g_
ensuring that equimolar quantities of the reference sequences are added to
the reaction. This minimises the potential for preferential target
amplification which can result from errors introduced by the pipetting of
multiple DNA targets.
s Further adaptations of the single molecule reference material
are envisaged, including:
1. The inclusion of unique restriction sites between each of the
reference sequences to allow for the removal or insertion of material.
2. The inclusion of an RNA transcription start site to enable the
~o generation of an RNA transcript prior to reverse transcription and
amplification. This will allow the specificity of reverse transcription to be
assessed in addition to amplification, for example in reverse transcription
PCR.
3. The inclusion of additional control sequences, for example a
~s control sequence containing one or more internal restriction sites to give
a
control for CAPS {cleavage of amplified products) analysis (Meyer et al
1995).
4. The inclusion of variable %GC content or high Tm domains
known to be resistant to amplification {McDowell et al 1998). For example,
2o these domains may be incorporated into intervening sequences of the
reference sequences to modify the reference material for use with PCR
targets whose amplification is either more favoured or less favoured than
normal due to the presence of such domains.
5. The inclusion of priming sites specified by users, to act as a
2s specific matched or mismatched control for a given assay or to serve as a
competitive standard for quantification purposes etc.
By including restriction sites as described in 1 above, the
insertion of other features such as those described under 2 to 5 either in
addition to or in replacement of one or more of the reference sequences,
so can be easily carried out by restriction digestion and ligation of new
sections into the molecule.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
- 10-
Monitoring amplification of the target sequence and/or of the
reference material can be effected in real time by techniques known to
those skilled in the art. Alternatively, amplification can be monitored by
determining the presence or absence of any amplification product of the
target sequence and of the reference material.
Where an amplification reaction is performed using the
invention, and the degree of specificity of the reaction is found to be
insufficient, the reaction parameters are modified in appropriate fashion
and the reaction may be repeated until a desired specificity is obtained.
~o This may involve altering assay reagents and/or their concentration,
temperature, timing, or it may involve making a more fundamental change
such as replacing a machine or an operator conducting the reaction. The
invention may also be used to assess for example the variability in or
between thermal cyclers, reagents and assay set-ups, and to evaluate new
Is equipment or reagents for use in amplification reactions.
Although the invention is described primarily with reference to
PCR, it can also be applied to a range of other amplification techniques
which involve specific oligonucleotide hybridisations to target sequences.
Examples include Ligase Chain Reaction (LCR) and the related Gapped
2o Ligase Chain Reaction (G-LCR), Strand Displacement Amplification (SDA),
Nucleic Acid Sequence Based Amplification (NASBA - trade mark owned
by Organon Teknika) and Self-sustained Sequence Replication (3SR).
In LCR, the counterpart to the pair of primers in PCR is a pair
of oligonucleotides which hybridise to a target, adjacent to one another on
2s the target. In the absence of mis-matches at the ends of the
oligonucleotides where they meet, the oligonucleotides are ligated by a
ligase enzyme and the resulting molecule itself serves as a template for
further amplification. G-LCR differs in that there is a short gap of usually 1
to 3 bases which separates the oligonucleotides when they hybridise to the
3o target. The hybridised oligonucleotides are extended by the action of a
DNA polymerase such that the extended products are then adjacent and a
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-11 -
substrate for the ligase enzyme. The oligonucleotides used in LCR are
often referred to as "probes" rather than primers, because they are not
involved in primer extension reactions. Nevertheless, the term "primer
binding site" as used herein is not intended to exclude LCR type reactions.
A suitable reference material according to the invention for
assessing tolerance of mismatches in an LCR system may be a reference
material which is itself amplified by LCR, or it may be amplified by
conventional PCR.
The utility of LCR for the detection of polymorphisms has
~o been demonstrated for the analysis of various genetic diseases, including
cystic fibrosis (Fang et al 1995) and sickle cell anaemia (Barany, 1991 ).
LCR has also been used for the detection of various infectious disease
agents, including human immunodeficiency virus (HIV; Laffler et al 1993),
Chlamydia (Laffler et al 1993) and multidrug resistant (MDR)
~s Mycobacterium tuberculosis (Winn-Deen et al 1993), and has been
exploited for the discrimination of Listeria monocytogenes from other
Listeria species (Wiedmann et al 1992). An LCR-based kit (Abbot Lex
MTB Assay) for the detection of common mutations in multidrug resistant
(MDR) Mycobacterium tuberculosis is currently available from Abbot
2o Laboratories, Chicago, III, USA. These or other LCR systems may benefit
from the use of a reference material according to the invention.
SDA is a target amplification method involving two pairs of
primers, an internal pair and an external pair, in a primer extension reaction
carried out at a fixed temperature (Walker et al 1992; Walker et al 1994).
2s SDA has predominantly been used for the detection of Mycobacterium
species. An SDA-based kit for the detection of mycobacterium is available
from Becton Dickinson Microbiology Systems (Sparks, Md. USA).
Reference materials according to the invention can be used with SDA.
NASBA and 3SR are transcription-based amplification
so methods employing reverse transcriptase and RNA polymerase enzymes.
Both techniques use a pair of oligonucleotide primers to amplify a target
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-12-
sequence of interest, which may be an RNA target or a double-stranded
DNA target. NASBA has been successfully applied to the detection of RNA
viruses e.g. HIV-1 (Kievits et al 1991 ) and microorganisms, including
Campylobacter (Uyttendaele et al 1994) and others. A NASBA-based
s assay for the detection of hepatitis C virus RNA is currently available in
kit
form, marketed by Organon Teknika (Boxtel, Netherlands). 3SR has also
been successfully applied to the detection of RNA viruses, in particular
HIV-1 (Bush et al 1992) and human papilloma virus (Brown et al 1990).
3SR has also been developed as an in situ amplification technique, and
~o has been applied for the in situ detection of the measles virus RNA (Hofler
et al 1995). Reference materials according to the invention can be used
with these methods.
It is envisaged that the present invention will be useful in any
of these methods, in particular where detection of target sequences in
~s medical or environmental samples is desired. As already discussed in
detail, the reference materials may be used independently to control for
errors in a particular system, or they may used as an internal control in an
amplification reaction to amplify a particular target sequence. In the latter
case, the reference material and the primers which amplify it may be
2o independent of the target sequences and target primers, or the reference
material may be designed as a "mimic" of the target sequence such that it
undergoes amplification in the presence of the target primers.
The invention will now be further described in the
examples which follow, with reference to the accompanying figures.
2s
EXAMPLES
Example 1 - Reference Material based on 16S rRNA Seauences
In a test system the 16S rRNA genes were targeted since
these are commonly used PCR targets within the scientific community.
~o Since these genes are conserved to some degree across all bacteria, there
is a chance that unintended but related targets in a sample could amplify
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
- 13-
depending upon the degree of relatedness between the genes/organisms.
Assumptions can be made using available sequence information as to
whether this is likely, based on whether the regions of the gene used as
priming sites are known to be highly or less highly conserved between
s particular species. However, the majority of environmental species are
unculturable and no sequence information is available for these. Because
of this, a measure of PCR specificity would be of use in order to ensure
confidence in correct amplification.
16S ribosomal RNA gene sequences were amplified from
~o stock Legionella strains using specially designed primers (RDNA3 and
RDNA4 as shown in figure 1 a), cloned, and the internal sequence
confirmed. Further amplification was then performed from a semi
conserved primer binding site differing by 1, 2 or 3 bases (3 bases in from
the 3' end) known as RDNA 2, to RDNA4 as indicated in figure 1 b.
~s Subsequent work involved the construction of a size mimic
containing the matched RDNA2 and RDNA3 primer sites using a non-
specific amplification from calf thymus DNA (Sigma) followed by selection
of a suitable clone of approx. 100 by which could be readily coamplified
and distinguished from the approx. 150 by products of the previous clones.
2o Duplex amplifications of the approx. 100 by and 150 by targets were
performed (results not shown).
This size mimic was later superseded and optimisation
problems overcome by generating a new series of 3 constructs each
containing a matched and a mismatched primer site. Three new and
2s truncated PCR products were generated from the 150 by RDNA2/RDNA3
Legionella pneumophila serogroup 1 target to give 100 by products with a
conserved RDNA3 site and a RDNA2 site which either matched that of the
150 by target or differed by 1 and 2 bases from it in the same way as
described above. Thus, three constructs were prepared in which the
RDNA2 priming site in the 100 by target:
1. matches the RDNA2 site in the 150 by product;
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-14-
2. differs by 1 base to the RDNA2 site in the 150 by product;
3. differs by 2 bases to the RDNA2 priming site in the 150 by
product.
The RDNA3 priming site was conserved throughout. The 3
s products were flanked by Hindlll sites allowing them to be cloned into the
Hindlll site of a clone of the 150 by target fom L, pneumophila SGI as
shown in figure 2. It is the performance of this series of 3 constructs which
is illustrated in figures 3 and 4. Amplification was performed using both
RDNA2 and RDNA3 primers. The 150 by product should normally be
~o produced subject to correct reaction set-up and absence of PCR inhibitors
etc. The 100 by target would be expected to be present or absent
depending on the degree of mismatch of the primer to the priming site
tolerated under the conditions used such as with different annealing
temperatures (see figures 3 and 4). The construct in which the RDNA2
~s priming site is conserved in both the 100 and 150 by target served as a
control for uniform amplification. In brief, raising the annealing temperature
resulted in a progressive improvement in the specificity or accuracy of
primer interaction with the matched and mismatched priming sites and
prevented the mismatched or incorrect targets being amplified.
Figure Legends for Example 1
Figure 1 shows sequences of the region of the
L. pneumophila serogroup 1 16S ribosomal RNA gene to which the original
RDNA3 and RDNA4 PCR primers were targeted. The internal sequence
2s varies according to the Legionella species with the sequences at the
RDNA2 site for selected species shown in b; and (b) sequences at the
RDNA2 site for different Legionella species. Only differences to the L.
pneumophila SG1 sequence are shown. The four cloned sequences used
for the work described are in bold.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-15-
Figure 2 shows a diagrammatic representation of the original
reference material from which the data contained in figures 3 and 4 was
obtained.
Figures 3 and 4 are schematic representations of two
s photographs of gels showing the separated amplification products. In
figure 3:
lanes 1, 2 = 0 by mismatch (control)
lanes 3, 4 = 1 by mismatch
lanes 5, 6 = 2 by mismatch
~o
In Figure 4:
lanes 1, 4 = 0 by mismatch (control)
lanes 2, 5 = 1 by mismatch
lanes 3, fi = 2 by mismatch
~s
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-16-
The different annealing temperatures used are indicated.
Under the conditions used mismatches were tolerated as follows:
Figure Annealing Mismatches
s Temp. tolerated
3A 40C 1 and 2
3B 50C 1 and 2
3C 60C 1 not 2
4A 55C 1 not 2
4B 60C 1 not 2
4C 65C 1 not 2
4D 70C neither 1 nor
2
Conditions
Amplification conditions utilised unless otherwise stated were
~s 50 mM KCI, lOmM Tris-HCI (pH 8.3 at 20°C), 1.5 mM MgCl2, 0.01%
gelatin, 0.2 mM each dNTP and 0.6 Units Taq polymerase. Optimisation of
reaction conditions for the reference plasmids described was performed
over a range of conditions but 10,000 to 100,000 copies of the reference
plasmid were used throughout. For amplification of targets from genomic
2o DNA prior to cloning and manipulation work, approx 1 microgram of DNA
was used. Bacterial strains were obtained from Public Health Laboratory
Service National Collection of Type Cultures.
The physical conditions for PCR were:
30 seconds at 94°C; 30 seconds at annealing temperature (variable); 30
2s seconds at 72°C; for 30 rounds of amplification. An additional hold
of 30
seconds at 94°C was included prior to cycling and a hold of 3 minutes
at
72°C after completion of cycling. Amplifications were performed in a
Perkin
Elmer 2400 thermal cycler.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-17-
Example 2 - Reference Material comprising four reference seQUences
of different lengths
A second system was designed to contain a number of DNA
targets, amplified in a multiplex reaction, potentially generating up to four
different sized PCR products depending upon the degree of mismatch (lack
of specificity) tolerated under the conditions used. Under sub-optimal
conditions where specificity is increasingly compromised additional
products will be generated, with the intensity and number of products giving
an indication of the level of specificity achieved as shown in Figure 5. ~
~o
Construction of the PCR Reference Material DNA Sequences
To establish a consistent set of DNA targets for the system,
clones were constructed by amplifying sequence regions of the pGEM luc
Basic 2 plasmid (Promega) using primers (construction primers) designed
~s to contain the first 20 nucleotides of the target sequence, adjacent to
which
are the size and diagnostic primer recognition sites (Table 1 a). The targets
were designed to have no significant homology with other known
sequences. These PCR fragments were ligated into the pCR II plasmid
according to the supplier's instructions (Invitrogen). The ligation mixes
2o were propagated in Escherichia coli DH5-a (Clontech). The resulting
clones were screened by PCR using both size and M13 primers to
determine the presence and size of the insert (Table 1 b). Standard stocks
of each target were prepared using Wizard Maxiprep kits and the
concentration of these targets determined by UV-absorption (260nm).
2s
Design of size and diagnostic primers
The length and %GC content of the size (mismatched) primer
and diagnostic (construct specific) primers developed for use with the
Reference Material system were designed to be the same (Table 2). This
~o made it more feasible to establish a generic set of conditions that were
applicable to the DNA targets of interest. Also, destabilising the size-
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-18-
specific primers, by introducing deliberate mismatches at or close to the 3'-
terminal nucleotide decreases specificity and reduces yield thus allowing
the degree of assay specificity to be ascertained. When introducing
additional mismatches into such a system, the position within the primer
s and the G/C content of the 5 or 6 bases preceding the 3'-terminal
nucleotide had to be considered. The closer to the 3'-terminus of the
primer that an additional primer extension mismatch is incorporated, the
greater is the inhibitory effect on primer extension. Therefore, the primers
designed to amplify a 100 by DNA target, one of which possessed 3
~o deliberate mismatches, would theoretically be highly destabilised in the
PCR reaction. The complementary primer for the system was also
designed to possess a GC content of 50% and to contain no repeat or
unusual sequences. An additional T7 promoter sequence was
incorporated to facilitate the production of an RNA version of the reference
~s material system. The diagnostic primers were designed to be specific to
each individual construct for quality control purposes. (Figure 6). ~
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-19-
Primer used in the generation of the matched primer and associated priming
regions.
(The construction primer is complementary to the luciferase gene target)
diagaoatic primer Size primer Construction primer
aatttaatacgactcacctat AGGGATTGTCGAAGTCTGAC CACTCGGATATTTGATATGT
Primers used in the generation of the mismatched primer and associated priming
regions
(The construction primer is complementary to the luciferase gene target)
250 by target
diagnostic Drimer Size primer Construction primer
gcctgtatcatgctgtctag TCTCTTCTGCGTGAATGCAC CTTTCGAAAGAGGTGCGCCC
200 by target
diagnostic primer Size primer 1 Construction primer
gtcgtcctaaggagtactgt TCTCTTCTGCGTGAATGCAG TCGTATTTGTCAATCAGAGT
150 by target
diagnostic Driraer Size primer 21 Construction primer
agaccgaagaaggtcgaagt TCTCTTCTGCGTGAATGCTG TACTAGCAACGCACTTTGAA
100 by target
diagnostic prim~r Size primer 321 Construction primer
gctagccgatngtcgactta TCTCTTCTGCGTGAATGGTG GCTCTTCTTCAAATCTATAC
Table la. Construction primers used to generate DNA targets. Diagnostic
primers are given in
bold lower case whilst the size primers are in italic upper case and the
construction primers in
underlined upper case.
The construction primers amplify regions of the luciferase gene (pGEM luc DNA
vector) between
bases 500 to 1000 to generated PCR products ranging from 100 by to 250 by in
length.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-20-
name Primer sequence 5'-3' Mimic enerated
~ (bp)
1 TCTCTT T GTGAAT GTGGCTC i TCTTC
8? It)t)
AAA T CTATACATTA.AGACG.ACTCG~,.=,.-",TCCa,l0U
CATATCAAATATCCGAGTGGTCAGACTTCG
ACAATCCCT
~'821~0 TCTCTTCTGCGTGAATGCTGTACTAGCAAC
GC.ACTTTGAATTTTGAATCCTGAAGGGATCG
TAAAAACAGCTCTTCTTCAAATCTATACATTA I~O
AGACGACTCGAAATCCACATATCAAATATCC
GAGTGGTCAGACTTCGACAATCCCT
1'82 200 TCTCTTCTGCGTGAATGCAGTACTAGCAAC
GC ACTTTGAATTTTGTAATCCTGAAGGGATC
GTAAAAACAGCTCTTCTTCAAATCTATACAT 200
TAAGACGACTCGAAATCCACATATCAAATA
TCCGAGTGGTCAGACTTCGACAATCCCT
Y82 250 TCTCTTCTGCGTGAATGCACCTTTCGAAAG
AGGTGCGCCCCCAGAAGCA,ATTTCGTGTAA.4
TTAGATAAATCGTATTTGTCAATCAGAGTGC
TTTTGGCGAAGAATGAAA.ATAGGGTTGGTAC 2~0
TAGCAACGCAC'rTI"GAATTTTGTAATCCTGA
AGGGATCGTAAAAACAGCTCTTCTTCA AATC
TATACATTAAGACGACTCGAAATCCACATAT
CAAATATCCGAGTGGTCAGACTTCGACAAT
CCCT
Size primer binding sites arc highlighted in bold.
Table lb. PCR products generated using the reference material DNA targets.
Name Primers (bp) %GC content
Y82 SC AGGGATTGTCGAAGTCTGAC 20 $0
Y82 SN TCTCTTCTGCGTGAATGCAC 20 50
1'82 S1M TCTCTTCTGCGTGAATGCA~ 20 SO
Y82 S2M TCTCTTCTGCGTGAATGCT~ 20 50
Y82 S3M TCTCTTCTGCGTGAATG~ 20 50
Y82 DC AATTTAATACGACTCACTAT 20 25
Y82 DN GCCTGTATCATGCTGTCTAG 20 SO
Y82 D GTCGTCCTAAGGAGTACTGT 20 SO
1M
Y82 D2M AGACCGAAGAAGGTCGAAGT 20 50
Y82 D3M GCTAGCCGATAGTCGACTTA 20 50
~Imm:ucHc~l
h;mx
an: underlined
and highlighted
in bold.
Table 2. Size and diagnostic primers designed for the Reference Material
system.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-21 -
Optimisation of the Reference Material system
The PCR conditions used in this Example were as described
in Example 1.
Several factors are known to affect the specificity of primers
used in this type of assay system. These factors, such as magnesium ion
concentration, primer concentration and annealing temperature can
significantly reduce specificity. Consequently, experiments were conducted
to ascertain the effect of these factors on the amplification of the Reference
Material DNA targets.
to
Magnesium ion concentration
All four of the reference material DNA targets were titrated in
the presence of MgCl2 ranging from 0.8 mM to 3.2 mM. Magnesium ion
concentration had no visible effect on the amplification of the DNA targets
~s in this example, as all target products generated possessed similar band
intensities over the range of MgCl2 employed.
Primer concentration
The DNA targets were amplified using primer concentrations
2o ranging from 0.5 ~.M to 6.0 ~.M. No significant differences were observed
in
the intensities of the target product bands generated. The concentration of
the primers employed therefore does not appear to have a significant effect
on the amplification of the DNA targets in this example.
2s Annealing temperature
All of the DNA targets were amplified at a range of annealing
temperatures. At an annealing temperature of 50°C all targets were
successfully amplified, showing that up to 2 mismatched bases were
tolerated under the conditions used, the 200 by and 250 by generating
~o stronger product signals than the other two shorter templates. Stronger
signals were generated at an annealing temperature of 55°C for the 150
CA 02325051 2000-10-03
WO 00!46401 PCT/GB00/00305
-22-
bp, 200 by and 250 by templates. The 100 by template generated fainter
signals than those of the larger templates at this annealing temperature. At
an annealing temperature of 60°C only the 200 by template was
successfully amplified in duplicate, the other templates generating fainter,
s product bands. The choice of annealing temperature therefore appears to
be an important consideration for successful amplification of the reference
material DNA targets.
Examale 3 - A Synthetic Multi-purpose Reference Material
o A synthetic reference material was constructed containing a
series of priming regions, intervening regions and unique restriction sites.
The sequence of this reference material is given in Figure 7. J
The numbers represent the number of bases in the motif.
The 6 base motifs are unique, 6 base recognition sequence,
restriction sites of which there are 5 within the sequence
R1 EcoRl R2 Kpnl
2o R3 BamHl R4 Pstl
R5 Hindlll
The 30 and 25 base motifs are conserved sequences within
which PCR primers can be selected of which there are 4 forward
2s sequences (F1-4) containing a mismatch region (underlined), and a single
conserved reverse sequence.
F1 TGCTATCTCTACTGCGTGAATGCACTCGTC - 100 by
F2 TGCTATCTCTACTGCGTGAATGCAGTCGTC - 150 by
F3 TGCTATCTCTACTGCGTGAATGCTGTCGTC - 200 by
30 F4 TGCTATCTCTACTGCGTGAATGGTGTCGTC - 250 by
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-23-
The reverse 25 base region is found downstream of each
forward region allowing PCR to amplify the intervening sequences (li, 12,
13, 14).
C CTCAGGTCAGACTTCGACAATCCCT
In summary, the reference material was designed to contain a
series of targets in which one priming region is conserved (C) and the other
contains a small number of base differences (1-3). Unique restriction sites
to were placed in the sequence so as to allow the targets to be removed or
replaced and to allow the insertion of additional pieces of DNA to spatially
separate the targets or to allow other modifications as required.
In the example illustrated below, the following structure was
derived from the above synthetic sequence following standard genetic
Is manipulation procedures. It is this structure which is referred to here on
as
the Reference Material or RM
6 30 45 25 6 2.2 kb 30 95 25 6 30 14525 6
EcoRl Fl ll C KpnlStuffersequenceF2 I2 C BamHl F3 13 C HindIll
The above structure was cloned in pUCl9 and linearised at
2o the BamH1 restriction site prior to use. This resulted in a linear molecule
containing three targets termed F1, F2 and F3 with nominal sizes of 100,
150 and 200 bases respectively in which the three targets were spatially
separated by approximately 2.2kb stuffer region and the pUCl9 vector
DNA.
2s The sequences of the three targets were:
>ri
5'TGCTATCTCTACTGCGTGAATGCACTCGTCATTCGGAGTATCCCGCGAACCGC
TCTTGGTGAGCGCACCGCAACACTCAGGTCAGACTTCGACAATCCCT 3'
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-24-
F2
5'TGCTATCTCTACTGCGTGAATGCAGTCGTCCCCTAATTTACGGTAGGAAAGGT
ATCGCGGTCCGCTAGCTCCCAACTGACGCACCATGTACTCCATAGCTATATCGGT
CCCACCTCGCGTCCTATCTCAGGTCAGACTTCGACAATCCCT 3'
F3
5'TGCTATCTCTACTGCGTGAATGCTGTCGTCGCTGTTTTGCAAATAGTTTTGAG
AAATCAGCCGGCCGCGTTCTGCGGGTCGACCGCATACTGGGGCATGTGATTTTCG
ACGTGGGTATGCATACCAAGCCAGTGACCAAGCTCCTTATGTTCATCTGCGGCTT
TCCTTGACCTTTCTCAGGTCAGACTTCGACAATCCCT 3'
For the purposes of the following work, a primer was
designed to the F3 sequence such that the F2 target contained a single
is mismatch in the F2 priming region and the F1 target contained two
mismatches in the F1 priming region. Only the F3 (200 bp) target would
therefore be expected to amplify under specific amplification conditions with
the F2 (150bp) and then the F1 (100bp) being amplified under progressively
less specific conditions.
Experimental conditions
The reference material was amplified under the following
conditions unless otherwise stated.
2s
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-25-
PCR reaction mix
dNTPs (1.25mM) 4.Opl
10x PCR Buffer
s (100mM Tris-HCL(pH 9.0),lSmM MgC12,500mMKCl) 2.5p.1
C-25 primer (20p,M) 1.Op.l
F3-18/F3-20 primer (20p.M) l.Op,l
Taq polymerase(5000 u/ml) 0.125u1
Target DNA as required
to Sterile distilled water to a final volume of 25p,1
The RM was linearised at the BamH1 restriction site and
added to a level of 1.75 x 10 6 copies / 2511 reaction. Amplifications were
performed on a Perkin Elmer 2400 thermal cycler using the following
Is thermal profile.
94C 4 mins 1 cycle
94C 30 secs 30 cycles
Specified30 secs
C 1 min
72C
72C 7 min 1 cycle
4C hold
The samples were analysed by electrophoresis on a 1.75% agarose gel
20 (containing 0.01 % ethidium bromide) at 175v for 30-,45 minutes. The
PCR products were visualised on a UV transilluminator and documented
using an Alpha imagerT"" 1220 system.
Results
2s The performance of the reference material was assessed
under a number of reaction conditions in order to inform its wider use as a
reference standard for specificity and sensitivity purposes.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-26-
1. Effect of annealing temp and primer length
Two different forward primers of different length (18 and 20
bases) were designed to the forward priming region F3 and designated
s F3-18 and F3-20 respectively. The priming regions of the reference
material were designed so that primers of different length and position
could be selected for use. The use of different primers was expected to
have an effect on the performance of the reference material. A single
primer was designed to be complementary to a sequence within the
~o conserved priming region and designated C-25.
The sequences of these primers were:
C-25 5' AGGGATTGTCGAAGTCTGACCTGAG 3' (25mer 52$ G/C)
F3-ZO 5' TCTACTGCGTGAATGCTGTC 3' (20mer 50 $ G/C)
P'3-t8 5' TACTGCGTGAATGCTGTC 3'(l8mer 50$ G/C)
The RM was amplified at a range of annealing temperatures
2o using the C-25 primer in combination with both the F3-18 and F3-20
primers.
With the F3-20 primer all three targets (F1, 100 bp; F2, 150
bp; and F3, 200 bp) were amplified at 55°C or below and demonstrated
that
up to 2 mismatches could be tolerated within this temperature range.
2s Between 56°C and 65°C only the 150 and 200 by products could
be seen
showing the limitation of mismatch tolerance to a single base. Above
65°C
the amplification was observed to be specific with only the 200bp product
seen.
When amplifications were performed using the Primer F3-18,
3o a higher level of specificity was observed and the 100 by target containing
two mismatches to the primer was not produced under the conditions used.
Production of the 150 by target containing a single mismatch was restricted
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-27-
to annealing temperatures of 61 °C and below and total specificity
observed
at 62°C and above.
The results obtained using the F3-18 and F3-20 primers at
different annealing temperatures are summarised below.
s
53 54 55 56 S7 58 S9 60 61 62 63 64 65 66 67 68
F3-20200200 200200 200 200200200 200200 200 200200 200200200
150150 1S0ISO 150 1S0150150 150150 150 150150
100100 100
F3-18200200 200200 200 200200200 200200 200 200200 200200
ISO150 150150 150 150150150 150
2. Effect of hot start PCR
Hot start PCR is often used as a way of ensuring or
increasing amplification specificity. It can be achieved in a number of ways
to including the use of the enzyme Taq GoIdT"" which is a thermal stable DNA
polymerase requiring heat activation. To determine the effect of hot start
PCR when using a hot start procedure, the Taq polymerase was
substituted with Taq GoIdT'". The effect of the Taq GoIdT"" enzyme was to
reduce the annealing temperature at which the 150bp non-specific product
is was produced from 65°C to 61 °C and the 100 by target from
55°C to 54°C
when using the F3-20 primer and the 150 by product from 61 °C to
56°C
when using the F3-18 primer. The results for both primers are summarised
below.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-28-
O
,nO
N
O
N
O
,nO
N
N
N
M
N
N
a ~ N N
a~
~
N O N
~O
N
H
G ~ N N
~ N O N
N ~ N
N
N 0
h
N v
1
O 0
O
N ~ 0
~
N N
~
et O O O
N
N
O O
r1 O
N N
O o_o
N
I
w w
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-29-
The reference material clearly demonstrated that the use of a
hot start procedure was to improve the specificity of the amplification as
would be expected. It is clear that under a given set of reaction conditions
where only the 200 by should have been amplified a compromise in
specificity, such as the use of Taq rather than Taq GoIdT"', would have
been clearly demonstrated by the production of an addition product of
150bp from the RM.
3. Effect of MgCl2 concentration.
The concentration of MgCl2 in a PCR reaction mix is often
adjusted when optimising amplification conditions to achieve specificity.
The RM was amplified under a range of MgCl2 concentrations from 1-4 mM
to determine the effect of this parameter on its specificity pertormance.
The temperature at which the non-specific 150 by product was amplified
is was up to and including 54, 62, 65, 65°C respectively when using the
F3-18
primer as summarised below. The results are summarised below. A
similar pattern was observed using the F3-20 primer with the non-specific
temperature points being higher and the 100 by product additionally
amplified (data not shown).
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-30-
0 0
0
N N N
O O O
N
N
N
,n O O O O O
O O
~
N N N
O O O O O O
N N
N N
N
L4
O h
0 O N ~ O h
N N .-
, y N
N N ~ N O
N
N
N N O N O N
OD
N N O N O
N
N
O O O O O O O
N N ~ O ~ O
N N
h
N N O O
N N
t0 O O
N N O W C
N N
W O $ O O
N
et ~ ~ O
N N N ~ N
M O O O
O ~ N O
N
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-31 -
4. Use of the RM as an internal reference standard.
It was the intention of the RM design that the RM could be
used as an internal control in other amplification reactions. In order to
prove this to be feasible, the RM was added to a reaction which a product
s of 584 by was specifically amplified from the bacterium E. coli. The
optimised parameters for this amplification are 3mM MgCl2 and an
annealing temperature of 62°C. High molecular weight DNA from E. coli
strain W3110 (Sigma D0421 ) was used as a target in combination with the
following primers to give a 584 by product.
~o
EC 1653 5' CGGTTCCCGAAGGCACATTC 3'
EC 1655 5' GAGTAAAGTTAATACCTTTGC 3'
The RM was added to the E. coli reaction mix and
~s amplification performed under a range of annealing temperatures and
MgCl2 concentrations using either the F3-18 or F3-20 primer set in
combination with the E.coli primer set. The results of these experiments
are summarised below.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-32-
O O O o
N N N
p p N O O
0 O ~ o ~
N O ~ ~ O
N 0 N o
0 0
h
O O O
N N ~ O
0~
o N ~
0
h
O O O N O
~ p ~ O ~ O
0 N N ~ ~ ,~ N
~
O
y ,. N o0 00
~
p
N oo ~n vy
i
M
~'"
N N o
O ~O~ ~O'~
~ dNC
O ~
N
N .-~ v1 v~
.
o N O O
~o~ ~o ~o~
son n ~ ~o ~o~
oo ~ ~ V~ ~
..~ n
v~ ~n ~n in v~
N O O O O O
C a0 O O O ~ O h O w
O
y "" oo oo N ~ ~
h ,n 00
y~
ar N
C N N N p O O
o O O O po N O
~~ ~ OO ~OV
0 ~ 1
h ,n N 0 ~ .-r
0 p
~ ~ ~
O O
~0~ ~O~ 0000 ~~ ~O ~ CO
~
v1~ apy n N ~O
~n p
v ~ n n ~ N
~
o N O O O O O O
0
O ~
O v ~ O ~ O h ~ ~ O ~ O
1 O O ~ ~
O
~
O O O
O v O ~ tt ~ ~ ~ O ~ O
O O ~ N
~1
O
O O O
N O N O N O
O O
o
~ O ~ et O ~' ~
O ~ O O
i ~
p
p N o 0 ~
p
-
v~ v ~ n v~
i
0
O O O O
~
~0
~p0~0 0 ~0~0 ~ ~O~ ~O~O ~O
'
W ~ n v ~
~!' N O N O o ~ N O N O
M O O O O O
O O
O
o o O ~ O t O N N ~ O O m
v1 ~ O ~ ~n ~n
O ~ O O
W N 0
~
0
v 7 ~
~ !1
" '~ N ~
~
N M c
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-33-
The results of the amplifications were as expected clearly
demonstrating that the RM could be used in combination with other targets
and primer sets. Since it would not normally be possible to check the
performance under a range of annealing temperatures and MgCl2
s concentrations in order to identify changes in expected performance, it
would be preferred that only the 200 by specific product would be produced
under the conditions of the assay and that the non-specific products would
be amplified if the performance criteria ensuring specificity were
compromised e.g. the annealing temperature achieved was lower than
~o intended as a result of incorrect thermal cycler calibration or poor block
temperature uniformity. It is envisaged that the matching of RM
performance to designed amplification criteria would be achieved by further
optimisation of parameters and adjusting primer annealing temperatures as
required by adjusting the length and/or using DNA analogues which have
is different contributions to melting temperatures than the standard DNA
bases. The use of the RM in such a manner would show whether the
correct amplification conditions had been met in each individual reaction
DISCUSSION
2o It has been demonstrated that the RM can be linearised and
amplified under a range of conditions leading to the production of a range
of targets according the level of specificity achieved in the amplification.
Specificity has been well documented in the scientific literature to be
affected by parameters such as annealing time, annealing temperature,
zs MgCl2 concentration and hot start PCR amongst others. The results
presented demonstrate that specificity can be assayed by the production of
a range of targets with closely related primer sites as found in the
Reference Material and that the RM performs in a predictable way in
response to variations in parameters well known to affect specificity. The
~o RM may be used in isolation to check for variations in specificity
resulting
from poor thermal cycler calibration and variations in temperature across
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-34-
the thermal cycler block as well as those introduced by the operator by
incorrect or inaccurate additions of reagents. Similar performance of the
RM has also been demonstrated in combination with other targets
indicating the suitability of the RM for use as an internal positive control
in
s independent amplifications.
The design of the reference material is such that the
amplification of the specific and non-specific targets can be identified by
size and by mass using DNA probes and a range of fluorescent reporter
molecules which can be monitored in real time.
~o
References
Barany, F. (1991) Genetic disease detection and DNA
amplification using clone thermostable ligase. Proc. Natl. Acad. Sci. (USA)
88:189-193.
~s Brown, J., Haydock, P. and Radany, E. (1990). Isothermal
enzymatic amplification of HPV RNA using the 3SR reaction. J. Cell Biol.
111, 293.
Bush, C. E., Donovan, R. M., Peterson, W. R., Jennings, M.
B., Bolton, V., Sherman, D. G., Vanden, B. K., Beninsig, L. A. and Godscy.
2o J. H. (1992). Detection of human immunodeficiency virus type 1 RNA in
plasma samples from high-risk pediatric patients by using the self-
sustained sequence replication reaction. J. Clin. Microbiol. 30, 281-286.
Fang. P., Bouma, S., Jou, C., Gordon, J. and Beaudet, A. L.
(1995). Simultaneous analysis of mutant and normal alleles for multiple
2s cystic fibrosis mutations by the ligase chain reaction. Hum. Mutat 6,
144-151.
Hofler, H., Putz, B., Mueller, J. D., Neubert, W., Suffer, G.
and Gais, P. {1995). In situ amplification of measles virus RNA by the self-
sustained sequence replication reaction. Lab. Invest. 73, 577-585.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00100305
-35-
Kievits, T., van Gemen, B., van Strijp, D., Schukkink, R.,
Dircks, M., Adriaanse, H., Maick, L., Sooknanan, R. and Lens, P. (1991).
NASBAT"" isothermal enzymatic in vitro nucleic acid amplification optimised
for the detection of HIV-1 infection. J. Virol. Meths. 35, 273-286.
s Laffler, T. G., Carrino, J. J. and Marshall, R. L. (1993). The
ligase chain reaction in DNA-based diagnostics. Ann. Biol. Clin. 50, 821-
826.
Lambertz, S.T., Ballagi-Pordany, A. and Lindqvist, R. (1998).
A mimic as internal standard to monitor PCR analysis of food-borne
~o pathogens. Letters in Applied Microbiol. 26: 9-11.
Lebedev, et al., (1996) Genetic Analysis - Biomolecular
Engineering 13: 15-21.
McDowell, D.G., Burns, N.A. and Parkes. (1998). Localised
sequence regions possessing high melting temperatures prevent the
~s amplification of a DNA mimic in competitive PCR. Nucleic Acids Research
26(14): 3340-3347.
Meyer, R., Hofelein, C., Luthy, J. and Candrian, U. (1995).
Polymerase chain reaction restriction fragment length polymorphism
analysis: A simple method for species identification in food. J. AOAC Int.
20 78{6):1542-1551.
Nguyen, H.K., Auffray, P., Asseline, U., Dupret, D. and
Thuong, N.T. {1997). Nucleic Acids Research 25: 3059-fi5.
Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi,
R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988). Primer-directed
2s enzymatic amplification of DNA with thermostable DNA polymerase.
Science 239: 487-491.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T.,
Erlich, H.A. and Arnheim, N. (1985). Enzymatic amplification of (3-globin
genomic sequences and restriction site analysis for diagnosis of sickle cell
so anemia. Science 230: 1350-1354.
CA 02325051 2000-10-03
WO 00/46401 PCT/GB00/00305
-36-
Uyttendaele, M., Schukkink, R., van Gemen, B. and
Debevere, J. (1994). Identification of Campylobacter coli and
Campylobacter lari by the nucleic acid amplification system NASBA~. J.
Appl. Bacteriol. 77, 694-701.
s Wang, A.M., Doyle, M.V.L. and Mark, D.F. (1989).
Quantification of mRNA by the polymerase chain reaction. Proc. Natl.
Acad. Sci. USA 86, 9717-9721.
Wiedmann, M., Czajka, J., Barany, F. and Batt, C. A. (1992).
Discrimination of Listeria monocytogenes from other Listeria species by
~o ligase chain reaction. Appl. Environ. Microbiol. 58 (11), 3443-3447.
Winn-Deen, E. S., Batt, C. A. and Wiedmann, M. (1993).
Non-radioactive detection of Mycobacterium tuberculosis LCR products in a
microtitre plate format. Mol. CeIL Probes 7, 179-186.
is
