Note: Descriptions are shown in the official language in which they were submitted.
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
TITLE OF THE INVENTION
MOUSE GROWTH HORMONE SECRETAGOGUE RECEPTOR
FIELD OF THE INVENTION
This invention relates to a newly identified receptor, the mouse
gowth hormone secretagogue receptor (mGHS-R), nucleic acids encoding this
receptor; and to the use of a mGHS-R to identify growth hormone secretagogues
and compounds that modulate mGHS-R function.
BACKGROUND OF THE INVENTION
Growth hormone secretagogues (GHSs) and secretagogue-like
compounds, both peptide and non-peptide, bind to and exert their biological
effects
(i.e., release of growth hormone (GH)) through a G protein-coupled receptor
(GPC-R)
distinct from the receptors for growth hormone releasing hormone (GHRH) and
somatostatin (SST) (Pong et al., 1996Mo1. Endocrin. 10:57-61). The molecular
cloning of this growth hormone secretagogue receptor (GHS-R) capitalized on
the
pivotal observation that GHSs transduce their signal through activation of the
phospholipase C pathway (Cheng et al., 1991 Endocrinology 129:3337-3342;
Howard
et al., 1996 Science 273:974-977). cDNA and genomic DNA cloning from human,
swine, and rat showed that the GHS-R is a protein of 364/366 amino acids
containing
7 putative alpha-helical transmembrane (TM) domains, a signature feature of
GPC-Rs
(Howard et al. 1996; McKee et al., 1997 Mol. Endocrin. 11:415-423). In all
species
evaluated, the GHS-R is encoded by a single highly-conserved gene containing
one
intron, placed at the C-terminal end of TM domain 5.
The biology of the growth hormone secretagogues (GHSs) is still in
a relatively early stage of development. Research is focused on identification
of
the GHS natural ligand system and understanding the role of the GHS-R in brain
regions (substantia nigra, dentate gyrus, hippocampus) other than those
traditionally thought to be involved in GH secretion (Bennett et al. 1997;
Guan et
a1.1997).
It would be desirable to know the molecular structure of growth
hormone secretagogue receptors in order to analyze this new receptor family
and
understand its normal physiological role in concert with the actions of GHRH
and
somatostatin. This could lead to a better understanding of the in vivo
processes
which occur upon ligand-receptor binding. Further, it would be desirable to
use
-1-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
cloned-growth hormone secretagogue receptors as essential components of an
assay system which can identify new growth hormone secretagogues which would
confer a significant benefit on children and adults deficient in growth
hormone, the
frail elderly, those in post-hip fracture rehabilitation and post-operative
recovery
patients.
DETAILED DESCRIPTION OF THE INVENTION
This invention relates to a novel receptor, mouse growth hormone
secretagogue receptor (mGHS-R), which is free from receptor associated
proteins.
A further aspect of this invention is mGHS-R which is isolated or purified.
Another aspect of this invention is mGHS-Rs which are encoded by
substantially the same nucleic acid sequence, but which have undergone changes
in
splicing or other RNA processing-derived modifications or mutagenesis induced
changes, so that the expressed protein has a homologous, but different amino
acid
sequence from the native form. These variant forms may have different and/or
additional fi~nctions in animal physiology or in vitro in cell based assays.
Growth hormone secretagogue receptors are proteins containing
various fiznctional domains, including one or more domains which anchor the
receptor in the cell membrane, and at least one ligand binding domain. As with
many receptor proteins, it is possible to modify many of the amino acids,
particularly those which are not found in the ligand binding domain, and still
retain
at least a percentage of the biological activity of the original receptor.
Thus, this
invention specifically includes modified functionally equivalent mGHS-Rs which
have deleted, truncated, or mutated N-terminal portions. This invention also
specifically includes modified fianctionally equivalent mGHS-Rs which contain
modified and/or deletions in other domains, which are not accompanied by a
loss
of functional activity.
Additionally, it is possible to modify other functional domains such
as those that interact with second messenger effector systems, by altering
binding
specificity and/or selectivity. Such fi~nctionally equivalent mutant receptors
are
also within the scope of this invention.
A further aspect of this invention are nucleic acids which encode a
mouse growth hormone secretagogue receptor or a fi~nctional equivalent. These
nucleic acids may be free from associated nucleic acids, or they may be
isolated or
purified. For most cloning purposes, cDNA is a preferred nucleic acid, but
this
-2-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
invention specifically includes other forms of DNA as well as RNAs which
encode
a mGHS-R or a fi~nctional equivalent.
Yet another aspect of this invention relates to vectors which
comprise nucleic acids encoding mGHS-R or a functional equivalent. These
vectors may be comprised of DNA or RNA; for most cloning purposes DNA
vectors are preferred. Typical vectors include plasmids, modified viruses,
bacteriophage and cosmids, yeast artificial chromosomes, transposable elements
and other forms of episomal or integrated DNA that can encode a mGHS-R. It is
well within the skill of the ordinary artisan to determine an appropriate
vector for a
particular gene transfer or other use.
A further aspect of this invention are host cells which are
transformed with a vector comprising a gene which encodes a mouse growth
hormone secretagogue receptor or a functional equivalent. The host cell may or
may not naturally express a GHS-R on the cell membrane. Preferably, once
transformed, the host cells are able to express the mouse growth hormone
secretagogue receptor or a functional equivalent on the cell membrane.
Depending
on the host cell, it may be desirable to adapt the DNA so that particular
codons are
used in order to optimize expression. Such adaptations are known in the art,
and
these nucleic acids are also included within the scope of this invention.
Generally,
mammalian cell lines, such as COS, HEK-293, CHO, HeLa, NS/0, CV-1, GC,
GH3 or VERO cells are preferred host cells, but other cells and cell lines
such as
Xenopus oocytes or insect cells, may also be used.
Another aspect of this invention is a process for identifying nucleic
acids encoding mouse growth hormone secretagogue related receptors comprising
hybridizing a first nucleic acid encoding a mouse growth hormone secretagogue
receptor with a second nucleic acid suspected of comprising nucleic acids
encoding
a growth hormone secretagogue receptor, wherein the hybridizing takes place
under relaxed or moderate post hybridizational washing conditions; and
identify
areas of the second nucleic acid where hybridization occurred.
BRIEF DESCRIPTION OF THE FIGURES
FIGURE 1 is the DNA sequence encoding the mouse GHS-R, 5'
and 3' flanking regions and the intron; SEQ ID NO:1.
FIGURE 2 is the DNA sequence encoding the open reading frame
(ORF) of the mouse GHS-R; SEQ ID N0:2.
-3-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
FIGURE 3 is the deduced amino acid sequence of the mouse GHS-
R; SEQ ID N0:3.
FIGURE 4 is an amino acid alignment of the mouse GHS-R with
other GHS-R's from several species (human - SEQ ID N0:4, rat - SEQ ID NO: 5,
and swine - SEQ ID N0:6).
As used throughout the specification and claims, the following
definitions shall apply:
Growth Hormone Secretagogue - any compound or agent that
directly or indirectly stimulates or increases the release of growth hormone
in an
animal.
Ligands-- any molecule which binds to the mGHS-R of this
invention. These ligands can have either agonist, partial agonist, partial
antagonist
or antagonist activity.
~ Free from receptor-associated proteins-- the receptor protein is not
in a mixture or solution with other membrane receptor proteins.
Free from associated nucleic acids-- the nucleic acid is not
covalently linked to DNA which it is naturally covalently linked in the
organism's
chromosome.
Isolated receptor--the protein is not in a mixture or solution with
any other proteins.
Isolated nucleic acid-- the nucleic acid is not in a mixture or
solution with any other nucleic acid.
Functional equivalent--a receptor which does not have the exact
same amino acid sequence of a naturally occurring mouse growth hormone
secretagogue receptor due to alternative splicing, deletions, mutations, or
additions, but retains at least 1%, preferably 10%, and more preferably 25% of
the
biological activity of the naturally occurnng receptor. Such derivatives will
have a
significant homology with a natural mGHS-R and can be detected by reduced
stringency hybridization with a DNA sequence obtained from a mGHS-R. The
nucleic acid encoding a functional equivalent has at least about 50% homology
at
the nucleotide level to a naturally occurring receptor nucleic acid.
Purified receptor-- the receptor is at least about 95% pure.
Purified nucleic acid-- the nucleic acid is at least about 95% pure.
-4-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
Standard or high stringency post hybridizational washing conditions
-- 6 X SSC at 55°C.
Moderate post hybridizational washing conditions --6 X SSC at
45°C.
Relaxed post hybridizational washing conditions -- 6 X SSC at
30°C.
The mouse isoform of the previously identified GHS-R was cloned
from two genomic DNA libraries for the generation of a GHS-R knock-out mouse.
This isoform has been shown to be functionally activated by secretagogues such
as
growth hormone releasing peptide GHRP-6 and MK-0677 through expression
studies of the complete and contiguous open reading frame of mGHS-R using the
aequorin biolumenescence assay. The proteins of this invention were found to
have structural features which are typical of the 7-transmembrane domain (TM)-
containing G-protein linked receptor superfamily (GPC-R's or 7-TM receptors),
including seven transmembrane regions, three intra- and extracellular loops,
and
the GPC-R protein signature sequence. Thus, mGHS-R, as an additional member
of the growth hormone secretagogue family of receptors, constitutes a new
member of the GPC-R family of receptors. Note not all regions are required for
functioning, and therefore this invention also comprises functional receptors
which
lack one or more non-essential domains.
Sequence analysis of the mGHS-R revealed, further, the presence of
a non-coding, intronic sequence at nt 790 corresponding to a splice-donor site
(G/GT) (Fig. 1). This sequence insertion occurs two amino acids after the
completion of the predicted transmembrane domain (TM) 5 (leucine-263), thus
dividing the ORF of the mouse GHS-R into an amino-terminal segment
(encompassing the extracellular domain, TM-1 through TM-5, and the first two
intra-and extra-cellular loops) and a carboxyl-terminal segment containing TM-
6,
TM-7, the third intra- and extra-cellular loops, and the intracellular domain.
The
point of insertion and flanking DNA sequence are highly conserved between
human, swine, rat and mouse. Comparison of the complete ORF encoding the
murine GHS-R type Ia protein sequence (Fig. 4) to rat, human and swine GHS-R
homologs reveals a high degree of sequence identity (mouse vs. rat, 99.5%;
mouse
vs. human 95%; mouse vs. swine 94%).
-5-
CA 02335272 2001-O1-10
WO 00/02918 PCTNS99/15375
The mGHS-Rs of this invention also share some sequence
homology with previously cloned GPC-receptors including the rat and human
neurotensin receptor (approximately 32 % identity) and the rat and human
thyrotropin releasing hormone (TRH) receptor (approximately 29 % identity).
The mGHS-R and fragments are immunogenic. Thus, another
aspect of this invention is antibodies and antibody fragments which can bind
to
mGHS-R or a mGHS-R fragment. These antibodies may be monoclonal antibodies
and produced using either hybridoma technology or recombinant methods. They
may be used as part of assay systems or to deduce the function of a mGHS-R
present on a cell membrane.
A further aspect of this invention are antisense oligonucleotides -
nucleotides which can bind to mGHS-R nucleotides and modulate receptor
function or expression.
A further aspect of this invention is a method of increasing the
amount of mGHS-Rs on a cell membrane comprising, introducing into the cell a
nucleic acid encoding a mGHS-R, and allowing expression of the mGHS-R.
A mGHS receptor, preferably immobilized on a solid support, may
be used diagnostically for the determination of the concentration of growth
hormone secretagogues, or metabolites thereof, in physiological fluids, e.g.
body
fluids, including serum, and tissue extracts, as for example in patients who
are
undergoing therapy with a growth hormone secretagogue.
The administration of a mGHS receptor to a patient may also be
employed for purposes of amplifying the net effect of a growth hormone
secretagogue by providing increased downstream signaling following
administration of the growth hormone secretagogue thereby diminishing the
required dosage of growth hormone secretagogue; or diminishing the effect of
an
overdosage of a growth hormone secretagogue during therapy.
Yet a further aspect of the present invention is a method of
identifying ligands comprising contacting the mGHS-R with a compound suspected
of being a ligand specific for said receptor and determining whether binding
occurs,
binding constituting a positive indication of the presence of a ligand.
Ligands detected using assays described herein may be used in the
treatment of conditions which occur when there is a shortage of growth
hormone,
such as observed in growth hormone deficient children, elderly patients with
-6-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
musculoskeletal impairment and those recovering from hip fracture, and
osteoporosis.
Targeted disruption of the mouse GHS-R gene may also prove
useful in elucidation of the mechanism of action and role of the growth
hormone
secretagogues in human and animal physiology.
The following, non-limiting Examples are presented to better
illustrate the invention.
EXAMPLE 1
Isolation of mouse GHS-R
A mouse (strain 129, liver) genomic library constructed in the
vector lamda Fix II (Stratagene) was screened under moderate stringency
hybridization
conditions with a complete ORF probe derived from the swine GHS-R. Nylon
filters
repesenting 1.2 x 106 PFU were hybridized overnight at 58°C in 6 X SSC
containing
10% dextran sulfate, 2% SDS, 0.5 M NaCI, and 100 p,g/ml salmon sperm DNA with
the random prime 32P-labeled swine GHS-R probe. Filters were washed in
4 X SSC, 1% SDS at room temerature for 20 minutes, 4 X SSC, 1% SDS at
55°C for
30 min, 2 X SSC, 1% SDS at 55°C for 30 min, and 2 X SSC, 1% SDS at
62°C for 30
min. Three positive clones were identified, phage DNA was isolated, and
partial DNA
sequencing performed to verify that they encoded the murine GHS-R gene. In
addition, a mouse genomic library constructed in a BAC vector and gridded in a
filter
array (Genome Systems, Inc) was screened under moderate stringency
hybridization
conditions as given above with a complete ORF probe dervived from the human
GHS-
R. A positive clone was identified from the BAC library.
-7-
CA 02335272 2001-O1-10
WO 00/0291$ PCT/US99/15375
EXAMPLE 2
Sequencing Of Mouse GHS-R
The BAC clone was sequenced with ABI Prism BigDye
terminator cycle sequencing ready reaction mix (P/N 4303149; PE Applied
Biosystems, Foster City, CA) using lp,g DNA/reaction, 5% DMSO, 100 ng primer -
standard cycle sequencing. Reactions were run on an ABI Prism 377 DNA
Sequencer
with XL Upgrade (ABI Prism 377XL).
DNA from the positive lambda clones was prepared from a
liquid lysate of the E. coli strain XLBIue MRA minus. For DNA sequencing, 500
ng
of DNA was used under the same conditions as given above.
EXAMPLE 3
Anal~rsis Of Mouse GHS-R Sequence
Sequence analysis revealed the presence of a non-coding,
intronic sequence at nt 790 corresponding to a splice-donor site (G/GT) (Fig.
1 ). This
sequence insertion occurs two amino acids after the completion of the
predicted
transmembrane domain (TIV)7 5 (leucine-263), thus dividing the ORF of the
mouse
GHS-R into an amino-terminal segment (encompassing the extracellular domain,
TM-1
through TM-S, and the first two intra-and extra-cellular loops) and a carboxyl-
terminal
segment containing TM-6, TM-7, the third intra- and extra-cellular loops, and
the
intracellular domain. The point of insertion and flanking DNA sequence are
highly
conserved between human, swine, rat and mouse. Comparison of the complete ORF
encoding the murine GHS-R type Ia protein sequence (Fig. 4) to rat, human and
swine
GHS-R homologs reveals a high degree of sequence identity (mouse vs. rat,
99.5%;
mouse vs. human 95%; mouse vs. swine 94%).
_g-
CA 02335272 2001-O1-10
WO 00/02918 PCTNS99/15375
EXAMPLE 4
Construction Of Mouse GHS-R Expression Plasmid
For expression studies in mammalian cells, a contiguous ORF
(Figs. 2 and 3) was assembled in the vector pcDNA-3 (Invitrogen) by
overlapping
PCR to remove the single intron present following nucleotide 790 of the ORF.
To
subclone, the Advantage HF PCR kit (K1909-1; Clonetech Laboratories, Inc, Palo
Alto, CA) was used under the following conditions: 94°C for i min;,
then 25 cycles of
the following: 94°C for 15 sec, 55°C for 15 sec, and 68°C
for 3 min. The primers used
were: primer 1- 5'GGG CCC GAA TTC GCC GCC ATG TGG AAC GCG ACG CCC
AGC 3' (SEQ 117 N0:7, including EcoR I site, Kozak initation sequence, and
translational start Met); primer 2- 5'CAC CAC CAC
AG C AAG CAT CTT CAC TGT CTG3' (SEQ ID N0:8; nucleotides shown in italic
type overlap exon 2); primer 3- 5'AAG ATG CTT G CT GTG GTG GTG TTT GCT
TTC ATC3' (SEQ ID N0:9; nucleotides shown in italic type overlap exon 1); and
primer 4- 5'AGT TTA GCG GCC GCT CAT GTA TTG ATG CTC GAC TTT GT3'
(SEQ ID NO:10, including Not I site and stop codon). "Overlapping" PCR was
performed. The first PCR reactions were performed with primers 1 and 2 (exon
1) or
3 and 4 (exon 2). The second PCR reactions were performed with primers 1 and 4
(ORF). The second product was digested with EcoRI and NotI, agarose gel
purified,
ethanol precipitated, phenol extracted, and Ggated into pcDNA3 with Ready-to-
Go T4
Ligase (27-0361-O1; Pharmacia, Piscataway, NJ), and transformed into SCS1
cells
(20023 l; Stratagene, La Jolla, CA). DNA was isolated with Wizard Plus
miniprep
(A1460; Promega, Madison, WI) and 500ng was sequenced as above, but without
DMSO.
-9-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
EXAMPLE 5
Functional Activity Of Mouse GHS-R
Measurement of mouse GHS-R expression in the aequorin-
expressing stable reporter cell line 293-AEQ17 (Button et al., 1993 Cell
Calcium
14:663-671.) was performed using a Luminoskan RT luminometer (Labsystems Inc.,
Gaithersburg, MD. 293-AEQ17 cells (8 x 105 cells plated 18 hr. before
transfection in
a T75 flask) were transfected with 22 p,g of pcDNA-3/mouse GHS-R plasmid DNA
and 264 p,g lipofectamine (Life Technologies). Forty hours after transfection,
the apo-
aequorin in the cells was charged for 1 hour with coelenterazine CP ( 10 NM)
under
reducing conditions (300 mM reduced glutathione) in ECB buffer (140 mM NaCI,
20
mM KCI, 20 mM HEPES-NaOH, pH=7.4, 5 mM glucose, 1 mM MgCl2, 1 mM
CaCl2, 0.1 mg/ml bovine serum albumin). The cells were harvested, washed once
in
ECB medium and resuspended to 500,000 cells/ml. One hundred (100) p,l of cell
suspension (corresponding to 5x104 cells) was then injected into each well of
a 96-
well microtiter test plate, and the integrated light emission was recorded
over 30
seconds, in 0.5 second units. Twenty (20) p,l of lysis buffer (0.1% final
Triton X-100
concentration) was then injected and the integrated light emission recorded
over 10
seconds, in 0.5 second units. The "fractional response" values for each well
were
calculated by taking the ratio of the integrated response to the initial
challenge to the
total integrated luminescence including the Triton X-100 lysis response. Data
were
analyzed using GraphPad Prism software V.2.0 (GraphPad Software, San Diego,
CA).
-10-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
SEQUENCE LISTING
<110> Merck & Co., Inc.
<120> MOUSE GROWTH HORMONE SECRETAGOGUE
RECEPTOR
<130> 20218 PCT
<150> 60/092,361
<151> 1998-07-10
<160> 10
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4009
<212> DNA
<213> Mus musculus
<400> 1
agagaggagccctcacacactcgctttgcagcgcctgccttccgcaagagcccacgcact 60
cggacgcttgtggggagcacgacaggcttgctggggcgagatctccagtgccaggcaact 120
gctggtggcgccgccgtttgagtgacaggtaagtgagtgcgtgacagtcgaggctgtatt 180
gggagaccgggactgtgtggggaagatagtgggaagggggaagaaaagagagatgtggga 240
gggaggggagaggaggaacggaaggaaatagggagagacgtgcagtgggtcactctcttc 300
ctttcatcgctaatgttcgcacccccattccaccttctcctaggcttcttctcacttctc 360
tcttccccaagcatccttcctgctgctcgcgcccattcctccccccacgccgccccccgc 420
ccggcccccactcttccgcgcctaggaggacctcctcaggggaccagatttccgcgcggc 480
tgcgaccccaagcctggcaacatgtggaacgcgacgcccagcgaggagccggagcctaac 540
gtcacgctggacctggactgggacgcttctcccggcaacgactcactctctgacgaactg 600
ctgccactgttccccgcgccgctgctggcgggcgtcactgccacctgcgtggcgctcttc 660
gtggtgggcatctcgggcaacctgctcaccatgctggtggtgtcccgcttccgcgagctg 720
CA 02335272 2001-O1-10
WO 00/02918 PCTNS99/15375
cgcaccaccaccaacctctacctatccagcatggccttctccgatctgctcatcttcctg780
tgcatgccgctggacctcgtccgcctctggcagtatcggccctggaacttcggcgacctg840
ctctgcaaactcttccagtttgtcagcgagagctgcacctacgccacggtcctcaccatc900
accgcgctgagcgtcgagcgctacttcgccatctgcttcccgctgcgggccaaggtggtg960
gtcaccaagggccgtgtgaagctggtcatccttgtcatctgggccgtggccttctgcagc1020
gcggggcccatcttcgtgctggtgggcgtggagcacgagaacggcacagatccccgggac1080
accaacgagtgccgcgccaccgagttcgctgtgcgctctgggctgctcaccgtcatggtg1140
tgggtgtccagcgtcttcttctttctaccggtcttctgcctcactgtgctctacagtctc1200
atcgggaggaagctatggcggagacgcggcgatgcagcggtgggcgcctcgctccgggac1260
cagaaccacaaacagacagtgaagatgcttggtgagttctgacaccccggtggcttttct1320
tcccccactgcttgctctttgccagagccctctatttctgtttctggtcgtctccatctc1380
tccctaagtctctcaagtctctgtctgtctctgyctctctsttggttcttggtctcactg1440
ctttckggttttttttcctctgtctgtccctgtatcttctccacgaaaaagcccctcata1500
ttggcaattccctaaatgagtactggtctgggaaatttggtccaagatggaaatacctca1560
ttatggtttattgagtcccctaattgttaayggtkymkcwymtwgwctcacatagaattt1620
gtggttatcmaagtmataatattaaggtaagcaggcaggyawtgggtttagaaatyrctc1680
catggtaartctaaccamaaawttgggtcactctgttaargaygryttatagatgtrttt1740
tgtttgtttkcaatattrggatttrttytctgccctgcmyctkyctcagataattacatc1800
cactcttgtttagtctatggttttgccaggaggggcttcatgctggggtctcctttttct1860
tgtttttgtatttgtctccccagtaatataggccaggatagggtggagaagtcatccttt1920
cctcaaactgtccttcaggaaggtctgggtactgaacggttactgcataaactctgcttc1980
cccaaaggcatgtgcttggtgtggtaaagtcatgaagatggtgctcatgtccaagaggaa2040
cctctgatctcacttttcaagggatttcatgtttgctgacatttaatacttgttagtttt2100
tgcagggggatgatttctcatttgcaattttattattctcaaattctgcatgtcagaatg2160
ttagagattt-ctcagggatgtcaggttctgtttccagatgagtgattgccctgtgtcctc2220
cattggactgtaaactcatatgcaccagacagggtctacattgctgccgtggtgcatagc2280
cttccatgtgtcacttagtcctaaagagaagttactaataacctaatctcactaatctca2340
ctggcatctcaatgccgatcccattgtcatctgaaaatttgaaggggacattaaagtggc2400
acagggaccagaacaatatttttctctcattgctgaattttaaaaacaatctaaaaaatt2460
ggaattcttgaagaaactatcttatatgactaaaatgaagccttgggtgggtgctaatta2520
ttattgtctggcttacctgccccccccactacttatatcttttagagatgacacagactt2580
gctttccctgtggctactaatcccaattgcacattcagtcccttgatagacttactctaa2640
aaatctaagttcagcggtccacgaaacataacaaagcctgtcctaaaacagaaagaaaga2700
aagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaacagaagacaaaca2760
-2-
CA 02335272 2001-O1-10
WO 00/02918 PCTNS99/15375
aggtctttccccattccctaacatacaggaatggaaattattaagtctacgtgatagcca2820
atgaatctgtttcttaagtatgcccacaagggtgctgccggagccattgctcagggctgg2880
agtatttactgggcatgcttgaccccagcatggagggtgagaagtgctcctgggaactct2940
gatccactgctgtggtggagagcaaacacctggcctcatttatacttgttgtctgtataa3000
tgcatataaatggaggataatcattaatgaactgtttagttgggtcatcatgccaagtca3060
gtcacaaagccaagtcgttatcacatagaaagactgggaagcccagtggagattgttagc3120
tgttggtctgacagtctcactgtgtgctatctatagtgttagaacggatggaggcagtat3180
ttatgtgaagagcagggtgtcgtgtttcctgtgtcaaagagcaagatgtgatgtttgtca3240
gtgggcatgcccctcatggagaaaagagatccgggacttaaaaatgtgaagtgatttatg3300
ccgtgtcacacccatgctccaccctgatggtctctctttgtgtgccttcagctgtggtgg3360
tgtttgctttcatcctctgctggctgcccttccacgtgggaagatatctgttttccaagt3420
ctttcgagcctggctctctggagatcgcgcagatcagtcagtactgcaacctggtgtcct3480
ttgtcctcttctacctcagcgctgccatcaaccccattctgtacaacatcatgtccaaga3540
agtaccgggtggccgtgttcaaacttctaggatttgaatccttctcccagagaaagcttt3600
ccactctgaaggatgagagttcccgggcctggacaaagtcgagcatcaatacatgacatc3660
gcagcgcatctctccgtcatcgctcattgctccacaccagaagccatagccaagcgggac3720
ttgggaggaggcagaacgtcagtttggggattagagacaaatggatctggaaacaattgg3780
gggtggggagtagagccagatgggcagggtccgtgcagattgatctatttgtgcgcccac3840
cagagcactcatgtgcagcccctgcacacctgtgtctgtgattttgcgaatttgcatttg3900
gagcttctgacagctttgcagctcgaaggagggaggggcgcagagcaggcaacggccgtc3960
cttcttggtgtgtaacactaaactccatttgcttttctcatcataatag 4009
<210>2
<211>1095
<212>DNA
<213>Mus musculus
<400> 2
atgtggaacg cgacgcccag cgaggagccg gagcctaacg tcacgctgga cctggactgg 60
gacgcttctc ccggcaacga ctcactctct gacgaactgc tgccactgtt ccccgcgccg 120
ctgctggcgg gcgtcactgc cacctgcgtg gcgctcttcg tggtgggcat ctcgggcaac 180
ctgctcacca tgctggtggt gtcccgcttc cgcgagctgc gcaccaccac caacctctac 240
ctatccagca tggccttctc cgatctgctc atcttcctgt gcatgccgct ggacctcgtc 300
cgcctctggc agtatcggcc ctggaacttc ggcgacctgc tctgcaaact cttccagttt 360
-3-
CA 02335272 2001-O1-10
WO 00/02918 PCTNS99/15375
gtcagcgagagctgcacctacgccacggtcctcaccatcaccgcgctgagcgtcgagcgc 420
tacttcgccatctgcttcccgctgcgggccaaggtggtggtcaccaagggccgtgtgaag 480
ctggtcatccttgtcatctgggccgtggccttctgcagcgcggggcccatcttcgtgctg 540
gtgggcgtggagcacgagaacggcacagatccccgggacaccaacgagtgccgcgccacc 600
gagttcgctgtgcgctctgggctgctcaccgtgatggtatgggtgtcgagcgtcttcttc 660
tttctgccggtcttctgcctcactgtgctctacagtctcatcgggaggaagctgtggcgg 720
aggcgcggcgacgcggcggtgggctcctcgctcagggaccagaaccacaaacagacagtg 780
aagatgcttgctgtggtggtgtttgctttcatcctctgctggctgcccttccacgtggga 840
agatatctgttttccaagtctttcgagcctggctctctggagatcgcgcagatcagtcag 900
tactgcaacctggtgtcctttgtcctcttctacctcagcgctgccatcaaccccattctc 960
tacaacatcatgtccaagaagtaccgggtggccgtgttcaaacttctaggatttgaatcc 1020
ttctcccagagaaagctttccactctgaaggatgagagttcccgggcctggacaaagtcg 1080
agcatcaatacatga 1095
<210>3
<211>364
<212>PRT
<213>Mus musculus
<400> 3
Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Glu Pro Asn Val Thr Leu
1 5 10 15
Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Ser Asp Glu
20 25 30
Leu Leu Pro Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr Ala Thr
35 40 45
Cys Val Ala Leu Phe Val Val Gly Ile Ser Gly Asn Leu Leu Thr Met
50 55 60
Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr Thr Asn Leu Tyr
65 70 75 80
Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met Pro
85 90 95
Leu Asp Leu Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly Asp
100 105 110
-4-
CA 02335272 2001-O1-10
WO 00/02918 PCTNS99/15375
Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr Ala
115 120 125
Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala Ile
130 135 140
Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val Lys
145 150 155 160
Leu Val Ile Leu Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly Pro
165 170 175
Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro Arg
180 185 190
Asp Thr Asn Glu Cys Arg Ala Thr Glu Phe Ala Val Arg Ser Gly T~eu
195 200 205
Leu Thr Val Met Val Trp Val Ser Ser Val Phe Phe Phe Leu Pro Val
210 215 220
Phe Cys Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp Arg
225 230 235 240
Arg Arg Gly Asp Ala Ala Val Gly Ser Ser Leu Arg Asp Gln Asn His
245 250 255
Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe Ile Leu
260 265 270
Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys Ser Phe
275 280 285
Glu Pro Gly Ser Leu Glu Ile Ala Gln Ile Ser Gln Tyr Cys Asn Leu
290 295 300
Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro Ile Leu
305 310 315 320
Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Lys Leu Leu
325 330 335
Gly Phe G1u Ser Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys Asp Glu
340 345 350
Ser Ser Arg Ala Trp Thr Lys Sex Ser Ile Asn Thr
355 360
<210> 4
-5-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
<211> 366
<212> PRT
<213> Homo sapiens
<400> 4
Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Gly Phe Asn Leu Thr Leu
1 5 10 15
Ala Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Gly Asp
20 25 30
Glu Leu Leu Gln Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr Ala
35 40 45
Thr Cys Val Ala Leu Phe Val Val Gly Ile Ala Gly Asn Leu Leu Thr
50 55 60
Met Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr Thr Asn Leu
65 70 75 80
Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met
85 90 95
Pro Leu Asp Leu Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly
100 105 110
Asp Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr
115 120 125
Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala
130 135 140
Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val
145 150 155 160
Lys Leu Val Ile Phe Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly
165 170 175
Pro Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro
180 185 190
Trp Asp Thr Asn Glu Cys Arg Pro Thr Glu Phe Ala Val Arg Ser Gly
195 200 20S
Leu Leu Thr Val Met Val Trp Val Ser Ser Ile Phe Phe Phe Leu Pro
210 215 220
-6-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
Val Phe Cys Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp
225 230 235 240
Arg Arg Arg Arg Gly Asp Ala Val Val Gly Ala Ser Leu Arg Asp Gln
245 250 255
Asn His Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe
260 265 270
Ile Leu Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys
275 280 285
Ser Phe Glu Pro Gly Ser Leu Glu Ile Ala Gln Ile Ser Gln Tyr Cys
290 295 300
Asn Leu Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro
305 310 315 320
Ile Leu Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Arg
325 330 335
Leu Leu Gly Phe Glu Pro Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys
340 345 350
Asp Glu Ser Ser Arg Ala Trp Thr Glu Ser Ser Ile Asn Thr
355 360 365
<210> 5
<211> 364
<212> PRT
<213> Rattus norvegicus
<400> 5
Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Glu Pro Asn Val Thr Leu
1 5 10 15
Asp Leu Asp Trp Asp Ala Ser Pro Gly Asn Asp Ser Leu Pro Asp Glu
20 25 30
Leu Leu Pro Leu Phe Pro Ala Pro Leu Leu Ala Gly Val Thr Ala Thr
35 40 45
Cys Val Ala Leu Phe Val Val Gly Ile Ser Gly Asn Leu Leu Thr Met
50 55 60
_ 'j _
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
Leu Val Val Ser Arg Phe Arg Glu Leu Arg Thr Thr Thr Asn Leu Tyr
65 70 75 80
Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met Pro
85 90 95
Leu Asp Leu Val Arg Leu Trp Gln Tyr Arg Pro Trp Asn Phe Gly Asp
100 105 110
Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr Ala
115 120 125
Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala Ile
130 135 140
Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val Lys
145 150 155 160
Leu Val Ile Leu Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly Pro
165 170 175
Ile Phe Val Leu Val Gly Val Glu His Glu Asn Gly Thr Asp Pro Arg
180 185 190
Asp Thr Asn Glu Cys Arg Ala Thr Glu Phe Ala Val Arg Ser Gly Leu
195 200 205
Leu Thr Val Met Val Trp Val Ser Ser Val Phe Phe Phe Leu Pro Val
210 215 220
Phe Cys Leu Thr Val Leu Tyr Ser Leu Ile Gly Arg Lys Leu Trp Arg
225 230 235 240
Arg Arg Gly Asp Ala Ala Val Gly Ala Ser Leu Arg Asp Gln Asn His
245 250 255
Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe Ile Leu
260 265 270
Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys Ser Phe
275 280 285
Glu Pro G1y Ser Leu Glu Ile Ala Gln Ile Ser Gln Tyr Cys Asn Leu
290 295 300
Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro Ile Leu
305 310 315 320
Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Lys Leu Leu
325 330 335
_g_
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
Gly Phe Glu Ser Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys Asp Glu
340 345 350
Ser Ser Arg Ala Trp Thr Lys Ser Ser Ile Asn Thr
355 360
<210>6
<211>366
<212>PRT
<213>Sus scrofa
<400> 6
Met Trp Asn Ala Thr Pro Ser Glu Glu Pro Gly Pro Asn Leu Thr Leu
1 5 10 15
Pro Asp Leu Gly Trp Asp Ala Pro Pro Glu Asn Asp Ser Leu Val Glu
20 25 30
Glu Leu Leu Pro Leu Phe Pro Thr Pro Leu Leu Ala Gly Val Thr Ala
35 40 45
Thr Cys Val Ala Leu Phe Val Val Gly Ile Ala Gly Asn Leu Leu Thr
50 55 60
Met Leu Val Val Ser Arg Phe Arg Glu Met Arg Thr Thr Thr Asn Leu
65 70 75 80
Tyr Leu Ser Ser Met Ala Phe Ser Asp Leu Leu Ile Phe Leu Cys Met
85 90 95
Pro Leu Asp Leu Phe Arg Leu Trp Gln Tyr Arg Pro Trp Asn Leu Gly
100 105 110
Asn Leu Leu Cys Lys Leu Phe Gln Phe Val Ser Glu Ser Cys Thr Tyr
115 120 125
Ala Thr Val Leu Thr Ile Thr Ala Leu Ser Val Glu Arg Tyr Phe Ala
130 135 140
Ile Cys Phe Pro Leu Arg Ala Lys Val Val Val Thr Lys Gly Arg Val
145 150 155 160
Lys Leu Val Ile Leu Val Ile Trp Ala Val Ala Phe Cys Ser Ala Gly
165 170 175
-9-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
Pro Ile Phe Val Leu Val Gly Val Glu His Asp Asn Gly Thr Asp Pro
180 185 190
Arg Asp Thr Asn GIu Cys Arg Ala Thr Glu Phe Ala Val Arg Ser Gly
195 200 205
Leu Leu Thr Val Met Val Trp Val Ser Ser Val Phe Phe Phe Leu Pro
210 215 220
Val Phe Cys Leu Thr Val Leu Tyr Sex Leu Ile Gly Arg Lys Leu Trp
225 230 235 240
Arg Arg Lys Arg Gly Glu Ala Ala Val Gly Ser Ser Leu Arg Asp Gln
245 250 255
Asn His Lys Gln Thr Val Lys Met Leu Ala Val Val Val Phe Ala Phe
260 265 270
Ile Leu Cys Trp Leu Pro Phe His Val Gly Arg Tyr Leu Phe Ser Lys
275 280 285
Ser Leu G1u Pro Gly Ser Val Glu Ile Ala Gln Ile Ser Gln Tyr Cys
290 295 300
Asn Leu Val Ser Phe Val Leu Phe Tyr Leu Ser Ala Ala Ile Asn Pro
305 310 315 320
Ile Leu Tyr Asn Ile Met Ser Lys Lys Tyr Arg Val Ala Val Phe Lys
325 330 335
Leu Leu Gly Phe Glu Pro Phe Ser Gln Arg Lys Leu Ser Thr Leu Lys
340 345 350
Asp Glu Ser Ser Arg Ala Trp Thr Glu Ser Ser Ile Asn Thr
355 360 365
<210>7
<211>39
<212>DNA
<213>PCR primer
<400> 7
gggcccgaat tcgccgccat gtggaacgcg acgcccagc 39
<210> 8
- 10-
CA 02335272 2001-O1-10
WO 00/02918 PCT/US99/15375
<211> 30
<212> DNA
<213> PCR primer
<400> 8
caccaccaca gcaagcatct tcactgtctg 30
<210> 9
<211> 33
<212> DNA
<213> PCR primer
<400> 9
aagatgcttg ctgtggtggt gtttgctttc atc 33
<210> 10
<211> 38
<212> DNA
<213> PCR primer
<400> 10
agtttagcgg ccgctcatgt attgatgctc gactttgt 38
-11-
