Note: Descriptions are shown in the official language in which they were submitted.
CA 02326623 2000-09-29
WO 99/54465 PC'T/US99/08568
-1-
GENE ENCODING SYNTAXIN INTERACTING PROTEIN
BACKGROUND OF THE INVENTION
The present invention relates to novel genes and polypeptides derived
therefrom encoding a syntaxin interacting protein. The invention also
describes
vectors and host cells comprising the novel gene. The invention further
describes
methods for using the novel gene, polypeptides, and antibodies specifically
targeting the polypeptides, in the detection of genetic deletions of the gene,
subcellular localization of the polypeptide, isolation of discrete classes of
RNA,
gene therapy applications, diagnostics for syndromes involving abnormal levels
of
glucose or abnormal GLUT4 translocation, development of proprietary screening
strategies for inhibitors of syntaxin interacting protein.
SUMMARY OF THE RELATED ART
Insulin stimulation of glucose transport in the major insulin responsive cell
types, muscle, skeletal and fat, occurs by the recruitment of glucose
transporters,
in particular GLUT4, from the intracellular low density microsomal compartment
to the cell surface. A certain class of proteins have been implicated in the
insulin-
induced translocation of GLUT4 to the plasma membrane. This class of proteins
have been referred to as SNARE proteins.
SNARE proteins are vesicle membrane and target membrane soluble
N-ethylmaleidide-sensitive factor attachments protein receptors. SNARE
proteins
identified in the vesicle membrane, or v-SNARES, are synaptobrevin or VAMP.
SNARE proteins identified in the target membrane, or t-SNARES, are syntaxin
and SNAP-25.
Recent studies have demonstrated that isoforms of syntaxin, namely
syntaxin-4, and VAMP, namely VAMP2 and VAMP3/cellubrevin, are required
functional t-SNAREs and v-SNARES for the insulin-stimulated GLUT4
translocation to the plasma membrane. GLUT4 translocation plays an important
role in the uptake of glucose by cells, which in turn plays an important role
in
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-2-
disease states characterized by abnormal glucose uptake. By gaining an
understanding of the biochemical mechanisms behind these required v- and
t-SNAREs and their effect on insulin-stimulated GLUT4 translocation, new
opportunities for treating and diagnosing diseases related to abnormal (high
or
low) storage and/or utilization of glucose, may be achieved. Stated another
way, a
better understanding of the molecular mechanisms of glucose transport will
allow
improved design of therapeutic drugs that treat diseases related to abnormal
storage and/or utilization of glucose. Such disease states include diabetes,
glycogen storage diseases, obesity, polycystic ovarian syndrome, hypertension,
atherosclerosis and other diseases of insulin-resistance.
SUMMARY OF THE INVENTION
The invention relates to the discovery and purification of a novel target
membrane protein (SNARE) syntaxin-4 interacting protein ("SYNIP") and the
isolation of polynucleotide sequences encoding the proteins. SYNIPs are of
interest because they may play an important role in the translocation of GLUT4
from the intracellular compartment to the cell surface in response to the
presence
of insulin. 5YNIPs competitively bind to syntaxin-4 and prevent the ligand
from
interacting with its cognate intracellular receptor. This property of SYNIPs
has
profound physiological effects. Thus, by regulating the intracellular levels
of the
subject SYNIPs, desirable physiological effects may be obtained. Such effects
may be used to treat a variety of diseases involving abnormal levels of
glucose or
the abnormal translocation of GLUT4 (ie, disease states include, but are not
limited to diabetes, glycogen storage diseases, obesity, polycystic ovarian
syndrome, hypertension, atherosclerosis and other diseases of insulin-
resistance).
The rationale for Ehe therapeutic use of SYNIP to design or discover
treatment for these diseases is based upon the general disregulation of
glucose
transport in such states. Numerous studies have shown that the stimulation of
glucose transport by insulin is significantly reduced in Type II diabetes and
other
states of insulin resistance. Thus, pharmacological or genetic approaches to
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-3-
alleviating this deficiency will have a major impact on the diseases described
above.
One aspect of the invention is to provide purified SYNIPs. The purified
proteins may be obtained from either recombinant cells or naturally occurring
cells. The purified SYNIPs of the invention may be mammalian in origin.
Primate,
including human-derived SYNIPs are examples of the various SYNIPs
specifically provided for. The invention also provides allelic variants and
biologically active derivatives of naturally occurring SYNIPs.
Another aspect of the invention is to provide polynucleotides encoding the
SYNIPs of the invention and to provide polynucleotides complementary to
polynucleotide coding strand. The polynucleotides of the invention may be used
to
provide for the recombinant expression of SYNIPs. The polynucleotides of the
invention may also be used for genetic therapy purposes so as to treat
diseases
related to intracellular receptors that bind ligands that bind to SYNIPs, used
in the
1 S detection of genetic deletions of the polynucleotide, subcellular
localization of the
polypeptide, and isolation of discrete classes of RNA. The invention also
provides
polynucleotides for use as hybridization probes and amplification primers for
the
detection of naturally occurring polynucleotides encoding SYNIPs.
Another aspect of the invention is to provide antibodies capable of binding
to the SYNIPs of the invention. The antibodies may be polyclonal or
monoclonal.
The invention also provides methods of using the subject antibodies to detect
and
measure expression of SYNIPs either in vitro or in vivo, or for detecting
proteins
that interact with SYNIPs, or molecules that regulate any of the activities of
SYNIPs.
Another aspect of the invention is to provide assays for the detection or
screening of therapeutic compounds that interfere with the interaction between
SYNIPs and syntaxin-4 (or other ligands that bind to SYNIPs). The assays of
the
invention comprise the step of measuring the effect of a compound of interest
on
binding between SYNIPs and syntaxin-4 (or other Iigands that bind to SYNIPs).
Binding may be measured in a variety of ways, including the use of labeled
SYNIPs or labeled ligands.
Another aspect of the invention is to provide assays for the discovery of
proteins that interact directly or indirectly with SYNIPs. The assays of the
CA 02326623 2000-09-29
WO 99/54465 PCTIUS99/08568
-4-
invention comprise a method for detecting such interactions in cells, or in
biochemical assays. These interactions may be detected in a variety of ways,
including the use of the cDNA encoding SYNIPs, or SYNIPs themselves, or
fragments or modifications thereof.
The foregoing is not intended and should not be construed as limiting the
invention in any way. Unless defined otherwise, all technical and scientific
terms
used herein have the same meaning as is commonly understood by one of skill in
the art to which this invention belongs. All U.S. patents and all publications
mentioned herein are incorporated in their entirety by reference thereto.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Cloning, characterization of SYNIP expression and specificity of
binding. A) Deduced amino acid sequences of the single open reading frame in
the
isolated SYNIP cDNA. B) Predicted structural organization of SYNIP functional
domains. The numbers on the top indicate the amino acid residues that define
the
boundaries of these domains. C) Northern blot analysis of SYNIP mRNA
expression in mouse tissues. The mouse multiple tissue mRNA blot was probed
with the coding sequences of SYNIP cDNA. H, heart; Br, brain; Sp, spleen; Lu,
lung; Li, liver; Sk, skeletal muscle; K, kidney; Te, testis. D) Specificity of
SYNIP/WT and SYNIP/CT binding to Syntaxin 4. Cell lysates from 293T cells
overexpressing FIag-tagged wild type SYNIP (SYNIP/WT) or the carboxyl
terminal SYNIP (SYNIP/CT) were incubated with equal amounts of GST (lane 1 ),
GST-SynlA (lane 2), GST-SynlB (lane 3), GST-Syn2 (lane 4), GST-
Syn3 (lane 5) and GST-Syn4 (lane 6) proteins immobilized on Glutathion-agarose
beads. The retained proteins were immunoblotted with anti-Flag antibody. The
SYNIP and cDNA sequence have been deposited in GeneBank. Accession
number XXXXXX.
Figure 2. Insulin stimulation induces a dissociation of SYNTP from
syntaxin-4 in vivo. CHO/IK cells were transfected with the full-length SYNIP
(SYNIPIWT), the amino terminal SYNIP domain (SYNIP/NT) or the carboxyl
terminal SYNIP domain (SYNIP/CT) and stimulated with and without insulin.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-S-
A) Cell lysates were prepared and immunobloted with the Flag antibody. B) Cell
lysates were immunoprecipitated with a syntaxin-4 antibody and immunoblotted
with the Flag antibody. C) The immunoprecipitates in (B) were immunoblotted
with the syntaxin-4 antibody.
S Figure 3. Insulin stimulation results in a decreased affinity of SYNIP for
syntaxin-4. CHOIR cells were transfected with the full-length SYNIP
(SYNIP/WT'), the amino terminal SYNIP domain (SYNIP/NT) or the carboxyl
terminal SYNIP domain (SYNIP/CT) and stimulated with and without insulin.
A) Cell lysates were prepared and immunobloted with the Flag antibody. B) Cell
lysates were incubated with the GST-Syn4 fusion protein and the resultant
precipitates were immunoblotted with the Flag antibody. C) Cell lysates were
incubated with the GST-SYNIP fusion protein and the resultant precipitates
were
immunoblotted with the syntaxin-4 antibody. D) Cell lysates were incubated
with
various amounts of the GST-Syn4 fusion protein and the resultant precipitates
were immunoblotted with the Flag antibody.
Figure 4. Insulin induces dissociation of the SYNIPayntaxin-4 complex in
differentiated 3T3L1 adipocytes. Differentiated 3T3L1 adipocytes were
transfected with the full-length SYNIP (SYNIP/WT) or the carboxyl terminal
SYNIP domain (SYNIP/CT) and stimulated with and without insulin. A) Cell
lysates were prepared and immunobloted with the Flag antibody. B) The cell
lysates were then incubated with the GST-Syn4 fusion protein and the resultant
precipitates were immunoblotted with the Flag antibody.
Figure 5. Expression of a dominant-interfering mutant of SYNIP inhibits
insulin-stimulated glucose transport. A) Differentiated 3T3L1 adipocytes were
electroporated with various amounts of pcDNA3.1-Lac2 and
transfection/expression efficiency assessed by X-Gal staining for ~i-
galactosidase
expression. Under each electroporation condition the total amount of plasmid
DNA was 600 p.g maintained by the addition of the pcDNA3.1 empty vector.
B) Differentiated 3T3L1 adipocytes were electroporated with either empty
vector
or various SYNIP cDNA constructs and the rate of basal (open bars) and insulin-
stimulated (solid bars) 2-deoxyglucose transport was determined.
CA 02326623 2000-09-29
WO 99154465 PCT/US99/08568
-6-
Figure 6. Expression of a dominant-interfering mutant of SYNIP inhibits _
insulin-stimulated GLUT4 but not GLUT1 translocation. A) Differentiated
3T3L1 adipocytes were co-transfected with GLUT4-eGFP and various SYNIP
cDNAs. B) Differentiated 3T3Li adipocytes were co-transfected with eGFP-
GLUT1 and various SYNIP cDNAs. The subcellular localization of
GLUT4-eGFP and eGFP-GLUT 1 was determined in control and insulin-
stimulated cells by confocal fluorescence microscopy.
Figure 7. Hypothetical model for the insulin-dependent regulation of
SYNIP function and GLUT4 translocation.
DETAILED DESCRIPTION OF THE INVENTION
Within this application, unless otherwise stated, the techniques utilized
may be found in any of several well-known references such as: Molecular
Cloning: A Laboratory Manual (Sambrook et al., 1989, Cold Spring Harbor
Laboratory Press), Gene Expression Technology (Methods in Enzymology,
Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, CA), "Guide
to Protein Purification" in Methods in Enzymology (M.P. Deutshcer, ed., {
1990)
Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications
(Innis et al., 1990, Academic Press, San Diego, CA), Culture of Animal Cells:
A
Manual of Basic Technique, 2nd ed. (R.I. Freshney, 1987, Liss, Inc. New York,
NY), and Gene Transfer and Expression Protocols, pp. 109-128, ed. E.J. Murray,
The Humana Press Inc., Clifton, NJ).
In one aspect, the present invention provides novel isolated and purified
polynucleotides, hereinafter referred to as syntaxin-4 interacting ("SYNIP")
protein genes, encoding SYNIPs. The term "syntaxin-4" is used broadly herein.
Unless noted otherwise, the term "syntaxin-4" include, but is not limited to,
any
natural mammalian-derived form of syntaxin-4 and the like. It is preferred
that the
term syntaxin-4 include primates and humans. Also, the term "interacting" is
used
broadly herein. Unless noted otherwise, the term "interacting" includes, but
is not
linuted to, binding, affecting, and regulating.
c
CA 02326623 2000-09-29
WO 99154465 PCT/US99/08568
_'7_
The polynucleotides provided for may encode complete SYNIPs or
portions thereof. The polynucleotides of the invention may be produced by a
variety of methods including in vitro chemical synthesis using well-known
solid
phase synthesis technique, by cloning or combinations thereof. The
polynucleotide of the invention may be derived from cDNA or genomic libraries.
Persons of ordinary skill in the art are familiar with the degeneracy of the
genetic
code and may readily design polynucleotides that encode SYNIPs that have
either
partial or polynucleotide sequence homology to naturally occurring
polynucleotide sequences encoding SYNIPs. The polynucleotides of the invention
may be single stranded or double stranded. Polynucleotide complementary to
polynucleotides encoding SYNIPs are also provided.
Polynulceotide encoding a SYNIP can be obtained from cDNA libraries
prepared from tissue believed to possess SYNIP mRNA and to express it at a
detectable level. For example, cDNA library can be constructed by obtaining
polyadenylated mRNA from a cell line known to express SYNIP, and using the
mRNA as a template to synthesize double stranded cDNA.
Libraries, either cDNA or genomic, are screened with probes designed to
identify the gene of interest or the protein encoded by it. For cDNA
expression
libraries, suitable probes include monoclonal and polyclonal antibodies that
recognize and specifically bind to a SYNIP. For cDNA libraries, suitable
probes
include carefully selected oligonucleotide probes (usually of about 20-80
bases in
length) that encode known or suspected portions of a SYNIP from the same or
different species, and/or complementary or homologous cDNAs or fragments
thereof that encode the same or a similar gene, and/or homologous genomic
DNAs or fragments thereof. Screening the cDNA or genomic library with the
selected probe may be conducted using standard procedures as described in
Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory Manual,
New York, Cold Spring Harbor Laboratory Press, 1989).
A preferred method of practicing this invention is to use carefully selected
oligonucleotide sequences to screen cDNA libraries from various tissues. The
oligonucleotide sequences selected as probes should be sufficient in length
and
sufficiently unambiguous that false positives are minimized. The actual
nucleotide
sequences) is/are usually designed based on regions of a SYNIP that have the
CA 02326623 2000-09-29
WO 99/54465 PCT/US99108568
_g_
least codon redundance. The oligonucleotides may be degenerate at one or more
positions. The use of degenerate oligonucleotides is of particular importance
where a library is screened from a species in which preferential codon usage
is not
known.
The oligonucleotide must be labeled such that it can be detected upon
hybridization to DNA in the library being screened. The preferred method of
labeling is to use ATP (eg, T32P) and polynucleotide kinase to radiolabel the
S' end of the oligonucleotide. However, other methods may be used to label the
oligonucleotide, including, but not limited to, biotinylation or enzyme
labeling.
cDNAs encoding SYNIPs can also be identified and isolated by other
known techniques of recombinant DNA technology, such as by direct expression
cloning or by using the polymerase chain reaction (PCR) as described in
US Patent No. 4,683,195, in Section 14 of Sambrook et al., Molecular Cloning:
A
Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press,
New York, 1989, or in Chapter 15 of Current Protr~cols in Molecular Biology,
Ausubel et al., eds., Green Publishing Associates and Wiley-Interscience,
1991.
This method requires the use of oligonucleotide probes that will hybridize to
DNA
encoding a SYNIP.
In a preferred embodiment, the invention comprises DNA sequences
substantially similar to those shown in SEQ ID 1 or 6 (mouse SYNIP
polynucleotides) and SEQ ID 3 or 4 (human SYNIP polyneucleotides). As defined
herein, "substantially similar" includes identical sequences, as well as
deletions,
substitutions or additions to a DNA, RNA or protein sequence that maintain the
function of the protein product and possess similar zinc-binding motifs.
Preferably, the DNA sequences according to the invention consist essentially
of
the DNA sequence of SEQ ID 1, 3, 4, or 6. These novel purified and isolated
DNA sequences can be used to direct expression of SYNIP and for mutational
analysis of SYNIP function.
Mutated sequences according to the invention can be identified in a routine
manner by those skilled in the art using the teachings provided herein, and
techniques well-known in the art.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-9-
In a preferred embodiment, the present invention comprises a nucleotide
sequence that hybridizes to the nucleotide sequence shown in SEQ ID 1, 3, 4,
or 6
under high stringency hybridization conditions. As used herein, the term "high
stringency hybridization conditions" refers to hybridization at 65°C in
a low salt
hybridization buffer to the probe of interest at 2 x 108 cpm/p,g for between
about
8 hours to 24 hours, followed by washing in 1 % SDS, 20 mM phosphate buffer
and 1 mM EDTA at 65°C, for between about 30 minutes to 4 hours. In a
preferred
embodiment, the low salt hybridization buffer comprises between, 0.5-10% SDS,
and 0.05 M and 0.5 M sodium phosphate. In a most preferred embodiment, the
low salt hybridization buffer comprises, 7% SDS, and 0.125 M sodium phosphate.
The polynucleotides of the invention have a variety of uses, some of which
have been indicated or will be addressed in greater detail, infra. The
particular
uses for a given polynucleotide depend, in part, on the specific
polynucleotide
embodiment of interest. The polynucleotides of the invention may be used as
hybridization probes to recover SYNIP encoding polynucleotides or a portion
thereof from genetic libraries. The polynucleotides of the invention may also
be
used as primers for the amplification of SYNIP encoding polynucleotides or a
portion thereof through the polymerase chain reaction (PCR) and other similar
amplification procedures. The polynucleotides of the invention may also be
used
as probes and amplification primers to detect mutations in SYNIP encoding
polynucleotides or a portion thereof that have been correlated with diseases,
particularly diseases related to overexpression or underexpression of ligands
for
S YNIP.
The invention also provides a variety of polynucleotide expression vectors,
comprising SYNIP encoding polynucleotides or a portion thereof or a sequence
substantially similar to it subcloned into an extra-chromosomal vector. This
aspect
of the invention allows for in vitro expression of SYNIP encoding
polynucleotides, thus permitting an analysis of SYNIP encoding polynucleotides
regulation and SYNIP structure and function. As used herein, the term "extra-
chromosomal vector" includes, but is not limited to, plasmids, bacteriophages,
cosmids, retroviruses and artificial chromosomes. In a preferred embodiment,
the
extra-chromosomal vector comprises an expression vector that allows for SYNIP
c.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-10-
production when the recombinant DNA molecule is inserted into a host cell.
Such
vectors are well-known in the art and include, but are not limited to, those
with the
T3 or T7 polymerase promoters, the SV40 promoter, the CMV promoter; or any
promoter that either can direct gene expression, or that one wishes to test
for the
ability to direct gene expression.
In a preferred embodiment, the subject expression vectors comprise a
polynucleotide sequence encoding a SYNIP in functional combination with one or
more promoter sequences so as to provide for the expression of the SYNIP (or
an
anti-sense copy of the sequence suitable for inhibition of expression of an
endogenous gene). The vectors may comprise additional polynucleotide sequences
for gene expression, regulation, or the convenient manipulation of the vector,
such
additional sequences include terminators, enhancers, selective markers,
packaging
sites, and the like. Detailed description of polynucleotide expression vectors
and
their use can be found in, among other places Gene Expression Technology:
Methods in Enzymology, Volume 185, Goeddel, ed., Academic Press Inc.,
San Diego, CA (1991), Protein Expression in Animal Cells, Roth, ed., Academic
Press, San Diego, CA ( 1994).
The polynucleotide expression vectors of the invention have a variety of
uses. Such uses include the genetic engineering of host cells to express
SYNIPs.
In a further aspect, the present invention provides recombinant host cells
that are
stably transfected with a recombinant DNA molecule comprising SYNIP
encoding polynucleotides subcloned into an extra-chromosomal vector. The host
cells of the present invention may be of any type, including, but not linuted
to,
bacterial, yeast, and mammalian cells. Transfection of host cells with
recombinant
DNA molecules is well-known in the art (Sambrook et al., Molecular Cloning, A
Laboratory Manual, 2nd ed., Cold Spring Harbor Press, 1989) and, as used
herein,
includes, but is not limited to calcium phosphate transfection, dextran
sulfate
transfection, electroporation, lipofection and viral infection. This aspect of
the
invention allows for in vitro and in vivo expression of SYNIP and its gene
product, or a portion of SYNIP and its gene product, thus enabling high-level
expression of SYNIP or a portion thereof.
Other uses of the polynucleotide expression vectors, discussed in greater
detail, infra, include, their use for genetic therapy for diseases and
conditions in
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-1 I-
which it may be desirable use to express SYNIPs at levels greater than
naturally
occurring expression levels. Alternatively, it may be desirable to use the
subject
vectors for anti-sense expression to reduce the naturally occurring levels of
SYNIP.
In another aspect, the present invention provides a substantially purified
recombinant protein comprising a polypeptide substantially similar to the
SYNIP
shown in SEQ ID 2 or 5. Furthermore, this aspect of the invention enables the
use
of SYNIP in several in vitro assays described below. As used herein, the term
"substantially similar" includes deletions, substitutions and additions to the
sequences of SEQ ID 2 or 5 introduced by any in vitro means. As used herein,
the
term "substantially purified" means that the protein should be free from
detectable
contaminating protein, but the SYNIP may be co-purified with an interacting
protein, or as an oligomer. In a most preferred embodiment, the protein
sequence
according to the invention comprises an amino acid sequence of SEQ ID 2 or 5.
Mutated sequences according to the invention can be identified in a routine
manner by those skilled in the art using the teachings provided herein and
techniques well-known in the art. This aspect of the invention provides a
novel
purified protein that can be used for in vitro assays, and as a component of a
pharmaceutical composition for GLUT4 translocation modification, described
infra.
SYNIPs may be used to discover molecules that interfere with its
activities. For example, molecules that prevent the binding of SYNIP to
Syntaxin-4 in insulin responsive tissues, thus increasing glucose transport.
Additionally, SYNIPs may be used to find other proteins that can directly
interact
with it, representing additional important regulators of glucose transport.
The SYNIPs of the present invention have the biological activity of
binding to syntaxin-4. The SYNIP of the invention may be isolated from a
variety
of mammalian animal species. Preferred mammalian species for isolation are
primates and humans. The invention also contemplates allelic variants of
SYNIP.
SYNIPs may be prepared from a variety of mammalian tissues, however cell lines
established from insulin responsive tissues are preferred non-recombinant
sources
of SYNIPs. Preferably SYNIPs are obtained from recombinant host cells
genetically engineered to express significant quantities of SYNIPs. SYNIPs may
e.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-12-
be isolated from non-recombinant or recombinant cells in a variety of ways
well-
known to a person of ordinary skill in the art.
The term "SYNIP" as used herein refers not only to proteins having the
amino acid residue sequence of naturally occurring SYNIPs, but also refers to
functional derivatives and variants of naturally occurring SYNIP. A
"functional
derivative" of a native polypeptide is a compound having a qualitative
biological
activity in common with the native SYNIP. Thus, a functional derivative of a
native SYNIP is a compound that has a qualitative biological activity in
common
with a native SYNIP, eg, binding to syntaxin-4 and other cognate ligands.
. "Functional derivatives" include, but are not limited to, fragments of
native
polypeptides from any animal species (including human), and derivatives of
native (human and non-human) polypeptides and their fragments, provided that
they have a biological activity in common with a respective native
polypeptide.
"Fragments" comprise regions within the sequence of a mature native
polypeptide. The term "derivative" is used to define amino acid sequence and
glycosylation variants, and covalent modifications of a native polypeptide,
whereas the term "variant" refers to amino acid sequence and glycosylation
variants within this definition. Preferably, the functional derivatives are
polypeptides which have at least about 65% amino acid sequence identity, more
preferably about 75% amino acid sequence identity, even more preferably at
least
$5% amino acid sequence identity, most preferably at least about 95% amino
acid
sequence identity with the sequence of a corresponding native polypeptide.
Most
preferably, the functional derivatives of a native SYNIP retain or mimic the
region
or regions within the native polypeptide sequence that directly participate in
ligand binding. The phrase "functional derivative" specifically includes
peptides
and small organic molecules having a qualitative biological activity in common
with a native SYNIP.
"Identity" or "homology" with respect to a native polypeptide and its
functional derivative is defined herein as the percentage of amino acid
residues in
the candidate sequence that are identical with the residues of a corresponding
native polypeptide, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent homology, and not considering any
conservative substitutions as part of the sequence identity. Neither N- or
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-13-
C-terminal extensions nor insertions shall be construed as reducing identity
or
homology. Methods and computer programs for the alignment are well-known in
the art.
Amino acid sequence variants of native SYNIPs and SYNIP fragments are
prepared by methods known in the art by introducing appropriate nucleotide
changes into a native or variant SYNIP encoding DNA, or by in vitro synthesis
of
the desired polypeptide. There are two principal variables in the constnzction
of
amino acid sequence variants: the location of the mutation site and the nature
of
the mutation. With the exception of naturally-occurring alleles, which do not
require the manipulation of the DNA sequence encoding the SYNIP, the amino
acid sequence variants of SYNIP are preferably constructed by mutating the
DNA,
either to arrive at an allele or an amino acid sequence variant that does not
occur
in nature.
Alternatively or in addition, amino acid alterations can be made at sites
that differ in SYNIPs from various species, or in highly conserved regions,
depending on the goal to be achieved.
Sites at such locations will typically be modified in series, eg, by
( 1 ) substituting first with conservative choices and then with more radical
selections depending upon the results achieved, (2) deleting the target
residue or
residues, or (3) inserting residues of the same or different class adjacent to
the
located site, or combinations of options 1-3.
One helpful technique is called "alanine scanning," Cunningham and
Wells, Science, 1989;244:1081-1085. Here, a residue or group of target resides
is
identified and substituted by alanine or polyalanine. Those domains
demonstrating
functional sensitivity to the alanine substitutions are then refined by
introducing
further or other substituents at or for the sites of alanine substitution.
After identifying the desired mutation(s), the gene encoding a SYNIP
variant can, for example, be obtained by chemical synthesis.
More preferably, DNA encoding a SYNIP amino acid sequence variant is
prepared by site-directed mutagenesis of DNA that encodes an earlier prepared
variant or a nonvariant version of SYNIP. Site-directed (site-specific)
mutagenesis
allows the production of SYNIP variants through the use of specific
oligonucleotide sequences that encode the DNA sequence of the desired
mutation,
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-14-
as well as a suff cient number of adjacent nucleotides, to provide a primer
sequence of sufficient size and sequence complexity to form a stable duplex on
both sides of the deletion junction being traversed. Typically, a primer of
about
20 to 25 nucleotides in length is preferred, with about 5 to 10 residues on
both
sides of the junction of the sequence being altered. In general, the
techniques of
site-specific mutagenesis are well-known in the art, as exemplified by
publications
such as, Edelman et al., DNA, 1983;2:183. As will be appreciated, the site-
specific
mutagenesis technique typically employs a phage vector that exists in both a
single-stranded and double-stranded form. Typical vectors useful in site-
directed
mutagenesis include vectors such as the M 13 phage. This and other phage
vectors
are commercially available, and their use is well-known to those skilled in
the art.
A versatile and efficient procedure for the construction of
oligodeoxyribonucleotide directed site-specific mutations in DNA fragments
using M 13-derived vectors was published by Zoller M.J. and Smith M., Nucleic
Acids Res., 1982;10:6487-6500). Also, plasmid vectors that contain a
single-stranded phage origin of replication, Veira et al., Meth. Enzymol.,
1987;153:3, may be employed to obtain single-stranded DNA. Alternatively,
nucleotide substitutions are introduced by synthesizing the appropriate DNA
fragment in vitro, and amplifying it by PCR procedures known in the art.
In general, site-specific mutagenesis may be performed by first obtaining a
single-stranded vector that includes within its sequence a DNA sequence that
encodes the relevant protein. An oligonucleotide primer bearing the desired
mutated sequence is prepared, generally synthetically, for example, by the
method
of Crea et al., Proc. Natl. Acad. Sci., USA, 1978;75:5765. This primer is then
annealed with the single-stranded protein sequence-containing vector, and
subjected to DNA-polymerizing enzymes such as, E. coli polymerase I Klenow
fragment, to complete the synthesis of the mutation-bearing strand. Thus, a
heteroduplex is formed wherein one strand encodes the original non-mutated
sequence and the second strand bears the desires mutation. This heteroduplex
vector is then used to transform appropriate host cells such as HB 101 cells,
and
clones are selected that include recombinant vectors bearing the mutated
sequence
arrangement. Thereafter, the mutated region may be removed and placed in an
appropriate expression vector for protein production.
CA 02326623 2000-09-29
WO 99154465 PCT/US99/08568
-15-
The PCR technique may also be used in creating amino acid sequence
variants of a SYNIP. When small amounts of template DNA are used as starting
material in a PCR, primers that differ slightly in sequence from the
corresponding
region in a template DNA can be used to generate relatively large quantities
of a
specific DNA fragment that differs from the template sequence only at the
positions where the primers differ from the template. For introduction of a
mutation into a plasmid DNA, one of the primers is designed to overlap the
position of the mutation and to contain the mutation; the sequence of the
other
primer must be identical to a stretch of sequence of the opposite strand of
the
plasmid, but this sequence can be located anywhere along the plasmid DNA. It
is
preferred, however, that the sequence of the second primer is located within
200 nucleotides from that of the first, such that in the end the entire
amplified
region of DNA bounded by the primes can be easily sequenced. PCR
amplification using a primer pair like the one just described results in a
population
of DNA fragments that differ at the position of the mutation specified by the
primer, and possibly at other positions, as template copying is somewhat
error-prone.
Further details of the foregoing and similar mutagenesis techniques are
found in general textbooks, such as, for example, Sambrook et al., Molecular
Cloning: H Laboratory Manual, 2nd edition, Cold Spring Harbor Press,
Cold Spring Harbor ( 1989), and Current Protocols in Molecular Biology,
Ausubel
et al., eds., John Wiley and Sons ( 1995).
Naturally-occurnng amino acids are divided into groups based on common
side chain properties:
( 1 ) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophobic: cys, ser. tier;
(3) acidic: asp, glu;
(4) basic: asn, gin, his, lys, erg;
(S) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, pine.
Conservative substitutions involve exchanging a member within one group
for another member within the same group, whereas non-conservative
substitutions will entail exchanging a member of one of these classes for
another.
CA 02326623 2000-09-29
WO 99154465 PCTIU599/08568
-16-
Variants obtained by non-conservative substitutions are expected to result in
significant changes in the biological properties/function of the obtained
variant,
and may result in SYNIP variants which block SYNIP biological activities, ie,
ligand binding. Amino acid positions that are conserved among various species
are generally substituted in a relatively conservative manner if the goal is
to retain
biological function.
Amino acid sequence deletions generally range from about 1 to
30 residues, more preferably about I to 10 residues, and typically are
contiguous.
Deletions may be introduced into regions not directly involved in ligand
binding.
Amino acid insertions include amino- and/or carboxyl terminal fusions
ranging in length from one residue to polypeptides containing a hundred or
more
residues, as well as intrasequence insertions of single or multiple amino acid
residues. Intrasequence insertions (ie, insertions within the SYNIP amino acid
sequence} may range generally from about 1 to 10 residues, more preferably 1
to
5 residues, more preferably 1 to 3 residues. Examples of terminal insertions
include the SYNIPs with an N-terminal methionyl residue, an artifact of direct
expression in bacterial recombinant cell culture, and fusion of a heterologous
N-terminal signal sequence to the N-terminus of the SYNIP to facilitate the
secretion of the mature SYNIP from recombinant host cells. Such signal
sequences will generally be obtained from, and thus homologous to, the
intended
host cell species. Suitable sequences include STII or Ipp for E. coli, alpha
factor
for yeast, and viral signals such as herpes gD for mammalian cells. Other
insertional variants of the native SYNIP molecules include the fusion of the N-
or
C-terminus of an SYNIP to immunogenic polypeptides, eg, bacterial polypeptides
such as betalactamase or an enzyme encoded by the E. coli trp locus, or yeast
protein, and C-terminal fusions with proteins having a long half life such as
immunoglobulin regions (preferably immunoglobulin constant regions), albumin;
or ferritin, as described in PCT published application WO 89102922.
Since it is often difficult to predict in advance the characteristics of a
variant SYNIP, it will be appreciated that screening will be needed to select
the
optimum variant. For this purpose biochemical screening assays, such as those
described herein below, will be readily available.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99I08568
-17-
In a further aspect, the present invention provides antibodies and methods
for detecting antibodies that selectively bind polypeptides with an amino acid
sequence substantially similar to the amino acid sequence of SEQ 1D 2 or 5. As
discussed in greater detail, infra, the antibody of the present invention can
be a
polyclonal or a monoclonal antibody, prepared by using all or part of the
sequence
of SEQ ID 2 or 5, or modified portions thereof, to elicit an immune response
in a
host animal according to standard techniques (Harlow and Lane (1988), eds.,
Antibody: A Laboratory Manual, Cold Spring Harbor Press). In a preferred
embodiment, the entire polypeptide sequence of SEQ )D 2 is used to elicit the
production of polyclonal antibodies in a host animal.
The method of detecting SYNIP antibodies comprises contacting cells
with an antibody that recognizes SYNIP and incubating the cells in a manner
that
allows for detection of the SYNIPantibody complex. Standard conditions for
antibody detection of antigen can be used to accomplish this aspect of the
invention (Harlow and Lane, 1988). This aspect of the invention permits the
detection of SYNIP protein both in vitro and in vivo.
The subject invention provides methods for the treatment of a variety of
diseases characterized by undesirably abnormal levels of glucose or abnormal
GLUT4 translocation. Diseases may be treated through either in vivo or in
vitro
genetic therapy. Protocols for genetic therapy through the use of viral
vectors can
be found, among other places, in Viral Vector Gene Therapy and Neuroscience
Applications, Kaplit and Lowry, Academic Press, San Diego ( 1995). The genetic
therapy methods of the invention comprise the step of introducing a vector for
the
expression of SYNIP (ar inhibitory anti-sense RNA) into a patient cell. The
patient cell may be either in the patient, ie, in vivo genetic therapy, or
external to
the patient and subsequently reintroduced into the patient, ie, in vitro
genetic
therapy. Diseases that may be treated by the subject genetic therapy methods
include, but are not limited to diabetes, glycogen storage diseases, obesity,
polycystic ovarian syndrome, hypertension, atherosclerosis and other diseases
of
insulin-resistance.
In a preferred aspect of the invention, a method is provided for protecting
mammalian cells from abnormal levels of glucose or abnormal GLUT4
translocation, comprising introducing into mammalian cells an expression
vector
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-18-
comprising a DNA sequence substantially similar to the DNA sequence shown in
SEQ ID 1 or 4, that is operatively linked to a DNA sequence that promotes the
expression of the DNA sequence and incubating the cells under conditions
wherein the DNA sequence of SEQ ID 1 or 4 will be expressed at high levels in
the mammalian cells. Suitable expression vectors are as described above. In a
preferred embodiment, the coding region of the human SYNIP gene (SEQ ID 4) is
subcloned into an expression vector under the transcriptional control of the
cytomegalovirus (CMV) promoter to allow for constitutive SYNIP gene
expression.
In another preferred aspect of the present invention, a method is provided
for treating or preventing abnormal levels of glucose or abnormal GLUT4
translocation, comprising introducing into mammalian tumor cells an expression
vector comprising a DNA that is antisense to a sequence substantially similar
to
the DNA sequence shown in SEQ ID 1 or 4 that is operatively linked to a DNA
sequence that promotes the expression of the antisense DNA sequence. The cells
are then grown under conditions wherein the antisense DNA sequence of
SEQ ID 1 or 4 will be expressed at high levels in the mammalian cells.
In a most preferred embodiment, the DNA sequence consists essentially of
SEQ ID 1 or 4. In a further preferred embodiment, the expression vector
comprises an adenoviral vector wherein SYNIP cDNA is operatively linked in an
antisense orientation to a cytomegalovirus (CMV) promoter to allow for
constitutive expression of the SYNIP antisense cDNA in a host cell. In a
preferred
embodiment, the SYNIP adenoviral expression vector is introduced into
mammalian insulin-sensitive cells by injection into a mammal.
Another aspect of the invention is to provide assays useful for determining
if a compound of interest can bind to SYNIPs so as to interfere with the
binding of
syntaxin-4 (or other ligands) to the v- and t-SNAREs. The assay comprises the
steps of measuring the binding of a compound of interest to a SYNIP . Either
the
SYNIP or the compound of interest to be assayed may be labeled with a
detectable
label, eg, a radioactive or fluorescent label, so as to provide for the
detection of
complex formation between the compound of interest and the SYNIP. In another
embodiment of the subject assays, the assays involve measuring the
interference,
ie, competitive binding, of a compound of interest with the binding
interaction
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-19-
between a SYNIP and syntaxin-4 (or another ligand already known to bind to
SYNIP). For example, the effect of increasing quantities of a compound of
interest
on the formation of complexes between radioactivity labeled syntaxin-4 and an
SYNIP may be measured by quantifying the formation of labeled Iigand-SYNIP
complex formation.
Polyclonal antibodies to SYNIPs generally are raised in animals by
multiple subcutaneous (se) or intraperitoneal (ip) injections of a SYNIP and
an
adjuvant. It may be useful to conjugate the SYNIP or a fragment containing the
target amino acid sequence to a protein that is immunogenic in the species to
be
immunized, eg, keyhole limpet hemocyanin, serum albumin, bovine
thyroglobulin, or soybean trypsin inhibitor using a bifunctional or
derivatizing
agent, for example maleimidobenzoyl sulfosuccinimide ester (conjugation
through
cysteine residues), N-hydroxysuccinimide (through lysine resides),
glutaraldehyde, succinic anhydride, SOC12, or Rl-N=C=NR, where R and RI are
different alkyl groups.
Animals are immunized against the immunogenic conjugates or
derivatives by combing 1 mg or 1 fig of conjugate (for rabbits or mice,
respectively) with 3 volumes of Freund's complete adjuvant and injecting the
solution intradermally at multiple sites. One month later the animals are
boosted
with 1/5 to 1110 the original amount of conjugate in Freund's complete
adjuvant
by subcutaneous injection at multiple sites. Seven to 14 days later the
animals are
bled and the serum is assayed for anti-SYNIPs antibody titer. Animals are
boosted
until the titer plateaus. Preferably, the animal boosted with the conjugate of
the
same SYNIP, but conjugated to a different protein and/or through a different
cross-linking reagent. Conjugates also can be made in recombinant cell culture
as
protein fusions. Also, aggregating agents such a alum are used to enhance the
immune response.
Monoclonal antibodies are obtained from a population of substantially
homogeneous antibodies, ie, the individual antibodies comprising the
population
are identical except for possible naturally-occurring mutations that may be
present
in minor amounts. Thus, the modifier "monoclonal" indicates the character of
the
antibody as not being a mixture of discrete antibodies. For example, the
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-20-
anti-SYNIP monoclonal antibodies of the invention may be made using the
hybridoma method first described by Kohler & Milstein, Nature, 1975;256:495,
or
may be made by recombinant DNA methods [Cabilly et al, US Pat.
No. 4,816,567).
In the hybridoma method, a mouse or other appropriate host animal, such a
hamster is immunized as herein above described to elicit lymphocytes that
produce or are capable of producing antibodies that will specifically bind to
the
protein used for immunization. Alternatively, lymphocytes may be immunized
in vitro. Lymphocytes then are fused with myeloma cells using a suitable
fusing
agent, such as polyethylene glycol, to form a hybridoma cell [Coding,
Monoclonal
Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)].
The anti-SYNIP specific antibodies of the invention have a number of
uses. The antibodies may be used to purify SYNIPs from either recombinant or
non-recombinant cells. The subject antibodies may be used to detect and/or
quantify the presence of SYNIPs in tissue samples, eg, from blood, skin, and
the
like. Quantitation of SYNIPs may be used diagnostically for those diseases and
physiological or genetic conditions that have been correlated with particular
levels
of SYNIP expression levels.
In a further aspect, the present invention provides a diagnostic assay for
detecting cells containing SYNIP polynucleotide deletions, comprising
isolating
total genomic DNA from the cell and subjecting the genomic DNA to PCR
amplification using primers derived from the DNA sequence of SEQ ID 1 or 4.
This aspect of the invention enables the detection of SYNIP
polynucleotide deletions in any type of cell, and can be used in genetic
testing or
as a laboratory tool. The PCR primers can be chosen in any manner that allows
the
amplification of a SYNIP polynucleotide fragment large enough to be detected
by
gel electrophoresis. Detection can be by any method, including, but not
limited to
ethidium bromide staining of agarose or polyacrylamide gels, autoradiographic
detection of radio-labeled SYNIP gene fragments, Southern blot hybridization,
and DNA sequence analysis. In a preferred embodiment, detection is
accomplished by polyacrylamide gel electrophoresis, followed by DNA sequence
analysis to verify the identity of the deletions. PCR conditions are routinely
CA 02326623 2000-09-29
WO 99154465 PCT/US99/08568
-21-
determined based on the length and base-content of the primers selected
according
to techniques well-known in the art (Sambrook et al., 1989).
An additional aspect of the present invention provides a diagnostic assay
for detecting cells containing SYNIP polynucleotide deletions, comprising
isolating total cell RNA and subjecting the RNA to reverse transcription-PCR
amplification using primers derived from the DNA sequence of SEQ iD 1 or 4.
This aspect of the invention enables the detection of SYNIP deletions in any
type
of cell, and can be used in genetic testing or as a laboratory tool.
Reverse transcription is routinely accomplished via standards techniques
(Ausubel et al., in Current Protocols in Molecular Biology, ed. John Wiley and
Sons, Inc., 1994) and PCR is accomplished as described above.
In another aspect, the present invention provides methods of isolating
RNA containing stretches of polyA (adenine), polyC (cytosine) or polyU
(uridine)
residues, comprising contacting an RNA sample with SYNIP, incubating the
RNA-SYNIP mixture with an antibody that recognizes the SYNIP polypeptide,
isolating the antibody-SYNIP-RNA complexes, and purifying the RNA away
from the antibody-SYNIP complex. This aspect of the invention provides a novel
in vitro method for isolating a discrete class of RNA. In a preferred
embodiment,
the RNA sample is contacted with SYNIP in the presence (for preferential
isolation of polyA and polyC-containing RNAs}, or absence (for preferential
isolation of polyU-containing RNAs), of a reducing agent. Preferred reducing
agents for use in this aspect of the invention include, but are not limited to
DTT
and ~3-mercaptoethanol. The reducing agents are preferably used at a
concentration
of between about 50 nM and 1 M. Isolation of antibody-SYNIP-RNA complexes
can be accomplished via standard techniques in the art, including, but not
limited
to the use of Protein-A conjugated to agarose or cellulose beads.
The present invention may be better understood with reference to the
accompanying examples that are intended for purposes of illustration only and
should not be construed to limit the scope of the invention, as defined by the
claims appended hereto.
CA 02326623 2000-09-29
WO 99154465 PCTIUS99/08568
-22-
EXAMPLES
Example 1
Summary
Insulin-stimulated glucose transport and GLUT4 translocation require
specific interactions between the v-SNARE, VAMP2, and the t-SNARE,
syntaxin- 4. However, insulin does not directly effect these or any other
SNARE-
like molecules identified to date. As shown in the following example, a novel
syntaxin-4 binding protein, SYNIP, was isolated which specifically interacted
with syntaxin-4 and was only expressed in cells that displayed insulin-
responsive
glucose transport and GLUT4 translocation. Insulin induced a dissociation of
the
SYNIPayntaxin-4 complex due to a decreased binding affinity of SYNIP for
syntaxin-4. In contrast, the binding of the carboxyl terminal SYNIP domain was
refractive to insulin stimulation but inhibited glucose transport and GLUT4
translocation. These data identify SYN1P as the first insulin-regulated SNARE-
like protein directly involved in the regulation of glucose transport and
GLUT4
vesicle translocation.
Experimental Procedures
Materials
The Flag M2 monoclonal antibody was obtained from Kodak and the
syntaxin-4 sheep polyclonal antibody was isolated as previously described
(Olson A.L., Knight J.B., and Pessin J.E., "Syntaxin 4, VAMP2, and/or
VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors
for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol,
1997;17: 2425-2435). The ~3-galactosidase expression plasmid
{pcDNA3.l/his/LacZ) was purchased from Invitrogen. SuperSigal ULTRA
Enhanced Chemiluminescent (ECL) reagents, and the secondary anti-sheep and
anti-rabbit IgG-HRP were from Pierce. ECL western blotting reagents and
[a-32P]dCTP were purchased from Amersham Life Science. All restriction
enzymes, cell culture media, and reagents were from GIBCO BRL. All other
reagents were obtained from Sigma Chemical Co. unless specifically noted.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-23-
Isolation of SYNIP cDNA by yeast two-hybrid screening
The coding region of the cytoplasmic domain of syntaxin-4 (residue
2-274) was amplified by PCR from the plasmid carrying syntaxin-4 cDNA using
the primers 5'CGGGATCCTGCGCGACAGGACCCATG 3' and
5' GGTCGACCZ"1'ITl'CTTCCTCGC 3'. The PCR product was then subcloned
into BamHI-SaII site of the bait vector pGBT9 (Clontech), in frame with
GAL4 DNA-binding domain. To screen for syntaxin-4 binding proteins, yeast
strain Y190 was sequentially transformed with the bait DNA and then the yeast
two-hybrid cDNA library constructed from 3T3L1 adipocyte mRNA as previously
described (Printen J.A., Brady M.J., and Saltiel A.R., "PTG, a protein
phosphatase
1-binding protein with a role in glycogen metabolism." Science, 1997;275:1475-
1478). The transformation was plated onto synthetic media lacking tryptophan,
leucine and histidine and containing 25 mM 3-aminotriazole (Sigma) and
incubated at 30°C. Colonies which appeared after 5-7 days of incubation
were
analyzed for ~i-galactosidase activity by plating onto the media containing X-
Gal.
The prey cDNAs were recovered from the strongest hits and were subjected to
DNA sequencing. All sequences were analyzed by BLAST search, Protein tool
and COILS 2.2 programs.
Northern blot analysis
The 1.67 kb of the SYNIP cDNA coding sequences were radiolabeled with
[a-32P]dCTP using a random hexamer labelling kit, and the probe was purified
with a QIAquick Nucleotide Removal Kit (QIAGEN). The probe was hybridized
with a Northern blot containing 2 mg of purified poly A+ RNA isolated from
various mouse tissues in ExpressHyb hybridization solution (Clontech) for
16 hours at 65°C. The blot was then extensively washed followed
manufacturer's
recommendation and subjected to autoradiography.
Expression Constructs
The coding region of SYNIP cDNA was PCR amplified from a plasmid
containing 2.6 kb SYNIP cDNA with a pair of oligos:
5'GTACTGACCCGGGAATTCGAAAGCATGAGTGATGGTACAGC3' and
CA 02326623 2000-09-29
WO 99!54465 PCT/US99/08568
-24-
5'GTCGACGCGGCCGCTCGAGCTACTTGTCATCGTCGTCCTTGTA
GTCGCTTTTCGGGTCTGTTAGCTCTCTG3'. The 3' end of the primer
incorporated sequences encoding for a eight-amino acid flag epitope. The PCR
product was cloned into pCR2.1 vector (Invitrogen). To construct the SYNIP/WT
mammalian expression plasmid, the full length carboxyl terminal Flag-tagged
SYNIP was subcloned into EcoR l/Xho 1 sites of the pcDNA3 vector (Invitrogen}.
To construct SYNIP/NT (residue 1-301) deletion mutant, the insert was first
generated by PCR with primers 5'ACTGAATTCATGAGTGATGGTA
CTGCTTCTGC3' and 5'ATCCTCGAGCACTTCATCTGCTTCTAGAG 3' and
cloned into EcoR1/XhoI sites of a pcDNA3 vector containing a Flag tag
immediately downstream of XhoI site. The SYNIP/NT construct was obtained by
switching an internal EcoRI/XbaI fragment with the same fragment from the
SYNIP/WT plasmid so that it contained the wild type Kozak sequences. To
construct the SYNIP/CT mutant, the original two hybrid cDNA was subcloned
into EcoRI/SaII sites of pFlag-CMV2 vector (Kodak).
The GLUT4-eGFP fusion construct was prepared by subcloning the rat
GLUT4 cDNA into the pEGFP vector (Clontech) at the 5' BamHI and 3' HindIII
sites. The GLUT4 cDNA was put in frame with the EGFP cDNA by excising
the 200 by BgIII-AgeI fragment and replacing it with the BgIII/AgeI digested
PCR fragment generated by amplification of the rat GLUT4 cDNA using
primers 5'CTTCATCTTCACCTTCCTAA3' and 5'GGTGGCGACCGGTA
CGTCATTCTCATCTGG3'. The fusion protein is the contiguous sequence of
GLUT4 with 5 additional amino acids (Val-Pro-Val-Ala-Thr) connecting it to
EGFP. The resultant GLUT4-eGFP was subcloned into pcDNA3 vector using the
5' HindIII and 3' XbaI sites. The eGFP-GLUT 1 construct was prepared by
subcloning the rat GLUT! cDNA into the pEGFP-C3 plasmid (Clontech) using
S' XhoI and 3' EcoRI restriction sites. The resulting construct contains
9 additional amino acids between the EGFP and GLUT1 (Tyr-Ser-Asp-Leu-Glu-
Arg-Ser-Ala-Ala).
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-25-
Cell culture
Human embryo kidney 293T cells were obtained from the American Type
Culture Collection and maintained in Dulbecco's modified Eagle medium
(DMEM) containing 10% fetal bovine serum at 37°C in a 5% C02
atmosphere.
Chinese hamster ovary cells expressing the human insulin receptor (CHO/IR.)
were obtained as previously described (Waters S.B., Yamauchi K., and
Pessin J.E., "Insulin-stimulated disassociation of the SOS-Grb2 complex." Mol
Cell Biol, 1995;15:2791-2799.) These cells were maintained in minimal Eagle's
medium containing nucleotides plus 10% fetal bovine serum at 37°C in a
5%
C02 atmosphere. 3T3L 1 preadipocytes were obtained from the American Type
Tissue Culture repository and were cultured in DMEM containing 25 mM
glucose, 10% calf serum at 37°C in a 8% C02 atmosphere. Confluent
cultures
were induced to differentiate by incubation of the cells with DMEM containing
25 mM glucose, 10% fetal bovine serum, 1 mg/mL insulin, 1 mM dexamethasone,
and 0.5 mM isobutyl-I-methylxanthine. After 4 days, the medium was changed to
DMEM, 25 mM glucose, 10% fetal bovine serum and 1 mg/mL insulin for an
additional 4 days. The medium was then changed to DMEM containing 25 mM
glucose and 10% fetal bovine serum. Under these conditions greater than 95% of
the cell population morphologically differentiated into adipocytes. The
adipocytes
were maintained for an additional 4 to 8 days prior to use.
Purification of GST-fusion proteins
Cytoplasmic portions of syntaxin-lA (amino acids 4-264), syntaxin-1B
(amino acids 3-263), syntaxin-2 (amino acids I-265), syntaxin-3 (amino acids
1-262), and syntaxin-4 (amino acids 2-274) were subcloned into pGEX-4T-1
expression vector (Pharmacia). The GST-recombinant proteins were
overexpressed in BL21 (DE3) (Stratagene) and bacteria cells were lysed using
B-PER-Bacterial Protein Extraction Reagent (Pierce). The GST-fusion proteins
were then bound to 50% Glutathione-agarose beads, extensively washed and
stored for up to 2 weeks at 4°C.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-26-
GST fusion protein precipitation
Cell lysates from HEK293T, CHOIR or 3T3LI adipocytes were incubated
with either GST alone or with GST-fusion proteins immobilized on glutathione-
agarose beads for 1 hour at 4°C. The beads were washed extensively
three times
with 1 mL HNTG (50 mM HEPES, pH 7.4, 150 mM sodium chloride, 1 % Triton
X-100, 10% glycerol, and 1 mM EDTA) buffer and then two times with 1 mL
distilled water. The retained proteins were then eluted with 50 p,L 2X
Laemrnli
sample buffer, heated at 100°C for 5 minutes and separated by SDS-PAGE,
and
then immunoblotted with the Flag M2 monoclonal antibody or a sheep polyclonal
SYNIP antibody.
Immunoprecipitation and immunoblotting
Whole cell detergent extracts were prepared by detergent solubilization in
a NP-40 lysis buffer (25 mM Tris pH 7.4, 1 % NP-40, 10% glycerol, 50 mM
sodium fluoride, 10 mM sodium pyrophosphate, 137 mM NaCI, I mM Na3V04,
1 mM phenylmethylsulfonyl fluoride, 10 p,g/mL aprotinin, I pg/mL pepstatin,
5 ~,g/mL leupeptin) for 10 minutes at 4°C. Immunoprecipitations were
performed
by using 4.0 mg of the cell extracts incubated with 8 pg of a syntaxin-4
polyclonal
sheep antibody for 2 hours at 4°C. The syntaxin-4 antibody was prepared
in sheep
using a GST fusion protein expressing the cytoplasmic domain of syntaxin-4
(Olson A.L., Knight J.B., and Pessin J.E., "Syntaxin 4, VAMP2, and/or
VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors
for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol,
1997;17:2425-2435.} The samples were then incubated with protein A-Sepharose
for 2 hours at 4°C. The resulting immunoprecipitates were then
subjected to SDS-
polyacrylamide gel electrophoresis and western blotted using the syntaxin-4
polyclonal antibody and the Flag M2 monoclonal antibody.
Transfection of HEK293T cells, CHOIR cells and 3T3L1 adipocytes
HEK293T cells were transfected with a mammalian CaP04 transfection
kit (Stratagene). CHOIR cells were quantitatively transfected by
electroporation
as previously described (Yamauchi K., Ribon V., Saltiel A.R., and Pessin J.E.,
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-27-
"Identification of the major SHPTP2-binding protein that is tyrosine-
phosphorylated in response to insulin." J Biol Chem, 1995;270;17716-17722).
Briefly, these cells were mixed with a total of 40 ~,g of plasmid DNA and
electroporated at 340 V and 960 ~,F. Under these conditions greater than 95%
of
the surviving cell population express the cDNA of interest. Differentiated
3T3L1 adipocytes were electroporated using a modification of this protocol.
The
adipocytes were put into suspension by mild trypsinization and electroporated
with a total of 600 ~.g plasmid under low voltage conditions ( 160 V, 960 ~F).
The
cells were then allowed to adhere to collagen-coated tissue culture dishes for
30-48 hours and the adipocytes were then were serum starved for 2 hours prior
to
incubation in the absence or presence of 100 nM insulin for 15 minutes at
37°C.
Under these conditions, approximately 15% of the electroporated adipocytes
survived but of these cells there was greater than a 70%
transfection/expression
efficiency.
In situ [3-galactosidase staining
Differentiated 3T3L1 adipocytes were electroporated with various
amounts of plasmid DNA containing the LacZ gene (pcDNA3.I/his/LacZ) as
described above, washed with phosphate-buffered saline ( 137 mM NaCI, 2.7 mM
KCI, 8 mM Na2HP04, 2.6 mM KH2P04, pH 7.4) and fixed with 2%
formaldehyde, 0.2% glutaraldehyde in PBS, pH 7.4 for 10 minutes at room
temperature. The cells were then rinsed and incubated with 0.2% 5-bromo-
4-chloro-3-indolyl (3,D-galactoside reagent (X-Gal) in 10 mM Na2HP04, pH 7.4,
1 mM MgCl2, 150 mM NaCI, 3.3 mM K3Fe(CN)6, 3.3 mM K4Fe(CN) for
2 hours at 37°C. The cells were then stored under 70% glycerol and
photographed
at 100x magnification.
2-Deoxyglucose transport
The electroporated 3T3L1 adipocytes were placed in DMEM containing
25 mM glucose plus 0.5% bovine serum albumin for 2 hours at 37°C. The
cells
were then washed with KRPH buffer (5 mM Na2HP04~ 20 mM HEPES, pH 7.4,
CA 02326623 2000-09-29
WO 99/54465 PCTIUS99/08568
-28-
1 mM MgS04, 1 mM CaCl2, 136 mM NaCI, 4.7 mM KCI, and 1 % bovine serum
albumin) and either untreated or stimulated with 100 nM insulin for 15 minutes
at
37°C. Glucose transport was determined by incubation with 50 ~.M
2-deoxyglucose containing 0.5 mCi of [3H]2-deoxyglucose in the absence or
presence of 10 p,M cytochalasin B. The reaction was stopped after 10 minutes
by
washing the cells 3 times with ice cold PBS. The cells were then solubilized
in 1 %
Triton X-100 at 37°C for 30 minutes and aliquots were subjected to
scintillation
counting. Protein concentration was determined by the method of Bradford.
Confocal fluorescence microscopy
Differentiated 3T3L1 adipocytes were electroporated as described above
with 50 p,g of pcDNA3-GLUT4-eGFP and 200 pg of either pcDNA3, SYNIP/WT,
SYNIPINT, or SYNIP/CT. Forty-eight hours after electroporation, the cells were
serum starved in DMEM media for 3 hours and incubated with or without 100 nM
insulin for 30 minutes. Insulin was removed by two washes with ice cold PBS,
fixed with 2% paraformaldehyde (in PBS) for 15 minutes at room temperature,
and quenched with 100 mM glycine for 15 minutes at room temperature.
Fluorescent cells were visualized by scanning confocal microscopy at the
University of Iowa Microscope Facility.
Results
Identification of SYNIP, a multidomain Syntaxin-4 interacting protein
To isolate binding proteins) that might interact with and regulate the
function of syntaxin-4 in insulin-responsive tissues, a yeast two hybrid
3T3L1 adipocyte cDNA library fused to the GAL4 transcription activation domain
(Printen J.A., Brady M.J., and Saltiel A.R. "PTG, a protein phosphatase 1-
binding
protein with a role in glycogen metabolism." Science, 1997;275:1475-1478) with
the cytoplasmic portion of syntaxin-4 fused to the DNA binding domain of
GAL4 as bait (GAL4-Syn4) was screened. Among one million transformants
screened, 200 colonies grew on His-Trp-Leu- synthetic medium, of which 102
were positive for ~i-galactosidase activity when plated on X-GaI containing
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-29-
medium. Library-derived plasmids were recovered for DNA sequencing and focus
was given to one class of cDNAs that induced ~3-galactosidase activity only
when
coexpressed with GAL4-Syn4, but not with a fusion protein containing the
cytoplasmic domain of syntaxin-3. DNA sequences of the GAL4 fusion junctions
of the plasmid inserts encoded for different domains of protein fragments
overlapping at the carboxyl terminus. To obtain the upstream 5' end of the
cDNA,
5'-RACE was carried out and an additional 1.2 kb was cloned. The longest 2.6
kb
cDNA was obtained by ligating the original 1.4 kb two-hybrid clone with the
1.2 kb S'-RACE clone. The nucleotide sequence of the SYNIP gene is set forth
in
Figure 8. Sequence analysis revealed that this cDNA had a single open reading
frame which encoded for a 557 amino acid protein with predicted molecular
weight of 61 kDa (Fig. lA). This protein was designated SYNIP for syntaxin-4
interacting protein.
A search of the data bases revealed two mouse EST clones
(AA756269 and AA919678} spanning the translation start site of SYNIP. Protein
sequence analysis indicated that SYNIP has three specific protein-protein
interaction domains: a single PDZ domain at the amino terminus, a pair of
tandem
coiled-coil domains and a WW domain at the carboxyl terminus (Fig. 1B). In
addition, SYNIP contains a potential calcium binding EF-hand motif carboxyl
terminal to the predicted PDZ domain and amino terminal to the coiled-coil
domains. All these motifs are underlined in the primary amino acid sequences
in
Figure lA.
The tissue distribution of SYNIP mRNA was determined using a mouse
multiple tissue Northern blot hybridized with a radiolabeled probe containing
1.67 kb of the SYNIP coding sequence (Fig. 1C). A 7.5 kb transcript was
predominantly found in skeletal muscle and heart, with substantially lower
expression in testis. Two additional transcripts with smaller sizes were also
detected, but they did not display a similar restricted tissue distribution
pattern.
There were no specific SYNIP transcripts in brain, liver, spleen, lung, or
kidney
tissues. Furthermore, SYNIP mRNA was also detected in rat white and brown
adipocytes by Northern blotting (data not shown).
CA 02326623 2000-09-29
WO 99l544b5 PCT/US99/08568
-30-
To determine the specifccity of SYNIP binding, Flag epitope tag SYNIP
constructs were prepared for both full-length SYNIP (SYNIPIWT) and the
carboxyl terminal SYNIP domain (SYNIP1CT) encoding for the tandem coiled-
coil and WW domains. These constructs were then transfected into HEK293T
cells and incubated with either GST alone or GST fusion protein containing the
cytoplasmic domains of syntaxin-lA, syntaxin-1B, syntaxin-2, syntaxin-3, and
syntaxin-4. In vitro binding analysis demonstrated that both SYNIP/WT and
SYNIP/CT bound specifically to syntaxin-4 (Fig. 1 D, lane 6) but not to the
other
syntaxin proteins lA,,1B, 2, and 3 (Fig. ID, lanes 2-5). Thus, the specific
expression of SYNIP in tissues that are enriched in syntaxin-4 and that
exclusively
display insulin-sensitive glucose transport (muscle and fat), is consistent
with a
potential role for this protein as a physiologically relevant regulator of
GLUT4
translocation.
Insulin disrupts the interaction between SYNIP and syntaxin-4
Previous studies have demonstrated that VAMP2 functions as a
GLUT4 vesicle v-SNARE and that the interaction of VAMP2 with syntaxin-4 is
necessary for insulin-stimulated GLUT4 translocation to the plasma membrane
(Cain C.C., Trimble W.S., and Lienhard G.E., "Members of the VAMP family of
synaptic vesicle proteins are components of glucose transporter-containing
vesicles from rat adipocytes." J Biol Chem, 1992;267:11681-11684; Cheatham B.,
Volchuk A., Kahn C. R., Wang L., Rhodes C.J., and Klip A., "Insulin-stimulated
translocation of GLUT4 glucose transporters requires SNARE-complex proteins."
Proc Natl Acad Sci USA, 1996;93:15169-15173; Jagadish M.N., Fernandez C.S.,
Hewish D.R., Macaulay S.L., Gough K.H., Grusovin J., Verkuylen A.,
Cosgrove L., Alafaci A., Frenkel M.J., and Ward C.W., "Insulin-responsive
tissues contain the core complex protein SNAP-25 (synaptosomal-associated
protein 25) A and B isoforms in addition to syntaxin-4 and synaptobrevins 1
and 2." Biockem J,1996;3I7:945-954; Martin L.B., Shewan A., Millar C.A.,
Gould G.W., and James D.E., "Vesicle-associated membrane protein 2 plays a
specific role in the insulin-dependent trafficking of the facilitative glucose
transporter GLUT4 in 3T3-L 1 adipocytes." J Biol Chem, 1998;273:1444-1452;
Olson A.L., Knight J.B., and Pessin J.E., Syntaxin-4, VAMP2, and/or
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-31-
VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors
for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol,
1997:17:2425-2435; Tamori Y., Hashiramoto M., Araki S., Kamata Y.,
Takahashi M., Kozaki S., and Kasuga M., "Cleavage of vesicle-associated
membrane protein (VAMP)-2 and cellubrevin on GLUT4-containing vesicles
inhibits the translocation of GLUT4 in 3T3-L 1 adipocytes." Biochem Biophys
Res
Commun,1996;220:740-745; Volchuk A., Sargeant R., Sumitani S., Liu Z., He L.,
and Klip A., "Cellubrevin is a resident protein of insulin-sensitive GLUT4
glucose
transporter vesicles in 3T3-LI adipocytes." J Biol Chem, 1995;270:8233-8240).
To explore the potential regulation of the SYNIPayntaxin-4 interaction by
insulin,
the association of these two proteins was evaluated by co-immunoprecipitation
in
Chinese hamster ovary cells expressing the human insulin receptor (CHO/IR).
Cells were transfected with cDNAs encoding for the Flag epitope-tagged full-
length SYNIP (SYNIP/WT), the amino terminal SYNIP domain (SYNIP/NT), and
the carboxyl terminal SYNIP domain (SYNIP/CT). Immunoblotting of whole cell
detergent extracts demonstrated similar expression of SYNIP/WT and SYNIP/NT,
with a slightly greater expression of SYNIP/CT in this particular experiment
(Fig. 2A, lanes 1, 3, 5). Insulin stimulation had no significant effect on the
expression of these proteins (Fig. 2A, lanes 2, 4, 6). As expected,
immunoprecipitation of endogenous syntaxin-4 resulted in the
co-immunoprecipitation of SYNIP/WT (Fig. 2B, lane 1). However, following
insulin treatment there was a marked reduction in the amount of SYNIP/WT that
was co-immunoprecipitated with syntaxin-4 (Fig. 2B, lane 2). In contrast,
insulin
stimulation had no significant effect on the ability of syntaxin-4 to
co-immunoprecipitate the SYNIP/NT or SYNIP/CT proteins (Fig. 2B, lanes 3-6).
Interestingly, the interaction of SYNIP/NT with syntaxin 4 in vivo was
significantly less than that seen with either SYNIP/WT or SYNIP/CT (Fig. 2B),
suggesting that the carboxyl terminal region of SYNIP contains the major
syntaxin-4 binding domain. In any case, the amount of immunoprecipitated
syntaxin-4 can not account for these differences as it was essentially
identical
under all these conditions (Fig. 2C).
There are several possible mechanisms that could account for the insulin-
stimulated dissociation of SYNIP from syntaxin-4. Since there was no apparent
CA 02326623 2000-09-29
WO 99/54465 PCT/US99108568
-32-
change in SYNIP or syntaxin-4 expression, it seemed most likely that insulin
could induce a functional alteration in either SYNIP or syntaxin-4. To explore
these possibilities, the ability of GST-syntaxin-4 (GST-Syn4) and GST-SYNIP
(GST-SYNIP) fusion proteins to precipitate their corresponding binding partner
was examined (Fig. 3). As previously observed, transfection of CHOIR cells
with
the SYNIP/WT, SYNIP/NT and SYNIP/CT cDNAs resulted in similar levels of
protein expression (Fig. 3A). Incubation of cells with insulin produced a
marked
reduction in the amount of SYNIP/WT precipitated with GST-Syn4 in cell
extracts (Fig. 3B, lanes 1 and 2). However, there was no significant
difference in
the GST-Syn4 precipitation of either SYNIP/NT or SYNIP/CT in extracts derived
from insulin-stimulated cells (Fig. 3B, lanes 3-6). In contrast, incubation of
extracts from control and insulin-stimulated cells with GST-SYNIP resulted in
the
identical amount of syntaxin-4 precipitation (Fig. 3C, lanes 1-4).
To confirm that insulin reduced the binding affinity of SYNIP for
syntaxin-4, the binding as a function of GST-Syn4 concentration was examined
(Fig. 3D). Immunoblots of whole cell detergent extracts demonstrated equal
amounts of expressed SYNIP protein in the control and insulin-stimulated cell
extracts (Fig. 3D, lanes 1 and 2). Insulin stimulation resulted in a marked
reduction in the amount of SYNIP/WT that was precipitated with 10 and 20 pg of
GST-Syn4 compared to the control extracts (Fig. 3D, compare lanes 3 with 4 and
lanes 5 with 6). However, the difference between the control and insulin
stimulated cell extracts was diminished with increasing amounts of GST-
Syn4 (40 p.g), and no significant difference was observed at 80 mg (Fig. 3D,
compare lanes 7 with 8 and lanes 9 with 10). The saturation of SYNIP/WT
binding was also specific at these concentrations of GST-Syn4 as there was no
detectable precipitation of SYNIP/WT by GST alone (data not shown). Thus,
these data demonstrate that insulin stimulation results in a specific
modification of
SYNIP that reduces its ability to associate with syntaxin-4. Furthermore, the
decreased binding between SYNIP and syntaxin-4 results from a change in
SYNIP binding affinity with no significant alteration in the number of SYNIP
or
syntaxin-4 binding sites.
CA 02326623 2000-09-29
WO 99/54465 PCTIUS99108568
-33-
Insulin regulates the interaction of SYNiP with syntaxin-4 in
3T3L1 Adipocytes
In contrast to CHOIR cells, 3T3L1 adipocytes respond to insulin with
respect to glucose transport and GLUT4 translocation. It was therefore
determined
whether the interaction between SYNIP and syntaxin-4 was also sensitive to
insulin in these cells. Differentiated 3T3L1 adipocytes were transfected by
electroporation with the cDNAs encoding for SYNIP/WT and SYNIP/CT (see
Figure 5). Immunoblotting of whole cell lysates demonstrated expression of
both
SYNIP/WT and SYNIP/CT which was not affected by insulin treatment (Fig. 4A,
lanes 1-4). Similar to that observed in CHOIR cells, incubation of insulin-
stimulated cell extracts with GST-Syn4 resulted in a marked decrease in the
precipitation of SYNIP/WT but not SYNIP/CT compared to control cell extracts
(Fig. 4B, lanes 1-4). These data recapitulate the findings in CHOIR cells and
demonstrate that insulin regulates the interaction between SYNIP and syntaxin-
4
in a metabolic insulin-responsive cell type.
SYNIP plays a crucial role in insulin-stimulated glucose transport and
GLUT4 translocation
Several studies have also suggested that syntaxin-4 function is necessary
for insulin-stimulated GLUT4 vesicle translocation but not GLUT1 vesicle
trafficking (Cheatham B., Volchuk A., Kahn C. R., Wang L., Rhodes C.J., and
Klip A., "Insulin-stimulated translocation of GLUT4 glucose transporters
requires
SNARE-complex proteins." Proc Natl Acad Sci USA, 1996;93:15169-15173;
Olson A.L., Knight J.B., and Pessin J.E., Syntaxin-4, VAMP2, and/or
VAMP3/cellubrevin are functional target membrane and vesicle SNAP receptors
for insulin-stimulated GLUT4 translocation in adipocytes." Mol Cell Biol,
1997:17:2425-2435; Tamori Y., Hashiramoto M., Araki S., Kamata Y.,
Takahashi M., Kozaki S., and Kasuga M., "Cleavage of vesicle-associated
membrane protein (VAMP)-2 and cellubrevin on GLUT4-containing vesicles
inhibits the translocation of GLUT4 in 3T3-L 1 adipocytes." Biochem Biophys
Res
Commun,1996;220:740-745; Volchuk A., Wang Q., Ewart H.S., Liu Z., He L.,
Bennett M.K., and Klip A., "Syntaxin 4 in 3T3-L1 adipocytes: regulation by
insulin and participation in insulin-dependent glucose transport." Mol Biol
Cell,
CA 02326623 2000-09-29
WO 99154465 PCT/US99/08568
-34-
1996;7:1075-1082). However, biochemical analyses of these interactions have
been inadequate, since efficient transfection/expression of cDNAs in
differentiated 3T3L1 adipocytes is notoriously difficult. To circumvent this
issue,
a low voltage electroporation method was established for fully differentiated
adipocytes which provided for efficient expression using high concentrations
of
plasmid DNA (Fig. SA). As a marker for transfection/expression efficiency,
differentiated 3T3L1 adipocytes were electroporated (160 V, 960 EtF) with
various
amounts of a cDNA encoding for [3-galactosidase (LacZ). Electroporation with
the
empty vector did not result in any detectable X-Gal staining (Fig. SA, panel
1). In
contrast, electroporation with the LacZ plasmid resulted in a concentration-
dependent increase in adipocytes staining positive for (3-galactosidase
activity
(Fig. SA, panels 2-5). Electroporation with 600 ~tg of the LacZ expression
plasmid
routinely results in greater than 70% transfection efficiency with no
detectable
expression from contaminating fibroblasts.
IS Having established a reasonable transfection protocol for differentiated
3T3L1 adipocytes, next was examined the effect of SYNIP expression on insulin-
stimulated glucose transport (Fig. SB). Cells electroporated with the empty
vector
{pcDNA3) remained sensitive to insulin with a 4-fold stimulation of
2-deoxyglucose uptake in these cells. Although expression of SYNIP/WT and
SYNIP/NT tended to increase the basal uptake of 2-deoxyglucose, exposure of
these cells to insulin resulted in an activation of glucose transport similar
to that
observed in cells transfected with the empty vector. In contrast, expression
of
SYNIP/CT slightly inhibited the basal rate of glucose transport, but
significantly
blunted the insulin-stimulated increase.
3T3L1 adipocytes express both the GLUT1 and GLUT4 glucose
transporter isoforms {Calderhead D.M., Kitagawa K., Lienhard G.E., and
Gould G.W., "Translocation of the brain-type glucose transporter largely
accounts
for insulin stimulation of glucose transport in BC3H-1 rnyocytes." Biochem J,
1990;269:597-601; Yang J. and Holman G.D., "Comparison of GLUT4 and
GLUT1 subcellular trafficking in basal and insulin-stimulated 3T3-L1 cells."
JBiol Chem, 1993;268:4600-4603). Although GLUT1 primarily resides on the
cell surface in the basal state, it can also undergo insulin-stimulated
translocation
c:
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-35-
to the plasma membrane (Holman G.D., Kozka LJ., Clark A.E., Flower C.J.,
Saltis J., Habbe~eld A.D., Simpson LA., and Cushman S.W., "Cell surface
labeling of glucose transporter isoform GLUT4 by bis-mannose photolabel.
Correlation with stimulation of glucose transport in rat adipose cells by
insulin
and phorbol ester." J Biol Chem, 1990;265:18172-18179; Piper R.C., Hess L.J.,
and James D.E., "Differential sorting of two glucose transporters expressed in
insulin-sensitive cells." Am J Physiol, 1991;260:CS70-580; Robinson L.J.,
Pang S., Harris D.S., Heuser J., and James D.E., "Translocation of the glucose
transporter (GLUT4) to the cell surface in permeabilized 3T3-L1 adipocytes:
effects of ATP insulin, and GTP gamma S and localization of GLUT4 to clathrin
lattices." J Cell Biol, 1992;117:1 I 81-1196). Thus, to distinguish the effect
of
SYNIP expression on GLUT1 and GLUT4 translocation, 3T3L1 adipocytes were
transfected with enhanced Green Fluorescent Protein tagged
GLUT4 (GLUT4-eGFP) and GLUT I (eGFP-GLUT 1 ) cDNAs (Fig. 6). In control
cells, GLUT4-eGFP was localized to a perinuclear region and to discrete
intracellular vesicles throughout the cell interior, but not at the cell
surface
(Fig. 6A, panel 1 ). This pattern of GLUT4-eGFP protein expression is
identical to
that observed for endogenous GLUT4 and co-localizes with another protein
marker for the insulin-responsive GLUT4 vesicles, vp165/IRAP (data not shown).
Insulin stimulation resulted in a redistribution of the intracellular
localized
GLUT4-eGFP to the plasma membrane (Fig. 6A, panel 2). These data
demonstrate that the expressed GLUT4-eGFP in 3T3L1 adipocytes undergoes the
characteristic insulin-stimulated translocation to the plasma membrane,
reminiscent of endogenous GLUT4. Consistent with the glucose transport data,
expression of SYNIP/VVT' and SYNIP/NT had no effect on the insulin-stimulated
translocation of GLUT4-eGFP (Fig. 6A, panels 2-6). Although expression of
SYNIP/CT did not alter the basal distribution of GLUT4-eGFP, there was a near
complete inhibition of plasma membrane rim fluorescence (Fig. 6A, panels 7
and 8).
In contrast to GLUT4, a Large proportion of GLUTI is found localized to
the plasma membrane in the basal state (Rea S. and James D.E., "Moving
GLUT4: the biogenesis and trafficking of GLUT4 storage vesicles." Diabetes,
1997;46:1667-1677; Yang J. and Holman G.D., "Camparison of GLUT4 and
c.;
CA 02326623 2000-09-29
WO 99154465 PCT/US99/08568
-36-
GLUTI subcellular trafficking in basal and insulin-stimulated 3T3-L1 cells."
JBiol Chem, 1993;268:4600-4603). Similarly, expression of eGFP-GLUT1 also
resulted in both plasma membrane and intracellular localization in the basal
state
(Fig. 6B, panel 1). As expected, transfection with the empty vector had no
S significant effect on the distribution of eGFP-GLUT 1 (Fig. 6B, panel 2). In
addition, expression of SYNIP/WT, SYNIP/NT, or SYNIP/CT did not affect
either the basal or insulin-stimulated localization of eGFP-GLUT1 (Fig. 6B,
panels 2-8). Thus, the inhibition of insulin-stimulated glucose transport
activity by
SYNIP/CT was specific for GLUT4 translocation, without any significant effect
on GLUT1 subcellular distribution.
EXAMPLE 2
Cloning of a cDNA Encoding Human SYNIP
In order to identify hSYNIP, a human sequence database was queried with
the nucleotide sequence encoding for mouse SYNIP. A human expressed
sequence tag (EST) clone, AA652491, was identified. This EST exhibited 86%
homology to the mouse SYNIP sequence.
In order to obtain a full-length human clone, we used the sequence
information from the EST to design a polymerase chain reaction (PCR) strategy
utilizing Rapid Amplification of cDNA Ends (RACE). Two forward PCR
primers, S'-AGCCCACAAAGGAACAACACCAAGCC-3' and
S'-GCTCAAGTGTGAAGAGATGATGCC-3', were designed for 3' nested PCR
RACE and two reverse primers, 5'-GGCATCATCTCTTTCACACTTGAGC-3'
and 5'-GCAAGCAAAACAAGTTTCTGGCAACC-3' were designed for 5' nested
RACE. Reactions were carried out using a Clontech human fat RACE library.
After completing the 5' and 3'RACE reactions, the resulting sequences
were combined to obtain the full length sequence. To confirm that the 5'RACE
and 3'RACE sequences were from the same gene, a 5' forward primer surrounding
the ATG start codon was designed. Using this oligonucleotide, along with a
3' reverse primer surrounding the stop codon, another PCR reaction was
preformed, and a single band was amplified, confirming the identity of the
cDNA.
CA 02326623 2000-09-29
WO 99/54465 PCT/US99/08568
-37-
The resulting clone was subject to a final sequence analysis, yielding the
complete
human SYNIP cDNA sequence.
It is to be understood that the invention is not to be limited to the exact
details of operation, or to the exact compounds, compositions, methods,
procedures, or embodiments shown and described, as obvious modifications and
equivalents will be apparent to one skilled in the art, and the invention is
therefore
to be limited only by the full scope of the appended claims.
