Note: Descriptions are shown in the official language in which they were submitted.
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
HUMAN SCAD-RELATED MOLECULES, SCRM-i AND SCRM-2
TECHNICAL FIELD
This invention relates to nucleic acid and amino acid sequences of SCAD-
related
molecules and to the use of these sequences in the diagnosis, treatment, and
prevention of
cell proliferative and immune disorders.
BACKGROUND OF THE INVENTION
l0 The short-chain alcohol dehydrogenases (SCADS) are a diverse family of
oxidoreductase enzymes. SCAD family members are involved in all aspects of
cell
biochemistry and physiology, including metabolism of sugar, synthesis or
degradation of
fatty acids, and synthesis or degradation of glucocorticoids, estrogens,
androgens, and
prostaglandins E, and FZa. SCADs are found in bacteria, plants, invertebrates,
and
15 vertebrates. Alignment of the different family members reveals large
homologous regions
and clustered similarities indicating sites of structural and functional
importance. Some of
these sites are associated with a type of coenzyme-binding domain, although
similarity
between family members can extend beyond this domain. Family members typically
show
only about 15% to 30% identity between enzyme pairs. Over one third of the
conserved
20 residues are glycine residues, showing the importance of conformational and
spatial
restrictions. (Baker, M.E. (1995) Biochem. J. 309:1029-1030; and Jornvall, H.
et al.
( 1995) Biochemistry 34:6003-6013.)
Members of the SCAD family differ in substrate specificity, tissue
distribution, and
subcellular location. For example, rat retinol dehydrogenase, which catalyzes
the rate
25 limiting step in retinoic acid synthesis, is located in microsomes, while
2, 4-dienoyl-CoA
reductase, which is involved in breakdown of unsaturated fatty acids, is
located in
mitochondria. Hep27, recently identified as a member of the SCAD family, is
located in
the nucleus. interestingly, Hep27 is upregulated in growth-arrested human
hepatoblastoma (HepG2) cells. Resumption of DNA synthesis in these cells
results in a
3o down-regulation of the Hep27 protein. This suggests a role for SCAD family
members in
cell proliferation and cancer. (Gabrielli, F. et al. (1995) Eur. J. Biochem.
232, 473-477.)
SCAD involvement in fatty acid and steroid metabolism implicates members of
the
-1-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/1b164
SCAD family in a variety of disorders. Steroid dehydrogenases, such as the
hydroxysteroid dehydrogenases, are involved in hypertension, fertility, and
cancer. (Duax,
W.L. and Ghosh, D. (1997) Steroids 62:95-100.) Retinoic acid, a regulator of
differentiation and apoptosis, has been shown to down-regulate genes involved
in cell
proliferation and inflammation. (Chaff, X. et al. (1995) J. Biol. Chem.
270:3900-3904.)
Such differences in distribution and substrate specificity are presumably due
to the unique
segments contained within each family member. (Jornvall, supra.)
SCAD family members share two conserved structural motifs. One motif consists
of a
tyrosine and a lysine separated by any three amino acid residues. This motif
is typically located at
about residue I 50 in a 250-residue dehydrogenase. The tyrosine and lysine
residues are likely to
be important in catalysis. Support for the importance of these two residues
comes from
mutagenesis studies with Drosoohila alcohol dehydrogenase. human 15-
hydroxyprostaglandin
dehydrogenase, and human 11 (3-hydroxysteroid and 17-(3-hydroxysteroid
dehydrogenases.
(Baker, sUpf'd.)
The other motif shared by SCAD family members consists of an adenosine
monophosphate (AMP)-binding domain. This motif is typically located near the N-
terminus and
consists of a hydrophobic pocket containing three glycine residues in a seven
amino acid
sequence. (Baker, su ra.)
Variation in both the pentapeptide catalytic motif and the AMP-binding domain
can exist
between family members, though these changes do not seem to affect the
activity of these
proteins. For example, the tyrosine residue in the pentapeptide motif is
replaced by a methionine
in E. coli enoyl-acyl-carrier protein (EnvM), by serine in human 2,4-dienoyl-
CoA reductase, and
by valine in S. cerevisiae sporulation specific protein (SPX 19). Some members
of this group also
have differences in the AMP-binding domain, including an insertion of two
residues and poor
conservation in one of the three glycine residues. (Baker, supra.)
The discovery of new SCAD-related molecules and the polynucleotides encoding
them
satisfies a need in the art by providing new compositions which are useful in
the diagnosis,
treatment, and prevention of cell proliferative and immune disorders.
SUMMARY OF THE INVENTION
The invention features substantially purified polypeptides, SCAD-related
molecules,
referred to collectively as "ScRM" and individually as "ScRM-1" and "ScRM-2."
In one aspect,
the invention provides a substantially purified polypeptide comprising an
amino acid sequence
selected from the group consisting of SEQ ID NO:1, SEQ ID N0:2, a fragment of
SEQ ID NO:1,
_2_
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
and a fragment of SEQ ID N0:2.
The invention further provides a substantially purified variant having at
feast 90% amino
acid identity to the amino acid sequences of SEQ ID NO: I or SEQ ID N0:2, or
to a fragment of
either of these sequences. The invention also provides an isolated and
purified polynucleotide
encoding the polypeptide comprising an amino acid sequence selected from the
group consisting
of SEQ 1D NO: I, SEQ ID N0:2, a fragment of SEQ ID NO:1, and a fragment of SEQ
ID N0:2.
The invention also includes an isolated and purified polynucleotide variant
having at least 90%
polynucleotide sequence identity to the polynucleotide encoding the
polypeptide comprising an
amino acid sequence selected from the group consisting of SEQ ID NO: I, SEQ ID
N0:2, a
fragment of SEQ ID NO: I, and a fragment of SEQ ID N0:2.
Additionally, the invention provides an isolated and purified polynucleotide
which
hybridizes under stringent conditions to the polynucleotide encoding the
polypeptide comprising
an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ
ID N0:2, a
fragment of SEQ ID NO: I, and a fragment of SEQ ID N0:2, as well as an
isolated and purified
polynucleotide having a sequence which is complementary to the polynucleotide
encoding the
poiypeptide comprising the amino acid sequence selected from the group
consisting of SEQ 1D
NO: I, SEQ ID N0:2, a fragment of SEQ ID NO:1, and a fragment of SEQ ID N0:2.
The invention also provides an isolated and purified polynucleotide comprising
a
polynucleotide sequence selected from the group consisting of SEQ ID N0:3, SEQ
ID N0:4, a
fragment of SEQ ID N0:3, and a fragment of SEQ ID N0:4. The invention further
provides an
isolated and purified polynucleotide variant having at least 90%
polynucleotide sequence identity
to the polynucleotide sequence comprising a polynucleotide sequence selected
from the group
consisting of SEQ ID N0:3, SEQ ID N0:4, a fragment of SEQ ID N0:3, and a
fragment of SEQ
ID N0:4, as well as an isolated and purified polynucleotide having a sequence
which is
complementary to the polynucleotide comprising a polynucleotide sequence
selected from the
group consisting of SEQ ID N0:3, SEQ ID N0:4, a fragment of SEQ ID N0:3, and a
fragment of
SEQ ID N0:4.
The invention further provides an expression vector containing ai least a
fragment of the
polynucleotide encoding the polypeptide comprising an amino acid sequence
selected from the
group consisting of SEQ ID NO:1, SEQ ID N0:2, a fragment of SEQ ID NO:1, and a
fragment of
SEQ ID N0:2. In another aspect, the expression vector is contained within a
host cell.
The invention also provides a method for producing a polypeptide comprising an
amino
acid sequence selected from the group consisting of SEQ ID NO: l, SEQ ID N0:2,
a fragment of
SEQ ID NO:1, and a fragment of SEQ ID N0:2, the method comprising the steps of
(a) culturing
the host cell containing an expression vector containing at least a fragment
of a polynucleotide
-3-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
encoding the polypeptide under conditions suitable for the expression of the
polypeptide: and (b)
recovering the polypeptide from the host cell culture.
The invention also provides a pharmaceutical composition comprising a
substantially
purified polypeptide having an amino acid sequence selected from the group
consisting of SEQ ID
NO:1, SEQ ID N0:2, a fragment of SEQ ID NO:1, and a fragment of SEQ ID N0:2 in
conjunction with a suitable pharmaceutical carrier.
The invention further includes a purified antibody which binds to a
polypeptide
comprising an amino acid sequence selected from the group consisting of SEQ ID
NO: I, SEQ ID
N0:2, a fragment of SEQ ID NO:1, and a. fragment of SEQ ID N0:2, as well as a
purified agonist
and a purified antagonist to the polypeptide.
The invention also provides a method for treating or preventing an immune
disorder, the
method comprising administering to a subject in need of such treatment an
effective amount of a
pharmaceutical composition comprising a substantially purified polypeptide
having an amino acid
sequence selected from the group consisting of SEQ ID NO:1, SEQ ID N0:2, a
fragment of SEQ
IS ID NO:I, and a fragment of SEQ ID N0:2.
The invention also provides a method for treating or preventing a cell
proliferative
disorder, the method comprising administering to a subject in need of such
treatment an effective
amount of a pharmaceutical composition comprising a substantially purified
polypeptide having an
amino acid sequence selected from the group consisting of SEQ ID NO: I, SEQ ID
N0:2, a
fragment of SEQ tD NO:1, and a fragment of SEQ ID N0:2.
The invention also provides a method for detecting a polynucleotide encoding
the
polypeptide comprising an amino acid sequence selected from the group
consisting of SEQ ID
NO:1, SEQ ID N0:2, a fragment of SEQ ID NO:1, and a fragment of SEQ ID N0:2 in
a biological
sample containing nucleic acids, the method comprising the steps of: {a)
hybridizing the
complement of the polynucleotide sequence encoding the polypeptide comprising
an amino acid
sequence selected from the group consisting of SEQ ID NO: I, SEQ ID N0:2, a
fragment of SEQ
ID NO:1, and a fragment of SEQ ID N0:2 to at least one of the nucleic acids of
the biological
sample, thereby forming a hybridization complex; and (b) detecting the
hybridization complex,
wherein the presence of the hybridization complex correlates with the presence
of a
polynucleotide encoding the polypeptide in the biological sample. In one
aspect, the method
further comprises amplifying the polynucleotide prior to hybridization.
_q_
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
BRIEF DESCRIPTION OF THE FIGURES AND TABLE
Figures 1 A, ! B, 1 C, and 1 D show the amino acid sequence (SEQ ID NO: i )
and nucleic
acid sequence (SEQ ID N0:3) of ScRM-1. The alignment was produced using
MacDNASIS
PROTM software (Hitachi Software Engineering Co. Ltd., San Bruno, CA).
Figures 2A, 2B, 2C, 2D, 2E, and 2F show the amino acid sequence (SEQ ID N0:2)
and
nucleic acid sequence (SEQ ID N0:4) of ScRM-2. The alignment was produced
using
MacDNASIS PROTM software.
Figures 3A and 3B show the amino acid sequence alignment between ScRM-1
(Incyte
Clone 1240869; SEQ ID NO:1 ) and human Hep27 (GI 1079566; SEQ ID NO:S),
produced using
the multisequence alignment program of LASERGENETM software (DNASTAR Inc,
Madison
WI).
Figures 4A, 4B, 4C, 4D, and 4E show the amino acid sequence alignment between
ScRM-
2 (lncyte Clone 2060002; SEQ ID N0:2) and C. elegans alcohol
dehydrogenase/ribitol
dehydrogenase (GI 2731377; SEQ ID N0:6), produced using the multisequence
alignment
IS program of LASERGENETM software.
Table I shows the programs used to identify and characterize ScRM, and
provides
relevant descriptions, references, and threshold parameters.
DESCRIPTION OF THE INVENTION
Before the present proteins, nucleotide sequences, and methods are described,
it is
understood that this invention is not limited to the particular methodology,
protocols, cell lines,
vectors, and reagents described, as these may vary. It is also to be
understood that the terminology
used herein is for the purpose of describing particular embodiments only, and
is not intended to
limit the scope of the present invention which will be limited only by the
appended claims.
It must be noted that as used herein and in the appended claims, the singular
forms "a,"
"an," and "the" include plural reference unless the context clearly dictates
otherwise. Thus, for
example, a reference to "a host cell" includes a plurality of such host cells,
and a reference to "an
antibody" is a reference to one or more antibodies and equivalents thereof
known to those skilled
in the art, and so forth.
Unless defined otherwise, all technical and scientific terms used herein have
the same
meanings as commonly understood by one of ordinary skill in the art to which
this invention
belongs. Although any methods and materials similar or equivalent to those
described herein can
be used in the practice or testing of the present invention, the preferred
methods, devices, and
materials are now described. All publications mentioned herein are cited for
the purpose of
describing and disclosing the cell lines, vectors, and methodologies which are
reported in the
-5-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
publications and which might be used in connection with the invention. Nothing
herein is to be
construed as an admission that the invention is not entitled to antedate such
disclosure by virtue of
prior invention.
DEFINITIONS
"ScRM," as used herein, refers to the amino acid sequences, or variant
thereof, of
substantially purified ScRM obtained from any species, particularly a
mammalian species,
including bovine, ovine, porcine, murine, equine, and preferably the human
species, from any
source, whether natural, synthetic, semi-synthetic, or recombinant.
The term "agonist," as used herein, refers to a molecule which, when bound to
ScRM,
increases or prolongs the duration of the effect of ScRM. Agonists may include
proteins, nucleic
acids, carbohydrates, or any other molecules which bind to and modulate the
effect of ScRM.
An ''allelic variant,'' as this term is used herein, is an alternative form of
the gene encoding
ScRM. Allelic variants may result from at least one mutation in the nucleic
acid sequence and
IS may result in altered mRNAs or in polypeptides whose structure or function
may or may not be
altered. Any given natural or recombinant gene may have none, one, or many
allelic forms.
Common mutational changes which give rise to allelic variants are generally
ascribed to natural
deletions, additions, or substitutions of nucleotides. Each of these types of
changes may occur
alone, or in combination with the others, one or more times in a given
sequence.
"Altered" nucleic acid sequences encoding ScRM, as described herein, include
those
sequences with deletions, insertions, or substitutions of different
nucleotides, resulting in a
polynucleotide the same as ScRM or a polypeptide with at least one functional
characteristic of
ScRM. Included within this definition are polymorphisms which may or may not
be readily
detectable using a particular oligonucleotide probe of the polynucleotide
encoding ScRM, and
improper or unexpected hybridization to allelic variants, with a locus other
than the normal
chromosomal locus for the polynucleotide sequence encoding ScRM. The encoded
protein may
also be "altered," and may contain deletions, insertions, or substitutions of
amino acid residues
which produce a silent change and result in a functionally equivalent ScRM.
Deliberate amino
acid substitutions may be made on the basis of similarity in polarity, charge,
solubility,
hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues,
as long as the
biological or immunological activity of ScRM is retained. For example,
negatively charged amino
acids may include aspartic acid and glutamic acid, positively charged amino
acids may include
lysine and arginine, and amino acids with uncharged polar head groups having
similar
hydrophilicity values may include leucine, isoleucine, and valine; glycine and
alanine; asparagine
and glutamine; serine and threonine; and phenylalanine and tyrosine.
-6-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/161b4
The terms "amino acid" or "amino acid sequence," as used herein, refer to an
oligopeptide, peptide, polypeptide, or protein sequence, or a fragment of any
of these, and to
naturally occurring or synthetic molecules. In this context, "fragments,"
"immunogenic
fragments," or "antigenic fragments" refer to fragments of ScRM which are
preferably at least 5 to
about 15 amino acids in length, most preferably at least 14 amino acids, and
which retain some
biological activity or immunological activity of ScRM. Where ''amino acid
sequence" is recited
herein to refer to an amino acid sequence of a naturally occur ing protein
molecule, "amino acid
sequence" and like terms are not meant to limit the amino acid sequence to the
complete native
amino acid sequence associated with the recited protein molecule.
l0 "Amplification," as used herein, relates to the production of additional
copies of a nucleic
acid sequence. Amplification is generally carried out using polymerase chain
reaction (PCR)
technologies well known in the art. (See, e.g., Dieffenbach, C. W. and G.S.
Dveksler ( 1995) PCB
Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, pp.l-5.)
The term "antagonist," as it is used herein, refers to a molecule which, when
bound to
IS ScRM, decreases the amount or the duration of the effect of the biological
or immunological
activity of ScRM. Antagonists may include proteins, nucleic acids,
carbohydrates, antibodies, or
any other molecules which decrease the effect of ScRM.
As used herein, the term "antibody" refers to intact molecules as well as to
fragments
thereof, such as Fab, F(ab')2, and Fv fragments, which are capable of binding
the epitopic
20 determinant. Antibodies that bind ScRM polypeptides can be prepared using
intact polypeptides
or using fragments containing small peptides of interest as the immunizing
antigen. The
polypeptide or oligopeptide used to immunize an animal (e.g., a mouse, a rat,
or a rabbit) can be
derived from the translation of RNA, or synthesized chemically, and can be
conjugated to a carrier
protein if desired. Commonly used carriers that are chemically coupled to
peptides include bovine
25 serum albumin, thyrogiobulin, and keyhole limpet hemocyanin (ICLH). The
coupled peptide is
then used to immunize the animal.
The term "antigenic determinant," as used herein, refers to that fragment of a
molecule
(i.e., an epitope) that makes contact with a particular antibody. When a
protein or a fragment of a
protein is used to immunize a host animal, numerous regions of the protein may
induce the
30 production of antibodies which bind specifically to antigenic determinants
(given regions or three-
dimensional structures on the protein). An antigenic determinant may compete
with the intact
antigen (i.e., the immunogen used to elicit the immune response) for binding
to an antibody.
The team "antisense," as used herein, refers to any composition containing a
nucleic acid
sequence which is complementary to the "sense" strand of a specific nucleic
acid sequence.
35 Antisense molecules may be produced by any method including synthesis or
transcription. Once
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
introduced into a cell, the complementary nucleotides combine with natural
sequences produced
by the cell to form duplexes and to block either transcription or translation.
The designation
"negative" can refer to the antisense strand, and the designation "positive"
can refer to the sense
strand.
As used herein, the term "biologically active," refers to a protein having
structural,
regulatory, or biochemical functions of a naturally occurring molecule.
Likewise,
"immunologically active" refers to the capability of the natural, recombinant,
or synthetic ScRM,
or of any oligopeptide thereof, to induce a specific immune response in
appropriate animals or
cells and to bind with specific antibodies.
The terms "complementary" or "complementarily," as used herein, refer to the
natural
binding of polynucleotides by base pairing. For example, the sequence "5' A-G-
T 3"' binds to the
complementary sequence "3' T-C-A 5'." Complementarily between two single-
stranded molecules
may be "partial," such that only some of the nucleic acids bind, or it may be
"complete," such that
total complementarily exists between the single stranded molecules. The degree
of
complementarily between nucleic acid strands has significant effects on the
efficiency and strength
ofthe hybridization between the nucleic acid strands. This is of particular
importance in
amplification reactions, which depend upon binding between nucleic acids
strands, and in the
design and use of peptide nucleic acid (PNA) molecules.
A "composition comprising a given polynucleotide sequence" or a "composition
comprising a given amino acid sequence," as these terms are used herein, refer
broadly to any
composition containing the given polynucleotide or amino acid sequence. The
composition may
comprise a dry formulation or an aqueous solution. Compositions comprising
polynucleotide
sequences encoding ScRM or fragments of ScRM may be employed as hybridization
probes. The
probes may be stored in freeze-dried form and may be associated with a
stabilizing agent such as a
carbohydrate. In hybridizations, the probe may be deployed in an aqueous
solution containing
salts, e.g., NaCI, detergents, e.g.,sodium dodecyl sulfate (SDS), and other
components, e.g.,
Denhardt's solution, dry milk, salmon sperm DNA, etc.
"Consensus sequence." as used herein, refers to a nucleic acid sequence which
has been
resequenced to resolve uncalled bases, extended using XL-PCRTM (The Perkin-
Elmer Corp.,
Norwalk, CT) in the 5' and/or the 3' direction, and resequenced, or which has
been assembled from
the overlapping sequences of more than one Incyte Clone using a computer
program for fragment
assembly, such as the GELVIEWTM Fragment Assembly system (GCG, Madison, WI).
Some
sequences have been both extended and assembled to produce the consensus
sequence.
As used herein, the term "correlates with expression of a polynucleotide"
indicates that the
detection of the presence of nucleic acids, the same or related to a nucleic
acid sequence encoding
_g_
CA 02333471 2001-O1-15
WO 00/04135 PCT/tJS99116164
ScRM, by Northern analysis is indicative of the presence of nucleic acids
encoding ScRM in a
sample, and thereby correlates with expression of the transcript from the
polynucleotide encoding
ScRM.
A "deletion," as the term is used herein, refers to a change in the amino acid
or nucleotide
sequence that results in the absence of one or more amino acid residues or
nucleotides.
The term "derivative," as used herein, refers to the chemical modification of
a polypeptide
sequence, or a polynucleotide sequence. Chemical modifications of a
polynucleotide sequence
can include, for example, replacement of hydrogen by an alkyl, acyl, or amino
group. A
derivative poiynucleotide encodes a polypeptide which retains at least one
biological or
immunological function of the natural molecule. A derivative polypeptide is
one modified by
glycosylation, pegylation, or any similar process that retains at least one
biological or
immunological function of the polypeptide from which it was derived.
The term "similarity," as used herein, refers to a degree of complementarily.
There may
be partial similarity or complete similarity. The word "identity" may
substitute for the word
"similarity." A partially complementary sequence that at least partially
inhibits an identical
sequence from hybridizing to a target nucleic acid is referred to as
''substantially similar." The
inhibition of hybridization of the completely complementary sequence to the
target sequence may
be examined using a hybridization assay (Southern or Northern blot, solution
hybridization, and
the like) under conditions of reduced stringency. A substantially similar
sequence or hybridization
probe wiif compete for and inhibit the binding of a completely similar
(identical) sequence to the
target sequence under conditions of reduced stringency. This is not to say
that conditions of
reduced stringency are such that non-specific binding is permitted, as reduced
stringency
conditions require that the binding of two sequences to one another be a
specific (i.e., a selective)
interaction. The absence of non-specific binding may be tested by the use of a
second target
sequence which lacks even a partial degree of complementarily (e.g., less than
about 30%
similarity or identity). In the absence of non-specific binding, the
substantially similar sequence
or probe will not hybridize to the second non-complementary target sequence.
The phrases "percent identity" or "% identity" refer to the percentage of
sequence
similarity found in a comparison of two or more amino acid or nucleic acid
sequences. Percent
identity can be determined electronically, e.g., by using the MegAlignTM
program (DNASTAR,
Inc., Madison WI). The MegAlignTM program can create alignments between two or
more
sequences according to different methods, e.g., the clustal method. (See,
e.g., Higgins, D.G. and
P.M. Sharp (1988) Gene 73:237-244.) The ciustal algorithm groups sequences
into clusters by
examining the distances between all pairs. The clusters are aligned pairwise
and then in groups.
The percentage similarity between two amino acid sequences, e.g., sequence A
and sequence B, is
_g_
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
calculated by dividing the length of sequence A, minus the number of gap
residues in sequence A,
minus the number of gap residues in sequence B, into the sum of the residue
matches between
sequence A and sequence B, times one hundred. Gaps of low or of no similarity
between the two
amino acid sequences are not included in determining percentage similarity.
Percent identity
between nucleic acid sequences can also be counted or calculated by other
methods known in the
art, e.g., the Jotun Hein method. (See, e.g., Hein, J. ( 1990) Methods
Enzymol. 183:626-645.)
Identity between sequences can also be determined by other methods known in
the art, e.g., by
varying hybridization conditions.
"Human artificial chromosomes" (HACs), as described herein, are linear
microchromosomes which may contain DNA sequences of about 6 kb to 10 Mb in
size, and which
contain all of the elements required for stable mitotic chromosome segregation
and maintenance.
(See, e.g., Harrington, J.J. et al. ( 1997) Nat Genet. 15:345-355.)
The term ''humanized antibody," as used herein, refers to antibody molecules
in which the
amino acid sequence in the non-antigen binding regions has been altered so
that the antibody more
IS closely resembles a human antibody, and still retains its original binding
ability.
"Hybridization," as the term is used herein, refers to any process by which a
strand of
nucleic acid binds with a complementary strand through base pairing.
As used herein, the term "hybridization complex" refers to a complex formed
between two
nucleic acid sequences by virtue of the formation of hydrogen bonds between
complementary
bases. A hybridization complex may be formed in solution (e.g., Cot or Rflt
analysis) or formed
between one nucleic acid sequence present in solution and another nucleic acid
sequence
immobilized on a solid support (e.g., paper, membranes, filters, chips, pins
or glass slides, or any
other appropriate substrate to which cells or their nucleic acids have been
fixed).
The words "insertion" or "addition," as used herein, refer to changes in an
amino acid or
nucleotide sequence resulting in the addition of one or more amino acid
residues or nucleotides,
respectively, to the sequence found in the naturally occurring molecule.
"Immune response" can refer to conditions associated with inflammation,
trauma, immune
disorders, or infectious or genetic disease, etc. These conditions can be
characterized by
expression of various factors, e.g., cytokines, chemokines, and other
signaling molecules, which
may affect cellular and systemic defense systems.
The term "microarray," as used herein, refers to an arrangement of distinct
polynucleotides arrayed on a substrate, e.g., paper, nylon or any other type
of membrane, filter,
chip, glass slide, or any other suitable solid support.
The terms "element" or "array element" as used herein in a microarray context,
refer to
hybridizable polynucleotides arranged on the surface of a substrate.
-l0-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
The tenor "modulate," as it appears herein, refers to a change in the activity
of ScRM. For
example, modulation may cause an increase or a decrease in protein activity,
binding
characteristics, or any other biological, functional, or immunological
properties of ScRM.
The phrases "nucleic acid" or "nucleic acid sequence," as used herein, refer
to a
nucleotide, oligonucleotide, polynucleotide, or any fragment thereof. These
phrases also refer to
DNA or RNA of genomic or synthetic origin which may be single-stranded or
double-stranded
and may represent the sense or the antisense strand, to peptide nucleic acid
(PNA), or to any
DNA-like or RNA-like material. In this context, "fragments" refers to those
nucleic acid
sequences which, comprise a region of unique polynucleotide sequence that
specifccally identifies
SEQ ID N0:3, SEQ ID N0:4, for example, as distinct from any other sequence in
the same
genome. For example, a fragment of SEQ ID N0:3, SEQ ID N0:4 is useful in
hybridization and
amplification technologies and in analogous methods that distinguish SEQ ID
N0:3, SEQ ID
N0:4 from related polynucleotide sequences. A fragment of SEQ ID N0:3, SEQ ID
N0:4 is at
least about 15-20 nucleotides in length. The precise length of the fragment of
SEQ ID N0:3, SEQ
ID N0:4 and the region of SEQ ID N0:3, SEQ ID N0:4 to which the fragment
corresponds are
routinely determinable by one of ordinary skill in the art based on the
intended purpose for the
fragment. In some cases, a fragment, when translated, would produce
polypeptides retaining some
functional characteristic, e.g., antigenicity, or structural domain
characteristic, e.g., ATP-binding
site, of the full-length polypeptide.
The terms "operably associated" or "operably linked," as used herein, refer to
functionally
related nucleic acid sequences. A promoter is operably associated or operably
linked with a
coding sequence if the promoter controls the translation of the encoded
polypeptide. While
operably associated or operably linked nucleic acid sequences can be
contiguous and in the same
reading frame, certain genetic elements, e.g., repressor genes, are not
contiguously linked to the
sequence encoding the polypeptide but still bind to operator sequences that
control expression of
the polypeptide.
The term "oligonucleotide," as used herein, refers to a nucleic acid sequence
of at least
about 6 nucleotides to 60 nucleotides, preferably about 15 to 30 nucleotides,
and most preferably
about 20 to 25 nucleotides, which can be used in PCR amplification or in a
hybridization assay or
microarray. As used herein, the term "oligonucleotide" is substantially
equivalent to the terms
"amplimer," "primer," "oligomer," and "probe," as these terms are commonly
defined in the art.
"Peptide nucleic acid" (PNA), as used herein, refers to an antisense molecule
or anti-gene
agent which comprises an oligonucleotide of at least about 5 nucleotides in
length linked to a
peptide backbone of amino acid residues ending in lysine. The terminal lysine
confers solubility
to the composition. PNAs preferentially bind complementary single stranded DNA
or RNA and
-11-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
stop transcript elongation, and may be pegylated to extend their lifespan in
the cell. (See, e.g.,
Nielsen, P.E. et al. ( 1993) Anticancer Drug Des. 8:53-63.)
The term "sample," as used herein, is used in its broadest sense. A biological
sample
suspected of containing nucleic acids encoding ScRM, or fragments thereof, or
ScRM itself, may
comprise a bodily fluid; an extract from a cell, chromosome, organelle, or
membrane isolated from
a cell; a cell; genomic DNA, 1L~IA, or cDNA, in solution or bound to a solid
support; a tissue; a
tissue print; etc.
As used herein, the terms ''specific binding" or "specifically binding" refer
to that
interaction between a protein or peptide and an agonist, an antibody, or an
antagonist. The
interaction is dependent upon the presence of a particular structure of the
protein, e.g., the
antigenic determinant or epitope, recognized by the binding molecule. For
example, if an antibody
is specific for epitope "A," the presence of a polypeptide containing the
epitope A, or the presence
of free unlabeled A, in a reaction containing free labeled A and the antibody
will reduce the
amount of labeled A that binds to the antibody.
As used herein, the term "stringent conditions" refers to conditions which
permit
hybridization between polynucleotides and the claimed polynucleotides.
Stringent conditions can
be defined by salt concentration, the concentration of organic solvent, e.g.,
formamide,
temperature, and other conditions well known in the art. In particular,
stringency can be increased
by reducing the concentration of salt, increasing the concentration of
formamide, or raising the
hybridization temperature.
The term "substantially purified," as used herein, refers to nucleic acid or
amino acid
sequences that are removed from their natural environment and are isolated or
separated, and are
at least about 60% free, preferably about 75% free, and most preferably about
90% free from other
components with which they are naturally associated.
A "substitution," as used herein, refers to the replacement of one or more
amino acids or
nucleotides by different amino acids or nucleotides, respectively.
"Transformation," as defined herein, describes a process by which exogenous
DNA enters
and changes a recipient cell. Transformation may occur under natural or
artificial conditions
according to various methods well known in the art, and may rely on any known
method for the
insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic
host cell. The method
for transformation is selected based on the type of host cell being
transformed and may include,
but is not limited to, viral infection, electroporation, heat shock,
lipofection, and particle
bombardment. The term "transformed" cells includes stably transformed cells in
which the
inserted DNA is capable of replication either as an autonomously replicating
plasmid or as part of
the host chromosome, as well as transiently transformed cells which express
the inserted DNA or
-12-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
RNA for limited periods of time.
A "variant" of ScRM polypeptides, as used herein, refers to an amino acid
sequence that is
altered by one or more amino acid residues. The variant may have
"conservative" changes,
wherein a substituted amino acid has similar structural or chemical properties
(e.g., replacement of
leucine with isoleucine). More rarely, a variant may have ''nonconservative"
changes (e.g.,
replacement of glycine with tryptophan). Analogous minor variations may also
include amino
acid deletions or insertions, or both. Guidance in determining which amino
acid residues may be
substituted, inserted, or deleted without abolishing biological or
immunological activity may be
found using computer programs well known in the art, for example, LASERGENET'"
software.
The term "variant," when used in the context of a polynucleotide sequence, may
encompass a polynucleotide sequence related to ScRM. This definition may also
include, for
example, ''allelic" (as defined above), "splice," "species," or "polymorphic"
variants. A splice
variant may have significant identity to a reference molecule, but will
generally have a greater or
lesser number of polynucleotides due to alternate splicing of exons during
mRNA processing. The
corresponding polypeptide may possess additional functional domains or an
absence of domains.
Species variants are polynucleotide sequences that vary from one species to
another. The resulting
polypeptides generally wilt have significant amino acid identity relative to
each other. A
polymorphic variant is a variation in the polynucleotide sequence of a
particular gene between
individuals of a given species. Polymorphic variants also may encompass
"single nucleotide
polymorphisms" (SNPs) in which the polynucleotide sequence varies by one base.
The presence
of SNPs may be indicative of, for example, a certain population, a disease
state, or a propensity for
a disease state.
THE INVENTION
, The invention is based on the discovery of new human SCAD-related molecules
(ScRM),
the polynucleotides encoding ScRM, and the use of these compositions for the
diagnosis,
treatment, or prevention of cell proliferative and immune disorders.
Nucleic acids encoding the ScRM-1 of the present invention were first
identified in Incyte
Clone 1240869 from the lung cDNA library (LUNGNOT03) using a computer search,
e.g.,
BLAST, for amino acid sequence alignments. A consensus sequence, SEQ ID N0:3,
was derived
from the following overlapping and/or extended nucleic acid sequences: Incyte
Clones
1240869H1 (LUNGNOT03), 39629381 and 396293F1 (PITUNOT02), 1382578F1
(BRAITUT08), and 1806716F6 (SINTNOT13).
In one embodiment, the invention encompasses a polypeptide comprising the
amino acid
sequence of SEQ ID NO:I, as shown in Figures lA, iB, 1C, and 1D. ScRM-1 is 278
amino acids
-13-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
in length and has three potential casein kinase II phosphorylation sites at
residues T25, 5125, and
5232; eight potential protein kinase C phosphorylation sites at residues S 16,
S2I, T25, T31, 562,
563, S232. and T236; and a short-chain alcohol dehydrogenase family signature
sequence from
residue S 169 through A 197. BLOCKS analysis identifies short-chain alcohol
dehydrogenase
motifs from residues K33 through G45, G 108 through A I 18, G 162 through E
199, and N204
through 6213. PRINTS analysis identifies glucose/ribitol dehydrogenase motifs
from residues
V34 through 851, G 108 through V 119, M 156 through A 172, Y 182 through A201,
8203 through
S220, and 8238 through E258; and short-chain alcohol dehydrogenase motifs from
residues 6108
through V119, and Y182 through A201. ProfileScan identifies a short-chain
alcohol
dehydrogenase family signature from residue G 162 through 6213. PFAM analysis
identifies
significant sequence identity with short-chain alcohol dehydrogenases. ScRM- I
contains a
modified AMP-binding domain and a canonical catalytic site of short-chain
alcohol
dehydrogenases from residues T39 through G46 and Y 182 through K I 86,
respectively. As shown
in Figures 3A and 3B, ScRM-I has chemical and structural similarity with human
Hep27 (GI
1079566; SEQ ID NO:S). In particular, ScRM-1 and human Hep27 share 56%
identity, have
almost identical molecular mass (29.9 kDa) and isoelectric points (9.0), and
share a canonical
SCAD catalytic domain. A region of unique sequence in ScRM-1 from about amino
acid 222 to
about amino acid 228 is encoded by a fragment of SEQ ID N0:3 from about
nucleotide 694 to
about nucleotide 714. Northern analysis shows the expression of this sequence
in various
libraries, at least 67% of which are proliferative and at least 34% of which
involve immune
response. Of particular note is the expression of ScRM-1 in reproductive and
cardiovascular
tissues.
Nucleic acids encoding the ScRM-2 of the present invention were first
identified in lncyte
Clone 2060002 from the ovarian cDNA library (OVARNOT03) using a computer
search, e.g.,
BLAST, for amino acid sequence alignments. A consensus sequence, SEQ ID N0:4,
was derived
from the following overlapping and/or extended nucleic acid sequences: Incyte
Clones
2060002H1 (OVARNOT03), 1353231F1 (LATRTUT02), 99677981 (KIDNTUTO1), 94920981
(PANCNOTOS), 1275304F1 (TESTTUT02), 130811581 (COLNFET02), and 100431281
(BRSTNOT03).
In one embodiment, the invention encompasses a polypeptide comprising the
amino acid
sequence of SEQ ID N0:2, as shown in Figures 2A, 2B, 2C, 2D, 2E, and 2F. ScRM-
2 is 564
amino acids in length and has nine potential casein kinase II phosphorylation
sites at residues S2I,
T62, S208, S233, S249, T482, S507, 5515, and 5517; five potential protein
kinase C
phosphorylation sites at residues T103, T204, T354, T459, and T556; and a
potential tyrosine
kinase phosphorylation site at residue Y45. As shown in Figures 4A, 4B, 4C,
4D, and 4E, ScRM-
-19-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
2 has chemical and structural similarity with C. ele ans alcohol/ribitol
dehydrogenase (GI
2731377; SEQ ID N0:6). In particular, ScRM and C. elegans alcohol/ribitol
dehydrogenase share
35% identity, with identity highest over the novel N-terminal half of the C.
elegans protein.
ScRM-2 and C. a a ans similar to alcohol/ribitol dehydrogenase share two
potential casein kinase
II phosphorylation sites and a potential protein kinase C phosphorylation site
at residues S233 and
S507, and T103 in ScRM-2, respectively. A region of unique sequence in ScRM-2
from about
amino acid 115 to about amino acid 121 is encoded by a fragment of SEQ ID N0:4
from about
nucleotide 361 to about nucleotide 381. Northern analysis shows the expression
of this sequence
in various libraries, at least 65% of which, are proliferative and at least
24% of which involve
immune response. Of particular note is the expression of ScRM-2 in
reproductive tissues.
The invention also encompasses ScRM variants. A preferred ScRM variant is one
which
has at least about 80%, more preferably at least about 90%, and most
preferably at least about 95%
amino acid sequence identity to the ScRM amino acid sequence, and which
contains at least one
functional or structural characteristic of ScRM.
The invention also encompasses polynucleotides which encode ScRM. In a
particular
embodiment, the invention encompasses a polynucleotide sequence comprising the
sequence of
SEQ ID N0:3. 1n a further embodiment, the invention encompasses the
polynucleotide sequence
comprising the sequence of SEQ ID N0:4.
The invention also encompasses a variant of a polynucleotide sequence encoding
ScRM.
In particular, such a variant polynucleotide sequence will have at least about
70%, more preferably
at least about 85%, and most preferably at least about 95% polynucleotide
sequence identity to the
polynucleotide sequence encoding ScRM. A particular aspect of the invention
encompasses a
variant of SEQ ID N0:3 which has at least about 70%, more preferably at least
about 85%, and
most preferably at least about 95% polynucleotide sequence identity to SEQ ID
N0:3. The
invention further encompasses a polynucleotide variant of SEQ ID N0:4 having
at least about
70%, more preferably at least about 85%, and most preferably at least about
95% polynucleotide
sequence identity to SEQ ID N0:4. Any one of the polynucleotide variants
described above can
encode an amino acid sequence which contains at least one functional or
structural characteristic
of ScRM.
It will be appreciated by those skilled in the art that as a result of the
degeneracy of the
genetic code, a multitude of polynucleotide sequences encoding ScRM, some
bearing minimal
similarity to the polynucleotide sequences of any known and naturally
occurring gene, may be
produced. Thus, the invention contemplates each and every possible variation
of polynucleotide
sequence that could be made by selecting combinations based on possible codon
choices. These
combinations are made in accordance with the standard triplet genetic code as
applied to the
-15-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
polynucleotide sequence of naturally occurring ScRM, and all such variations
are to be considered
as being specifically disclosed.
Although nucleotide sequences which encode ScRM and its variants are
preferably
capable of hybridizing to the nucleotide sequence of the naturally occurring
ScRM under
appropriately selected conditions of stringency, it may be advantageous to
produce nucleotide
sequences encoding ScRM possessing a substantially different codon usage,
e.g., inclusion of non-
naturally occurring codons. Codons may be selected to increase the rate at
which expression of
the peptide occurs in a particular prokaryotic or eukaryotic host in
accordance with the frequency
with which particular codons are utilized by the host. Other reasons for
substantially altering the
nucleotide sequence encoding ScRM and its derivatives without altering the
encoded amino acid
sequences include the production of RNA transcripts having more desirable
properties, such as a
greater half life, than transcripts produced from the naturally occurring
sequence.
The invention also encompasses production of DNA sequences which encode ScRM
and
ScRM derivatives, or fragments thereof, entirely by synthetic chemistry. After
production, the
synthetic sequence may be inserted into any of the many available expression
vectors and cell
systems using reagents well known in the art. Moreover, synthetic chemistry
may be used to
introduce mutations into a sequence encoding ScRM or any fragment thereof.
Also encompassed by the invention are polynucleotide sequences that are
capable of
hybridizing to the claimed polynucleotide sequences, and, in particular, to
those shown in SEQ ID
N0:3, SEQ ID N0:4, a fragment of SEQ ID N0:3, or a fragment of SEQ ID N0:4,
under various
conditions of stringency. (See, e.g., Wahl, G.M. and S.L. Berger ( 1987)
Methods Enzymol.
I 52:399-407; Kirnmel, A.R. ( 1987) Methods Enzymol. 152:507-511.) For
example, stringent salt
concentration will ordinarily be less than about 750 mM NaCI and 75 mM
trisodium citrate,
preferably less than about 500 mM NaCI and SO mM trisodium citrate, and most
preferably less
than about 250 mM NaCI and 25 mM trisodium citrate. Low stringency
hybridization can be
obtained in the absence of organic solvent, e.g., formamide, while high
stringency hybridization
can be obtained in the presence of at least about 35% formamide, and most
preferably at least
about 50% formamide. Stringent temperature conditions will ordinarily include
temperatures of at
feast about 30°C, more preferably of at least about 37°C, and
most preferably of at least about
42°C. Varying additional parameters, such as hybridization time, the
concentration of detergent,
e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier
DNA, are well known
to those skilled in the art. Various levels of stringency are accomplished by
combining these
various conditions as needed. In a preferred embodiment, hybridization will
occur at 30°C in 7S0
mM NaCI, 75 mM trisodium citrate, and i% SDS. In a more preferred embodiment,
hybridization
will occur at 37°C in 500 mM NaCI, 50 mM trisodium citrate, 1% SDS, 35%
formamide, and 100
-16-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
~cg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment,
hybridization
will occur at 42°C in 250 mM NaCI, 25 mM trisodium citrate, I % SDS, 50
% formamide, and 200
ug/ml ssDNA. Useful variations on these conditions will be readily apparent to
those skilled in
the art.
The washing steps which follow hybridization can also vary in stringency. Wash
stringency conditions can be defined by salt concentration and by temperature.
As above, wash
stringency can be increased by decreasing salt concentration or by increasing
temperature. For
example, stringent salt concentration for the wash steps will preferably be
less than about 30 mM
NaCI and 3 mM trisodium citrate, and most preferably less than about 15 mM
NaCI and 1.5 mM
trisodium citrate. Stringent temperature conditions for the wash steps will
ordinarily include
temperature of at least about 25°C, more preferably of at least about
42°C, and most preferably of
at least about 68°C. In a preferred embodiment, wash steps will occur
at 25°C in 30 mM NaCI, 3
mM trisodium citrate. and O.t% SDS. In a more preferred embodiment, wash steps
will occur at
42°C in 1 ~ mM NaCI, I .5 mM trisodium citrate, and 0.1 % SDS. 1n a
most preferred embodiment,
I S wash steps will occur at 68°C in I S mM NaCi, 1.5 mM trisodium
citrate, and 0.1 % SDS.
Additional variations on these conditions will be readily apparent to those
skilled in the art.
Methods for DNA sequencing and analysis are well known in the art. The methods
may
employ such enzymes as the Klenow fragment of DNA polymerise I, SEQUENASE~
(Amersham
Pharmacia Biotech Ltd., Uppsala, Sweden), Taq polymerise (The Perkin-Elmer
Corp., Norwalk,
CT), thermostable T7 polymerise (Amersham Pharmacia Biotech Ltd., Uppsala,
Sweden), or
combinations of polymerises and proofreading exonucleases, such as those found
in the
ELONGASETM amplification system (Life Technologies, Inc., Rockville, MD).
Preferably,
sequence preparation is automated with machines, e.g., the ABI CATALYSTTM 800
(The Perkin-
Elmer Corp., Norwalk, CT) or MICROLAB~ 2200 (Hamilton Co., Reno, NV) systems,
in
combination with thermal cyclers. Sequencing can also be automated, such as by
ABI PRISMTM
373 or 377 systems (The Perkin-Elmer Corp., Norwalk, CT) or the MEGABACETM
1000 capillary
electrophoresis system (Molecular Dynamics, Inc., Sunnyvaie, CA). Sequences
can be analyzed
using computer programs and algorithms well known in the art. (See, e.g.,
Ausubel, supra, unit
7.7; and Meyers, R.A. ( 1995) Molecular Biolosv and Biotechnoloev, Wiley VCH,
Inc, New York,
NY.)
The nucleic acid sequences encoding ScRM may be extended utilizing a partial
nucleotide
sequence and employing various PCR-based methods known in the art to detect
upstream
sequences, such as promoters and regulatory elements. For example, one method
which may be
employed, restriction-site PCR, uses universal and nested primers to amplify
unknown sequence
from genomic DNA within a cloning vector. (See, e.g., Sarkar, G. {1993) PCR
Methods Applic.
-17-
CA 02333471 2001-O1-15
WO (10/04135 PCT/US99/16164
2:318-322.) Another method, inverse PCR, uses primers that extend in divergent
directions to
amplify unknown sequence from a circularized template. The template is derived
from restriction
fragments comprising a known genomic locus and surrounding sequences. (See,
e.g., Triglia, T. et
al. (1988) Nucleic Acids Res. 16:8186.) A third method, capture PCR, involves
PCR
amplification of DNA fragments adjacent to known sequences in human and yeast
artificial
chromosome DNA. (See, e.g., Lagerstrom, M. et al. (1991) PCR Methods Applic.
1:11 I-119.) In
this method, multiple restriction enzyme digestions and ligations may be used
to insert an
engineered double-stranded sequence into a region of unknown sequence before
performing PCR.
Other methods which may be used to retrieve unknown sequences are known in the
art. (See, e.g.,
Parker, J.D. et al. (1991 ) Nucleic Acids Res. 19:3055-306). Additionally, one
may use PCR,
nested primers, and PromoterFinderT"' libraries to walk genomic DNA (Clontech,
Palo Alto, CA).
This procedure avoids the need to screen libraries and is useful in finding
intron/exon junctions.
For all PCR-based methods, primers may be designed using commercially
available software, such
as OLIGOT"' 4.06 Primer Analysis software (National Biosciences Inc.,
Plymouth, MN) or another
IS appropriate program, to be about 22 to 30 nucleotides in length, to have a
GC content of about
50% or more, and to anneal to the template at temperatures of about
68°C to 72°C.
When screening for full-length cDNAs, it is preferable to use libraries that
have been
size-selected to include larger cDNAs. In addition, random-primed libraries,
which often include
sequences containing the 5' regions of genes, are preferable for situations in
which an oligo d(T)
library does not yield a full-length cDNA. Genomic libraries may be useful for
extension of
sequence into 5' non-transcribed regulatory regions.
Capillary electrophoresis systems which are commercially available may be used
to
analyze the size or confirm the nucleotide sequence of sequencing or PCR
products. In particular,
capillary sequencing may employ flowable polymers for electrophoretic
separation, four different
nucleotide-specific, laser-stimulated fluorescent dyes, and a charge coupled
device camera for
detection of the emitted wavelengths. Output/light intensity may be converted
to electrical signal
using appropriate software (e.g., GenotyperTM and Sequence NavigatorT"', (The
Perkin-Elmer
Corp., Norwalk, CT)), and the entire process from loading of samples to
computer analysis and
electronic data display may be computer controlled. Capillary electrophoresis
is especially
preferable for sequencing small DNA fragments which may be present in limited
amounts in a
particular sample.
In another embodiment of the invention, polynucleotide sequences or fragments
thereof
which encode ScRM may be cloned in recombinant DNA molecules that direct
expression of
ScRM, or fragments or functional equivalents thereof, in appropriate host
cells. Due to the
inherent degeneracy of the genetic code, other DNA sequences which encode
substantially the
-18-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
same or a functionally equivalent amino acid sequence may be produced and used
to express
ScRM.
The nucleotide sequences of the present invention can be engineered using
methods
generally known in the art in order to alter ScRM-encoding sequences for a
variety of purposes
including, but not limited to, modification of the cloning, processing, and/or
expression of the
gene product. DNA shuffling by random fragmentation and PCR reassembly of gene
fragments
and synthetic oligonucleotides may be used to engineer the nucleotide
sequences. For example,
oligonucleotide-mediated site-directed mutagenesis may be used to introduce
mutations that create
new restriction sites, alter glycosylation patterns, change codon preference,
produce splice
variants, and so forth.
In another embodiment, sequences encoding ScRM may be synthesized. in whole or
in
part, using chemical methods well known in the art. (See, e.g., Caruthers,
M.H. et al. ( 1980) Nucl.
Acids Res. Symp. Ser. 215-223. and Horn, T. et al. ( 1980) Nucl. Acids Res.
Symp. Ser. 225-232.)
Alternatively, ScRM itself or a fragment thereof may be synthesized using
chemical methods. For
example, peptide synthesis can be performed using various solid-phase
techniques. (See, e.g.,
Roberge, J.Y. et al. ( 1995) Science 269:202-204.) Automated synthesis may be
achieved using
the ABI 431A Peptide Synthesizer (The Perkin-Elmer Corp., Norwalk, CT).
Additionally, the
amino acid sequence of ScRM, or any part thereof, may be altered during direct
synthesis and/or
combined with sequences from other proteins, or any part thereof, to produce a
variant
polypeptide.
The peptide may be substantially purified by preparative high performance
liquid
chromatography. (See, e.g, Chiez, R.M. and F.Z. Regnier { 1990) Methods
Enzymol. 182:392-
421.) The composition of the synthetic peptides may be confirmed by amino acid
analysis or by
sequencing. (See, e.g., Creighton, T. ( 1984) Proteins. Structures and
Molecular Properties, WH
Freeman and Co., New York, NY.)
In order to express a biologically active ScRM, the nucleotide sequences
encoding ScRM
or derivatives thereof may be inserted into an appropriate expression vector,
i.e., a vector which
contains the necessary elements for transcriptional and translational control
of the inserted coding
sequence in a suitable host. These elements include regulatory sequences, such
as enhancers,
constitutive and inducible promoters, and 5' and 3' untranslated regions in
the vector and in
polynucleotide sequences encoding ScRM. Such elements may vary in their
strength and
specificity. Specific initiation signals may also be used to achieve more
efficient translation of
sequences encoding ScRM. Such signals include the ATG initiation codon and
adjacent
sequences, e.g. the Kozak sequence. In cases where sequences encoding ScRM and
its initiation
codon and upstream regulatory sequences are inserted into the appropriate
expression vector, no
-19-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
additional transcriptional or translational control signals may be needed.
However, in cases where
only coding sequence, or a fragment thereof, is inserted, exogenous
translational control signals
including an in-frame ATG initiation codon should be provided by the vector.
Exogenous
transiational elements and initiation codons may be of various origins, both
natural and synthetic.
The efficiency of expression may be enhanced by the inclusion of enhancers
appropriate for the
particular host cell system used. (See, e.g., Scharf; D. et al. ( 1994)
Results Probl. Cell Differ.
20:125-162.)
Methods which are well known to those skilled in the art may be used to
construct
expression vectors containing sequences encoding ScRM and appropriate
transcriptional and
translational control elements. These methods include in vitro recombinant DNA
techniques,
synthetic. techniques, and in vivo genetic recombination. (See, e.g.,
Sambrook, J. et al. (1989)
Molecular Clonins A Laboratory Manual, Cold Spring Harbor Press, Plainview,
NY, ch. 4, 8, and
16-17; and Ausubel, F.M. et al. ( 1995, and periodic supplements) Current
Protocols in Molecular
Bioloan, John Wiley & Sons, New York, NY, ch. 9, 13, and 16.)
A variety of expression vector/host systems may be utilized to contain and
express
sequences encoding ScRM. These include, but are not limited to, microorganisms
such as bacteria
transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression
vectors; yeast
transformed with yeast expression vectors; insect cell systems infected with
viral expression
vectors (e.g., baculovirus); plant cell systems transformed with viral
expression vectors (e.g.,
cauliflower mosaic virus (CaMV) or tobacco mosaic virus (TMV)) or with
bacterial expression
vectors (e.g., Ti or pBR322 plasmids); or animal cell systems. The invention
is not limited by the
host cell employed.
In bacterial systems, a number of cloning and expression vectors may be
selected
depending upon the use intended for polynucleotide sequences encoding ScRM.
For example,
routine cloning, subcloning, and propagation of polynucleotide sequences
encoding ScRM can be
achieved using a multifunctional E. colt vector such as Bluescript~
(Stratagene) or pSportlTM
plasmid (GI8C0 BRL). Ligation of sequences encoding ScRM into the vector's
multiple cloning
site disrupts the IacZ gene, allowing a colorimetric screening procedure for
identification of
transformed bacteria containing recombinant molecules. In addition, these
vectors may be useful
for in vitro transcription, dideoxy sequencing, single strand rescue with
helper phage, and creation
of nested deletions in the cloned sequence. (See, e.g., Van Heeke, G. and S.M.
Schuster ( 1989) J.
Biol. Chem. 264:5503-5509.) When large quantities of ScRM are needed, e.g. for
the production
of antibodies, vectors which direct high level expression of ScRM may be used.
For example,
vectors containing the strong, inducible TS or T7 bacteriophage promoter may
be used.
Yeast expression systems may be used for production of ScRM. A number of
vectors
-20-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/1b164
containing constitutive or inducible promoters, such as alpha factor, alcohol
oxidase, and PGH,
may be used in the yeast Saccharomvces cerevisiae or Pichia,pastoris. In
addition, such vectors
direct either the secretion or intracellular retention of expressed proteins
and enable integration of
foreign sequences into the host genome for stable_propagation. (See, e.g.,
Ausubel, supra; and
Grant et al. (1987) Methods Enrymol. 153:516-54; Scorer, C. A. et al. (1994)
Bio/Technology
12:181-184.)
Plant systems may also be used for expression of ScRM. Transcription of
sequences
encoding ScRM may be driven viral promoters, e.g., the 35S and 19S promoters
of CaMV used
alone or in combination with the omega leader sequence from TMV. (Takamatsu,
N. ( 1987)
EMBO J. 6:307-311.) Alternatively, plant promoters such as the small subunit
of RUBISCO or
heat shock promoters may be used. (See, e.g., Coruzzi, G. et al. (1984) EMBO
J. 3:1671-1680;
Broglie, R. et al. (1984) Science 224:838-843; and Winter, J. et a1. (1991)
Results Probl. Cell
Differ. 17:85-105.) These constructs can be introduced into plant cells by
direct DNA
transformation or pathogen-mediated transfection. (See, e.g., Hobbs, S. or
Murry, L.E. in
McGraw Hill Yearbook of Science and Technoloev ( 1992) McGraw Hili, New York,
NY; pp.
191-196.)
In mammalian cells, a number of viral-based expression systems may be
utilized. In cases
where an adenovirus is used as an expression vector, sequences encoding ScRM
may be ligated
into an adenovirus transcription/translation complex consisting of the late
promoter and tripartite
leader sequence. Insertion in a non-essential E1 or E3 region of the viral
genome may be used to
obtain infective virus which expresses ScRM in host cells. (See, e.g., Logan,
J. and T. Shenk
( 1984) Proc. Natl. Acad. Sci. 81:3655-3659.) In addition, transcription
enhancers, such as the
Rous sarcoma virus (RSV) enhancer, may be used to increase expression in
mammalian host cells.
SV40 or EBV-based vectors may also be used for high-level protein expression.
Human artificial chromosomes (HACs) may also be employed to deliver larger
fragments
of DNA than can be contained in and expressed from a plasmid. HACs of about 6
kb to 10 Mb
are constructed and delivered via conventional delivery methods (liposomes,
polycationic amino
polymers, or vesicles) for therapeutic purposes.
For tong term production of recombinant proteins in mammalian systems, stable
expression of ScRM in cell lines is preferred. For example, sequences encoding
ScRM can be
transformed into cell lines using expression vectors which may contain viral
origins of replication
and/or endogenous expression elements and a selectable marker gene on the same
or on a separate
vector. Following the introduction of the vector, cells may be allowed to grow
for about 1 to 2
days in enriched media before being switched to selective media. The purpose
of the selectable
marker is to confer resistance to a selective agent, and its presence allows
growth and recovery of
-21-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
cells which successfully express the introduced sequences. Resistant clones of
stably transformed
cells may be propagated using tissue culture techniques appropriate to the
cell type.
Any number of selection systems may be used to recover transformed cell lines.
These
include, but are not limited to, the herpes simplex virus thymidine kinase and
adenine
phosphoribosyltransferase genes, for use in tlr or apr cells, respectively.
(See, e.g., Wigler, M. et
al. (1977) Cell 11:223-232; and Lowy, I. et al. (1980) Ceil 22:817-823.) Also,
antimetabolite,
antibiotic, or herbicide resistance can be used as the basis for selection.
For example, dhJr confers
resistance to methotrexate; neo confers resistance to the aminoglycosides
neomycin and G-418;
and als or pat confer resistance to chlorsulfuron and phosphinotricin
acetyltransferase,
respectively. (See, e.g., Wigler, M. et al. ( 1980) Proc. Natl. Acad. Sci.
77:3567-3570;
Colbere-Garapin, F. et al (1981) J. Mol. Biol. ISO:I-14; and Murry, supra.)
Additional selectable
genes have been described, e.g., trpB and hisD, which alter cellular
requirements for metabolites.
(See, e.g., Hartman, S.C. and R.C. Mulligan (1988) Proc. Natl. Acad. Sci.
85:8047-8051.) Visible
markers, e.g., anthocyanins, green fluorescent proteins (GFP) (Clontech, Palo
Alto, CA), (i
glucuronidase and its substrate f3-D-glucuronoside, or luciferase and its
substrate luciferin may be
used. These markers can be used not only to identify transformants, but also
to quantify the
amount of transient or stable protein expression attributable to a specific
vector system. (See, e.g.,
Rhodes, C.A. et al. (1995) Methods Mol. Biol. 55:121-131.)
Although the presence/absence of marker gene expression suggests that the gene
of
interest is also present, the presence and expression of the gene may need to
be confirmed. For
example, if the sequence encoding ScRM is inserted within a marker gene
sequence, transformed
cells containing sequences encoding ScRM can be identified by the absence of
marker gene
function. Alternatively, a marker gene can be placed in tandem with a sequence
encoding ScRM
under the control of a single promoter. Expression of the marker gene in
response to induction or
selection usually indicates expression of the tandem gene as well.
In general, host cells that contain the nucleic acid sequence encoding ScRM
and that
express ScRM may be identified by a variety of procedures known to those of
skill in the art.
These procedures include, but are not limited to, DNA-DNA or DNA-RNA
hybridizations, PCR
amplification, and protein bioassay or immunoassay techniques which include
membrane,
solution, or chip based technologies for the detection and/or quantification
of nucleic acid or
protein sequences.
Immunological methods for detecting and measuring the expression of ScRM using
either
specific polyclonal or monoclonal antibodies are known in the art. Examples of
such techniques
include enryme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs),
and
fluorescence activated cell sorting (FACS). A two-site, monoclonal-based
immunoassay utilizing
-22-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99116164
monoclonal antibodies reactive to two non-interfering epitopes on ScRM is
preferred, but a
competitive binding assay may be employed. These and other assays are well
known in the art.
(See, e.g., Hampton, R. et al. ( 1990) Seroloeical Methods a Laboratory
Manual, APS Press, St
Paul, MN, Section IV; Coligan, J. E. et al. (1997 and periodic supplements)
Current Protocols in
Immunology, Greene Pub. Associates and Wiley-Interscience, New York, NY; and
Maddox, D.E.
et al. ( 1983 ) J. Exp. Med. 158:1211- I 216).
A wide variety of labels and conjugation techniques are known by those skilled
in the art
and may be used in various nucleic acid and amino acid assays. Means for
producing labeled
hybridization or PCR probes for detecting sequences related to poiynucleotides
encoding ScRM
IO include oligolabeling, nick translation, end-labeling, or PCR amplification
using a labeled
nucleotide. Alternatively, the sequences encoding ScRM, or any fragments
thereof, may be
cloned into a vector for the production of an mRNA probe. Such vectors are
known in the art, are
commercially available, and may be used to synthesize RNA probes in vitro by
addition of an
appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides.
These procedures
IS may be conducted using a variety of commercially available kits, such as
those provided by
Pharmacia & Upjohn (Kalamazoo, MI), Promega (Madison, WI), and U.S.
Biochemical Corp.
(Cleveland, OH). Suitable reporter molecules or labels which may be used for
ease of detection
include radionuclides, enzymes. fluorescent, chemiluminescent, or chromogenic
agents, as well as
substrates, cofactors, inhibitors. magnetic particles, and the like.
20 Host cells transformed with nucleotide sequences encoding ScRM may be
cultured under
conditions suitable for the expression and recovery of the protein from cell
culture. The protein
produced by a transformed cell may be secreted or retained intraceilularly
depending on the
sequence and/or the vector used. As will be understood by those of skill in
the art, expression
vectors containing polynucleotides which encode ScRM may be designed to
contain signal
25 sequences which direct secretion of ScRM through a prokaryotic or
eukaryotic cell membrane.
In addition, a host cell strain may be chosen for its ability to modulate
expression of the
inserted sequences or to process the expressed protein in the desired fashion.
Such modifications
of the polypeptide include, but are not limited to, acetylation,
carboxylation, glycosylation,
phosphoryiation, lipidation, and acylation. Post-translational processing
which cleaves a "prepro"
30 form of the protein may also be used to specify protein targeting, folding,
and/or activity.
Different host cells which have specific cellular machinery and characteristic
mechanisms for
post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are
available from
the American Type Culture Collection (ATCC, Bethesda, MD) and may be chosen to
ensure the
correct modification and processing of the foreign protein.
35 In another embodiment of the invention, natural, modified, or recombinant
nucleic acid
-23-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
sequences encoding ScRM may be ligated to a heterologous sequence resulting in
translation of a
fusion protein in any of the aforementioned host systems. For example, a
chimeric ScRM protein
containing a heterologous moiety that can be recognized by a commercially
available antibody
may facilitate the screening of peptide libraries for inhibitors of ScRM
activity. Heterologous
protein and peptide moieties may also facilitate purification of fusion
proteins using commercially
available affinity matrices. Such moieties include, but are not limited to,
glutathione S-transferase
(GST), maltose binding protein (MBP), thioredoxin (Trx), calmodulin binding
peptide (CBP), 6-
His, FLAG, c-myc, and hemagglutinin (HA). GST, MBP, Trx, CBP, and 6-His enable
purification
of their cognate fusion proteins on immobilized glutathione, maltose,
phenylarsine oxide,
calmodulin, and metal-chelate resins, respectively. FLAG, c-myc, and
hemagglutinin (HA) enable
immunoaffinity purification of fusion proteins using commercially available
monoclonal and
polyclonal antibodies that specifically recognize these epitope tags. A fusion
protein may also be
engineered to contain a proteolytic cleavage site located between the ScRM
encoding sequence
and the heterologous protein sequence, so that ScRM may be cleaved away from
the heterologous
moiety following purification. Methods for fusion protein expression and
purification are
discussed in Ausubel, F. M. et al. ( 1995 and periodic supplements) Current
Protocols in Molecular
Bi to , John Wiley & Sons, New York, NY, ch 10. A variety of commercially
available kits
may also be used to facilitate expression and purification of fusion proteins.
In a further embodiment of the invention, synthesis of radiolabeled ScRM may
be
achieved in vitro using the TNTT'" rabbit reticulocyte lysate or wheat germ
extract systems
(Promega, Madison, WI). These systems couple transcription and translation of
protein-coding
sequences operably associated with the T7, T3, or SP6 promoters. Translation
takes place in the
presence of a radiolabeled amino acid precursor, preferably "S-methionine.
Fragments of ScRM may be produced not only by recombinant production, but also
by
direct peptide synthesis using solid-phase techniques. (See, e.g., Creighton,
supra pp. 55-60.)
Protein synthesis may be performed by manual techniques or by automation.
Automated synthesis
may be achieved, for example, using the Applied Biosystems 431A Peptide
Synthesizer (The
Perkin-Elmer Corp., Norwalk, CT). Various fragments of ScRM may be synthesized
separately
and then combined to produce the full length molecule.
THERAPEUTICS
Chemical and structural similarity exists between ScRM-1 and Hep27 from human
(GI
1079566). In addition, ScRM-1 is expressed in tissues associated with cell
proliferation and
inflammation. Therefore, ScRM-1 appears to play a role in cell proliferative
and immune
disorders.
-29-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
Chemical and structural similarity exists between ScRM-2 and alcohol/ribitol
dehydrogenase from C. eleQans (GI 2731377). In addition, ScRM-2 is expressed
in tissues
associated with cell proliferation and inflammation. Therefore, ScRM-2 appears
to play a role in
cell proliferative and immune disorders.
Therefore, in one embodiment, ScRM or a fragment or derivative thereof may be
administered to a subject to treat or prevent a cell proliferative disorder.
Such cell proliferative
disorders can include, but are not limited to, actinic keratosis,
arteriosclerosis, atherosclerosis,
bursitis, cirrhosis, hepatitis. mixed connective tissue disease (MCTD),
myelofibrosis, paroxysmal
nocturnal hemoglobinuria, polycythemia vera, psoriasis, primary
thrombocythemia, and cancers
including adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma,
teratocarcinoma,
and, in particular, cancers of the adrenal gland, bladder, bone, bone marrow,
brain, breast, cervix,
gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung,
muscle, ovary, pancreas,
parathyroid. penis, prostate, salivary glands, skin, spleen. testis, thymus,
thyroid, and uterus.
In another embodiment, a vector capable of expressing ScRM or a fragment or
derivative
thereof may be administered to a subject to treat or prevent a cell
proliferative disorder including,
but not limited to, those described above.
In a further embodiment, a pharmaceutical composition comprising a
substantially
purified ScRM in conjunction with a suitable pharmaceutical carrier may be
administered to a
subject to treat or prevent a cell proliferative disorder including, but not
limited to, those provided
above.
In still another embodiment, an agonist which modulates the activity of ScRM
may be
administered to a subject to treat or prevent a cell proliferative disorder
including, but not limited
to, those listed above.
In another embodiment, ScRM or a fragment or derivative thereof may be
administered to
a subject to treat or prevent an immune disorder. Such immune disorders can
include, but are not
limited to, acquired immunodeficiency syndrome (AIDS), Addison's disease,
adult respiratory
distress syndrome, allergies, ankylosing spondylitis, amyloidosis, anemia,
asthma, atherosclerosis,
autoimmune hemolytic anemia, autoimmune thyroiditis, bronchitis,
cholecystitis, contact
dermatitis, Crohn's disease, atopic dermatitis, dermatomyositis, diabetes
mellitus, emphysema,
episodic lymphopenia with lymphocytotoxins, erythroblastosis fetalis, erythema
nodosum,
atrophic gastritis, glomerulonephritis, Goodpasture's syndrome, gout, Graves'
disease,
Hashimoto's thyroiditis, hypereosinophiiia, irritable bowel syndrome, multiple
sclerosis,
myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis,
osteoporosis,
pancreatitis, polymyositis, psoriasis, Reiter's syndrome, rheumatoid
arthritis, scleroderma,
Sjogren's syndrome, systemic anaphylaxis, systemic lupus ervthematosus,
systemic sclerosis,
-25-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
thrombocytopenic purpura, ulcerative colitis, uveitis, Werner syndrome;
complications of cancer,
hemodialysis, and extracorporea) circulation, viral, bacterial, fungal,
parasitic, protozoal, and
helminthic infections, and trauma.
In another embodiment, a vector capable of expressing ScRM or a fragment or
derivative
thereof may be administered to a subject to treat or prevent an immune
disorder including, but not
limited to, those described above.
In a further embodiment, a pharmaceutical composition comprising a
substantially
purified ScRM in conjunction with a suitable pharmaceutical carrier may be
administered to a
subject to treat or prevent an immune disorder including, but not limited to,
those provided above.
In still another embodiment, an agonist which modulates the activity of ScRM
may be
administered to a subject to treat or prevent an immune disorder including,
but not limited to, those
listed above.
In other embodiments, any of the proteins, antagonists, antibodies, agonists,
complementary sequences, or vectors of the invention may be administered in
combination with
other appropriate therapeutic agents. Selection of the appropriate agents for
use in combination
therapy may be made by one of ordinary skill in the art, according to
conventional pharmaceutical
principles. The combination of therapeutic agents may act synergistically to
effect the treatment
or prevention of the various disorders described above. Using this approach,
one may be able to
achieve therapeutic efficacy with lower dosages of each agent, thus reducing
the potential for
adverse side effects.
An antagonist of ScRM may be produced using methods which are generally known
in the
art. In particular, purified ScRM may be used to produce antibodies or to
screen libraries of
pharmaceutical agents to identify those which specifically bind ScRM.
Antibodies to ScRM may
also be generated using methods that are well known in the art. Such
antibodies may include, but
are not limited to, polyclonal, monoclonal, chimeric, and single chain
antibodies, Fab fragments,
and fragments produced by a Fab expression library. Neutralizing antibodies
(i.e., those which
inhibit dimer formation) are especially preferred for therapeutic use.
For the production of polycional antibodies, various hosts including goats,
rabbits, rats,
mice, humans, and others may be immunized by injection with ScRM or with any
fragment or
oligopeptide thereof which has immunogenic properties. Rats and mice are
preferred hosts for
downstream applications involving monoclonal antibody production. Depending on
the host
species, various adjuvants may be used to increase immunological response.
Such adjuvants
include, but are not limited to, Freund's, mineral gels such as aluminum
hydroxide, and surface
active substances such as lysolecithin, pluronic polyols, polyanions,
peptides, oil emulsions, KL,H,
and dinitrophenol. Among adjuvants used in humans, BCG.(tiacilli Calmette-
Guerin) and
-26-
CA 02333471 2001-O1-15
WO 00104135 PCT/US99/16164
Corvnebacterium parvum are especially preferable. (For review of methods for
antibody
production and analysis, see, e.g., Harlow, E. and Lane, D. ( 1988)
Antibodies: A Laborato~
Manual, Cold Spring Harbor Laboratory, Coid Spring Harbor, N.Y.)
It is preferred that the oligopeptides, peptides, or fragments used to induce
antibodies to
ScRM have an amino acid sequence consisting of at least about 5 amino acids,
and, more
preferably, of at least about 14 amino acids. It is also preferable that these
oligopeptides, peptides,
or fragments are identical to a portion of the amino acid sequence of the
natural protein and
contain the entire amino acid sequence of a small, naturally occurring
molecule. Short stretches of
SeRM amino acids may be fused with those of another protein, such as KLH, and
antibodies to the
chimeric molecule may be produced.
Monoclonal antibodies to ScRM may be prepared using any technique which
provides for
the production of antibody molecules by continuous cell lines in culture.
These include, but are
not limited to, the hybridoma technique, the human B-cell hybridoma technique,
and the EBV-
hybridoma technique. (See, e.g., Kohler, G. et al. ( 1975) Nature 256:495-497;
Kozbor, D. et al.
(1985) J. Immunol. Methods 81:31-42; Cote, R.J. et al. (1983) Proc. Natl.
Acad. Sci.
80:2026-2030; and Cole, S.P. et al. (1984) Mol. Cell Biol. 62:109-120.)
In addition, techniques developed for the production of "chimeric antibodies,"
such as the
splicing of mouse antibody genes to human antibody genes to obtain a molecule
with appropriate
antigen specificity and biological activity, can be used. (See, e.g.,
Morrison, S.L. et al. (1984)
Proc. Natl. Acad. Sci. 81:6851-6855; Neuberger, M.S. et al. (1984) Nature
312:604-608; and
Takeda, S. et al. (I985) Nature 314:452-454.) Alternatively, techniques
described for the
production of single chain antibodies may be adapted, using methods known in
the art, to produce
ScRM-specific single chain antibodies. Antibodies with related specificity,
but of distinct
idiotypic composition, may be generated by chain shuffling from random
combinatorial
immunoglobulin libraries. (See, e.g., Burton D.R. ( 1991 ) Proc. Natl. Acad.
Sci. 88:10134-10137.)
Antibodies may also be produced by inducing in vivo production in the
lymphocyte
population or by screening immunoglobulin libraries or panels of highly
specific binding reagents
as disclosed in the literature. (See, e.g., Orlandi, R. et al. ( 1989) Proc.
Natl. Acad. Sci. 86:
3833-3837; and Winter, G. et al. ( 1991 ) Nature 349:293-299.)
Antibody fragments which contain specific binding sites for ScRM may also be
generated.
For example, such fragments include, but are not limited to, F(ab')2 fragments
produced by
pepsin digestion of the antibody molecule and Fab fragments generated by
reducing the disulfide
bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may
be constructed to
allow rapid and easy identification of monoclonal Fab fragments with the
desired specificity.
(See, e.g., Huse, W.D. et al. ( 1989) Science 246:1275-1281.)
_27_
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99116164
Various immunoassays may be used for screening to identify antibodies having
the
desired specificity and minimal cross-reactivity. Numerous protocols for
competitive binding or
immunoradiometric assays using either polyclonal or monoclonal antibodies with
established
specificities are well known in the art. Such immunoassays typically involve
the measurement of
complex formation between ScRM and its specific antibody. A two-site,
monoclonal-based
immunoassay utilizing monoclonal antibodies reactive to two non-interfering
ScRM epitopes is
preferred, but a competitive binding assay may also be employed. (Maddox,
supra.)
Various methods such as Scatchard analysis in conjunction with
radioimmunoassay
techniques may be used to assess the affinity of antibodies for ScRM. Affinity
is expressed as an
association constant, K" which is defined as the molar concentration of ScRM-
antibody complex
divided by the molar concentrations of free antigen and free antibody under
equilibrium
conditions. The K, determined for a preparation of polyclonal antibodies,
which are
heterogeneous in their affinities for multiple ScRM epitopes. represents the
average affinity, or
avidity, of the antibodies for ScRM. The K, determined for a preparation of
monoclonal
antibodies, which are monospecific for a particular ScRM epitope, represents a
true measure of
affinity. High-affinity antibody preparations with K, ranging from about 109
to I0'2 L/mole are
preferred for use in immunoassays in which the ScRM-antibody complex must
withstand rigorous
manipulations. Low-affinity antibody preparations with K, ranging from about
106 to 10' L/mole
are preferred for use in immunopurification and similar procedures which
ultimately require
dissociation of ScRM, preferably in active form, from the antibody. (Catty, D.
(1988) Antibodies.
Volume I: A Practical Approach, IRL Press, Washington, D. C.; and Liddell, J.
E, and Cryer, A.
(1991) A Practical Guide to Monoclonal Antibodies, John Wiley & Sons, New
York, NY.)
The titre and avidity of polyclonal antibody preparations may be further
evaluated to
determine the quality and suitability of such preparations for certain
downstream applications. For
example, a poiyclonal antibody preparation containing at least I-2 mg specific
antibody/ml,
preferably 5-10 mg specifcc antibody/ml, is preferred for use in procedures
requiring precipitation
of ScRM-antibody complexes. Procedures for evaluating antibody specificity,
titer, and avidity,
and guidelines for antibody quality and usage in various applications, are
generally available.
(See, e.g., Catty, supra, and Coligan et al. supra.)
In another embodiment of the invention, the polynucleotides encoding ScRM, or
any
fragment or complement thereof, may be used for therapeutic purposes. In one
aspect, the
complement of the polynucleotide encoding ScRM may be used in situations in
which it would be
desirable to block the transcription of the mRNA. In particular, cells may be
transformed with
sequences complementary to polynucleotides encoding ScRM. Thus, complementary
molecules
or fragments may be used to modulate ScRM activity, or to achieve regulation
of gene function.
-28-
CA 02333471 2001-O1-15
WO 00104135 PCT/US99/16164
Such technology is now well known in the art, and sense or antisense
oligonucieotides or larger
fragments can be designed from various locations along the coding or control
regions of sequences
encoding ScRM.
Expression vectors derived from retroviruses, adenoviruses, or herpes or
vaccinia viruses,
or from various bacterial plasmids, may be used for delivery of nucleotide
sequences to the
targeted organ, tissue, or cell population. Methods which are well known to
those skilled in the art
can be used to construct vectors to express nucleic acid sequences
complementary to the
polynucleotides encoding ScRM. {See, e.g., Sambrook, sera; and Ausubel,
supra.)
Genes encoding ScRM can be turned off by transforming a cell or tissue with
expression
vectors which express high levels of a polynucleotide, or fragment thereof,
encoding ScRM. Such
constructs may be used to introduce untranslatable sense or antisense
sequences into a cell. Even
in the absence of integration into the DNA, such vectors may continue to
transcribe RNA
molecules until they are disabled by endogenous nucleases. Transient
expression may last for a
month or more with a non-replicating vector, and may last even longer if
appropriate replication
I S elements are part of the vector system.
As mentioned above, modifications of gene expression can be obtained by
designing
complementary sequences or antisense molecules (DNA, RNA, or PNA) to the
control, 5', or
regulatory regions of the gene encoding ScRM. Oligonucleotides derived from
the transcription
initiation site, e.g., between about positions -10 and +10 from the start
site, are preferred.
Similarly, inhibition can be achieved using triple helix base-pairing
methodology. Triple helix
pairing is useful because it causes inhibition of the ability of the double
helix to open sufficiently
for the binding of polymerases, transcription factors, or regulatory
molecules. Recent therapeutic
advances using triplex DNA have been described in the literature. (See, e.g.,
Gee, J.E. et al.
(1994) in Huber, B.E. and B.I. Carr, Molecular and Immunolo_l~A,pproaches,
Futura Publishing
Co., Mt. Kisco, NY, pp. 163-177.) A complementary sequence or antisense
molecule may also be
designed to block translation of mRNA by preventing the transcript from
binding to ribosomes.
Ribozymes, enzymatic RNA molecules, may also be used to catalyze the specific
cleavage
of RNA. The mechanism of ribozyme action involves sequence-specific
hybridization of the
ribozyme molecule to complementary target RNA, followed by endonucleolytic
cleavage. For
example, engineered hammerhead motif ribozyme molecules may specifically and
efficiently
catalyze endonucleolytic cleavage of sequences encoding ScRM.
Specific ribozyme cleavage sites within any potential RNA target are initially
identified by
scanning the target molecule for ribozyme cleavage sites, including the
following sequences:
GUA, GUU, and GUC. Once identified, short RNA sequences of between 1 S and 20
ribonucleotides, corresponding to the region of the target gene containing the
cleavage site, may
-29-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
be evaluated for secondary structural features which may render the
oligonucleotide inoperable.
The suitability of candidate targets may also be evaluated by testing
accessibility to hybridization
with complementary oligonucleotides using ribonuclease protection assays.
Complementary ribonucleic acid molecules and ribozymes of the invention may be
prepared by any method known in the art for the synthesis of nucleic acid
molecules. These
include techniques for chemically synthesizing oligonucleotides such as solid
phase
phosphoramidite chemical synthesis. Alternatively, RNA molecules may be
generated by
in vitro and in vivo transcription of DNA sequences encoding ScRM. Such DNA
sequences may
be incorporated into a wide variety of vectors with suitable RNA polymerase
promoters such as
T7 or SP6. Alternatively, these cDNA constructs that synthesize complementary
RNA,
constitutively or inducibly, can be introduced into cell lines, cells, or
tissues.
RNA molecules may be modified to increase intracellular stability and half
life. Possible
modifications include, but are not Limited to, the addition of flanking
sequences at the 5' and/or 3'
ends of the molecule, or the use of phosphorothioate or 2' O-methyl rather
than phosphodiesterase
IS linkages within the backbone of the molecule. This concept is inherent in
the production of PNAs
and can be extended in all of these molecules by the inclusion of
nontraditional bases such as
inosine, queosine, and wybutosine, as well as acetyl-, methyl-, thio-, and
similarly modified forms
of adenine, cytidine, guanine, thymine, and uridine which are not as easily
recognized by
endogenous endonucleases.
Many methods for introducing vectors into cells or tissues are available and
equally
suitable for use inin vivo, in vitro, and ex vivo. For ex vivo therapy,
vectors may be introduced into
stem cells taken from the patient and clonally propagated for autologous
transplant back into that
same patient. Delivery by transfection, by liposome injections, or by
polycationic amino polymers
may be achieved using methods which are well known in the art. (See, e.g.,
Goldman, C.K. et al.
( 1997) Nature Biotechnology 15:462-466.)
Any of the therapeutic methods described above may be applied to any subject
in need of
such therapy, including, for example, mammals such as dogs, cats, cows,
horses, rabbits,
monkeys, and most preferably, humans.
An additional embodiment of the invention relates to the administration of a
pharmaceutical or sterile composition, in conjunction with a phanmaceutically
acceptable carrier,
for any of the therapeutic effects discussed above. Such pharmaceuticat
compositions may consist
of ScRM, antibodies to ScRM, and mimetics, agonists, antagonists, or
inhibitors of ScRM. The
compositions may be administered alone or in combination with at least one
other agent, such as a
stabilizing compound, which may be administered in any sterile, biocompatible
pharmaceutical
carrier including, but not limited to, saline, buffered saline, dextrose, and
water. The compositions
-30-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
may be administered to a patient alone, or in combination with other agents,
drugs, or hormones.
The pharmaceutical compositions utilized in this invention may be administered
by any
number of routes including, but not limited to, oral, intravenous,
intramuscular, intra-arterial,
intramedullary, intrathecal, intraventricular, transdermal, subcutaneous,
intraperitoneal, intranasal,
enteral, topical, sublingual, or rectal means.
In addition to the active ingredients, these pharmaceutical compositions may
contain
suitable pharmaceutically-acceptable carriers comprising excipients and
auxiliaries which
facilitate processing of the active compounds into preparations which can be
used
pharmaceutically. Further details on techniques for formulation and
administration may be found
in the latest edition of Remineton's Pharmaceutical Sciences (Maack Publishing
Co., Easton, PA).
Pharmaceutical compositions for oral administration can be formulated using
pharmaceutically acceptable carriers well known in the art in dosages suitable
for oral
administration. Such carriers enable the pharmaceutical compositions to be
formulated as tablets,
pills, dragees, capsules, liquids. gels, syrups, slurries, suspensions, and
the like, for ingestion by
the patient.
Pharmaceutical preparations for oral use can be obtained through combining
active .
compounds with solid excipient and processing the resultant mixture of
granules (optionally, after
grinding) to obtain tablets or dragee cores. Suitable auxiliaries can be
added, if desired. Suitable
excipients include carbohydrate or protein fillers, such as sugars, including
lactose, sucrose,
mannitol, and sorbitol; starch from corn, wheat, rice, potato, or other
plants; cellulose, such as
methyl cellulose, hydroxypropylmethyl-cellulose, or sodium
carboxymethylcellulose; gums,
including arabic and tragacanth; and proteins, such as gelatin and collagen.
If desired,
disintegrating or solubilizing agents may be added, such as the cross-linked
polyvinyl pyrrolidone,
agar, and aiginic acid or a salt thereof, such as sodium alginate.
Dragee cores may be used in conjunction with suitable coatings, such as
concentrated
sugar solutions, which may also contain gum arabic, talc,
polyvinylpyrrolidone, carbopol gel,
polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable
organic solvents or
solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee
coatings for
product identification or to characterize the quantity of active compound,
i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit capsules
made of
gelatin, as well as soft, sealed capsules made of gelatin and a coating, such
as glycerol or sorbitol.
Push-fit capsules can contain active ingredients mixed with fillers or
binders, such as lactose or
starches, lubricants, such as talc or magnesium stearate, and, optionally,
stabilizers. In soft
capsules, the active compounds may be dissolved or suspended in suitable
liquids, such as fatty
oils, liquid, or liquid polyethylene glycol with or without stabilizers.
-31-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
Pharmaceutical formulations suitable for parenteral administration may be
formulated in
aqueous solutions, preferably in physiologically compatible buffers such as
Hanks's solution,
Ringer's solution, or physiologically buffered saline. Aqueous injection
suspensions may contain
substances which increase the viscosity of the suspension, such as sodium
carboxymethyl
cellulose, sorbitol, or dextran. Additionally, suspensions of the active
compounds may be
prepared as appropriate oily injection suspensions. Suitable lipophilic
solvents or vehicles include
fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl
oleate, triglycerides, or
liposomes. Non-lipid polycationic amino polymers may also be used for
delivery. Optionally, the
suspension may also contain suitable stabilizers or agents to increase the
solubility of the
compounds and allow for the preparation of highly concentrated solutions.
For topical or nasal administration, penetrants appropriate to the particular
barrier to be
permeated are used in the formulation. Such penetrants are generally known in
the art.
The pharmaceutics! compositions of the present invention may be manufactured
in a
manner that is known in the art, e.g., by means of conventional mixing,
dissolving, granulating,
dragee-making, Ievigating, emulsifying, encapsulating, entrapping, or
lyophilizing processes.
The pharmaceutical composition may be provided as a salt and can be formed
with many
acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic,
tartaric, malic, and
succinic acid. Salts tend to be more soluble in aqueous or other protonic
solvents than are the
corresponding free base forms. In other cases, the preferred preparation may
be a lyophilized
powder which may contain any or all of the following: 1 mM to 50 mM histidine,
0.1 % to 2%
sucrose, and 2% to 7% mannitol, at a pH range of 4.5 to 5.~, that is combined
with buffer prior to
use.
After pharmaceutical compositions have been prepared, they can be placed in an
appropriate container and labeled for treatment of an indicated condition. For
administration of
ScRM, such labeling would include amount, frequency, and method of
administration.
Pharmaceutical compositions suitable for use in the invention include
compositions
wherein the active ingredients are contained in an effective amount to achieve
the intended
purpose. The determination of an effective dose is well within the capability
of those skilled in the
art.
For any compound, the therapeutically effective dose can be estimated
initially either in
cell culture assays, e.g., of neoplastic cells or in animal models such as
mice, rats, rabbits, dogs, or
pigs. An animal model may also be used to determine the appropriate
concentration range and
route of administration. Such information can then be used to determine useful
doses and routes
for administration in humans.
A therapeutically effective dose refers to that amount of active ingredient,
for example
-32-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
ScRM or fragments thereof, antibodies of ScRM, and agonists, antagonists or
inhibitors of ScRM,
which ameliorates the symptoms or condition. Therapeutic efficacy and toxicity
may be
determined by standard pharmaceutical procedures in cell cultures or with
experimental animals,
such as by calculating the EDS° (the dose therapeutically effective in
50% of the population) or
LD,° (the dose lethal to 50% of the population) statistics. The dose
ratio of therapeutic to toxic
effects is the therapeutic index, and it can be expressed as the
EDs°/LD,° ratio. Pharmaceutical
compositions which exhibit large therapeutic indices are preferred. The data
obtained from cell
culture assays and animal studies are used to formulate a range of dosage for
human use. The
dosage contained in such compositions is preferably within a range of
circulating concentrations
that includes the ED,° with little or no toxicity. The dosage varies
within this range depending
upon the dosage form employed, the sensitivity of the patient, and the route
of administration.
The exact dosage will be determined by the practitioner, in light of factors
related to the
subject requiring treatment. Dosage and administration are adjusted to provide
sufficient levels of
the active moiety or to maintain the desired effect. Factors which may be
taken into account
I S include the severity of the disease state, the general health of the
subject, the age, weight, and
gender of the subject, time and frequency of administration, drug
combination(s), reaction
sensitivities, and response to therapy. Long-acting pharmaceutical
compositions may be
administered every 3 to 4 days, every week, or biweekly depending on the half
life and clearance
rate of the particular formulation.
Normal dosage amounts may vary from about 0.1 ug to 100,000 /cg, up to a total
dose of
about 1 gram, depending upon the route of administration. Guidance as to
particular dosages and
methods of delivery is provided in the literature and generally available to
practitioners in the art.
Those skilled in the art will employ different formulations for nucleotides
than for proteins or their
inhibitors. Similarly, delivery of polynucleotides or polypeptides will be
specific to particular
cells, conditions, locations, etc.
DIAGNOSTICS
In another embodiment, antibodies which specifically bind ScRM may be used for
the
diagnosis of disorders characterized by expression of ScRM, or in assays to
monitor patients being
treated with ScRM or agonists, antagonists, or inhibitors of ScRM. Antibodies
useful for
diagnostic purposes may be prepared in the same manner as described above for
therapeutics.
Diagnostic assays for ScRM include methods which utilize the antibody and a
label to detect
ScRM in human body fluids or in extracts of cells or tissues. The antibodies
may be used with or
without modification, and may be labeled by covalent or non-covalent
attachment of a reporter
molecule. A wide variety of reporter molecules, several of which are described
above, are known
-33-
CA 02333471 2001-O1-15
WO 00/04135 PCTNS99/16164
in the art and may be used.
A variety of protocols for measuring ScRM, including ELISAs, RIAs, and FRCS,
are
known in the art and provide a basis for diagnosing altered or abnormal levels
of ScRM
expression. Normal or standard values for ScRM expression are established by
combining body
fluids or cell extracts taken from normal mammalian subjects, preferably
human, with antibody to
ScRM under conditions suitable for complex formation The amount of standard
complex
formation may be quantitated by various methods, preferably by photometric
means. Quantities of
ScRM expressed in subject, control, and disease samples from biopsied tissues
are compared with
the standard values. Deviation between standard and subject values establishes
the parameters for
diagnosing disease.
In another embodiment of the invention, the polynucleotides encoding ScRM may
be used
for diagnostic purposes. . The polynucleotides which may be used include
oligonucleotide
sequences, complementary RNA and DNA molecules, and PNAs. The polynucleotides
may be
used to detect and quantitate gene expression in biopsied tissues in which
expression of ScRM
may be correlated with disease. The diagnostic assay may be used to determine
absence,
presence, and excess expression of ScRM, and to monitor regulation of ScRM
levels during
therapeutic intervention.
In one aspect, hybridization with PCR probes which are capable of detecting
polynucleotide sequences, including genomic sequences, encoding ScRM or
closely related
molecules may be used to identify nucleic acid sequences which encode ScRM.
The specificity of
the probe, whether it is made from a highly specific region, e.g., the 5'
regulatory region, or from a
less specific region, e.g., a conserved motif, and the stringency of the
hybridization or
amplification (maximal, high, intermediate, or low), will determine whether
the probe identifies
only naturally occurring sequences encoding ScRM, allelic variants, or related
sequences.
Probes may also be used for the detection of related sequences, and should
preferably
have at least 50% sequence identity to any of the ScRM encoding sequences. The
hybridization
probes of the subject invention may be DNA or RNA and may be derived from the
sequences of
SEQ ID N0:3, SEQ ID N0:4, or from genomic sequences including promoters,
enhancers, and
introns of the ScRM gene.
Means for producing specific hybridization probes for DNAs encoding ScRM
include the
cloning of polynucleotide sequences encoding ScRM or ScRM derivatives into
vectors for the
production of mRNA probes. Such vectors are known in the art, are commercially
available, and
may be used to synthesize RNA probes in vitro by means of the addition of the
appropriate RNA
polymerases and the appropriate labeled nucleotides. Hybridization probes may
be labeled by a
variety of reporter groups, for example, by radionuclides such as'ZP or'sS, or
by enzymatic labels,
-39-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
such as alkaline phosphatase coupled to the probe via avidin/biotin coupling
systems, and the like.
Polynucleotide sequences encoding ScRM may be used for the diagnosis of a
disorder
associated with expression of ScRM. Examples of such a disorder include, but
are not limited to,
cell proliferative disorders such as actinic keratosis, arteriosclerosis,
atherosclerosis, bursitis,
cirrhosis, hepatitis, mixed connective tissue disease (MCTD), myelofibrosis,
paroxysmal nocturnal
hemoglobinuria, polycythemia vera, psoriasis, primary thrombocythemia, and
cancers including
adenocarcinoma, leukemia, lymphoma, melanoma, myeioma, sarcoma,
teratocarcinoma, and, in
particular, cancers of the adrenal gland, bladder, bone, bone marrow, brain,
breast, cervix, gall
bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle,
ovary, pancreas,
parathyroid, penis, prostate, salivary glands, skin, spleen, testis, thymus,
thyroid, and uterus; and
immune disorders such as acquired immunodeficiency syndrome (AIDS), Addison's
disease, adult
respiratory distress syndrome, allergies, ankylosing spondylitis, amyloidosis,
anemia, asthma,
atherosclerosis, autoimmune hemolytic anemia, autoimmune thyroiditis,
bronchitis, cholecystitis,
contact dermatitis, Crohn's disease, atopic dermatitis, dermatomyositis,
diabetes mellitus.
emphysema, episodic iymphopenia with lymphocytotoxins, erythroblastosis
fetalis, erythema
nodosum, atrophic gastritis, glomerulonephritis, Goodpasture's syndrome, gout,
Graves' disease,
Hashimoto's thyroiditis, hypereosinophilia, irritable bowel syndrome, multiple
sclerosis,
myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis,
osteoporosis,
pancreatitis, polymyositis, psoriasis, Reiter's syndrome, rheumatoid
arthritis, scieroderma,
Sjogren's syndrome, systemic anaphylaxis, systemic lupus erythematosus,
systemic sclerosis,
thrombocytopenic purpura, ulcerative colitis, uveitis, Werner syndrome,
complications of cancer,
hemodialysis, and extracorporeal circulation, viral, bacterial, fungal,
parasitic, protozoal, and
helminthic infections, and trauma. The polynucieotide sequences encoding ScRM
may be used in
Southern or Northern analysis, dot blot, or other membrane-based technologies;
in PCR
technologies; in dipstick, pin, and ELISA assays; and in microarrays utilizing
fluids or tissues
from patients to detect altered ScRM expression. Such qualitative or
quantitative methods are well
known in the art.
In a particular aspect, the nucleotide sequences encoding ScRM may be useful
in assays
that detect the presence of associated disorders, particularly those mentioned
above. The
nucleotide sequences encoding ScRM may be labeled by standard methods and
added to a fluid or
tissue sample from a patient under conditions suitable for the formation of
hybridization
complexes. After a suitable incubation period, the sample is washed and the
signal is quantitated
and compared with a standard value. If the amount of signal in the patient
sample is significantly
altered in comparison to a control sample then the presence of altered levels
of nucleotide
sequences encoding ScRM in the sample indicates the presence of the associated
disorder. Such
-35-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/1 b164
assays may also be used to evaluate the efficacy of a particular therapeutic
treatment regimen in
animal studies, in clinical trials, or to monitor the treatment of an
individual patient.
In order to provide a basis for the diagnosis of a disorder associated with
expression of
ScRM, a normal or standard profile for expression is established. This may be
accomplished by
combining body fluids or cell extracts taken from normal subjects, either
animal or human, with a
sequence, or a fragment thereof, encoding ScRM, under conditions suitable for
hybridization or
amplification. Standard hybridization may be quantified by comparing the
values obtained from
normal subjects with values from an experiment in which a known amount of a
substantially
purified polynucleotide is used. Standard.values obtained in this manner may
be compared with
values obtained from samples from patients who are symptomatic for a disorder.
Deviation from
standard values is used to establish the presence of a disorder.
Once the presence of a disorder is established and a treatment protocol is
initiated,
hybridization assays may be repeated on a regular basis to determine if the
level of expression in
the patient begins to approximate that which is observed in the normal
subject. The results
obtained from successive assays may be used to show the efficacy of treatment
over a period
ranging from several days to months.
With respect to cancer, the presence of a relatively high amount of transcript
in biopsied
tissue from an individual may indicate a predisposition for the development of
the disease, or may
provide a means for detecting the disease prior to the appearance of actual
clinical symptoms. A
more definitive diagnosis of this type may allow health professionals to
employ preventative
measures or aggressive treatment earlier thereby preventing the development or
further
progression of the cancer.
Additional diagnostic uses for oligonucleotides designed from the sequences
encoding
ScRM may involve the use of PCR. These oligomers may be chemically
synthesized, generated
enzymatically, or produced in vitro. Oligomers will preferably contain a
fragment of a
polynucleotide encoding SeRM, or a fragment of a polynucleotide complementary
to the
polynucleotide encoding ScRM, and wilt be employed under optimized conditions
for
identification of a specific gene or condition. Oligomers may also be employed
under less
stringent conditions for detection or quantitation of closely related DNA or
RNA sequences.
Methods which may also be used to quantitate the expression of ScRM include
radiolabeling or biotinylating nucleotides, coamplification of a control
nucleic acid, and
interpolating results from standard curies. (See, e.g., Melby, P.C. et al.
(1993) J. Immunol.
Methods 159:235-244; and Duplaa, C, et al. (1993) Anal. $iochem. 229-236.) The
speed of
quantitation of multiple samples may be accelerated by running the assay in an
ELISA format
where the oligomer of interest is presented in various dilutions and a
spectrophotometric or
-36-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
colorimetric response gives rapid quantitation.
In further embodiments, oligonucleotides or longer fragments derived from any
of the
polynucleotide sequences described herein may be used as targets in a
microarray. The
microarray can be used to monitor the expression level of large numbers of
genes simultaneously
and to identify genetic variants, mutations, and polymorphisms. This
information may be used to
determine gene function, to understand the genetic basis of a disorder, to
diagnose a disorder, and
to develop and monitor the activities of therapeutic agents.
Microarrays may be prepared, used, and analyzed using methods known in the
art. (See,
e.g., Brennan, T.M. et al. ( 1995) U.S. Patent No. 5,474,796; Schena, M. et
al. ( 1996) Proc. Natl.
Acad. Sci. 93:10614-10619; Baldeschweiier et al. ( 1995) PCT application
W095/251116; Shalon,
D. et al. ( 1995) PCT application W095/35505; Heller, R.A. et al. (1997) Proc.
Natl. Acad. Sci.
94:2150-2155; and Heller, M.J. et al. (1997) U.S. Patent No. 5,605,662.)
In another embodiment of the invention, nucleic acid sequences encoding ScRM
may be
used to generate hybridization probes useful in mapping the naturally
occurring genomic
sequence. The sequences may be mapped to a particular chromosome, to a
specific region of a
chromosome, or to artificial chromosome constructions, e.g., human artificial
chromosomes
(HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes
(BACs), bacterial
P1 constructions, or single chromosome cDNA libraries. (See, e.g., Price, C.M.
(1993) Blood
Rev. 7:127-134; and Trask, B.J. ( 1991 ) Trends Genet. 7:149-154.)
Fluorescent in situ hybridization (FISH) may be correlated with other physical
chromosome mapping techniques and genetic map data. (See, e.g., Heinz-Ulrich,
et al. (1995) in
Meyers, R.A. led.) Molecular Bioloev and Biotechnoloev, VCH Publishers New
York, NY, pp.
965-968.) Examples of genetic map data can be found in various scientific
journals or at the
Online Mendelian Inheritance in Man (OMIM) site. Correlation between the
Location of the gene
encoding ScRM on a physical chromosomal map and a specific disorder, or a
predisposition to a
specific disorder, may help define the region of DNA associated with that
disorder. The
nucleotide sequences of the invention may be used to detect differences in
gene sequences among
normal, carrier, and affected individuals.
In situ hybridization of chromosomal preparations and physical mapping
techniques, such
as linkage analysis using established chromosomal markers, may be used for
extending genetic
maps. Often the placement of a gene on the chromosome of another mammalian
species, such as
mouse, may reveal associated markers even if the number or arm of a particular
human
chromosome is not known. New sequences can be assigned to chromosomal arms by
physical
mapping. This provides valuable information to investigators searching for
disease genes using
positional cloning or other gene discovery techniques. Once the disease or
syndrome has been
-37-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
crudely localized by genetic linkage to a particular genomic region, e.g.,
ataxia-teiangiectasia to
I 1q22-23, any sequences mapping to that area may represent associated or
regulatory genes for
further investigation. (See, e.g., Gatti, R.A. et al. ( 1988) Nature 336:577-
580.) The nucleotide
sequence of the subject invention may also be used to detect differences in
the chromosomal
location due to translocation, inversion, etc., among normal, carrier, or
affected individuals.
In another embodiment of the invention, ScRM, its catalytic or immunogenic
fragments,
or oligopeptides thereof can be used for screening libraries of compounds in
any of a variety of
drug screening techniques. The fragment employed in such screening may be free
in solution,
affixed to a solid support, borne on a cell surface, or located
intracellularly. The formation of
binding complexes between ScRM and the agent being tested may be measured.
Another technique for drug screening provides for high throughput screening of
compounds having suitable binding affinity to the protein of interest. (See,
e.g., Geysen, et al.
( 1984) PCT application W084/03564.) In this method, large numbers of
different small test
compounds are synthesized on a solid substrate, such as plastic pins or some
other surface. The
I S test compounds are reacted with ScRM, or fragments thereof, and washed.
Bound ScRM is then
detected by methods well known in the art. Purified ScRM can also be coated
directly onto plates
for use in the aforementioned drug screening techniques. Alternatively, non-
neutralizing
antibodies can be used to capture the peptide and immobilize it on a solid
support.
In another embodiment, one may use competitive drug screening assays in which
neutralizing antibodies capable of binding ScRM specifically compete with a
test compound for
binding ScRM. In this manner, antibodies can be used to detect the presence of
any peptide which
shares one or more antigenic determinants with ScRM.
In additional embodiments, the nucleotide sequences which encode ScRM may be
used in
any molecular biology techniques that have yet to be developed, provided the
new techniques rely
on properties of nucleotide sequences that are currently known, including, but
not limited to, such
properties as the triplet genetic code and specific base pair interactions.
Without further elaboration, it is believed that one skilled in the art can,
using the
preceding description, utilize the present invention to its fullest extent.
The following preferred
specific embodiments are, therefore, to be construed as merely illustrative,
and not limitative of
the remainder of the disclosure in any way whatsoever.
The disclosures of all patents, applications, and publications mentioned above
and below,
in particular U.S. Ser. No. [Attorney Docket No. PF-0559 P], filed July 16,
1998, are hereby
expressly incorporated by reference.
-38-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
EXAMPLES
I. cDNA Library Construction
LUNGNOT03
The LUNGNOT03 cDNA library was constructed using RNA isolated from non-
tumorous
lung tissue removed from a 79 year old Caucasian male. Pathology for the
associated tumor
revealed a grade four carcinoma with Hlirthle cells that had metastasized from
thyroid cancer.
Patient history included a benign prostate neoplasm and atherosclerosis.
OVARNOT03
The OVARNOT03 cDNA library was constructed using RNA isolated from non-
tumorous
ovary tissue obtained from a 43 year old Caucasian female during fallopian
tube and ovary
removal. Pathology for the associated tumor tissue indicated grade two
mucinous
cystadenocarcinoma. Patient history included viral hepatitis, cerebrovascular
disease,
atherosclerosis and mitral valve disorder. Family history included
atherosclerotic coronary artery
disease, pancreatic cancer, stress reaction, cerebrovascular disease, breast
cancer, and uterine
cancer.
LUNGNOT03 and OVARNOT03
The frozen tissue was homogenized and lysed using a Brinkmann Homogenizes
Polytron
PT-3000 (Brinkmann Instruments, Westbury NJ). The lysate was centrifuged over
a 5.7 M CsCI
cushion using a Beckman SW28 rotor in a Beckman L8-70M Ultracentrifuge
(Beckman
Instruments) for 18 hours at 25,000 rpm at ambient temperature. The RNA was
extracted with
phenol chloroform at either pH 8.0 (LUNGNOT03) or pH 4.0 (OVARNOT03),
precipitated using
sodium acetate and ethanol, resuspended in RNAse-free water, and treated with
DNase. The RNA
was re-extracted with phenol chloroform and precipitated as before. Poly(A+)
RNA was isolated
using the Qiagen Oligotex kit (QIAGEN inc., Chatsworth CA).
Poly(A+) RNA was used for cDNA synthesis and library construction according to
the
recommended protocols in the Superscript plasmid system (Cat. #18248-013, Life
Technologies,
Gaithersburg, MD). cDNAs were fractionated on a Sepharose CL4B column (Cat.
#275105-O1,
Pharmacia Amersham Biotech, Piscataway, NJ) and those cDNAs exceeding 400 by
were ligated
into pSPORTI (Life Technologies, Inc.) and subsequently transformed into
DHSaT"' competent
cells (Cat. # 18258-012, Life Technologies).
-39-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
II. Isolation of cDNA Clones
Plasmid DNA was released from the cells and purified using the Miniprep Kit
(Catalog
#77468; Advanced Genetic Technologies Corporation, Gaithersburg MD). This kit
consists of a
96-well block with reagents for 960 purifications. The recommended protocol
was employed
except for the following changes: 1 ) the bacteria were cultured in 1 ml of
sterile Terrific Broth
(Catalog #22711, LIFE TECHNOLOGIESTM) with carbenicillin at 25 mglL and
glycerol at 0.4%;
2) after the cultures were incubated for 24 hours, the cells were lysed with
60 ~I of lysis buffer, 3)
centrifugation for 5 minutes at 2900 rpm using a Beckman GS-6R rotor was
performed before the
block contents were added to the primary filter plate; and 4) addition of
isopropanol to TRIS
buffer was not routinely performed. The DNA samples were stored at 4°C.
III. Sequencing and Analysis
The cDNAs were prepared for sequencing using either an ABI PRISM CATALYST 800
(Perkin-Elmer Applied Biosystems, Foster City, CA) or a MICROLAB 2200
(Hamilton Co., Reno,
NV) sequencing preparation system in combination with Peltier PTC-200 thermal
cyclers (MJ
Research, Inc., Watertown, MA). The cDNAs were sequenced using the ABI PRISM
373 or 377
sequencing systems and ABI protocols, base calling software, and kits (Perkin-
Elmer Applied
Biosystems). Alternatively, solutions and dyes from Amersham Pharmacia
Biotech, Ltd. were
used in place of the ABI kits. In some cases, reading frames were determined
using standard
methods (Ausubel, supra). Some of the cDNA sequences were selected for
extension using the
techniques disclosed in Example V.
The polynucleotide sequences derived from cDNA, extension, and shotgun
sequencing
were assembled and analyzed using a combination of software programs which
utilize algorithms
well known to those skilled in the art. Table 1 summarizes the software
programs used,
corresponding algorithms, references, and cutoff parameters used where
applicable. The
references cited in the third column of Table 1 are incorporated by reference
herein. Sequence
alignments were also analyzed and produced using MACDNASIS PRO software
(Hitachi
Software Engineering Co., Ltd. San Bruno, CA) and the multisequence alignment
program of
LASERGENE software (DNASTAR Inc, Madison WI).
The polynucleotide sequences were validated by removing vector, linker, and
polyA tail
sequences and by masking ambiguous bases, using algorithms and programs based
on BLAST,
dynamic programing, and dinucleotide nearest neighbor analysis. The sequences
were then
queried against a selection of public databases such as GenBank primate,
rodent, mammalian,
vertebrate, and eukaryote databases, and BLOCKS to acquire annotation, using
programs based
on BLAST, FASTA, and BLIMPS. The sequences were assembled into full length
-90-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
polynucleotide sequences using programs based on Phred, Phrap, and Consed, and
were screened
for open reading frames using programs based on GeneMark, BLAST, and FASTA.
This was
followed by translation of the full length polynucleotide sequences to derive
the corresponding full
length amino acid sequences. These full length polynucleotide and amino acid
sequences were
subsequently analyzed by querying against databases such as the GenBank
databases described
above and SwissProt, BLOCKS, PRINTS, PFAM, and Prosite.
IV. Northern Analysis
Northern analysis is a laboratory technique used to detect the presence of a
transcript of a
gene and involves the hybridization of a labeled nucleotide sequence to a
membrane on which
RNAs from a particular cell type or tissue have been bound. (See, e.g.,
Sambrook, supra, ch. 7;
and Ausubel, supra, ch. 4 and 16.)
Electronic northerns were produced using analogous computer techniques. These
techniques apply BLAST to search for identical or related molecules in
nucleotide databases such
as GenBank or LIFESEQTM database (Incyte Pharmaceuticals). The sensitivity of
the computer
search was modified to determine the specificity of the match. The basis of
the search is the
product score, which is defined as:
se4uence identity x % maximum BLAST score
100
The product score encompasses both the degree of similarity between two
sequences and the
length of the sequence match. For example, with a product score of 40, the
match may have a
possibility of a I% to 2% error, in contrast, a product score of 70 indicates
that the match will be
exact. Similar molecules were identified by product scores between I S and 40,
although lower
scores may identify related molecules.
Electronic northern analysis further involved the categorization of cDNA
libraries by
organ/tissue and disease. The organ/tissue categories included cardiovascular,
dermatologic,
developmental, endocrine, gastrointestinal, hematopoietic/immune,
musculoskeletal, nervous,
reproductive, and urologic. The disease categories included cancer,
inflammation/trauma, fetal,
neurological, and pooled. For each category, the number of libraries
expressing the sequence of
interest was divided by the total number of libraries across all categories.
The results above were
reported as a percentage distribution.
-91-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/1b164
V. Extension of ScRM Encoding Polynucleotides
The full length nucleic acid sequences of SEQ ID N0:3 and SEQ ID N0:4 were
produced
by extension of an appropriate fragment of the full length molecule, using
oligonucleotide primers
designed from this fragment. One primer was synthesized to initiate extension
of an antisense
polynucleotide, and the other was synthesized to initiate extension of a sense
polynucleotide.
Primers were used to facilitate the extension of the known sequence "outward"
generating
amplicons containing new unknown nucleotide sequence for the region of
interest. The initial
primers were designed from the cDNA using OLIGOTM 4.06 (National Biosciences,
Plymouth,
MN), or another appropriate program, to be about 22 to 30 nucleotides in
length, to have a GC
content of about 50% or more, and to anneal to the target sequence at
temperatures of about 68°C
to about 72 °C. Any stretch of nucleotides which would result in
hairpin structures and primer-
primer dimerizations was avoided.
Selected human cDNA libraries (GIBCO BRL) were used to extend the sequence. If
more
than one extension is necessary or desired, additional sets of primers are
designed to further
extend the known region.
High fidelity amplification was obtained by following the instructions for the
XL-PCRTM
kit {The Perkin-Elmer Corp., Norwalk, CT) and thoroughly mixing the enzyme and
reaction mix.
PCR was performed using the PTC-200 thermal cycler (MJ Research, Inc.,
Watertown, MA),
beginning with 40 pmol of each primer and the recommended concentrations of
all other
components of the kit, with the following parameters:
Step 1 94 C for 1 min (initial denaturation)
Step 2 65 C for 1 min
Step 3 68 C for 6 min
Step 4 94 C for 15 sec
Step 5 65 C for I min
Step 6 68 C for 7 min
Step 7 Repeat steps 4 through 6 for an
additional 15 cycles
Step 8 94 C for 15 sec
Step 9 65 C for 1 min
Step 10 68 C for 7:15 min
Step I 1 Repeat steps 8 through 10 for an
additional 12 cycles
Step 12 72 C for 8 min
Step 13 4 C (and holding)
A 5 /.cl to 10 ul aliquot of the reaction mixture was analyzed by
electrophoresis on a low
concentration (about O.b% to 0.8%) agarose mini-gel to determine which
reactions were successful
in extending the sequence. Bands thought to contain the largest products were
excised from the
gel, purified using QIAQUICKTM (QIAGEN Inc.), and trimmed of overhangs using
Klenow
enzyme to facilitate religation and cloning.
-42-
CA 02333471 2001-O1-15
WO (10/04135 PCT/US99/16164
After ethanol precipitation, the products were redissolved in 13 ~1 of
ligation buffer, I~cl
T4-DNA ligase (IS units) and 1~1 T4 poiynucleotide kinase were added, and the
mixture was
incubated at room temperature for 2 to 3 hours, or overnight at 16° C.
Competent E. colt cells (in
40 ui of appropriate media) were transformed with 3 /cl of ligation mixture
and cultured in 80 ul
of SOC medium. (See, e.g., Sambrook, su~~ra, Appendix A, p. 2.) After
incubation for one hour at
37°C, the E. oli mixture was plated on Luria Bertani (LB) agar (See,
e.g., Sambrook, supra,
Appendix A, p. 1) containing carbeniciltin (2x carb): The following day,
several colonies were
randomly picked from each plate and cultured in 150 ~cl of liquid LB/2x carb
medium placed in an
individual well of an appropriate commercially-available sterile 96-well
microtiter plate. The
following day, 5 ~I of each overnight culture was transferred into a non-
sterile 96-well plate and,
after dilution 1:10 with water, 5 ~I From each sample was transferred into a
PCR array.
For PCR amplification, 18 ~cl of concentrated PCR reaction mix (3.3x)
containing 4 units
of rTth DNA polymerase, a vector primer, and one or both of the gene specific
primers used for
the extension reaction were added to each well. Amplification was performed
using the following
conditions:
Step 1 94 C for 60 sec
Step 2 94 C for 20 sec
Step 3 55 C for 30 sec
Step 4 72 C for 90 sec
Step 5 Repeat steps 2 through 4 for an
additional 29 cycles
Step 6 72 C for 180 sec
Step 7 4 C (and holding)
Aliquots of the PCR reactions were run on agarose gels together with molecular
weight
markers. The sizes of the PCR products were compared to the original partial
cDNAs, and
appropriate clones were selected, ligated into plasmid, and sequenced.
In like manner, the the nucleotide sequences of SEQ ID N0:3 and SEQ ID N0:4
are used
to obtain S' regulatory sequences using the procedure above, oligonucieotides
designed for 5'
extension, and an appropriate genomic library.
VI. Labeling and Use of Individual Hybridization Probes
Hybridization probes derived from SEQ ID N0:3 and SEQ ID N0:4 are employed to
screen cDNAs, genomic DNAs, or mRNAs. Although the labeling of
oligonucleotides, consisting
of about 20 base pairs, is specifically described, essentially the same
procedure is used with larger
nucleotide fragments. Oligonucleotides are designed using state-of the-art
software such as
OLIGOT'" 4.06 software (National Biosciences) and labeled by combining SO pmol
of each
oiigomer, 250 ~Ci of [y-'~P] adenosine triphosphate (Amersham, Chicago, IL),
and T4
-43-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
polynucleotide kinase (DuPont NEN~, Boston, MA). The labeled oligonucleotides
are
substantially purified using a SephadexTM G-25 superfine size exclusion
dextran bead column
(Pharmacia & Upjohn, Kalamazoo, MI). An aliquot containing 10' counts per
minute of the
labeled probe is used in a typical membrane-based hybridization analysis of
human genomic DNA
digested with one ofthe following endonucleases: Ase I, Bgl II, Eco RI, Pst I,
Xbal, or Pvu II
(DuPont NEN, Boston, MA).
The DNA from each digest is fractionated on a 0.7% agarose gel and transferred
to nylon
membranes (Nytran Plus, Schleicher & Schuell, Durham, NH). Hybridization is
carried out for 16
hours at 40°C. To remove nonspecific signals, blots are sequentially
washed at room temperature
under increasingly stringent conditions up to 0.1 x saline sodium citrate and
0.5% sodium dodecyl
sulfate. After XOMAT ARTM film (Kodak, Rochester, NY) is exposed to the blots
to film for
several hours, hybridization patterns are compared visually.
VII. Microarrays
A chemical coupling procedure and an ink jet device can be used to synthesize
array
elements on the surface of a substrate. (See, e.g., Baldeschweiler, supra.) An
array analogous to a
dot or slot blot may also be used to arrange and link elements to the surface
of a substrate using
thermal, UV, chemical, or mechanical bonding procedures. A typical array may
be produced by
hand or using available methods and machines and contain any appropriate
number of elements.
After hybridization, nonhybridized probes are removed and a scanner used to
determine the levels
and patterns of fluorescence. The degree of complementarily and the relative
abundance of each
probe which hybridizes to an element on the microarray may be assessed through
analysis of the
scanned images.
Full-length cDNAs, Expressed Sequence Tags (ESTs), or fragments thereof may
comprise the elements of the microarray. Fragments suitable for hybridization
can be selected
using software well known in the art such as LASERGENET"'. Full-length cDNAs,
ESTs, or
fragments thereof corresponding to one of the nucleotide sequences of the
present invention, or
selected at random from a cDNA library relevant to the present invention, are
arranged on an
appropriate substrate, e.g., a glass slide. The cDNA is fixed to the slide
using, e.g., UV cross-
linking followed by thermal and chemical treatments and subsequent drying.
(See, e.g., Schena,
M. et al. ( 1995) Science 270:467-470; and Shalon, D. et al. ( 1996) Genome
Res. 6:639-645.)
Fluorescent probes are prepared and used for hybridization to the elements on
the substrate. The
substrate is analyzed by procedures described above.
_99_
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
VIII. Complementary Polynucleotides
Sequences complementary to the ScRM-encoding sequences, or any parts thereof,
are
used to detect, decrease, or inhibit expression of naturally occurring ScRM.
Although use of
oligonucleotides comprising from about I S to 30 base pairs is described,
essentially the same
procedure is used with smaller or with larger sequence fragments. Appropriate
oligonucleotides
are designed using OLIGOTM 4.06 software and the coding sequence of ScRM. To
inhibit
transcription, a complementary oligonucleotide is designed from the most
unique 5' sequence and
used to prevent promoter binding to the coding sequence. To inhibit
translation, a complementary
oligonucleotide is designed to prevent ribosomal binding to the ScRM-encoding
transcript.
IX. E:pression of ScRM
Expression and purification of ScRM is achieved using bacterial or virus-based
expression systems. For expression of ScRM in bacteria, cDNA is subcloned into
an appropriate
vector containing an antibiotic resistance gene and an inducible promoter that
directs high levels
of cDNA transcription. Examples of such promoters include, but are not limited
to, the trp-lac
(tac) hybrid promoter and the TS or T7 bacteriophage promoter in conjunction
with the lac
operator regulatory element. Recombinant vectors are transformed into suitable
bacterial hosts,
e.g., BL21(DE3). Antibiotic resistant bacteria express ScRM upon induction
with isopropyl beta-
D-thiogalactopyranoside (IPTG). Expression of ScRM in,eukaryotic cells is
achieved by infecting
insect or mammalian cell lines with recombinant A_utographica californica
nuclear polyhedrosis
virus (AcMNPV), commonly known as baculovirus. The nonessential polyhedrin
gene of
baculovirus is replaced with cDNA encoding ScRM by either homologous
recombination or
bacterial-mediated transposition involving transfer plasmid intermediates.
Viral infectivity is
maintained and the strong polyhedrin promoter drives high levels of cDNA
transcription.
Recombinant baculovirus is used to infect Spodoptera frqgiperda (Sf9) insect
cells in most cases,
or human hepatocytes, in some cases. Infection of the latter requires
additional genetic
modifications to baculovirus. (See Engelhard, E. K. et al. ( 1994) Proc. Natl.
Acad. Sci. USA
91:3224-3227; Sandig, V. et al. (1996) Hum. Gene Ther. 7:1937-1945.)
In most expression systems, ScRM is synthesized as a fusion protein with,
e.g.,
glutathione S-transferase (GST) or a peptide epitope tag, such as FLAG or 6-
His, permitting rapid,
single-step, affinity-based purification of recombinant fusion protein from
crude cell lysates.
GST, a 26-kilodalton enzyme from Schistosoma~aponicum, enables the
purification of fusion
proteins on immobilized glutathione under conditions that maintain protein
activity and
antigenicity (Phanmacia, Piscataway, NJ). Following purification, the GST
moiety can be
proteolytically cleaved from ScRM at specifically engineered sites. FLAG, an 8-
amino acid
-45-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
peptide, enables immunoaffiniry purification using commercially available
monoclonal and
polyclonal anti-FLAG antibodies (Eastman Kodak, Rochester, NY). 6-His, a
stretch of six
consecutive histidine residues, enables purification on metal-chelate resins
(QIAGEN Inc,
Chatsworth, CA). Methods for protein expression and purification are discussed
in Ausubel, F. M.
et al. (1995 and periodic supplements) Current Protocols in Molecular Biology,
John Wiley &
Sons, New York, NY, ch 10, t 6. Purified ScRM obtained by these methods can be
used directly
in the following activity assay.
X. Demonstration of ScRM Activity
ScRM activity is measured by the oxidation of NADPH to NADP in the presence of
substrate. (Kunau and Dommes ( 1978) Eur. J. Biochem. 91:533-544.) ScRM is
preincubated for
10 min. at 37 °C.in 60 PM potassium phosphate (pH 7.4), 125 nM NADPH,
and 0.2 IeM CoASH.
The reaction is started by addition of substrate ( 12.5 to 150 pM final
concentration). Change in
absorbance at 340 nm, due to the oxidation of NADPH to NADP, is measured using
a
spectrophotometer at 23 °C. Units of ScRM activity are expressed as
umoles of NADP foamed per
i5 minute. A reaction lacking ScRM is used as a control. ScRM may increase or
decrease the level
ofNADPH oxidation, relative to the control, depending on the substrate used.
XI. Functional Assays
ScRM function is assessed by expressing the sequences encoding ScRM at
physiologically elevated levels in mammalian cell culture systems. cDNA is
subcloned into a
mammalian expression vector containing a strong promoter that drives high
levels of cDNA
expression. Vectors of choice include pCMV SPORTT"' (Life Technologies,
Gaithersburg, MD)
and pCRTM 3.1 (Invitrogen, Carlsbad, CA, both of which contain the
cytomegalovirus promoter.
5-10 ~g of recombinant vector are transiently transfected into a human cell
line, preferably of
endothelial or hematopoietic origin, using either liposome formulations or
electroporation. 1-2 ~cg
of an additional plasmid containing sequences encoding a marker protein are co-
transfected.
Expression of a marker protein provides a means to distinguish transfected
cells from
nontransfected cells and is a reliable predictor of cDNA expression from the
recombinant vector.
Marker proteins of choice include, e.g., Green Fluorescent Protein {GFP)
(Clontech, Palo Alto,
CA), CD64, or a CD64-GFP fusion protein. Flow cytometry (FCM), an automated,
laser optics-
based technique, is used to identify transfected cells expressing GFP or CD64-
GFP, and to
evaluate properties, for example, their apoptotic state. FCM detects and
quantifies the uptake of
fluorescent molecules that diagnose events preceding or coincident with cell
death. These events
include changes in nuclear DNA content as measured by staining of DNA with
propidium iodide;
-4 6-
CA 02333471 2001-O1-15
WO 00104135 PCT/US99/16164
changes in cell size and granularity as measured by forward Tight scatter and
90 degree side light
scatter; down-regulation of DNA synthesis as measured by decrease in
bromodeoxvuridine
uptake; alterations in expression of cell surface and intracellular proteins
as measured by reactivity
with specific antibodies; and alterations in plasma membrane composition as
measured by the
binding of fluorescein-conjugated Annexin V protein to the cell surface.
Methods in flow
cytometry are discussed in Ormerod, M. G. (1994) Flow Cvtometrv, Oxford, New
York, NY.
The influence of ScRM on gene expression can be assessed using highly purified
populations of cells transfected with sequences encoding ScRM and either CDb4
or CD64-GFP.
CD64 and CD64-GFP are expressed on the surface of transfected cells and bind
to conserved
regions of human immunoglobulin G (IgG). Transfected cells are efficiently
separated from
nontransfected cells using magnetic beads coated with either human IgG or
antibody against CD64
(DYNAL, Lake Success, NY). mRNA can be purifed from the cells using methods
well known
by those of skill in the art. Expression of mRNA encoding ScRM and other genes
of interest can
be analyzed by Northern analysis or microarray techniques.
IS XII. Production of ScRM Specific Antibodies
ScRM substantially purified using polyacrylamide gel electrophoresis
(PAGEXsee, e.g.,
Harrington, M.G. (1990) Methods Enzymol. 182:488-495), or other purification
techniques, is
used to immunize rabbits and to produce antibodies using standard protocols.
Alternatively, the ScRM amino acid sequence is analyzed using LASERGENETM
software (DNASTAR lnc.) to determine regions of high immunogenicity, and a
corresponding
oligopeptide is synthesized and used to raise antibodies by means known to
those of skill in the
art. Methods for selection of appropriate epitopes, such as those near the C-
terminus or in
hydrophilic regions are well described in the art. (See, e.g., Ausubel supra,
ch. I I.)
Typically, oligopeptides IS residues in length are synthesized using an
Applied
Hiosystems Peptide Synthesizer Model 431A using fmoc-chemistry and coupled to
ICLH (Sigma,
St. Louis, MO) by reaction with N-maleimidobenzoyl-N-hydroxysuccinimide ester
(MBS) to
increase immunogenicity. (See, e.g., Ausubel supra.) Rabbits are immunized
with the
oligopeptide-ICi.H complex in complete Freund's adjuvant. Resulting antisera
are tested for
antipeptide activity by, for example, binding the peptide to plastic, blocking
with 1% BSA,
reacting with rabbit antisera, washing, and reacting with radio-iodinated goat
anti-rabbit IgG.
XIII. Purification of Naturally Occurring ScItM Using Specific Antibodies
Naturally occurring or recombinant ScRM is substantially purified by
immunoaffinity
chromatography using antibodies specific for ScRM. An immunoaffinity column is
constructed
-47-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
by covalently coupling anti-ScltM antibody to an activated chromatographic
resin, such as
CNBr-activated Sepharose (Pharmacia & Upjohn). After the coupling, the resin
is blocked and
washed according to the manufacturer's instructions.
Media containing ScRM are passed over the immunoaffinity column, and the
column is
washed under conditions that allow the preferential absorbance of ScRM (e.g.,
high ionic strength
buffers in the presence of detergent). The column is eluted under conditions
that disrupt
antibody/ScRM binding (e.g., a buffer of pH 2 to pH 3, or a high concentration
of a chaotrope,
such as urea or thiocyanate ion), and ScRM is collected.
XIV. Identification of Molecules Which Interact with ScRM
ScRM, or biologically active fragments thereof, are labeled with 'ZSI Bolton-
Hunter
reagent. (See, e.g., Bolton et al. (1973) Biochem. J. 133:529.) Candidate
molecules previously
arrayed in the wells of a multi-well plate are incubated with the labeled
SciIIVI, washed, and any
wells with labeled ScRM complex are assayed. Data obtained using different
concentrations of
ScRM are used to calculate values for the number, affinity, and association of
ScRM with the
candidate molecules.
Various modifications and variations of the described methods and systems of
the
invention will be apparent to those skilled in the art without departing from
the scope and spirit of
the invention. Although the invention has been described in connection with
specific preferred
embodiments, it should be understood that the invention as claimed should not
be unduly limited
to such specific embodiments. Indeed, various modifications of the described
modes for carrying
out the invention which are obvious to those skilled in molecular biology or
related fields are
intended to be within the scope of the following claims.
-98-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
T
K
x ~ 11 r
L = .. ;~ C
~
_ C ~- " x ~ a r,
y
r. C J z ._~ 'p C
r.'
II G
.'~yS~J' O~.w~ C.N
~ .
Z ~. Y ~ t ~ 0(: ' II
% C. ~
.
.F. > C _ II ' ' ~ p ~ ~ es
~ ~ C ~ .~
~ y. ~ '
. _ OGII>
>1 e5 m. e. '
a'~ yd
>i
.'l
x '
. u
v: s ~ = r ' x .c :c
c.. a 9 ;.,'~ x
"~'
Z t '~ ~ w ~ L 3 C L r
r ' t
_ ~ L
a i ~ ~~ n ~ s
C ~
~ C s ~' ~ ~ ~ iI
a iI
_ ~ E ~ >
f.~ a ~ ~, ~ 04 ' 2
~- ~ a ~ ~
~
0a. ~ ' ~ W a os =
~'i ~ ~
4 "~
C Vii
>
. ._ t
. v: tW a
'' ~3~~ :~ W h
_
ri ~ a ~ a r~
x ',~r '",
C x
'
_ x . ~ ~ r
. ~ a
a Y a a
Y ~ .. . ~e ~ ~ -;
E ~ v ~~~ C/
. . :
~ ~ ~
~ = -_
Z~
a a ~. a X x v ,~"..' ~
~t '~ ;~
na ni
~ ~-x .Cw- a u vLLa
_ _ ~; N ~ S .
L" C7 is rte. ,3 4 = ~ -:
~ ~~ N ' a ~
f~. N
~ .:
u a s N vi x = V s 1~.
~ C v ' ~ v
-
c
_ ' r. ~ , a a ,
. . ' Q'
c: e' :
m
c ~ ~ ~ ,; ~ C7 a
a ~= v . c ~ ' ~ St
~ 4a: ~ x Y v j
~ < < _ c 'c f-
< < V a < ~ ~ C n
~
~ .,
V U ~ ..' _ ~:; _ r
~ .t , L
~
7
= ~; ~ c,; Y v, ~
.. t
3
~ ~ ~ V
::1 si: - ~ <
W r~ V <
J ~ gF=
, . ~ _ N
C ~ c v,~ 3
~ ~ .
~ _
Y ,~ _ ~ V Z ~V~~< =0f
~ a ~Q '
V
i
0J ' ' a ~ ~ ~ ea ~ ~E a ~ a
~ .~ ~ ~ ~ z
x . <
_ ::. a ev Z a Z .r v, x a ~. ~e
L < ~ " =
Z
s
.
~ ~ -
eo
~' a
a ~E '
y~ o
se s
. ii
v. . ~
~ c
V ~ ~' ~ r
~ ~ e~' ~
~ j .3 7 V
~. ' ~
~ t
C
s ~ e~e u~ ~~' .
7.
v r ~ ..~ f n r a
r c~
a ~ c
'~
t= " a
~'~. !: ;
:J
C 7 C G L r _ !
a ' _ ' ~c
a E
Z C4
L .3 E t a
- ~ r. 0
L
C . a 4
~ ~ a ~ a ~
'
J :J A C _ 'r 'C '
? ~ C
~ ~
V .C C ~ x t
~ ' .~ ~
>
. ' ~ j
a ~
> ' '~ a .E ~ ' a
~'S ~ ~ v:
C ~ n' a ~ ~ :r
~ > r
,e0 ~ G ~ ~ ~y ~
J
' 7 ~ Y ~ K > e~
,i ~ < r .> >, v> ~
c v O CO
",-
c
~ c ~ a ~ e~L- ac.=.~
~" A~~= .
e
p t ~ ~ ~ ~ -
~' ~E
~
_o ~ 'n.'~sE ' '~ ~ ~.
. ~~ c _
'
G EE C,~. ~ =' " Ne ~.c'=c eecs
~ ~''m '
y' ~ . $ = ~ ~ ~
~ v ~
~
.~ ~ ~ ;,. c
G ~ 3 x .l
d
in '
~
s G . y ",
E _ ~ m .~
~ '
< < a 'rn < ~ v ~ ~ y, !
r Ca '_ r L
v
p .
L
L
'
rte. a
OC v
~
_ r
V u.
r < <
v 'y' .,
n
< <
< E- < r.
v:
x _ y .
v c
G < < < m
_
-49-
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
r
.J
'' v
'u . 'u
'
u
~ ~
'r. o A
o 'p
''
r C ~ .G
v
_ a
~t
x x ~ c'
a a '~ ~ v'~
v:
:J
> V7 0G
< ~ ~ 'v n
vC C
vi C
v>,r= o~~'e
~' a
C .. LL
ii: n L C
v C", ' ' V ~ a C
C nr
,r x n t- R
v ~ E a ~ = 0
oe 3
~ c
a m = a N > U
x ~ v 3 H ~ C7
< . C? m >-' n ~
a c .
C
0' _ ob v: ~ .
~ p: ~ $; ~ 3 y
x e N oo ~ o:
~
T = _ a v ~
~ ~ ~3 ~ .~ Q ~3
~, C ~~
v ~ ~
' v _ A !E ~' '
m N . Y; !f, 0C N Q ' Q
!3 ' ~ C
~ A T V;
V = (O N a a i s
, V ~ .,.' a C . _.
N < N A ~,0
T.
V
Y _ _
C , aC t= n' ~ .' = a a
~ ~ ~' $ ~ - Cr
~ o~'
V ~ ~ ~ - N
~
y .yi ~ oo ~ ~; ~ ~ ,c ~ ~
~' a a L 0 suo
~ ' m ~ p
~ r'~'
'' C -~ ' v ' ~ Q ~ _ c
G = < a ~ ~ v . a
i ~ n a
: <
G ;: ;:. f ~ c~ z ac
t < 3 ~e ~ _ C . o:
v~ r ::
u ..
. .
a ~ ~ _sT a ...
a ~
G G
~u G
!e
?,~ EZ H ~,L e~d
~ G r
pD ~ ~
0'
N 1. G _ :J
I n'
< f S o4
C
.
y ,C .Y 04 3
~ Z E T 3
'G ~
j _
A~ j a ~ '
~ ~~~
~
. j ~
~ ,
3 w a C ~
's E a
~ t ~ C .E
p
v L a
v. v Z a ~ a J
m ~3 ~ ~ v
.~ ~r x
.
~3 o''u o ~ e'. e'e
u a
_~ l ~ , K
C V ~ _
Z ~ C
. ~ ~ a w
RE
a s '~ _. 3 ' E
G C n ~ a a s v v.
a a 0G ~
a s a .r r a ro
eo _ c~ i~ = a _u i v
~" ~ ~~ a w
_ L ~ _ ' .
'- L ~ ~ N ~ yJ
~
' ~~ ~ ~ ~ < . <
~
.. < < <v a s
V J .- _
ac ~ ~ r.
_ V H
-50-
CA 02333471 2001-O1-15
WO 00/04135 PC'T/US99/16164
SEQUENCE LISTING
<110> INCYTE PHARMACEUTICALS, INC.
BANDMAN, Olga
TANG, Y. Tom
CORLEY, Neil C.
AZIMZAI, Yalda
BAUGHN, Mariah R.
<120> SCAD-RELATED MOLECULES
<130> PF-0559 PCT
<140> To Be Assigned
<141> Herewith
<150> 09/116,750: Unassigned
<151> 1998-07-16: 1998-07-16
<160> 6
<170> FastSEQ for Windows Version 3.0
<210> i
<211> 278
<212> PRT
<213> HOMO SAPIENS
<220>
<221> mist feature
<223> Incyte Clone No: 1240869
<300>
<900> 1
Mit His Met Ala A5g Leu Leu Gly Leu Cys Ala Trp Ala Arg Lys Ser
15
Val Arg Met Ala Ser Ser Arg Met Thr Arg Arg Asp Pro Leu Thr Asn
25 30
Lys Val Ala Leu Val Thr Ala Ser Thr Asp Gly Ile Gly Phe Ala Ile
35 40 45
Ala Arg Arg Leu Ala Gln Asp Arg Ala His Val Val Val Ser Ser Arg
50 55 60
Lys Gln Gln Asn Val Asp Gln Ala Val Ala Thr Leu Gln Gly Glu Gly
65 70 75
Leu Ser Val Thr Gly Thr Val Cys His Val Gly Lys Ala Glu Asp Arg
85 90 95
Glu Arg Leu Val Ala Thr Ala Val Lys Leu His Gly Gly Ile Asp Ile
100 105 110
Leu Val Ser Asn Ala Ala Val Asn Pro Phe Phe Gly Ser Ile Met Asp
115 120 125
Val Thr Glu Glu Val Trp Asp Lys Thr Leu Asp Ile Asn Val Lys Ala
130 135 140
Pro Ala Leu Met Thr Lys Ala Val Val Pro Glu Met Glu Lys Arg Gly
195 150 155 160
Gly Gly Ser Val Val Ile Val Ser Ser Ile Ala Ala Phe Ser Pro Ser
165 170 175
Pro Gly Phe Ser Pro Tyr Asn Val Ser Lys Thr Ala Leu Leu Gly Leu
180 185 190
Asn Asn Thr Leu Ala Ile Glu Leu Ala Pro Arg Asn Ile Arg Val Asn
195 200 205
Cys Leu Ala Pro Gly Leu Ile Lys Thr Ser Phe Ser Arg Met Leu Trp
210 215 220
1/7
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
Met Asp Lys Glu Lys Glu Glu Ser Met Lys Glu Thr Leu Arg Ile Arg
225 230 235 2qp
Arg Leu Gly Glu Pro Glu Asp Cys Ala Gly Ile Val Ser Phe Leu Cys
245 250 255
5er Glu Asp Ala Ser Tyr Ile Thr Gly Glu Thr Val Val Val Gly Gly
260 265 270
Gly Thr Pro Ser Arg Leu
275
<210> 2
<211> 569
<212> PRT
<213> HOMO SAPIENS
<220>
<221> misc feature
<223> Incyte Clone No: 2060002
<300>
<400> 2
Mit Ser Tyr Pro A5a Asp Asp Tyr Glu Ser Glu Ala Ala Tyr Asp Pro
15
Tyr Ala Tyr Pro Ser Asp Tyr Asp Met His Thr Gly Asp Pro Lys Gln
25 30
Asp Leu Ala Tyr Glu Arg Gln Tyr Glu Gln Gln Thr Tyr Gln Val Ile
35 40 45
Pro Glu Val Ile Lys Asn Phe Ile Gln Tyr Phe His Lys Thr Val Ser
50 55 60
Asp Leu Ile Asp Gln Lys Val Tyr Glu Leu Gln Ala Ser Arg Val Ser
65 70 75 BO
Ser Asp Val Ile Asp Gln Lys Val Tyr Glu Ile Gln Asp Ile Tyr Glu
85 90 95
Asn Ser Trp Thr Lys Leu Thr Glu Arg Phe Phe Lys Asn Thr Pro Trp
100 105 110
Pro Glu Ala Glu Ala Ile Ala Pro Gln Val Gly Asn Asp Ala Val Phe
115 120 125
Leu Ile Leu Tyr Lys Glu Leu Tyr Tyr Arg His Ile Tyr Ala Lys Val
130 135 190
Ser Gly Gly Pro Ser Leu Glu Gln Arg Phe Glu Ser Tyr Tyr Asn Tyr
145 150 155 160
Cys Asn Leu Phe Asn Tyr Ile Leu Asn Ala Asp Gly Pro Ala Pro Leu
165 170 175
Glu Leu Pro Asn Gln Trp Leu Trp Asp Ile Ile Asp Glu Phe Ile Tyr
180 185 190
Gln Phe Gln Ser Phe Ser Gln Tyr Arg Cys Lys Thr Ala Lys Lys Ser
195 200 205
Glu Glu Glu Ile Asp Phe Leu Arg Ser Asn Pro Lys Ile Trp Asn Val
210 215 220
His Ser Val Leu Asn Val Leu His Ser Leu Val Asp Lys Ser Asn Ile
225 230 235 240
Asn Arg Gln Leu Glu Val Tyr Thr Ser Gly Gly Asp Pro Glu Ser Val
245 250 255
Ala Gly Glu Tyr Gly Arg His Ser Leu Tyr Lys Met Leu Gly Tyr Phe
260 265 270
Ser Leu Val Gly Leu Leu Arg Leu His Ser Leu Leu Gly Asp Tyr Tyr
275 280 285
Gln Ala Ile Lys Val Leu Glu Asn Ile Glu Leu Asn Lys Lys Ser Met
290 295 300
305 Ser Arg Val Pro Glu Cys Gln Val Thr Thr Tyr Tyr Tyr Val Gly
310 315 320
Phe Ala Tyr Leu Met Met Arg Arg Tyr Gln Asp Ala Ile Arg Val Phe
325 330 335
Ala Asn Ile Leu Leu Tyr Ile Gln Arg Thr Lys Ser Met Phe Gln Arg
340 395 350
2/7
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
Thr Thr Tyr Lys Tyr Glu Met Ile Asn Lys Gln Asn Glu Gln Met His
355 360 365
Ala Leu Leu Ala Ile Ala Leu Thr Met Tyr Pro Met Arg Ile Asp Glu
370 375 380
Ser Ile His Leu Gln Leu Arg Glu Lys Tyr Gly Asp Lys Met Leu Arg
385 390 395 400
Met Gln Lys Gly Asp Pro Gln Val Tyr Glu Glu Leu Phe Ser Tyr Ser
405 410 415
Cys Pro Lys Phe Leu Ser Pro Val Val Pro Asn Tyr Asp Asn Val His
420 425 930
Pro Asn Tyr His Lys Glu Pro Phe Leu Gln Gln Leu Lys Val Phe Ser
935 490 945
Asp Glu Val Gln Gln Gln Ala Gln Leu Ser Thr Ile Arg Ser Phe Leu
450 455 460
Lys Leu Tyr Thr Thr Met Pro Val Ala Lys Leu Ala Gly Phe Leu Asp
465 470 475 480
Leu Thr Glu Gln Glu Phe Arg Ile Gln Leu Leu Val Phe Lys His Lys
485 990 995
Met Lys Asn Leu Val Trp Thr Ser Gly Ile Ser Ala Leu Asp Gly Glu
500 505 510
Phe Gln Ser Ala Ser Glu Val Asp Phe Tyr Ile Asp Lys Asp Met Ile
515 520 525
His Ile Ala Asp Thr Lys Val Ala Arg Arg Tyr Gly Asp Phe Phe Ile
530 535 590
Arg Gln Ile His Lys Phe Glu Glu Leu Asn Arg Thr Leu Lys Lys Met
545 550 555 560
Gly Gln Arg Pro
<210> 3
<211> 1280
<212> DNA
<213> HOMO SAPIENS
<220>
<221> mi.sc feature
<223> Incyte Clone No: 1240869
<300>
<400>
3
gagtggaacccagacttgctggtctgatccatgcacatggccaggctgctaggcctctgt60
gcctgggcacggaagtcggtgcggatggccagctccaggatgacccgccgggacccgctc120
acaaataaggtggccctggtaacggcctccaccgacgggatcggcttcgccatcgcccgg180
cgtttggcccaggacagggcccacgtggtcgtcagcagccggaagcagcagaatgtggac240
caggcggtggccacgctgcagggggaggggctgagcgtgacgggcaccgtgtgccatgtg300
gggaaggcggaggaccgggagcggctggtggccacggctgtgaagcttcatggaggtatc360
gatatcctagtctccaatgctgctgtcaaccctttctttggaagcataatggatgtcact920
gaggaggtgtgggacaagactctggacattaatgtgaaggccccagccctgatgacaaag980
gcagtggtgccagaaatggagaaacgaggaggcggctcagtggtgatcgtgtcttccata540
gcagccttcagtccatctcctggcttcagtccttacaatgtcagtaaaacagccttgctg600
ggcctcaacaataccctggccatagagctggccccaaggaacattagggtgaactgccta660
gcacctggacttatcaagactagcttcagcaggatgctctggatggacaaggaaaaagag720
gaaagcatgaaagaaaccctgcggataagaaggttaggcgagccagaggattgtgctggc780
atcgtgtctttcctgtgctctgaagatgccagctacatcactggggaaacagtggtggtg840
ggtggaggaaccccgtcccgcctctgaggaccgggagacagcccacaggccagagttggg900
ctctagctcctggtgctgttcctgcattcacccactggcctttcccacctctgctcacct960
tactgttcacctcatcaaatcagttctgccctgtgaaaagatccagccttccctgccgtc1020
aaggtggcgtcttactcgggattcctgctgttgttgtggccttgggtaaaggcctcccct1080
gagaacacaggacaggcctgctgacaaggctgagtctaccttggcaaagaccaagatatt1140
ttttcctgggccactggggaatctgaggggtgatgggagagaaggaacctggagtggaag1200
gagcagagttgcaaattaacaacttgcaaatgaggtgcaaataaaatgcagatgattgcg1260
cggctttgaaaaaaaaaaaa 1280
<210> 4
3/7
CA 02333471 2001-O1-15
WO 00/04135 PGT/US99/16164
<211> 1894
<212> DNA
<213> HOMO SAPIENS
<220>
<221> misc feature
<223> Incyte Clone No: 2060002
<300>
<400>
4
ctcgcaagcgaggcagccat.gtcttatcccgctgatgattatgagtctgaggcggcttat60
gacccctacgcttatcccagcgactatgatatgcacacaggagatccaaagcaggacctt120
gcttatgaacgtcagtatgaacagcaaacctatcaggtgatccctgaggtgatcaaaaac180
ttcatccagtatttccacaaaactgtctcagatttgattgaccagaaagtgtatgagcta240
caggccagtcgtgtctccagtgatgtcattgaccagaaggtgtatgagatccaggacatc300
tatgagaacagctggaccaagctgactgaaagattcttcaagaatacaccttggcccgag360
gctgaagccattgctccacaggttggcaatgatgctgtcttcctgattttatacaaagaa420
ttatactacaggcacatatatgccaaagtcagtgggggaccttccttggagcagaggttt480
gaatcctattacaactactgcaatctcttcaactacattcttaatgccgatggtcctgct590
ccccttgaactacccaaccagtggctctgggatattatcgatgagttcatctaccagttt600
cagtcattcagtcagtaccgctgtaagactgccaagaagtcagaggaggagattgacttt660
cttcgttccaatcccaaaatctggaatgttcatagtgtcctcaatgtccttcattccctg720
gtagacaaatccaacatcaaccgacagttggaggtatacacaagcggaggtgaccctgag780
agtgtggctggggagtatgggcggcactccctctacaaaatgcttggttacttcagcctg84p
gtcgggcttctccgcctgcactccctgttaggagattactaccaggccatcaaggtgctg900
gagaacatcgaactgaacaagaagagtatgtattcccgtgtgccagagtgccaggtcacc960
acatactattatgttgggtttgcatatttgatgatgcgtcgttaccaggatgccatccgg1020
gtcttcgccaacatcctcctctacatccagaggaccaagagcatgttccagaggaccacg1080
tacaagtatgagatgattaacaagcagaatgagcagatgcatgcgctgctggccattgcc1140
ctcacgatgtaccccatgcgtatcgatgagagcattcacctccagctgcgggagaaatat1200
ggggacaagatgttgcgcatgcagaaaggtgacccacaagtctatgaagaacttttcagt1260
tactcctgccccaagttcctgtcgcctgtagtgcccaactatgataatgtgcaccccaac1320
taccacaaagagcccttcctgcagcagctgaaggtgttttctgatgaagtacagcagcag1380
gcccagctttcaaccatccgcagcttcctgaagctctacaccaccatgcctgtggccaag1940
ctggctggcttcctggacctcacagagcaggagttccggatccagcttcttgtcttcaaa1500
cacaagatgaagaacctcgtgtggaccagcggtatctcagccctggatggtgaatttcag1560
tcagcctcagaggttgacttctacattgataaggacatgatccacatcgcggacaccaag1620
gtcgccaggcgttatggggatttcttcatccgtcagatccacaaatttgaggagcttaat1680
cgaaccctgaagaagatgggacagagaccttgatgatattcacacacattcaggaacctg1740
ttttgatgtattataggcaggaagtgtttttgctaccgtgaaacctttacctagatcagc1800
catcagcctgtcaactcagttaacaagttaaggaccgaagtgtttcaagtggatctcagt1860
aaaggatctttggagccagaaaaaaaaaaaaaaa 1894
<210> 5
<211> 280
<212> PRT
<213> HOMO SAPIENS
<300>
<308> g1079566
<400> 5
Met Leu Ser Ala Val Ala Arg Gly Tyr Gln Gly Trp Phe His Pro Cys
1 5 10 15
Ala Arg Leu Ser Val Arg Met Ser Ser Thr Gly Ile Asp Arg Lys Gly
20 25 30
Val Leu Ala Asn Arg Val Ala Val Val Thr Gly Ser Thr Ser Gly Ile
35 40 95
Gly Phe Ala Ile Ala Arg Arg Leu Ala Arg Asp Gly Ala His Val Val
50 55 60
Ile Ser Ser Arg Lys Gln Gln Asn Val Asp Arg Ala Met Ala Lys Leu
65 70 75 80
Gln Gly Glu Gly Leu Ser Val Ala Gly Ile Val Cys His Val Gly Lys
85 90 95
9/7
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
Ala Glu Asp Arg Glu Gln Leu Val Ala Lys Ala Leu Glu His Cys Gly
100 105 110
Gly Val Asp Phe Leu Val Cys Ser Ala Gly Val Asn Pro Leu Val Gly
115 120 125
Ser Thr Leu Gly Thr Ser Glu Gln Ile Trp Asp Lys Ile Leu Ser Val
130 135 140
Asn Val Lys Ser Pro Ala Leu Leu Leu Ser Gln Leu Leu Pro Tyr Met
145 150 155 160
Glu Asn Arg Arg Gly Ala Val Ile Leu Val Ser Ser Ile Ala Ala Tyr
165 170 175
Asn Pro Val Val Ala Leu Gly Val Tyr Asn Val Ser Lys Thr Ala Leu
180 18S 190
Leu Gly Leu Thr Arg Thr Leu Ala Leu Glu Leu Ala Pro Lys Asp Ile
195 200 205
Arg Val Asn Cys Val Val Pro Gly Ile Ile Lys Thr Asp Phe Ser Lys
210 215 220
Val Phe His Gly Asn Glu Ser Leu Trp Lys Asn Phe Lys Glu His His
225 230 235 240
Gln Leu Gln Arg Ile Gly Glu Ser Glu Asp Cys Ala Gly Ile Val Ser
245 250 255
Phe Leu Cys Ser Pro Asp Ala Ser Tyr Val Asn Gly Glu Asn Ile Ala
260 265 270
Val Ala Gly Tyr Ser Thr Arg Leu
275 280
<210> 6
<211> 938
<212> PRT
<213> CAENORHABDITIS ELEGANS
<300>
<308> 82731377
<900> 6
Met Ser Arg Arg Val Glu Phe Asp Leu Ser Thr Glu Asp His Ser Asp
1 5 10 15
Arg Arg Arg Thr Asn Thr Phe Ser Ser Asp Glu Asp Gly Val Pro Asn
20 25 30
Glu Val Ala Asp Tyr Leu Val Tyr Phe Ser Arg Met Val Asp Glu Gln
35 40 95
Asn Val Pro Glu Ile Leu Thr Leu Tyr Asp Gln Ala Phe Pro Asp Leu
50 55 60
Thr Glu Arg Phe Phe Arg Asp Arg Met Trp Pro Asp Glu Asn Val Val
65 70 75 80
Glu Arg Ile Ile Gly Pro Gly Asn Lys Leu Phe Ile Ile Leu Tyr Lys
85 90 95
Glu Leu Tyr Tyr Arg Gln Leu Tyr Ala Arg Asn Thr Arg Gly Pro Leu
100 105 110
Leu Val His Arg Tyr Glu Ser Phe Met Asn Tyr Gln Glu Leu Phe Ser
115 120 125
Glu Leu Leu Ser Ser Lys Asp Pro Ile Pro Leu Ser Leu Pro Asn Val
130 135 140
Trp Leu Trp Asp Ile Ile Asp Glu Phe Val Tyr Gln Phe Gln Ala Phe
195 150 155 160
Cys Leu Tyr Lys Ala Asn Pro Gly Lys Arg Asn Ala Asp Glu Val Glu
165 170 175
Asp Leu Ile Asn Ile Glu Glu Asn Gln Asn Ala Trp Asn Ile Tyr Pro
180 185 190
Val Leu Asn Ile Leu Tyr Ser Leu Leu Ser Lys Ser Gln Ile Val Glu
195 200 205
Gln Leu Lys Ala Leu Lys Glu Lys Arg Asn Pro Asp Ser Val Ala Asp
210 215 220
Glu Phe Gly Gln Ser Asp Leu Tyr Phe Lys Leu Gly Tyr Phe Ala Leu
225 230 235 240
Ile Gly Leu Leu Arg Thr His Val Leu Leu Gly Asp Tyr His Gln Ala
5/7
CA 02333471 2001-O1-15
WO 00/04135 PCT/US99/16164
245 250 255
Leu Lys Thr Val Gln Tyr Val Asp Ile Asp Pro Lys Gly Ile Tyr Asn
260 265 270
Thr Val Pro Thr Cys Leu Val Thr Leu His Tyr Phe Val Gly Phe Ser
275 280 285
His Leu Met Met Arg Asn Tyr Gly Glu Ala Thr Lys Met Phe Val Asn
290 295 300
Cys Leu Leu Tyr Ile Gln Arg Thr Lys Ser Val Gln Asn Gln Gln Pro
305 310 315 320
Ser Lys Lys Asn Phe Gln Tyr Asp Val Ile Gly Lys Thr Trp Asp Gln
325 330 335
Leu Phe His Leu Leu Ala Ile Cys Leu Ala Ile Gln Pro Gln Arg Ile
390 345 350
Asp Glu Ser Ile Ala Ser Gln Leu Ser Glu Arg Cys Gly Glu Arg Met
355 360 365
Met His Met Ala Asn Gly Asn Ile Asp Glu Phe Arg Asn Ala Phe Ala
370 375 380
Thr Gly Cys Pro Lys Phe Leu Ser Pro Thr Thr Val Val Tyr Glu Gly
385 390 395 400
Val Asn Gln Ser Lys Glu Pro Leu Leu Arg Gln Thr Gln Ser Phe Leu
405 410 415
G1u Gly Ile Glu Ser Gln Met Ala Leu Pro Val Leu Arg Gly Tyr Leu
420 425 930
Lys Leu Tyr Thr Thr Leu Pro Thr Lys Lys Leu Ala Ser Phe Met Asp
435 940 445
Val Asp Asp Glu His Tyr Asp Ser Phe Ile Gly Lys Leu Leu Thr Tyr
450 455 460
Lys Met Ile Val Asn Glu Leu Gly Lys Glu Ala Gly Pro Ser Ser Ala
465 970 475 980
Asp Asp Asp Glu Pro Gln Thr Asp Ile Asp Phe Tyr Val Asp Arg Asp
985 490 495
Met Ile Asn Ile Ala Asp Thr Lys Val Ala Arg His Val Gly Cys Ala
500 505 510
Gln Thr Thr Arg Tyr Pro Glu Thr Met Ile Leu Lys Lys Lys Phe Val
515 520 525
Gly Arg Thr Val Leu Ile Thr Gly Ala Ser Arg Gly Ile Gly Lys Glu
530 535 540
Ile Ala Leu Lys Leu Ala Lys Asp Gly Ala Asn Ile Val Val Ala Ala
545 550 555 560
Lys Thr Ala Thr Ala His Pro Lys Leu Pro Gly Thr Ile Tyr Ser Ala
565 570 575
Ala Glu Glu Ile Glu Lys Ala Gly Gly Lys Ala Leu Pro Cys Ile Val
580 585 590
Asp Val Arg Asp Glu Ala Ser Val Lys Ala Ser Val Glu Glu Ala Val
595 600 605
Lys Lys Phe Gly Gly Ile Asp Ile Leu Ile Asn Asn Ala Ser Ala Ile
610 615 620
Ser Leu Thr Asp Thr Glu Asn Thr Glu Met Lys Arg Tyr Asp Leu Met
625 630 635 690
His Ser Ile Asn Thr Arg Gly Thr Phe Leu Met Thr Lys Thr Cys Leu
695 650 655
Pro Tyr Leu Lys Ser Gly Lys Asn Pro His Val Leu Asn Ile Ser Pro
660 665 670
Pro Leu Leu Met Glu Thr Arg Trp Phe Ala Asn His Val Ala Tyr Thr
675 680 685
Met Ala Lys Tyr Gly Met Ser Met Cys Val Leu Gly Gln His Glu Glu
690 695 700
Phe Arg Pro His Gly Ile Ala Val Asn Ala Leu Trp Pro Leu Thr Ala
705 710 715 720
Ile Trp Thr Ala Ala Met Glu Met Leu Ser Asp Lys Gly Gly Glu Ala
725 730 735
Gly Ser Arg Lys Pro Ser Ile Met Ala Asp Ala Ala Tyr Ala Val Leu
740 745 750
Ser Lys Asn Ser Lys Asp Phe Thr Gly Asn Phe Cys Ile Asp Glu Asp
755 760 765
6/7
CA 02333471 2001-O1-15
WO 00/04135 PCTNS99/16164
Ile Leu Lys Ala Glu Gly Val Thr Asp Phe Asp Arg Tyr Ala Cys Val
770 775 780
Pro Asp Ala Pro Leu Met Pro Asp Phe Phe Ile Pro Ala Gly Thr Tyr
785 790 795 800
Asp His Lys Phe Ser Ser Gly Ala Gln Ile Gly Lys Lys Asn Lys Thr
805 slo 815
His Glu Ala Gly Val Val Glu Glu Glu Ile Lys Gln Ile Phe Thr Ser
820 825 830
Ala Lys Arg Leu Leu Asn Ala Asp Ile Val Lys Lys Thr Gly Phe Val
835 840 845
Tyr Glu Phe Leu Leu Lys Asp Pro Thr Thr Lys Ser Glu Arg Ile Ile
850 855 860
Thr Leu Asp Leu Lys Asn Gly Glu Gly Ala Leu Thr Asp Lys Lys AIa
865 870 B75 880
Ser Gly Lys Ala Asp Val Lys Phe Thr Leu Ala Pro Glu His Phe Ala
885 890 895
Pro Leu Phe Thr Gly Lys Leu Arg Pro Thr Thr Ala Leu Met Thr Lys
900 905 910
Lys Leu Gln Ile Ser Gly Asp Met Pro Gly Ala Met Lys Leu Glu Ser
915 920 925
Leu Leu Arg Lys Phe Thr Glu Gly Lys Leu
930 935
7/7
