Note: Descriptions are shown in the official language in which they were submitted.
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
NUCLEIC ACID-COUPLED COLORIMETRIC ANALYTE DETECTORS
This invention claims the benefit of U.S. Provisional Application No.
60/090,266
filed June 22, 1998.
This invention was made in part during work partially supported by the U.S.
Department of Energy under DOE Contract No.: DE-AC03-76SF00098. The government
has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates to methods and compositions for the direct
detection
of analytes using color changes that occur in biopolymeric material in
response to selective
binding of analyzes.
BACKGROUND OF THE INVENTION
DNA synthesis via the automated solid-phase method, whereby the DNA fragment
is built up by the sequential addition of activated nucleotides to a growing
chain that is
linked to an insoluble support, has provided for the synthesis of DNA chains
of up to 100
1~ nucleotides long at an approximate rate of 10 minutes per base. Such
artificial DNA
strands with known sequence, the single stranded probe DNA, have been used to
find the
complementary counterpart in DNA samples by hybridization. Above a certain
temperature (Tm) the DNA double helix "melts" to form two complementary single
strands
which recombine upon cooling. If a single strand from the sample has the
complementary
sequence to the probe DNA they can hybridize to form a double helix. Detection
of the
DNA hybridization process is important for the development of methods and
compositions
for DNA synthesis and detection of specific nucleic acid sequences (e.g.,
detection of
mutations, pathogens, and particular alleles). One approach for detecting DNA
hybridization utilizes a quartz crystal microbalance, which is a very
sensitive device to
2~ measure mass changes in the nanogram regime (Okahata et al., J. Am. Chem.
Soc.
114:8299 [1992]. Another method of detecting DNA hybridization at surfaces
employed
the electrogenerated chemiluminescence (ECL) by intercalating an ECL marker
into the
double helix of the sample-probe DNA tethered to a surface (Xu et al., J. Am.
Chem. Soc.
117:2627 [ 1995] ). However, both methods are rather sensitive to
interferences, such as
chemical, pH, temperature, etc., and require sophisticated equipment.
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
There has been an increasing interest in the field of DNA sensors due to the
impact
of such devices on diverse areas of medical, environmental, and biological
applications.
(See e.g.. Fodor et crl., Science 251:767-773 [1991]; Maeda et ul., Anal.
Sciences 8:83-34
[1992]: Sakurai et al., Anal. Chem. 64:1996-1997 [1992]; Okahata et al., J.
Am. Chem.
Soc. 114:8299-8~00 [1992]; Xu et al., J. Am. Chem. Soc. 117:2627-2631 [1995];
and
Wang et ul., Anal. Chem. 68:2629-2634 [1996]). Besides pure sequencing
applications,
such DNA sensors could help detect infectious or inherited diseases, or as RNA
sensors.
aid in monitorin~z expression levels of specific metabolic pathways to
determine
environmental pollution. DNA hybridization between a synthetic
oligodeoxynucleotide of
I:nown sequence and its complement in a given sample provides a powerful tool
for the
detection and sequencing of DNA and RNA. The hybridization event itself is
usually
monitored by introducing fluorescent markers and radioactive labels or by
applying
antibody assays and enzyme reactions to the specifically modified DNA (or RNA)
pair.
which '~enerallv requires labor intensive and time consuming multistep
procedures.
1~ Thus, there remains a need of analyte detectors that provide for DNA
detection that
can be visually monitored by the naked eye, thus, making any further detection
procedures
ancillary or unnecessary.
SUMMARY OF THE INVENTION
The present invention relates to methods and compositions for the direct
detection
of analytes usin~T color changes that occur in biopolymeric material in
response to selective
bindin~~ of anal~-tes. In one embodiment, the biopolymeric material comprises
self
assemblin~~ monomers. In another embodiment, the self assembling monomers are
lipids.
T'he present invention contemplates biopolymeric materials comprising a
plurality
of polymerized self-assembling monomers and one or more nucleic acid ligands,
wherein
2S said biopolymeric materials change color in the presence of an analyte. In
some
embodiments, the nucleic acids have affinity for an analyte. In other
embodiments, the
nucleic acid li~ands are single stranded nucleic acid sequences. In a further
embodiment.
the nucleic acid liQands are linked to said polymerized self assembling
monomers through
one or more covalent bonds. In yet another embodiment, the covalent bonds are
selected
from the group consisting of amine bonds, thiol bonds, and aldehyde bonds.
CA 02330937 2000-12-12
WO 99/67423 PGT/(JS99114029
In a preferred embodiment of the present invention, the biopolymeric materials
contains nucleic acids as ligands that have affinity for an analyte. In one
embodiment, the
nucleic acid ligands have affinity for an analyte selected from the group of
nucleic acid
molecules, enzymes, pathogens, drugs, receptor ligands, antigens, ions,
proteins, hormones.
S blood components. antibodies, and lectins. In further embodiments, the
analytes are
nucleic acid molecules are from any organism (including microorganisms,
including, but
not limited to bacteria, fungi, viruses, etc.), cell, plasmid, or expression
vector. In another
embodiment, the analytes which are nucleic acid molecules are selected from
ribosomal
RNA. transfer R'~A, messenger RNA, intron RNA, double stranded RNA, single
stranded
RNA. single stranded DNA, double stranded DNA, DNA-RNA hybrid molecules, PNA,
PNA-DNA or PNA-RNA hybrid molecules, nucleic acid sequences characteristic of
human
pathogens. nucleic acid sequences characteristic of non-human pathogens, and
nucleic acid
sequences characteristic of genetic abnormalities {e.g., cystic fibrosis, Tay-
Sachs disease.
cretinism, phenvlketonuria (PKL1), sickle-cell anemia, diabetes insipidus,
retinoblastoma.
hemophilia, Deuchenne-type muscular dystrophy, Klinefelter's syndrome,
Turner's
syndrome, and trisomy-21 (i. e., Down's syndrome)). In additional embodiments,
the
analytes are enzymes including, but not limited to, polymerases, nucleases,
iigases,
telomerases, and transcription factors.
The present invention also contemplates biopolymeric materials comprising
nucleic
acid ligands that have affinity for analytes that are pathogens. It is not
intended that the
present invention be limited to any particular pathogen analyte(s), as a
variety of pathogen
analytes are contemplated. In one embodiment, the pathogens are selected from
viruses.
bacteria. parasites. and fungi. In further embodiments, the pathogens are
viruses selected
from influenza. rubella, varicella-zoster, hepatitis A, hepatitis B, other
hepatitis viruses,
ZS herpes simple. polio, smallpox, human immunodeftciency virus, vaccinia,
rabies, Epstein
Barr. retroviruses. and rhinoviruses. In another embodiment, the pathogens are
bacteria
selected from Escherichia coli, Mycobacterium tuber°culosis,
Salmonellu. Chlamydicr and
Strelooc~occus. In vet a further embodiment. the pathogens are parasites
selected from
Plcrs7rrodium, Tr-tpartosoma, Toxoplasma gondii, and Onchvcerccr. However, it
is not
intended that the present invention be limited to the specific genera and/or
species listed
above.
In certain embodiments, the biopolymeric materials comprise biopolymeric
films.
In other embodiments, the biopolymeric materials comprise biopolymeric
liposomes. In
-,-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
yet other embodiments, the biopolymeric materials are selected from the group
consisting
of tubules, braided assemblies, lamellar assemblies, helical assemblies, fiber-
like
assemblies, solvated rods, and solvated coils.
In some embodiments, the self assembling monomers of the biopolymeric material
a of the present invention comprise diacetylene monomers. In certain
embodiments, the
diacetylene monomers are selected from the group consisting of 5,7-
docosadiynoic acid,
5,7-pentacoadiynoic acid, 10,12-pentacosadiynoic acid, and combinations
thereof, although
all diacetylene monomers are contemplated by the present invention. In other
embodiments, the self assembling monomers are selected from the group
consisting of
1(1 acetylenes. alkenes. thiophenes, polythiophenes, imides, acrylamides,
methacrylates,
vinylether. malic anhydride. urethanes, allylamines, siloxanes anilines,
pyrroles,
vinylpyridinium, and combinations thereof. In certain embodiments, the self
assembling
monomers contain head groups selected from the group consisting of carboxylic
acid,
hydroxyl groups. amine groups, amino acid derivatives, and hydrophobic groups,
although
is other head groups are also contemplated by the present invention.
The present invention also contemplates biopolymeric materials further
comprising
dopant materials. However. it is not intended that the present invention be
limited to
certain dopant materials, as a variety of dopant materials are contemplated.
In one
embodiment the dopant materials are selected from the group consisting of
surfactants,
20 polysorbate, octoxynol, sodium dodecyl sulfate, polyethylene glycol,
zwitterionic
detergents. decs-lglucoside, deoxycholate, diacetylene derivatives,
phosphatidylserine,
phosphatidylinositol, phosphatidylethanolamine, phosphatidylcholine,
phosphatidylglycerol.
phosphatidic acid. phosphatidylmethanol, cardiolipin, ceramide, cholesterol.
steroids,
cerebroside, lysophosphatidylcholine, D-erythroshingosine, sphingomyelin,
dodecyl
25 phosphocholine, and N-biotinyl phosphatidylethanolamine. In another
embodiment, the
dopant material is a diacetylene derivative selected from the group consisting
of sialic
acid-derived diacetylene, lactose-derived diacetylene, and amino-derived
diacetylene.
The present invention also contemplates biopolymeric materials further
comprising
one or more non-nucleic acid ligands. However, it is not intended that the
present
30 invention be limited to certain non-nucleic acid ligands, as a variety of
non-nucleic acid
ligands are contemplated. In one embodiment the non-nucleic acid ligands are
selected
from the group consisting of carbohydrates, proteins, drugs, chromophores,
antigens.
chelatin« compounds, molecular recognition complexes, ionic groups,
polymerizable
CA 02330937 2000-12-12
WO 99/67423 PCTlUS99/14029
groups, linker groups, electron donors, electron acceptor groups, hydrophobic
groups,
hydrophilic groups. receptor binding groups, trisaccharides, tetrasaccharides,
ganglioside
GM,, ganglioside GT"" sialic acid, and combinations thereof.
In some embodiments of the present invention, the biopolymeric materials
further
comprise a support, wherein the biopolymeric materials are immobilized to the
support. In
certain embodiments, the support is selected from the group consisting of
polystyrene,
polyethylene, teflon, mica. sephadex, sepharose, polyacrynitriles, filters,
glass, gold, silicon
chips. and silica. In other embodiments, the support comprises porous silica
glass,
wherein the biopolymeric materials are immobilized within the porous silica
glass,
although the present invention contemplates a variety of other supports.
The present invention also provides devices comprising one or more of the
biopolymeric materials described above, wherein the biopolymeric materials are
immobilized to the device.
The present invention further provides methods for detecting the presence of
an
analyte. In particularly preferred embodiments, the methods comprise the steps
of
providing biopolv-merit materials comprising a plurality of polymerized lipid
monomers
and one or more ligands wherein the biopolymeric materials change color in the
presence
of analyte, and a sample suspected of containing an analyte; contacting the
biopolymeric
materials with the sample; and detecting a color change in the biopolymeric
materials. In
some embodiments. the ligands are nucleic acid ligands.
Furthermore, the present invention provides biopolymeric materials for
analyses
such as methods to colorimetrically detect DNA hybridization. The present
invention also
provides methods for detecting the presence of nucleic acid hybridization. In
particularly
preferred embodiments, the methods comprise the steps of providing one or more
nucleic
2S acid hybrids to b~ detected. and biopolymeric materials comprising a
plurality of
polymerized lipid monomers and one or more ligands with affinity for the
nucleic acid to
be detected; contacting the biopolymeric materials with the nucleic acid to be
detected;
and detecting the presence of nucleic acid.
_j_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
DESCRIPTIO\ OF THE FIGURES
Figure 1 shows a schematic representation of biopolymeric films. Y is a
centrosymmetric multilayer film, while films X and Z are noncentrosymmetric
multilayers.
Figure ? shows a schematic representation of biopolymeric liposomes. Part A is
a
S cross-section two-dimensional view and part B is a three-dimensional view of
half of a
liposome.
Figure 3 shows biopolymeric I) liposomes and 2) films comprising the same
biopolymeric material and exposed to the same analyte.
Figure -1 shows a heating curve depicting the large main phase transition for
unpolvmerized liposomes prepared from PDA monomer.
Figure ~ shows a schematic representation of a L angmuir Blodgett apparatus
where
a compressed film is being transferred to a vertical plate.
Figure G shows a micrograph of liposomes cooled onlv to room temperature.
Figure 7 shows a micrograph of liposomes prepared with cooling to
4°C.
Figure 8 shows the chemical structure of 5,7-pentacosadiynoic acid.
Figure 9 shows a synthesis reaction for modifying the free amino group of a
molecule for coupling to a lipid monomer.
Figure 10 shows the properties of biopolymeric materials composed of amino
acid-
derivated diacemlene monomers.
Figure I 1 shows the chemical structure of sialic acid derived 10,12-
pentacosadiynoic acid (compound 1 ) and I 0,12-pentacosadiynoic acid (compound
2).
Fi~~ure 1- shows substrate lipid (i.e.. DMPC) in a diacetylenic lipid matrix
before
(top) and after t bottom) polymerization.
Figure l: shows the visible absorption spectrum of the liposomes of Figure 12
2, before (solid linz~ and after {dashed line} exposure to phospholipase A,.
Figure I-1 shows the change in colorimetric response of the liposomes of
Figure 1?
with varying concentrations of DMPC in response to phospholipase A, exposure.
Figure I ~ shows the absorbance at 412 nm of liposomes containing 1,2-bis-(S-
decanovl)-1.2-dithio-sn-glycero-3-phosphocholine (DTPC) following exposure to
PLA, for
various lengths of time.
Figure 16 shows '~P NMR spectra of the DMPC/PDA vesicles prior to the addition
of PLA, (A}, and following the enzymatic reaction (B}.
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
Figure 17 shows the colorimetric response of DMPC containing liposomes in the
presence of PLA= (circles), and PLA, with inhibitors (squares and diamonds).
Figure 18 shows the visible absorption spectra of the polydiacetylene
liposomes in
a sol-gel matrix.
Figure 19 shows the visible absorption spectra of the material in Figure 18
following heating of the liposomes to 55 °C.
Figure 20 shows an optical micrograph of diacetylene film.
Figure 21 shows the properties of polydiacetylene monolayers with and without
sialic acid-deri~~ated PDA and ganglioside G,,".
Figure 2? shows the isotherms of 5% GM,/S% SA-PDA/90% PDA as a function of
subphase concentration of CdCI,.
Figure ~~ shows the isotherms of 5% G~~,/5% SA-PDA/90% PDA at pH 4.5, 5.8.
and 9.2.
Figure 2-l shows the temperature effect on the isotherms of 100% PDA. 5%SA-
l, PDA/9~% PDA. and 5% GM,/5% SA-PDA/90% PDA.
Figure ?~ shows the visible absorption spectrum of "blue phase" 5% GM, and 95%
s.7-docosadiynoic acid liposomes.
Figure 26 shows the visible absorption spectrum of the liposomes of Figure 25
following exposure to cholera toxin.
Figure 27 shows the visible absorption spectrum for sialic-acid containing
films
before (solid line) and after (dashed line) exposure to influenza virus.
Figure 28 shows the color transition of ganglioside GM,-containing liposomes
in
response to varying concentrations of cholera toxin.
Figure '?9 shows the visible absorption spectrum of the polymeric liposomes
2, containing 5% G", ligand and 95% 5,7-DCDA.
Figure 30 shows the visible absorption spectrum of the material in Figure 29
followin'J exposure to E. coli toxin.
Figure 31 shows the absorption spectrum of a PCA film in before (line a) and
after
exposure to 1-octanol dissolved in water (line b).
Fi~~ure 3~' shows a bar graph indicating colorimetric responses of PDA
material to
various VOCs (.-~ ~ and a table showing the concentration of the VOCs (B).
Figure ~_ shows a graph comparing colorimetric responses of biopolymeric
material to 1-butanol to the concentration of 1-butanol.
_7_
CA 02330937 2000-12-12
WO 99/67423 PC'T/US99/14029
Figure 3-1 shows compounds and synthesis schematics for producing PDA
derivatives for the detection of small organic compounds.
Figure 3~ shows the UV-Vis spectra of a hexokinase modified PDA monolayer
upon addition of glucose as a function of incubation time at (A) background,
(B) t = 0.02
min, (C) t = 30. and (D) at t = 60 min.
Figure 36 shows the colorimetric response of hexokinase containing
biopolymeric
material to a variety of sugars.
Figure 3'shows derivations of PDA for use in detection arrays.
Figure 38 shows the organic synthesis of compound 2.10 from Figure ~7.
Figure ,9 shows several embodiments of biopolymeric assemblies.
Figures -10-~0 show- various embodiments of nucleic acid-coupled biopolymeric
material generation and use. Each is described in more detail below.
DEFINITIONS
To facilitate an understanding of the present invention. a number of terms and
is phrases are defined below:
As used herein, the term "nucleic acid molecule" refers to any nucleic acid
containing molecule including, but not limited to DNA or RNA. The term
encompasses
sequences that include any of the known base analogs of DNA and RNA including.
but
not limited to. 4-acetylcytosine, 8-hydroxy-N6-methyladenosine,
aziridinylcytosine,
pseudoisocytosin~. ~-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-
bromouracil. ~-
carboxymethylaminomethv°l-2-thiouracil, 5-
carboxymethylaminomethyluracil, dihydrouracil.
inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, I-
methylguanine.
I-methylinosine. '_.2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-
methyl-
cytosine. ~-meth~-Icytosine. N6-methyladenine, 7-methylguanine,
~-methylaminomethyluracil, ~-methoxyaminomethyl-2-thiouracil,
beta-D-mannosvlqueosine. S'-methoxycarbonylmethyluracil, 5-methoxyuracil.
2-methvlthio-N6-isopentenvladenine, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic
acid, oxvbutoxosine, pseudouracii, queosine, 2-thiocytosine, ~-methyl-2-
thiouracil, 2-
thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid
methylester,
uracil-~-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine. and 2,6-
diaminopurine.
As used herein, the term "oligonucleotide," refers to a short length of single-
stranded polynuclzotide chain. Oligonucleotides are typically less than 100
residues long
_g-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029 ~
(e.~,>., between 1~ and 50), however, as used herein, the term is also
intended to encompass
longer polynucleotide chains. Oligonucleotides are often referred to by their
length. For
example a 24 residue oligonucleotide is referred to as a "24-mer".
Oligonucleotides can
form secondary and tertiary structures by self hybridizing or by hybridizing
to other
polynucleotides. Such structures can include, but are not limited to,
duplexes, hairpins,
cruciforms, bends. and triplexes.
As used herein, the terms "complementary" or "complementarity" are used in
reference to polvnucleotides (i.e., a sequence of nucleotides) related by the
base-pairing
rules. For example, for the sequence "A-G-T," is complementary to the sequence
"T-C-
A." Complementarity may be "partial," in which only some of the nucleic acids'
bases are
matched according to the base pairing rules. Or, there may be "complete" or
"total"
complementaritv between the nucleic acids. The degree of complementarity
between
nucleic acid strands has significant effects on the efficiency and strength of
hybridization
between nucleic acid strands. This is of particular importance in
amplification reactions,
as well as detection methods that depend upon binding between nucleic acids.
The term "homology" refers to a degree of complementarity. There may be
partial
homology or complete homology (i. e., identity). A partially complementary
sequence is
one that at least partially inhibits a completely complementary sequence from
hybridizing
to a target nucleic acid is referred to using the functional term
"substantially homologous."
The inhibition of hybridization of the completely complementary sequence to
the target
sequence may be examined using a hybridization assay {Southern or Northern
blot,
solution hybridization and the like) under conditions of low stringency. A
substantially
homologous sequence or probe will compete for and inhibit the binding (i.e.,
the
hybridization) of a completely homologous to a target under conditions of low
stringency.
This is not to sav that conditions of low stringency are such that non-
specific binding is
permitted; low stringency conditions require that the binding of two sequences
to one
another be a specific (i.e.. selective) interaction. The absence of non-
specific binding may
be tested by the use of a second target that lacks even a partial degree of
complementarity
(e.~>., less than about 30% identity); in the absence of non-specific binding
the probe will
not hybridize to the second non-complementary target.
The art knows well that numerous equivalent conditions may be employed to
comprise low stringency conditions; factors such as the length and nature
(DNA, RNA,
base composition i of the probe and nature of the target (DNA, RNA, base
composition,
-9-
CA 02330937 2000-12-12
WO 99/67423 PC'T/US99/14029
present in solution or immobilized, etc.) and the concentration of the salts
and other
components (e.c.. the presence or absence of formamide, dextran sulfate,
polyethylene
glycol) are considered and the hybridization solution may be varied to
generate conditions
of low stringency hybridization different from, but equivalent to, the above
listed
s conditions. In addition, the art knows conditions that promote hybridization
under
conditions of high stringency (e.g., increasing the temperature of the
hybridization and/or
wash steps, the use of formamide in the hybridization solution, etc.) (see
definition below
for "stringency" ).
When used in reference to a double-stranded nucleic acid sequence such as a
cDNA or genomic clone. the term "substantially homologous" refers to any probe
that can
hybridize to either or both strands of the double-stranded nucleic acid
sequence under
conditions of low stringency as described above.
When used in reference to a single-stranded nucleic acid sequence, the term
"substantially homologous" refers to any probe that can hybridize (i. e., it
is the
is complement of) the single-stranded nucleic acid sequence under conditions
of low
stringency as described above.
As used herein, the term "hybridization" is used in reference to the pairing
of
complementary nucleic acids. Hybridization and the strength of hybridization
(i.e., the
strength of the association between the nucleic acids) is impacted by such
factors as the
degree of complementary between the nucleic acids, stringency of the
conditions involved,
the T", of the formed hybrid, and the G:C ratio within the nucleic acids. A
single
molecule that contains pairing of complementary nucleic acids within its
structure is said
to be "self hybridized."
As used herein, the term "Tm" is used in reference to the "melting
temperature."
2, The melting temperature is the temperature at which a population of double-
stranded
nucleic acid molecules becomes half dissociated into single strands. The
equation for
calculating the T_ of nucleic acids is well known in the art. As indicated by
standard
references. a simple estimate of the Tm value may be calculated by the
equation: T~, _
81.~ + 0.41(% G T C), when a nucleic acid is in aqueous solution at 1 M NaCI
(See e.g..
3() Anderson and 1-oung, Quantitative Filter Hybridization, in Nucleic Acid
Hybridization
[198]). Other references include more sophisticated computations that take
structural as
well as sequence characteristics into account for the calculation of Tn,.
- 10-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein the term "stringency" is used in reference to the conditions of
temperature, ionic strength, and the presence of other compounds such as
organic solvents.
under which nucleic acid hybridizations are conducted. With "high stringency"
conditions.
nucleic acid base pairing will occur only between nucleic acid fragments that
have a high
frequency of complementary base sequences. Thus, conditions of "weak" or "low"
stringency are often required with nucleic acids that are derived from
organisms that are
genetically diverse. as the frequency of complementary sequences is usually
less.
As used herein, the term "polymerase chain reaction" ("PCR") refers to the
method
of K.B. Mullis L-.S. Patent Nos. 4,683,195, 4,683,202, and 4,965,188, hereby
incorporated
by reference, which describe a method for increasing the concentration of a
segment of a
target sequence in a mixture of genomic DNA without cloning or purification.
This
process for amplifying the target sequence consists of introducing a large
excess of two
oligonucleotide primers to the DNA mixture containing the desired target
sequence,
followed by a precise sequence of thermal cycling in the presence of a DNA
polymerase.
1~ The na~o primers are complementary to their respective strands of the
double stranded
target sequence. To effect amplification, the mixture is denatured and the
primers then
annealed to their complementary sequences within the target molecule.
Following
annealing, the primers are extended with a polymerase so as to form a new pair
of
complementary strands. The steps of denaturation, primer annealing and
polymerase
extension can be repeated many times (i. e., denaturation, annealing and
extension
constitute one "cycle"; there can be numerous "cycles") to obtain a high
concentration of
an amplified segment of the desired target sequence. The length of the
amplified segment
of the desired target sequence is determined by the relative positions of the
primers with
respect to each other, and therefore, this length is a controllable parameter.
By virtue of
the repeating aspect of the process, the method is referred to as the
"polymerase chain
reaction" (hereinafter "PCR"). Because the desired amplified segments of the
target
sequence become the predominant sequences (in terms of concentration) in the
mixture.
they are said to be "PCR amplified."
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
With PCR. it is possible to amplify a single copy of a specific target
sequence in
genomic DNA to a level detectable by several different methodologies (e.g.,
hybridization
with a labeled probe; incorporation of biotinylated primers followed by avidin-
enzyme
conjugate detection, incorporation of 3'P-labeled deoxynucleotide
triphosphates, such as
dCTP or dATP. into the amplified segment). In addition to genomic DNA, any
oligonucleotide or polynucleotide sequence can be amplified with the
appropriate set of
primer molecules. In particular, the amplified segments created by the PCR
process are.
themselves, efficient templates for subsequent PCR amplifications.
As used herein, the terms "PCR product," "PCR fragment," and "amplification
product" refer to the resultant mixture of compounds after two or more cycles
of the PCR
steps of denaturation. annealing and extension are complete. These terms
encompass the
case where there has been amplification of one or more segments of one or more
target
sequences.
As used herein. the term "antisense" is used in reference to DNA or RNA
is sequences that are complementary to a specific DNA or RNA sequence (e. g.,
mRNA).
Included within this definition are antisense RNA ("asRNA") molecules involved
in gene
regulation by bacteria. Antisense RNA may be produced by any method, including
synthesis by splicing the genes) of interest in a reverse orientation to a
viral promoter
which permits the synthesis of a coding strand. Once introduced into an
embryo, this
transcribed strand combines with natural mRNA produced by the embryo to form
duplexes. These duplexes then block either the further transcription of the
mRNA or its
translation. In this manner. mutant phenotypes may be generated. The term
"antisense
strand" is used in reference to a nucleic acid strand that is complementary to
the "sense"
strand. 'The designation (-) (i.e., "negative") is sometimes used in reference
to the
antisense strand. with the designation (+) sometimes used in reference to the
sense (i.e.,
"positive") strand.
As used herein, the term "non-synthetic synthesis" refers to the synthesis of
biopolvmeric materials, whereby one or more components of the assemly is not
part of the
polymer backbone. For example. in some embodiments of the present invention,
ganglioside is used as a ligand for the direct detection of analytes (e.g.,
cholera toxin),
where the ganglioside ligands are incorporated into the assemblies, but are
not part of the
polymerized nem~ork.
-12-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the term "reaction" refers to any change or transformation in
which
a substance (e.g.. molecules, membranes, and molecular assemblies) combines
with other
substances, interchanges constituents with other substances, decomposes,
rearranges, or is
otherwise chemically altered. As used herein, the term "reaction means" refers
to any
S means of initiatin~~ and/or catalyzing a reaction. Such reaction means
include, but are not
limited to. enzymes, temperature changes, and pH changes. The phrase "affinity
for said
reaction means" refers to compounds with the ability to specifically associate
(e.g., bind)
to a given reaction mean, although not necessarily a substrate for the
reaction means. For
example, a PLA= antibody has affinity for PLA-,, but is not the substrate for
the enzyme.
As used herein, the term "immobilization" refers to the attachment or
entrapment,
either chemically or otherwise, of material to another entity (e.g., a solid
support) in a
manner that restricts the movement of the material.
As used herein, the terms "material" and "materials" refer to, in their
broadest
sense, any composition of matter.
As used herein, the term "biopolymeric material" refers to materials composed
of
polymerized biological molecules (e.g., lipids, proteins, carbohydrates, and
combinations
thereof). Such materials include, but are not limited to, films, vesicles,
liposomes,
multilayers, aggregates, membranes, and solvated polymers (e.g., polythiophene
aggregates
such as rods and coils in solvent). In some embodiments, biopolymeric material
comprises
molecules that are not part of the polymerized matrix (i. e. , molecules that
are not
polymerized).
As used herein the term "protein" is used in its broadest sense to refer to
all
molecules or molecular assemblies containing two or more amino acids. Such
molecules
include. but are not limited to, proteins, peptides, enzymes, antibodies,
receptors,
2s lipoproteins, and glycoproteins.
As used herein the terns "antibody" refers to a glycoprotein evoked in an
animal by
an immunogen ~ antigen). An antibody demonstrates specificity to the
immunogen, or,
more specifically . to one or more epitopes contained in the immunogen. Native
antibody
comprises at least two light polypeptide chains and at least two heavy
polypeptide chains.
Each of the hea«- and light polypeptide chains contains at the amino terminal
portion of
the polvpeptide chain a variable region (i.e., VH and VL respectively), which
contains a
binding domain that interacts with antigen. Each of the heavy and light
polypeptide
chains also comprises a constant region of the polypeptide chains (generally
the carboxy
- 1J -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
terminal portionl which may mediate the binding of the immunoglobulin to host
tissues or
factors influencing various cells of the immune system, some phagocytic cells
and the first
component (C 1 q ~ of the classical complement system. The constant region of
the light
chains is referred to as the "CL region," and the constant region of the heavy
chain is
referred to as the "CH region." The constant region of the heavy chain
comprises a CH 1
region, a CH2 region, and a CH3 region. A portion of the heavy chain between
the CH 1
and CH? regions is referred to as the hinge region (i.e., the "H region"). The
constant
region of the heave- chain of the cell surface form of an antibody further
comprises a
spacer-transmembranal region (M 1 ) and a cytoplasmic region (M2) of the
membrane
carboxy terminus. The secreted form of an antibody generally lacks the M1 and
M2
regions.
As used herein, the term "biopolymeric films" refers to polymerized organic
films
that are used in a thin section or in a layer form. Such films can include,
but are not
limited to, monolavers, bilayers, and multilayers. Biopolyrneric films mimic
biological
1 ~ cell membranes l t~. g. , in their ability to interact with other
molecules such as proteins or
analytes).
As used herein, the term "sol-gel" refers to preparations composed of porous
metal
oxide glass structures. Such structures can have biological or other material
entrapped
within the porous structures. The phrase "sol-gel matrices" refers to the
structures
comprising the porous metal oxide glass with or without entrapped material.
The term
"sol-gel material" refers to any material prepared by the sol-gel process
including the glass
material itself and any entrapped material within the porous structure of the
glass. As
used herein. the term "sol-gel method" refers to any method that results in
the production
of porous metal wide glass. In some embodiments, "sol-gel method" refers to
such
2s methods conducted under mild temperature conditions. The terms "sol-gel
glass" and
"metal oxide glass" refer to glass material prepared by the sol-gel method and
include
inorganic material or mixed organic/inorganic material. The materials used to
produce the
glass can include. but are not limited to, aluminates, aluminosilicates,
titanates, ormosils
(organically modified silanes), and other metal oxides.
As used herein, the term "direct colorimetric detection" refers to the
detection of
color changes without the aid of an intervening processing step (e.~.,
conversion of a color
change into an electronic signal that is processed by an interpreting device).
It is intended
-14-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
that the term encompass visual observing (e.g., observing with the human eye)
as well as
detection by simple spectrometry.
As used herein, the term "analytes" refers to any material that is to be
analyzed.
Such materials include, but are not limited to, ions, molecules, antigens,
bacteria,
compounds, viruses, cells, antibodies, and cell parts.
As used herein, the term "selective binding" refers to the binding of one
material to
another in a manner dependent upon the presence of a particular molecular
structure (i. e..
specific binding). For example, a receptor will selectively bind ligands that
contain the
chemical structures complementary to the ligand binding site(s). This is in
contrast to
"non-selective binding," whereby interactions are arbitrary and not based on
structural
compatibilities of the molecules.
As used herein, the term "biosensors" refers to any sensor device that is
partially or
entirely composed of biological molecules. In a traditional sense, the term
refers to "an
analytical tool or system consisting of an immobilized biological material
(such as enzyme.
1 ~ antibody whole cell, organelle, or combination thereof) in intimate
contact with a suitable
transducer device which will convert the biochemical signal into a
quantifiable electrical
signal" (Gronow. Trends Biochem. Sci. 9: 336 [1984]).
As used herein, the term "transducer device" refers to a device that is
capable of
converting a non-electrical phenomenon into electrical information, and
transmitting the
information to a device that interprets the electrical signal. Such devices
include, but are
not limited to, de~~ices that use photometry, fluorimetry, and
chemiluminescence; fiber
optics and direct optical sensing (e.g., grating coupler); surface plasmon
resonance:
potentiometric and amperometric electrodes; field effect transistors;
piezoelectric sensing:
and surface acoustic wave.
As used herein, the term "miniaturization" refers to a reduction in size, such
as the
size of a sample to increase utility (e. g., portability, ease of handling,
and ease of
incorporation into arrays).
As used herein, the term "stability" refers to the ability of a material to
withstand
deterioration or displacement and to provide reliability and dependability.
,As used herein, the term "conformational change" refers to the alteration of
the
molecular structure of a substance. It is intended that the term encompass the
alteration of
the structure of a single molecule or molecular aggregate (e.g., the change in
structure of
polydiacetylene upon interaction with an analyte).
- is -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the term "small molecules" refers to any molecule with low
molecular weight (i.e., less than 10,000 atomic mass units and preferably less
than 5,000
atomic mass units) that binds to ligands, interacts with ligands, or interacts
with
biopolymeric material in a manner that creates a conformational change.
As used herein, the term "pathogen" refers to disease causing organisms,
microorganisms. or agents including, but not limited to, viruses, bacteria,
parasites
(including, but not limited to, organisms within the phyla Protozoa,
Platyhelminthes,
Aschelminithes. .~canthocephala, and Arthropoda), fungi, and prions.
As used herein, the term "bacteria" and "bacterium" refer to all prokaryotic
organisms, including those within all of the phyla in the Kingdom Procaryotae.
It is
intended that the term encompass all microorganisms considered to be bacteria
including
Mycoplcr.smcr, Chlcrmydia, Actinomycer, Streptomyce.s, and Rickeltsia. All
forms of bacteria
are included ~~ithin this definition including cocci, bacilli, spirochetes,
spheropiasts,
protoplasts, etc. "Gram negative" and "gram positive" refer to staining
patterns obtained
with the Gram-staining process which is well known in the art (See e.g.,
Finegold and
Martin. Diagnostic Microbiology, 6th Ed. (1982), CV Mosby St. Louis, pp 13-
15).
As used herein, the term "membrane" refers to, in its broadest sense, a sheet
or
layer of material. It is intended that the term encompass all "biomembranes"
(i. e. , any
organic membrane including, but not limited to, plasma membranes, nuclear
membranes,
organelle membranes, and synthetic membranes). Typically, membranes are
composed of
lipids. proteins. glycolipids, steroids, sterols and/or other components. As
used herein, the
term "membrane fragment" refers to any portion or piece of a membrane. The
term
"polymerized membrane" refers to membranes that have undergone partial or
complete
polymerization.
As used herein, the terms "membrane rearrangement" and "membrane
conformational change" refer to any alteration in the structure of a membrane.
Such
alterations can be caused by physical perturbation, heating, enzymatic and
chemical
reactions. among other events. Reactions that can result in membrane
rearrangement
include. but are not limited to lipid cleavage, polymerization, lipid
flipping,
transmembrane signalling. vesicle formation, lipidation, glycosylation, ion
channeling,
molecular rearrangement. and phosphorylation. Enzymatic catalysis that results
in
membrane rearrangement can result from free enzymes interacting with the
biopolymeric
material (e.g.. reacting with an enzyme substrate in the biopolymeric
material) and can
-16-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
result from enzymatic activity present in certain analytes (e.g., viruses,
bacteria, and toxins
among others).
As used herein, the term "lipid cleavage" refers to any reaction that results
in the
division of a lipid or lipid-comprising material into two or more portions.
"Lipid cleavage
s means" refers to any means of initiating and/or catalyzing lipid cleavage.
Such lipid
cleavage means include, but are not limited to enzymes, free radical
reactions, and
temperature changes.
As used herein, the term "polymerization" encompasses any process that results
in
the conversion of small molecular monomers into larger molecules consisting of
repeated
units. Typically. polymerization involves chemical crosslinking of monomers to
one
another.
As used herein, the term "membrane receptors" refers to constituents of
membranes
that are capable of interacting with other molecules or materials. Such
constituents can
include. but are not limited to, proteins, lipids, carbohydrates, and
combinations thereof.
1~ As used herein, the term "volatile organic compound" or "VOC" refers to
organic
compounds that are reactive (i.e., evaporate quickly, explosive, corrosive,
etc.), and
typically are hazardous to human health or the environment above certain
concentrations.
Examples of VOCs include. but are not limited to, alcohols, benzenes,
toluenes,
chloroforms, and cyclohexanes.
As used herein, the term "enzyme" refers to molecules or molecule aggregates
that
are responsible for catalyzing chemical and biological reactions. Such
molecules are
typically proteins. but can also comprise short peptides, RNAs, ribozymes,
antibodies, and
other molecules.
As used herein, the term "substrate," in one sense, refers to a material or
substance
on which an enzyme or other reaction means acts. In another sense, it refers
to a surface
on which an sample grows or is attached. The term "reaction substrate" refers
to the
substrate for a reaction means (e.g., a "substrate lipid" reacted by a lipid
cleavage means).
As used herein. the term "analyte substrate" refers to a material or substance
upon which
an analvte reacts. For example, the analyte can be an enzyme and the analyte
substrate is
an enzyme substrate. In another sense, the analyte can be a pathogen and the
analyte
substrate comprises a material or sample that is altered by a "reaction means"
associated
with the pathogen.
- 17-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the term "lipase" refers to any of a group of hydrolytic
enzymes
that acts on ester bonds in lipids. Such lipases include, but are not limited
to, pancreatic
lipase that catalyses the hydrolysis of triacylglycerols, lipoprotein lipase
that catalyzes the
hydrolysis of triacylglycerols to glycerol and free fatty acids, and
phospholipases, among
s others. The term "phospholipase" refers to enzymes that cleave phospholipids
by the
hydrolysis of carbon-oxygen or phosphorus-oxygen bonds. Phospholipases
include, but are
not limited to, phospholipases A" A2, C, and D.
As used herein, the term "drug" refers to a substance or substances that are
used to
diagnose_ treat. or prevent diseases or conditions. Drugs act by altering the
physiology of
a living organism. tissue, cell, or in vitro system that they are exposed to.
It is intended
that the term encompass antimicrobials, including, but not limited to,
antibacterial,
antifungal, and antiviral compounds. It is also intended that the term
encompass
antibiotics. including naturally occurring, synthetic, and compounds produced
by
recombinant Dlv_-~ technology.
As used herein, the term "peptide" refers to any substance composed of two or
more amino acids.
As used herein, the term "carbohydrate" refers to a class of molecules
including,
but not limited to. sugars, starches, cellulose, chitin, glycogen, and similar
structures.
Carbohydrates can also exist as components of glycolipids and glycoproteins.
As used herein, the term "chromophore" refers to molecules or molecular groups
responsible for the color of a compound, material, or sample.
As used herein, the term "antigen" refers to any molecule or molecular group
that
is recognized by at least one antibody. By definition, an antigen must contain
at least one
epitope (i.e.. the specific biochemical unit capable of being recognized by
the antibody).
2a The term "immunogen" refers to any molecule, compound, or aggregate that
induces the
production of antibodies. By definition, an immunogen must contain at least
one epitope
(i.e., the specific biochemical unit capable of causing an immune response).
As used herein, the term "chelating compound" refers to any compound composed
of or containing coordinate links that complete a closed ring structure. The
compounds
can combine with metal ions, attached by coordinate bonds to at least two of
the nonmetal
IotlS.
As used herein, the term "molecular recognition complex" refers to any
molecule.
molecular group. or molecular complex that is capable of recognizing (i.e.,
specifically
-18-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
interacting with) a molecule. For example, the ligand binding site of a
receptor would be
considered a molecular recognition complex.
As used herein, the term "ambient condition" refers to the conditions of the
surrounding environment (e.g., the temperature of the room or outdoor
environment in
s which an experiment occurs).
.~s used herein, the term "room temperature" refers, technically, to
temperatures
approximately between 20 and 25 degrees centigrade. However, as used
generally, it
refers to the any ambient temperature within a general area in which an
experiment is
taking place.
As used herein, the terms "home testing" and "point of care testing" refer to
testing
that occurs outside of a laboratory environment. Such testing can occur
indoors or
outdoors at. for example. a private residence, a place of business, public or
private land. in
a vehicle. under water, as well as at the patient's bedside.
.-~s used herein, the term "lipid" refers to a variety of compounds that are
la characterized by their solubility in organic solvents. Such compounds
include, but are not
limited to, fats, waxes, steroids, sterols, glycolipids, glycosphingolipids
(including
gangliosides), phospholipids, terpenes, fat-soluble vitamins, prostaglandins,
carotenes. and
chlorophvlls. As used herein, the phrase "lipid-based materials" refers to any
material that
contains lipids.
.as used herein, the term "virus" refers to minute infectious agents, which
with
certain exceptions, are not observable by light microscopy, lack independent
metabolism,
and are able to replicate only within a living host cell. The individual
particles (i. e..
virions) consist of nucleic acid and a protein shell or coat; some virions
also have a lipid
containin~~ membrane. The term "virus" encompasses all types of viruses,
including
2~ animal. plant, phase, and other viruses.
.-~s used herein, the phrase "free floating aggregates" refers to aggregates
that are
IlOt 11111110b111Zed.
.as used herein, the term "encapsulate" refers to the process of encompassing.
encasin~~, or otherwise associating two or more materials such that the
encapsulated
material is immobilized within or onto the encapsulating material.
.-~s used herein, the term "optical transparency" refers to the property of
matter
whereby the matter is capable of transmitting light such that the light can be
observed b~~
visual light detectors (e.h.. eyes and detection equipment).
- 19-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the term "biologically inert" refers to a property of mater
ial
whereby the material does not chemically react with biological material.
As used herein, the term "organic solvents" refers to any organic molecules
capable
of dissolving another substance. Examples include. but are not limited to,
chloroform,
alcohols, phenols. and ethers.
As used herein, term "nanostructures" refers to microscopic structures,
typically
measured on a manometer scale. Such structures include various three-
dimensional
assemblies, including, but not limited to, liposomes, films, multilayers.
braided, lamellar.
helical. tubular. and fiber-like shapes, and combinations thereof. Such
structures can, in
some embodiments. exist as solvated polymers in aggregate forms such as rods
and coils.
As used herein, the term "films" refers to any material deposited or used in a
thin
section or in a layer form.
As used herein. the term "vesicle" refers to a small enclosed structures.
Often the
structures are membranes composed of lipids, proteins, glycolipids, steroids
or other
components associated with membranes. Vesicles can be naturally generated
(e.g.. the
vesicles present in the cytoplasm of cells that transport molecules and
partition specific
cellular functions) or can be synthetic (e.g., liposomes).
As used herein, the term "liposome" refers to artificially produced spherical
lipid
complexes that can be induced to segregate out of aqueous media. The terms
"liposome"
and "vesicle" are used interchangeably herein.
As used herein, the term "biopolymeric liposomes" refers to liposomes that are
composed entirely. or in part, of biopolymeric material.
As used herein, the term "tubules" refers to materials comprising small hollow
cylindrical structures.
2s As used herein, the terms "solvated polymer," "solvated rod," and "solvated
coil"
refer to polymerized materials that are soluble in aqueous solution.
As used the term "multilayer" refers to structures comprised of two or more
monolavers. The individual monolayers may chemically interact with one another
(e.g.,
through covalent bonding. ionic interactions, van der Waals' interactions,
hydrogen
bonding. hydrophobic or hydrophilic assembly, and stearic hindrance) to
produce a film
with novel properties (i.e.. properties that are different from those of the
monolayers
alone).
-20-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the terms "self assembling monomers" and "lipid monomers"
refer
to molecules that spontaneously associate to form molecular assemblies. In one
sense, this
can refer to surfactant molecules that associate to form surfactant molecular
assemblies.
The term "self-assembling monomers" includes single molecules (e.g., a single
lipid
molecule] and small molecular assemblies (e.g., polymerized iipidsj, whereby
the
individual small molecular assemblies can be further aggregated (e.g.,
assembled and
polymerized) into larger molecular assemblies. "Surfactant molecular
assemblies" refers to
an assembly of surface active agents that contain chemical groups with
opposite polarity,
form oriented monolayers at phase interfaces, form micelles (colloidal
particles in
aggregation colloids), and have detergent, foaming, wetting, emulsifying, and
dispersing
properties.
As used herein, the term "homopolymers" refers to materials comprised .of a
single
type of polymerized molecular species. The phrase "mixed polymers" refers to
materials
comprised of two or more types of polymerize molecular species.
As used herein, the term "ligands" refers to any ion, molecule, molecular
group, or
other substance that binds to another entity to form a larger complex.
Examples of ligands
include. but are not limited to, peptides, carbohydrates, nucleic acids
(e.~,~., DNA and
RNA). antibodies. or any molecules that bind to receptors.
As used herein, the term "dopant" refers to molecules that are added to
biopolymeric materials to change the material's properties. Such properties
include, but
are not limited to. colorimetric response, color, sensitivity, durability,
robustness,
amenability to immobilization, temperature sensitivity, and pH sensitivity.
Dopant
materials include. but are not limited to, lipids, cholesterols, steroids,
ergosterols,
polyethylene glycols, proteins, peptides, or any other molecule (c~.~,~..
surfactants,
2~ polysorbate. octownol, sodium dodecyl sulfate, zwitterionic detergents.
decylglucoside.
deoxycholate, diacetylene derivatives, phosphatidylserine,
phosphatidylinositol,
phosphatidylethanolamine, phosphatidylcholine, phosphatidylglycerol,
phosphatidic acid,
phosphatidylmethanol, cardiolipin, ceramide, cerebroside,
lysophosphatidylcholine, D-
erythroshingosine. sphingomyelin, dodecyl phosphocholine, N-biotinyl
phosphatidylethanolamine. and other synthetic or natural components of cell
membranes)
that can be associated with a membrane (e.g.. liposomes and films).
As used herein, the terms "organic matrix" and "biological matrix" refer to
collections of organic molecules that are assembled into a larger multi-
molecular structure.
-21 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
Such structures can include., but are not limited to, films, monolayers, and
bilayers. As
used herein, the term "organic monolayer" refers to a thin film comprised of a
single layer
of carbon-based molecules. In one embodiment, such monolayers can be comprised
of
polar molecules whereby the hydrophobic ends all line up at one side of the
monolayer.
s The term "monolaver assemblies" refers to structures comprised of
monolayers. The term
"organic polymetric matrix" refers to organic matrices whereby some or all of
the
molecular constituents of the matrix are polymerized.
As used herein, the terms "head group" and "head group functionality" refer to
the
molecular groups present an the ends of molecules (e.g., the carboxylic acid
group at the
end of fatty acidsl.
As used herein, the term "hydrophilic head-group" refers to ends of molecules
that
are substantially attracted to water by chemical interactions including, but
not limited to,
hydro~~en-bonding. van der Waals" forces, ionic interactions, or covalent
bonds. As used
herein, the term "hydrophobic head-group" refers to ends of molecules that
self associate
with other hydrophobic entities, resulting in their exclusion from water.
As used herein, the term "carboxylic acid head groups" refers to organic
compounds containing one or more carboxyl (-COOH) groups located at, or near,
the end
of a molecule. The term carboxylic acid includes carboxyl groups that are
either free or
exist as salts or esters.
As used herein, the term "detecting head group" refers to the molecular group
contained at the end of a molecule that is involved in detecting a moiety
{e.g., an analyte).
As used herein, the term "linker" or "spacer molecule" refers to material that
links
one entity to another. In one sense, a molecule or molecular group can be a
linker that is
covalent attached two or more other molecules (e.g., linking a ligand to a
self-assembling
2, monomer).
As used herein, the phrase "polymeric assembly surface" refers to polymeric
material that provides a surface for the assembly of further material (e.g., a
biopolymeric
surface of a film or liposome that provides a surface for attachment and
assembly of
ligands).
As used herein, the term "formation support" refers to any device or structure
that
provides a physical support for the production of material. In some
embodiments, the
formation support provides a structure for layering and/or compressing films.
-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
As used herein, the term "diacetylene monomers" refers to single copies of
hydrocarbons containing two alkyne linkages (i.e., carbon/carbon triple
bonds).
As used herein, the terms "standard trough" and "standard Langmuir-Blodgett
trough" refer to a device, usually made of teflon, that is used to produce
Langmuir films.
The device contains a reservoir that holds an aqueous solution and moveable
barriers to
compress film material that are layered onto the aqueous solution (See e.g.,
Roberts,
Lan~muir-Blodgett Films', Plenum, New York, [1990]).
As used herein, the term "crystalline morphology" refers to the configuration
and
structure of crystals that can include, but are not limited to, crystal shape.
orientation.
texture. and size.
As used herein, the term "domain boundary" refers to the boundaries of an area
in
which polymerized film molecules are homogeneously oriented. For example. a
domain
boundary can be the physical structure of periodic, regularly arranged
polydiacetylene
material (e.~,T.. striations, ridges, and grooves).
IS As used herein, the term "domain size" refers to the typical length between
domain
boundaries.
As used the terms "conjugated backbone" and "polymer backbone" refer to the
ene-
yne polymer backbone of polymerized diacetylenic films that, on a macroscopic
scale,
appears in the form of physical ridges or striations. The term "polymer
backbone axis"
refers to an imaginary line that runs parallel to the conjugated backbone. The
terms
"intrabackbone" and "interbackbone" refer to the regions within a given
polymer backbone
and between polymer backbones, respectively-. The backbones create a series of
lines or
"linear striations." that extend for distances along the template surface.
As used herein, the term "bond" refers to the linkage between atoms in
molecules
2, and between ions and molecules in crystals. The term "single bond" refers
to a bond with
two electrons occupying the bonding orbital. Single bonds between atoms in
molecular
notations are represented by a single line drawn between two atoms (e.g., C~-
C~,). The
term "double bond" refers to a bond that shares two electron pairs. Double
bonds are
stronger than single bonds and are more reactive. The term "triple bond"
refers to the
sharing of three electron pairs. As used herein. the term "ene-yne" refers to
alternatin~~
double and triple bonds. As used herein the terms "amine bond." "thiol bond,"
and
"aldehyde bond" refer to any bond formed between an amine group (i. e. , a
chemical group
derived from ammonia by replacement of one or more of its hydrogen atoms by
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
hydrocarbon groups), a thiol group (i.e., sulfur analogs of alcohols), and an
aldehyde
group (i.o., the chemical group -CHO joined directly onto another carbon
atom),
respectively, and another atom or molecule.
As used herein. the term "covalent bond" refers to the linkage of two atoms by
the
sharing of two electrons, one contributed by each of the atoms.
As used the term "absorption" refers, in one sense, to the absorption of
light. Light
is absorbed if it is not reflected from or transmitted through a sample.
Samples that
appear colored have selectively absorbed all wavelengths of white light except
for those
corresponding to the visible colors that are seen.
As used herein, the term "spectrum" refers to the distribution of light
energies
arranged in order of wavelength.
As used the term "visible spectrum" refers to light radiation that contains
wavelengths from approximately 360 nm to approximately 800 nm.
As used herein, the term "ultraviolet irradiation" refers to exposure to
radiation
with wavelengths less than that of visible light (i.e., less than
approximately 360 nM) but
greater than that of X-rays (i.e., greater than approximately 0.1 nM).
Ultraviolet radiation
possesses greater energy than visible light and is therefore, more effective
at inducing
photochemical reactions.
As used herein, the term "chromatic transition" refers to the changes of
molecules
or material that result in an alteration of visible light absorption. In some
embodiments,
chromatic transition refers to the change in light absorption of a sample,
whereby there is
a detectable color change associated with the transition. This detection can
be
accomplished through various means including, but not limited to, visual
observation and
spectrophotometrv.
As used herein, the term "thermochromic transition" refers to a chromatic
transition
that is initiated by a change in temperature.
As used herein, the term "solid support" refers to a solid object or surface
upon
which a sample is layered or attached. Solid supports include, but are not
limited to,
glass. metals, gels. and filter paper. among others. "Hydrophobized solid
support" refers
to a solid support that has been chemically treated or generated so that it
attracts
hydrophobic entities and repels water.
-24-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the term "film-ambient interface" refers to a film surface
exposed
to the ambient environment or atmosphere (i. e.. not the surface that is in
contact with a
solid support).
As used herein, the term "formation solvent" refers to any medium, although
typically a volatile organic solvent, used to solubilize and distribute
material to a desired
location (e.~,=., to a surface for producing a film or to a drying receptacle
to deposit
liposome material for drying).
As used herein, the term "micelle" refers to a particle of colloidal size that
has a
hydrophilic exterior and hydrophobic interior.
As used herein, the term "topochemical reaction" refers to reactions that
occur
within a specific place (e.g., within a specific portion of a molecule or a
reaction that only
occurs when a certain molecular configuration is present).
As used herein, the term "molding structure" refers to a solid support used as
a
template to design material into desired shapes and sizes.
As used herein, the terms "array" and "patterned array" refer to an
arrangement of
elements (i. c'., entities) into a material or device. For example, combining
several types of
biopolymeric material with different analyte recognition groups into an
analyte-detecting
device, would constitute an array.
As used herein the term "interferants" refers to entities present in an
analyte sample
that are not the analyte to be detected and that, preferably, a detection
device will not
identify. or would differentiate from the analyte(s) of interest.
As used herein, the term "badge" refers to any device that is portable and can
be
carried or worn b~~ an indi~-idual working in an analyte detecting
environment.
As used herein, the term "device" refers to any apparatus (e.~r., mufti-well
plates
and badges) that contain biopolymeric material. The biopolymeric material may
be
immobilized or entrapped in the device. More than one type of biopolymeric
material can
be incorporated into a single device.
As used herein, the term "halogenation" refers to the process of incorporating
or
the degree of incorporation of halogens (i.e., the elements fluorine,
chlorine, bromine,
iodine and astatine) into a molecule.
As used herein, the term "aromaticity" refers to the presence of aromatic
groups
(i.c'., six carbon rings and derivatives thereof) in a molecule.
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the phrase "water-immiscible solvents" refers to solvents that
do
not dissolve in water in all proportions. The phrase "water-miscible solvents"
refers to
solvents that dissolve in water in all proportions.
As used herein, the terms "positive." "negative," and "zwitterionic charge"
refer to
molecules or molecular groups that contain a net positive, negative, or
neutral charge,
respectively. Zwitterionic entities contain both positively and negatively
charged atoms or
groups whose charges cancel (i.e., whose net charge is 0).
As used herein, the term "biological organisms" refers to any carbon-based
life
forms.
As used herein, the term "in situ" refers to processes, events, objects, or
information that are present or take place within the context of their natural
environment.
As used the term "aqueous" refers to a liquid mixture containing water, among
other components.
As used herein, the term "solid-state" refers to reactions involving one or
more
is rigid or solid-like compounds.
As used herein, the term "regularly packed" refers to the periodic arrangement
of
molecules within a compressed film.
As used herein, the term "filtration" refers to the process of separating
various
constituents within a test sample from one another. In one embodiment,
filtration refers to
the separation of solids from liquids or gasses by the use of a membrane or
medium. In
alternative embodiments, the term encompasses the separation of materials
based on their
relative size.
As used herein, the term "inhibitor" refers to a material, sample, or
substance that
retards or stops a chemical reaction. The term "reaction means inhibitor"
refers to
2s inhibitors that are capable of retarding or stopping the action or activity
of a given
reaction means ~ e.g. , an enzyme).
As used herein, the term "inhibitor screening" refers to any method used to
identif~~
and/or characterize inhibitors. Preferably, inhibitor screening methods
provide "high
throughput screening," the ability to screen a large number of samples
suspected of
containin~~ inhibitors in a short period of time. It may also be desired that
the inhibitor
screenin!~ method provide quantifiable results to provide comparisons of
inhibitor
efficiency.
-z~-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
As used herein, the term "sample" is used in its broadest sense. In one sense
it can
refer to a biopolvmeric material. In another sense, it is meant to include a
specimen or
culture obtained from any source, as well as biological and environmental
samples.
Biological samples may be obtained from animals (including humans) and
encompass
fluids. solids, tissues, and gases. Biological samples include blood products,
such as
plasma. serum and the like. Environmental samples include environmental
material such
as surface matter. soil, water, crystals and industrial samples. These
examples are not to
be construed as limiting the sample types applicable to the present invention.
GENERAL DESCRIPTION OF THE INVENTION
The present invention relates to methods and compositions for the direct
detection
of membrane conformational changes through the detection of color changes in
biopolvmeric materials. In one embodiment of the present invention, the
polydiacetylene
sensors composed of fully conjugated polymer backbones embedded in lipid
bilayers,
undergo colorimetric transitions upon a specific binding event between a
surface bound
ligand and a receptor or host molecule in the sample specimen. The
chromophoric
detection unit is built into the sensor and can be visually monitored by the
naked eye,
making any further detection procedures unnecessary. In one embodiment of the
present
invention. attachment of synthetic oligodeoxynucleotides to such sensor
surfaces provides
devices that allow direct detection of nucleic acid hybridization events by
colorimetric
transition.
In preferred embodiments of the present invention, ligands that allow direct
colorimetric detection of nucleic acid hybridization are incorporated into
polymerized
biosensors. In particular, the present invention provides methods and
compositions related
to the specific detection of nucleic acid hybridization via recognition of a
single stranded
2S sample nucleic acid with a single stranded probe nucleic acid, which is
covalently attached
to the surface of the biopolymeric material of the present invention. A
visible transition
from blue to the red form of the biopolymeric material allows specific
detection of nucleic
acid hybridization. This colorimetric response upon nucleic acid
hydribidization provides
a quick and simple detection of specific nucleic acid fragments (e. g. ,
produced by the
PCR) or as a diagnostic tool in medicine. Additionally, the nucleic acid-
linked
biopolvmeric material provides a means to detect the presence and activity of
enzymes or
other molecule that associate with or alter nucleic acid samples. In some
embodiments.
_ ?7 _
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
the present invention provide compositions and methods related to the
constructson.
characterization and optimization of patterned nucleic acid sensors based on
the
photochromic transition in biopolymeric materials upon nucleic acid
hybridization.
In some embodiments of the present invention, an array of patterned nucleic
acid
assays are incorporated into a single device, such that parallel detection of
many different
hybridization events occurs simultaneously. Such arrays are designed so that
the presence
of a given analvte produces a color change in a known location in the device,
or that
produces a color change specific to the given analyte (e.g>., purple to orange
for analyte 1
and blue to red for analyte 2). It is also contemplated that other arrays are
used with the
present invention. including such easily understood patterns as a "+" sign to
indicate that
presence of a particular substance or compound. It is not intended that the
present
invention be limited to any particular array design or configuration.
DETAILED DESCRIPTION OF THE INVENTION
The present invention comprises methods and compositions related to
biopolymeric
materials that change color in response to membrane rearrangements through
ligand
analyte binding or other rearrangements. These biopolymeric materials comprise
many
forms including. but not limited to, films, vesicles, tubules, multilayered
structures, and
solvated rods and coils. These biopolymeric materials are comprise polymerized
self
assembling monomers. In some embodiments, the biopolymeric materials comprise
more
than one species of self assembling monomer. Some of these self assembling
monomers
may lack polymerizable groups. In other embodiments, the materials further
comprise
dopant materials) that alter the properties of the sensor. Dopants include,
but are not
limited to, polymerizable self assembling monomers, non-polymerizable
self=assembling
monomers, lipids. sterols, membrane components, and any other molecule that
optimizes
2~ the biopolymeric material (e.g., material stability, durability,
colorimetric response, and
immobilizabilitv). The biopolymeric material may further comprise ligands
(e.g., proteins.
antibodies, carbohydrates, and nucleic acids). The ligands provide attachment
sites for
recruiting molecules to the biopolymeric surface or are used as binding sites
for analytes.
whereby the binding event causes a colorimetric change in the biopolymeric
material. The
various embodiments of the present invention provide the ability to
colorimetrically detect
a broad range reactions and analytes. With certain biopolymeric materials, a
color
transition in response to a reaction is viewed by simple visual observation
or, if desired,
-2$-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
by color sensing equipment. The present invention further provides a variety
of means of
immobilizing the biopolymeric material to provide stability, durability, and
ease of
handling and use. In some embodiments, a variety of different polymeric
materials are
combined into a single device to produce an array. The array is designed to
detect and
differentiate differing types or quantities of reactions or analytes (i.e.,
the array can
provide duantitative and/or qualitative data). The methods and compositions of
the present
invention find use in a broad range of analyte detection circumstances and are
particularU
amenable to situations where simple, rapid, accurate, and cost-efficient
detection is
required.
l4 The description of the invention is divided into: I. Forms of Biopolymeric
Materials: II. Self Assembling Monomers; III. Dopants; IV. Ligands; V.
Detection of
C:olorimetric Changes: V1. Detection of Membrane Conformational Changes; VII.
Immobilization of Biopolvmeric Materials; and VIII. Arrays. The biopolymeric
materials
described in these sections can be designed to detect the presence of analytes
(e.g.,
pathogens, chemicals, nucleic acids, and proteins) and can be designed to
detect membrane
rearrangements ~ e. ~. , lipid cleavage events and modification of nucleic
acids). In some
embodiments, it may be desired to have biopolymeric materials that accomplish
both of
these functions. The optimization of the biopolymeric materials (e.g.,
optimization of
colorimetric response, color, and stability) with regards to the detection of
analytes or
membrane rearrangements is often generally applicable to both scenarios. Where
there are
differences. it is noted.
I. FORI\~IS OF BIOPOLYMERIC MATERIALS
fhe biopolvmeric material of the presently invention can take many physical
forms
including. but not limited to, liposomes, films. and multilayers, as well as
braided,
2a lamellas. helical. tubular, and fiber-like shapes, and combinations
thereof. In some
embodiments. the biopolymeric materials are solvated polymers in aggregate
forms such as
rods and coils. Each of these classes is described below, highlighting their
advantages and
the difficulties overcome during the development of these materials.
-?9-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
A. Films
In some embodiments, the biopolymeric material used in the present invention
comprise biopolvmeric film. As described in Example 1. biopolymeric films were
prepared by layering the desired matrix-forming material (e.g.. self
assembling organic
monomers) onto a formation support. In preferred embodiments, the formation
support
was a standard Langmuir-Blodgett trough and the matrix-forming material was
layered
onto an aqueous surface created by filling the trough with an aqueous
solution. The
material was then compressed and polymerized to form a biopolymeric film. In
preferred
embodiments. the compression was conducted in a standard Langmuir-Blodgett
trough
using moveable barriers to compress the matrix-forming material. Compression
was
carried out until a tight-packed monolayer of the matrix-forming material was
formed.
Films provide a very sensitive colorimetric screen for analytes.
As described in Example 1. in some embodiments, the matrix-forming material.
located within the formation support, was polymerized by ultra-violet
irradiation.
1, However, all methods of polymerization axe contemplated by the present
invention and
include. but are not limited to, gamma irradiation, x-ray irradiation,
chemical crosslinking.
and electron beam exposure.
In some embodiments, lipids comprising diacetylene monomers (DA) were used as
the self assemblin~~ monomer. The diacetylene monomers (DA) were polymerized
to
polvdiacetylene tp-PDA or PDA) using ultraviolet irradiation. In preferred
embodiments.
the ultraviolet radiation source is kept sufficiently far from the film to
avoid causing heat
dama~~e to the film. The crystalline morphology of the polymerized film can be
readily
observed between crossed polarizers in an optical microscope, although this
step is not
required by the present invention. The conjugated backbone of alternating
double and
2~ triple bonds (i.c~.. ene-ynej that was generated following polymerization,
gave rise to
intense absorptions in the visible spectrum and led to a distinct blue/purple
appearance of
the polymerized diacetylene film.
In certain embodiments the visibly blue films were then transferred to
hvdrophobized solid supports, such that the carboxylic acid head groups were
exposed at
3U the film-ambient interface (Charych et al., Science 261: 585 [1993]) to
undergo further
analysis. although the method of the present invention does not require this
step. Linear
striations typical of PDA films can be observed in the polarizing optical
microscope. The
-30-
CA 02330937 2000-12-12
WO 99/67423 PGTNS99/14029
material may also be characterized using atomic force microscopy or other
characterization
means (See e.g.. Example 2).
The present invention contemplates all other means of making films, as several
other methods are known in the art. For example, films can be made by solvent
casing
s (i.e.. slow evaporation of the solvent). Also, lipid monomers can be made
with silane or
thiol anchoring groups, which allows dipping of solid supports into the
solution to form a
coated solid support. In one embodiment of the present invention, diacetylene
monomers
are anchored by the silane and thiol groups and are then polymerized. This
method
eliminates the need for a trough.
I3. Liposomes
In other embodiments, the biopolymeric material used in the present invention
comprises biopolvmeric liposomes. Liposomes were prepared using a probe
sonication
method (New. Liposomes: A Practical Approach, Oxford University Press, Oxford.
pp
s3-104 [1990]). although any method that generates liposomes is contemplated
by the
is present invention. Self-assembling monomers, either alone, or associated
with a desired
ligand. were dried to remove the formation solvents and resuspended in
deionized water.
The suspension was probe sonicated and polymerized. The resulting liposome
solution
contained biopolvmeric liposomes.
Liposomes differ from monolayers and films in both their physical
characteristics
and in the methods required to generate them. Monolayers and films (or
multiiayers)
made from amphiphilic compounds are planar membranes and form a two-
dimensional
architecture. Monolayers and films, in this context, are solid state materials
that are
supported by an underlying solid substrate as shown in Figure 1. Film Y is a
centrosymmetric multilayer film, while films X and Z are noncentrosymmetric
multilayers.
2, Such materials are described in numerous articles and have been reviewed in
text such as
Ulman (Ulman. .-In Introduction to Ultrathin Organic Films: From Langmuir-
Blodgett to
Self=Assembly. Academic Press, Inc., Boston, [1991]) and Gaines (Games,
Insoluble
Nlnrrolaver.s cry Liclaud-Gas Interfaces, Interscience Publishers, New York,
[1966)). In
contrast to films and monolayers, liposomes are three-dimensional vesicles
that enclose an
aqueous space as shown in Figure 2. Figure 2 shows A) a cross-section two-
dimensional
view: and B) a three-dimensional view of half of a liposome. These materials
are
described in numerous articles and have been reviewed in texts such as New
(New.
- J1 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
Lipo.some,s: A Practical Approach, IRL Press, Oxford, [1989]), and Rosoff
(Rosoff,
V(!.S'lL'I('..5'. Marcel Dekker, Inc., New York, [1996]) among others.
Liposomes can be
constructed so that they entrap materials within their aqueous compartments.
Films and
monolayers do not enclose an aqueous space and do not entrap materials within
a
compartment. The liposomes are typically more stable and robust than the films
made of
the same material.
Liposomes and films are prepared using different methods. Liposomes are
prepared by dispersal of amphiphilic molecules in an aqueous media and remain
in the
liquid phase. In contrast. monolayers and films are prepared by immobilizing
amphiphilic
molecules at the air-water interface. A solid support is then passed through
the interface
to transfer the film to the solid support. Liposomes exist within homogenous
aqueous
suspensions and may be created in a variety of shapes such as spheres,
ellipsoids, squares.
rectangles. and tubules. Thus, the surface of a liposome is in contact with
liquid only--
primarily water. In some respects, liposomes resemble the three-dimensional
architecture
of natural cell membranes. If liposomes are dried to their solid state, they
may lose their
shape and no longer exist in a liposomal state (i.e,, are no longer
"liposomes"). In
contrast, films exist as planar heterogeneous coatings, immobilized onto a
solid support.
The surface of a monolayer or film can be in contact with air, other gases, or
other
liquids. Films can be dried in air and maintain their planar monolayer or
multilayer
structure and thus remain as "films."
A much higher concentration of polymerized material can be achieved with
liposome solutions compared to monolayer assemblies, due to their greater
cross-sectional
density. Liposomes have the advantage, generally, of making the color change
more
visually strikin~~ and increasing the colorimetric response (See e.~~., Figure
3 showing the
2~ colorimetric response of immobilized sialic-acid-containing liposomes ( 1 )
and films (2) to
the presence of influenza virus).
In designing methods to generate the liposomes of the present invention,
several
difficulties had to be overcome. While it was initially hoped that liposomes
could be
generated with tile self assembling monomer material (e. g., diacetylenes)
used in various
i lm embodiments (i.e., film embodiments of the present invention discussed
above and in
Example 1 ), it was not known whether this would be possible, largely due to
the
differences in liposomal and film architecture. Liposomes are three-
dimensional instead of
two-dimensional. Therefore. it was not clear whether 1) the diacetylenic
lipids would
-32-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
actually form liposomes at all; 2) whether they would polymerize if they were
capable or
forming liposomes: and/or 3) whether they would exhibit colorimetric
properties even if
they could be polymerized.
Regarding the first point, it was not clear that the single-chained
diacetylenic lipids
S would actually form liposomes. 'this is because the majority of the
literature shows that
single chain molecules tend to form micelles (i.e., loosely packed single-
bilayer
suspensions), whereas only double chain molecules can form liposomes.
Furthermore, as
described by New (New, supra), the double chain molecules typically used in
liposome
formation are derived from natural cell membranes and usually have a classical
phospholipid structure incorporating such molecular components as
phosphodiglycerides
and sphingolipids. unlike the diacetylenic lipids of the present invention.
Initially. attempts to form liposomes with diacetylenic lipids using standard
methods such as vortexing or bath sonications were tried (i. e. , methods that
are similar to
those commonl~~ applied to phospholipids). These methods failed to form
liposomes and
resulted in the formation of an insoluble, non-dispersed, non-characterizable
mixture. This
mixture did not exhibit colorimetric properties. Applying differential
scanning
calorimetry, it was determined that the Tm (main phase transition temperature)
of the lipids
was much higher than their natural phospholipid counterparts. For example,
Figure 4
shows a heating curve depicting the large main phase transition for
unpolymerized
liposomes prepared from lysine-derivated PDA monomer. Therefore, it was
necessary to
emplou higher energy methods such as ultrasonic probe sonication and heating,
to raise the
temperature above T", and to disperse the lipid. Under these conditions (e. g.
, as described
in Example 1 ) liposomes were formed, as evidenced by light scattering and
transmission
electron microscopy with a size in accordance with a liposome (i. e. ,
approximately I00
2, nm).
Regarding the second point, polymerization reduires that the lipids pack in a
precise distance and orientation with respect to one another. The
polymerization of
polydiacetylene is therefore a "solid state" or topochemical polymerization.
This is why
the molecules must be closely packed to allow cross-linking. This precise
packing can be
controlled in monolayer and films at the air-water interface using moveable
barriers of
Lan~Tmuir apparatus that can compress the film to the desired packing as shown
in Figure
~, in which a compressed film is being transferred to a vertical plate. In the
case of
liposome formation. no such external compression is possible. The lipids
assemble and
_"_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
occupy an equilibrium distance and orientation with respect to one another.
Therefore,
prior to the development of the present invention, it was not clear that the
distance and
packin'T between the molecules in the liposome material would be sufficient to
allow the
polymerization reaction to take place.
a Initially. the most difficult aspect was cross-linking the liposome
diacetylenic
monomeric lipids. to generate a polydiacetylene conjugated polymer (i.e.,
polymerized
liposomes). It is the conjugated polymer backbone that provides the liposomes
with the
desired color. and potentially allows the detection of biological analytes
through an
observable color change produced by the binding of the analyte to the
liposomes.
However. after the liposomes were formed (i. e. , using the methods described
above) and
cooled to room temperature, it was found that they did not polymerize at all
upon
exposure to ultraviolet light. This was surprising because, in principle, the
lipids should
have crystallized and returned to their solid-like state when cooled to room
temperature
(i. e., once the lipids returned to this state, they should have undergone the
topochemical
1~ polymerization as described above). However, they did not, as apparently
the lipids were
still fluid. Further analysis by transmission electron microscopy (TEM) proved
that the
liposomes were not crystallized. These room temperature liposomes aggregated
into larger
globules. characteristic of non-stabilized fluid phase liposomes as shown in
the micrograph
of Figure G. Based upon these observations, it was hypothesized that there was
a
2U hysteresis effect in the heating/cooling curve of these materials. This
proved to be correct.
leading to the development of "supercooling" methods. For Example, in these
methods,
the liposomes were cooled to 4°C, resulting in the successful
crystallization of the lipids.
After the cooling step was carried out, it was found that the liposomes could
be
polymerized, even when raised back to room temperature. Polymerization was
evidenced
2s by the blue color of the material, and the absorbance at approximately G30
nm. In
contrast to the liposomes that were not supercooled, these liposomes
crystallized into
squares. rectangles, ellipses. or spheres that maintained their structure
indefinitely. as
shown in the micrograph of Figure 7.
All of the above experimentation for production of suitable Iiposomes for
various
30 embodiments of the present invention (i.e., experimentation described
above). is in direct
contrast to the methods used to produce films. Films can be formed and
polymerized at
the same (i.e.. ambient) temperature.
-34-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
Regarding the third point, even with the polymerized liposomes, prior to the
development of the present invention, it was not known whether they would
exhibit color
changes in response disruption of the biopolymeric membrane. For instance, it
was not
known whether the different lipid packing architecture of liposomes would
permit the
s color changes observed with the film embodiments. It was only through
further
experimentation that optimal liposomes were developed for colorimetric
detection of
analvtes.
C. Other Forms
in other embodiments, it is contemplated that variations in the heating and
cooling
rates. agitation methods, and materials of the biopolymeric material will
provide other
nanostructures. Such nanostructures include, but are not limited to,
multilayers, braided,
lamellae. helical, tubular, and fiber-like shapes, and combinations thereof.
Such structures
can. in some embodiments. be solvated polymers in aggregate forms such as rods
and
coils. For example, it has been shown that the chain length of the monomers
effects the
is type of aggregate that forms in solution (Okahata and Kunitake, J. Am.
Chem. Soc. 101:
5231 [ 1979]). Generation of these other forms with surfactant materials has
been
described for double chains (Kuo et al., Macromolecule 23: 3225 [1990)),
lamellae
(Rhodes et al.. Langmuir 10: 267 [1994]), hollow tubules and braids (Frankel
et al.. J.
Atll. Chetll. Soc. 116 [1994]). In some embodiments, colorimetric tubules were
generated.
As described in Example 1, tubules were prepared similarly to liposome, except
that 1-
10% of an organic solvent (e.g., ethanol) was added to the solution prior to
sonication.
The present in vention also contemplates other shapes suitable for particular
uses as
desired.
Other bilaver systems of polydiacetylene lipids can be prepared to serve as
2s colorimetric detectors. Such structures include molecular double layers on
solid supports
created by LB. Langmuir-Schaefer transfer, or by adsorption and unrolling of
monomeric
liposomes. followed by photopolymerization (Figure 39[I]). A related system is
the
tethered supported bilayer (Figure 39[II]) with a 'cushion' layer sandwiched
between the
substrate surface and the bilayer. This 'cushion' layer decouples the flexible
bilayer from
the immobile solid support and allows, for example. incorporation of membrane
proteins.
A third structural variation is the covalent fixation of polymeric liposomes
at planar
surfaces of self-assembled monolayers (Figure 39[III]).
_ 3J _
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
In other embodiments, soluble polymers of polythiophenes are generated. In
some
embodiments. sugar groups, peptides, or other ligands can be synthesized as
thiophene
derivatives and then polymerized as co-polymers. Alternately, NHS derivatives
of
thiophene can be polymerized and ligand groups can be attached after the
polymer has
s formed (described below). The thiophene polymers are rendered water soluble
by the
addition of acid groups. Thus they are synthesized to freely dissolve in
aqueous solution,
creating a colorimetric solution.
II. SELF-ASSEMBLING MONOMERS
In certain embodiments, the present invention contemplates a variety of self
assembling monomers that are suitable for formation of biopolymeric materials.
Such
monomers include. but are not limited to, acetylenes, diacetylenes (e.g., 5,7-
docosadiynoic
acid. ~.7-pentacosadiynoic acid, and 10,12-pentacosadiynoic acid), alkenes,
thiophenes,
polythiophenes. imides, acrylamides, methacrylates, vinylether, malic
anhydride, urethanes.
allylamines, siloxanes, poly-silanes, anilines, pyrroles, polyacetylenes, poly
(para-
1~ phylenevinylene~. poly (para-phylene), and vinylpyridinium. Lipids
containing these
groups can be homopolymers or mixed polymers. Furthermore, monomers with a
variety
of head groups are contemplated, including, but not limited to carboxylic
acid, hydroxyl
groups, primary amine functionalities, amino acid derivatives, and hydrophobic
groups.
Certain head groups may act as recognition sites for binding to analytes,
allowing direct
colorimetric detection, simply through exposure of the biopolymeric material
to the
analvte.
The biopoivmeric material of the present invention may comprise a single
species
of seli~-assembling monomer (e.g., may be made entirely of 5,7-
pentacosadiynoic acid) or
may comprise two or more species. To produce biopolymeric material with more
than one
2s type of self assembling monomer, solvents containing the individual
monomers are
combined in the desired molar ratio. This mixture is then prepared as
described above
(e.g.. layering onto the aqueous surface of a Langmuir-Blodgett device for
film preparation
or evaporated and resuspended in aqueous solution for liposome preparation).
In some
embodiments the self assembling monomers may be chemically linked to another
molecule
(c~.g.. a ligandj.
In preferred embodiments, lipid monomers comprising diacetylene were used as
the
self=assembling monomers of the biopolymeric material of the present
invention. The
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
present invention contemplates a variety of diacetylene-containing lipids
includir.~, but not
limited to 5,7-docosadiynoic acid (5,7-DCDA), 5,7-pentacosadiynoic acid (5,7-
PCA), and
10,12-pentacosadivnoic acid ( 10,12-PCA).
The present invention further contemplates the optimization of the
biopolymeric
material to maximize response to given reaction conditions. Although it is not
necessary
to understand the mechanism in order to use the present invention, and it is
not intended
that the present invention be so limited, it is contemplated that the
chemistry of the
particular lipid used in the biopolymeric material plays a critical role in
increasing or
decreasin~~ the sensitivity of the colorimetric transition. For example, a
positional
variation of the chromophoric polymer backbone can alter sensitivity to a
given analyte.
This may be accomplished by moving the diacetylene group closer to the
interfacial region
as illustrated in Figure 8, showing 5,7-pentacosadiynoic acid (as opposed to
10,12-
pentacosadiynoic acid). Altering the placement of the polymerizable group to
the 5,7
position in the monomer, dramatically improved colorimetric sensitivity in
some
1~ embodiments (Se~~ e.g., Example 3). In addition, shorter or longer chain
lengths of PDA
were shown to have an effect on the sensitivity of the biopolymeric material
for analyte
detection, presumably due to changes in packing. In some analyte-detecting
embodiments,
such improved sensitivity allowed detection of small analytes (e.~,J.,
bacterial toxins such as
cholera toxin from Vibrio cholerae and pertussis toxin, as well as
antibodies). It is
contemplated that further optimization will generate sensitive materials for
the detection of
many reactions. rzarrangements, and analytes.
A. Polymerizable Group Placement in Monomer Carbon Chain
The carbon chain length that positions the head group a specific distance from
the
polymer backbon: in the final polymerized material is dependent on the
position of the
2s polymerizable group in an unassembled monomer. In the case of diacetylene
liposomes.
SOllle eIIlbOd1111eI1t5 of the present invention demonstrated that a
diacetylene group
positioned fiom between the 18-20 positions to the 3-5 position in the
monomers produced
progressively more sensitive liposomes when used for the detection of
analytes.
Liposomes produced from monomers with the diacetylene groups from the 10-12
position
to the 4-b position provided particularly efficient control of sensitivity.
Diacetylene
groups positioned in about the ~-7 position are preferred for certain
embodiments, such as
_37_
CA 02330937 2000-12-12
WO 99/67423 PCf/US99/14029
cholera toxin detection. The production protocol for the monomer determines at
which
position the diacetvlene group is placed in the final monomer product.
B. Total Carbon Chain Length
Experiments conducted during the development of the present invention
demonstrated that the total carbon chain length in the unassembled monomer
also
influenced the le~~el of sensitivity of the liposome product, although to a
lesser extent than
the position of the polymerizable group in the monomer carbon chain. The
shorter chain
length typically provided for greater sensitivity for, as determined in
analyte-detecting
embodiments. The monomers that are ideally useful in construction of the
inventive
colorimetric liposomes range from between C,, to Cps in length. although both
longer and
shorter chain lencths are contemplated by the present invention. A preferred
range of
monomer carbon chain length in the present invention is C~~, to C,:.
The influence of monomer chain lengths and positioning of the polymerizable
group on the chain has been demonstrated in several experiments. It was showm
that in
Is the case of 10.1'-diacetylene derivative, C~; chains provided a final
colorimetric liposomes
product that chanced color at a lower analyte level than those produced from
monomers
with a C,5 chain. In the case of 5,7-diacetylene derivatives, the C" length
chain provided
a greater sensitivity than the C,4 length chain. Thus, the chain length is
designed so as to
be suitable for thz optimal detection conditions of interest, in view of other
desired
characterisitcs of the biopolymeric materials (e.~.. stability).
III. DOPANTS
The biopolvmeric materials of the present invention may further comprise one
or
more dopant materials. Dopants are included to alter and optimize desire
properties of the
biopolvmeric materials, Such properties include, but are not limited to.
colorimetric
response. color. sensitivity, durability, robustness, amenability to
immobilization,
temperature sensitivity. and pH sensitivity. Dopant materials include, but are
not limited
to, lipids. cholestzrols, steroids, ergosterols, polyethylene glycols,
proteins, peptides. or an v
other molecule 1 t~.~~. , surfactants, polysorbate, octoxynol, sodium dodecyl
sulfate,
zwitterionic detergents, decylglucoside, deoxycholate, diacetylene
derivatives,
3(1 phosphatidylserins. phosphatidylinositol, phosphatidylethanolamine,
phosphatidylcholine,
phosphatidylglycerol, phosphatidic acid, phosphatidylmethanol, cardiolipin,
ceramide.
- J
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
cerebroside, lysophosphatidylcholine, D-erythroshingosine, sphingomyelin,
dodecyl
phosphocholine. ~-biotinyl phosphatidylethanolamine, and other synthetic or
natural
components of cell membranes) that is associated with a membrane (e.gl.,
liposomes and
films). For example, the embodiments provided in Example 4 demonstrate that
the
addition of sialic acid-derived diacetylene monomers to liposomes comprising
ganglioside
and PDA provided a dramatic increase in colorimetric sensitivity and
quantifiability to the
detection of low levels of analyte. This improvement in colorimetric response
using
dopant is extremely beneficial when un-doped materials produce only weak
signals. Such
is often the case when the target lipids (e.g., lipids that contain the ligand
or that are the
substrate of an enzymatic reaction) are not covalently linked to the polymer
backbone
(e.h.. ~~anglioside ligands).
In some embodiments. dopants are added to alter the color of the biopolymeric
material. For example, the present invention provides liposomes that change
from blue to
red, but also blue to orange, purple to red, purple to orange, green to red,
and green to
orange. For example, glutamine-derivatized PDA produced very dark blue (i. e.
, almost
black) liposomes. In other embodiments, green liposomes were produced with
cycles of
annealing (i.v.. heating to approximately 80°C) and cooling (i.e., to
ambient temperatures)
prior to polymerization. The advantage with the mufti-color approach is that
sensors can
be made where a specific reaction turns the material a specific color.
1n other embodiments, different dopant materials are combined in a single
biopolvmeric material preparation. For example, the present invention provides
a dopant
cocktail that is a mix of glucose and sialic acid-derived polydiacetylene. The
glucose
component of the dopant mixture appears to act primarily to prevent non-
specific adhesion
to the surface of the inventive liposome and may also enhance sensitivity. The
2a polvdiacetylene bound sialic acid component appears to functionally
destabilize the surface
to provide a dramatic increase in sensitivity for analyte detection. By using
this co-dopant
approach, both specificity of adhesion and sensitivity can be optimized,
without unduly
compromising the structural integrity of the biopolymeric material.
Although it is not necessary to understand the mechanism in order to use the
present invention. and it is not intended that the present invention be so
limited, it is
contemplated that the addition of dopant lowers the activation barrier of the
chromatic
transition and/or provides a connection between the ligands (i.e., if ligands
are present)
and the conjugated backbone, enabling the reactions to induce the colorimetric
transition.
-s9-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
One theory elucidated during the development of the present invention is that
dopants with
bulky headgroups (e.~~., sialic acid-derived lipid monomers) are subject to
various solvent
interactions at the matrix surface, destabilizing the structure of the blue
film and thus
allowing relatively small perturbations provided by the localized membrane
rearrangements
to complete the colorimetric transition. Another possible explanation for the
improved
colorimetric response observed using dopants with bulky headgroups is that the
stearic
effects induced by the molecular recognition event (i.e., the interaction of
an analyte or
other molecule with the biopolymeric material) may interfere with the
headgroups of the
dopants, thus propagating the perturbation caused by the analyte.
In certain embodiments, the dopant comprises a diacetylene or a modified
diacetylene (e.g.. sialic acid derived diacetylene). It should be noted that
in this case, the
derivatized lipid is used to modify the properties of the biopolymeric
material and is not
used as a molecular recognition site for an analyte detection (e.g.. as in the
case of sialic
acid ligand used to detect influenza virus). For example, a diacetylene-based
polymeric
material containing only sialic acid derivatized monomer or lactose
derivatized monomer
did not respond to neurotoxins (e.g., botulinum neurotoxin), indicating that
there was an
insufficient interaction between the neurotoxins and the derivatized
diacetylene lipid to
induce the color change. However, when the same material was provided with a
ligand
having affinity for neurotoxin (e.g., ganglioside GM,), a colorimetric
response was detected
in the presence of neurotoxin. In this example, the sialic acid and lactose
derived lipids
are "dopants" and the ganglioside GM, is a ligand.
1t is contemplated that a wide variety of dopant materials will find use in
optimizing the properties of the biopolymeric material used in various
embodiments of the
present invention. Materials that are constituents of cell membrane structures
in nature are
generally useful as dopants in the present invention. For instance, steroids
(e.g.,
cholesterols) represent potential dopants that can provide desired degrees of
destabilization
or stabilization to the biopolymeric material. Surfactant type compounds also
may serve
as dopants. whether or not they are polymerized to self assembling monomers
that make
up the polymer back bone. For example, the detergent TWEEN 20, which does not
contain a polymerizable group, has been shown to provide a very dramatic
intensity to the
blue color of the iiposomes of certain embodiments of the present invention.
An
alternative surfactant that can be used as dopants are peptide-detergents (i.
e. , small
amphipathic molecules that have a hydrophobic region mimickin~~ the membrane
spanning
-40-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
regions of membrane proteins). These small peptides (typically 20-25 amino
acids in
length j can be incorporated into the biopolymeric material to alter the
stability or
sensitivity of the colorimetric response of the material. Since peptide-
detergents are
bulkier in the hydrophobic region of the material, they are capable of
producing a more
s pronounced effect on film stability or sensitivity than many other
surfactant molecules.
The most appropriate percentage of dopant incorporated into the structure of
the
biopolvmeric material is dependent on the particular system being developed,
and the
needs of the testing situation. For instance, sensitivity may be compromised
to some
extent in the favor of long shelf life, or to accommodate rigorous field
conditions. The
acceptable percentage of dopant is theoretically limited only to that which
will not
preclude sufficient incorporation of the indicator polydiacetylene molecules
to produce the
necessary optical density and color change or to that which will disrupt the
stability of the
polymeric structures.
Molar percentages of dopant can vary from as low as 0.01 % where increases of
sensiti~~itv have been observed in certain embodiments, to as high as 75%,
after which the
structural integrin~ of the biopolymeric material typically begins to
deteriorate. However.
there may be specific embodiments where the percentage of dopant is greater
than 75% or
lower than 0.01 °.°. A preferred range for dopant is 2%-10%. In
certain embodiments of
the present invention, the optimal percentage of dopant is about 5% (See e.g.,
Example 4,
2() section II). For example, for the detection of cholera toxin, it was found
that a film
COlllpl'tSttlg 2% lactose-derivatized polydiacetylene (PDA). 5% ganglioside,
and 93% PDA
resulted in a strop= blue to red color change when the film was incubated with
the analyte.
In selecting appropriate incorporation methods for the dopant, there are
several
competing considerations. For example, for the sonication bath method for
production of
2, certain liposome embodiments, the incorporation is very controlled, and
requires several
hours of processin<,. T'his relatively slow, gentle incorporation method
allows the
incorporation of comparatively large or complex dopant materials. However, the
sonication bath approach is only suitable when it is intended that a
relatively low
percenta~~e of dopant is to be incorporated. The point probe method allows the
30 incorporation of a much higher percentage of dopant material over a shorter
period of
time. typically from one to ten minutes. However, this method is typically
limited to
incorporation of small to intermediate sized dopant materials. The temperature
chosen for
incorporation are selected based on the particular analytical system and
Iiposome
-41 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
parameters desired. A practitioner will be able to select parameters such as
pH, choice of
dilutents. and other factors based on the particular system and desired
characteristics of the
biopolymeric material.
A series of derivatized polydiacetylene dopant molecules have been synthesized
s with a wide range of physical characteristics. These dopants are not the
same as filler
molecules typically observed in biological membranes (i.e., cholesterol,
proteins, lipids.
deter~~ents). They differ in that they provide unique and specific
functionality to a given
sensor system. The design of several dopants that provide specific
functionality to the
non-synthetic embodiments are described below and in Example 4.
1 (1 .-~ simple system has been designed so that the PDA molecule can easily
be
deriyatized. The synthesis is shown in Figure 9. Here, 10,12-pentacosadiynoic
acid is
modified to amine-couple to any molecule with a free amino group. Since all
amino acids
have a free amino ~~roup (lysine has ? free amino groups). the 20 amino acids
were each
placed on the head of PDA molecules. Each one of the derivatized PDA molecules
has
is special properties that allow special functionality to be incorporated into
the biopolymeric
material. For example, glutamine-PDA doped materials were the most sensitive,
most
water soluble, and most consistent colorimetric sensors. The properties of
some of the
other amino acid-derivated PDA molecules are described in Example 4. The water
solubility. ability to form films and liposomes, color, and colorimetric
response for
20 representative amino acid-derived diacetylenes is shown in Figure 10.
1V. LIGANDS
The biopolymeric materials of the present invention may further comprise one
or
more li~=ands. Li~~ands act as a recognition site in the biopolymeric
materials for analytes
or as anchors for recruiting molecules or localizing reactions to the
biopolymeric surface.
2, In some embodiments, upon the interaction of the analyte with the ligand or
ligands. a
disruption of the polymer backbone of the biopolymeric material occurs,
resulting in a
detectable color transition.
In some embodiments, ligands are linked by a linking arm to the self
assembling
monomers. directly linked to the monomers, incorporated into the biopolymeric
matrix
30 prior to or Burin n the polymerization process, or attached to the matrix
following
polymerization 1 c. ~~.. by linking ligands to matrix constituents that
contain head groups that
bind to the ligands or through other means). For example, Figure 11 provides a
schematic
- 42 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
depiction of one embodiment of the present invention. Compound 1 shows a
receptor-
binding ligand (i.e., sialic acid) attached to one terminal end of a spacer
molecule. The
second terminal end of the spacer molecule is attached to one of several
monomers (e.g.,
10,12-pentacosadivnoic acid) that have been polymerized so as to form a
chromatic
detection element. Compound 2 shows the 10,12-pentacosadiynoic acid without an
attached ligand.
The ligand group of the present invention comprise a wide variety of
materials.
The main criterion is that the ligand have an affinity for the analyte of
choice.
Appropriate ligands include, but are not limited to, peptides, carbohydrates,
nucleic acids.
biotin. drugs, chromophores, antigens, chelating compounds, short peptides,
pepstatin,
Diels-Alder reagents, molecular recognition complexes, ionic groups,
polymerizable
groups. dinitrophenols, linker groups, electron donor or acceptor groups,
hydrophobic
~Troups. hydrophilic groups. antibodies, or any organic molecules that bind to
receptors.
The biopolymeric material can be composed of combinations of ligand-linked and
unlinked
monomers to optimize the desired colorimetric response (e.g., 5% ligand-linked
dicosadynoic acid [DCDA] and 95% DCDA). Additionally, multiple ligands can be
incorporated into a single biopolymeric matrix. As is clear from the broad
range of
ligands that can be used with the present invention, an extremely diverse
group of analyzes
can be detected.
I n some embodiments, the self-assembling monomers are not associated with
ligands. but are directly assembled, polymerized, and used as colorimetric
sensors. Such
biopolvmeric materials find use in the detection of certain classes of
analytes including,
but not limited to. volatile organic compounds (VOCs).
In some embodiments, ligands are incorporated to detect a variety of
pathogenic
2s organisms includin~T. but not limited to, sialic acid to detect HIV (Wies
c~t al., Nature 333:
426 [1988]), influenza (White et al., Cell 56: 725 [1989]), Chlamydia (Infect.
Imm. 57:
2378 [1989]), A~ei.sseria merringitidis, Streptococcus sui.s, Salmonella.
mumps, newcastle.
and various viruses. including reovirus, Sendai virus, and myxovirus; and 9-
OAC sialic
acid to detect coronavirus. encephalomyelitis virus, and rotavirus; non-sialic
acid
glycoproteins to detect cytomegalovirus (Virology 176: 337 [1990]) and measles
virus
(Virology 172: 386 [1989]): CD4 (Khatzman et al., Nature 312: 763 [1985]),
vasoactive
intestinal peptide a Sacerdote et al.. J. of Neuroscience Research 18: 102 [
1987]), and
peptide T (Ruff er crl., FEBS Letters 211: 17 [1987]) to detect HIV; epidermal
growth
- 43 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
factor to detect vaccinia (Epstein et al., Nature 318: 663 [1985]);
acetylcholine receptor to
detect rabies (Lentz et al., Science 215: 182 [1982]); Cd3 complement receptor
to detect
Epstein-Barr virus {Caret et al., J. Biol. Chem. 265: 12293 [1990]); [3-
adrenergic receptor
to detect reovirus (Co et al., Proc. Natl. Acad. Sci. 82: 1494 [1985]); ICAM-1
(Marlin et
s al.. Nature 344: 70 [1990]), N-CAM, and myelin-associated glycoprotein MAb
(Shephey
et al. , Proc. Natl. Acad. Sci. 85: 7743 [ 1988]) to detect rhinovirus; polio
virus receptor to
detect polio virus (Mendelsohn et al., Cell 56: 855 [19$9]); fibroblast growth
factor
receptor to detect herpes virus (Kaner et al., Science 248: 1410 [1990]);
oligomannose to
detect E.rcher°ichicr coli; ganglioside GM, to detect Neissericr
meningitidis; and antibodies to
detect a broad variety of pathogens (e.g., Nei.ssericr gonorrhoeae, h
vulnificus, V.
hcrrahcremnlyticus. I! cholerae, and I! alginolyticus).
One skilled in the art will be able to associate a wide variety of ligand
types with
the biopolymeric materials of the present invention. Methods of derivatizing
lipids with a
diverse range of compounds (e.g., carbohydrates, proteins, nucleic acids, and
other
1S chemical groups) are well known in the art. The carboxylic acid on the
terminal end of
lipids can be easily modified to form esters, phosphate esters, amino groups,
ammoniums.
hydrazines, polyethylene oxides, amides, and many other compounds. These
chemical
groups provide linking groups for carbohydrates, proteins, nucleic acids, and
other
chemical groups (e.g., carboxylic acids can be directly linked to proteins by
making the
activated ester. followed by reaction to free amine groups on a protein to
form an amide
linkage). Examples of antibodies attached to Langmuir films are known in the
art (See
c~.~.. Tronin c~ ul.. Langmuir 11: 385 [1995]; and Vikholm et crl., Langmuir
12: 3276
[ 1996] ). There are numerous other means to couple materials to membranes, or
incorporate materials within a membrane, including for example, coupling of
proteins or
2, nucleic acids to polymer membranes (See e.g.. Bamford et al. Adv. Mat. 6:
550 [1994]):
couplin~~ of proteins to self assembled organic monolayers (See e.g., Winner
et ul., Adv.
Mat. ~: 912 [199]), and incorporating proteins into membranes (See e.g.,
Downer et al..
Biosensor and Bioelect. 7: 429 [1992]); among others. Protocols for attaching
ligands
(e.g., proteins. nucleic acids, and carbohydrates) to the colorimetric
materials of the
present invention are demonstrated in Example 5.
For example, the methods of the present invention provide a system to easily
attach
protein molecule. including antibodies, to the surface of polydiacetylene thin
films and
liposomes. thereb~~ providing biopolymeric materials with "protein" ligands.
Such ligands
-44-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
include. but are not limited to, peptides, proteins, lipoproteins,
glycoproteins, en?ymes,
receptors, channels. and antibodies. Upon binding an analyte (e. g. , enzyme
substrate,
receptor ligand. antigen, and other protein), a disruption of the polymer
backbone of the
biopolvmeric material may occur, resulting in a detectable color change. The
present
invention contemplates protein ligands that are incorporated into the
biopolymeric material
and those chemically associated with the surface of the biopolymeric material
(e. g.,
chemically linked to the surface head group of a monomer in the biopolymeric
monomer).
A. \ucleic Acid Ligands
(i) Selection of Nucleic Acid Ligands
1(1 One characteristic property of nucleic acids is their ability to form
sequence-specific hydrogen bonds with a nucleic acid having a complementary
sequence of
nucleotides. This ability of nucleic acids to form sequence-specific hydrogen
bonds (i.e., to
hybridize) with complementary strands of nucleic acids is exploited in the
methods of the
present invention. Nucleic acid having a known sequence (nucleic acid ligand)
or desired
1, hybridization characteristics is used as a "probe" to search a sample for a
"target"
complementary sequence. Target sequences are identified employing various
nucleic acid
ligands and the compositions and methods of the present invention.
The target sequence. to which the probe region is complementary, can be any
whole or portion of genomic material, or nucleic acid gene product such as
ribosomal,
2(1 transfer. messenger or intron RNA, from any organism (including, but not
limited to
bacteria. viruses. parasites. and fungi) or cells (e.g., any eukaryotic or
prokaryotic cells,
including but not limited to cultured cells). Target sequences are typically
in the order of
several hundred nucleotides. although shorter and longer sequences are
contemplated by
the present invention. They can be, for example and without limitation,
sequences
2, characteristic of a human or non-human pathogen (which includes any
infectious
microorganism). human or non-human {e.g., animal) DNA or RNA sequences (e.g.,
sequences characteristic of a genetic abnormality or other condition), and
sequences
derived from <~enetic engineering experiments such as, for example, total mRNA
or
random fragments of whole cell DNA. Methods for identifying target sequences
and for
30 preparin~~ probe regions are well known in the art. The target sequence can
also be, for
example. complementary to a nucleic acid sequence characteristic of a class of
human or
non-human pathogens, for example, all enteric bacilli or all Chlamydia. The
target
- 4~ -
CA 02330937 2000-12-12
WO 99/67423 PC'T/US99/14029
sequence can also be, for example, complementary to a nucleic acid sequence
characteristic of a host cell or vector used in the manufacture of recombinant
DNA
products (e.g., to detect the presence of such DNA or RNA contaminants in the
product).
In this regard, nucleic acids which are complementary to (i.e., have affinity
for) various
target sequences identified above are contemplated as the nucleic acid ligands
of the
present invention.
Another type of nucleic acid ligand contemplated by the present invention,
include
nucleic acid molecules which bind to, or interact with, other biological
molecules (e.g..
enzymes such as polymerases, nucleases, ligases, telomerases. and
transcription factors).
This type of binding depends upon the nucleotide sequences) that comprise the
DNA or
RNA involved. For example, short DNA sequences are known to bind to target
proteins
that repress or activate transcription in both prokaryotes and eukaryotes.
Other short DNA
sequences are known to serve as centromeres and telomeres of chromosomes,
presumably
by creating ligands for the binding of specific proteins that participate in
chromosome
1, mechanics. In this regard, nucleic acid molecules with sequences that are
natural targets
of biological molecules are contemplated as the nucleic acid ligands of the
present
invention.
The present invention also contemplates nucleic acid ligands that are not the
natural
targets for biological molecules, but which are instead capable of binding to
any desired
analvte selected b~- the user. One technique used to identify such nucleic
acids is called
the SELEX procedure. The basic SELEX procedure is described in U.S. Pat. Nos.
~.47~.09G: 5,270.163; and 5,475,096; and in PCT publications WO 97/38134, WO
98/33941. and ~~-O 99/07724, all of which are herein incorporated by
reference. The
SELEX procedure allows identification of nucleic acid molecules with unique
sequences.
2~ each of which has the property of binding specifically to a desired target
analyte or
molecule.
Briefly. the SELEX procedure involves selection from a mixture of candidates
of
interest in step-wise iterations. The SELEX procedure starts with a mixture of
nucleic
acids, preferably comprising a segment of randomized sequence. The mixture is
contacted
with a target (e.g.. an analyte) under conditions favorable for binding. Next,
unbound
nucleic acids are partitioned from those nucleic acids which have bound to
target
molecules. Then. the nucleic acid-target pairs are dissociated and the nucleic
acid is either
amplified or isolated to yield a preparation enriched for target binding. The
steps of
-46-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
binding, partitioning, dissociating and amplifying may be reiterated through
as many
cycles as desired.
Nucleic acids that have the highest affinity constants for the target are most
likely
to bind. After partitioning, dissociation and amplification, a second nucleic
acid mixture is
generated that is enriched for the higher binding affinity candidates.
Additional rounds of
selection progressively favor the best ligands until the resulting nucleic
acid mixture is
predominantly composed of only one or a few sequences. These can then be
cloned,
sequenced and individually tested for binding affinity as pure ligands.
Cycles of selection and amplification are repeated until a desired goal is
achieved.
In the most general case, selection/amplification is continued until no
significant
improvement in binding strength is achieved upon repetition of the cycle. The
method
may be used to sample as many as about 10' g different nucleic acid species in
a test
mixture. The nucleic acids of the test mixture preferably include a randomized
sequence
portion, as this portion provides a large number of possible sequences and
structures with
l~ a wide range of binding affinities for a given target. A nucleic acid
mixture comprising,
for example a ?0 nucleotide randomized segment can have 4'-° candidate
possibilities.
However. the present invention is not limited to a randomized segment of any
particular
length. In some embodiments, the randomized portion may be from about 40 to
120 base
pairs in length. while in other embodiments, the randomized portion may be
from about 50
to 100 base pairs in length. and in some preferred embodiments, the randomized
portion is
from about 70 to 90 base pairs in length.
The randomized portion is flanked by 5' and 3' fixed sequence regions. The
fixed
sequence regions are conserved sequences useful for efficient amplification
(e.g., by PCR).
Accordingly, the same pair of PCR primers can be utilized to amplify the
randomized
regions selected by the protocol. In some preferred embodiments, the fixed
sequence
regions are designed so that dimer formation and annealing between primers is
minimized.
In other preferred embodiments, the fixed regions include a promoter region
(e.g., T3, T7.
or SP6 promoter). In still other embodiments, the 5' fixed sequence region and
3' fixed
sequence region are flanked by restriction sites to allow easy cloning of the
entire nucleic
acid including the fixed regions, or subcloning of the randomized region.
Useful
restriction sites include, but are not limited to, sites known in the art such
as EcoRI.
HindIII. P.stI. etc.
-47-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
Nucleic acid sequence variants can be produced in a number of ways including
synthesis of randomized nucleic acid sequences and size selection from
randomly cleaved
cellular nucleic acids. The variable sequence portion may contain fully or
partially
random sequence: it may also contain subportions of conserved sequence
incorporated with
S randomized sequence. Sequence variation in test nucleic acids can be
introduced or
increased by mutagenesis before or during the selection/amplification
iterations.
Partitioning methods used in SELEX rely on a partitioning matrix. High
affinity
oligonucleotides may be separated using various methods, including
chromatographic-type
processes, binding to nitrocellulose filters, liquid-liquid partition, gel
filtration, and density
gradient centrifugation.
Accordingly. the present invention contemplates screening a randomized pool of
nucleic acid molecules for the ability to bind to various analytes, in order
to use these
nucleic acid molecules as nucleic acid ligands in the present invention. In
some
embodiments, a composition comprising nucleic acids is provided. In some
embodiments,
the mixture comprises greater than about 10~' different nucleic acid
sequences, while in
particularly preferred embodiments, the mixture comprises greater than about
10~R different
nucleic acid sequences. In preferred embodiments of the present invention, the
nucleic
acids include a randomized portion. In other embodiments, the randomized
portion is
from about 30 to 150 nucleotides in length. In still other embodiments, the
randomized
portion is from about 40 to 120 nucleotides in length. In other preferred
embodiments, the
randomized portion is from about 50 to 100 nucleotides in length. In some
particularly
preferred embodiments, the randomized portion is from about 70 to 95
nucleotides in
length. while in other particularly preferred embodiments, the randomized
portion is from
about 50 to 60 nucleotides in length.
Therefore. the present invention comtemplates nucleic acid ligands capable of
binding to mam- types of analytes. Further examples of these these analytes
include, but
are not limited to. pathogens. drugs, receptor ligands, antigens, ions,
proteins, hormones,
blood components. antibodies, and lectins.
All of the various nucleic acid ligands identified above may also be included
as a
domain or portion of a larger nucleic acid molecule. Also, all of the nucleic
acid ligands
identified above can be conjugated to monomers as described below.
-48-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
(ii) Attachment of DNA to monomers
In one embodiment of the present invention, self assembling monomers were
covalently attached to the 5'-terminus of a single stranded DNA fragment, also
referred to
as oligodeoxynucleotide (ODN). The ODN-lipid conjugate was incorporated into
diacetylene liposome assemblies. A common procedure for conjugation reactions
with
synthetic DNA is the modification of an oligodeoxynucleotide (ODN) in a DNA
synthesizer with an amino function at the 5'-end and cleaving and deprotecting
the ODN
to give a reactive amine functionality capable of further reactions (See e.g.,
Chatterjee et
al., .I. Alll. Chetll. Soc. 112:6397-6399 [1990]; Gryaznov et al., Nucleic
Acids Res. 21
lU (1993]: Reed et u.'.. Bioconjugate Chem. 6:101-108 [1995]; Soukup et crl.,
Bioconjugate
Chem. 6:135-138 [1995]; Herrlein et al., J. Am. Chem. Soc. 117:10151-10152
[1995];
Timofeev et ul.. \ucleic Acids Res. 24:3142-3148 [1996]; Kang et al., Nucleic
Acids Res.
24:3896-3902 [1996]; and Ganachaud et al., Langmuir 13:701-707 [1997]).
Amidation
with an activated carboxylate (i. e. , N-hydroxysuccinimide ester) is usually
employed. In
15 one embodiment. a 5'-amino functionalized 27-mer (hereinafter, "Oligo 1 "),
HEN-CH,-CH(CH:OH)-OPO,H-O-S~GAATGTATTAGAATGTAATGAACTTTA3~) (SEQ
ID NO: I ). was conjugated with the N-hydroxysuccinimide ester of 10,12-
pentacosadiynoic
acid (NHS-PDA ).
An alternative procedure for conjugation was the N,N'-dicyclohexylcarbodiimide
2U (DCC) mediated esterification of a diacetylene lipid monophosphate. The
method of
phosphate diester formation by reaction of a phosphate monoester with an
alcohol in the
presence of dic~~cioheylcarbodiimide has been described by Khorana et al.,
with
pyrophosphates being formed as side products (See e,g. , Khorana et al. , 3.
Chem. Soc.
[195 3): Smith er al.. J. Atll. Chem. Soc. 80:6204-6212 [1958]: Gilham et al.,
J. Am.
25 Chem. Soc. 80:6'_'12-6222 [1958]; and Tener et al., J. Am. Chem. Soc. 80
[1958]). The
reaction of a sug r phosphate with a lipid alcohol has been reported using
dicycloheylcarbodiimide as condensation reagent (See e.g., Warren et al.,
Biochemistry
11:2566-2572 [19'?]; Warren et al., Biochemistry 12:5031-5037 [1973]; and
Warren et
al.. Biochemistry 1':5038-5045 [1973]). The obtained conjugation products were
30 characterized by ~~zl electrophoresis as single strands and as
hybridization products with
their unmodified ;.omplements. DNA incorporation into liposomes using
bacteriophage i.
to inject DNA into liposomes carrying the Shigella receptor has also been
reported (New
et crl.. Liposome:: _a Practical Approach, first Ed.. Oxford University
Press:New York
-49-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
[1990]). In one embodiment of the present invention, the 5'-OH terminus of a
solid
support bound 10-mer was conjugated with a diacetylene monophosphate using
DCC.
In certain embodiments of the present invention, the ODN-lipid conjugates were
mixed with liposomes which were then photopolymerized and filtered to remove
unbound
ODN. The amount of ODN retained with the liposomes was quantified by UV
absorbance
measurements at 260 nm. Interaction and inclusion of DNA in liposomes have
been
investigated, particularly as DNA delivery systems in gene therapy (See e.~T.
, New et ul. ,
supra). Cationic liposomes form layered complexes with parallel aligned DNA
helixes
sandwiched bem~een lipid bilayers, exhibiting a liquid crystalline behavior
(See e.g., Radler
er al.. J. Am. Chem. Soc. 275:810-814 [1997]; and Lasic et al.. J. Anl. Chem:
Soc.
I 19:832-833 [ 1997]) Unlike the present invention, however. none of these
liposomes
exhibit visible colorimetric changes upon binding to DNA.
In certain embodiments, the adsorption characteristics of ODN onto canonically
charged latex particles were investigated in dependence of pH. Coulomb
interaction
between the positively charged surface and the negatively charged ODN, and
hydrophobic
interactions or H-bonding play an important role (See e.g., Ganachaud et al.,
Langmuir
13:701-707 [1997]; and Elaissari et al., Langmuir 11:1261-1267 [1995]). This
hydrophobic interaction / H-bonding causes ODN to adsorb even on negatively
charged
surfaces, as was observed in PDA liposomes with exposed carboxylic acid
headgroups at
the liposome surface.
It is not intended that the present invention be limited to any particular
methods of
DNA-lipid incorporation. In one embodiment, single stranded probe DNA (ss-p-
DNA)
lipids are incorporated into preformed biopolymeric material with subsequent
photopolymerization. This method requires synthesis of ss-p-DNA lipids.
conjugation of
2, the probe DNA with a diacetylene lipid, and subsequent insertion in the
layer, followed by
polymerization of the diacetylenes. The direct conjugation of the diacetylene
lipid to the
5'-end of the probe DNA could, for example, be achieved by treatment of the 5'-
OH-
terminated oligonucleotide with POCl3/PO(OCH3)3 and the lipid alcohol, or by
phosphorylation of the 5'-OH-end with cyanoethyl
phosphate/trichloroacetonitrile, followed
by reaction with the lipid alcohol/trichloroacetonitrile. This method however,
gives a
rather low yield. (See e.g., Ringsdorf et al., Angew. Chem. 100:117 [1988];
and Chen cn
crl., J. Colloid Interface Sci. 153:244 [1992]). An alternative synthetic
procedure that
gives higher yields involves the coupling of phosphoramidite or the H-
phosphonate of the
-50-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
lipid as the last coupling step in the automated oligonucleotide synthesis
(See e.~.,
Kunitake, Angew. Chem. 104:692 [ 1992]; Roberts, Langmuir-Blodgett Films,
Plenum
Press, New York [ 1990]; and Ulman, Ultrathin Organic Films, first ed..
Academic Press,
Inc., San Diego [ 1991 ]). This method requires that the lipid be stable
against the reaction
conditions in the DNA synthesizer. Since oxidation of the intermediate
phosphite triester
to the phosphate is accomplished by I, treatment, the diacetylene unit might
not be stable
under these conditions, and addition of iodine to the triple bond might occur.
Functional
groups may also be introduced at the 5'-end, like an amino or thiol moiety,
followed by
the coupling of the lipid. A variety of phosphoramidites with such functional
groups are
commercially available for use in the DNA synthesizer.
Alternatively, ss-p-DNA could be linked to specific anchor lipids after
photopolymerizaiton of the lipids, in order to circumvent photodegradation of
the DNA.
Furthermore, liposomes are immobilized covalently to a substrate surface for
integration
into colorimetric detection devices. This attachment can be achieved by
incorporation of
is an anchor lipid which reacts specifically with functional groups exposed on
the substrate
surface. DNA fixation at polydiacetylene surfaces can be achieved by
unspecific
immobilization at amino or Al(III) phosphonate functionalized surfaces, or
photocoupling
of DNA to silica gel-bound psoralen. In the case of the amino- and Al(III)
phosphonate,
surface specific hybridization of complementary DNA to the surface bound DNA
was
reported (See e.g.. Zasadzinski et al., Science 263:1726 [1994]; Whitesides et
al., Science
254:1312 [ 1991 ]: and Damer et al. , Liposome Preparation: Methods and
Mechanisms, first
ed., Marcel Dekker, Inc., New York and Basel [ 1983]).
In one embodiment of the present invention, the DNA ligands provided a 30%
colorimetric response to a hybridization event by complementary nucleic acid.
The
response was sequence-specific, as noncomplementary control oligonucleotides
provided
only 15% response.
V. DETECTION OF COLORIMETRIC CHANGES
T'he colorimetric change resulting from disruption of the biopolymeric
material can
be detected using many methods. In preferred embodiments of the present
invention, a
color shift was observed simply by visual observation. Thus, the present
invention may be
easily used by an untrained observer such as an at-home user.
-51 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
In alternative embodiments, spectral test equipment well known in the art is
employed to detect changes in spectral qualities beyond the limits of simple
visual
observation, including optical density to a particular illuminating light
wavelength. For
example, using a spectrometer, the spectrum of the material was measured
before and after
analyte introduction, and the colorimetric response (%CR) was measured. The
visible
absorption spectrum of the material prior to analyte exposure was measured as
Bo Ia/(I~, +
I~) where "B" represents the percentage of a given color phase at wavelength
I, compared
to a reference wavelength I,.. The spectrum was then taken following analyte
exposure
and a similar calculation was made to determine the B,;"~i. The colorimetric
response was
calculated as %CR = [(B~-8,;~~,)/Bo] X 100%.
Additionally, the present invention can be, if desired, attached to a
transducer
device. The association of self assembled monomer materials with transducers
has been
described using optical fibers (See e. g., Beswick and Pitt, J. Colloid
Interface Sci. 124:
146 [1988]; and Zhao and Reichert, Langmuir 8: 2785 [1992]), quartz
oscillators (See e.g..
1~ Furuki and Pu. Thin Solid Films 210: 471 [1992]; and Kepley et al., Anal.
Chem. 64:
3191 [1992]), and electrode surfaces (See e.g., Miyasaka et al., Chem. Lett.,
p. 627
[ 1990]; and Bilewicz and Majda, I~angmuir 7: 2794 [ 1991 ]). However, unlike
these
examples, the present invention provides a double-check (i.e., confirmation
method) by
observation of color change in the material.
In some embodiments, the biopolymeric materials of the present invention can
be
coated on thin PzT materials that oscillate at a resonance frequency,
producing a
microelectromechanical system (MEMS system). Thus, alterations in the
biopolymeric
material can be detected as a change in resonant frequency with colorimetric
change
providing a confirmation of event.
2> Sensitivim can also be enhanced by coupling the lipid-polymer to a
photoelectric
device. colorimeter. or fiber optic tip that can read at two or more specific
wavelengths.
Also, the device can be linked to an alternative signalling device such as a
sounding alarm
or vibration to provide simple interpretation of the signal.
As describzd above. in addition to detecting the activity of analytes (e.g.,
lipid
cleavage activity of lipases and membrane modification activity of
transferases), it may
also be desired to detect the presence of analytes. The biopolymeric materials
of the
present invention can be used to detect a large variety of analytes including,
but not
limited to, small molecules. microorganisms, membrane receptors, membrane
fragments,
-52-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029 .
volatile organic compounds (VOCs), enzymes, drugs, antibodies, and other
relevant
materials by the observation of color changes that occur upon analyte binding.
The
present invention works under very mild testing conditions, providing the
ability to detect
small biomolecules in a near natural state and avoiding the risks associated
with
S modification or degradation of the analyte.
VI. DETECTION OF MEMBRANE CONFORMATIONAL CHANGES
As described above. the present invention provides methods for detecting
conformational alterations in the biopolymeric material by observation of
colorimetric
changes. Such conformational changes can be caused by the binding of an
analyte to a
ligand (described above) and through the chemical modification of the
biopolymeric
material by chemical reactions (e.g., enzymatic catalysis).
In some embodiments, the present invention provides a simple protocol using
biopolymeric material and offers a practical approach to detecting interfacial
catalysis,
identifying inhibitors, and screening enzymes and other catalytic entities
(e.g., catalytic
antibodies) to characterize their catalytic capabilities. These methods use
natural,
unlabeled substrates, and catalysis or inhibition is signaled by the presence
or lack of a
color transition of the surrounding lipid-polymer assembly. The one-step
nature of the
technique allows for convenient adaptation to high throughput compound
screening. This
method is generally applicable to factors that affect enzyme recognition and
activity, and
influence membrane reorganization.
Polymerized mixed vesicles are highly stable against chemical and physical
degradation and offer a convenient, economical alternative to enzymatic assays
that
employ radiolabled substrates. The vesicle stock solutions described by the
present
invention have be;.n stored for over six months without affecting the results
of the assay.
Specific applications of the present invention are described below to
illustrate the
broad applicability of the invention to a range of conformational changes and
to
demonstrate its spzcificity. and ease of use. Phospholipase A,, phospholipase
C,
phospholipase D. bungarotoxin, and other enzyme activities are illustrated.
These
examples are intznded to merely illustrate the broad applicability of the
present invention;
it is not intended that the present invention be limited to these particular
embodiments.
-53-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
A. Phospholipase AZ Activity
PLAN activity has previously been studied in a variety of model membrane
systems
such as polymerized vesicles (Dug et al., J. Biol. Chem. 270, 263 [1995]),
micelles
(Reynolds et al. .SUrpra), and monolayers (Grainger et al, supra; and Mirsky
et al., Thin
s Solid Films 284. 939 [1996)) using labeling techniques (e.g., radioactivity
and
fluorescence). The present invention provides biopolymeric materials
incorporating PLA,
substrate lipids for the colorimetric detection of PLA, enzyme activity.
Biopolymeric materials were prepared with a combination of polymerizable
matrix
lipid (e.g., 10.1?-tricosadiynoic acid) and various mole fractions (0-40%) of
PLA,
substrate lipid (e.g.. dimyristoylphosphatidylcholine [DMPC]) as described in
Examples 1
and 10. In some embodiments, the biopolymeric materials containing the PLA,
substrate
lipid were liposomes as shown in Figure 12. This figure shows DMPC substrate
in a
diacetvlenic lipid matrix before (top) and after (bottom) polymerization. In
their initial
state, the vesicles appeared deep blue to the naked eye and absorbed maximally
at around
1S 620 nm. as shown in Figure 13 (solid line). Upon addition of PLA, to the
DMPC/PDA
vesicles, the suspension rapidly turned red (i.e., within minutes) and
exhibited a maximum
absorption at approximately 540 nm as shown in Figure 13 (dashed line).
The color change was modulated by altering the mole percentage of the natural
lipid DMPC in the PDA vesicle as shown in Figure 14. A relative color change
of 10%
or more is clearly observed with the naked eye. Within minutes, liposomes
containing
greater than 20% DMPC exhibited strong colorimetric responses. Liposomes with
low
molar ratios of DMPC (e.g., 5%) also showed visually detectable colorimetric
response
after longer incubations. Vesicles that did not contain DMPC, remained largely
in their
blue phase upon addition of PLA, as shown in the control sample.
2~ Biochromic transitions of PDA vesicles and films have been proposed to
arise from
perturbation of the extended ~c-overlap of the conjugated polymer backbone.
This
structural rearrangement, induced in previous studies by multivalent receptor
binding or
penetration of peptide domains into the PDA matrix. results in absorption at
shorter
wavelengths, (i.~.. 490-540 nm) (Charych et al., Chemistry and Biology, supra;
Pan and
Charych. supra: and Cheng and Stevens, Advance Materials, supra). The intense
color
change observed upon the interaction between the enzyme PLA, and the mixed
DMPC!PDA vesicles indicates, that in this case, chemical modification of the
vesicles by
interfacial catalysis provides an alternative pathway for inducing the
biochromatic
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
transitions. Thus, the present invention demonstrates a new means of inducing
colorimetric change in biopolymeric materials.
in order to confirm that biocatalysis was occurring at the DMPC/PDA vesicles,
PLA, activity was independently measured using a labeled lipid analog
incorporated into
the PDA matrix. allowing simultaneous measurement of product formation and
colorimetric response of the vesicles. The analog used was thioester 1,2-bis-
(S-decanoyl)-
1.2-dithio-sn-glycero-3-phosphocholine (DTPC). Cleavage of DTPC by PLAN
produces a
soluble thiol-modified lipid that readily reacts with S,S'-dithiobis-2-
nitrobenzoic acid
(DTNB) to produce a colored product that characteristically absorbs at 412 nm
(Reynolds
et crl.. .swpr°cr). Indeed, when PLA, was added to mixed 40% DTPC/PDA
vesicles, the
hydrolysis products reacting with DTNB gave rise to a significant absorption
at 412 nm as
shown in Figure 1S. At the same time, the PDA vesicles also changed color, and
the
suspension exhibited a colorimetric response similar to that of the vesicles
containing
DMPC shown in Figure 13. These results confirm that interfacial catalysis by
PLA,
is occurred at the polymerized mixed vesicles.
NMR experiments further verified the occurrence of interfacial catalysis by
PLA,,
and provided information of the fate of the enzymatic reaction products.
Figure 16
features ='' P NMR spectra of the DMPC/PDA vesicles prior to the addition of
PLAN
(Figure 16A), and following the enzymatic reaction (Figure 16B). The
relatively broad,
anisotropic "P resonance from the intact vesicles, Figure 16A, corresponds to
the choline
head-group of DMPC embedded in the PDA vesicles. The observation of 3'P
anisotropy
in Figure 16A indicates that DMPC molecules are immobilized within the vesicle
matrix.
After addition of PLA." the "P signal was shifted downfield as shown in Figure
16B. The
position of the ''P resonance in Figure 16B coincides with the shift observed
for the
water-solubilized lyso-myristoylphosphatidylcholine, the hydrolysis product of
DMPC.
Furthermore, Figure 16B shows that the 3~P resonance observed in the
suspension of the
enzyme-treated vesicles becomes significantly narrower than the ''P signal
from the initial
DMPC/PDA vesicle, Figure 16A, indicating a higher mobility of the phosphate
group
following PLA, catalysis (Smith and Ekiel, Phosphorous-31 NMR, Pt~inciple.s
and
Applicatinn.s, Academic Press, Orlando, pp 447 [1984]). This result suggests
dissolution
of the Ivsolipid reaction products following the enzymatic reaction. 'H NMR
data
indicating the appearance of a distinct lysolipid phase following the reaction
with PLA,
further supported this description.
-SS-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
B. Others Phospholipases
Colorimetric detection of interfacial catalysis by other enzymes such as
phospholipase C (PLC) and phospholipase D (PLD) has been also achieved using
the
substrate-modified PDA vesicles, demonstrating that the methodology described
by the
present invention is generally applicable. These phospholipases cleave the
polar head
Group region of glycerophospholipids, whereas phospholipase A~ cleaves the
acyl ester
bond exclusively at the 2-acyl position.
The assay test for phospholipase D and C were run under similar conditions as
the
PLA~ assays. Both PLD and PLC activity were successfully detected by the
liposomes
assay. The PLD assay yielded a final colorimetric response of approximately
55%.
However. the shape of the response curve was more gradual than that of PLA,.
Although
it is not necessary to understand the mechanism in order to use the present
invention, and
it is not intended that the present invention be so limited, it is
contemplated that either the
kinetics of the PLD-catalyzed reaction are different or that the response time
between the
catalytic event and the color change is slower. The PLC assay yielded a final
colorimetric
response of 60°ro and the response curve was similar to that of PLA,.
NMR experiments
further verified the occurrence of interfacial catalysis by PLC and PLD.
C. Bungarotoxin (BUTX)
[3-bungarotoxin, a snake toxin from Bungarus multicinclus, is known to destroy
synaptic vesicles and inhibit acetylcholine release. It is classified as a
PLA~ toxin and is
composed of two subunits: a 12-kDa subunit that exhibits PLAN activity and a
7.5-kDa
subunit that shares sequence homology with protease inhibitors.
Experiments with bungarotoxin and 40% DMPC/60% 10,12-tricosadiynoic acid
(TRCDA) liposomes displayed a maximum colorimetric response of approximately
50%
after a one hour incubation time. The response curve was similar to that of
the PLA
assay. in addition. after incubation with BUTX, the liposomes in the assay
solution not
only changed color. but also precipitated. In a previous study, BUTX was shown
to
induce fusion of small unilamellar liposomes (Rufini et al., Biochemistry 29,
9644
[ 1990]). The mechanism of the fusion remains unclear, but it seems to be
dependent upon
the interaction beriveen BUTX, Ca-'-, and lysophospholipids.
This bungarotoxin assay provides an example of a large molecular assembly
possessing enzymatic properties that is capable of producing a colorimetric
change in the
-56-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
biopolymeric materials. In some embodiments, it may be desired to add
additior_al
bungarotoxin-detecting features to the biopolymeric materials to enhance the
colorimetric
detection. For example, antibodies raised against bungarotoxin (i. c'. ,
ligands) can be
incorporated onto the biopolymeric materials in addition to DMPC. Thus, when
bungarotoxin is present. in a sample, the ligand/analyte interaction and the
enzyme/substrate reaction will combine to provide an enhanced colorimetric
response.
D. Other Enzyme Systems
The present invention will find use in detecting, measuring, and
characterizing the
enzyme activities of many other systems including, but not limited to,
lipolytic enzymes.
acyltransferases. protein kinases, glycosidases, isomerases, ligases,
polymerases, and
proteinases, amon<, others. Such enzymes can be free in solution, or be part
of larger
molecular aggregates, cells. and pathogens. For a general description of
biocatalytic
events. the reader is directed to Dordick (Dordick, Bincatalysts,for Industry,
Plenum Press
[1991]).
1 ~ For example, glycosidases can be detected to measure their activity or as
indicators
of the presence of a pathogen. Sialidases such as neuraminidase are found on
influenza
virus. and other sialidases are associated with Salmonella. By providing
biopolymeric
materials with substrate for the glycosidases, the presence of the pathogens
can be
detected. In combination with other detection elements (e.g., sialic acid
ligands for
detection of influenza virus). extremely sensitive colorimetric sensors can be
produced.
Substrates can also be provided to produce detection systems for proteinases.
For
example. C'andida albicans can be detected though its protease activity on
pepstatin
substrates. Also. anthrax spores from Bacillus anthracis can be detected by
identifying
laccase activity though its reaction with a substrate. Laccases are mufti-
copper-containing
enzymes that catalyze oxidative conversion of a variety of substrates,
including phenols,
poly-phenols, and aromatic amines. Specific substrates include vanillic acid,
syringic acid.
and 2-? ~-azino-bill 3-ethyl-benzthioazoline-6-sulfonic acid). By introducing
one or more
of these known laccase substrates into the biopolymeric materials of the
present invention.
a detection assay for antrax spores may be generated.
Other applications include incorporation of nucleic acids onto the
biopolymeric
material to test the activity of nucleotide polymerases (e.g., DNA
polymerase). These
assay s~-stems will find use in techniques for identifying and characterizing
polymerase
-57-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029 .
inhibitors. From these examples, it is clear that the biopolymeric materials
of the present
invention find use in the colorimetric detection of a broad array of membrane
conformational changes and reactions.
E. Inhibitor Screening
As described above. the present invention provides methods for detecting the
activity of enzymes and other molecules that alter the conformation of
biopolymeric
membranes. These methods can be expanded to provide an accurate, and fast
screening
technique for identifying and characterizing inhibitors of the activity
responsible for the
colorimetric chance (e.g., identifying and characterizing protease inhibitors
by subjecting
candidate inhibitors to biopolymeric materials comprising the protein
substrates for the
enzymes).
For example, with the detection of PLA, enzyme activity described above, the
color change of the DMPC/PDA vesicles can be suppressed by using inhibitors to
PLA,.
In the presence of the inhibitor I-hexadecyl-3-trifluoroethylglycero-2-
phosphomethanol
(MJ33) (Gelb et al., supra; and Jain et al., Biochemistry 30, 10256 [1991]),
the vesicles
remained in their blue phase upon addition of PLAN. These color differentials
were clearly
visualized for PLA,/vesicle suspension in the presence (blue) and absence
(red) of MJ33 in
a 96-w°ell microtiter plate. The absorbance of the wells was measured
using a standard
microplate reader. and quantitatively confirmed the suppression of the
colorimetric
response as shown in Figure 17. This figure shows the colorimetric response
curves for
DMPC/PCA vesicles in the absence of inhibitor (solid line, max error 1.9%) and
in the
presence of MJ33 (dashed line, squares, max error 6.9%). Also shown is the
inhibition of
PLA= by replacement of Ca'-~ with Zn'-+ (dashed line, diamonds, max error
6.5%).
The inhibition of the blue to red color change by MJ33 indicates that non-
specific
adhesion does not play a role in the biochromic response, and PLA, activity is
directly
responsible for the color change. Inactivation of PLA, is also observed upon
removal of
Ca'-~. the catalytic co-factors for PLA, (Gelb et al. , supra), from the
buffer solution.
Similarly. PLA, prepared in buffer containing Zn'-' instead of Ca'-' ions does
not induce a
blue to red color change of the vesicles as shown in Figure 17 (dashed line,
diamonds).
The vesicles also do not change color in the presence of other enzymes such as
lysozyme
and glucose oxidase, both of which produce a colorimetric response below 5%
after more
than an hour of incubation with the 40% DMPC/PDA vesicles. The specificity of
the
-58-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
colorimetric response provides the necessary selectivity for high throughput
screening of
enzyme inhibitors.
For screening inhibitors, biopolymeric material comprising a substrate for the
enzyme being tested, are placed into a mufti-chambered device (e.g., a 96-well
plate).
Each well is incubated with a sample suspected of containing an enzyme
inhibitor. The
enzyme is then added and the observation of a color change is detected.
Successful
inhibitors will partially or completely prevent the enzyme from producing a
color change
in the biopolymeric material. Appropriate control samples (e.g., a sample with
no
inhibitor and a sample with known inhibitor) are run with the assay to provide
confidence
in the results.
F. Designed Catalysts
The biopolvmeric materials of the present invention further provide methods
for
screeninL~ the efficacy and activity of "designed" proteins, peptides, and
catalytic
antibodies. There is much current activity in engineering enzymes to be stable
under
is specific conditions of solvent and heat, among other conditions. By
providing a substrate
for such enzymes in the biopolymeric materials of the present invention, a
simple, accurate
screen of these engineered proteins can be conducted under a variety of test
conditions.
Likewise. the inventive methods can be used to screen and characterize the
reactions of
catalytic antibodies.
VII. IMMOBILIZATION OF BIOPOLYMERIC MATERIALS
The biopolvmeric material of the present invention can be immobilized on a
variety
of solid supports. including. but not limited to polystyrene, polyethylene,
teflon, silica gel
beads, hydrophobized silica, mica, filter paper (e.g., nylon, cellulose, and
nitrocellulose).
glass beads and slides, gold and all separation media such as silica gel,
sephadex, and
2; other chromatographic media. In some embodiments, the biopolymeric
materials were
immobilized in silica glass using the sol-gel process.
Immobilization of the colorimetric biopolvmeric materials of the present
invention
Illav be desired to improve their stability, robustness, shelf life,
colorimetric response.
color. ease of use. assembly into devices (c~.g.. arrays), and other desired
properties. In
some embodiments. placement of colorimetric materials onto a variety of
substrates
surfaces can be undertaken to create a test method similar to the well-known
and easy to
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
use litmus paper test. For example, the reflective properties of nylon filter
paper greatly
enhance the colorimetric properties of the immobilized polydiacetylene
liposomes. Filter
paper also increases the stability of the liposomes due to the mesh size.
In another example, the liposome embodiment of the present invention has been
loaded into the ink cartridge of a inkjet printer and used to print
biopolymeric liposome
material onto paper as though it were ink. The liposome material present on
the paper
maintained its calorimetric properties. This embodiment demonstrates the ease
with which
patterned arrays can be generated into any desired shape and size. By using
multiple
cartridges (e.~;.. using a color printer), patterned arrays can be generated
with different
1(1 biopolymeric materials.
In some embodiments of the present invention, liposome layers on thin support
(i.e., printing paper. plastic sheets, overhead transparencies. etc.) were
patterned, using a
regular inkjet printer. The printer was used by filling the printing cartridge
with the
liposome solution. This allowed patterning in the range from several tens of
cm down to
1S the sub mm region (resolution limit of the printer), and the pattern was
easily designed
and printed from any personal computer application (e.g., drawing program.
word
processor). The printed liposomes were photopolymerized after drying with the
resulting
polymer being strongly absorbed, and even organic solvents like acetone or
CH~CI~ did not
dissolve the created pattern. This method represents an ideal approach to the
generation of
20 test stick type applications or array type assays. An additional advantage
is the efficient
use of the liposome material which is applied in thin films, and used
completely in the
assay (i. e.. no loss due to washing or functionalization steps).
The general working procedure consists of the following steps: i) preparation
of
the liposome solution (>_5 ml, 2-10 mM) and filling of the cartridge with it;
ii) priming
2s and flushing of the cartridge with an ink intensive print pattern
immediately followed by
printing of the desired liposome pattern; and iii) photopolymerization of the
liposome
printout.
In the course of experiments, several problems were observed. Polymerization
yield depended on paper type with regular white copy paper generally giving
good results.
30 On higher qualim papers (i. e.. laser printer paper, color printer paper)
the printed
liposomes did not polymerize as well, which also depended on the type of
liposomes.
Pure TRCDA ( 10 mM) or PDA (2 mM) liposomes polymerized with slightly reduced
yield compared to regular paper, but TRCDA liposomes containing 20% of a
sialic acid
-60-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
lipid (SA-PDA) did not polymerize at all on such high quality paper. On the
other hand
SA-PDA containing liposomes polymerized well on standard paper or overhead
transparencies. In other experiments, print nozzles clogged after a short
time. This was
most likely due to evaporation of water and aggregation of liposomes in the
nozzles. To
prevent clogging. ~-30% ethanol was added to the liposome solution which was
quite
effective for declogging the nozzles, although polymerization yields dropped.
The nozzles
can be cleared by washing with ethanol and flushing with liposome solution by
pressurizing the cartridge with N, or air, forcing the liquid inside the
cartridge through the
printing nozzles. It is contemplated that the additives like glycerol and
polyethyleneglycol
may be added to prevent evaporation of water. resulting in the prevention of
prevent
liposome aggregation without affecting polymerization yields. In alternative
embodiments.
the nozzle is redesigned to prevent clogging (e.g., redesigning the shape or
using different
materials).
A. Entrapment of Biopolymeric Material by the Sol-Gel Method
While the sol-gel process has been used for entrapping organic molecules such
as
dyes and biomolecules in silica gels (See e.~., Avnir, Accounts Chem. Res. 28:
328
[1995]; Yamanaka et al., Am. Chem. Soc. 117: 9095 [1995]; Miller et al., Non-
Cryst.
Solids 202: 279 [1996]; and Dave et al., Anal. Chem. 66: 1120A [1994]), prior
to the
development of the present invention, immobilization of self organized
molecular
aggregates (e.~l.. biopolymeric material, self assembling monomer aggregates,
and
liposomes) was not realized in sol-gel materials.
Embodiments of the present invention provide for the successful immobilization
of
spherical. bilayer lipid aggregates, and liposomes using an aqueous sol-gel
procedure.
These molecular structures. and particularly liposomes, composed of biological
or
2s biomimetic (i. e.. mimics nature) lipids, are fairly robust under aqueous
conditions and
ambient temperatures, but can easily degrade in the presence of organic
solvents and high
temperatures. The sol-gel process provides a facile method of immobilizing
molecular
aggregates with no detectable structure modification, creating robust
structures that are
easily fabricated into any desired size or shape.
The silica sol-gel material was prepared by sonicating
tetramethylorthosilicate.
water. and hydrochloric acid under chilled conditions until a single phased
solution was
obtained. The use of metal oxides, other than tetramethylorthosilicate, are
contemplated
-61 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
by the present invention, so long as they facilitate the entrapment and form
substantially
transparent glass material. Such metal oxides include, but are not limited to,
silicates.
titanates, aluminates, ormosils, and others. Buffer was then added to the
acidic solution
under cooling conditions. The biopolymeric materials, generated as described
above, were
mixed into the buffered sol solution. This composite was poured into a desired
molding
structure and allowed to gel at ambient temperatures. It is not intended that
the present
invention be limited by the type of molding structure used, as it is
contemplated that a
variety of structures can be applied to generate gels of any desired size and
shape
including. but not limited to, cuvettes, flat surfaces for generating thin
films, plastic,
ceramic. or metal moldings to generate badges, etc. It is not intended that
the present
invention be limited to gelation at ambient temperatures, as any temperature
range that
facilitates the production of functional analyte-detecting gels is
contemplated.
In one embodiment. DCDA liposomes were incorporated into sol-gel glass,
although incorporation of any biopolymeric structure is contemplated by the
present
invention. Following the sol-gel procedure as described above, gelation
occurred within a
few minutes, producing gels with a violet color. The visible absorption
spectra of the
polydiacetylene liposomes, as shown in Figure 18, was unaltered in the sol-gel
matrix
compared to liposomes in solution. Following heating of the liposomes to 55
°C, a blue to
red thermochromic transition occurred that was characteristic of
polydiacetylene materials.
The blue to red phase materials were similarly unchanged in the sol-gel state
compared to
solution as shown in the spectrum in Figure 19. Thus, the present invention
provides a
sol-gel matrix that is compatible with fragile biopolymeric structures (i.e.,
liposomes) and
maintains those physical properties that were observed in bulk solution.
Additionally, it is contemplated that sol gel prepared materials of various
2~ thicknesses will possess unique sensitivities to analytes. Thicker films
have a higher
surface to volume ratio and therefore may require a higher concentration of
analyte to
trigger the chromatic transition.
Furthermore, the gelling conditions of the sol-gel preparation can be
optimized by
varying gelling temperatures, gel materials, and drying conditions to generate
material with
desired pore sizes. Varying the crosslink density of the material also
provides control over
pore size. Pore sizes from nanometers to hundreds of nanometers or greater are
contemplated b~~ the present invention. Some gels allow size-selective
screening of
undesired material while maintaining analyte access to the ligand. Also. the
sol-gel
-62-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
technique allows structures to be formed that can be molded into any desirable
shape,
including. but not limited to, cartridges, coatings, monoliths, powders, and
fibers.
B. Immobilization by Chemical Linkage
In some embodiments of the present invention, the biopolymeric material can be
attached to membranes of poly(ether urethanes) or polyacrylonitrile. These
membranes are
porous, hydrophilic and can be used for affinity separations or
immunodiagnosis. The
liposomes of the present invention can be coupled to these membranes by first
attaching
an activating group such as imidizolyl-carbonyl. succinimido, FMP or
isocyanate to the
membrane which adds rapidly to nucleophiles (e.g., -NH,, -SH, or -OH groups)
present in
I(1 tire liposomes. Thus, any liposome preparation which contains these
functionalities can be
directly attached to the membrane. This procedure is analogous to the coupling
of
proteins to membranes, the latter of which is well known in the art (See
e.~l., Bamford et
al.. Chromatography 606: 19 [ I 992]).
A variety of other immobilization techniques known in the art can be applied
to the
is biopolymeric material of the present invention. For example, materials
which have an -SH
fLIIICtIOllallt~' can also be immobilized directly to gold surfaces,
particles, or electrodes via
the thiol-gold bond. In this case, a solution of the liposomes containing the -
SH group are
incubated with the clean gold surface in water for 12-24 hours with stirring
at room
temperature. Also. materials can be immobilized to silicon chips or silica gel
(e.g., silicon
20 dioxide) using the procedure described in Example 8. Furthermore, materials
containing -
NI-I- functionalities can also be immobilized onto surfaces with standard
glutaraldehyde
couplin~~ reactions that are often used with the immobilization of proteins.
Additionally.
liposomes can be attached through their carboxy groups to surfaces comprising
polyethyleneimine. a branched polymer with free amine groups.
25 VIII. ARRAYS
Certain embodiments of the present invention contemplate the generation of a
large
palette of polymerizable lipids with different headgroup chemistries, ligands,
dopants,
monomers or other properties within a single device to increase selectivity,
sensitivity.
quantitation. ease of use, and portability, among other desired
characteristics and qualities.
30 By usin;~ the array format. several advantages can be realized that
overcome the
shortcomings of a single sensor approach. 'these include the ability to use
partially
-63-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
selective sensors and to measure multicomponent samples. This offers the
possibility of
sensing a specific sample in the presence of an interfering background, or to
monitor two
or more samples of interest at the same time. The sensitivities of a given
lipid to a given
sample can be determined in order to generate identifiable fingerprints
characteristic of
S each sample. For example, the lipid-polymer film of PDA derivative A may
convert
completely to an orange phase in the presence of sample X (%CR=100), while PDA
derivative B may have a %CR of 70 giving rise to a pink color, and PDA
derivative C
may have a %CR of 40 yielding a purple color and PDA derivative D may not
change at
all (i.e.. therefore. remains blue/purple). The response fingerprint
orange/pink/purple/blue-
purple would indicate the presence of sample X. Clearly, the higher the number
of
elements in the array, the greater the chance of a positive identification for
a given
analyte. By immobilizing the biopolymeric material, materials of any desired
size and
shape can be created and incorporated into a small, easily read. and
interpretable device.
Arrays can be generated that measure both the presence and activity of
samples.
1~ For example, when characterizing a certain enzyme, one portion of the array
can provide
analyte-detecting capabilities for the enzyme (e.g., by incorporating a ligand
that interacts
with the enzyme). while another provides and enzyme activity assay (e.g., by
including a
substrate for the enzyme within the biopolymeric material). Such arrays can be
expanded
for use in inhibitor screening techniques where each portion of the array
provides
quantitative or qualitative data, or provides a control experiment.
EXPERIMENTAL
The following examples are provided in order to demonstrate and further
illustrate
certain preferred embodiments and aspects of the present invention and are not
to be
construed as limiting the scope thereof.
2, In the experimental disclosure which follows, the following abbreviations
apply: N
(normal): M (molar); mM (millimolar); ~M (micromolar): mol (moles); mmol
(millimoles); pmol (micromoles); nmol (nanomoles); pmol (picomoles); g
(grams); mg
(milligrams): pg (micrograms); ng (nanograms}; 1 or L (liters); ml
(milliliters); Ltl
(microliters): cm (centimeters); mm (millimeters); elm (micrometers); nm
(nanorneters):
llCi (microcurie): mN (millinewton): A (angstrom); kDa (kilodalton); ppm
(parts per
1111111011): N (newrton); °C (degrees Centigrade): RT (room
temperature); h {hour or hours):
w-t% (percent by weight); aq. (aqueous): J (Joule); UV (ultraviolet); XPS (x-
ray
-64-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
photoelectron spectroscopy); PDA (diacetylene monomer); PCA (pentacosadiyneic
acid
monomer); DCD A (docosadynoic acid); TRCDA (tricosadiynoic acid); SA-PDA
(sialic
acid-derived PDA); BUTX (bungarotoxin); OTS (octadecyltrichlorosilane); VOC
(volatile
organic chemical j: CR (colorimetric response); pH (hydrogen ion
concentration); EDC
(ethylcarboiimide hydrochloride); AFM (atomic force microscope); Hz (Hertz);
LB
(Langmuir-Blodgett); NHS (N-hydroxy succinimide); CO, (carbon dioxide); MgSO~
(magnesium sulfate); CdCI, (cadmium chloride); MeOH {methanol); Be (beryllium
ions);
Mg {magnesium ions); Ca (calcium ions); Ba (barium ions); N, (nitrogen gas);
Sigma
(Sigma Chemical Co., St. Louis, MO); Perkin-Elmer (Perkin-Elmer Co., Norwalk,
CT);
Fisher (Fisher Scientific, Pittsburgh, PA); and Farchan Laboratories (Farchan
Laboratories.
Inc.. Gainesville. FL); Park Scientific Instrument (Park Scientific
Instruments, Sunnyvale,
CA): Biorad (Bio-Rad Laboratories, Hercules, CA); Gelman (Gelman Sciences, Ann
Arbor. MI); Pierce (Pierce. Rockford, Ill); and Bellco Glass (Bellco Glass
Inc., Vineland,
N,T).
1> All compounds were of reagent grade purity and used as supplied unless
stated
otherwise. Organic solvents were of spectral grade from Fisher Scientific. All
aqueous
solutions were prepared from water purified through a Barnstead Type D4700
NANOpure
Analytical Deionization System with ORGANICfree cartridge registering an 18.0
M-Ohm-
cm resistance.
EXAMPLE 1
Biopolymeric Material Preparation
I. Production of Liposomes
'The self assembling monomers to be incorporated into the liposomes were
dissolved in solvent (e.g., chloroform for diacetylenes and methanol for
ganglioside GM,).
2~ Many other volatile solvents find use in the present invention, including,
but not limited
to, benzene, hexane, and ethylacetate. The solvent solutions were mixed in
appropriate
volumes in a browm vial (i. e. , to prevent light interference during the
upcoming drying
steps) to achieve the desired lipid mixture (e.gJ., 5% by mole of GM,, 95%
diacetylenes)
and a total lipid content of approximately 2 qmol. The solvent was then
evaporated by
rotary evaporation or with a stream of nitrogen gas. The dried lipids were
resuspended in
sufficient de-ionized water to produce a 1-15 mM solution of lipid. The
solution was then
sonicated for I ~-60 minutes with a probe sonicator (Fisher sonic dismembrator
model
-65-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
300, SO% output. microtip) as described by New (New, supra). The solution was
heated
during the sonication (in most cases the sonicating process alone provides
sufficient heat)
to a temperature above the phase transition of the lipids used (typically 30-
90 °C). The
resulting mixture was filtered through a 0.8 micromole nylon filter (Gelman)
or through a
J 111111 Millipore 1-iillex-SV filter and cooled to 4°C for storage or
was polymerized. In
one embodiment. prior to polymerization, oxygen in the solution was removed by
bubbling
nitrogen through the sample for 5-10 minutes.
Polymerization of the stirred liposome solution was conducted in a 1 cm quartz
cuvette with a small 254 nm UV-lamp (pen-ray, energy: 1600 microwatt/cm'-) at
a
distance of ~ CIll. The chamber was purged with nitrogen during the
polymerization to
replace all oxygen and to cool the sample. Polymerization times varied between
5 and 30
minutes depending on the desired properties (e.g., color, polymerization
degree) of the
liposomes. In other embodiments. the solution was placed in a UV-chamber,
without
purging, and exposed to 0.3-20 J/cm' of ultraviolet radiation, preferably 1.6
J/cm-', for ~-
30 minutes.
In some embodiments, polymerization was conducted in a mufti-chambered plate
(c~.y.. ELISA plate). Approximately 200 pl of sonicated liposome solution was
placed in
each well of the plate. The plate was placed under a UV lamp with the distance
between
the plate and the lamp kept at 3 cm. Irradiation times typically lasted for a
minute.
Prolonged irradiation resulted in formation of pink/purple liposomes,
indicating that a
color change was initiated by UV Light. Such liposomes gave inconsistent
results and
should be avoided.
II. Production of Films
Polvdiaeetylene films were formed in a standard Langmuir-Blodgett trough
(Sc~c~
c~.~,J.. Roberts, Lan~muir Blodgett Films, Plenum. New York [1990]). The
trough was
filled with water to create a surface for the film. Distilled water was
purified with a
millipore water purifier with the resistivity of 18.2 M-Ohm. Diacetylene
monomers (e. g.,
5.7-docosadiynoic acid, 10.12-pentacosadiynoic acid [Farchan Laboratories],
5.7-pentacosadivnoic acid. combinations thereof. or other self assembling
monomers),
dissolved in a solvent spreading agent (e.g., spectral grade chloroform
[Fisher]), were
layered onto the aqueous surface with a syringe. to form a continuous film.
Monomers
prepared in the concentration range of 1.0 to 2.~ mM, were kept at a
temperature of 4°C
- 66 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
in the dark. and were allowed to equilibrate at room temperature before being
used in
experiments.
Once layered on the water surface, the film was physically compressed using
moveable barriers to form a tightly-packed monolayer of the self assembling
monomers.
S The monolayer was compressed to its tightest packed form (i.e., until a film
surface
pressure of 20-40 mN/m was achieved). Following compression, the film was
polymerized. Certain embodiments (e.g., embodiments with dopants) of the
present
lnvellt1011 llla)' require surface pressure compression greater or less than
20-40 mN/m.
Ultraviolet irradiation was used to polymerize the monomers, although other
means
1() of polymerization are available (e. K,, gamma irradiation, x-ray
irradiation, and electron
beam exposure). Pressure was maintained on the film with the moveable barriers
throughout the irradiation process at surface pressure of 20-40 mN/m. An
ultraviolet lamp
was placed 20 cm or farther from the film and trough. It was found that if the
lamp is
placed closer to the film, damage to the diacetylene film may occur due to the
effects of
1, heating the film. The film was exposed to ultraviolet light with a
wavelength of
approximately 2~-1 mn for approximately one minute. The polymerization was
confirmed
by observing the blue color acquired upon polymerized diacetylene formation
and
detecting the linear striations typical of polymerized diacetylene films with
a polarizing
optical microscope.
20 II1. Production of Tubules
Selt=assembling monomers to be incorporated into the tubules were dissolved in
solvent. mixed together, evaporated, and resuspended in water as described
above for
liposomes. 1-10°. o by volume of ethanol was added to the solution,
although other organic
solvents are contemplated by the present invention. The solution was then
sonicated (with
2s heating if necessar~~), filtered. cooled, and polymerized as described
above for liposomes.
EXAMPLE 2
Examination of Biopolymeric Materials
I. Optical Microscopy and X-ray Spectroscopy
Diacetylene films were prepared in a Langmuir Blodgett trough as described
above
30 usin~~ a combination of PDA monomers and sialic acid-derived PDA monomers.
The
floatin~~ polymerized assembly was lifted by the horizontal touch method onto
a glass slide
-G7-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
previously coated with a self assembled monolayer of octadecyltrichlorosilane
(nTS) as
described (Maoz and Sagiv, J. Colloid Interface Sci. 100: 465 [1984]).
The slide was then examined by optical microscopy with the use of crossed
polarizers as described (Day and Lando, Macromolecules 13: 1478 [1980]). The
film
s exhibited a high degree of order over a macroscopic range (i.e., 50 to I50
pM) as shown
in the optical micrograph of Figure 20. Large domains up to 150 pM were
visible (1 cm
= 10 yM).
The films were further characterized by angle-resolved x-ray photoelectron
spectroscopy (XPS) and ellipsometry. The XPS results indicated that the amide
nitrogen
atoms and the carbonyl carbon atoms of the head groups were localized at the
surface
relative to the methylene carbons of the lipid chains, demonstrating that the
sialoside head
group was presented at the surface of the film. Ellipsometric analysis of the
polydiacetylene monolayer coated on HF-treated silicon indicated a film
thickness of
approximately 40 A, in agreement with the expected value based on molecular
modeling.
IS II. Atomic Force Microscopy
lra .situ atomic force microscopy was used to reveal the morphology, surface
topography. and growth and dissolution characteristics of microscopic
biopolymeric
crystals, and allowed dynamic observations of nucleation events and the
determination.
Studies were conducted using standard techniques for in .sitar studies as
described by
Binni~~ c~t al. (Binnig et al., Phys. Rev. Lett. 12: 930 [1986]; and Binnig et
al.. Europhys.
Lett. 3: 1281 [1987])
Two different atomic force microscopes were used in this study. Images larger
than I ~llll- were acquired with a commercially available instrument (Park
Scientific
Instrument). In this case Si ultralevers (Park Scientific Instrument) were
used.
Commercially available photolithographically patterned glass slides (Bellco
Glass) were
used to allow imaging of the exact same region of the film after each
temperature step.
Images smaller than 1 p.m- were taken with a home-built AFM (Kolbe et al.,
Ultramicroscopy -t2-44: 1113 [1992]). Si3N4 cantilevers with a nominal force
constant of
0.1 N/m were used (Park Scientific Instruments). Both microscopes were
operated in
contact mode. and in the latter case a four-quadrant position-sensitive
photodiode allowed
the measurement of the cantilever bending and twisting simultaneously. All
images were
acquired in contact mode under ambient conditions.
-68-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
EXAMPLE 3
Optimization of Biopolymeric Materials
'the present invention provides a variety of different biopolymeric material
forms
(e.~~.. liposomes. films, tubules, etc.). with and without dopant materials,
with a variety of
ligands. and immobilized in a variety of forms. For each of these embodiments,
it is
possible to optimize the biopolymeric material to maximize sensitivity,
robustness,
colorimetric response, and other desired factors. Described below are a few
illustrative
examples of such optimization. These examples are intended to merely
illustrate the
flexibility of the present invention. It is not intended that the present
invention be limited
to these particular embodiments.
I. Mixed Monomers
The biopolvmeric material of the present invention can comprise a sample of
pure
monomers (e.g.. pure diacetylene) or can comprise mixed monomers (e.g., PDA
with
Ganglioside G~" or dopant). Optimization of the percent composition of mixed
monomers
can be undertaken to provide biopolymeric material with desired properties. An
example
of such optimization is provided below for the detection of an analyte (i.e.,
cholera toxin)
with a ganglioside ligand.
To evaluate the colorimetric response of GM,/PDA films, different
concentration
combinations of ligand (i.e., GM,) and PDA were tested. If too much ligand
molecule was
added (i.c~., low concentration of polymerized lipid), the films were unstable
and had high
background. If the films had too much polymerized lipid molecule, they were
too stable
and the color change would not occur well. In search of the G~,"/PDA biosensor
composition capable of displaying maximal response, a series of PDA monolayer
films
were transferred to OTS coated glass slides. The films were evaluated by
exposure to
2S cholera toxin and the colorimetric response was measured using UV-Vis
spectroscopy.
Figure 21 summarizes the colorimetric properties and response of the GM,
biosensing
monolayer films studied in these experiments showing the initial absorbance,
transfer rate,
and colorimetric response in buffer and in response to analyte. The initial
absorbance
(A;~;,). which reflects the maximal peak value of the films at 640 nm, is a
function of the
film transfer rate and composition. GM,, which does not provide chromatic
functionality
into the mixed assembly. generally decreases the intensity of the initial blue
color. The
transfer rate. which is the ratio of the area decreased on the tough surface
and the area of
-69-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
the substrate emerged into the subphase, indicates that the PDA films are
highly
transferable as compared to those of sialic acid-PDA (SA-PDA) and GM,
molecules. The
blue to red colorimetric response (CR) shows that monolayer films exhibit low
CR in
buffer solution except when high content of GM, or SA-PDA is used.
II. Optimization of Subionic Phase
The ionic content of the aqueous subphase has significant impact on the
properties
of Langmuir monolayers. The presence of cationic species strengthens the
electrostatic
interaction of monolayer with anionic headgroups and consequently stabilized
the film
(Games, Insoluble ~l~lonolayers at Liquid-Gas Interface, Interscience
Publishers, New
York, pp 291-299 [ 1966]). Figure 22 shows the isotherms of 5% GM,/5% SA-
PDA/90%
PDA as a function of subphase concentration of CdCI,. As the concentration of
Cd'+ is
increased. the expanded phase shifts systematically toward the low molecular
area,
indicating that the monolayer is stabilized at high Cd'T concentration. This
behavior
results largely from the ionic interactions between Cd'' and partially
dissociated anionic
carboxylate headgroup of PDA (pKa ~ 5), while acidic SA-PDA and GM, (pKa ~ 2.6
for
sialic acid on these molecules) probably also contribute to strengthen the
effect. Further
evidence for this mechanism of monolayer stabilization is seen in the increase
in surface
pressure as a function of higher ionic concentrations. Many divalent ions (Be,
Mg, Ca,
Ba, and Cd) have been shown to have an impact on the isotherms of PDA monomers
through salt formation, which influences the packing of molecules on a basis
of ion size
and charge. No immiscible trend was observed for the ternary system of 5%
GM,/5% SA-
PDA/90% PDA on aqueous subphases containing up to 0.01 M Cd'-l, indicating the
this
mixed monolayer is relatively stable as respect to ionic content. When Cd'~
was increased
to 0.1 M. however. erratic behavior of the 5% GM,/S% SA-PDA/90% PDA monolayer
was
2s observed. This is possibly due to formation of aggregated domains as a
result of different
ability to interact with Cd'- between sialic acid in SA-PDA and GM, and
carboxylic in
PDA. or precipitation at high salt concentration.
At low Cd=- concentrations (i.e., approximately 10-~M), the isotherms differ
very
little in the condensed phase region, indicating that low ionic content in
subphase has no
significant effect on the structure of the compact films. Increasing the
concentration of
Cd-'~ above 10-'Ai. resulted in a shift of molecular area in the condensed
phase region as
shown in Figure '_'?. pointing to some structural change in the compact
monolayer. In
-70-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
order to explore the role of additives in the mixture for inducing such a
structural change.
an isotherm of pure PDA on 10~2M Cd'-' was measured. On the 10-'-M Cd-'-
subphase. a
steep rise at low molecular area is seen in the isotherm of PDA. However, the
slope of
the isotherm within the compact region and the molecular area were essentially
the same
as on water. Such a result is consistent with an ordered film at high salt
concentration.
where the film characteristics are primarily dictated by the long hydrophobic
segment of
the molecules. Similar results were obtained for amine-based diacetylene
(Walsh and
Lando. Langmuir. 10: 252 [ 1994]). Therefore, the shift in Figure 22 reflects
a mixed
electrostatic effect induced by differently dissociated individual components
in the films.
I (i suggestin~~ a lower stability of the ternary films as compared to the
pure PDA films.
III. Optimization of Subphase pH
For acidic molecule PDA, an increase in pH resulted in the ionization of PDA
molecules and consequently introduced substantial charge along the monolayer
interface.
Figure 23 shows the isotherms of S% GM,/5% SA-PDA/90% PDA at pH 4.5, 5.8, and
9.2.
At high pH (pH 9.2), the film became very expanded as a result of
electrostatic repulsion
between the adjacent PDA molecules. Compression of such a fihll to form a
monolayer
was difficult. Additionally, distinct segments of individual molecules were
observed,
pointing to an immiscible trend in the mixed monolayer that tends to form
segregated
domains. Evidently, high charge density at the monolayer interface created
unfavorable
interactions on the aqueous surface. It can be expected that the addition of
compounds
such as G", (i.e.. which is acidic) into the PDA mixture at this pH will be
unfavorable.
The isotherm of the ternary system at low pH exhibits normal peak behavior.
The
collapse pressure is significantly larger than at neutral pH, indicating a
more stable film
formed at low pH. Suppression of ionization of the PDA molecules at this pH
contributes
to the enhancement of film stability, which can consequently stabilize the
incorporation of
G~," molecules in the PDA films.
I~'. Optimization of Subphase Temperature
During film production, an increase in temperature usually results in higher
surface
pressure. an enlargement of the expanded region, and a shift in the phase
transition point
towards the iow molecular area direction in ~/A isotherms (Birdi, Lipid and
Biopolymer
Mnnnlaver.~~ al Liguid Interfaces, Plenum Press. New York [1989]). This effect
stems
-71-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
from the higher flexibility of hydrocarbon tails of lipids at high temperature
as a result of
thermal agitation. and can be analyzed with the two-dimensional Clausius-
Clapeyron
equation (Birdi. supra). Monolayer films containing PDA, however, typically
experience
film collapse during compression. Consequently, the evaluation of the subphase
temperature effect has to take this phenomenon into consideration. Figure 24
displays the
temperature effect on the isotherms of 100% PDA, 5%SA-PDA/95% PDA, and 5%
GMy~% SA-PDA'90% PDA. With decrease in subphase temperature, the surface
pressure
increased and the isotherm shape changed. Isotherms at low temperature
exhibited more
and more liquid-solid phase transition features, as indicated by the
disappearance of the
peak and occurrence of the smooth curve at the transition region. All the 7<-A
isotherms
obtained for the three rnonolayers display similar characteristics. The major
difference
bet~~een these figures is the position of collapse point, which is a function
of film
COI17pO51t1011.
V, Position of the Monomer Polymerizable Group
A comparison of the colorimetric responses of 10,12-pentacosadiynoic acid
liposomes and ~.7-docosadiynoic acid (a gift from Alice Deckert of Holy Cross
College)
liposomes to anals-te was conducted to determine the effect of the position of
the
polymerizable group within the self assembling monomers. GM, ligands were
incorporated
into each type of liposome to analyze the detection of cholera toxin. The
ganglioside G~,~
was mixed at ~ mol % with the diacetylene "matrix lipid" monomers. Liposomes
were
prepared using the probe sonication method and polymerized by UV irradiation
(254 nm).
The conjugated ene-yne backbone of polydiacetylene liposomes resulted in the
appearance of a deep blueipurple solution. The visible absorption spectrum of
the freshly
prepared purple liposomes is shown in Figure 25. When cholera toxin was added
to the
liposomes composed of 5% G~" and 95% 5,7-docosadiynoic acid, the solution
immediately
changes to an orange color. and the "red phase" absorption of polydiacetylene
dominates.
as shown in Figure 26. When the ganglioside GM, was mixed with a matrix lipid
composed of 10.1?-pentacosadiynoic acid instead of 5,7-docosadiynoic acid, the
colorimetric response was significantly reduced. Although it is not necessary
to
understand the mechanism in order to use the present invention, and it Is not
intended that
the present invention be so limited, it is contemplated that the enhanced
sensitivity
observed with the ~.7-docosadiynoic acid liposomes arises from the positioning
of the
_7
CA 02330937 2000-12-12
WO 99/67423 PCT/US99114029
optical reporter group nearer to the interface (i.e., three methylene units
compared to
eight). It has been shown by Fourier transform IR spectroscopy that small
rotations about
the C-C bond [3 to the polymer backbone are sufficient to change the effective
conjugated
length (Berman et ul., Science 259: 515 [1995]). These conformational changes
are more
easily transduced through shorter alkyl chain length.
EXAMPLE 4
Incorporation, Optimization, and Properties of Dopants
Each time a new sensor system is designed, the amount of PDA, dopant, and
ligand (c~.~J., ganglioside) are varied to create the optimal sensor. Although
0-100%
amounts are typically used for testing, optimal systems appear to use ~-15%
ligands. 0-
95°/« PDA, and 0-9~% dopant. The percent of each component depends on
the system, the
needed stability. and the needed sensitivity. Certain embodiments of the
present invention
may incorporate more than one type of dopant into the biopolymeric material.
I. Incorporation of Dopant into Biopolyrneric Material
l~ Amino-acid derivatized diacetylene dopants were incorporated into
colorimetric
liposomes. The lipids (i. e.. the dopants and the diacetylene monomers) were
first
dissolved in chloroform, and an aliquot was transferred to the reaction vial.
The organic
solvent was blown out by use of N, gas, and an appropriate amount of water was
added to
bring the lipid concentration to approximately 1 mM. Bath sonication was used
to break
down the white precipitate to form liposomes. Typical sonication times varied
from 1
hour to ~ hours. dependent on the type of dopants used. During sonication, the
temperature was carefully raised to approximately $0°C to facilitate
the formation of the
liposomes. The sonication continued until the solutions became clear. The hot
solutions
were immediately filtered though a 5 uM Millipore Millex-SV filter to remove
any
2, impurity that may be present in the solution. The obtained solutions were
stored at 4"C
overnight before use.
Following polymerization, deep blue colored liposomes were obtained. The final
liposomes contained the amino-acid derivatized diacetylene dopant.
_7;_
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
II. Optimization of Dopant Concentration
Films comprising PDA, GM, (i. e., the ligand) and sialic acid-derived PDA (i.
e. , the
dopant) were generated as described in Example 3, Section I for the detection
of cholera
toxin. Colorimetric assays demonstrated that all three components were
required for
s optimal colorimetric response. For the optimal detection of cholera toxin,
both SA-PDA
and G~," need be present in the films, otherwise the films are either too
unstable or they do
not change color well, depending on the concentration of all three components.
Although
it is not necessar<- to understand the mechanism in order to use the present
invention, and
it is not intended that the present invention be so limited, it is
contemplated that the
function of SA-PDA is to provide the metastable state of the films for
biomolecular
recognition through a stress-induced mechanism (Charych et al., Chem. and
Biol. 3: 113
[1996]). A film consisting of 1% GM~/1% SA-PDA/98% PDA was also investigated.
The
CR turned out to be low and it did not yield a useful colorimetric biosensor.
As shown in
Figure 21, the optimal colorimetric sensor was determined to be 5% GM,/5% SA-
PDA/90% PDA. Thus, a 5% molar content of the dopant SA-PDA provides the best
sensor for detection of cholera toxin.
III. Properties of Derivatized Diacetylene Dopants
Hydrophobic amino acids linked to diacetylenes can be used to lower the
solubility
of the biopolymeric material as well as the stability of the films or
liposomes. These
derivatized PDA's can be useful in the assembly of complex systems to fine
tune the
stability and sensitivity, two factors that are directly coupled to one
another. Using the
hydrophobic PD:~'s with the hydrophilic PDA's, the stability of films and
liposomes can
be greatly increased, under a variety of environmental conditions. Although a
large gain
in stability is seen. it is at a cost to sensitivity. A balance between
sensitivity and stability
2s has to be optimized.
Acidic and basic amino acids linked to diacetylenes can be used to increase
the
solubility of the material. Specifically, these changes allowed
polydiacetylene lipids to
mix with water soluble biological molecules. Ordinarily, PDA is not water
soluble and
organic solvents are necessary (i.e., which can be destructive to biological
molecules). By
placing acidic or basic head groups onto the PDA molecule, the solubility of
the
derivatized PDA's were greatly enhanced. They also produced much brighter
colors and
were more consistent in the assembly of sensors. These results were likely due
to the
-74-
CA 02330937 2000-12-12
WO 99/67423 PC'T/US99/14029
increase in water solubility and homogeneity of mixing between all components.
The
acid/base PDA's were by far the most sensitive of the amino acid-derived
diacetylenes.
Attaching histidine to amine-coupled PDA created materials that could easily
turn
color. but that could also be re-generated. The particular advantage to this
approach is
that ordinarily polymerized PDA's turn color, but cannot be used again. The
near-neutral
pKa of the head group of the histidine materials allows for this advantage.
By placing fluorescent PDA head groups onto the PDA amine-coupled system,
colorimetric biosensors can be made with the addition of fluorescent
properties. This
provides a mufti-purpose and more sensitive sensor.
1 U EXAMPLE 5
Attachment of Ligands
Ligands can be covalently linked to the head groups of self assembling
monomers
(e.y., sia(ic acid linked to diacetylene monomers), can be covalently linked
to the surface
of polymerized materials (e.g., proteins and antibodies with multiple amine
and thiol
linkages to the material surface), or can be non-covalently incorporated into
the
biopolymeric material (e.k., ganglioside incorporated into the membrane of
films and
liposomes).
The self assembling monomers can be synthesized to contain a large variety of
chemical head-group functionalities using synthesis techniques common in the
art. In
some embodiments. the ligands are then joined to the self assembling monomers
through
chemical reaction with these funetionalities using synthesis methods well
known in the art.
The functionalities include. but are not limited to, esters, ethers, amino,
amides, thiols, or
combinations thereof. Alternately, many ligands can be incorporated into the
self
assembling matrix without covalent linkage to the surfactants (e.g., membrane
proteins and
2~ molecules with hydrophobic regions such as gangliosides and lipoproteins).
Specific applications of the present invention are described below to
illustrate the
broad range of ligands that can be associated with the inventive biopolymeric
material.
These examples are intended to merely illustrate the broad applicability of
the present
invention and are not intended to limit the present invention to these
particular
embodiments.
_7s_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
I. Sialic Acid
Sialic acid was attached as a ligand to diacetylene monomers. Several
synthesis
methods well known in the art can be used, many of which have general
applicability to
the attachment of carbohydrates to the inventive biopolymeric materials. In
one
embodiment, PD.-~ ( 1.0 g, 2.7 mmol in chloroform) was reacted with N-hydroxy
succinimide (NHS) (.345 g, 3.0 mmol) and 1-(3-dimethylaminopropyl)-3-
ethylcarbodiimide hydrochloride (EDC) (.596 g, 3.1 mmol). The solution was
stirred for 2
hours followed by evaporation of the chloroform. The residue was extracted
with diethyl
ether and water. The organic layer was dried with magnesium sulfate (MgSO~)
and
lU filtered. The solvent was then evaporated by rotary evaporation to give
1.21 g of N-
succinimidyl-PD:~ (NfiS-PDA). Ethanolamine (.200 ml, 2.9 mmol) was added to a
solution of NHS-PDA (1.21 g in 50 ml of chloroform), followed by triethylamine
(.350
1111. 2.J 17111101) and stirred for two hours at room temperature. The solvent
was evaporated
and the residue purified by silica gel chromatography (2:1 EtOAc:hexane, R,_
0.1 ~) to give
1 ~ 0.99 g of N-(2-hvdroxyethyl)-PDA.
Tetraethvlene glycol diamine ( 1.26 g, 6.60 mmol) in 25 ml of chloroform was
added to a solution of N-succinimidyl-PDA (.603 g, 1.28 mmol) in 20 ml of
chloroform.
dropwise. with stirring, over a period of 30 minutes. The reaction was stirred
for an
additional 30 minutes before removal of the solvent by rotary evaporation. The
residue
20 was dissolved in EtoAc and extracted twice with water. The organic layer
was dried with
M~~SO,. and the solvent removed by rotary evaporation. The extract was
purified by silica
~~el chromatography (20:1 CHCI;:MeOH, R,.=0.20) to give 3.72 g of N-(11-amino-
3.6.9-
trioxyundecanyl j-PDA.
Two ml of acetic anhydride was added to a cooled solution of ethyl-5-N-acetyl-
2.6-
25 anhydro-3.~-dideosy-2-C-(2-propenyl)-D-erythro-L-mannonononate (0.47 g,
1.30 mmol) in
1.7 ml of pyridine under nitrogen, with stirring. The reaction was allowed to
warm to
room temperature overnight. After 18 hours, the solvents were removed under
reduced
pressure at ambient temperature, to yield a crude viscous oil. The oil was
solidified by
repeated evaporation from toluene. The crude solid was flash chromatographed
over silica
3U with ethvlacetate as eluent. producing 0.58 g of ethyl-5-N-acetyl-4,7,8,9-
tetra-O-acetyl-3.~-
dideoxv-2-C-(2-propenyl)-D-erythro-L-manno-nononate.
A solution of ethyl-~-N-acetyl-4,7,8,9-tetra-O-acetyl-3,5-dideoxy-2-C-(2-
propenyl)-
D-ervthro-L-manno-nononate (0.38 g, 0.72 mmol) in 10 ml of acetone was cooled
to -78
-76-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
°C while protected from moisture with a CaCh drying tube. Ozone was
aspirated into the
solution until the characteristic blue color persisted for S minutes. The
reaction was
purged with O, to dissipate the excess 03, followed by warming to 5_ "C.
Excess Jones"
reagent (7 drops) was added until a rust orange color persisted, then the
reaction was
warmed to ambient temperature. After several minutes, ethanol was added
dropwise to
consume the excess oxidant. The green precipitate was filtered and washed with
acetone
several times. The combined filtrates were evaporated in vacuuo and dissolved
in
ethylacetate. The solution was extracted with saturated aqueous NaHCO,
solution three
times. The combined aqueous layers were acidified with concentrated HC1 and
extracted S
t0 times with methvlene chloride. The combined methylene chloride extracts
were dried with
MgSO~. filtered and evaporated in vacuuo to give ethyl-S-N-acetyl-4.7,8.9-
tetra-O-acetyl-
3.S-dideoxy-2-C-(acetic acid)-D-erythro-L-manno-nonate.
Ethyl-S-N-acetyl-4.7.8.9-tetra-O-acetyl-3.S-dideoxy-2-C-(acetic acid)-D-
erythro-L-
manno-nonate (0.194 g, 0.35 mmol) was added to a cooled solution (S °C)
NHS (O.OSB g.
15 0.50 mmol) and EDC (:0.096 g, 0.50 mmol) in 2 ml of chloroform, under
nitrogen. The
reaction was warmed to ambient temperature with stirring for S hours. The
reaction was
then diluted with 1 S ml of chloroform and washed with 1 N HCl (aq.), twice;
saturated
(aq.) sodium bicarbonate, twice: and saturated (aq.) sodium chloride. once.
The organic
layer was dried over MgSO~, filtered, and evaporated to form ethyl-S-N-acetyl-
4,7,8,9-
20 tetra-O-acetyl-3.S-dideoxy-2-C-(N-succinimidylacetate)-D-erythro-L-manno-
nononate.
Ethyl-S-N-acetyl-4,7,8,9-tetra-O-acetyl-3,S-dideoxy-2-C-(N-
succinimidylacetate)-D-
erythro-L-manno-nononate (0.143 g, 0.22 mmol) and N-(11-amino-3,6.9-
trioxyundecanyl)-
PDA (0.13 3 g. 0.2-1 mmol) were dissolved in 2 ml of chloroform and the
reaction was
sealed and stirred for S6 hours. The solution was diluted with 1 S ml of
chloroform and
2s washed with sodium chloride saturated IN I-ICl (aq.), twice; saturated
(aq.) sodium
bicarbonate. twice: and saturated (aq.) sodium chloride, once. The organic
layer was dried
over MgSO~, filtered, and evaporated to a crude semi-solid. The material was
flash
chromatographed over silica (20:1 CHCI3:MeOH), producing ethyl-S-N-acetyl-
4,5,8,9-tetra-
O-acetyl-3,S-dideoxv-2-C-[(N-11'-(PDA)-3',6',9'-trioxyundecanyl) acedamido]-D-
erythro-
30 L-manno-nononate.
The sialic acid derived-PDA was formed by dissolving ethyl-S-N-acetyl-4,5,8,9-
tetra-O-acetyl-3.S-dideoxy-2-C-[(N-11'-(PDA)-3',6',9'-trioxyundecanyl)
acedamido]-D-
erythro-L-manno-nononate (0.20 g, 0.19 mmol) in a solution of 4 ml of water
and 0.5 ml
_77-
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
of methanol containing 0.1 g dissolved sodium hydroxide. The solution was
stirred for 3
hours, and ion exchange resin (Biorad AG SOW-X4 H+ form) was added until the
solution
was acidic to pH paper. The solution was filtered and the filtrate evaporated
in vacuo,
producing sialic acid derived-PDA.
II. Carbohydrates
In other embodiments of the invention, carbohydrates (i.e., including sialic
acid)
can be modified by a three-step procedure to produce N-allyl glycosides. For
example,
the N-allyl glycosides can then be easily linked to other molecules (e.g.,
PDA) using
simple chemical swthesis methods known in the art. This method provides a
means to
incorporate a broad range of carbohydrates into biopolymeric material (and
thus provides a
means to detect a broad range of analytes). First, oligosaccharides are
dissolved in neat
allyl amine (water may be added if necessary and does not adversely affect the
yield)
producing a 0.~-0.1 M solution. The reaction is stopped and stirred for at
least 48 hours.
Upon complete conversion of the starting material into amino glycoside
product, the
solvent is removed by evaporation and the crude solid is treated with toluene
and
evaporated to drwess several times. The solid is then chilled in an ice bath
and a solution
of 60% pyridine. -10% acetic anhydride is added to give a solution containing
five hundred
mole percent excess of acetic anhydride. The reaction is protected from
moisture, stirred
and allowed to warm to ambient temperature overnight. The solvents are removed
by
evaporation and the residue is dissolved in toluene and dried by evaporation
several times.
The crude product is purified by flash chromatography producing the
peracetylated NAc-
allyl glycoside form of the free sugars.
The peracetvlated NAc-allyl glycosides are then dissolved in anhydrous
methanol
to give a 0.1-0.01 M solution. Several drops of 1 N NaOMe in MeOH are added
and the
reaction stirred at ambient temperature for 3 hours. Enough Dowex 50 resin (H+
form) is
added to neutralizz the base. then the solution is filtered and evaporated to
dryness
(purification by recrystallization can be conducted if desired). The products
are the N-
allyl glycoslamide form of the carbohydrates. These synthesis reactions have
produced the
N-allyl glycoslamide forms of a variety of carbohydrates, including, but not
limited to,
glucose. NAc-glucosamine. fucose, lactose, tri-NAc-Chitotriose, Sulfo Lewisa
analog, and
Sialyl Lewis'' analog. Skilled artisans will appreciate the general
applicability of this
method to the attachment of a broad range of carbohydrates to diacetylene
lipids.
_78-
CA 02330937 2000-12-12
WO 99/b7423 PCT/US99/14029
III. Ganglioside GN"
Ganglioside GM, presents an example of incorporation of a ligand without
covalent
attachment to the self assembling monomers. Ganglioside GM, was introduced in
the
biopolymeric material by combining a solution of methanol dissolved
ganglioside G~~~
i (Sigma) with chloroform dissolved PDA, and dried. The ganglioside contains a
hydrophobic region that facilitates its incorporation into self assembling
surfactant
structures. Thus. when the dried solutions were resuspended in deionized
water, the
resultin~T structures contained a mixture of ganglioside and PDA. Liposomes
and other
forms were produced from the resuspended mixture as described in Example 1.
Although
the ;~=an~~lioside does not contain a polymerizable group, the ganglioside
became embedded
in the polymerized matrix created by the cross-linking of the diacetylenes.
Similar
methods can be used for the incorporation of other ligands that contain
hydrophobic
regions (~~.g.. transmembrane proteins and lipoproteins).
IV. Proteins
The NHS-PDA, as generated above, thiol-linked PDA, and other methods known in
the art provide functional groups for the attachment of proteins and
antibodies. The NHS
or thiol-linked monomers are incorporated into the desired aggregate and
polymerized.
The NHS or thiol functional groups then provide a surface reaction site for
covalent
linkage to proteins and antibodies using chemical synthesis reactions standard
in the art.
In another embodiment, a hydrazide functional group can be placed on PDA,
allowing
linka~~e to aldehvdes and ketone groups of proteins and antibodies. These
embodiments
provide a means to incorporate an extremely broad array of proteins and
antibodies onto
the biopolymeric material. Specific examples are provided below. These
examples are
intended to merely- illustrate the broad applicability of the present
invention and are not
2~ intended to limit the present invention to these particular embodiments.
A. Hexokinase
NHS-PD_a lipid was synthesized as described above. In brief, 1.00 g 10,12-
pentacosadivnoic acid (Farchan, Gainesville, FL) was dissolved in CHCI;, to
which 0.34
~~ N-hvdroxvsuccinimide (NHS) and 0.596 g 1-(3-dimethylaminopropyl)- >-
ethvlcarbodiimide hydrochloride were added. The solution was stirred at room
temperature for m~o hours, followed by removal of CHCI; using a rotavap. The
residue
-79-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
was extracted with EtOAC and water. After separation, the organic layer was
dried with
MgSOa and filtered. followed by solvent removal. The raw product was then
recrystallized twice with CHCI3, and confirmed by FT-IR.
The I :1 ( molar ratio) PDA/NHS-PDA chloroform solution was spread on the
S aqueous subphase on a Langmuir-Blodgett trough (KSV mini-trough, KSV
Instruments,
Inc.. Finland) b~~ using a microsyringe (subphase temperature was maintained
at 5 °C).
The organic solvent was allowed to evaporate by resting the solution for 20
min. The
films were compressed to compact monolayer level and then transferred by
vertical
deposition to glass slides coated with octadecyltrichlorosilane (OTS). The
compression
and dipping speed was maintained at ~ mm/min. Three layers were deposited onto
the
glass slide to provide enough colorimetric signal for detection after
polymerization and to
ensure the hydrophilic surface was exposed to solution.
The preparation of stable PDA monolayer films before enzyme immobilization is
critical for low background and enhanced reproducibililty of the sensors. The
Langmuir
1, monolaver trough provides a method to measure film stability through the
evaluation of
the surface collapse pressure of the monolayers. It was found that the mixed
films (i. e. ,
films with PDA and NHS-PDA) appear to be much more stable than the monolayers
consisting of one component and thus more suitable for enzyme immobilization.
For
instance, the collapse pressure for 1:1 NHS-PDA/PDA monolayer at 5 °C
was 57 mN/m,
2() while NHS-PDA and PDA monolayers collapsed at 34 and 28 mN/m,
respectively.
Although it is not necessary to understand the mechanism in order to use the
present
invention. and it is not intended that the present invention be so limited, it
is contemplated
that the interactions are more favorable in these mixed monolayers, presumably
due to the
optimal spatial arrangements that allow head groups of different size to pack
closely.
25 Besides mechanical stability, the monolayers should possess desirable
optical
properties (i.e.. high color intensity) to be suitable as sensors. F11111
quality. in this
particular case color intensity, was studied at different deposition
pressures. It was found
that films made at =IO mNim gave the best transfer rate and color intensity.
Therefore. the
1:1 NHS-PDA.~PD.-~ films obtained at this transfer pressure were selected for
modification
30 with hexokinase.
feast he~okinase suspension (E.C. 2.7.1.1. from Boehringer Mannheim GmbH.
Germany was spun in a microcentrifuge to remove saturated ammonium sulfate.
The
protein was resolubilized in 0.1 M phosphate buffer (pH 8.0) to give
approximately 1
- so -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
nlg/1111 concentration, and dialyzed against the same buffer using a Slide-A-
Lyzer dialysis
cassette (Pierce) for 3 hours. The PDA monolayer slides were cut into 0.7 cm x
2.~ cm
rectangular pieces. and incubated in the hexokinase solution at 4°C for
1 hr. Prolonged
incubation was found to result in decreased color intensity, presumably due to
the
shedding of LB monolayers during the chemical cross-linking reaction. The
monolayer
chips were then rinsed with deionized water and immersed into 0.1 M
ethanolarnine for 10
min to terminate the reaction. The chips were rinsed again with deionized
water and air
dried. Polymerization was conducted by irradiating the films with a hand held
UV lamp.
The irradiation time was 6 min. each side. Extended irradiation results in
irreversible
color change to red.
B. Antibodies
Commercially obtained diacetylene was first filtered to remove the insoluble
impurities (e.g.. polymerized form) and converted chemically to NHS-PDA as
described
above. Appropriate amounts of NHS-PDA and other forms of PDA derivatives
(e.g.,
dopants or ligands) were mixed to give the desired molar ratio. The solution
was dried
using N, gas, so a thin layer of white material deposited on the bottom of the
vial.
Deionized water was added to bring the total concentration of lipid to
approximately 1
mM. The solution was sonicated by using either a probe sonicator for
approximately 20
minutes or a bath sonicator for over 2 hours until a clear solution was
obtained. The
solution was filtered through ~ um filter while hot, then stored at 4°C
overnight.
Prior to cross linking. 0.1 M phosphate buffer (pH 8.5) was added to the
liposome
solution. Antibody dissolved in a similar buffer was then added. and the
solution was
stored at 4°C overnight. Excess antibody was removed by either
centrifugation or dialysis.
When centrifugation was used, the pellet was resonicated gently using an ice
bath.
2~ Followin;~ association of the antibody to the sonicated material,
polymerization was
conducted as described for liposomes in Example 1.
Antibodies can also be attached to biopolymeric material by hydrazides. In
some
embodiments, this may be preferred to NHS-coupling because NHS may react at
the Fab
region of the antibody, blocking binding to analytes. The hydrazide method
causes
attachment of the Fc region of the antibodies to the biopolymeric material,
leaving
available. the binding region. In the hydrazide method, hydrazide-PDA lipids
were
produced. and unpolymerized liposomes are generated (e.g.. 20% hydrazide
PDA/80%
-81 _
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
TRCDA). Using Centricon 50 filters, 500 pl of stock antibody solution was
washed by
adding an equal volume of 123 mM sodium citrate (pH 5.5) and spun down at 4000
rpm
for 9 minutes. The filtering step was repeated two more times. Four hundred
microliters
of the antibodies in citrate buffer were then oxidized by incubating with 2~
pl of sodium
periodate for 2 hours at 22°C. After the 2 hours, the reaction was
quenched by adding 50
~l of N-acetylmethionine. Next, 300 pl of liposomes, 150 pl citrate buffer,
400 pl water.
and 200 pl of oxidized antibodies were incubated overnight at 22°C.
Uncoupled
antibodies are removed from the liposomes by using Centricon 500 filters and
washing
with 900 pl Tris buffer (pH 9.0) and centrifugation at 4000 rpm for 2 minutes.
After
multiple washes, the sample is dilute (if necessary) with Tris buffer to make
a 0.2 mM (or
less) liposome solution.
V. Others (Amino Acids, Nucleotides, Etc.)
As described above and shown in Figure 9, the attachment of amino acids though
amine linkage to diacetylenes has been accomplished. A variety of other means
of
1, attaching amino acids to lipids are also known in the art.
The generation of PDA-linked Iigands containing a variety of different
chemical
head-group species is described in Example 7, for VOC detection. These
examples
demonstrate the derivation of PDA with a broad range of chemical head groups
such as
hydrophilic uncharged hydroxyl groups, primary amine functionalities, amino
acid
derivatives, and h~~drophobic groups. These and other modifications are
generated by
synthesis methods known in the art.
In other embodiments. various other surfactant-linked ligands can be prepared
usin~~
condensation reactions involving an activated carboxylic acid group and a
nucleophilic
amino or hydrow. PDA can be activated with trimethylacetylchloride under
anhydrous
conditions to form an active asymmetric anhydride. The anhydride can be
treated with
excess ethylene diamine or ethanolamine to form ethylenediamino-PDA (EDA-PDA)
or
ethanolamine-PD.~ (EA-PDA), respectively. One and a half mole equivalents of
triethylamine are added as a catalytic base and reactions are allowed to
proceed for three
hours at room temperature. EDA-PDA and EA-PDA are chromatographically purified
usin~~ a silica gel column and a chloroform/methanol gradient. The EDA-PDA or
EA-
PDA are then be condensed with free carboxylic acid containing ligands
(chemically
activated as above 1 to form the ligand-linked polymerizable surfactants.
Representative
-82-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
examples of ligands that can be prepared by this method include, but are not
limited to,
carbohydrates, nucleotides. and biotin.
The art contains numerous other examples of successful linkage or association
of
molecules to lipids and membranes. The self assembling monomers associated
with
ligands can be of modified chain length or may consist of double or multiple
chains.
These various combinations of ligands and monomers provide an extremely broad
array of
biopolymeric materials appropriate for the interaction with a broad range of
analytes. with
the desired colorimetric response, selectivity, and sensitivity.
In one embodiment of the present invention. the hydrazide of PDA was
synthesized
by treatment of'~HS-PDA with hydrazine hydrate. Hydrazine hydrate (500 ~1,
~80%) was
mixed with NHS-PDA solution (1 mL. 40 mg Illl-~ in CH~CI,), alld reacted at
room
temperature for 1? h. The organic phase was then exhaustively extracted with
H,O and
rotavaped to drwess, yielding quantitatively pure PDA-NH-NH, as one spot on
TLC
(CH,CI, / MeOH ' NH3 aq. 13:6:1, R,-= 0.94). Characterization: white solid, 'H-
NMR
(200 MHz. CDCI:): 8 [ppm] = 0.87 (t, ,I= 6.42 Hz. 3 H, -CHI), 1.25 (br. s, 32
H, alkyl-
CI-I,-). 2.14 (t, .I = 7.52 Hz. 2 H, -CH,-CHI-CO-NH-), 2.23 (t, ,1= 6.87 Hz, 4
H, -CH,-
C=C-C-C-CH,-). ~3.3 (br. s, 2 H, -NH-NH,), 6.75 (s, 1 H, -CO-NH-NH,); IR
(KBr):v~
[cm-'] = 3310 (s. v(-NHS)). 2918 (s, v(CH,)), 2851 (s, v(CH~)), 1645 (s,
v(C=O)), 1606 (s.
8(>CON-H)). 1 ~s4 (m, amid II), 1471 (m), 1422 (m), 1263 (w), 1012 (w), 976
(w), 716
(w). 691 (w). ~8 ~ (w), 1R spectroscopy of PDA-NH-NH2 (KBr) showed a strong
peak at
3310 cm-'. which was characteristic of an amino group. The carbonyl stretch
vibration of
PDA at 1600 cm-~ was replaced by three amide bands (1645, 1606, 1534 cm-').
These
bands can be very useful for IR studies of H-bonding in PDA-NH-NH, layer
systems.
In one embodiment of the present invention. mixed liposomes (0.1 mM) composed
of 9~% PDA and ~% PDA-NH-NH, were polymerized with 0.3 J cm'-'. These
liposomes
posses the same polymerization behavior as pure PDA liposomes and could be
easily used
for bindin~~ studies with keto-modified cells, aldehydes, ketones or NHS-
esters. Although
an understanding of the mechanism is not necessary to practice the present
invention, and
the present invention is not limited to any particular mechanism, liposomes
made from
pure PDA-NI-I-1H2 surprisingly did not polymerize in pure HBO. After
irradiating a 0.1
171M lIpOSOllle SOllttlOn lil H,O with 0.9 J cm--. only a very weak red
absorption was
observed. The same lack of polymerization was seen when irradiating the
liposomes in
basic medium (i.~°.. 90 ml\-t NH;: PHY02 or carbonate buffer pH 9:
PHY03). In
_g;_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
contrast, liposomes (0.1 mM) polymerized in high yield straight to the red
form in a 90
mM I-ICl solution. By increasing the HCl concentration to 0.9 M the liposomes
polymerized in excellent yield to the blue form. This solution was not stable
over time
and the liposomes precipitated. When these blue liposomes were treated with
slight excess
of base (i. e. , NH, ) the color changed to red. Upon addition of HC1 the
color reversed to
blue again. A similar effect of pH on formation of a specific color phase was
also
observed with NH;-treated PDA samples.
This reversible colorimetric transition was thought to be due to altered H-
bonding
in the head group region, although an understanding of the mechanism is not
necessary to
practice the present invention, and the present invention is not limited to
any particular
mechanism. It is likely that H-bonding strongly governs molecular packing of
the lipid
chains. and imposes conformational changes onto the conjugated polymer
backbone.
EXAMPLE 6
Colorimetric Analysis
I. Visual Detection
In preferred embodiments, the colorimetric changes of the biopolymeric
materials
of the present invention are detected though simple observation by the human
eye.
Because of the simplicity of the observation, this function can be
accomplished by an
untrained observer such as an at-home user. This Example provides a
description of the
methods used in the development of the colorimetric analyses of the present
invention.
II. Visible Absorption Spectroscopy
I n some embodiments it may be preferred to obtain accurate quantitative data
of
the colorimetric responses or to record subtle changes or faint signals
undetectable by the
human eve. Spectroscopy means may be applied to acquire such data.
2s Visible absorption studies were performed using a Hewlett Packard 8452A
Diode
array spectrophotometer. For PDA material (i.e., films and liposomes), the
colorimetric
response (CR) «-as quantified by measuring the percent change in the
absorption at 626
tlm ( i. e. . which imparts the blue color to the material) relative to the
total absorption
maxima.
_84_
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
In order to quantify the response of a biopolymeric material to a given amount
of
analyte, the visible absorption spectrum of the biopolymeric material without
the analyte
was analyzed as
Bo 1626/(1536 + 1626)
where B" is defined as the intensity of absorption at 626 lull divided by the
sum of the
absorption intensities at 536 and 626 nm. The biopolymeric material exposed to
analytes
were analyzed in the same manner as
Ba 1626/(1536 + 1626)
where B;, represents the new ratio of absorbance intensities after incubation
with the
analvte. The colorimetric response (CR) of a liposome solution is defined as
the
percentage chan_e in B upon exposure to analyte.
CR = [(Ba-B")/B"] X 100%
EXAMPLE 7
Detection of Analytes
1~ The broad range of biopolymeric materials taught by the present invention
allow
for the detection of numerous analytes. Such analytes range from complex
biological
organisms (e.~.. viruses, bacteria. and parasites) to simple, small organic
molecules (e.~,T..
alcohols and sugars). Specific applications of the present invention are
described below to
illustrate the broad applicability of the invention to a range of analyte
detection systems
and to demonstrate its specificity. and ease of use. These examples are
intended to merely
illustrate the broad applicability of the present invention. It is not
intended that the
present invention be limited to these particular embodiments.
_85_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
I. Detection of Influenza Virus
The present invention provides superior means of detecting influenza compared
to
currently available technology. Immunological assays are limited because of
the antigenic
shift and drift exhibited by the virus. The present invention detects all
varieties of
S influenza and thus a determination of a patient's exposure to influenza will
be definitive,
and not limited to a particular strain. Indeed, even newly evolved,
uncharacterized
influenza strains can be detected.
Sialic acid-linked biopolymeric material was generated as described in
Examples 1
and 5. The materials were exposed to influenza virus and colorimetric
information was
ZO observed visually or with spectroscopy as described in Example 6, and shown
in Figure 27
for blue (solid line) and red phase (dashed line) material, respectively. For
liposomes, a 1-
10% mixture of sialic acid-linked PCA was incorporated, as previous studies
indicated that
optimum viral binding occurs for mixtures of 1-10% in liposomes (Spevak et
al., J. Am.
Chem. Soc. 161: 1146 [ I 993]).
15 For silicate glass-entrapped liposomes (i,e., liposomes prepared by the sol-
gel
method), it was found that 5,7-DCDA provided a more vivid colorimetric
response than
10,12-PCA. It is believed that the improved response with 5,7-DCDA was related
to the
size restrictiveness of the sol-gel material and the topochemical nature of
the
conformational changes responsible for the chromatic transitions, although an
20 understanding of the mechanism is not required to practice the present
invention.
In one experiment. irradiation of a sialic acid-linked PCA containing liposome
solutions for ~-10 minutes resulted in the formation of deeply blue colored
liposomes,
while polymerization for between 10 and 30 minute resulted in a purple color.
When
influenza virus was added to the liposomes, the material changed to a pink or
orange
25 color, depending on whether the initial preparation was blue or purple,
respectively. These
color changes were readily visible with the naked eye.
Competitive inhibition experiments were conducted to demonstrate the
specificity
of the ligand-analvte interaction. Experiments were performed as described
above, but
with a slight excess of a-O-methyl-neuramatic acid. a known inhibitor for
influenza virus
30 hemagglutination. The presence of the inhibitor resulted in no detectable
color change of
the biopolymeric material.
-86-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99I14029
It is contemplated that the influenza virus detection system include
additional
ligands that recognize and differentiate influenza strains or serotypes from
one another and
from other pathogens.
The sialic-acid containing biopolymeric materials of the present invention
provide
s means of detecting many other pathogens. In addition to influenza virus,
sialic acid has
the capability of detecting other analytes including, but not limited to, HIV,
chlamydia,
reovirus. Streptococcus .suis, Salmonella, Sendai virus, mumps, newcastle,
myxovirus, and
Nei.scericr meniugitidis.
II. Detection of Cholera Toxin
Cholera toxin is an endotoxin of the Gram-negative bacterium Vibriv cholerae
that
causes potentially lethal diarrheal disease in man. Cholera toxin is composed
of two
subunits: .4 (?7 I:Da) and B (11.6 kDa) with the stoichiometry AB;. The B
components
bind specit7call~- to G,~" gangliosides on cell surfaces, ultimately leading
to translocation of
the A, fragment through the membrane. Cholera toxin can be recognized by GM,-
Is containing supported lipid membranes and polymerized Langmuir-Blodgett
films
containing G,," and a carbohydrate "promoter" lipid (i.e., sialic acid-derived
diacetylenes)
as shown by Pan and Charych (Langmuir 13: 136 [1997j).
Ganglioside GM,, cholera toxin from Vibrio Cholerae, human serum albumin, and
wheat germ agglutinin were purchased from Sigma. 5,7-docosadiynoic acid was
synthesized. Deionized water was obtained by passing distilled water through a
Millipore
yF ultrapurification train. Solvents used were reagent grade. The ganglioside
GM, was
mixed at ~ mol ° o with the diacetylene "matrix lipid" monomers.
Liposomes were
prepared using the probe sonication method and polymerized by UV irradiation
(254 nm).
The conjugated ene-yne backbone of polydiacetylene liposomes results in the
appearance
2~ of a deep blue.~purple solution. The visible absorption spectrum of the
freshly prepared
purple liposomes is shown in Figure 25.
For the colorimetric assay, cholera toxin was diluted to 1 mg/ml in 50 mM Tris
buffer. pH 7Ø In a 500 pl glass cuvette, blue phase liposomes produced as
above were
diluted l:~ in ~0 mM Tris buffer, pH 7Ø The liposomes were pre-incubated in
the buffer
for I p- 30 minutes to ensure stability of the blue phase prior to the
addition of cholera
toxin. No color changes were observed during this period.
_87_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
Cholera toxin was added to the cuvette by the method of successive additions.
After each addition. the contents were mixed and the visible absorption
spectrum was
recorded as a function of time. Typically, 95% of the absorption changes were
observed
to occur within the first 2 minutes after addition of toxin as shown in Figure
26. After
each experiment. the contents of the cuvette were transferred to a single well
of a white
microtiter plate. The pink-orange color of the cholera-treated liposomes was
verified
visually with a blue negative control.
A negative response was observed if the ganglioside G~." ligand was removed
from
the liposomes. Similarly, negative responses were obtained when comparable
quantities of
other proteins besides cholera toxin were added to the GM,-containing
liposomes. These
include human serum albumin, avidin, and wheat germ agglutinin.
Kinetic experiments indicate that greater than 95% of the color change occurs
within the first mo minutes of adding the toxin. As shown in Figure 28, the
color
transition is not an all or nothing effect but depends on the quantity of
toxin titrated into
1~ the solution. The sigmoidal behavior suggest cooperativity of the
colorimetric transition.
Although it is not necessary to understand the mechanism in order to use the
present
invention. and it is not intended that the present invention be so limited, it
is contemplated
that this may indicate that the binding itself is cooperative in the sense
that binding of
toxin to the G~" ligand makes the binding of subsequent toxins more favorable.
Alternatively this result might more appropriately be understood in terms of
the lipid-
polvmer side chain conformation and its result on the effective conjugated
length of the
polvdiacetvlene backbone. Once the effective conjugated length is reduced as a
result of
t(1\111 binding. subsequent perturbation of the remainder of the lipid-polymer
backbone
becomes more favorable.
2, III. Detection of E. coli Toxin
L.iposomes were prepared with 5% by mole of GM, and 95% 5,7-DCDA. For the
colorimetric assa~~. E. coli toxin (Sigma) was spun through a 30 K molecular
weight cutoff
filter at 2000 x « at 15°C to remove salts. The protein was re-diluted
in 50 mM Tris
buffer pH 7.0 to a final concentration of 1 mg/ml.
Fi~~ure '_'~ shows the visible absorption spectrum of the polymeric liposomes
containin~~ ~% G.., ligand and 95% 5,7-DCDA prior to exposure to E. cnli
toxin. The
liposomes were diluted in 50 mM Tris buffer, pH 8.0 to a final concentration
of 0.2 mM
-8s-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
in a plastic disposable cuvette. The solution in the cuvette appeared purple
to the naked
eye.
To the liposomes solution in the cuvette, 40 pl of the above E. coli toxin was
added and the sample allowed to incubate for 10 minutes. The visible
absorption
spectrum was again recorded as shown in Figure 30. The solution in the cuvette
appeared
pink to the naked eye after the addition of the toxin compared to a purple
color before the
addition. The absorption spectra of Figures 29 and 30 confirm the color
changes
observed.
IV. Detection of Other Pathogens
The present invention may also be used to detect a variety of other pathogens.
Ligands. specific for a large number of pathogens (e.g., carbohydrates,
proteins, and
antibodies) can be incorporated into the biopolymeric material using routine
chemical
synthesis methods described above and known in the art. Some of the examples
of
pathogen detection systems are presented below to demonstrate the variety of
methods that
can be applied using the present invention and to demonstrate the broad
detecting
capabilities of single ligand species (e.g., sialic acid).
The sialic acid derivated material of the present invention has been used to
detect
the presence of parasites such as Plasmodium (i. e. , the etiologic agent that
causes malaria).
In these embodiments, the genetically conserved host binding site was
utilized. P17A films
containing sialic acid as described above were exposed to solutions containing
malaria
parasites and er~-throcytes. After overnight exposure to the parasites. the
films became
pink in color. The color response (CR) in each case was nearly 100%. It is
contemplated
that the system be used in conjunction with other testing material (e.g.,
arrays of
biopolymeric material with various ligands) to identify and differentiate the
presence of
2~ particularly virulent species or strains of Plasmodium (e. g., P.
.firlciparum) or other
pathogens.
In yet other embodiments, antibodies were used as ligands to successfully
detect
the presence of .\eisrerin gonorrhoeae and Vibrio vulnificu.s. The
incorporation of the
antibodies into the biopolvmeric material is described in Example 5.
As is clear from these examples, the present invention provides a variety of
means
to detect a broad range of pathogens, including bacteria, viruses, and
parasites.
-89-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
V. Detection of Volatile Organic Chemicals (VOCs)
Certain embodiments of the present invention provide means to colorimetrically
detect volatile orUanic compounds (VOCs). Most of the current methods of VOC
detection require that samples be taken to laboratory facilities where they
are analyzed by
s gas chromatography/mass spectroscopy. Some of the on-site methodologies
require large.
bulky pieces of equipment such as that used in spectroscopic analysis. While
these
methods are excellent for providing quantitation and identification of the
contaminant, they
cannot ensure the safety of the individual worker. In one embodiment, the
present
invention provides a badge containing immobilized biopolymeric material that
signals the
presence of harmful VOCs and provides maximum workplace safety within areas
that
contain VOCs. The badge is easy and simple to read and requires no expertise
to analyze
on the part of the wearer. The color change of the badge signals the
individual to take
appropriate action. The badges reduce costs and improve the efficiency of
environmental
management and restoration actions, significantly reducing down-time due to
worker
illness by preventing over-exposure to potentially harmful substances.
Two main approaches toward VOC detection have been adopted by various groups.
The first involves traditional analytical techniques such as GC/MS that have
been modified
for VOC detection {i.e., an instrument-based approach) (Karpe et ul., J.
Chromatography A
708: 105 [1995]). However, these methods are expensive, complicated, and do
not lend
themselves to field or home use. The second involves the coupling of lipid
membranes to
detector surface( s ) (i. e. , an organic-device approach). In the past
decade, several sensor
devices that in~-ol~~e the coating of a piezoelectric mass balance with an
organic film have
been investigated. Because of the non-selective nature of the coating, these
have been
investigated in an array. These sensors, such as the quartz crystal
microbalance (QCM)
2~ and the surface acoustic wave (SAW) devices (See e.g., Rose-Pehrsson et
al., Anal. Chem.
60: 2801 [ 1988]1. have linear frequency changes with applied mass. By
applying a
polymer or other coating to the crystal, a sensor based on the QCM or SAW is
constructed. The complex electronics involved in the use of SAW, QCM, and
electrode
based systems makes these approaches less amenable to use as personal safety
devices.
The present invention differs from these methods in that signal transduction
is an
integral part of the organic layer structure rather than signal transduction
to an electronic
device. In addition. embodiments of the present invention facilitate optical
detection of
the signal rather than electronic detection. Furthermore, the present
invention provides
-90-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
flexibility in material design, allowing easy immobilization into a small
cartridge (e.g., a
badge) rather than being burdened with the need for electronic equipment.
During the development of the present invention, it was observed that the
interaction of volatile organic solvents with certain lipid-polymer membranes
produced a
strong blue to red color transition. Figure 31, curve a, shows the absorption
spectrum of a
PCA film in blue phase. The film changes to red phase PCA, curve b, upon
exposure to
approximately X00 ppm of 1-octanol dissolved in water. For a variety of
solvents
analyzed. the decree of color change was generally dependent upon the
concentration of
the solvent and also increased with the extent of halogenation and
aromaticity. In this
study. a single component thin membrane film of PCA was prepared and
polymerized to
the blue state by UV exposure (254 nm). These materials were more sensitive to
water-
immiscible solvents than to water-miscible solvents. For the miscible
alcohols, it was
found that the response increased dramatically for isopropanol compared to
ethanol.
perhaps because of a greater extent of solvent intercalation into the
membrane. For the
water-immiscible solvents. measurable color changes were obtained at 0.05 wt%
(500
ppm). Within this group, a similar trend was observed with increased alcohol
chain
length. as well as with increased extent of chlorination. A wide variety of
water-
immiscible solvents were examined at their water-saturation concentration, as
shown in
Figure 32A and B. As indicated in section B, each concentration is different.
In Figure
32A. the v-axis represents the colorimetric response. or the extent of blue-to-
red
conversion. The numbers above the bar represent an upper limit to the
detection in ppm.
For many of these solvents. it is clear that solvent concentrations well below
500 ppm can
be detected.
For the immiscible solvents that have a relatively high solubility in water,
it was
2, possible to examine the effect of solvent concentration on the colorimetric
response. A
linear relationship was found to exist between the colorimetric response and
solvent
concentration in water in the range of 0.05-8 wt % as shown in Figure J3 for 1-
butanol.
The pharmaceutical industry has an ongoing need for solvent sensors, as
pharmaceutical compounds are typically manufactured through organic chemical
reactions
that take place in the presence of solvents. Before packaging of a drug for
use in humans
or other animals. the solvent must be completely driven off (Carey and
Kowalski, Anal.
Chem. G0: X41 [1988]). The currently used method for detecting these VOCs uses
energy
intensive dryers to blow hot air across the drug and piezoelectric crystal
arrays to analyze
-91 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
the evaporation of the various solvents (Carey, Trends in Anal. Chem. 13: 210
f 1993]).
The present invention provides a colorimetric based approach that greatly
simplify these
measurements.
In addition. interest in analytical methods for the quantitation of VOCs in
non-
industrial indoor air environments has increased dramatically in the last
several years.
This is due primarily to a heightened awareness of emissions from common
household
appliances or office equipment, as well as trends in controlled building
ventilation.
Companies that produce consumer products have an interest in serving this
increased need
by providing indoor air monitors that can deduce the presence of hazardous
VOCs in-.situ.
without the need for air sampling and subsequent laboratory analysis. The
present
invention provides embodiments to achieve such means. Indeed, embodiments of
the
present invention provide for enhanced air sampling, and the cartridges may be
connected
to small. portable. battery-operated pumps for personal or general air
sampling.
VI. Detection of Other Small Organic Molecules
Certain inclusion compounds, or clathrates, such as compounds 1 and 2 in
Figure
34 have been shown to be highly selective sorbents for organic solvent vapors
(Ehlen, e~
ul., Angev~. Cheer. Int. Ecl. Engl. Vol. 32, p. 110 [1993]). For example,
compound 1 has a
pronounced affinit<~ for dioxane and little affinity for butanol, acetone,
methanol, 2-
propanol, cyclohexane, toluene, and water. Compound 2 on the other hand, shows
a
pronounced affinity for 1-butanol over the same group of solvents.
The purpose of this example is to show the development of a new class of
functional materials that specifically trap small organic compounds and report
the
entrapment event by a colorimetric change which can be detected visually.
These material
act as simple color-based sensor devices that detects the presence of
compounds such as
solvents or other toxic pollutants in air or water streams.
The first step involves the synthesis of lipid diacetylene analogs of
compounds 1
and 2 as shown in Figure 34. In this figure, the enantiometrically pure ester
of PDA
(pentacosadiynoic acid) 3 is hydroxylated via molybdenum peroxide oxidation to
alcohol
4. Diasteriomers are separated and the ester is hydrolyzed to chiral lactate
analogs 5 and
6, The ethyl esters are formed and treated with Grignard reagents to give the
desired
chiral lipid analogs 7 and 8. Variation in the R groups result in a wide
variety of new
materials in which the specific entrapment capabilities are reviewed.
-92-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
The monomer-lipid clathrate is ordered and compressed on the water surface
using
a Langmuir-Blodgett film apparatus. Polymerization of the monolayer by UV
irradiation
yields the blue colored material as described above. The film is lifted onto a
hydrophobized microscope slide. Exposure of these materials to analytes (e.g.
, 1-butanol
or dioxane) produces a colorimetric response.
VII. Detection of Glucose with Hexokinase Ligands
For the colorimetric measurements, the hexokinase modified films, as described
above. were placed onto silanized glass cover slides for the purpose of
measuring the
optical properties. The biosensor coated glass cover slides were placed in
glass cuvettes
and the UV-Vis spectra of hexokinase modified films were recorded in 0.1 M
phosphate
buffer (pH 6.5). Measurements taken in this buffer condition were considered
background.
Addition of glucose. or other sugar substitutes. occurred directly in the
cuvettes. Figure
35 shows the U~~-Vis spectra of a hexokinase modified PDA monolayer upon
addition of
glucose as a function of incubation time, showing (A) background (0.1 M
phosphate
buffer, pH 6.5); (B) at t = 0.02 min after addition of 10.0 mM glucose; (C) at
t = 30 min
after addition of 10.0 mM glucose; and (D) at t = 60 min after addition of
10.0 mM
glucose.
It is clear that addition of glucose provokes an immediate response as
reflected by
the increase in absorbance at S50 nm. The response increases with time,
reaching its peak
at 60 minutes. The colorimetric response (CR), defined above, was 5.2, 13.7,
and 17.1
for t= 0.02, 30, and 60 minutes, respectively. The color change was
irreversible under
these conditions.
The selectivity of the glucose sensor was studied using sugar compounds
structurally similar to glucose as shown in Figure 36. All tests were made in
0.1 M
phosphate buffer IpH 6.5). The second to the last column on the right
represents the
glucose agitation on the PDA monolayers without immobilized hexokinase. The
sampling
number (n) for the glucose is n = 6, while for the rest n = 3. Addition of
10.0 mM
sorbitol, galactose. and sucrose did not trigger the sensor, suggesting that
the sensor is
very specific for the sugar glucose. 'ro further examine the mechanism of
activation of
the sensor, a PD.~ monolayer without immobilized hexokinase was tested. No
significant
response was observed, as the CR at t = 60 minutes was comparable to the
background of
the hexokinase-conjugated PDA monolayer. The result demonstrated that glucose
by itself
- 93 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
cannot induce the color change in the PDA films. The presence of immobilized
hexokinase was required to allow the sensor to respond to glucose.
VIII. Detection of Nucleic Acid Hybridization Events
In other embodiments, the materials of the present invention comprise nucleic
acid
ligands that allow specific detection of DNA hybridization or other nucleic
acid
interactions via nucleic acid molecular recgnition of a single stranded sample
DNA (ss-s-
DNA) with single stranded probe DNA (ss-p-DNA), which is covalently attached
to the
surface of the biopolymeric material of the present invention. With certain
biopolymeric
materials, a color transition occurs upon analyte binding that can be viewed
by simple
visual observation or, if desired, by color sensing equipment. The
colorimetric detection
of DNA hybridization is illustrated schematically in Figure 40.
IX. Other Examples
The examples provided above demonstrate the broad range of analytes detectable
by the present invention, ranging from complex biological organisms (e.g.,
viruses,
is bacteria, and parasites) to simple, small organic molecules (e.gr.,
alcohols). A number of
other analytes have been successfully detected using ligands linked to
biopolymeric
material including. but not limited to botulinum neurotoxin detected with
ganglioside
incorporated PD.-~ (Pan and Charych, Langmuir 13: 1367 [1997]). It is
contemplated that
numerous ligand I<-pes will be linked to self assembling monomers using
standard
chemical synthesis techniques known in the art to detect a broad range of
analytes.
Additionally, numerous other ligand types can be incorporated into the
biopolymeric
matrix without covalent attachment to self assembling monomer. These materials
allow
for the detection of small molecules, pathogens, bacteria, membrane receptors,
membrane
fragments. volatile organic compounds, enzymes, drugs, and many other relevant
materials.
'the present invention also finds use as a sensor in a variety of other
applications.
The color transition of PDA materials is affected by changes in temperature
and pH.
Thus, the methods and compositions of the present invention find use as
temperature and
pH detectors.
Ligands can also be used in the present invention when they function as
competitive binders to the analyte. For example, by measuring the colorimetric
response
to an analyte in the presence of a natural receptor for the analyte, one can
determine the
-94-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
quantity and/or binding affinity of the natural receptor. Application of
competition or
inhibition techniques allow the testing of very small, largely unreactive
compounds, as
well as substances present in very low concentrations or substances that have
a small
number or single valiancy. One application of this technique finds use as a
means for the
S development and improvement of drugs by providing a screening assay to
observe
competitive inhibition of natural binding events. The compositions of the
present
invention further provide means for testing libraries of materials, as the
binding of desired
material can be colorimetrically observed and the relevant biopolymeric
material with its
relevant ligand separated from the others by segregating out a particular
polymeric
structure.
EXAMPLE 8
Immobilization of Biopolymeric Material
I. Immobilization to Silicon Chips and Gels
The silicon gel or wafers are acid cleaned in 1:1 HCl/methanol, rinsed in
water,
and placed in concentrated sulfuric acid. After a thorough water rinse, the
wafer chips or
gel is boiled in doubly distilled deionized water, allowed to cool and dry and
then
silanized under inert atmosphere in a 2% solution of 3-mercaptopropyl
trimethoxysilane
prepared in dry toluene. Next, the chips or gels are placed in a 2 mM solution
of either
GMBS (N-succinimidyl 4-maleimidobutyrate) or EMCS (N-succinimidyl 6-
maleimidocaproate) prepared in 0.1 M phosphate buffer (the cross linker is
first dissolved
in a minimal amount of dimethylformamide). After rinsing with phosphate
buffer, the
chips are placed in a 0.0~ mg/ml solution of the liposomes prepared in pH 8.0
phosphate
buffer. Finally. the chips or gels are thoroughly rinsed with, and then stored
in, the buffer
solution prior to their use. The liposomes should have an -NHS functionality
for the cross-
2s linking with G~iBS or EMCS to work.
II. Sol-Gel Entrapment of Biopolymeric Material
A silica sol was prepared by sonicating 15.25 g of tetramethylorthosilicate
(TMOS). 3.3~ g of water, and 0.22 ml of 0.04 N aqueous hydrochloric acid in a
chilled
bath until the solution was one phase (approximately 20 minutes). Chilled MOPS
buffer
solution (50% ~~ O was then added to the acidic sol making sure that the
solution was well
cooled in an ice bath to retard gelation. A variety of materials are
appropriate for
-95-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
generating silica sots, including, but not limited to, any tetraalkoxysilane
or organically
modified silane (e.g., ormosil). Additionally, tetraethylorthosilicate (TEOS),
methyltriethoxysilane (MeTEOS), aryl silsesquioxanes, and other metal oxides
fmd use in
generating sol-gel glass.
For encapsulating liposomes, a polymerized liposome solution (2.~ ml) (as
generated in Example 1 ) was then mixed into the buffered sol ( 10 ml) and the
mixture
poured into plastic cuvettes, applied as a film on a flat surface, or poured
into any other
desired formation template, sealed with Parafilm, and allowed to gel at
ambient
temperature. Gelation of the samples occurred within a few minutes resulting
in
transparent, monolithic solids ( 18 mm x 10 mm x 5 mm) in the case of cuvette
formed
gels and as violet colored monoliths with p-PDA liposomes. Slight shrinkage of
aged
monoliths was observed due to syneresis.
The encapsulation of other biopolymeric material shapes (i.e., film and other
nanostructures) can be conducted as described above. The materials must be
generated or
sectioned into small (i.e., nanoscopic) sized portions if not already so, and
incorporated
into a solution to be mixed with the buffered sol.
EXAMPLE 9
Generation of Arrays
In some embodiments, the present invention contemplates the generation of a
large
palette of polymerizable lipids of different headgroup chemistries to create
an array.
Lipids containing head groups with carboxylic acid functionalities (imparting
a formal
negative charge). hydrophilic uncharged hydroxy groups, primary amine
functionalities
(that may acquire a formal positive charge), amino derivatives (with positive,
negative or
zwitterionic charge), and hydrophobic groups among others can be generated. In
some
embodiments of the present invention, the combination of these materials into
a single
device facilitates the simultaneous detection of a variety of analytes or the
discrimination
of a desired anah~tes from background interferants. In some embodiments,
biopolymeric
materials comprising varying dopant materials are used to provide a different
color pattern
for each portion of the array.
_ For example, a large palette of polymerizable lipids of different headgroup
chemistries can be generated to create an array. For example, Figure 37
depicts lipids
with ~~arious head group chemistries. These may be categorized into five
groups based
-96-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
upon their head group functionality. Compounds 2.4 and 2.5 contain carboxylic
acid
functionalities. imparting a formal negative charge. Compounds 2.6 and 2.7
contain a
hydrophilic uncharged hydroxyl group. Compounds 2.8 and 2.9 have primary amine
functionaiities that may acquire a formal positi~~e charge. The amino acid
derivative 2.10
s may exist with positive, negative or zwitterionic charge. Compounds 2.11-
2.13 have
hydrophobic head groups.
The synthesis of these lipids begins with commercially available PDA {2.4).
Synthesis of all but 2.10, 2.12, and 2.13 can be carried out by coupling the
respective head
group to PDA utilizing the activated N-hyroxysuccinimidyl ester of PDA (NHS-
PDA) as
described above. The amino acid lipid 2.10 can be prepared in four steps from
PDA as
Sh0\~~11 111 Figure 38, using lithium aluminum hydride and transformation of
the alcohol to
the corresponding bromide derivative. The bromide is converted to the
protected amino
acid by reaction with diethyl N-acetimidomalonate in acetonitrile with sodiup
hydride.
followed by deprotection. The fluorinated lipids 2.12 and 2.13 can be prepared
by the
1~ reaction of pentafluorobenzoyl chloride with amino lipids 2.8 and 2.9.
Materials prepared as above, can be deposited into chambers of a device or
immobilized to specific portions of a device. By generating biopolymeric
materials with
different properties (e.g., analyte or reaction detection capabilities,
colors, analytes
affinities) within a single apparatus (e.g., a badge), an array is generated
with the ability to
identify. distin~~uish, and quantitate a broad range of reactions and
analytes.
In other embodiments, the construction of a patterned DNA assay automated DNA
synthesis is carried out with the growing chain linked to the polydiacetylene
bilayer
system on solid substrates. as shown in Figure 46. The activated nucleotide
monomers
which are added in each cycle carry a photosensitive protecting group at the
~' end. After
2~ the coupling reaction, the chain ends (5') are capped with the
photosensitive protecting
=roup. By irradiation of the substrate through a mask, only the parts of the
substrate that
are irradiated are deprotected. Thus, on a single substrate (detector) surface
several
independent ss-p-DNA sequences can be synthesized in a parallel manner by
appropriate
choice of mash. This approach will yield a powerful multivalent sensor for the
detection
3(1 of many different ss-s-DNA fragments in one step. The method requires a
photosensitive
protecting group that is cleaved at a wavelength which does not affect the DNA
itself (i~"1,~
= 260 nm) or interfere with the polydiacetylene backbone. Such photosensitive
protecting
groups are n-nitrobenzlyoxv esters of phosphoric acid (?~.,~,~, ~ 340 nm) and
related
_c~7_
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
compounds (See. Greene et al., Protective Groups in Organic Synthesis', second
ed.. John
Wilev & Sons. Inc., New York [1991]); Pillai, Synthesis, p. 1 [1980]; and
Zehavi, Adv.
Carbohydr. Chem. Biochem. 46:179 [1988]).
EXAMPLE 10
S Detection of Membrane Rearrangements
I. Phospholipase Az
Biopolymeric liposomes were prepared by probe sonication of a mixture of
polvmerizable matrix lipid 10,12-tricosadiynoic acid and various mole
fractions (0%-40%)
of PLA, substrate lipid (e.g.. DMPC) in water, followed by polymerization with
1.6
I CI ~.L.I/Clll~ ultraviolet radiation. 254 llm. Analysis by tra11S1111SS1011
el2Ctr011 1111CrOSCOpy
indicated an average vesicle size of approximately 100 nm.
In their initial state, the vesicles appeared deep blue to the naked eye and
absorb
maximally at around 620 nm. Polymerized vesicles composed of 40% DMPC/60% PDA.
1 mM total lipid. were diluted 1:10 in 50 mM Tris buffer pH 7.0 to a final
volume of 0.5
I1 1111 in a standard cuvette and the spectrum recorded using a Hewlett
Packard
Spectrophotometer Model 9153C. Bee venom phospholipase A, (Sigma) was
dissolved in
a 10 mM Tris. 1 ~0 mM NaCI, 5 mM CaCh buffer pH 8.9 to yield a final
concentration of
1.4 mg/ml PLA,. 50 P.l of this solution was added to the cuvette and the
spectrum was
recorded after 60 minutes. Upon addition of PLAN to the DMPC/PDA vesicles, the
20 suspension rapidly turned red (i.e., within minutes) and exhibited a
maximum absorption at
approximately X40 nm as shown in Figure 13, described above.
Liposomes containing a range of mole% DMPC were tested for their ability to
produce a colorimetric response. Five mieroliters of 1.4 mg/ml PLA, was added
to ~0 pl
of DMPC/PDA vesicles (0.1 mM final total lipid concentration). The experiment
was
2~ carried out in a standard 96-well plate using a Molecular Devices UV Max
kinetic
microplate reader. The absorption of the vesicle solution was monitored as a
function of
time at 620 nm and 490 nm wavelengths. The data was then plotted as
colorimetric
response (CR) ~~ersus time to yield the color response curves as shown in
Figure 17.
described above.
30 In order to confirm that biocatalysis was occurring at the DMPC/PDA
vesicles,
PLA, activity was independently measured using a labeled lipid analog
incorporated into
the PDA matrix. allowing simultaneous measurement of product formation and
-98-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
colorimetric response of the vesicles. The analog used was thioester 1.2-bis-
(S-decanoyl)-
1,2-dithio-sn-glycero-3-phosphocholine (DTPC). Five microliters of 40%
DTPC/PDA
vesicles diluted with 45 ~tl 40 mM Tris pH 7.0 and 5 ~tl of 6 mM DTNB were
incubated
with 10 yl of 1.4 mg/ml PLA,. The absorbance at 412 nm was monitored over
time.
NMR experiments were conducted to further verify the occurrence of interfacial
catalysis by PI_A=. and provide information of the fate of the enzymatic
reaction products.
The spectra were taken at a magnetic field of 11.7 Tesla on a Bruker DMX500
NMR
spectrometer. The Block-decay pulse sequence was used with 2048 acquisition
data
points. 40 000 free induction decays were accumulated in each experiment with
2 second
recycle delays. 0.1 M phosphoric acid was used as an external reference.
Figure 16
shows the ''P NI\-IR spectra of A) Mixed DMPC/PDA vesicles, 0.1 mM total
lipid; B) the
same vesicle suspension after addition of PLA~ {200 ng).
II. Phospholipase C and D
The assays for phospholipase D and C were run under similar conditions as the
phospholipase PL:~, assays. In all assays, 1 mM 40% DMPC/ 60% 10,12-
tricosadivnoic
acid (TRCDA) liposomes were used. Aqueous stock solutions of phospholipase D
and C
were prepared by dissolving the enzymes at 1 mg/ml concentration in 50 mM
Tris, 150
mM NaCI. ~ ml\M CaCI, pH 8.9 buffer and 20 mM sodium borate, 150 mM NaCI, ~ mM
CaCI, pH 8.9 buffer, respectively. The assays were then performed by adding 5
Pl of
liposomes. 46 yl ~0 mM Tris pH 7.0 (or 20 mM sodium borate pH 7.0 when testing
PLC). and 5 ~l of enzyme. Controls for the assays consisted of ~ yl of buffer
instead of
enzyme. The assays were monitored at 620 nm and 490 nm every two minutes for
the
first ten minutes. and then every ten minutes for the remaining 50 minutes.
III. Bungarotoxin
2> Assays were conducted under similar conditions to the experiments described
above. Ten microliters of 1 mM 40% DMPC/60% TRCDA liposomes, 3~ ~tl of 50 mM
Tris pH 7.4. I s ul BUTX 1 ~'lolecular Probes B-3459) were dissolved in ~0 mM
Tris. 150
mM NaCI, ~ mhl CaCI, pH 7.4 to make a 2 mg/ml solution. Spectra were monitored
every ? minutes for the first 10 minutes of the incubation and every 10
minutes for the
remainin~~ ~0 minutes. Absorbance at 490 and 620 nm were monitored using a UV
max
microplate reader.
-99-
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
IV. Inhibitor Screening
Inhibitors were used to block the colorimetric event initiated by PLA,.
DMPC/PDA vesicles containing 0.6% MJ33 were polymerized and incubated with 5
yl of
1.4 111/1111 PLi~_. Five microliters of unpolymerized liposomes were combined
with 40 yl
a of 50 mM Tris pH 7.0, 5 ~l MJ33 (0.006 M dissolved in water), 5 ~1 of 50 mM
Tris, 150
tnM NaCI. 5 m~f CaCI~ pH 8.9, and incubated for 15 minutes. The liposomes were
then
polymerized in 96 well plates and absorption spectrum were recorded at 490 nm
and 620
11111. Fi~~e microliters of PLA, were added and spectra at specific time
intervals were
monitored for one hour. For Zn'' inhibition, the enzyme was dissolved in 10 mM
Tris,
1() 150 mM NaCI. 0.1 mM ZnCI, pH 8.9.
EXAMPLE 11
Nucleic Acid-Linked Biopolymeric Materials
In these experiments. oligonucleotides were derivatized to form single
stranded
probe DNA (ss-p-DNA) for incorporation into biopolymeric liposomes. The
liposomes
1~ were prepared from a lipid mixture of 95% compound 1 (Figure 4I ) and 5"/o
compound 3
(Figure 41 ). as described above by sonicating a dried film of the lipid
mixture in an
aqueous medium. This liposome solution was photopolymerized by irradiation
with UV
Light (254 nm). and then either compound 4 (Figure 41; [SEQ ID N0:2J) or
compound 5
(Figure 41 ) was added to form covalent linkages at the active ester lipid
sites of compound
20 3. This process is illustrated in Figure 42.
Coupling the a.,o~-bisamino ss-p-DNA (i.e.. compound 5) to the surface of the
polymeric liposome potentially creates a more sensitive probe than one
generated with
compound 4. although an understanding of the mechanism is not required to
practice the
present invention and the present invention is not limited to any particular
explanation, the
2, possible reasons for this increased sensitivity are as follows. The single
stranded DNA
forms a coiled structure in solution as known from dissolved polymers.
Attaching the
coiled ss-p-DNa. compound 5. to the liposome surface resulted in two
relatively close
linl:a~~es. upon h~ bridization the double helical DNA elongates and causes,
simultaneously at both linkages, conformational changes in the polydiacetylene
backbone.
30 This cooperative effect increases the sensitivity of colorimetric
detection.
The characteristics of these liposomes, such as size and shape, can be
determined
from various measurements. including TEM (e.g.. freeze fracture method) and
light
- 100 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
scatterin~~. Raman- and UV/Vis spectroscopy give information about the polymer
backbone. whereas FTIR spectroscopy is sensitive for the alkyl chains. Surface
topology
is revealed under the AFM, and the chemical composition of the surface may be
probed by
XPS. although the present invention does not require such characterization
experiments.
Compound 1 and analogues 2 and 3 of Figure 41 were used and derivatized to
yield the desired functionalizations at the membrane surfaces. Figure 41 shows
the film
structure with the conjugated polymer backbone before and after
photopolymerization with
lipid 1. The oliaonucleotide dGGGAATTCGT (SEQ ID N0:4), complementary to a
sequence on the \113 phage DNA, could be derivatized to form the ss-p-DNA
compounds
1 () 4 alld ~. which carry amino groups at the chain ends. These amino groups
can react with
the active ester lipid. compound 3, in a polydiacetylene film, allowing the
attachment of
the ss-p-DNA to the liposome or bilayer after photopolymerization. However, it
is not
intended that the present invention be limited to any particular ss-p-DNA
sequences.
In some experiments, the ODN-lipid conjugate Oligo 1 (hereinafter, "W001 ")
was
obtained by reaction of NHS-PDA with the amino functionalized 27-mer Oligo 1
in
DMSO %' aqueous buffer medium (pH 9, Na~CO;/NaHCO; buffer, 0.1 M) as shown in
Figure 4s. The \HS-PDA dissolved in DMSO partially crashed out of solution
when
added to the aqueous ODN-buffer solution, but nevertheless the reaction
proceeded over a
period of two weeks in the cold (i. e., approximately 4°C). A second
attempt to form the
2(1 amide in a two-phase system (i.e., an amine in water and an acid chloride
in an organic
solvent). with an aqueous ODN-buffer solution and NHS-PDA dissolved in CH~CI,
was
unsuccessful. Although an understanding of the mechanism is not necessary to
practice
the present invention. and the present invention is not limited to any
particular mechanism.
this failure was probably due to the very strong difference of polarity of
both reactants. so
that neither of them could cross the phase boundary to come in close enough
proximity to
react.
In addition. the primary OH-group of the 5'-terminus was conjugated to a
diacetvlene lipid with phosphate head group, using DCC as condensation agent
and
pyridine as base as shown in Figure 43. The lipid was coupled to the
detritylated Oligo 2
3(1 (i.c~.. the lipid-linked oligonucleotide designated as seq.l-DA13//90P03H2
in Figure 43)
carrvin~r the nucleobase protecting groups and which was bound to the solid
support. The
ODN-lipid copjuaate was cleaved from the solid support and deprotected with
the standard
NH ; workup to yield Oligo ? conjugate.
- 101 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
Large batches of liposomes were prepared during these experiments. Lipids were
inially filtered. and the filtered lipid solution was placed in organic
solvent. In preferred
embodiments of the present invention, the total volume of organic solvent in a
liposome
solution with a volume of 30-80 ml was less than 5 ml, giving a high
concentration of the
lipid. The beaker was placed onto a handwarm heat plate and a gentle stream of
N, was
passed over the surface of the liquid. After complete evaporation a magnetic
stirrbar and
the appropriate ammount of H~O was added. The beaker was then mounted in the
sonicator chamber on top of a magnetic stirrer with the sonicator tip resting
I-2 mm above
the stirrbar. In preferred embodiments, the liquid was sonicated at 60% output
power,
with gentle stirring and heating (i.e., with a heat gun) until all solid was
dispersed. After
the appropriate sonication time (5-30 min) the hot solution was filtered
through a 0.8 pm
Metricel filter and refrigerated.
The effect of ODN on liposome polymerization was determined with 5% "Oligo ?"
(i.c~.. the lipid-linked oligonucleotide designated as seq.l-DA13//90P03H2 in
Figure 43),
1~ added to a 1 mh-I solution of monomeric PDA liposomes, which were incubated
for I ~
min at room temperature, photopolymerized (1.6 J cm-') and then diluted to 0.1
mM lipid
concentration. Based tin comparisons between the utilized energy dose and the
absorbance
at 642 11111 (AbS.bpnm = 0.5 O.D., energy dose =1.6 J cm-') to the polymer
absorbance of
pure PDA liposomes (Abs.6;9~~, - 0.68 O.D., energy dose = 0.8 3 cm-'-), it was
suggested
2(1 that the presence of ODN reduced the efficiency of polymerization, due to
the strong
absorbance of ODN at 254 nm (i.e., the wavelength used for polymerization)
although an
understanding of the mechanism is not necessary to practice the present
invention. and the
present invention is not limited to any particular mechanism. Another effect
might be the
interaction of ODN with the liposome bilayer, which gets distorted, and thus
less
25 effectively polymerized. This interaction is also most likely responsible
for the shift of the
polymer maximum absorbance from 639 to 642 nm. After filtration (i.c~., cc30
filtration:
the filters used were centricon 30 filters with a molecular cutoff at ~ 30 000
g mol-' and
filtration was achieved by centrifugation), the amount of ODN associated with
the
liposome phase was drastically reduced and the filtrate contained most of the
ODN. After
30 a second filtration step, most of the ODN was removed from the liposome
phase. The
loss of liposomes by 10-1 ~% due to the filtration procedure, was comparable
to that
observed using pure liposomes.
- 102 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
ODN loss by cc30 filtration was quantified by subtracting the liposome
hackground
from the UV-Vis spectra, to obtain the pure ODN absorbance, reflecting a
direct measure
of ODN concentration in the liposome phase. By subtracting the volume
corrected
spectrum of the filtrate (i. e. . pure Oligo 2) from the initial liposome-ODN
spectrum. a
s pure liposome "blank" was created which in turn could be used to extract the
clean ODN
spectra from the retentate spectra. This procedure allowed quantitative values
to be
obtained for the ODN concentration in the liposome phase, which decreased
following an
exponential "decay" law, as is reasonable for a dilution series. After two
cc30 filtrations,
a total of 75% liposomes and 14% ODN were retained. The exact ODN
concentration in
the retained liposome phase depended on three major factors: i) the dilution
of the
1'e111altlitlg ODN in the retentate which was diluted following an
exponentially declining
function: ii) a fraction of the ODN unspecifically bound to the liposomes,
with binding in
equilibrium with the ODN concentration in the surrounding medium; and iii) the
loss of
ODN by absorption of liposomes at the filter surface by which ODN gets
entrapped in the
filter and which was correlated to polymer loss. The last factor becomes
particularly
important when the OI)N is specifically bound to the liposome surface, as is
the case with
the ODN-lipid conjugates.
In some experiments, PDA liposomes ( 1 mM concentration) were mixed with 5%
"Oligo 3" (SEQ ID NO:3) (the complement of Oligo 2). The liposomes
precipitated upon
irradiation. which was due to the high salt content in this ODN sample. To
improve
polymerization yields, the PDA liposomes were diluted to a concentration of
0.1 mM prior
to polymerization. After incubating the diluted liposomes with 5% Oligo 2 for
14 h at
room temperature and 6 h at 4°C, photopolymerization was achieved with
an energy dose
as low as 0.3 J cmv (254 nm) in a comparable yield to pure PDA liposomes. The
10-fold
2~ dilution of the ODN-liposome mixture reduced the relative salt
concentration and allowed
a polymerization yield comparable to pure PDA liposomes and the Oligo 2
sample. This
result was in contrast to the 1 mM liposome solution mixed with 5% Oligo 3,
whereby the
liposomes came out of solution upon irradiation due to high salt
concentration. The major
differences between Oligo 2 and Oligo 3 are the longer chain length (27-mer
versus 10-
mer) and the terminal primary amino group. This amino function can be
protonated by
the PDA acid head group to form a salt pair and the longer chain length should
enhance
unspecific adsorption at the liposome surface. Both effects lead to a higher
ODN retention
in the liposome phase. The polymer loss between the first and second
filtration was 9%.
- 103 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
In other experiments. 1-(3-dimethylaminopropyl}-3-
ethylcarbodiimidehydrochloride
(EDC) and NHS were added to the ODN / liposome mixture (i.e., PDA of 1 mM and
5%
ODN), to produce a covalent attachment of Oligo I to the liposome surface. To
this
mixture 50 ~tl of an EDC stock (0.6 mg ml-' EDC HCI in H,O) and 1 ~tl of a NHS
stock
s (0.6 mg ml-' in H=O) were added and incubated for 11 h at room temperature.
The
monomeric liposome mixture was cc30 filtered / rediluted (vr 1 ), polymerized
(0.3 J cm'-')
and filtered / diluted again (v~=1 ).
In vet other experiments, prepolymerized PDA liposomes (0.1 mM) / Oligo 1 (5%)
were used. Unpolvmerized PDA liposomes (0.1 mM) were cc30 filtered once,
rediluted
and polymerized (0.3 J cni') and then incubated with 5% Oligo I for 11 h at
room
temperature. After ODN incubation, the liposomes were filtered twice more,
with a
polymer loss of 17% per filtration step. In yet other experiments,
prepolymerized PDA
liposomes (0.1 mil) / Oligo 1 (5%) were used with EDC and NHS-treated. EDC and
NHS were added to the liposome surface, and the liposomes were polymerized
before
1~ incubation with ODN. The PDA liposomes were filtered once in monomeric
form,
rediluted to 0. I mVl, polymerized (0.3 J cm-') and incubated with 5% Oligo 1,
EDC (50
yl of 0.6 mg ml~' EDC HCI in Hz0) and NHS ( I l.tl of 0.6 mg ml-' NHS in H.,O)
for 11 h
at room temperature. After incubation, the ODN-liposome mixture was filtered a
second
and a third time with a linear polymer loss of 15% and 23%, respectively.
Although an
understanding of the mechanism is not necessary in order to make and use the
present
invention, it is suggested that neither EDC / NHS treatment nor polymerization
conditions
(pre- or postpol~~merization) significantly change the ODN retention behavior.
In addition. liposomes were investigated for their ability to covalently bind
amino
funetionalized Oligo I on their surface. For this purpose the polymerized
liposomes (0.3 J
2~ cm- . 0.1 mM) were incubated with 5% Oligo 1 for 11 h at RT, cc30 filtered,
and
rediluted to the original volume. The cc30 filtration was repeated two more
times, and the
polymer loss was measured at 640 nm, showing a slight exponential "flattening
out."
Although an understanding of the mechanism is not required to practice the
present
invention and the present invention is not limited to any particlar
mechanistic explanation.
this flattening of polymer loss was most likely due to a more complete
coverage of the
filter surface with adsorbed liposomes after each filtration step, leaving
less free filter
surface for further liposorne adsorption. The pure ODN spectra were obtained
after
subtracting the liposome background, which allow calculation of the ODN loss
upon
- 104 -
CA 02330937 2000-12-12
WO 99/67423 . PCT/US99/14029
filtration. This ODN loss followed essentially the same linear function,
indicating that the
use of 10% NHS-PDA in liposomes does not improve ODN retention.
Results showed that for the unmodified 10-mers and after three cc30
filtrations,
about 70% of polymer (decreases to ~40% at high salt concentration) and 6% ODN
were
retained. The amino functionalized 27-mer with pure PDA liposomes were only
twice
cc30 filtered. From the linear relationship between polymer- / ODN-loss and
number of
filtrations a polymer retention of 50-GO% and an ODN retention of 16-32% after
three
cc30 filtrations can be extrapolated. With the NHS-PDA / PDA (10:90) liposomes
only
24% polymer, but 37% ODN, were retained. If the ODN was bound to the liposome
surface. the ODI\ retention was also a function of polymer loss, as ODN is
extracted from
solution with filter-adsorbed liposomes. This fact complicated the
determination of actual
ODN concentration relative to liposome concentration, since the precise nature
and extent
of ODN-liposome interaction was not known. Generally. the relative ODN
retention in
terms of liposome concentration was higher than the absolute ODN retention
(i.e., relative
1 s to the total volume of the liposome phase).
To obtain a more specific (i.e., covalent) interaction of ODN with the
liposomes,
two different ODN-lipid conjugates were synthesized. The monomeric Iiposomes
(0.1
mM. X00 pl) were incubated with the ODN-lipid conjugates (5%, 8.5 h at room
temperature. and 1 ~ h at 4°C), polymerized (0.3 J cm-') and then three
times cc30 filtered
211 / washed (s00 pl H,O each). Before and after this treatment the UV-Vis
spectra were
taken to quantify polymer- and ODN loss. To 100 p.l of the unfiltered ODN-
liposome
mixture. an equivalent of unmodified complementary ODN was added to test
colorimetric
response upon hybridization. UV-Vis spectra of PDA liposomes mixed with Oligo
2 (5%)
before and after three cc30 filtrations indicated that the filtrate contained
only ODN.
25 Addition of the complementary Oligo 3 at room temperature did not affect
the polymer
absorption spectrum.
In additional experiments, 5% of the Oligo 1 conjugate was mixed with PDA
liposomes. and shown to drastically reduce polymerization yield. Although an
understanding the mechanism is not necessary to practice the present
invention, and the
30 present invention is not limited to a particular mechanism, this reduction
in yield was
probably due to an insertion of the ODN-lipid tail into the liposome bilayer,
causing some
disorder in the PD a packin~~. Addition of an oligonucleotide complementary
Oligo 1 (i. e..
Oli~To 4) slightly increased the red polymer absorbance. About 79% polymer was
retained
- 10~ -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
after three filtrations. In one embodiment of the present invention, PDA
liposotnes (0.1
mM) were incubated with 5% Oligo 4 followed by polymerization (0.3 J cm--'),
and
filtered to give a polymer retention of 39% and an ODN retention of 31 %
(Figure 27).
In other experiments, POS liposomes (0.1 mM) made from the monophosphate
S 10,12-hexacosadiyn-1-of phosphate (hereinafter, "DA13 liposomes") were
incubated with
5% of Oligo 2 lipid, which were then polymerized (0.3 J cm-'), and three times
cc30
filtered with a s 1 % polymer retention. Adding an equivalent of the
complement Oligo 3
induced a faint increase in the red absorbance, and a subsequent decrease in
blue
absorbance. From the extracted ODN spectra in shown in Figure 44, a high ODN
retention of 28% was deduced. Although an understanding of the mechanism is
not
necessary to practice the present invention, and the present invention is not
limited to any
particular mechanism, mixing 5% Oligo 1 with POS liposomes (0.1 mM) reduced
the
polymerization yield (0.3 J cm~'), probably due to intercalation of ODN-lipids
into the
POS liposomes. In this case the absorption maximum was even shifted to longer
1~ wavelengths, giving the liposomes a greenish tint. Addition of the
complement Oligo 4
did not affect the polymer absorbance. After three cc30 filtrations, 76%
polymer and 56%
ODN were retained.
All samples mixed with their ODN complements were incubated for about 30 min.
at 40°C to induce specific hybridization and color transition. but only
the POS liposomes
with Oligo 2/Oligo 3 visibly changed color to red.
Synthesis and Hybridization of DNA-PDA Conjugates
Two complementary sequences SEQ ID NO:1 (Oligo 2; SEQ1) (~ GGG AAT TCG
T' ) and SEQ ID \0:2 (Oligo 3; SEQ2) (S~ACG AAT TCC C'~) were synthesized on
an
Experdite 8909 nucleic acid synthesis system (PerSeptive Biosystems) by the
standard
2S phosphoramidite route.
The general phosphoramidite method is schematically depicted in Figure 46. In
a
first step A), the dimethoxvtrityl (DMT) group was cleaved at the ~'-end of a
solid
support bound nucleotide. The solid support was usually controlled pore glass
(CPG)
which was modified with long chain alkylamino groups to which the nucleotide
was bound
at the s~-end of the deoxyribose via a succinyl spacer. The free ~'-OH group
was then
activated in step B) by tetrazole and coupled with a phosphoramidite, to form
the one
nucleotide elongated chain. In step C), the unreacted 5'-OH ends was
esterified with
- 106 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
acetic anhydride to reduce the occurence of failure sequences. In the next
step D), the
phosphite triester bond was oxidized to the corresponding phosphotriester by
iodine in
pyridine/H~O. The cycle was then repeated ad libidum with the needed
phosphoramidites.
until the final sequence is established. By treating the material with aqueous
NH; ( i0%),
cleavage from solid support, and deprotection of the nucleotides, free
bioactive DNA was
obtained. Removal of protecting groups, salt and small byproducts can usually
be
achieved by spin column chromatography through Sephadex G-25 or G-50 columns.
Cleavage from CPG and deprotection of DNA may be achieved by a variety of
methods. In one method, the column is cut open to retrieve CPG beads, which
are
transferred into a small screw-capped, teflon-lined container. The CPG beads
are treated
for G-8 h at 55°C with 1 ml conc. NH40H (30%), and ammonia is then
decanted from the
beads. Alternatively. two syringes with 1 ml conc. NH~OH (30%) are connected
to the
ends of the column. the ammonium hydroxide solution pushed forth and back for
l.~ h.
transferred to a glass vial and heated for 6 h at SS°C. The DNA
containing ammonium
is hydroxide solution is evaporated to dryness by centrifuging (i.e., "speed
vac"), and the
solid obtained is redissolved in 200 pl HBO.
The free ~'-end of the fully protected and polymer support bound SEQ1 was
treated with PDA and DCC at room temperature in CH~CI, to obtain the DNA-PDA
conjugate. Following this method, the side products (i.e., dicylclohexyl urea)
and
excessive reagents can be washed from the column prior to DNA cleavage to
avoid
unnecessary purification steps. The reaction scheme for conjugation of SEQ1
with PDA is
illustrated in Figure 47. Since DNA cleavage from polymer support and removal
of
protecting groups (benzoyl and isv-butyloyl groups) was achieved by treatment
with
concentrated ammonia solution (30%) at 55°C for 6-8 hours the danger of
cleaving the
2s DNA-PDA ester bond had to be considered.
Two basic purification procedures, ethanol precipitation and Sephadex G-25
spin
column chromatography, were tested to remove any cleaved protecting groups and
salts
from the 10-mers. With SEQ2, the ethanol precipitation did not work most
likely due to
the short length of the 10-mer which makes it soluble in ethanol (70%) /
NH~AcO. The
success of the Sephadex G-?~ chromatography could not be directly checked. but
it could
be shown by UV-Vis spectroscopy that the DNA did come through the column. Gel
electrophoresis on a 20% acrylamide gel was performed to elucidate the success
of the
couplin~~ reaction between SEQ1 and PDA. The gels were stained with ethidium
bromide
- 107 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
or silver nitrate. and showed that the 10-mers are very insensitive to
ethidium bramide.
Electrophoresis shows that SEQ1 samples ran slightly faster than SEQ2, and
that SEQ1-
PDA and SEQ2 formed hybrides that stained well with ethidium bromide.
To check whether free PDA was present in the SEQ1-PDA sample, TLC was
S employed and stained with silver nitrate as known in the art. This method
resulted in
strong staining of PDA on silicagel upon heating. This experiment shows that
no free
PDA could be detected in the SEQ1-PDA samples, although the DNA was not run on
silica gel to reveal differences in polarity between SEQ1-PDA and SEQ2. UV-Vis
spectra
taken from the DNA samples showed the typical nucleo base peak at 260 nm and a
strong
absorption at -200 nm with intensity varying in different samples (most likely
due to
varying salt concentration).
To check whether diacetylene lipids (i. e. , phosphoramidites) could be used
in
automated DNA s~~nthesis, the stability of PDA against iodine in acetonitrile
was tested by
dissolving PDA and I, in acetonitrile at room temperature, and conducting TLC
after ~
min. The I, was used as oxidizing agent in automated DNA synthesis to oxidize
the
trivalent phosphonium ester to the pentavalent phosphoric acid ester after the
nucleobase
coupling step (Figure 33). The ThC showed that PDA readily reacted with I,
(addition) to
form a more polar product that does not polymerize upon UV irradiation,
suggesting that
diacetylenes might not be directly used in the DNA synthesizer.
In one embodiment. Oligo 2 was conjugated with DA13 lipid. A 2 mM DA13
solution (''.~ mL. ~ ~mol) in CH,CI, / EtOH (9~:5) was rotavaped to dryness
and
redissolved in 1 ml CH~CI, and 1 pl pyridine. To this solution was added 5.2
mg (2~
ymol) of DCC. and the mixture was injected into a membrane filter (MemSyn
Nucleic
Acid Synthesis Device, PerSeptive Biosystems) carrying the detritylated, fully
protected
2s Oligo 2. The reaction was left overnight while an insoluble white
precipitate formed
(most likely pyrophosphates). The liquid was removed and the membrane washed
several
times with CH,C1,. MeOH and H,O. ODN was cleaved from solid support /
deprotected
by the standard workup (aqueous NH3 30%, 55°C for 6 hours) and finally
resuspended in
200 yl H,O to yield raw Oligo 2 conjugate in a concentration of 203.1 pmol PI-
' (642.6
pg ml-'
In another embodiment of the present invention, Oligo 1 was conjugate with NHS-
PDA. A solution of NHS-PDA (6 pl , 0.24 mg. 508 nmol) NHS-PDA solution in
CH,CI,
(40 mg ml~') was dried and redissolved in 90 pl DMSO. Then, 70 pl Oligo 1
(0.26 ymol
- 108 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
ml-') and 10 ~l Na,CO; / NaHC03 buffer pH 9 (I M) were added to the solutioi:,
causing
the NHS-PDA to precipitate. The reaction mixture was kept at room temperature
overnight and then stored for two weeks at approximately 4°C. After
this period, the
mixture was diluted with 1000 fll of H,O and extracted five times with 500 pl
CH~CI,
(each time). The aqueous phase was speedvaced and redissolved in 100 pl HBO
yielding
the raw W001 (Oligo 1 conjugate) fraction (1~0.~ pmol pl-', 1304 ~g 1111-' ODN
+ NHS).
The buffer solution was prepared by mixing aqueous solutions of Na,CO; ( I M)
and
NaHCO; ( 1 M) in a ratio of 1:8.
In other experiments, the 27-mgr from the Bacillus globigii genome UCotDS' and
its complementary sequence UCotD3' (shown with a PDA-lipid conjug vin an amino
linker) were used as shown in Figure 34. The amino modification on the DNA
synthesizer and subsequent lipid conjugation is illustrated in Figure 49.
Modifications in
reaction parameters (i.c°.. prehydration of ODI~,T. DMSO/acetone as
solvent for NHS-PDA)
increased the yield of ODN-lipid.
l5 From each sequence an unmodified batch (UNahHsn), a 5' amino modified batch
(usin~.: ~~-Amino Modifier C6-TFA as in Figure 49, UNahHsnam), and a bis-amino
modified batch (primary amino groups at both ends, UNahHsnam2x) were
synthesized.
For the bis-amino modified ODN, an amino functionalized solid support was used
in the
synthesis. resulting in the bifunctional ODN shown in Figure 50.
In other experiments. NHS-PDA was conjugated with an amino-modified ODN.
An amino modified ODN (40-50 nmol) in 200 ul HBO was speed-vacuumed to
complete
dryness. then reh~~drated for ~30 min. with 5 X11 H,O, dissolved in 200 ~l
DMSO (~10 min.
llllxlll'~ time). To this solution was added 20 yl of 1M Na,/NaHCO; buffer, pH
9, and 40
yl of 0.7 mg NHS-PDA in 40 mI DMSO/acetone (I:l v/v). After ~24 hours, 400y1
H,O
were added and extracted five times with 400 ~1 CH,CI, each. The aqueous phase
was
speed-vacuumed and the solid resuspended in 200 pl HBO. Precipitation with n-
butanol
was accomplished by adding n-butanol (300 yl ) to ~30 pl ODN solution. The
solution
was shaken well and centrifuged at 14000 rpm for 10 minutes. The organic phase
was
carefully decanted from the pellet. 300 Etl ethanol (100%) was added and spun
at 14000
rpm for ~ min.. After the ethanol was decanted. the pellet was dryed in the
speed-vacuum
for --i minute.
In addition. [N-(6-aminohexyl)-p-azidobenzoic amido] was synthesized. N-
succinimidvl 4-azidobenzoate (250 mg. 0.95 mmol, ABA-NHS) was suspended in 2
ml
- 109 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029 .
CH,CI, (water bath cooling), and a solution of 550 mg (4.8 mmol)
hexamethylenediamine
in 2 ml CH,CI, was added. A white precipitate formed immediately and 4 ml
CH~CI, was
added and stirred for 30 min.. Then ~S ml HBO was added, upon which a stable
emulsion
formed. The organic phase was extracted several times with water, separated
from the
white solid at the interface and dried. This compound decomposes in solid form
at -18°C
over the period of several weeks, but it is stable in ethanolic solution ( 1
mM).
To purify the DNA from protecting groups and reaction side products, ethanol
precipitation was tested. SEQ2 was redissolved in 400 Pl HBO, followed by
addition of
140 pl aqueous NH~AcO (7.~ M, pH 5.2) and 1080 pl EtOH. The solution was
stored
overni~~lu at -20°C and centrifuged at 5 °C for 30 min / 14000 r
min-' the following day.
However. no precipitate was obtained. Further addition of 140 pl NH~AcO also
did not
result in a precipitate.
'hhe solution was concentrated again to 400 pl (via speed vac), and the DNA
concentration was found to be 430 pmol pl~' / 1314 p,g ml''. To remove salts
and other
1~ side products (e.g.. excess PDA), the SEQ2 solution was filtered through 1
ml Sephadex
G-2~ by spinning for 1 min at 1000 r miii' to obtain the fraction SEQ2 spin
c.s.p.B, with
a concentration of 221 pmol yl-' / 673 pg ml-'. Running another 200 yl TE
through the
column gave a second fraction SEQ2 spin c.s.p.B(TE) with 72 pmol E~l-' / 219
p.g ml-'.
The Sephadex G-2~ column itself was prepared just prior to use by clogging the
small
opening of a 1 1111 syringe with hydrophobized glass wool, and filling the
column with a
suspension of Sephadex G-2~ in TE (5 ml per 1 g G-25; TE: 10 mM Tris/HC1 + 1
mM
EDTA, pH 8). The syringe was repeatedly filled and spun for 30 s / 1000 r
miri' to pack
it with a total of 1 ml G-2~. Then the column was spun dry for 2- min /1000 r
mim'.
In one embodiment of the present invention, PDA (7.4 mg, 20 pmole) was
2, dissolved in 1 ml CH,CI_,, filtered through a 0.22 pm Teflon membrane to
remove
polymerized material. To the filtered PDA was added dicyclohexylcarbodiimide
(DCC.
4.1 m'=. 20 pmole). T'he 0.2 pm column with detritylated SEQ1 was washed with
2 ml
CH,CI,. and then the PDA reaction mixture was injected into the column
containing SEQI
by connecting two syringes at both ends of the column, and pushing the mixture
several
times back and forth. The reaction was allowed to proceed overnight at room
temperature.
The reaction mixture was removed the following day, and the column was flushed
with
mL portions of CH,Ch twice, followed by flushing with 2 mL portions of EtOH.
To
cleave the DNA from the column, 1 ml of cone. NH; solution (30%) was injected
and
- 110 -
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
pushed forth and back several times over the period of 1.5 h. Due to a leak,
0. S 1111 of the
NH; solution was lost after 15 min reaction time. After 1.5 h the remaining
solution was
transferred to a vial with a teflon-lined screw cap, which was sealed and
heated for 6
hours at 55°C. The solution was then transferred to an Eppendorf tube
and concentrated
S to dryness in a speed-vac centrifuge. The solid was dissolved in 200 pl H,O
and divided
into the following volumes: i) 50 pl SEQ1-PDA raw (433 pmol ~l-' / 1368 pg ml-
'); and
ii) 1~0 yl SEQ1-PDA raw, with further addition of 50 pl TE, and desalted
through
Sephadex G-2~ spin column (SEQ1-PDA s.c., 213 pmol pl-' / 672 wg ml-').
Through the
spin column another 200 pl TE was run to wash down remaining DNA (SEQ1-PDA
s.c.(TE). 52 pmol ~l~' / 163 pg ml-').
As a general procedure for hybridization, the two complementary DNA strands
(i.e.. SEQ-PDA and SEQ2) are mixed at 1 pg (each) in 100 wl H,O, heated for ~3
min in
boiling water and slowly cooled. For example. in one experiment 1 pl SEQ1-PDA
raw
(1368 yg ml-') and 2 pl SEQ2 spin c.s.p.B (673 p.g ml-') were mixed together
in 134 ~1
H,O, to give a final concentration of 10 ng pl-' (HybA). In another
experiment, 1.5 pl
SEQ1-PDA s.c. (672 p.g ml) and 1.5 pl SEQ2 spin c.s.p.B (673 ~g ml-') were
mixted
together in 97 pl H,O, to give a final concentration of 10 ng yl-' (HybB). A
water bath
was heated to boil in a microwave oven, then samples were immersed for 3 min,
taken
out, and allowed to cool on bench for 20 min at room temperature, and then
stored in
freezer. at -30°C. Following DNA hydridization, the PDA-DNA conjugate
were run on
eels for further characterization.
EXAMPLE 12
Colorimetric Detection of HIV-1 Using Nucleic Acid Ligand Hybridization
The following example illustrates the use of materials and methods of the
present
invention to detect target nucleic acid molecules in a sample suspected of
containing
nucleic acid associated with HIV-1. In particular, this example illustrates
the use of the
nucleic acid-linked biopolymeric materials of the present invention to detect
the presence
of HIV-1 in clinical samples using the methods of the present invention. The
procedure
described below is a modification of the reverse dot blot procedure described
in U.S. Pat.
x,599.662 to Respess (herein incorporated by reference), used to detect HIV-1.
The nucleic acid linked biopolymeric materials of this Example are prepared
according to Example 11. except a different nucleic acid ligand sequence
(probe) is used.
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/l4029
As in Respess. two different 35-mer probes are constructed (termed RAR 1034
and RAR
1037 by Respess). These sequences are synthesized by the standard
phosphramidite route
as described in Example 11. These 35-mer sequences are amino functionalized
and
reacted with NHS-PDA as described in Example 11, in order to covalently link
these
s sequences to the biopolymeric material of the present invention (i. e. ,
these sequence serve
as the nucleic acid ligands of the present invention). This biopolymeric
material is used to
detect HIV-1 as described below.
Clinical samples are obtained from subjects suspected of being infected with
HIV-1
by taking a blood sample, and isolating the peripheral blood monocytes by the
standard
Ficoll-Hypaque density gradient method described in Boyum (Boyum, Scan. .1.
Clin. Lab.
Invest.. 21 (Supp1.97):77 [1968]; herein incorporated by reference). Another
method
involves isolatinU the white blood cells from the blood sample by direct red
blood cell
lysis and DNA ewraction as described in Casareale et crl., (Casareale et ul.,
PCR Meth.
Appln.. 2:149-1 X3(1992]; herein incorporated by reference).
The next step involves amplifying the target HIV-1 DNA which may be present in
the clinical sample. This is done using two 33-mer primers (termed RAR 1032
and RAR
1033 by Respess) using standard PCR methodology. Unlike Respess, however, the
present
Example does not require the primers to be biotinylated in order to detect the
amplified
DNA.
Detection of amplified target DNA is then carried out using the nucleic acid-
linked
biopolymeric material described above. Clinical samples are added to eight-
microwell
plates containing the biopolymeric material immobilized to the surface of each
well for
about 30 minutes at 40 degrees Celsius (allowing hybridization to occur). The
presence of
HIV-1 DNA is indicated by visible color change of the biopolymeric material.
No wash
2~ step is necessary . as the presence of HIV-1 DNA alone is enough to cause a
detectable
color change in the biopolymeric material of the present invention. This is
contrasted to
Respess, which does require a wash step before developing the microwell with
the addition
of avidin-HRP conjugate (another step not required by the present invention).
As is clear from the above Example, the colorimetric materials and methods of
the
invention have many advantages for detecting the presence of DNA in a sample.
In
particular, this method allows the detection of amplified target DNA without
the need to
label the target DNA. This method also does not require a wash step, nor the
addition of
a developing solution (e.g.. avidin-HRP) in order to detect the presence of
target DNA.
_ 11~ _
CA 02330937 2000-12-12
WO 99/67423 PCT/US99/14029
EXAMPLE 13
Detection of Chorionic Gonadotropin Hormone
This Example demonstrates the usefulness of the methods and materials of the
present invention as applied to a home pregnancy test. In particular, this
Example
demonstrates the use of the nucleic acid-linked biopolymeric material of the
present
invention for the detection of human chorionic gonadotropin in urine for early
pregnancy
diagnosis.
Human chorionic gonadotropin (hCG) is a glycoprotein hormone synthesized by
the
placenta and released in blood and urine soon after the implantation of a
fertilized ovum in
111 the chorionic tissue. As such, the detection of hCG is widely used as a
pregnancy
indicator in home pregnancy tests (See, U.S. Pat. x,145,789, herein
incorporated by
reference).
The nucleic acid linked biopolymeric materials of this Example are prepared
according to Example 11, except a different nucleic acid ligand is used. The
nucleic acid
1 s ligand in this Example must have affinity for hCCr in order to be useful
in a home
pregnancy test. One method for identifying such nucleic acid ligands is the
SELEX
procedure described above. The basic SELEX procedure is described in U.S. Pat.
Nos.
~.47~,096: x.270.163; and x,475,096; and in PCT publications WO 97/38134, WO
98/33941. and WO 99/07724, all of which are herein incorporated by reference.
The
20 SELEX procedure allows identification of a nucleic acid molecules with
unique sequences.
each of which has the property of binding specifically to a desired target
analyte or
molecule. This procedure was used by Drolet et al (U.S. Pat. 5,874,218; herein
incorporated by reference) in order to find a nucleic acid ligand that
specifically bound to
hCG. This nucleic acid sequence is called H-42 RNA by Drolet et al., and can
be
2~ synthesized by the standard phosphramidite route as described in Example
11, or isolated
by emplovin~J the SELEX procedure. This hCG specific nucleic acid ligand is
amino-
functionalized and reacted with NHS-PDA as described in Example 11 in order to
covalentlv link these sequences to the biopolymeric material of the present
invention (i.c~..
these seduence serve as the nucleic acid ligands of the present invention).
This
30 biopolymeric material is used to detect hCG for home pregnancy tests as
described below.
TMe biopolvmeric material is then immobilized to a solid support, such as
nylon
filter paper. in order to construct a home pregnancy testing device. An
example of such
device is described in U.S Pat. No. 5,145,789 to Corti et al., except the
nylon filter paper
- 113 -
CA 02330937 2000-12-12
WO 99/67423 PCTNS99/14029
is produced as described above. Although the device of the present invention
is employed
in basically the same manner as Corti et al., the biopolymeric material of the
present
invention changes from one distinct color to another in the presence of urine
or blood
containing hCG. a feature of the present invention that provides various
advantages (e.g.,
S ease of reading). that are lacking in the Corti et ul. device. The presence
of hCG is
detected by hCG binding to the nucleic acid ligands linked to the biopolymeric
material of
the present invention which causes a color change in biopolymeric material.
Thus, the
present invention provides an easy to use device that is easy to read and
analyze, suitable
for point-of care, and/or home testing.
- 11 ~1 -
