Note: Descriptions are shown in the official language in which they were submitted.
CA 02329694 2000-11-28
WO 99161615 PCT/US99/11628
Description
', 5 KUNITZ DOMAIN POLYPEPTIDE
AND MATERIALS AND METHODS FOR MAKING IT
BACKGROUND OF THE INVENTION
In animals, proteinases are important in wound healing,
1 o extracellular matrix destruction, tissue reorganization,
and in cascades leading
>~
to blood coagulation, fibrinolysis, and complement activation.
Proteinases are
released by inflammatory cells for destruction of pathogens
or foreign
materials, and by normal and cancerous cells as they move
through their
surroundings.
15 The activity of proteinases is regulated by inhibitors;
10% of the
proteins in blood serum are proteinase inhibitors (Roberts
et al., Critical
Reviews in Eukaryotic Gene Expression 5:385-43fi, 1995).
One family of
proteinase inhibitors, the Kunitz inhibitors, includes inhibitors
of trypsin,
chymotrypsin, elastase, kallikrein, plasmin, coagulation
factors Xla and IXa,
2o and cathepsin G. These inhibitors thus regulate a variety
of physiological
i
processes, including blood coagulation, fibrinolysis, and
inflammation.
Proteinase inhibitors regulate the proteolytic activity
of target
proteinases by occupying the active site and thereby preventing
occupation by
normal substrates. Although proteinase inhibitors fall into
several unrelated
25 structural classes, they all possess an exposed loop (variously
termed an
"inhibitor loop", a "reactive core", a "reactive site",
or a "binding loop") which is
stabilized by intermolecular interactions between residues
flanking the binding
loop and the protein core (Bode and Huber, Eur. J. Biochem.
204:433-451,
1992). Interaction between inhibitor and enzyme produces
a stable complex
3 o which disassociates very slowly, releasing either virgin
(uncleaved) inhibitor, or
a modfied inhibitor that is cleaved at the scissile bond
of the binding loop.
One class of proteinase inhibitors, the Kunitz inhibitors,
are
generally basic, low molecular weight proteins comprising
one or more
inhibitory domains ("Kunitz domainsn). The Kunitz domain
is a folding domain
3 5 Of approximately 50-60 residues which forms a central anti-parallel
beta sheet
and a short C-terminal helix. This characteristic domain
comprises six cysteine
residues that form three disulfide bonds, resulting in a
double-loop structure.
CA 02329694 2000-11-28
WO 99/61615 PC'T/US99/i 1628
2
Between the N-terminal region and the first beta strand
resides the active
inhibitory binding loop. This binding loop is disu~rde bonded
through the P2
Cys residue to the hairpin loop formed between the last
two beta strands.
Isolated Kunitz domains from a variety of proteinase inhibitors
have been
shown to have inhibitory activity (e.g., Petersen et al.,
Eur: J. Biochem.
125:310-316, 1996; Wagner et al., Biochem. Biophys. Res.
Comm. 186:1138-
1145, 1992; Dennis et al., J. Biol. Chem. 270:25411-25417,
1995).
Proteinase inhibitors comprising one or more Kunitz domains
include tissue factor pathway inhibitor (TFPI), tissue factor
pathway inhibitor 2
to (TFPI-2), amyloid ~i-protein precursor (A~iPP), aprotinin,
and placental bikunin.
'';~ TFPI, an extrinsic pathway inhibitor and a natural anticoagulant,
contains three
tandemly linked Kunitz inhibitor domains. The amino-terminal
Kunitz domain
inhibits factor Vlla, plasmin, and cathepsin G; the second
domain inhibits factor
Xa, trypsin, and chymotrypsin; and the third domain has
no known activity
(Petersen et al., ibid.). TFPI-2 has been shown to be an
inhibitor of the
amidolytic and proteolytic activities of human factor Vlla-tissue
factor complex,
factor Xla, plasma kallikrein, and plasmin (Sprecher et
al., Proc. Natl. Acad.
Sci. USA 91:3353-3357, 1994; Petersen et al., Biochem. 35:266-272,
1996).
The ability of TFPI-2 to inhibit the factor Vlla-tissue
factor complex and its
2 o relatively high levels of transcription in umbilical vein
endothelial cells, placenta
and liver suggests a specialized role for this protein in
hemostasis (Sprecher et
al., ibid.). Aprotinin (bovine pancreatic trypsin inhibitor)
is a broad spectrum
Kunitz-type serine proteinase inhibitor that has been shown
to prevent
activation of the clotting cascade. Aprotinin is a moderate
inhibitor of plasma
kallikrein and plamin, and blockage of fibrinolysis and
extracorporeal
coagulation have been detected in patients given aprotinin
during open heart
surgery (Davis and Whittington, Drugs 49:954-983, 1995;
Dietrich et aL,
Thorac. Cardiovasc. Surgr. 37:92-98, 1989). Aprotinin has
also been used in
the treatment of septic shock, adult respiratory distress
syndrome, acute
3 o pancreatitis, hemorrhagic shock, and other conditions (Westaby,
Ann. Thorac.
Sung. 55:1033-1041, 1993; Wachtfogel et al., J. Thorac.
Cardiovasc. Surg.
106:1-10, 1993). The clinical utility of aprotinin is believed
to arise from its
inhibitory activity towards plasma kallikrein or plasmin
(Dennis et al., ibid.).
Placental bikunin is a serine proteinase inhibitor containing
two Kunitz
domains (Delaria et al., J. Biol. Chem. 272:12209-12214,
1997). Individual
Kunitr domains of bikunin have been expressed and shown
to be potent
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
3
inhibitors of trypsin, chymotrypsin, plasmin, factor Xla, and tissue and
plasma
kallikrein (Deiaria et al., ibid.).
Known Kunitz-type inhibitors lack specificity and may have low
potency. Lack of specificity can result in undesirable side effects, such as
s nephrotoxicity that occurs after repeated injections of high doses of
aprotinin.
These limitations may be overcome by preparing isolated Kunitz domains,
which may have fewer side effects than traditional anticoagulants. Hence,
there is a need in the art for additional Kunitz-type proteinase inhibitors.
io SUMMARY OF THE INVENTION
It is an object of the present invention to provide novel
Kunitz
inhibitor proteins and compositions comprising the proteins.
It is another object
of the invention to provide materials and methods for making
the Kunitz
3 inhibitor proteins. It is a further object of the invention
to provide antibodies
i5 that specifically bind to the Kunitz inhibitor proteins.
Within one aspect, the invention provides an isolated protein
comprising a sequence of amino acid residues as shown in
SEQ ID N0:5,
wherein the sequence is at least 90% identical to residues
9 through 59 of
SEQ ID N0:2 and wherein the protein has proteinase inhibiting
activity. within
2 0 one embodiment, the protein is from 51 to 81 amino acid
residues in length.
Within other embodiments, the protein is from 51 to 67
residues in length,
preferably from 55 to 62 residues in length. Within another
embodiment, the
sequence is selected from the group consisting of residues
9 through 59 of
SEQ ID N0:2 and residues 9 through 59 of SEQ ID N0:4. Within
a further
25 embodiment, the protein consists of from 51-557 contiguous
amino acid
residues of SEQ ID N0:10. Within an additional embodiment,
the protein
further comprises an affinity tag. Suitable affinity tags
include maltose binding
protein, polyhistidine, and Glu-Tyr-Met-Pro-Met-Glu (SEQ
ID N0:18).
Within a second aspect, the invention provides an expression
3 o vector comprising the following operably linked elements:
(a) a transcription
promoter; (b) a DNA segment encoding a protein as disclosed
above; and (c) a
transcription terminator. Within one embodiment, the expression
vector further
comprises a secretory signal sequence operably linked to
the DNA segment.
Within a third aspect, the invention provides a cultured
cell
3 s containing an expression vector as disclosed above, wherein
the cell
expresses the DNA segment.
CA 02329694 2000-11-28
WO 99161615 PCT/US99/11628
4
Within a fourth aspect of the invention there is provided a method
of making a protein having proteinase inhibiting activity comprising culturing
a
cell as disclosed above under conditions whereby the DNA segment is
expressed, and recovering the protein encoded by the DNA segment.
Within a fifth aspect of the invention there is provided an antibody
that specifically binds to a protein as shown in SEQ ID N0:2 or SEQ ID N0:4.
These and other aspects of the invention will become evident
upon reference to the following detailed description and the attached drawing.
1o BRIEF DESCRIPTION OF THE DRAWING
The Figure shows an amino acid sequence alignment of a
,:;
representative polypeptide of the present invention (SEQ ID N0:2), designated
"ZKUN5", with the sequence of the Kunitz domain of human alpha 3 type VI
collagen (SEQ ID N0:8), designated "1KNT".
. DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail, it may be helpful to the
understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide
2 o segment that can be attached to a second polypeptide to provide for
purification of the second polypeptide or provide sites for attachment of the
second polypeptide to a substrate. In principal, any peptide or protein for
which an antibody or other specific binding agent is available can be used as
an affinity tag. Affinity tags include a poly-histidine tract, protein A
(Nilsson et
al., EM80 J. 4:1075, 1985; Nilsson et al., Methods Enzymol. 198:3, 1991),
glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), Glu-Glu
affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA 82:7952-4, 1985)
(SEQ ID N0:18), substance P, Flag'~'M peptide (Hopp et al., Biotechnology
6_:1204-1210, 1988), streptavidin binding peptide, maltose binding protein
(Guars et al., Gene 67:21-30, 1987), cellulose binding protein, thioredoxin,
ubiquitin, T7 polymerise, or other antigenic epitope or binding domain. See,
in
general, Ford et al., Protein Expression and Purification 2: 95-107, 1991.
DNAs encoding affinity tags and other reagents are available from commercial
suppliers (e.g., Pharmacia Biotech, Piscataway, NJ; New England Biolabs,
3 5 Beverly, MA; Eastman Kodak, New Haven, CT).
The term "allelic variant" is used herein to denote any of two or
more alternative forms of a gene occupying the same chromosomal locus.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
Allelic variation arises naturally through mutation, and
may result in phenotypic
polymorphism within populations. Gene mutations can be
silent (no change in
the encoded polypeptide) or may encode polypeptides having
altered amino
acid sequence. The term allelic variant is also used herein
to denote a protein
5 encoded by an allelic variant of a gene.
The terms "amino-terminal" and "carboxyl-terminal" are
used
herein to denote positions within polypeptides. Where the
context allows,
these terms are used with reference to a particular sequence
or portion of a
polypeptide to denote proximity or relative position. For
example, a certain
to sequence positioned carboxyl-terminal to a reference sequence
within a
polypeptide is located proximal to the carboxyl terminus
of the reference
sequence, but is not necessarily at the carboxyl terminus
of the complete
polypeptide.
A "complement" of a polynucleotide molecule is a of nucleotide
P Y
molecule having a complementary base sequence and reverse
orientation as
compared to a reference sequence. For example, the sequence
5'
ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
The term "degenerate nucleotide sequence" denotes a sequence
of nucleotides that includes one or more degenerate codons
(as compared to a
2 o reference polynucleotide molecule that encodes a polypeptide).
Degenerate
codons contain different triplets of nucleotides, but encode
the same amino
acid residue (i.e., GAU and GAC triplets each encode Asp).
A "DNA segment" is a portion of a larger DNA molecule having
specified attributes. For example, a DNA segment encoding
a specified
2 s polypeptide is a portion of a longer DNA molecule, such
as a plasmid or
plasmid fragment, that, when read from the 5' to the 3'
direction, encodes the
sequence of amino acids of the specified poiypeptide.
The term "expression vector" is used to denote a DNA molecule,
linear or circular, that comprises a segment encoding a
polypeptide of interest
30 operably linked to additional segments that provide for
its transcription. Such
additional segments include promoter and terminator sequences,
and may also
include one or more origins of replication, one or more
selectable markers, an
enhancer, a polyadenylation signal, etc. Expression vectors
are generally
derived from plasmid or viral DNA, or may contain elements
of both.
35 The term "isolated", when applied to a polynucteotide,
denotes
that the polynucleotide has been removed from its natural
genetic milieu and is
thus free of other extraneous or unwanted coding sequences,
and is in a form
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
6
suitable for use within genetically engineered protein production systems.
Such isolated molecules are those that ace separated from their natural
environment and include cDNA and genomic clones. Isolated DNA molecules
of the present invention are free of other genes with which they are
ordinarily
associated, but may include naturally occurring 5' and 3' untranslated regions
such as promoters and terminators. The identification of associated regions
will be evident to one of ordinary skill in the art (see for example, Dynan
and
Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein
to that is found in a condition other than its native environment, such as
apart
a
from blood and animal tissue. In a preferred form, the isolated polypeptide is
substantiall free of other
y polypeptides, particularly other polypeptides of
animal origin. It is preferred to provide the polypeptides in a highly
purified
form, i.e. greater than 95% ure, more referabl °
p p y greater than 99 /o pure.
is When used in this context, the term "isolated" does not exclude the
presence
of the same polypeptide in alternative physical forms, such as dimers or
alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA segments,
indicates that the segments are arranged so that they function in concert for
2 o their intended purposes, e.g., transcription initiates in the promoter and
proceeds through the coding segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained
from one species that is the functional counterpart of a polypeptide or
protein
from a different species. Sequence differences among orthologs are the result
2 5 of speciation.
A "polynucleotide" is a single- or double-stranded polymer of
deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural
sources, synthesized in vitro, or prepared from a combination of natural and
3 o synthetic molecules. Sizes of polynucieotides are expressed as base pairs
(abbreviated "bp"), nucleotides ("nt"), or kilobases ("kb"). Where the context
allows, the latter two terms may describe polynucleotides that are single-
stranded or double-stranded. When these terms are applied to double-
stranded molecules they are used to denote overall length and will be
3 s understood to be equivalent to the term "base pairs". It will be
recognized by
those skilled in the art that the two strands of a double-stranded
polynucleotide
may differ slightly in length and that the ends thereof may be staggered as a
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
7
result of enzymatic cleavage; thus all nucleotides within a double-stranded
polynucleotide molecule may not be paired. Such unpaired ends will in general
not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by
s peptide bonds, whether produced naturally or synthetically. Polypeptides of
less than about 10 amino acid residues are commonly referred to as
"peptides".
The term "promoter" is used herein for its art-recognized meaning
to denote a portion of a gene containing DNA sequences that provide for the
to binding of RNA polymerase and initiation of transcription. Promoter
sequences
are commonly, but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more
polypeptide chains. A protein may also comprise non-peptidic components,
such as carbohydrate groups. Carbohydrates and other non-peptidic
15 substituents may be added to a protein by the cell in which the protein is
produced, and will vary with the type of cell. Proteins are defined herein in
terms of their amino acid backbone structures; substituents such as
carbohydrate groups are generally not specified, but may be present
nonetheless.
2o The term "secretory signal sequence" denotes a DNA sequence
that encodes a polypeptide (a "secretory peptide") that, as a component of a
larger polypeptide, directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger polypeptide is commonly
cleaved
to remove the secretory peptide during transit through the secretory pathway.
25 The term "splice variant" is used herein to denote alternative
forms of RNA transcribed from a gene. Splice variation arises naturally
through use of alternative splicing sites within a transcribed RNA molecule,
or
less commonly between separately transcribed RNA molecules, and may result
in several mRNAs transcribed from the same gene. Splice variants may
3 o encode polypeptides having altered amino acid sequence. The term splice
variant is also used herein to denote a protein encoded by a splice variant of
an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by
imprecise analytical methods (e.g., gel electrophoresis) will be understood to
3 5 be approximate values. When such a value is expressed as "about" X or
"approximately" X, the stated value of X will be understood to be accurate to
t10%.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
8
The present invention provides, in part, novel serine proteinases
comprising a Kunitz domain. This Kunitz domain, including
sequence variants
thereof and proteins containing it, is referred to herein
as "zkun5". The zkun5
polypeptide sequence shown in SEQ ID N0:2 comprises this
Kunitz domain,
which is bounded at the amino and carboxyl termini by cysteine
residues at
positions 9 and 59, respectively.
Zkun5 has 50% residue identity with the kunitz domain in
human
alpha 3 type VI collagen (shown in SEQ ID N0:8). The structure
of the latter
domain has been solved by X-ray crystallography and by NMR
(Arnoux et al.,
to J. Mol. Biol. 246:609-617, 1995; Sorensen et al., Biochemistry
36:10439-
10450, 1997). An alignment of zkun5 and the collagen Kunitz
domain {see
Figure) can be combined with a homology model of zkun5 based
on the X
r
-
ay
structure to predict the function of certain residues in
zkun5. Referring to SEQ
ID N0:2, disulfide bonds are predicted to be formed by paired
cysteine
is residues Cys9 - Cys59; Cys18 - Cys42; and Cys34 - Cys55.
The protease
binding loop (P3-P4') is expected to comprise residues 17-23
of SEQ ID N0:2
(Asn-Cys-Gly-Glu-Tyr-Val-Val), with the P1 residue being
GIy19, and the P1'
residue being GIu20. ZkunS further comprises a potential
glycosylation site at
position Asn43 of SEQ ID N0:2.
2 o The kunitz domain of human alpha 3 type VI collagen is not
known to have antiproteinase activity. Suspected reasons
for this include
unfavorable steric hindrances with trypsin involving the
residue Asp15 of
collagen (corresponding to GIu20 in zkun5). From these data
it is predicted
that a GIu20Ala mutant of zkun5 may show increased antiproteinase
activity.
25 The present invention thus contemplates zkun5 proteins wherein
residue 20 of
SEQ ID N0:2 is replaced with Ala as shown in SEQ ID N0:4.
Additional amino acid substations can be made within the
zkun5
sequence so long as the conserved cysteine residues are
retained and the
higher order structure is not disrupted. It is preferred
to make substitutions
o within the zkun5 Kunitz domain by reference to the sequences
of other Kunitz
domains. SEQ ID N0:5 is a generalized Kunitz domain sequence
that shows
allowable amino acid substitutions based on such an alignment.
The 51-
residue sequence shown in SEQ ID N0:5 conforms to the pattern:
C-X(8)-C-X(15)-C-X(7)-C-X(12)-C-X(3)-C
3 s wherein C denotes cysteine; X is any naturally occuring
amino acid residue,
subject to the limitations set forth in the attached Sequence
Listing for SEQ ID
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
9
N0:5; and the numerals indicate the number of such variable residues. The
second cysteine residue is in the P2 position.
- Within the present invention up to 10% of the amino acid
residues in the zkun5 Kunitz domain (residues 9 through 59 of SEQ ID N0:2)
s can be replaced with other amino acid residues, subject to the limitation
that
the resulting substituted sequence is one of the sequences disclosed in SEQ
ID N0:5. The present invention thus provides a family of proteins comprising a
sequence of amino acid residues as shown in SEQ ID N0:5, wherein the
sequence is at least 90% identical to residues 9 through 59 of SEQ ID N0:2. It
1 o is preferred that the proteins of the present invention comprise such a
sequence that is at least 95% identical to residues 9 through 59 of SEQ ID
N0:2.
Percent sequence identity is determined by conventional
methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603-616, 1986,
is and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919, 1992.
Briefly, two amino acid sequences are aligned to optimize the alignment scores
using a gap opening penalty of 10, a gap extension penalty of 1, and the
"BLOSUM62" scoring matrix of Henikoff and Henikoff (ibid.) as shown in Table
2 (amino acids are indicated by the standard one-letter codes). The percent
2 o identity is then calculated as:
Total number of identical matches
x 100
[length of the longer sequence plus the
2s number of gaps introduced into the longer
sequence in order to align the two
sequences]
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
S'
N M
fn tnN N O
M N N
LL n e-~ 'd'M N
(pd' N N e-
O N e-~
'"' ' r''_
.p Y ~ r M ~ O ~ M N N
r e-
"' - Wit'N N O ~'')N e-N e-r-
i ~ ~ ~ ~ i
tl'N M '- O M N r-M ~-M
00 M M r-N '_'N r-N N N M
~ ' ' ~ , ~ i
CflN ~ ~t N M M N O N N M M
i i i i ~
~ ~ N O M M ~ N M e- O ~-M N N
i ~ ~ ' ' ~ ~ i ,
V
M N N O M N e-O M e- O e-N ~-N
O M ~ M M e-~ M r" N M e-~ N N
0 '
CO M O N ~-~ M ~. ~ M M ~- O r-V' M M
O ~ ~ ~ ~ ~ ' ' ~ i i i
O ~ M O O O ~ M M O N M N r'O ~T N M
Q ~' O i i ' ' ~ i
N M ~ O N O M N N ~ M r'r'M N M
r" N ' N i ' ' i ~ i ~ i
N O r ~ O N ~ r..~-~ N ~ r-O M N O
~ ~ ~ ,
,
Q ~ z D U CJLU C~Z _ _i Y ~ tl.a v)I-~ >->
'n ° 'n o
v--1 T"~ N
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
11
The level of identity between amino acid sequences can
be
determined using the "FASTA" similarity search algorithm
of Pearson and
Lipman (Proc. Natl. Acad. Sci. USA 85:2444, 1988) and Pearson
(Meth.
Enzymol. 183:63, 1990). Briefly, FASTA first characterizes
sequence similarity
s by identifying regions shared by the query sequence (e.g.,
SEQ ID N0:2) and
a test sequence that have either the highest density of
identities (if the ktup
variable is 1 ) or pairs of identities (if ktup=2), without
considering conservative
amino acid substitutions, insertions, or deletions. The
ten regions with the
highest density of identities are then rescored by comparing
the similarity of all
i1 o paired amino acids using an amino acid substitution matrix,
and the ends of the
regions are "trimmed" to include only those residues that
contribute to the
highest score. If there are several regions with scores
greater than the "cutoff'
: value (calculated by a predetermined formula based upon
the length of the
;
, sequence and the ktup value), then the trimmed initial
regions are examined to
is determine whether the regions can be joined to form an
approximate alignment
with gaps. Finally, the highest scoring regions of the
two amino acid
sequences are aligned using a modification of the Needleman-Wunsch-Sellers
algorithm (Needleman and Wunsch, J. Mol. Biol. 4-88:444,
1970; Sellers, SIAM
J. Appl. Math. 26:787, 1974), which allows for amino acid
insertions and
2 o deletions. Illustrative parameters for FASTA analysis are:
ktup=1, gap opening
penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62.
These parameters can be introduced into a FASTA program
by modifying the
scoring matrix file ("SMATRIX"), as explained in Appendix
2 of Pearson, 1990
{ibid. ).
2s FASTA can also be used to determine the sequence identity
of
nucleic acid molecules using a ratio as disclosed above.
For nucleotide
sequence comparisons, the ktup value can range between
one to six,
preferably from four to six.
The proteins of the present invention can also comprise
non-
3 o naturally occurring amino acid residues. Non-naturally
occurring amino acids
include, without limitation, traps-3-methylproline, 2,4-methanoproline,
cis-4-
hydroxyproline, traps-4-hydroxyproline, N methylglycine,
allo-threonine,
methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine,
nitroglutamine, homoglutamine, pipecolic acid, thiazolidine
carboxylic acid,
3 s dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline,
tent leucine,
norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine,
and
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
12
4-fluorophenylalanine. Several methods are known in the
art for incorporating
non-naturally occurring amino acid residues into proteins.
For example, an in
vitro system comprising an E, coli S30 extract and commercially
available
enzymes and other reagents can be employed, wherein nonsense
mutations
are suppressed using chemically aminoacylated suppressor
tRNAs. See, for
example, Robertson et al., J. Am. Chem. Soc. 113:2722, 1991;
Ellman et al.,
Methods Enzymol. 202:301, 1991; Chung et al., Science 259:806-9,
1993; and
Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-9, 1993).
In a second
method, translation is carried out in Xenopus oocytes by
microinjection of
1o mutated mRNA and chemically aminoacylated suppressor tRNAs
(Turcatti et
al., J. BioL Chem. 271:19991-8, 1996). Within a third method,
E. coli cells are
cultured in the absence of a natural amino acid that is
to be replaced (e
g
.
.,
phenylalanine) and in the presence of the desired non-naturally
occurring
amino acids) (e.g., 2-azaphenylafanine, 3-azaphenylalanine,
4-
azaphenylalanine, or 4-fluorophenylalanine). See, Koide
et al., Biochem.
33:7470-6, 1994. Naturally occurring amino acid residues
can be converted to
non-naturally occurring species by in vitro chemical modification.
Chemical
modification can be combined with site-directed mutagenesis
to further expand
the range of substitutions (Wynn and Richards, Protein Sci.
2:395-403, 1993).
2 o Additional polypeptides may be joined to the amino and/or
carboxyl termini of the zkun5 Kunitr domain (residues 9-59
of SEQ ID N0:2) or
a derivative of the zkun5 Kunitz domain as disclosed above.
Within one
embodiment, the extensions are those shown in SEQ ID N0:10,
wherein the
zkun5 Kunitz domain is located at residues 504-554. Particularly
preferred
2s proteins in this regard include residues 1-62 of SEQ ID
N0:2 or SEQ ID N0:4.
Amino and carboxyl extensions of the zkun5 Kunitz domain
will be selected so
as not to destroy or mask the proteinase-inhibiting activity
of the protein by, for
example, burying the Kunitr domain within the interior of
the protein. There is
a consequent preference for shorter extensions, typically
10-15 residues in
3 0 length, preferably not exceeding 8 residues in length. There
is considerable
latitude in the permissible sequence of these extensions,
although it is
preferred to avoid the addition of cysteine residues in
close proximity to the the
Kunitz domain itself. For example, a zkun5 protein can comprise
residues 9-59
of SEQ ID N0:2 or SEQ ID N0:4 with amino- and carboxyl-terminal
dipeptides,
3 5 wherein the individual amino acid residues of the dipeptides
are any amino
acid residue except cysteine.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
13
Other amino- and carboxyl-terminal extensions that can be
included in the proteins of the present invention include,
for example, an
amino-terminal methionine residue, a small linker peptide
of up to about 20-25
residues, or an affinity tag as disclosed above. A protein
comprising such an
s extension may further comprise a polypeptide linker and/or
a proteolytic
cleavage site between the zkun5 portion and the affinity
tag. Preferred
cleavage sites include thrombin cleavage sites and factor
Xa cleavage sites.
For example, the zkun5 protein shown in SEQ ID N0:2 may
be expressed as a
fusion comprising, from amino terminus to carboxyl terminus:
maltose binding
1 o protein-polyhistidine-thrombin cleavage site (Leu-Val-Pro-Arg;
SEQ ID N0:11 )-
SEQ ID N0:2. Linker peptides and affinity tags provide for
additional functi
ons,
such as binding to substrates, antibodies, binding proteins,
and the like, and
a
facilitate purification, detection, and delivery of zkun5
proteins. in another
example, a zkun5 Kunitz domain can be expressed as a secreted
protein
is comprising a carboxyl-terminal receptor transmembrane domain,
permitting the
Kunitz domain to be displayed on the surface of a cell.
To span the lipid
bilayer of the cell membrane, a minimum of about 20 amino
acids are required
in the transmembrane domain; these should predominantly
be hydrophobic
amino acids. The Kunitz domain can be separated from the
transmembran
e
2 o domain by a spacer polypeptide, and can be contained within
an extended
polypeptide comprising a carboxyl-terminal transmembrane
domain-spacer
polypeptide-Kunitz domain-amino-terminal polypeptide. Many
receptor
transmembrane domains and polynucleotides encoding them
are known in the
art. The spacer polypeptide will generally be at least about
50 amino acid
2s residues in length, up to 200-300 or more residues. The
amino terminal
polypeptide may be up to 300 or more residues in length.
The present invention further provides polynucleotide molecules,
including DNA and RNA molecules, encoding zkun5 proteins.
The
polynucieotides of the present invention include the sense
strand; the anti-
3 o sense strand; and the DNA as double-stranded, having both
the sense and
anti-sense strand annealed together by their respective
hydrogen bonds.
Representative DNA sequences encoding zkun5 proteins are
set forth in SEQ
ID N0:1, SEQ ID N0:3, and SEQ ID N0:9. DNA sequences encoding
other
zkun5 proteins can be readily generated by those of ordinary
skill in the art
3 s based on the genetic code. Counterpart RNA sequences can
be generated by
substitution of U for T.
CA 02329694 2000-11-28
WO 99161615 PCTIUS99/11628
14
Those skilled in the art will readily recognize that, in view of the
degeneracy of the genetic code, considerable sequence variation is possible ,
among these polynucleotide molecules. SEQ ID N0:6 is a degenerate DNA
sequence that encompasses all DNAs that encode the zkun5 polypeptide of
SEQ ID N0:2. SEQ ID N0:7 is a degenerate DNA sequence that
encompasses all DNAs that encode the zkun5 polypeptide of SEQ ID N0:4.
Those skilled in the art will recognize that the degenerate sequences of SEQ
ID N0:6 and SEQ ID N0:7 also provide all RNA sequences encoding SEQ ID
N0:2 and SEQ ID N0:4, respectively, by substituting U for T. Thus, zkun5
to polypeptide-encoding polynucleotides comprising nucleotide 1 to nucleotide
186 of SEQ ID N0:6, nucleotide 1 to nucleotide 186 of SEQ ID N0:7, and their
respective RNA equivalents are contemplated by the present invention. Table
2 sets forth the one-letter codes used within SEQ ID NOS:6 and 7 to denote
,,
degenerate nucleotide positions. "Resolutions" are the nucleotides denoted by
a code letter. "Complement" indicates the code for the complementary
nucleotide(s). For example, the code Y denotes either C or T, and its
complement R denotes A or G, A being complementary to T, and G being
complementary to C.
CA 02329694 2000-11-28
WO 99/61615 , PCT/US99/11628
15
TABLE 2
Nucleotide Resolution NucleotideComplement
A A T . T
C C G G
G G C C
T T A A
R AIG Y CIT
o; Y CIT R IG
A
., M AIC K GIT
K GIT M AIC
S CIG S CIG
W AIT W AIT
H AICIT D AIGIT
B CIGIT V AICIG
V AICIG B CIGIT
D AIGIT H AICIT
N AICIGIT N AICIGIT
The degenerate codons used in SEQ 1D
NOS:6
and 7,
s encompassing all possible codons for amino , are set
a given acid forth in
Table 3.
CA 02329694 2000-11-28
WO 99161615 PCT/US99/1 I628
16
TABLE 3
One
Amino Letter Degenerate
Acid Code Codons Codon
Cys C TGC TGT TGY
Ser S AGC AGT TCA TCC TCG TCT WSN
Thr T ACA ACC ACG ACT ACN
Pro P CCA CCC CCG CCT CCN
Ala A GCA GCC GCG GCT GCN
n Gly G GGA GGC GGG GGT GGN
a
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
N
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGG CGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATC ATT ATH
Leu L CTA CTC CTG CTT TTA TTG YTN
Val V GTA GTC GTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAG TGA TRR
Asn~Asp B RAY
GIu~GIn Z SAR
Any X NNN
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
17
One of ordinary skill in the art will appreciate that some
ambiguity is introduced in determining a degenerate codon,
representative of
all possible codons encoding each amino acid. For example,
the degenerate
codon for serine (WSN) can, in some circumstances, encode
arginine (AGR)
,
and the degenerate codon for arginine (MGN) can, in some
circumstances
,
encode serine {AGY). A similar relationship exists between
codons encoding
phenylalanine and leucine. Thus, some polynucleotides encompassed
by the
degenerate sequence may encode variant amino acid sequences,
but one of
ordinary skill in the art can easily identify such variant
sequences by reference
to to the amino acid sequences shown in SEQ ID NOS:2 and 4.
Variant
sequences can be readily tested for functionality as described
herein.
One of ordinary skill in the art will aiso appreciate that
different
species can exhibit preferential codon usage, that is, a
bias in codon usa
ge
within the genome of a species. See, in general, Grantham
et al., Nuc. Acids
Res. 8:1893-912, 1980; Haas et al. Cun: Biol. 6:315-24,
1996; Wain-Hobson
et al., Gene 13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209,
1982;
Holm, Nuc. Acids Res. 14:3075-87, 1986; and Ikemura, J.
Mol. Biol. 158:573-
97, 1982. Preferred codons for a particular species can
be introduced info the
polynucleotides of the present invention by a variety of
methods known in the
2 o art, thereby increasing translation efficiency within a
particular cell type or
species. The degenerate codon sequences disclosed in SEQ
ID NOS
6
:
and
7 serve as templates for optimizing expression of polynucleotides
in various
cell types and species commonly used in the art and disclosed
herein
.
Sequences containing preferred codons can be tested and
optimized for
2s expression in various host cell species, and tested for
functionality as
disclosed herein.
It is preferred that zkun5 polynucleotides hybridize to
similar
sized regions of SEQ ID N0:1, or a sequence complementary
thereto, under
stringent conditions. In general, stringent conditions are
selected to be about
3 0 5C lower than the thermal melting point (Tm) for the specific
sequence at a
defined ionic strength and pH. The Tm is the temperature
(under defined
ionic strength and pH) at which 50% of the target sequence
hybridizes to a
pertectly matched probe. Typical stringent conditions are
those in which the
salt concentration is up to about 0.03 M at pH 7 and the
temperature is at
3 s least about 60C.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
18
As previously noted, zkun5 polynucleotides provided by the
present invention include DNA and RNA. Methods for preparing DNA
and
RNA are well known in the art. In general, RNA is isolated from
a tissue or
cell that produces large amounts of zkun5 RNA. Such tissues and
cells are
identified by Northern blotting (Thomas, Proc. Natl. Acad. Sci.
USA 77:5201,
1980), and include spinal cord, trachea, heart, colon, small intestine,
and
stomach. Total RNA can be prepared using guanidine-HCI extraction
followed by isolation by centrifugation in a CsCI gradient (Chirgwin
et al.,
Biochemistry 18:52-94, 1979). Poly (A)+ RNA is prepared from total
RNA
to using the method of Aviv and Leder (Proc. NatL Acad. Sci. USA
69:1408-12,
1972). Complementary DNA (cDNA) is prepared from poly(A)+ RNA using
known methods. In the alternative, genomic DNA can be isolated.
Polynucleotides encoding zkun5 polypeptides are then identified
and isolated
by, for example, hybridization or PCR.
A full-length clone encoding zkun5 can be obtained by
conventional cloning procedures. Complementary DNA (cDNA) clones
are
preferred, although for some applications (e.g., expression in transgenic
animals) it may be preferable to use a genomic clone, or to modify
a cDNA
clone to include at least one genomic intron. Methods for preparing
cDNA
2 o and genomic clones are well known and within the level of ordinary
skill in the
art, and include the use of the sequence disclosed herein, or parts
thereof, for
probing or priming a library. Expression libraries can be probed
with
antibodies to zkun5, receptor fragments, or other specific binding
partners.
The polynucleotides of the present invention can also be
synthesized using automated equipment ("gene machines). Gene synthesis
methods are well known in the art. See, for example, Glick and Pasternak,
Molecular Biotechnoloay. Principles & Aaalications of Recombinant
DNA,
ASM Press, Washington, D.C., 1994; Itakura et al., Annu. Rev. Biochem.
53:
323-356, 1984; and Climie et al., Proc. Nafl. Acad. Sci. USA 87:633-637,
3 0 1990.
The zkun5 polynucleotide sequences disclosed herein can be
used to isolate counterpart polynucleotides from other species (orthologs).
These orthologous polynucleotides can be used, infer alia, to prepare the
respective orthologous proteins. These other species include, but are not
3 5 limited to mammalian, avian, amphibian, reptile, fish, insect and other
vertebrate and invertebrate species. Of particular interest are zkun5
CA 02329694 2000-11-28
WO 99/61615 PCTNS99/11628
19
polynucleotides abd polypeptides from other mammalian species,
including
marine, porcine, ovine, bovine, canine, feline, equine,
and other primate
polypeptides. Orthologs of human zkun5 can be cloned using
information and
compositions provided by the present invention in combination
with
s conventional cloning techniques. For example, a cDNA can
be cloned using
mRNA obtained from a tissue or cell type that expresses
zkun5 as disclosed
herein. Suitable sources of mRNA can be identified by probing
Northern blots
with probes designed from the sequences disclosed herein.
A library is then
prepared from mRNA of a positive tissue or cell line. A
zkun5-encoding cDNA
s; 1 o can then be isolated by a variety of methods, such as by
i probing with a
complete or partial human cDNA or with one or more sets
of degenerate
probes based on the disclosed sequences. A cDNA can also
be cloned using
the polymerase chain reaction, or PCR (Mullis, U.S. Patent
No. 4,683
202)
,
,
using primers designed from the representative human zkun5
sequence
is disclosed herein. Within an additional method, the cDNA
library can be used
to transform or transfect host cells, and expression of
the cDNA of interest
can be detected with an antibody to zkun5 polypeptide. Similar
techniques
can also be applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequence
2 o disclosed in SEQ ID N0:1 represents a single allele of human
zkun5 and that
natural variation, including allelic variation and alternative
splicing, is expected
to occur. Allelic variants of this sequence can be cloned
by probing cDNA or
genomic libraries from different individuals according to
standard procedures.
Allelic variants of the DNA sequence shown in SEQ ID N0:1,
including those
25 containing silent mutations and those in which mutations
result in amino acid
sequence changes, are within the scope of the present invention,
as are
proteins which are allelic variants of SEQ ID N0:2. cDNAs
generated from
alternatively spliced mRNAs, which retain the proteinase
inhibiting activity of
zkun5 are included within the scope of the present invention,
as are
3 o polypeptides encoded by such cDNAs and mRNAs. Allelic variants
and splice
variants of these sequences can be cloned by probing cDNA
or genomic
libraries from different individuals or tissues according
to standard procedures
known in the art.
ZkunS proteins, including variants of wild-type zkun5, are
tested
3 s for activity in protease inhibition assays, a variety of
which are known in the
art. Preferred assays include those measuring inhibition
of trypsin,
CA 02329694 2000-11-28
WO 99!61615 PCT/US99I11628
chymotrypsin, plasmin, cathepsin G, and human leukocyte elastase.
See, for
example, Petersen et al., Eur. J. Biochem. 235:310-316, 1996. In
a typical ,
procedure, the inhibitory activity of a test compound is measured
by
incubating the test compound with the proteinase, then adding an
appropriate
s substrate, typically a chromogenic peptide substrate. See, for
example,
Norris et al. (Biol. Chem. Hoppe-Seyler 371:37-4.2, 1990). Briefly,
various
concentrations of the inhibitor are incubated in the presence of
trypsin,
plasmin, and plasma kallikrein in a low-salt buffer at pH 7.4, 25C.
After 30
minutes, the residual enzymatic activity is measured by the addition
of a
to chromogenic substrate (e.g., S2251 (D-Val-Leu-Lys-Nan) or S2302
(D-Pro-
Phe-Arg-Nan), available from Kabi, Stockholm, Sweden) and a 30-minute
incubation. Inhibition of enzyme activity is indicated by a decrease
in
absorbance at 405 nm or fluorescence Em at 460 nm. From the results,
the
apparent inhibition constant K; is calculated. The inhibition of
coagulation
i5 factors (e.g., factor Vila, factor Xa) can be measured using
chromogenic
substrates or in conventional coagulation assays (e.g., clotting
time of normal
human plasma; Dennis et al., ibid.).
Zkun5 proteins can be tested in animal models of disease,
particularly tumor models, models of fibrinolysis, and models of
imbalance of
2o hemostasis. Suitable modets are known in the art. For example,
inhibition
of
tumor metastasis can be assessed in mice into which cancerous cells
or
tumor tissue have been introduced by implantation or injection (e.g.,
Brown,
Advan. Enzyme Regul. 35:293-301, 1995; Conway et al., Clin. Exp.
Metastasis 14:115-124, 1996). Effects on fibrinolysis can be measured
in a
rat model wherein the enzyme batroxobin and radiotabeled fibrinogen
are
administered to test animals. Inhibition of fibrinogen activation
by a test
compound is seen as a reduction in the circulating level of the
label as
compared to animals not receiving the test compound. See, Lenfors
and
Gustafsson, Semin. Thromb. Hemost. 22:335-342, 1996. Zkun5 proteins
can
3 o be delivered to test animals by injection or infusion, or can be
produced in
vivo by way of, for example, viral or naked DNA delivery systems
or
transgenic expression.
Exemplary viral delivery systems include adenovirus,
herpesvirus, vaccinia virus and adeno-associated virus (AAV). Adenovirus,
a
3 5 double-stranded DNA virus, is currently the best studied gene
transfer
vector
for delivery of heterologous nucleic acid (for a review, see Becker
et al., Meth.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
21
Cell Biol. 43:161-189, 1994; and Douglas and Curiel, Science
8 Medicine
4:44-53, 1997). By deleting portions of the adenovirus
genome, larger inserts
(up to 7 kb) of heterologous DNA can be accommodated. These
inserts can
be incorporated into the viral DNA by direct ligation or
by homologous
s recombination with a co-transfected plasmid. In an exemplary
system, the
essential E1 gene is deleted from the viral vector, and
the virus will not
replicate unless the E1 gene is provided by the host cell
(e.g., the human 293
cell line). When intravenously administered to intact animals,
adenovirus
primarily targets the liver. If the adenoviral delivery
system has an E1
e
g
to ne
deletion, the virus cannot replicate in the host cells.
However, the host's
tissue (e.g., liver) will express and process (and, if
a signal sequence is
present, secrete) the heterologous protein. Secreted proteins
will enter the
circulation in the highly vascularized fiver, and effects
on the infected animal
can be determined.
15 An alternative method of gene delivery comprises removing
cells
from the body and introducing a vector into the cells as
a naked DNA plasmid.
The transformed cells are then re-implanted in the body.
Naked DNA vectors
are introduced into host cells by methods known in the
art, including
transfection, electroporation, microinjection, transduction,
cell fusion, DEAE
2 o dextran, calcium phosphate precipitation, use of a gene
gun, or use of a DNA
vector transporter. See, Wu et al., J. Biol. Chem. 263:14621-14624,
1988;
Wu et al., J. Biol. Chem. 267:963-967, 1992; and Johnston
and Tang, Meth.
CeIIBioL 43:353-365, 1994.
Transgenic mice, engineered to express a zkun5 gene, and
2 s mice that exhibit a complete absence of zkun5 gene function,
referred to as
"knockout mice" (Snouwaert et al., Science 257:1083, 1992),
can also be
generated (Lowell et al., Nature 366:740-742, 1993). These
mice are
employed to study the zkun5 gene and the encoded protein
in an in vivo
system. Transgenic mice are particularly useful for investigating
the role of
3 o zkun5 proteins in early development because they allow
the identification of
developmental abnormalities or blocks resulting from the
over- or
underexpression of a specific factor.
The zkun5 polypeptides of the present invention, including
full-
length polypeptides, biologically active fragments, and
fusion poiypeptides
35 can be produced in genetically engineered host cells according
to
conventional techniques. Suitable host cells are those
cell types that can be
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
22
transformed or transfected with exogenous DNA and grown
in culture, and
include bacteria, fungal cells, and cultured higher eukaryotic
cells.
Techniques for manipulating cloned DNA molecules and introducing
exogenous DNA into a variety of host cells are disclosed
by Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring
Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel
et al., eds.,
Current Protocols in Molecular Biology, John Wiley and
Sons, Inc., NY, 1987.
In general, a DNA sequence encoding a zkun5 polypeptide
is
operably linked to other genetic elements required for
its expression,
v to generally including a transcription promoter and terminator,
within an
expression vector. The vector will also commonly contain
one or more
selectable markers and one or more origins of replication,
although those
skilled in the art will recognize that within certain systems
selectable markers
may be provided on separate vectors, and replication of
the exogenous DNA
may be provided by integration into the host cell genome.
Selection of
promoters, terminators, selectable markers, vectors and
other elements is a
matter of routine design within the level of ordinary skill
in the art. Many such
elements are described in the literature and are available
through commercial
suppliers.
2 o To direct a zkun5 polypeptide into the secretory pathway
of a
host cell, a secretory signal sequence (also known as a
leader sequence,
prepro sequence or pre sequence) is provided in the expression
vector. The
secretory signal sequence may be that of zkun5, or may
be derived from
another secreted protein (e.g., t-PA; see, U.S. Patent
No. 5,641,655) or
synthesized de novo. The secretory signal sequence is operably
linked to the
zkun5 DNA sequence, i.e., the two sequences are joined
in the correct
reading frame and positioned to direct the newly sythesized
polypeptide into
the secretory pathway of the host cell. Secretory signal
sequences are
commonly positioned 5' to the DNA sequence encoding the
polypeptide of
3 o interest, although certain signal sequences may be positioned
elsewhere in
the DNA sequence of interest (see, e.g., Welch et al.,
U.S. Patent No.
5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Cultured mammalian cells are suitable hosts for use within
the
present invention. Methods for introducing exogenous DNA
into mammalian
3 s host cells include calcium phosphate-mediated transfection
(Wigier et al., Cell
14:725, 1978; Corsaro and Pearson, Somafic Cell Genetics
7:603, 1981:
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
23
Graham and Van der Eb, Virology 52:456, 1973), electroporation
(Neumann
et al., EMBO J. 1:841-845, 1982), DEAE-dextran mediated
transfection
(Ausubel et al., ibid.), and liposome-mediated transfection
(Hawley-Nelson et
al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80,
1993). The production
s of recombinant polypeptides in cultured mammalian cells
is disclosed, for
example, by Levinson et al., U.S. Patent No. 4,713,339;
Hagen et al., U.S.
Patent No. 4,784,950; Palmiter et al., U.S. Patent No.
4,579,821; and Ringold,
U.S. Patent No. 4,656,134. Suitable cultured mammalian
cells include the
COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK
(ATCC
to No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC
No. CRL 1573;
Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese
hamster ovary (e.g.
CHO-K1; ATCC No. CCL 61) cell lines. Additional suitable
cell lines are
known in the art and available from public depositories
such as the American
Type Culture Collection, Rockville, Maryland. in general,
strong transcription
15 promoters are preferred, such as promoters from SV-40 or
cytomegalovirus.
See, e.g., U.S. Patent No. 4,956,288. Other suitable promoters
include those
from metallothionein genes {U.S. Patent Nos. 4,579,821
and 4,601,978) and
the adenovirus major late promoter. Expression vectors
for use in mammalian
cells include pZP-1 and pZP-9, which have been deposited
with the American
2o Type Culture Collection, Rockville, MD USA under accession
numbers 98669
and 98668, respectively.
Drug selection is generally used to select for cultured
mammalian cells info which foreign DNA has been inserted.
Such cells are
commonly referred to as "transfectants". Cells that have
been cultured in the
2 s presence, of the selective agent and are able to pass the
gene of interest to
their progeny are referred to as "stable transfectants."
A preferred selectable
marker is a gene encoding resistance to the antibiotic
neomycin. Selection is
carried out in the presence of a neomycin-type drug, such
as G-418 or the
like. Selection systems can also be used to increase the
expression level of
3 o the gene of interest, a process referred to as "amplification."
Amplification ~ is
carried out by culturing transfectants in the presence
of a low level of the
selective agent and then increasing the amount of selective
agent to select for
cells that produce high levels of the products of the introduced
genes. A
preferred amplifiable selectable marker is dihydrofolate
reductase, which
3 s confers resistance to methotrexate. Other drug resistance
genes (e.g.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
24
hygromycin resistance, multi-drug resistance, puromycin acetyltransferase)
can also be used.
Other higher eukaryotic cells can also be used as hosts, '
including insect cells, plant cells and avian cells. The use of Agrobacterium
rhizogenes as a vector for expressing genes in plant cells has been reviewed
by Sinkar et al., J. Biosci. (Bangalore) 11:47-58, 1987. Transformation of
insect cells and production of foreign polypeptides therein is disclosed by
Guarino et al., U.S. Patent No. 5,162,222 and WIPO publication WO
94/06463.
to Insect cells can be infected with recombinant baculovirus,
commonly derived from Autographa califomica nuclear polyhedrosis
virus
(AcNPV) using methods commonly known in the art. See, King
and Possee,
The Baculovirus Expression System: A Laboratory Guide,
London, Chapman
& Hall; O'Reilly et al., Baculovirus Expression Vectors:
A Laboratory Manual,
New York, Oxford University Press., 1994; and Richardson,
Ed., Baculovirus
Expression Protocols. Methods in Molecular Biolo4v, Humana
Press, Totowa,
NJ, 1995. Recombinant baculovirus can also be produced
through the use of
a transposon-based system described by Luckow et al. (J.
Viral. 67:4566-
4579, 1993). This system, which utilizes transfer vectors,
is commercially
2 o available in kit form (Bac-to-BacT"" kit; Life Technologies,
Rockville, MD). The
transfer vector (e.g., pFastBac1T""; Life Technologies)
contains a Tn7
transposon to move the DNA encoding the protein of interest
into a
baculovirus genome maintained in E. coli as a large plasmid
called a
"bacmid." See, Hill-Perkins and Possee, J. Gen. ViroL 71:971-976,
1990;
Bonning et al., J. Gen. Viral. 75:1551-1556, 1994; and
Chazenbalk and
Rapoport, J. Biol. Chem. 270:1543-1549, 1995.
Fungal cells, including yeast cells, can also be used within
the
present invention. Yeast species of particular interest
in this regard include
Saccharomyces cerevisiae, Pichia pastoris, and Pichia mefhanolica.
Methods
3 o for transforming S. cerevisiae cells with exogenous DNA
and producing
recombinant polypeptides therefrom are disclosed by, for
example, Kawasaki,
U.S. Patent No. 4,599,311; Kawasaki et al., U.S. Patent
No. 4,931,373;
Brake, U.S. Patent No. 4,870,008; Welch et al., U.S. Patent
No. 5,037,743;
and Murray et al., U.S. Patent No. 4,845,075. Transformed
cells are selected
by phenotype determined by the selectable marker, commonly
drug
resistance or the ability to grow in the absence of a particular
nutrient (e.g.,
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
leucine). A preferred vector system for use in Saccharomyces
cerevisiae is
the POTS vector system disclosed by Kawasaki et al. (U.S.
Patent No.
4,931,373), which allows transformed cells to be selected
by growth in
glucose-containing media. Suitable promoters and terminators
for use i
n
s yeast include those from glycolytic enzyme genes {see, e.g.,
Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No. 4,615,974;
and Bitter
,
U.S. Patent No. 4,977,092) and alcohol dehydrogenase genes.
See also U.S.
Patents Nos. 4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including Hansenula
polymorpha,
1 o Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces
fragilis,
Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii and
Candida maltosa are known in the art. See, for example, Gleeson
et al.
J.
,
Gen. Microbiol. 132:3459-3465, 1986 and Cregg, U.S. Patent
No. 4,882,279.
Aspergillus cells may be utilized according to the methods
of McKnight et al.,
U.S. Patent No. 4,935,349. Methods for transforming Acremonium
chrysogenum are disclosed by Sumino et al., U.S. Patent No.
5,162,228.
Methods for transforming Neurospora are disclosed by Lambowitz,
U.S.
Patent No. 4,486,533. The use of Pichia methanolica as host
for the
production of recombinant proteins is disclosed in U.S. Patents
Nos.
20 5,716,808, 5,736,383, 5,854,039, and 5,888,768; and WIPO
Publications WO
97/17450 and W097/17451.
Prokaryotic host cells, including strains of the bacteria
Escherichia coli, Bacillus and other genera are also useful
host cells within th
e
present invention. Techniques for transforming these hosts
and expressing '
25 foreign DNA sequences cloned therein are well known in the
art (see, e.g.,
Sambrook et al., ibid.). When expressing a zkun5 polypeptide
in bacteria
such as E. coli, the polypeptide may be retained in the cytoplasm,
typically as
insoluble granules, or may be directed to the periplasmic
space by a bacterial
secretion sequence. In the former case, the cells are lysed,
and the granules
3 o are recovered and denatured using, for example, guanidine
isothiocyanate or
urea. The denatured poiypeptide can then be refolded and
dimerized by
diluting the denaturant, such as by dialysis against a solution
of urea and a
combination of reduced and oxidized glutathione, followed
by dialysis against
a buffered saline solution. In the latter case, the polypeptide
can be
3 s recovered from the periplasmic space in a soluble and functional
form by
d isrupting the cells {by, for example, sonication or osmotic
shock) to release
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
26
the contents of the periplasmic space and recovering the protein,
thereby
obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured according to
conventional procedures in a culture medium containing nutrients
and other
components required for the growth of the chosen host cells. A
variety of
suitable media, including defined media and complex media, are
known in the
art and generally include a carbon source, a nitrogen source, essential
amino
acids, vitamins and minerals. Media may also contain such components
as
growth factors or serum, as required. The growth medium will generally
select
1 o for cells containing the exogenously added DNA by, for example,
A! drug
selection or deficiency in an essential nutrient which is complemented
by the
selectable marker carried on the expression vector or co-transfected
into the
host cell.
ZkunS polypeptides, particularly shorter polypeptides, can also
be prepared through chemical synthesis according to methods known
in the
art, including exclusive solid phase synthesis, partial solid phase
methods,
fragment condensation or classical solution synthesis. See, for
example,
Merrifield, J. Am. Chem. Soc. 85:2149, 1963; Stewart et al., Solid
Phase
Peptide Synthesis (2nd edition), Pierce Chemical Co., Rockford,
IL, 1984;
2 o Bayer and Rapp, Chem. Pept. Prot. 3:3, 1986; and Atherton et al.,
Solid
Phase Peptide S~rnthesis: A Practical Approach, IRL Press, Oxford,
1989.
It is preferred to purify the proteins of the present invention
to
>_80% purity, more preferably to >_90% purity, even more preferably
>_95%
purity, and particularly preferred is a pharmaceutically pure state,
that is
greater than 99.9% pure with respect to contaminating macrorriolecules,
particularly other proteins and nucleic acids, and free of infectious
and
pyrogenic agents. Preferably, a purified protein is substantially
free of other
proteins, particularly other proteins of animal origin.
Zkun5 proteins are purified by conventional protein purification
3 o methods, typically by a combination of chromatographic techniques.
For
example, polypeptides comprising a polyhistidine affinity tag (typically
about 6
histidine residues) are purified by affinity chromatography on
a nickel chelate
resin. See, for example, Houchuli et al., BiolTechnol. 6: 1321-1325,
1988.
Using methods known in the art, zkun5 proteins can be
produced glycosylated or non-glycosylated; pegylated or non-pegylated;
and
may or may not include an initial methionine amino acid residue.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
27
The zkun5 proteins are contemplated for the preparation
of
medicaments for use in the treatment or prevention of conditions
associated
with excessive proteinase activity, in particular an excess
of trypsin, plasmin,
kallikrein, elastase, cathepsin G, proteinase-3, thrombin,
factor Vlla, factor
IXa, factor Xa, factor Xla, factor Xlla, or matrix metalloproteinases.
Such
conditions include, but are not limited to, acute pancreatitis,
cardiopulmonary
bypass (CPB)-induced pulmonary injury, allergy-induced
protease release,
deep vein thrombosis, myocardial infarction, shock (including
septic shock),
hype~brinolytic hemorrhage, emphysema, rheumatoid arthritis,
adult
to respiratory distress syndrome, chronic inflammatory bowel
disease, psoriasis,
and other inflammatory conditions. ZkunS-containing medicaments
are also
contemplated for use in preservation of platelet function,
organ preservation,
and wound healing.
Zkun5 proteins may be useful in the treatment of conditions
~5 arising from an imbalance in hemostasis, including acquired
coagulopathies,
primary fibrinolysis and fibrinolysis due to cirrhosis,
and complications from
high-dose thrombolytic therapy. Acquired coagulopathies
can result from liver
disease, uremia, acute disseminated intravascular coagulation,
post-
cardiopulmonary bypass, massive transfusion, or Warfarin
overdose
20 (Humphries, Transfusion Medicine 1:1181-1201, 1994). A
deficiency or
dysfunction in any of the procoaguiant mechanisms predisposes
the patient to
either spontaneous hemorrhage or excess blood loss associated
with trauma
or surgery. Acquired coagulopathies usually involve a combination
of
deficiencies, such as deficiencies of a plurality of coagulation
factors, and/or
25 platelet dysfunction. In addition, patients with liver
disease commonly
experience increased fibrinolysis due to an inability to
maintain normal levels
of a2-antiplasmin and/or decreased hepatic clearance of
plasminogen
activators (Shuman, Hemorrhagic Disorders, in Bennet and
Plurn, eds. Cecil
Textbook of Medicine, 20th ed., W.B. Saunders Co., 1996).
Primary
3 o fibrinolysis results from a massive release of plasminogen
activator.
Conditions associated with primary fibrinolysis include
carcinoma of the
. prostate, acute promyelocytic leukemia, hemangiomas, and
sustained release
of plasminogen activator by endothelial cells due to injection
of venoms. The
condition becomes critical when enough plasmin is activated
to deplete the
35 circulating level of a2-antiplasmin (Shuman, ibid.). Data
suggest that plasmin
on endothelial cells may be related to the pathophysiology
of bleeding or
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
28
rethrombosis observed in patients undergoing high-dose thrombolytic therapy
for thrombosis. Plasmin may cause further damage to the thrombogenic
surface of blood vessels after thrombolysis, which may result in rethrombosis
(~kajima, J. Lab. Chn. Med. 126:1377-1384, 1995).
s Additional antithrombotic uses of zkun5 proteins include
treatment or prevention of deep vein thrombosis, pulmonary embolism, and
post-surgical thrombosis.
Zkun5 proteins may also be used within methods for inhibiting
blood coagulation in mammals, such as in the treatment of disseminated
to intravascular coagulation. ZkunS proteins may thus be used in place of
known anticoagulants such as heparin, coumarin, and anti-thrombin lll. Such
methods will generally include administration of the protein in an amount
sufficient to produce a clinically significant inhibition of blood
coagulation.
Such amounts will vary with the nature of the condition to be treated, but can
15 be predicted on the basis of known assays and experimental animal models,
and will in general be within the ranges disclosed below.
Zkun5 proteins may also find therapeutic use in the blockage of
proteolytic tissue degradation. Proteotysis of extracellular matrix,
connective
tissue, and other tissues and organs is an element of many diseases. This
2 o tissue destruction is beleived to be initiated when plasmin activates one
or
more matrix metalloproteinases (e.g., collagenase and metallo-elastases).
Inhibition of plasmin by zkun5 proteins may thus be beneficial in the
treatment
of these conditions.
Matrix metalloproteinases (MMPs) are believed to play a role in
25 metastases of cancers, abdominal aortic aneurysm, multiple sclerosis,
fieumatoid arthritis, osteoarthritis, trauma and hemorrhagic shock, and
cornial
ulcers. MMPs produced by tumor cells break down and remodel tissue
matrices during the process of metastatic spread. There is evidence to
suggest that MMP inhibitors may block this activity (Brown, Advan. Enzyme
o Regul. 35:293-301, 1995). Abdominal aortic aneurysm is characterized by the
degradation of extracellular matrix and foss of structural integrity of the
aortic
wall. Data suggest that ptasmin may be important in the sequence of events
leading to this destruction of aortic matrix (Jean-Claude et al., Surgery
116:472-478, 1994). Proteolytic enzymes are also believed to contribute to
3 s the inflammatory tissue damage of multiple sclerosis (Gijbels, J. Clin.
Invest.
94:2177-2182, 1994). Rheumatoid arthritis is a chronic, systemic
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
29
inflammatory disease predominantly affecting joints and
other connective
tissues, wherein proliferating inflammatory tissue (panus)
may cause joint
deformities and dysfunction (see, Arnett, in Cecil Textbook
of Medicine, ibid.).
Osteoarthritis is a chronic disease causing deterioration
of the joint cartilage
s and other joint tissues and the formation of new bone (bone
spurs) at the
margins of the joints. There is evidence that MMPs participate
in the
degradation of collagen in the matrix of osteoarthritic
articular cartilage.
Inhition of MMPs results in the inhibition of the removal
of collagen from
cartilage matrix (Spirito, Inflam. Res. 44 (supp. 2):S131-S132,
1995; O'Byme,
,:; to Inflam. Res. 44 (supp. 2):S117-S118, 1995; Karran, Ann.
Rheumatic Disease
54:662-669, 1995). ZkunS proteins may also be useful in
the treatment of
trauma and hemorrhagic shock. Data suggest that administration
of an MMP
inhibitor after hemorrhage improves cardiovascular response,
hepatocellular
function, and microvascular blood flow in various organs
{Wang, Shock 6:377-
15 382, 1996). Corneal ulcers, which can result in blindness,
manifest as a
breakdown of the collagenous stromal tissue. Damage due
to thermal or
chemical injury to corneal surfaces often results in a
chronic wound-healing
situation. There is direct evidence for the role of MMPs
in basement
membrane defects associated with failure to re-epithelialize
in comes or skin
20 (Fini, Am. J. Pathol. 149:1287-1302, 1996).
The zkun5 proteins of the present invention may be combined
with other therapeutic agents to augment the activity (e.g.,
antithrombotic or
anticoagulant activity) of such agents. For example, a
zkun5 protein may be
used in combination with tissue plasminogen activator in
thrombolytic therapy.
2s Doses of zkun5 proteins will vary according to the severity
of the
condition being treated and may range from approximately
pglkg to 10
mg/kg body weight, preferably 100 uglkg to 5 mg/kg, more
preferably 100
wg/kg to 1 mg/kg. The proteins formulated in a pharmaceutically
acceptable
carrier or vehicle. It is preferred to prepare them in
a form suitable for
3 o injection or infusion, such as by dilution with with sterile
water, an isotonic
saline or glucose solution, or similar vehicle. In the
alternative, the protein
may be packaged as a lyophilized powder, optionally in
combination with a
pre-measured diluent, and resuspended immediatety prior
to use.
Pharmaceutical compositions may further include one or
more excipients,
35 preservatives, solubilizers, buffering agents, albumin
to prevent protein loss
on vial surfaces, etc. Formulation methods are within the
level of ordinary skill
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
in the art. See, Reminaton: The Science and Practice of
Pham~ac_y, Gennaro,
ed., Mack Publishing Co., Easton, PA, 19th ed., 1995.
Gene therapy provides an alternative therapeutic approach
for
delivery of zkun5 proteins. If a mammal has a mutated or
absent zkun5 gene,
5 a polynucleotide encoding a zkun5 protein can be introduced
into the cells of
the mammal. In one embodiment, a gene encoding a zkun5 protein
is
introduced in vivo in a viral vector. Such vectors include
an attenuated or
defective DNA virus, such as herpes simplex virus (HSV),
papillomavirus,
Epstein Barr virus (EBV), adenovirus, adeno-associated virus
(AAV), and the
Z o like. Defective viruses, which entirely or almost entirely
lack viral genes, are
preferred. A defective virus is not infective after introduction
into a cell. Use
of defective viral vectors allows for administration to
cells in a specific,
localized area, without concern that the vector can infect
other cells.
Examples of particular vectors include, without limitation,
a defective herpes
15 simplex virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell.
Neurosci. 2:320-30,
1991 ); an attenuated adenovirus vector, such as the vector
described by
Stratford-Perricaudet et al., J. Clin. Invest. 90:626-30,
1992; and a defective
adeno-associated virus vector (Samulski et al., J. Viral.
61:3096-101, 1987;
Samulski et al., J. Viral. 63:3822-8, 1989).
2 o Within another embodiment, a zkun5 polynucleotide can be
introduced in a retroviral vector, as described, for example,
by Anderson et
al., U.S. Patent No. 5,399,346; Mann et al. Cell 33:153,
1983; Temin et al.,
U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No.
4,980,289;
Markowitr et al., J. Viral. 62:1120, 1988; Temin et al.,
U.S. Patent No.
25 5,124,263; Dougherty et al., WIPO Publication No. WO 95107358;
and Kuo et
al., Blood 82:845, 1993. Alternatively, the vector can be
introduced by
lipofection in vivo using iiposomes. Synthetic cationic
lipids can be used to
prepare liposomes for in vivo transfection of a gene encoding
a marker
(Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7, 1987;
Mackey et al.,
3 o Proc. Natl. Acad. Sci. USA 85:8027-31, 1988).
Within a further embodiment, target cells are removed from
the
body, and a vector is introduced into the cells as a naked
DNA plasmid. The
transformed cells are then re-implanted into the body. Naked
DNA vectors for
gene therapy can be introduced into the desired host cells
by methods known
in the art, e.g., transfection, electroporation, microinjection,
transduction, cell
fusion, DEAE dextran, calcium phosphate precipitation, use
of a gene gun or
CA 02329694 2000-11-28
WO 99/61615 PCT/US99I11628
31
use of a DNA vector transporter. See, for example, Wu et
al., J. Biol. Chem.
267:963-7, 1992; Wu et al., J. Biol. Chem. 263:14621-4,
1988.
Zkun5 proteins can also be used to prepare antibodies that
specifically bind to zkun5 proteins. As used herein, the
term "antibodies"
includes polyclonal antibodies, monoclonal antibodies, antigen-binding
fragments thereof such as F(ab')2 and Fab fragments, single
chain antibodies,
and the tike, including genetically engineered antibodies.
Non-human
antibodies can be humanized by grafting only non-human CDRs
onto human
framework and constant regions, or by incorporating the
entire non-human
1 o variable domains (optionally "cloaking" them with a human-tike
surface by
replacement of exposed residues, wherein the result is a
"veneered"
antibody). In some instances, humanized antibodies may retain
non-human
residues within the human variable region framework domains
to enhance
proper binding characteristics. Through humanizing antibodies,
biological
half life may be increased, and the potential for adverse
immune reactions
upon administration to humans is reduced. One skilled in
the art can
generate humanized antibodies with specific and different
constant domains
(i.e., different Ig subclasses) to facilitate or inhibit
various immune functions
associated with particular antibody constant domains. Alternative
techniques
2 o for generating or selecting antibodies useful herein include
in vitro exposure of
lymphocytes to a zkun5 protein, and selection of antibody
display libraries in
phage or similar vectors (for instance, through use of immobilized
or labeled
zkun5 polypeptide). Antibodies are defined to be specifically
binding if they
bind to a zkun5 protein with an affinity at least 10-fold
greater than the binding
2s affinity to control (non-zkun5) polypeptide. It is preferred
that the antibodies
exhibit a binding affinity (Ka) of 106 M-' or greater, preferably
107 M'' or
greater, more preferably 108 M-' or greater, and most preferably
10g M-' or
greater. The affinity of a monoclonal antibody can be readily
determined by
one of ordinary skill in the art (see, for example, Scatchard,
Ann. NY Acad.
3 o Sci. 51: 660-672, 1949).
Methods for preparing polyclonal and monoclonal antibodies
are
well known in the art (see for example, Hurrell, J. G. R.,
Ed., Monoclonal
Hybridoma Antibodies: Techniques and Applications, CRC Press,
Inc., Boca
Raton, FL, 1982). As would be evident to one of ordinary
skill in the art,
35 polyclonal antibodies can be generated from a variety of
warm-blooded
animals such as horses, cows, goats, sheep, dogs, chickens,
rabbits, mice,
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
32
and rats. The immunogenicity of a zkun5 protein may be increased through
the use of an adjuvant such as alum (aluminum hydroxide) or Freund's
complete or incomplete adjuvant. Polypeptides useful for immunization also
include fusion poiypeptides, such as fusions of a zkun5 protein or a portion
thereof with an immunoglobulin polypeptide or with maltose binding protein.
The polypeptide immunogen may be a full-length molecule or a portion
thereof. If the polypeptide portion is "hapten-like", such portion may be
advantageously joined or linked to a macromolecular carrier (such as keyhole
limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for
to immunization.
Immunogenic zkun5 polypeptides may be as small as 5
residues. It is preferred to use polypeptides that are hydrophilic or comprise
a
~; hydrophilic region. A preferred such region of SEQ ID N0:2 includes
residues
43-59.
A variety of assays known to those skilled in the art can be
utilized to detect antibodies that specifically bind to a zkun5 protein.
Exemplary assays are described in detail in Antibodies: A Laboratory Manual,
Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988.
Representative examples of such assays include concurrent
2o immunoelectrophoresis, radio-immunoassays, radio-immunoprecipitations,
enzyme-linked immunosorbent assays (ELISA), dot blot assays, Western blot
assays, inhibition or competition assays, and sandwich assays.
Antibodies to zkun5 may be used for affinity purification of zkun5
proteins; within diagnostic assays for determining circulating levels of zkun5
proteins; for detecting or quantitating soluble zkun5 protein as a marker of
underlying pathology or disease; for immunolocalization within whole animals
or tissue sections, including immunodiagnostic applications; for
immunohistochemistry; for screening expression libraries; and for other uses
that will be evident to those skilled in the art. For certain applications,
3 o including in vitro and in vivo diagnostic uses, it is advantageous to
employ
labeled antibodies. Suitable direct tags or labels include radionuclides,
enzymes, substrates, cofactors, inhibitors, fluorescent markers,
chemiluminescent markers, magnetic particles and the like; indirect tags or
labels may feature use of biotin-avidin or other complement/anti-complement
3 5 pairs as intermediates.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
33
ZkunS proteins may be used in the laboratory or commercial
preparation of proteins from cultured cells. The proteins
can be used alone
to inhibit specific proteolysis or can be combined with
other proteinase
inhibitors to provide a "cocktail" with a broad spectrum
of activity. Of particular
interest is the inhibition of cellular proteases, which
can be release during cell
lysis. The proteins can also be used in the laboratory as
a tissue culture
additive to prevent cell detachment.
The present invention also provides reagents for use in
diagnostic applications. For example, the zkun5 gene, a
probe comprising
;4 to zkun5 DNA or RNA or a subsequence thereof can be used to
determine if the
zkun5 gene is present on chromosome 7 or if a mutation has
occurred.
Detectable chromosomal aberrations at the zkun5 gene locus
include, but are
not limited to, aneuploidy, gene copy number changes, insertions,
deletions,
restriction site changes and rearrangements. Such aberrations
can be
detected using polynucleotides of the present invention
by employing
molecular genetic techniques, such as restriction fragment
length
polymorphism (RFLP) analysis, short tandem repeat (STR)
analysis
employing PCR techniques, and other genetic linkage analysis
techniques
known in the art (Sambrook et al., ibid.; Ausubel et. al.,
ibid.; Marian, Chest
2 0 108:255-65, 1995).
Zkun5 polynucleotides can also be used for chromosomal
mapping. The human zkun5 gene has be localized to 7p22.2-p22.1.
Localization of the zkun5 gene facilitates the establishment
of directly
proportional physical distances between newly discovered
genes of interest
2s and previously mapped markers, including zkun5. The precise
knowledge of
a gene's position can be useful for a number of purposes,
including: 1 )
determining if a newly identified sequence is part of an
previously identified
gene or gene segment and obtaining additional surrounding
genetic
sequences in various forms, such as YACs, BACs or cDNA clones;
2)
3 o providing a possible candidate gene for an inheritable disease
which shows
linkage to the same chromosomal region; and 3) cross-referencing
model
organisms, such as mouse, which may aid in determining what
function a
particular gene might have. A useful technique in this regard
is radiation
hybrid mapping, a somatic cell genetic technique developed
for constructing
35 high-resolution, contiguous maps of mammalian chromosomes
(Cox et al.,
Science 250:245-50, 1990). Partial or full knowledge of
a gene's sequence
CA 02329694 2000-11-28
WO 99161615 PCT/US99/11628
34
allows one to design PCR primers suitable for use with chromosomal radiation
hybrid mapping panels. Radiation hybrid mapping panels, which are
commercially available (e.g., the Stanford G3 RH Panel and the GeneBridge 4
RH Panel, available from Research Genetics, Inc., Huntsville, AL), cover the
entire human genome. These panels enable rapid, PCR-based chromosomal
localizations and ordering of genes, sequence-tagged sites (STSs), and other
nonpolymorphic and polymorphic markers within a region of interest.
Sequence tagged sites (STSs) can also be used independently
for chromosomal localization. An STS is a DNA sequence that is unique in
1 o the human genome and can be used as a reference point for a particular
chromosome or region of a chromosome. An STS is defined by a pair of
oligonucleotide primers that are used in a polymerase chain reaction to
specifically detect this site in the presence of all other genomic sequences.
Since STSs are based solely on DNA sequence they can be completely
described within an electronic database (for example, Database of Sequence
Tagged Sites (dbSTS), GenBank; National Center for Biological Information,
National Institutes of Health, Bethesda, MD; http://www.ncbi.nlm.nih.gov) and
can be searched with a gene sequence of interest for the mapping data
contained within these short genomic landmark STS sequences.
The invention is further illustrated by the following non-limiting
examples.
EXAMPLES
Example 1
The 139-nucleotide sequence of an expressed sequence tag
(EST) was analyzed and found to encode a C-terminal portion of a Kunitz
domain. A clone corresponding to this EST was obtained and sequenced.
The clone contained the sequence shown in SEQ ID N0:1. This Kunitz
3 o domain sequence was designatied "zkun5°.
Analysis of tissue distribution of zkun5 was performed by
Northern blotting (using Human Multiple Tissue Blots I, II, and III, and Human
RNA Master blot from Clontech Laboratories, Inc., Palo Alto, CA). A probe
was made from a gel-purified EcoRl-Xhol fragment of the origninal zkun5
3 5 clone, and was radioactively labeled using a commercially available
labeling
kit (Rediprime'''" DNA labeling system, Amersham Corp., Arlington Heights, IL)
CA 02329694 2000-11-28
WO 99!61615 PCT/US99/11628
according to the manufacturer's specifications. The probe was purified using
a commercially available push column (NucTrapC~ column; Stratagene, La
Jolla, CA; see U.S. Patent No. 5,336,412). A commercially available
hybridization solution (ExpressHybT"' Hybridization Solution; Clontech
5 Laboratories, Inc., Palo Alto, CA) was used for prehybridization and as a
hybridization solution for the blots. Hybridization took place overnight at
65°C,
and the blots were then washed in 2X SSC and 0.05% SDS at room
temperature, followed by a wash in 0.1 X SSC and 0.1 % SDS at 55°C. Two
major transcript were observed at sizes of 7.5 kb and 5.0 kb. Signals were
;~ to present in many tissues, including spinal cord, trachea, heart, colon,
small
,;
intestine, stomach, placenta, skeletal muscle, kidney, pancreas, prostate,
testis, thyroid, and adrenal gland. The RNA appeared to be subject to a
tissue specific splicing event since trachea, testis and placenta give
different
size bands from the others.
is
Examale 2
Based on the tissue distribution from the Northern blotting
experiments (see Example 1 ), 5' RACE was performed on cDNAs made from
several tissues including pancreas, heart, stomach and testis. The cDNAs
2 o were prepared using a a commercially available kit (MarathonTM cDNA
Amplification Kit from Clontech Laboratories, Inc., Palo Alto, CA) and an
oligo(dT) primer.
To amplify the zkun5 DNA, 5 pl each of 1/100 diluted cDNAs, 20
pmoles each of oligonucleotide primers ZC9739 (SEQ ID N0:12) and
2s ZC15,999 (SEQ ID N0:13), and 1 U of a 2:1 mixture of ExTaqTM DNA
polymerase (TaKaRa Biomedicals) and Pfu DNA polymerasse (Stratagene,
La Jolla, CA) (ExTaqlPfu) were used in 25-wl reaction mixtures. The reaction
mixtures were incubated at 94°C for 2 minutes; 25 cycles of 94°C
for 15
seconds, 66°C for 20 seconds, and 72°C for 30 seconds; and a 1-
minute
3o incubation at 72°C. 1 p.l each of 1/100 diluted first PCR product
was used as
template for a nested PCR. 20 pmoles each of oligonucleotide primers
ZC9719 (SEQ ID N0:14) and ZC15,998 {SEQ ID N0:15), and 1 U of
ExTaqlPfu were used in 25-~I reaction mixtures. The mixtures were incubated
at 94°C for 2 minutes; 2 cycles of 94°C for 15 seconds,
66°C for 20 seconds,
3 s 72°C for 30 seconds; 25 cycles of 94°C for 15 seconds,
64°C for 20 seconds,
72°C for 30 seconds; and a 1-minute incubation at 72°C. The PCR
products
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
36
were gel purified and sequenced. Sequencing results indicated
that the PCR
products extended the original EST clone to include an intact
Kunitz domain.
The sequence of the PCR-generated clone is shown in SEQ
ID N0:9.
To construct an expression vector for the zkun5 Kunitz dom
i
a
n,
PCR was performed on cDNA prepared from pancreas as disclosed
above.
Based on the domain comparison with other known Kunitz domains
i
, pr
mers
were designed such that the PCR product would encode an
intact Kunitz
domain with restriction sites Bam HI in sense primer ZC17,238
(SEQ ID
N0:16) and Xho I in antisense primer ZC17,240 (SEQ ID N0:17)
to facilitate
i o subcloning into an expression vector. A silent mutation
(nucleotide T to C)
was introduced in the sense primer ZC17,238 (SEQ ID N0:16)
to remove an
internal Bam HI site within the Kunitz domain sequence.
5 pl of 1/100 diluted
cDNA, 20 pmoles each of oligonucleotide primers ZC17,238
(SEQ !D N0:16)
and ZC17,240 (SEQ ID N0:17), and 1 U of ExTaqIPfu were used
in 25-~I
reaction mixtures. The mixtures were incubated at 94C for
2 minutes; 3
cycles of 94C for 30 seconds, 50C for 30 seconds, 72C for
30 seconds; 35
cycles of 94C for 30 seconds, 68C for 30 seconds; and a
7-minute
incubation at 72C. The PCR product was gel purified and
restriction digested
with Bam HI and Xho I overnight.
2 o A mammalian expression vector was constructed with the
dihyrofolate reductase gene selectable marker under control
of the SV40 early
promoter, SV40 polyadenylation site, a cloning site to insert
the gene of
interest under control of the mouse metallothionein 1 (MT-1
) promoter and the
hGH polyadenylation site. The expression vector was designated
pZP-9 and
has been deposited at the American Type Culture Collection,
12301 Parklawn
Drive, Rockville, MD under accession no 98668. To facilitate
protein
purification, the pZP9 vector was modified by addition of
a tissue plasminogen
activator (t-PA) secretory signal sequence (see U.S. Patent
No. 5,641,655)
and a GIuGIu tag sequence (SEQ ID N0:18) between the MT-1
promoter and
3 o hGH terminator. The t-PA secretory signal sequence replaces
the native
secretory signal sequence for DNAs encoding polypeptides
of interest that are
inserted into this vector, and expression results in an
N-terminally tagged
protein. The N-terminally tagged vector was designated pZP9NEE.
The
vector was digested with Bam HI and Xho I, and the zkun5
fragment was
inserted. The resulting construct was confirmed by sequencing.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
37
Example 3
The human zkun5 gene was mapped to chromosome 7 using
the commercially available GeneBridge 4 Radiation Hybrid
Panel (Research
Genetics, Inc., Huntsville, AL). The GeneBridge 4 Radiation
Hybrid Panel
contains PCRable DNAs from each of 93 radiation. hybrid
clones, plus two
control DNAs (the HFL donor and the A23 recipient). A publicly
available
world-wide web server {http://www-genome.wi.mit.edulcgi-
bin/contig/rhmapper.pl) allows mapping relative to the
Whitehead Institute/MIT
Center for Genome Research's radiation hybrid map of the
human genome
to (the "WICGR" radiation hybrid map), which was constructed
with the
GeneBridge 4 Radiation Hybrid Panel.
' For the mapping of the zkun5 gene, 20-NI reaction mixtures
~,i
were set up in a PCRable 96-well microtiter plate (Stratagene,
La Jolla, CA)
and used in a thermal cycler (RoboCycler~ Gradient 96;
Stratagene). Each of
i5 the 95 PCR reaction mixtures contained 2 girl buffer (10X
KIenTaq PCR
reaction buffer; Clontech Laboratories, Inc., Palo Alto,
CA), 1.6 NI dNTPs mix
{2.5 mM each, PERKIN-ELMER, Foster City, CA), 1 NI sense
primer
(ZC16,523; SEQ ID N0:19), 1 NI antisense primer (ZC16,522;
SEQ ID
N0:20), 2 NI of a density increasing agent and tracking
dye (RediLoad,
2o Research Genetics, Inc., Huntsville, AL), 0.4 NI of a commercially
available
DNA polymerase/antibody mix {50X AdvantageTM KIenTaq Polymerase
Mix;
Clontech Laboratories, Inc.), 25 ng of DNA from an individual
hybrid clone or
control and x NI ddH20, for a total volume of 20 NI. The
mixtures were
overlaid with an equal amount of mineral oil and sealed.
The PCR cycler
2s conditions were as follows: an initial 5 minute denaturation
at 95C; 35 cycles
of a 1 minute denaturation at 95C, 1 minute annealing at
64C, and 1.5
minute extension at 72C; followed by a final extension
of 7 minutes at 72C.
The reaction products were separated by electrophoresis
on a 2% agarose
gel (Life Technologies, Gaithersburg, MD).
3 o The results showed that the zkun5 gene maps 2.74 cR_3000
from the framework marker D7S481 on the chromosome 7 WICGR
radiation
hybrid map. Proximal and distal framework markers were
D7S481 and
CHLC.GATA84A08, respectively. The use of surrounding markers
positions
the zkun5 gene in the 7p22.2-p22.1 region on the integrated
LDB
35 chromosome 7 map (The Genetic Location Database, University
of
Southhampton, WWW server: http://cedar.genetics. soton.ac.uklpublic
htmln.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
38
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of
illustration, various modifications may be made without deviating from the
s spirit and scope of the invention. Accordingly, the invention is not limited
except as by the appended claims.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> KUNITZ DOMAIN POLYPEPTIDE AND MATERIALS
AND METHODS FOR MAKING IT
<130> 98-22PC
<150> US 09/086,253
<151> 1998-05-28
;r
<160> 20
<170> FastSEQ for Windows Version 3.0
,:;
t;
<210> 1
<211> 186
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)...(186)
<400> 1
gtg gat ggg gca gag gac cct aga tgt ttg gaa gcc ttg aag cct gga 48
Val Asp Gly Ala Glu Asp Pro Arg Cys Leu Glu Ala Leu Lys Pro Gly
1 5 10 15
aac tgt ggt gaa tat gtg gtt cga tgg tat tat gac aaa cag gtc aac 96
Asn Cys Gly Glu Tyr Val Val Arg Trp Tyr Tyr Asp Lys Gln Val Asn
20 25 30
tct tgt gcc cga ttt tgg ttc agt ggc tgt aat ggc tca gga aat aga 144
Ser Cys Ala Arg Phe Trp Phe Ser Gly Cys Asn Gly Ser Gly Asn Arg
35 40 45
ttc aac agt gaa aag gaa tgt caa gaa acc tgc att caa gga 186
Phe Asn Ser Glu Lys Glu Cys Gln Glu Thr Cys Ile Gln Gly
50 55 60
<210> 2
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/I 1628
2
<211> 62
<212> PRT
<213> Nomo sapiens
<400> 2
Val Asp Gly Ala Glu Asp Pro Arg Cys Leu Glu Ala Leu Lys Pro Gly
1 5 10 15
Asn Cys Gly Glu Tyr Ilal llal Arg Trp Tyr Tyr Asp Lys Gln Ual Asn
20 25 . 30
Ser Cys Ala Arg Phe Trp Phe Ser Gly Cys Asn Gly Ser Gly Asn Arg
35 40 45
Phe Asn Ser Glu Lys Glu Cys Gln Glu Thr Cys Ile Gln Gly
t' S0 55 60
<210> 3
<211> 186
<212> DNA
<213> Artificial Sequence
<220>
<223> engineered variant
<221> CDS
<222> (1)...(186)
<221> misc_feature
<222> (1). .(186)
<223> n = A,T,C or G
<400> 3
gtg gat ggg gca gag gac cct aga tgt ttg gaa gcc ttg aag cct gga 48
Val Asp Gly Ala Glu Asp Pro Arg Cys Leu Glu Ala Leu Lys Pro Gly
1 5 10 15
aac tgt ggt gcn tat gtg gtt cga tgg tat tat gac aaa cag gtc aac 96
Asn Cys Gly Ala Tyr Val Ual Arg Trp Tyr Tyr Asp Lys Gln Val Asn
20 25 30
tct tgt gcc cga ttt tgg ttc agt ggc tgt aat ggc tca gga aat aga 144
Ser Cys Ala Arg Phe Trp Phe Ser Gly Cys Asn Gly Ser Gly Asn Arg
35 40 45
ttc aac agt gaa aag gaa tgt caa gaa acc tgc att caa gga 186
Phe Asn Ser Glu Lys Glu Cys Gln Glu Thr Cys Ile Gln Gly
50 55 60
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
3
<210> 4
<211> 62
<212> PRT
<213> Artificial Sequence
<220>
<223> engineered variant
<400> 4
Val Asp Gly Ala Glu Asp Pro Arg Cys Leu Glu Ala Leu Lys Pro Gly
1 5 10 15
'' Asn Cys Gly Ala Tyr Ual Val Arg Trp Tyr Tyr Asp Lys Gln Ual Asn
20 25 30
Ser Cys Ala Arg Phe Trp Phe Ser Gly Cys Asn Gly Ser Gly Asn Arg
35 40 45
Phe Asn Ser Glu Lys Glu Cys Gln Glu Thr Cys Ile Gln Gly
50 55 60
<210> 5
<211> 51
<212> PRT
<213> Artificial Sequence
<220>
<223> polypeptide motif
<221> VARIANT
<222> (2)...(2)
<223> Xaa is any residue except Asp. Cys. Gly, His, Met,
Pro. Trp or Ual
<221> VARIANT
<222> (3)...(3)
<223> Xaa is Leu. Glu, Met, Gln. Phe. Ser, Thr. Ala or
Pro
<221> VARIANT
<222> (4)...(4)
<223> Xaa is any residue except Arg, Cys. Met, Phe. Trp.
Tyr or Va 1
<221> VARIANT
<222> (5)...(5)
<223> Xaa is any residue except Asn, Cys. Gln. Gly. Phe.
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
4
Ser. Thr or Trp
<221> VARIANT
<222> (6)...(6)
<223> Xaa is Arg, Glu. Asn, Ala. Val. Asp, Lys. Ser, Tyr
or Met
<221> VARIANT
<222> (7)...(7)
<223> Xaa is any residue except Asn, Cys. Gly. His, Leu.
Met. Phe or Trp
<221> VARIANT
<222> (8)...(8)
<223> Xaa is Gly or Glu
<221> VARIANT
<222> (9)...(9)
<223> Xaa is Pro. Arg, Leu. Val, Ser, Asp. Ile. Asn or
Thr
<221> VARIANT
<222> (11)...(11)
<223> Xaa is any residue except Ala, Cys. Glu, His. Ile,
Pro, Trp and Val
<221> VARIANT
<222> (12)...(12)
<223> Xaa is Arg, Lys. Ala. Asp. Gln, Phe, Gly, Glu, Thr
and Ser
<221> VARIANT
<222> (13)...(13)
<223> Xaa is any residue except Asp, Cys, Glu, Pro. Thr
or Trp
<221> VARIANT
<222> (14)...(14)
<223> Xaa is any residue except Arg, Asn. Cys, Gly, His,
Ser, Trp or Tyr
<221> VARIANT
<222> (15)...(15)
<223> Xaa is any residue except Ala, Asp, Cys, Gly, His.
Met. Trp or Tyr
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
<221> VARIANT
<222> (16)...(16)
<223> Xaa is Ser, Ala, Arg, Val. Gln. Lys, Leu, Gly or
Ile
<221> VARIANT
<222> (17)...(17)
<223> Xaa is Phe. Tyr. Ile. Trp or Leu
<221> VARIANT
<222> (18)...(18)
<223> Xaa is Tyr, His. Phe. Trp. Asn or Ala
<221> VARIANT
<222> (19)...(19)
<223> Xaa is Tyr or Phe
<221> VARIANT
<222> (20)...(20)
<223> Xaa is Lys, Asn, Ser or Asp
<221> VARIANT
<222> (21)...(21)
<223> Xaa is any residue except Asp, Cys. Glu, His or Tyr
<221> VARIANT
<222> (22)...(22)
<223> Xaa is any residue except Cys. Met. Pro or Trp
<221> VARIANT
<222> (23)...(23)
<223> Xaa is Ala. Lys, Ser. Leu. Thr. Ile. Gln. Glu. Tyr or Val
<221> VARIANT
<222> (24)...(24)
<223> Xaa is Lys, Gln. Asn. His, Gly. Arg or Met
<221> VARIANT
<222> (25)...(25)
<223> Xaa is any residue except Asn, Asp, Cys. His, Ile, Pro. Trp.
Tyr or Val
<221> vARiANT
<222> (27)...(27)
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
6
<223> Xaa is any residue except Cys. Gly, Phe. Pro, Ser or Trp
<221> VARIANT
<222> (28)...(28)
<223> Xaa is any residue except Asp, Cys, His. Ile. Phe. Trp or Tyr
<221> VARIANT
<222> (29)...(29)
<223> Xaa is Phe or Tyr
<221> VARIANT
<222> (30)...(30)
<223> Xaa is any residue except Arg. Cys. Gly or Met
<221> VARIANT
<222> (31)...(31)
<223> Xaa is Tyr. Trp. Phe or Asp
<221> VARIANT
<222> (32)...(32)
<223> Xaa is Ser, Gly or Thr
<221> VARIANT
<222> (33)...(33)
<223> Xaa is Gly or Ile
<221> VARIANT
<222> (35)...(35)
<223> Xaa is Gly. Lys, Arg. Pro. Gln, Leu, Glu. Asn or Met
<221> VARIANT
<222> (36)...(36)
<223> Xaa is Gly. Lys or Ala
<221> VARIANT
<222> (37)...(37)
<223> Xaa is Asn, Lys or Ser
<221> VARIANT
<222> (38)...(38)
<223> Xaa is any residue except Cys, His, Ile, Phe. Pro, Thr, Trp,
Tyr or Ual
<221> VARIANT
<222> (39)...(39)
CA 02329694 2000-11-28
WO 99!61615 PCT/US99/11628
7
<223> Xaa is Asn or Tyr
<221> VARIANT
<222> (40)...(40)
<223> Xaa is Arg, Asn. Lys. Gln or Val
<221> VARIANT
<222> (41)...(41)
<223> Xaa is Phe, Tyr or Asp
<221> VARIANT
<222> (42)...(42)
<223> Xaa is any residue except Cys. Gln, Gly, Phe or Trp
<221> VARIANT
<222> (43)...(43)
<223> Xaa is Thr, Ser, Arg, Lys or As
P
<221> VARIANT
<222> (44)...(44)
<223> Xaa is Ile. Leu. Trp. Arg. Lys. Thr, Glu. Ala, Gln or Val
<221> VARIANT
<222> (45)...(45)
<223> Xaa is Glu. Asp, Ala. His. Met. Val. Gln. Lys. Arg or Pro
<221> VARIANT
<222> (46)...(46)
<223> Xaa is Glu, Lys. Gln. Asp, Ala or Tyr
v' <221> VARIANT
<222> (48)...(48)
<223> Xaa is any residue except Ala. Cys, Gly. Phe. Pro, Ser. Thr,
Trp or Tyr
<221> VARIANT
<222> (49)...(49)
<223> Xaa is any residue except Cys, Ile. Leu. Met. Phe. Pro. Ser.
Tyr or Val
<221> VARIANT
<222> (50)...(50)
<223> Xaa is Thr, Ala. Val, Ile. Phe. Leu, Met, Lys, Tyr or Arg
<400> 5
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/116Z8
8
Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa
20 25 30
Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa
35 40 45
Xaa Xaa Cys
<210> 6
<211> 186
<212> DNA
'' <213> Artificial Sequence
<220>
<223> degenerate DNA
<221> misc_feature
<222> (1). .(186)
<223> n = A,T.C or G
<400> 6
gtngayggng cngargaycc nmgntgyytn gargcnytna arccnggnaa ytgyggngar 60
taygtngtnm gntggtayta ygayaarcar gtnaaywsnt gygcnmgntt ytggttywsn 120
ggntgyaayg gnwsnggnaa ymgnttyaay wsngaraarg artgycarga racntgyath 180
carggn 186
<210> 7
<211> 186
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate ONA
<221> misc_feature
<222> (1). .(186)
<223> n = A,T,C or G
<400> 7
gtngayggng cngargaycc nmgntgyytn gargcnytna arccnggnaa ytgyggngcn 60
taygtngtnm gntggtayta ygayaarcar gtnaaywsnt gygcnmgntt ytggttywsn 120
ggntgyaayg gnwsnggnaa ymgnttyaay wsngaraarg artgycarga racntgyath 180
carggn 186
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
9
<210> $
<211> 55
<212> PRT
<213> Homo Sapiens
<400> 8
Thr Asp Ile Cys Lys Leu Pro Lys Asp Glu Gly Thr Cys Arg Asp Phe
1 5 10 15
Ile Leu Lys Trp Tyr Tyr Asp Pro Asn Thr Lys Ser Cys Ala Arg Phe
20 25 30
Trp Tyr Gly Gly Cys Gly Gly Asn Glu Asn Lys Phe Gly Ser Gln Lys
35 40 45
Glu Cys Glu Lys Val Cys Ala
50 55
'' <210> 9
<211> 2383
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)...(1674)
<221> misc_feature
<222> (1). .(2383)
<223> n = A,T,C or G
<400> 9
ggg ccc gaa gga cca aag ggt gaa ccg ggc att atg ggc cct ttt gga 48
Gly Pro Glu Gly Pro Lys Gly Glu Pro Gly Ile Met Gly Pro Phe Gly
1 5 10 15
atg cct gga aca tca att cct gga cca cct ggg cca aag gga gat aga 96
Met Pro Gly Thr Ser Ile Pro Gly Pro Pro Gly Pro Lys Gly Asp Arg
20 25 30
gga gga cct ggg ata cct gga ttt aag gga gaa cct gga ctt tct att 144
Gly Gly Pro Gly Ile Pro Gly Phe Lys Gly Glu Pro Gly Leu Ser Ile
35 40 45
cga gga cca aag ggt gtc caa ggc cct cgg gga cca gtg ggt get cca 192
Arg Gly Pro Lys Gly Val Gln Gly Pro Arg Gly Pro Val Gly Ala Pro
50 55 60
CA 02329694 2000-11-28
WO 99/61615 PCT/US99111628
gga ctc aaa ggt gat ggc tat cct ggt gtg cct gga cct cgt gga tta 240
Gly Leu Lys Gly Asp Gly Tyr Pro Gly Val Pro Gly Pro Arg Gly Leu
65 70 75 gp
cca gga ccc cct ggg ccg atg ggt tta cgt gga gtg gga gac act gga 288
Pro Gly Pro Pro Gly Pro Met Gly Leu Arg Gly Val Gly Asp Thr Gly
85 90 95
gca aag gga gag cct ggg gtc aga ggc cct cca ggt cct tct ggg cct 336
Ala Lys Gly Glu Pro Gly Val Arg Gly Pro Pro Gly Pro Ser Gly Pro
100 105 110
cgg ggc gta gga acc caa ggg cca aag ggt gat act ggg cag aaa ggc 384
Arg Gly Ual Gly Thr Gln Gly Pro Lys Gly Asp Thr Gly Gln Lys Gly
115 120 125
ttg cct ggc cct cct ggc ccc cct ggc tat gga tca cag gga att aaa 432
Leu Pro Gly Pro Pro Gly Pro Pro Gly Tyr Gly Ser Gln Gly Ile Lys
130 135 140
ggg gaa caa gga cca caa ggc ttc cca ggc cca aag ggc aca atg ggc 480
Gly Glu Gln Gly Pro Gln Gly Phe Pro Gly Pro Lys Gly Thr Met Gly
145 150 155 160
cat ggc ctc cca ggc cag aag gga gag cac gga gaa cgg ggc gat gtg 528
His Gly Leu Pro Gly Gln Lys Gly Glu His Gly Glu Arg Gly Asp Val
165 170 175
gga aag aaa ggt gat aaa gga gaa att gga gag cct gga tct cca gga 576
Gly Lys Lys Gly Asp Lys Gly Glu Ile Gly Glu Pro Gly Ser Pro Gly
180 185 190
aaa cag ggt tta caa gga ccc aaa gga gac cta gga ctt aca aaa gaa 624
Lys Gln Gly Leu Gln Gly Pro Lys Gly Asp Leu Gly Leu Thr Lys Glu
195 200 205
gaa att atc aaa ctt att aca gaa ata tgt ggt tgt ggg ccc aaa tgc 672
Glu Ile Ile Lys Leu Ile Thr Glu Ile Cys Gly Cys Gly Pro Lys Cys
210 215 220
aaa gag act cca cta gag ctg gtg ttt gtg atc gac agc tca gaa agc 720
Lys Glu Thr Pro Leu Glu Leu Val Phe Val Ile Asp Ser Ser Glu Ser
225 230 235 240
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
11
gtg ggg cca gag aac ttt cag atc att aaa aat ttt gtg aag act atg 768
Ual Gly Pro Glu Asn Phe Gln Ile Ile Lys Asn Phe Val Lys Thr Met
245 250 255
get gac cgg gtt get ctg gac ctt gcc acg gcc cgc ata ggc ata atc 816
Ala Asp Arg Val Ala Leu Asp Leu Ala Thr Ala Arg Ile Gly Ile Ile
260 265 270
aac tat agc cat aag gtg gag aag gtg get aat ttg aag cag ttc tcc 864
Asn Tyr Ser His Lys Val Glu Lys Val Ala Asn Leu Lys Gln Phe Ser
275 280 285
agc aag gat gac ttc aag ttg get gtt gac aac atg caa tat ctg ggg 912
Ser Lys Asp Asp Phe Lys Leu Ala Val Asp Asn Met Gln Tyr Leu Gly
290 295 300
gaa ggc aca tac aca gcc act get ctg caa gca gcc aac gac atg ttt 960
Glu Gly Thr Tyr Thr Ala Thr Ala Leu Gln Ala Ala Asn Asp Met Phe
305 310 315 320
gaa gat gca agg cca ggt gta aaa aaa gtg gcc ttg gtc atc act gat 1008
Glu Asp Ala Arg Pro Gly Val Lys Lys Val Ala Leu Val Ile Thr Asp
325 330 335
gga cag aca gat tct cgt gat aaa gag aaa ctg aca gag gtg gtg aag 1056
Gly Gln Thr Asp Ser Arg Asp Lys Glu Lys Leu Thr Glu Val Ual Lys
340 345 350
aat gcc agt gac acc aat gtg gag ata ttt gtg ata ggg gtg gtg aag 1104
Asn Ala Ser Asp Thr Asn Val Glu Ile Phe Val Ile Gly Val Val Lys
355 360 365
aaa aat gat ccc aac ttt gaa ata ttc cac aaa gaa atg aat cta att 1152
Lys Asn Asp Pro Asn Phe Glu Ile Phe His Lys Glu Met Asn Leu Ile
370 375 380
get act gac cca gag cat gtt tac cag ttt gat gat ttc ttt acc ctg 1200
Ala Thr Asp Pro Glu His Val Tyr Gln Phe Asp Asp Phe Phe Thr Leu
385 390 395 400
caa gac acc ctg aag caa aaa ttg ttt caa aaa att tgt gag gat ttt 1248
Gln Asp Thr Leu Lys Gln Lys Leu Phe Gln Lys Ile Cys Glu Asp Phe
405 410 415
CA 02329694 2000-11-28
WO 99/61615 PC'T/US99111628
12
gat tcc tat ctc gtt caa att ttt ggt tca tcg tca cct caa cct gga 1296
Asp Ser Tyr Leu Ual Gln Ile Phe Gly Ser Ser Ser Pro Gln Pro Gly
420 425 430
ttt ggg atg tca ggg gaa gaa ctc agt gaa tct act cca gag cct caa 1344
Phe Gly Met Ser Gly Glu Glu Leu Ser Glu Ser Thr Pro Glu Pro Gln
435 440 445
aaa gaa att tct gag tca ttg agt gtc acc aga gac cag gat gaa gat 1392
Lys Glu Ile Ser Glu Ser Leu Ser Ual Thr Arg Asp Gln Asp Glu Asp
450 455 460
gat aag get cca gag cca acg tgg get gat gat ctg cct gcc act acc 1440
Asp Lys Ala Pro Glu Pro Thr Trp Ala Asp Asp Leu Pro Ala Thr Thr
465 470 475 480
tca tct gag gcc acc acc acc ccc agg cca ctg ctc agc acc cct gtg 1488
Ser Ser Glu Ala Thr Thr Thr Pro Arg Pro Leu Leu Ser Thr Pro Ual
485 490 495
gat ggg gca gag gat cct aga tgt ttg gaa gcc ttg aag cct gga aac 1536
Asp Gly Ala Glu Asp Pro Arg Cys Leu Glu Ala Leu Lys Pro Gly Asn
500 505 510
tgt ggt gaa tat gtg gtt cga tgg tat tat gac aaa cag gtc aac tct 1584
Cys Gly Glu Tyr Val Ual Arg Trp Tyr Tyr Asp Lys Gln Ual Asn Ser
515 520 525
tgt gcc cga ttt tgg ttc agt ggc tgt aat ggc tca gga aat aga ttc 1632
Cys Ala Arg Phe Trp Phe Ser Gly Cys Asn Gly Ser Gly Asn Arg Phe
530 535 540
aac agt gaa aag gaa tgt caa gaa acc tgc att caa gga tga gcaagta 1681
Asn Ser Glu Lys Glu Cys Gln Glu Thr Cys Ile Gln Gly
545 550 555
aattggcctg tctctatcaaaagcatagaactccctaatttccacatattcacccaatac1741
aaatacagca ctatatttgagtgtatactgagtatttacaacttatacatgtaattgaat1801
tctcactaca gccctaggatgtacatattattaaccacttatataggtaagaaagctgag1861
gctctgagaa gtttagtaacttgtcaactgtcacccaactaaaaagtttcagagctgagg1921
atttagactt agagctgtgtaacttcaatacacagactctatctacttcacaacctgcaa1981
tgtgattctg attcctttaattcctgttgtatgtactatgtcagctcaaacccctacccc2041
tgtccctgcc catacctccacccactcacctccctaacctccttatgtccctcacagtag2101
caagatgtag gtgataggaaggacttcggtgtgagaattagaaatgatgtaaatgtttac2161
gcaggagtgc tgggataggagtcgggatggtgagggtagttagatttttgcctcacttgc2221
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
13
cctgaaagtg gtaataggga gaaaccaatn tgaattacaa ttacttaaat gtatcacaga 2281
ctgtcacttt gtattcctcc aacatgtttg gtaacaagtg cttaatgtat gttaaaataa 2341
agaaggtttt tatacccttc cattaaaaaa aaaaaaaaaa as 2383
<210> 10
<211> 557
<212> PRT
<213> Homo Sapiens
<400> 10
Gly Pro Glu Gly Pro Lys Gly Glu Pro Gly Ile Met Gly Pro Phe Gly
1 5 10 15
Met Pro Gly Thr Ser Ile Pro Gly Pro Pro Gly Pro Lys Gly Asp Arg
20 25 30
Gly Gly Pro Gly Ile Pro Gly Phe Lys Gly Glu Pro Gly Leu Ser Ile
35 40 .45
Arg Gly Pro Lys Gly Val Gln Gly Pro Arg Gly Pro Ual Gly Ala Pro
50 55 60
Gly Leu Lys Gly Asp Gly Tyr Pro Gly Val Pro Gly Pro Arg Gly Leu
65 70 75 80
Pro Gly Pro Pro Gly Pro Met Gly Leu Arg Gly Val Gly Asp Thr Gly
85 90 95
Ala Lys Gly Glu Pro Gly Vai Arg Gly Pro Pro Gly Pro Ser Gly Pro
100 105 110
Arg Gly Val Gly Thr Gln Gly Pro Lys Gly Asp Thr Gly Gln Lys Gly
115 120 125
Leu Pro Gly Pro Pro Gly Pro Pro Gly Tyr Gly Ser Gln Gly Ile Lys
I30 135 140
Gly Glu Gln Gly Pro Gln Gly Phe Pro Gly Pro Lys Gly Thr Met Gly
145 150 155 160
His Gly Leu Pro Gly Gln Lys Gly Glu His Gly Glu Arg Gly Asp Val
165 170 175
Gly Lys Lys Gly Asp Lys Gly Glu Ile Gly Glu Pro Gly Ser Pro Gly
180 185 190
Lys Gln Gly Leu Gln Gly Pro Lys Gly Asp Leu Gly Leu Thr Lys Glu
195 200 205
Glu Ile Ile Lys Leu Ile Thr Glu Ile Cys Gly Cys Gly Pro Lys Cys
210 215 220
Lys Glu Thr Pro Leu Glu Leu Val Phe Val Ile Asp Ser Ser Glu Ser
225 230 235 240
Val Gly Pro Glu Asn Phe Gln Ile Ile Lys Asn Phe Val Lys Thr Met
245 250 255
Ala Asp Arg Val Ala Leu Asp Leu Ala Thr Ala Arg Ile Gly Ile Ile
260 265 270
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
14
Asn Tyr Ser His Lys Val Glu Lys Val Ala Asn Leu Lys Gln Phe Ser
275 280 285
Ser Lys Asp Asp Phe Lys Leu Ala Val Asp Asn Met Gln Tyr Leu Gly
290 295 300
Glu Gly Thr Tyr Thr Ala Thr Ala Leu Gln Ala Ala Asn Asp Met Phe
305 310 315 320
Glu Asp Ala Arg Pro Gly Ual Lys Lys Val Ala Leu Ual Ile Thr Asp
325 330 335
Gly Gln Thr Asp Ser Arg Asp Lys Glu L.ys Leu Thr Glu Ual Val Lys
340 345 350
Asn Ala Ser Asp Thr Asn Ual Glu Ile Phe Ual Ile Gly Ual Val Lys
355 360 365
Lys Asn Asp Pro Asn Phe Glu Ile Phe His Lys Glu Met Asn Leu Ile
370 375 380
Ala Thr Asp Pro Glu His Ual Tyr Gln Phe Asp Asp Phe Phe Thr Leu
'a 385 390 395 400
Gln Asp Thr Leu Lys Gln Lys Leu Phe Gln Lys Ile Cys Glu Asp Phe
405 410 415
Asp Ser Tyr Leu Val Gln Ile Phe Gly Ser Ser Ser Pro Gln Pro Gly
420 425 430
Phe Gly Met Ser Gly Glu Glu Leu Ser Glu Ser Thr Pro Glu Pro Gln
435 440 445
Lys Glu Ile Ser Glu Ser Leu Ser Ual Thr Arg Asp Gln Asp Glu Asp
450 455 460
Asp Lys Ala Pro Glu Pro Thr Trp Ala Asp Asp Leu Pro Ala Thr Thr
465 470 475 480
Ser Ser Glu Ala Thr Thr Thr Pro Arg Pro Leu Leu Ser Thr Pro Val
485 490 495
Asp Gly Ala Glu Asp Pro Arg Cys Leu Glu Ala Leu Lys Pro Gly Asn
500 505 510
Cys Gly Glu Tyr Val Val Arg Trp Tyr Tyr Asp Lys Gln Val Asn Ser
515 520 525
Cys Ala Arg Phe Trp Phe Ser Gly Cys Asn Gly Ser Gly Asn Arg Phe
530 535 540
Asn Ser Glu Lys Glu Cys Gln Glu Thr Cys Ile Gln Gly
545 550 555
<210> 11
<21I> 4
<212> PRT
<213> Artificial Sequence
<220>
<223> thrombin cleavage site
CA 02329694 2000-11-28
WO 99!61615 PCT/US99/11628
<400> 11
Leu Ual Pro Arg
. 1
<210> 12
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC9739
'' <400> 12
ccatcctaat acgactcact atagggc 27
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC15.999
<400> 13
gtggcaaggt ccagagcaac cc 22
<210> 14
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC9719
<400> 14
actcactata gggctcgagc ggc 23
<210> 15
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC15.998
CA 02329694 2000-11-28
WO 99!61615 PCT/US99/11628
16
<400> 15
aacccggtca gccatagtct tcaca 25
<210> 16
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC17,238
<400> 16
cgggatccgt ggatggggca gaggacccta ga 32
<210> 17
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC17.240
<400> 17
ccctcgagtc atccttgaat gcaggtttct tg 32
<210> 18
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> peptide tag
<400> 18
Glu Tyr Met Pro Met Glu
1 5
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC16.523
CA 02329694 2000-11-28
WO 99/61615 PCT/US99/11628
17
<400> 19
agccttgaag cctggaaact 20
<210> 20
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer ZC16.522
<400> 20
_~ agggagttct atgctttttg a 21
