Note: Descriptions are shown in the official language in which they were submitted.
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
-1-
GENE SWITCH
The present invention relates inter alia, to the induction of gene expression
in
a eukaryote by the application of a chemical inducer to the eukaryote and to
materials
and methods for achieving induction. Such systems are referred to as "gene
switches".
In particular, the present invention relates to a method of controlling
expression of a target gene in a plant, animal or yeast.
Bacterial cells have the ability to respond to the surrounding environment.
The response to different environmental cues is essential for survival of
bacteria. It is
apparent that individual bacteria in a population are also able to sense the
density and
state of the local bacterial population (the "quorum") of which they are
members.
That is, an individual bacterium can detect the presence of like bacteria in
the
surrounding environment. Quorum sensing allows bacteria to synchronise growth,
development which when a minimal population level is reached initiates a
concerted
response from the population.
In the case of Photobacterium frscheri, N (3-oxohexanoyl)-L-homoserine
lactone or autoinducer regulates bioluminescence in a cell density-dependent
manner.
There are two main genes in the lux operon of P. frscheri involved in the
signal
production and signal detection. Luxl is the gene involved in the biosynthesis
of the
homoserine lactone but the mechanism by which this takes place is unclear. It
has
been proposed that S-adenosylmethionine and coenzymeA or the acyl carrier
protein
adduct of 3-oxohexanoic acid are substrates for the luxl gene in P. fischeri.
In bacteria, the autoinducer regulates expression of the luxl gene and thus
creates a positive autoregulation of autoinducer synthesis. LuxR, the response
regulator or autoinducer receptor, is a protein involved in responding to the
presence
of N (3-oxo)hexanoyl-L-homoserine lactone (OHHL) in P. fischeri. At the C-
terminal end LuxR contains a DNA binding domain and a transcriptional
activator.
LuxR C-terminal end shows amino acid homology to transcriptional activators
known
as the two component environmental-sensing systems such as UhpA, FixJ and
NarL.
LuxR is thought to interact with DNA as a homodimer to a palindrome within the
luxl
operator sequence termed lux box. The N-terminal end of the protein is called
the
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
_7_
receptor module as it has no similarity to the two-component environmental
sensing
systems.
Quorum sensing systems are found in other bacteria and may be activated by
different homoserine lactones. Such is the case in P. aeruginosa PAOI, Lasl
directs
the synthesis of the autoinducer N (3-oxadodecanoyl)-L-homoserine lactone
(OdDHL), which activates the positive transcriptional activator, LasR (Winson
et al.,
1995). Moreover, in the same P. auruginosa, PAO1, a second signalling pathway
termed vsm containing vsmR and vsml genes was isolated. The vsml gene product
is
involved in production of N butanoyl-L-homoserine lactone (BHL) and N hexanoyl-
L-homoserine lactone (HHL). These compounds are present in the spent culture
supernatants of P. aeruginosa and when either BHL or HHL to PAN067, a
pleiotropic
P. aeruginosa mutant unable to synthesize either of these autoinducers,
restored
elastase, chitinase, and cyanide production (Winson et al., 1995). Other
evidence
suggesting the presence of different homoserine inducers in one species has
recently
been observed in Vibrio anguillarum (Milton et al., 1997) and P. aeroginosa
(Pesci et
al., 1997). Furthermore, Table I, shows examples of characterised systems
where
different compounds are known to be inducers of different receptor molecules
in
different bacteria.
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
- 3 -
~ v -b
o,
r.
O v' (Y1 . cCf
G d _a
3 ~ ~ ~, o
' m
4~" a 3 a1 ~ 3
x ~ ~ b
Q' 0 ~ (~
G~ . ~ U cC
w ~ ~
3 co
0
0 N
N
a x a
,o ~ _
~ N o ~ ~ ~ M
p m ~ p N O~Ov pp
v ~ o~'oo ~ ~ ~ ~ N
C7 d c ~C ..a ~ ~ >C>C ..'~',.~
c
a
~
_ o ~ o
V '' U ~ ~ O
C a
r ~ U I1 a ..U"N ~1
O x a a
~. ~ o 0 ~L
O 1-.na ~ '/ ~ a
r ~ N ~ ~, o ~; x x
~ ~ o .~ ~ ~ ~ x
0 0
fx ~ ~ t~C
d E- U ~ U W
L
O
v
r C~
C C ~, ~ - ~b0
bD U W
ridaio d E~ U W
0
a m
o '1 ~ ;.
~ o
..' o . o a
a o d
r'.. o a o ~ o ~
..o a > cs
ea o 0 o a '~
E~s,
L s. V ~. -,' .~ o W
O ~C '~ ~~ W W a
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
- 4 -
'n '~ ~ a~
.r c~ a ~ ~M~"~ ~_ ~
,~ ~ ,r ,~ c 'n ~, ~s .,:
a ~ ~-
o~ a w o~ ' s ~ Vl -o~O
,.0C ~ N C 0~
r" C7C C ~ ~ ft~
O N O O c~f G G1 .~G1 C ~,
.U .N ~ N L ~ --~4..w O
O N .-.~ U O W .cs
~ a 3 ~,~. 3 3 ~ 0 3
~O
N
M
M
M ~ ~ N '.
O o0 i~
D_\~ r~
N
O
U C x ~ c
x a, o o
C o ~ ,~ a a C ~ 1.a
0 x ~ c
0 ~ L..aT oo "L~ ~
O ~ k 4 O w..~ 3 a1. x
a ~ ~ x ~ ~ ~, ~ V
x O .. C O x 'C~ N r4
'/ ~ C O O
x C .O U ~ z .~ ~ m
o z .~~ ~ ~ ~ x
.~
3
Q k ~ ~ ~ 04 ''c~
v a a > i d
_ o _
-sex ~ E
a ca
a
Q ~ C ~ ~ .C
- ~ ~, do '1
a ~ ~ 'r c.
U 0 0 :,,
C O
~ '':~ .O
O G
O p~ y
~1
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
- 5 -
a
m ~.
., a~
o,
a m c o~,
C O
c~ 0 , .~:
:0
H
O N
00
n
i >,
,...7 O
O O ~ O p O
:~ U ~ r-~..~>> x
x C ~ C ~ C x
x x ~~
o o -~a m
m m ~ ~ ~ a ~ ~ x
x z ~ z .~ x o
3
~.../~ ~ X
W .
d > a J-
a
0 0 ~ o
a ~' v
'
c a
o -~ a
0 0
0 0
a
CA 02335651 2001-O1-17
R~-V_ Vn1!: =P.4 MCJE\CHE~_ tIF : 11- 8- U : 10:5:3 : CCITT_ G_3-_. +49 89 ?-
~~~a~~ ~ ~
11-08-2000 . ~ - ~ ~ y GB 009902653
6
The present invention therefore seeks to provide inter olio, methods and
materials for the induction of bene expression in eukaryotes by the
application of
chemical inducers to the eukaryote.
According to a first aspect of the present invention there is provided a
method of
controlling expression of a target gene in a eukaryote, comprising
integrating,
preferably stably integrating, within the genome of the eulcaryote an
expression
system comprising a first poly~nucleotide comprising the target gene operabl3r
linked
to and under the control of a promoter comprising an 1v=aryl-homoserine
lactone
inducible promoter, wherein the eukaryotic cell is capable of producing a
response
regulator protein and whereby expression of the target gene depends upon the
presence of both N aryl-homoseiine Iactone and the response regulator protein.
The eulatyotic ce1! may already contain the mechanisms to produce the said
response protein or may alternatively be provided with them by inserting into
the said
cell, a polynucleotide which provides far the production of the response
protein using
techniaues well known within the art_
The expression system may $irther comprise a second polynucleofide which
comprises a DhTA sequence encoding a response regulator protein. The sequence
encoding the response regulator protein is preferably Lux R.
The expression of the target gene may be controllable by application of
exogenous N-acyl-homoserine lactone. Alternatively, the expression system may
further comprise a third polynucleotide which comprises a DNA sequence
encoding a
proiein involved in the biosynthesis ofN acyl-homoserine lactone. The sequence
is
preferably Lwc 1 or yen 1.
The inducible promoter ,for use in the above mentioned method may comprise
the nucleotide sequence depicted as SEQ ID No_ 2 or SEQ ID No. 1 and the
response
protein may cornprisc the amino acid sequence depicted in SEQ ID No. 19, 10 or
8,
Alternatively the irlducible promoter may comprise a functional variant such
as a
polyrtuclevtide which is the complement of orie which binds to SEQ ID No. 2 or
SEQ
1D f:~o. 1 at a temperature of between 60°C and 65°C in U.3
strength citrate buffered
saline containing 0.1°ro SDS followed by rinsing at the same
temperature with 0.3
stren;th citrate buffered saline containing 0.1% SDS wherein the said
polynucleotide
is still capable of acting as an inducible promoter upon binding wiih the said
inducin'
AMENDED SHEET
CA 02335651 2001-O1-17
RCS'. VON : EPA A9UENCHEN 06 : 11 - 8- U : 1 a : ~4 : ~ CC,1 TT .G3 = +~.9 89
33~3~J44R5 : ~ 6
11-08-2000 ~ ' ' - . _ ........ ... . . ., . ~ . . . . _ G B 009902853
7
comply. tn. particular the response protein for use in the method of the
present
invention may be encoded by the polynucleotide comprises the sequence depicted
in
SEQ ID No. 5. Alternatively the polynucleotide encoding the said response
protein
may comprise the complement of one which binds to SEQ ID No. 5 at a
temperature
of between. 60°C and 65°C in 0_3 strength citrate buffered
saline containing 0.1 % SDS
followed by rinsing at the same temperature with 0.3 strength citrate buffered
saline
containing 0.1 % SDS wherein the said polynuclcotide still encodes a protein
which is
capable of forming an inducing complex with the said chemical inducer. It is
particularly preferred tb~at the polynucleotide defining the inducible
promoter
according to the present invention contains the region depicted as SEQ ID No.l
. T he
method ofpresent invention is particularly applicable to initiating
transcription in
cells of plants, more particularly in ihc eclLs of melons, mangoes, soybean,
cotton,
tobacco, sugarbeet, oilseed rape. canola, flax, sunflower, potato, tomato,
alfalfa,
lettuce, maize, wheat, sorghum, rye, bananas, barley, oat, turf grass, forage
grass,
sugar cane, pea., field bean, rice, pine, poplar, apple, peaches, grape,
strawberries,
carrot, lettuce, cabbage, anions citrus or nut plants. In particular the
method of the
present invention may be used to initiate transcription in a variety of
tissues, including
roots, leaves, ste,~ns and reproductive tissues- The chemical indueer which
may be
used in the above mentioned method is N-(3-oxo)hexanoyl-L-homoserinc la.ctone
or a
functional equivalent thereof and may be applied to the plant cell as part of
an.
agriculturally acceptable formulation. Alternatively the chemical inducer may
be
produced within the plant by inserting into the genome of the plant a
polynucleotide
encoding a protein which provides for the production of the cltenuical inducer
within
the plant. This polynucleotide may, fox example, be under the transcriptional
control
of a constitutive promoter, a gene swiich (such as the alcAlR, Heliothis
ecdysone and
GST-27 gene switch), wound inducible, tissue or temporal promoters. The
advantage
of producing the chemical inducer in planta is that there is no need to spray
or
exogenously treat plants to induce gene expression.
Further alternative inducibte promoters, response proteins arid chemical
inducers which may be used in the method of the present invention are
referenced in
Tabl a 1. For example, the promoter sequence or a past thereof may obtainable
from
the vanl gene of v~biro an~illarum and the response protein encoded by the
vanR
AMENDED SHEET
CA 02335651 2001-O1-17
hC.V. VO!v : EF'A rtc~E~iCtiEN uE ~~., ~ ~ ., : 11- F3- C) . m : a~r . ~ . CC
I T1~ G_:3 - +48 88 2399446 : #~ 7
i 1-08-2000 ~ . ~ V ~ . - G B 009902653
8
gene may be used with th:~ chemical IvT-(3-oxo-decanoyfr-L-homoserine lactose
{ODHL) or a functional variant thereof.
Tire polynucleotide encoding the said response protein in the method referred
to above may be bounded by a promoter and a terminator sequence and in
particular
the promoter may be induciblc such as the Alt Al R switch system, the GST
switch
system and the ecdysone switch. Altemaiively the promoter may be constitutive
such
as cauliflower mosaic virus 35S/195, maim Ubiquitin and Arab:dopsis'lJbiquitin
3 or
raay be devclopmemally regulated specific promoter such as those controlling
expression of the gene required during seed formation, germination such as
cysteine
proteinases (as specified in our International Publication No WO 97135983 )
and
malale synthase.
The target pane in the method referred to about may be any gene of interest,
for example, p-glueuronidase; Baci.lus thuringenesis toxin; barnase or
barstar.
Also provided is a method of providing plants containing an inducible target
gene comprising=
{a) inserting into a plant cell, which cell provides for production of a
response protein
a polynucleotide defining an inducible promoter sequence operably linked to
said
target gene; and (b) regenerating morphologically normal fertile plants
thereof, and (c)
applying to the population of regenerants a cb.emical inducer or a functional
variant
thereof capable of binding to said response protein, wisereby said chemical
inducer
binds to said response protein to form an inducing complex which binds tv and
induces said urducible promoter thereby initiating transcription of said
target gene;
and (d) selecting those pants which are expressing the said target gene. TIZe
inducible
promoter sequence referred to in the preceding paragraph may comprise the
nucleotide sequence depicted as SEQ ID No. 2 or SEQ ):D No. 1 or a functional
variant thereof amd the response protein comprises the amino acid sequence
depicted
as SEQ DJ No. : 9, SEQ TD No. 10 ar SEQ ID No. 8 or a functional variarft
thereof
and the said chemical indu~.er is N-(3-oxo)hexanoyi-G-homoserine Lactone or a
functional equivalent thereof. In particular the inducible promoter sequence
may
:.ontain the nucleotide sequence depicted as SEQ ID No_ 13 or a ruictional
variant
Hereof and the response protein may comprises the amino acid sequence depicted
as
SBQ 1D No 2a or a functional variant thereof and the said chemical inducer
tnay be
AMENDED SHEET
CA 02335651 2001-O1-17
RCV. 1.'UN : ~Pr1 YfUEPJ_CHEiV U6 : 1 1- 8- 0 ~ ~ ~ .~~ - ~ CC 1 Tl~ G3 ~ +49
89 ?:39y4.4.RF : # R
11-08-2000 ~ ~ ~ ' ~ ~~~ --.. .. _ ' - ' ' ' ' ' ' GB 009902653
9
?V-(~-oxo)dodecanoyl-L-homoserine lactone or a functional equivalent thereof.
Alternatively, the said inducible promoter sequence may contain the nucleotide
sequence depicted as SEQ ID Iv'o. 1~ or 17 or a functionai_ variant thereof
and the
response protein rnay comprise the amino acid sequence depicted as SEQ ID No
21 or
a functional variant themof and the said chcxnical inducer may be trT-(3-
oxo~octanovl-
L-homoserine iaetone or a functional equivalent thereof.
The eukaryote is preferably a plant, mannmal or yeast.
The present invention also provides plants produced according to the method
of the preceding paragraph which plants may be selected from the group
consisting or":
melons, mangoes, svy'vean, cotton, tobacco, sugarbeet, oilseed rape, canola,
flax
sunflower, potato. tomato. alfalfa, lettuce, maize, wheat, sorghum, rye,
bananas,
barley, oat, turf grass, forage grass, sugar cane, pea, feld bean, rice, pine,
poplar,
apple, peaches, grape, strawberries, carrot, lettuce, cabbage, onion, citrus
or nut
plants.
Tlie method employed for transformation of plant cells is not especially
germane to the present invention and any method suitable for the target plant
may be
employed. For example, transgenic plants are abiained by regeneration from the
transformed cells. Nmnerous transformation procedures are h~nown from the
literature
including agroinfectivn using ~grubaetsrium tumejaeiens or its Ti plasnaid,
electroporation, microinjection or plants cells atxd prvtvplasts,
microprojectile
transformation. All of these methods are well kaovvn within the art. The
present
invention may also be applied to any plant fvr which transformation techniques
are, or
become, available.
Tn a Furtlier aspect of the present invention there is provided a
polynucleotide
comprising a DNA sequence comprising a target gene vperably linked to and
under
the control of an inducible promoter sequence and an operator sequence which
is
responsive to exposure to an inducer compound, wherein the inducrr compound is
~1r=
aryl-homoser:.ne lactone and wherein the polynucleotide further comprises a
DNr'1
sequence encoding a response regulator protein.The said first poiynucleotide
of the
D~IA construct may comprise the nucleotide sequence depicted as SEQ ID No. 2
or
SEQ ID No. 1 or a functional variant thereot'and the secondpolynucleotide
region
may comprise a polynucleotide which encodes the amino acid sequence depleted
as
AMENDED SHEET
CA 02335651 2001-O1-17
y' vnn~ ~'FF~n Mt If'NCliI;N 06 . : 11- 8- U : l U : v6 : ~ . CC I TT G3 ; +49
89 '_>34~-4.x;5 : ~ 4
71-08-2000 " . . . ..... _ _ . ., _ . . . . . . G B 009902653
SEQ ID loo. 19, SEQ ID No. 10 or SEQ ID No. 8 or a functional variant thereof.
Alternatively the said first polynucleotide may comprise the nucleotide
sequence
depi~-ted as SEQ ID No. 13 or a functional variant thereof and the second
polynucleotide region may oompri.se a polynueleotide which encodes the amino
acid
sequence depicted as SEQ ID N~o. 20 or a functional variant thereof.
Alternatively,
the said first polynucleotide may comprise the mzcleotide sequence depicted as
SEQ
ID No. 15 or 17 or a functional variant thereof and the second polynucleotide
region
may comprise a polynucleotidc which encodes the amino acid sequence depicted
as
SEQ ID No. 21 or a functional variant thereof. The said second polynucleotide
region
referred to above niay comprise a promoter operably linked to the
polymicleotide
encoding the said response protein. The said promoter may be inducible and
constitutive or developmentally controlled
In a fiuther aspect of the present invention there is provided a
polynucleotide
having two or morn regions tech expressing a protein, each region being
operably
linked to and under the control of separate inducible promoter regions wherein
one of
the inducible promoter regions is controllable by application of an exogenous
N acyl-
homoserine lactone. Preferably, the regions expressing a protein are
controlled by
different inducible promoter regions.
According to a further aspect there is provided plant tissue transformed with
the polynucleotide of the present invention, morphologically normal fertile
whole
plants comprisinb such tissue and the progeny of such plants.
The present invention still further provides the use of a polynucleotide
according to any one of claims 23 to 26 in the inducible expression of a
target gene
wh::rcin the protein encoding regions are expressed in a eukaryote.
In a further aspect of the present iaveution there is provided a method of
screening
compounds for bioactivity comprising monitoring the activity of a reporter
gene driven Lry a
N-aryl-homoserine lactone regulator promoter in response to exposure to the
compounds in
transgenic plants in the presence of a response reoulaxor protein which forms
au inducing
complex with the compound being screened. The chemical could be applied to the
plant and
the activity of the reporter gene monitored
for e.G. improved activity, mobility or stability or to assess if the chemical
had an
AMENDED SHEET
------ - - CA 02335651 2001-O1-17 -
,v ~; r.r.i v ~P d MI iHNCHEN 06 : 11- 8- 0 : 10 : 56 : CC I TT G3-~ +~9 89
2?~~' " ~r ~ " ,
11-08-2000' ~~ .' .--....._.. ..., . _._.. ....._ GB 009902653
11
inhibitorrr effect on the response protein which resulted in a decrease i.n
activity of the
reporter gene.
In a further aspect of the present invention there is provided a method of
selectively controlling pests in a field which f eld comprises crop plants and
pests
wherein the plants are those obtained according to the methods referred to
above and
the said target gene encodes a target protein which is capable of controlling
the said
pests said method comprising applying to the plants an amount of a chemical
inducer
which is sufficient to bind to the said response protein to produce the said
inducing
complex which is capable of initiating transcription of the target gene which
p;ovdes
for the production of the target protein in an amount which is cuff cient to
control the
said pests.
In a further aspect of the present invention there is provided a method of
providing a plant which cornains a target gene which is inducibly controlled
comprising:
(a) inserting into a first plant cell a polvnucleotide comprising a first
inducible
promoter operably linked to a target gene and regenerating a f rst
morphologically
normal fertile plant therefrom;
(b) inser~'ing into a second plant cell a poIynueleotide comprising a promoter
operably linked to a region encoding a. response protein which is capable of
binding to
a chemical inducer to produce an inducinb complex which is then capable of
binding
the said educible promoter to allow for the initiation of transcription of the
said target
gene and regenerating a second morphologically normal fertile plant therefrom;
(c) cross pollinating said first plant with the said second plant or said
second plant
with said first plant and harvesting the seed therefrom;
(d) growing said seed and applying to the resultant plants an amount of said
chemical inducer which provides an inducing complex capable of binding the
said
inducible promater to allow for the initiation of transcription of the said
target gene.
1'he term "functional variant" with respect to a polynucleotide encoding the
inducible prornoteT of the present invention includes variant sequences which
are the
complement of a sequence which hybridises to the indueible promoter sequence
at a
temperature oFhetween b0°C and 65°C in 0_3 strength citrate
buffered saline
containing 0.1% SDS followed by rinsing at the same temperature with 0.3
strength
AMENDED SHEET
CA 02335651 2001-O1-17 ---
-v; wnr;.c-nn ~a,~\~~~j UE, :I1- 8- U : 10:5? : CCITT G3-i +49 89 ~~;.__...._
_
11-08-2000 ' -"'~ "-- ~~ ~ ~ "' ' ' " ' - G B 009902653
- 11a
citrate buffered saline containing 0.1% SDS and ~~hich are still capable of
acting as an
inducible promoter.
The term ''functional variant" vrith respect to the response protein includes
variant proteins obtained by conservative subsi~tutions within the amh~o acid
sequeacc which substitutions do not significantly advcrseiy a~eci the ability
of the
response protein to bind the chemical inducer. In particular substitutions may
be
made between the following amino acid graups niz.
(a) Alanine, Serine. Glyeine and Threon.ine
(b) Glutarnic acid aad Aspartic acid
(c) Arginine and Lysine
(d) Isoleucine, Lcucinc, ~Jaline and Methionine
(e) Phcnylalanine, Tyrosine and Tryptophan
AMENDED SHEET
CA 02335651 2001-O1-17
WO 00/09704 - 12 - PCT/GB99102653
The term "transgenic" in relation to the present invention does not include a
wild type regulator promoter in its natural environment in combination with
its
associated functional gene in its natural environment.
The term "target gene" with reference to the present invention means any gene
of interest. A target gene can be any gene that is either foreign or natural
to the
eukaryote in question.
The term "construct" - which is synonymous with terms such as "cassette",
''hybrid" and "conjugate" - includes a target gene directly or indirectly
attached to the
regulator promoter, such as to form a cassette. An example of an indirect
attachment
is the provision of a suitable spacer group such as an intron sequence
intermediate the
promoter and the target gene. The same is true for the term "fused" in
relation to the
present invention which includes direct or indirect attachment. Such
constructs also
include plasmids and phage which are suitable for transforming a cell of
interest.
The term "expression system" means that the system defined above can be
expressed in an appropriate organism, tissue, cell or medium. The system may
comprise one or more constructs and may also comprise additional components
that
ensure to increase expression of the target gene by use of the regulator
promoter.
One possible use of the inducible promoters of the present invention is in the
control of male sterility. The anther is the site of male reproductive
processes in
flowering plants. It is composed of several tissues and cell types and is
responsible
for producing pollen grains that contain the sperm cells. The tapetum is a
specialised
tissue which plays a critical role in pollen formation. It surrounds the
pollen sac early
in pollen development, degenerates during the latter stages of development and
is not
present in an organised form in the mature anther. The tapetum produces a
number of
compounds which aid pollen development or are incorporated into the pollen
outer
wall and it has been demonstrated that many of the natural male sterility
mutations
have impaired tapetum differentiation or function.
Tapetal tissue is therefore critical to the formation of functional pollen
grains.
A number of genes have been identified and cloned that are specifically
expressed in
tapetal tissue. They include Osg6B, Osg4B..(Tsuchiya et al. 1994, Yokoi, S et
al.
1997), pEl, p T72 (W09213957), p CA55 corn (W092/13956) , TA29,
TA13,(Seurinck et al. 1990), RST2 corn ( W09713401), MS14,18,10 and A6, A9
CA 02335651 2001-O1-17
WO 00/09704 - 13 - PCT/GB99/02653
from Brassica napus (third et al. 1993). Anther specific clones have been
isolated
from a number of species Bp4A and C (Albani et al. 1990), chs petunia (Koes et
al.
1989), rice (Xu et al. 1993, Zou et al. 1994), amongst others. In higher
plants the
female reproductive organ is represented by the pistil, composed of the ovary,
style
and stigma. The gynoecium has been shown to contain up to 10,000 different
mRNAs not present in other organs (Kamalay and Goldberg 1980). These include
regulatory genes responsible for controlling pistil development as well as
"downstream" ones encoding proteins associated with differentiated cell types
in the
pistil. Genes governing self incompatibility and their homologues are one
class of
gene with pistil predominant expression patterns (Nasrallah et al. 1993).
Other cloned
genes which are applicable as target genes in the present invention include ~i
glucanase (Ori et al. 1990), pectate lyase ( Budelier et al. 1990) and
chitinase (Lotan
et al. 1989) which are expressed in the transmitting tissue and a proteinase
inhibitor
(Atkinson et al. 1993) which are expressed in the style. Others are
pathogenesis
related or are homologues of genes involved in the cleavage of glycosidic
bonds.
These enzymes may facilitate pollen tube growth by digesting proteins in the
tissue
through which the pollen tube grows. A number of female sterile mutants have
been
identified in Arabidopsis. For example, sinl (short integument) (Robinson-
Beers et
al. 1992) and bei I (bell) (Robinson-Beers et al. 1992) affect ovule
development. In
the short integument a mutation blocks megasporogenesis at the tetrad stage
(Elliot,R.C, et al. 1996, Klucher,K.M, 1996). A lethal ovule 2 mutation has
been
observed but not cloned in maize (Nelson et al. 1952). Pistil specific basic
endochitinases have been cloned from a number of species (Ficker et al. 1997,
Dzelzkalns et al. 1993, Harikrishna et al. 1996, Wemmer et al. 1994) and
extensin-
like genes have been shown to be expressed in the styles of Nicotiana alata
(Chen C-
G, et al. 1992). The following are ovule specific clones ZmOV23,13, (Greco R.,
et al.
unpublished), OsOsMAB3A (Kang H.G., et al. 1995), ZmZmM2 (Theissen G., et al.
1995) and stigma specific stigl (Goldman, M.H et al. 1994) , STG08, STG4B12
(EP-
412006-A). Mariani et al. used the promoter from the STIG1 gene to drive
expression
of barnase in the stigmatic secretory zone.
In summary then, the present invention therefore provides a gene switch which
is operably linked to a foreign gene or a series of foreign genes whereby
expression of
CA 02335651 2001-O1-17
WO 00/09704 _ 14 _ PCT/GB99/02653
said foreign gene or said series of foreign genes may be controlled by
application of
an effective exogenous inducer. The gene switch of the present invention,
therefore,
when linked to an exogenous or foreign gene and introduced into a eukaryote by
transformation, provides a means for the external regulation of expression of
that
foreign gene.
It is possible to use one, two or more of these inducible promoter regions
according to the present invention to activate different processes in plant
cells, thereby
obtaining a plant which will have multiple inducible cassettes all controlled
by for
example, different homoserine lactones. Also, a plant may contain, for
example, an
inducible promoter according to the present invention in conjunction with
other
switch type mechanisms examples of which include inducible promoters include
the
Alc A/ R switch system described in International Publication No. WO.
93/21334, the
GST switch system described in International Publication Nos WO 90/08826 and
WO
93/031294 and the ecdysone switch described in our International Publication
No.
WO 96/37609.
The methods and products of the present invention may also be used to control
expression of foreign proteins in eukaryotes such as yeast and mammalian
cells.
Many heterologous proteins for different applications may be produced by
expression
in such eukaryotic cells. The present invention is advantageous in that it
provides
control over the expression of foreign genes in such cells. It also provides a
further
advantage, particularly in yeast and mammalian cells, where accumulation of
large
quantities of a heterologous protein can damage the cells, or where the
heterologous
protein is damaging such that expression for short periods of time is required
in order
to maintain the viability of the cells. The inducible system of the present
invention
also has applicability in gene therapy as it allows the timing of the
therapeutic gene to
be controlled. The present invention is therefore not only advantageous in
transformed mammalian cells but also to mammals per se. Furthermore, the
present
invention may be used to switch on genes which produce potentially damaging or
lethal proteins. Such a system may be employed in the treatment of cancer in
which
cells are transformed with genes which express proteins which are lethal to
the cancer.
The timing of the action on such proteins on the cancer cells may be
controlled using
the switch of the present invention.
CA 02335651 2001-O1-17
WO 00/09704 - 15 - PCT/GB99/02653
Various preferred features and embodiments of the present invention will now
be described by way of non-limiting examples with reference to the
accompanying
Figures of which:-
Figure 1 shows a schematic representation of the general structure of the
response
regulator protein of the bacterial quorum sensing system.
Figure 2 shows a schematic representation of the homoserine lactone gene
switch
system.
Figure 3 is a plasmid map of the reporter gene construct, p221.91ux6.
Figure 4 is a plasmid map of p221.91ux2.
Figure 5 Plasmid map of p221.91ux3.
Figure 6 Plasmid map of p221.91uxC.
Figure 7 Plasmid map of p221.9Lpro.
Figure $ Depicts the expression vector containing the LuxR gene in the pDHS 1
LuxR
plasmid.
Figure 9 Shows the expression cassette containing the enhanced N-terminal
fusion
protein of SV40-NLS-Gal4-LuxR in the plasmid pDH5ISVLuxR.
Figure 10 Shows the expression cassette containing the enhanced C-terminal
fusion of
LuxR-SV40-NLS-Gal4 in the plasmidDHSILuxRSV.
Figurel 1 is the plasmid map of p221.9lasbox. Containing one copy of the LasR
Box.
Figure 12 is a plasmid map of the transient expression construct containing
LasR,
pSinLASR. _
Figure 13 expression plasmid pFunLuxR for expression in monocotyledon
protoplasts.
Figure 14 expression plasmid pFunLasR for expression in monocot protoplasts.
Figure 15 expression plasmid pFunTraR for expression in monocot protoplasts.
Figure 16 reporter plasmid p221.9traboxl containing tra box sequence 1
described by
Zhu and Winans, (1999)
Figure 17 reporter plasmid p221.9trabox2 containing tra box of sequence 2
described
by Zhu and Winans, ( 1999).
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
- 16-
Figure 18 is a plasmid map of binary vectors containing the effector and
reporter
cassettes, pAHL 1.
Figure 19. is a plasmid map of binary vectors containing the effector and
reporter
cassettes, pAHL2.
Figure 20. is a plasmid map of binary vectors containing the effector and
reporter
cassettes, pAHL3.
Figure 21 is a plasmid map of binary vector containing luxl gene, pBDHELI.
Figure 22 is a plasmid map of pSB401 containing the Lux operon.
Figure 23 shows the root of a transgenic tobacco plant that was grown in
tissue culture
under aseptic conditions was placed on an LB agar plate and overlain with top
agar
containing E. coli with the plasmid pSB401 (Figure 22). This strain expresses
the lux
operon and will bioluminesce in response to OHHL and HHL. Bioluminescence in
the
region around the root was clearly seen with the naked eye.
Figure 24. Shows a leaf of a transgenic tobacco plant that was grown in tissue
culture
under aseptic conditions. The leaf was excised from the plant and placed on an
LB
agar plate and overlaid with top agar containing Chromobacterium violaceum
indicator strain. The violet colour detected represent the induction of the
indicator
stain gene showing the extrusion of OHHL from the plan tissue into the
bacterial
medium.
Sequences
SEQ ID No. 1 is the Luxl box promoter region.
SEQ ID No. 2 is the Luxl promoter region.
SEQ ID No. 3 & 4 are the LuxRBamhl fragment.
SEQ ID No. S & 6 are the LuxR sequence/protein sequence.
SEQ ID No. 7 & 8 are the NVLuxR fusion flanked by BamHI and PstI sites/protein
sequence.
SEQ ID No. 9 & 10 are the LuxRNV sequence/protein sequence.
SEQ ID No. 11 is a TraRl fragment.
SEQ ID No. 12 is the TraR2 fragment.
SEQ ID No. 13 is the LasBoxl region.
SEQ ID No. 14 is the LasBox2 region.
SEQ ID No. 15, 16, 17 and 18 are the TraBox1,2,3,4 regions respectively.
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
-17-
SEQ ID No. 19 is the Lw~;R response protein sequence.
SEQ ID No. 20 is the LasR response protein sequence.
SEQ ID. No. 21 is the TrasR response protein sequence.
SEQ ID No. 22 & 23 are the open reading frames of LasR and TraR respectively.
SEQ ID No.24 is the Lux Box promoter region.
Example 1. Transient expression of LuxR and reporter plasmid in Tobacco
mesophyll protoplasts.
Preparation of Reporter gene expression cassette.
Six copies of the 20bp palindromic lux box sequence will be fused upstream of
the -60CaMV minimal promoter which in tum is fused to the reporter gene GUS.
The
palindrome of sequence 5' GATCACCTGTACGATCGTACAGGT 3' (Sequence ID.
1) was self annealed and introduced into a BamHI pBluescript vector. Sequence
determination of a number of recombinants lead to the identification of a
plasmid with
6 copies of the palindrome. The identified plasmid was digested with HindIII
and
SaII to release the in 6 copies of the palindrome and introduced into a
HindIIIlSaII
p221.9 vector. p221.9 plasmid contains a -60CaMV minimal promoter fused to GUS
downstream of the HindIII and SaII unique cloning sites. A recombinant plasmid
was
identified and named p221.91ux6 (Figure 3). The same oligonucleotide was used
to
generate p221.9LuxR2 (Figure 4), p221.9LuxR3 (Figure 5) and p221.9LuxC (Figure
6). p221.91pro was generated using the bacterial promoter containing the Lux
box
sequences (Figure 7 Sequence ID 2).
Preparation of LuxR expression vector.
The lux receptor was altered at both ends of the coding sequence. At the Fend
a plant Kozac consensus sequence was placed with an NcoI site at the ATG start
of
the coding sequence. Upstream from the Kozac consensus sequence a BamHI unique
site was introduced using PCR. The sense oligonucleotide was luxrbamhl 5'
CCCGGATCCTAACAATGGGTATGAAAGACATAAATG 3' (Sequence ID.3 )and
the antisense primer was luxrbamh2 S'
CGAACTCGAGTCATGATTTTAAAGTATGGGCAA-TCAATTG 3' (Sequence
ID.4 ). The PCR reaction was carned out using Taq polymerase (2.5 U) in a
reaction
CA 02335651 2001-O1-17
WO 00/09?04 PCT/GB99/02653
- 18-
buffer containing IOOng of template DNA, 100 ng of each oligonucleotide, 20 mM
TRIS-HCI pH 8.4, SO mM KCI, 10 mM MgClz, 50 mM dNTPs and using hot start
conditions followed by 15 cycles of denaturing (94°C for I minute),
annealing (66°C
for 1 min) and synthesis (72°C for 3 min). The fragment was purified
and digested
using BamHIlXhoI and was introduced into pDH~ 1 BamHIlSaII vector to give
pDH51 luxR (fYhoI and SaII restriction enzymes produce compatible ends)
(Figure 8).
The sequence of the insert was determined and compared to the published LuxR
sequence (Sequence ID. 5) (Devine et al., 1988).
Tobacco mesophyll transformation.
Tobacco shoot cultures cv. Samsun, were maintained on solidified MS medium
+ 3% sucrose in a controlled environment room (i 6 hour day / 8 hour night at
25°C,
55% R.H), were used as the source material for protoplasts. Leaves were sliced
parallel to the mid-rib, discarding large veins and the slices were placed in
CPW13M
(13% mannitol, pH5.6, 860mmol/kg) for 1 hour to pre-plasmolyse the cells. This
solution was replaced with enzyme mixture (0.2% cellulase R10, 0.05%
macerozyme
R10 in CPW9M (CPWI3M but 9% mannitol), pH5.6, 600mmo1/kg) and incubated in
the dark at 25°C overnight ( I 6 hours). The enzyme mixture was passed
through a
75pm sieve and the filtrate was centrifuged at 600rpm for 3.5 minutes,
discarding the
supernatant. The pellet was resuspended in 0.6M sucrose solution and
centrifuged at
600rpm for 10 minutes. The protoplasts were removed and diluted with CPW9M
(pH5.6, 560mmol/kg) and pelleted by centrifuging at 600rpm for 3.5 minutes.
The
protoplasts were resuspended in CPW9M, counted, diluted to 2x106/ml in MaMg
medium (Negrutui et al., 1987) and aliquoted at 4x105 protoplasts per
treatment.
20pg each of effector and reporter plasmid DNA (lmg/ml) were added followed by
200p1 PEG solution (Negrutui et al., 1987). The protoplasts were incubated at
room
temperature for 10 minutes before addition of Sml MSP19M medium (MS medium,
3% sucrose, 9% mannitol, 2mg/1 NAA, O.Smg/1 BAP, pH5.6, 700mmol/kg) in the
presence or absence of ligand (N-(-3-oxohexanoyl)-L-homoserine lactone
(OHHL)).
The protoplasts were cultured in their tubes lying horizontally at 25°C
and they were
harvested for the GUS assay after 24 hours.
CA 02335651 2001-O1-17
WO 00/09704 - 19 - PCT/GB99/02653
Transient Expression in Nicotiana pumbaginifolia suspension cells derived
protoplasts
Protoplasts isolation
Protoplasts were isolated from Nicotiana plumbaginifolia suspension cells.
Suspension cells were sub-cultured once a week in Np suspension medium in 250
ml
Erlenmeyer flasks that were shaken at 100 RPM , at 25°C with I6h/8h
lightldark
regime. Protoplasts were isolated 2 or 3 days after subculture. Two or 2.5 g
fresh
weight of cells were incubated with 20 ml filter-sterilised enzyme solution
and shaken
at 40 rpm at 25°C. The enzyme solution comprised 1 % cellulysin
(Calbiochem
219466), 1 % Macerozyme RIOT"' (Yakult, Tokyo), and 1 % Driselase (SigmaTM D-
9515) dissolved Artificial Sea Water Mannitol. After 3 h cell digestion in
enzyme
solution, they were washed through 100-, 50-um diameter sieves with W5
solution
before being collected by centrifugation at 80 x g for 4 min. This method is
also used
for the isolation of wheat protoplasts.
Protoplasts transformation.
Protoplasts were resuspended in W5 medium at densities ranging from 0.1 to
0.2 x I06 /ml and sedimented for 4 min at 80 g. They were then taken up in 0.2
to 0. 5
ml of: 0.4 M mannitol, 15 mM MgCIZ, 0.1 % MES, 2 % glucose, pH 5.6 containing
15
p,g plasmid DNA. Five minutes later poly-ethylene glycol (PEG) 4000 (FlukaT"')
at
40% (wlv) in 0.4 M mannitol and 0. 1 M Ca(N0,).4H20 pH 9.0 was added to give
final
PEG concentrations of 20%. After half an hour 1 ml 0.2 M CaCl,.2Hz0 were
added,
and the protoplasts centrifuged for 4 min at 40 g. The protoplasts were then
cultured
in transformation buffer at 0.1-0.2 x 106 protoplasts per ml during 48h at
25°C in the
dark. This method is also applicable to the transformation of wheat
protoplasts.
GUS Assays
Transient transformed tobacco protoplasts were harvested by centrifugation at
3000 rpm. by collecting them by centrifugation at 3000 rpm. The supernatant
was
discarded and the protoplasts resuspended in GUS extraction buffer (Jefferson
et al.,
1987) for preparation of (3-glucoronide extracts. The tubes were vortexed for
1 minute
and then spun at 13000rpm for 2 minutes. The supernatant was collected and
placed
CA 02335651 2001-O1-17
WO 00/09704 - 20 - PCT/GB99/02653
in a fresh eppendorf tube. 201 of the extract were used in the GUS assays.
Fluorometric assays for GUS activity were performed with the substrate 4-
methylumbelliferyl-D-glucuronide (Sigma'"'') using a Perkin-ElmerT"'' LS-35
fluorometer (Jefferson et al., 1987). Protein concentration of tissue
homogenates
were determined by the Bio-Rad'~'''' protein assay (Bradford, 1976).
Example 2. Transient expression of enhanced LuxR.
The transient expression experiments were carried out as described above.
The same reporter plasmid was used but different effector constructs were
produced.
In order to address whether the presence of a strong activator such as VP 16
would
enhance transcriptional efficacy of the receptor, it was introduced in both
the N- and
C- terminal ends of LuxR. The VP 16 was also fused to the nuclear localisation
signal
{NLS) from SV40. Both the NLS of SV40 and VP16 were obtained from the yeast
two hybrid plasmid pPC86 as a fused fragment which meant that it could be
fused as
one on to LuxR. The N-terminal fusion was constructed by isolating and
introducing
into pBluescript a CIaIlNotI fragment of pPC86 containing the SV40 NLS and
Gal4
activation domain. The resulting pBluescriptSV40V was digested with HindIII
and
filled in followed by BgIII digestion. The fragment was introduced into
SmaIlBamHI
pDH~ lluxR vector (BamHI and BgIII enzymes produce compatible ends) to produce
the N-terminal fusion in LuxR and yield plasmid pDH5INVLuxR {Figure 10). The
methionine start site is provided by the SV40 fragment.
The C-terminal end fusion was carried out by placing at the RcaI site in LuxR
the blunted fragment of NLS/VP 16. pDH51 LuxR was digested with RcaI, blunt
ended and ligated to the CIaIlNotI SV40-Gal4 blunt ended fragment. The fusion
resulted in plasmid pDHS 1 LuxRNV which contains four linking amino acids, C A
K
L, between the end of LuxR and the start of the nuclear locating sequence.
The plasmids were tested in tobacco mesophyll protoplasts as described in
Example l, where p221.91ux6 was introduced with or without either of the
expression
vectors containing the enhanced luxR. GUS assays were carried out as described
above.
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
-21 -
Cxamplc 3. Transient expression of LuxR, LasR and TraR in monocot
protoplasts.
Expression plasmid construction.
The vector of choice for expression in monocot transient system was pFun
which contains ubiquitin promoter region and the Nos terminator. In between
the two
there is multiple unique cloning sites. LuxR was transferred into pFun as a
BamHI
fragment. pLasR was transferred as a BamHI/KpnI fragment. TraR was isolated
from
Agrobacterium tumefaciens by PCR using oligonucleotides TraRl 5'
AATTGGTACCCACCATGCAGCACTGGCTGGACAAGTTGACC 3'(Sequence
ID. 11) and TraR2 5' AATTGGATCCCAGATCAGCTTTCTTCTGCTTGGCGAGG
3' (Sequence ID 12). The purified fragment was restriction enzyme digested
with
BamHI and introduced into pFun BamHI vector. On each case the expression
vectors
were named as follows: pFunLuxR (Figure 13), pFunLasR (Figure 14) and pFunTra
(Figure 15).
Reporter plasmid construction
Reporter plasmid used with the expression vector encoding for LuxR is the
same as that used in the transient experiments carried out in Tobacco
(Examples 1 and
2). In the case of reporter vectors for both the expression of LasR and TraR
the
parental plasmid p221.9 was used. In both cases oligonucleotides encoding the
LasBox and the two TraBoxes were synthetically made. The LasBox
oligonucleotides
are as follows LasBoxl 5' TCGACACCTGCGAGTTCTCCGAGGTG 3' (Sequence
ID 13) and LasBox2 is 5' TCGACACCTCGGAGAACTCGCAGG TG 3' (Sequence
ID 14). The TraBoxes as described by Zhu and Winans, (1999} were used and the
oligos are as follows, TraBoxl 5 ' TCGACTACACGTCTAGACGTGTAGG 3'
(sequence ID 15), TraBox2 5' TCGACCTACACGTCTAGACGTGTAG 3'(Sequence
ID 16) (first pair), TraBox3 5' TCGACTACACGTCTAGACGTGTAAG 3'
(Sequence ID 17) and trabox4 5' TCGACTTACACGTCTAGACGTGTAG 3'
(second pair) (Sequence ID 18). Equimolar amounts of each pair oligo in the
pair
were mixed denatured and allow to cool down slowing to form double stranded
DNA
which had SaII cohesive ends. The double stranded DNA was then ligated into a
SaII
digested p221.9 vector. Recombinants were screened by colony hybridisation and
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
-22-
sequenced to ascertain number of elements incorporated into the vector. The
vectors
were named as follows p221.9Traboxl (Figure 16), p2219Trabox2 (Figure 17) and
p221.9Lasbox (Figure 11 ).
Example 4. Stable expression of LuxR in Tobacco plants
Binary vector construction
The reporter cassette was isolated from p221.91ux6 by digesting with EcoRI
and HindIII to yield a 2.Okb fragment. The fragment was purified and
introduced into
pain 19 EcoRI/HindIII vector to produce pBinrepAHL. The three different
variants
of the LuxR receptor, that is LuxR and the two enhanced versions were
restriction
enzyme digested with EcoRI (site flanking both sides of the effector cassette)
and
introduced into a dephosphorylated EcoRI pBinl9repAHL vector to produce either
pAHLI (LuxR) (Figure 18), pAHL2 (SVLuxR) (Figure 19) or pAHL3 (LuxRSV)
(Figure 20).
Plant transformation
The plant transformation construct pAHL 1 (Figure 18), pAHL2 (Figure 19)
and pAHL3 (Figure 20), containing LuxR or chimeric LuxR and a reporter gene
cassette, were transformed into Agrobacterium tumefaciens LBA4404 using the
freeze/thaw method described by Holsters et al. ( 1978). Tobacco (Nicotiana
tabacum
cv Samsun) transformants were produced by the leaf disc method (Horsch et al.,
1988). Shoots were regenerated on medium containing 100mg/1 kanamycin. After
rooting, plantlets were transferred to the glasshouse and grown under 16 h
light/ 8 h
dark conditions
PCR analysis
Analysis of transgenic tobacco plants by PCR was carried out using leaf sample
extracted in 300p,1 of extraction buffer. The DNA was precipitated with
isopropanol
at 4°C for 10 minutes and then centrifuged. The pellet was dried and
resuspended in
. 100p,1 of TE (IOmM Tris HCl pH 8.0, 1mM EDTA):~2.5 pl were placed in a 500
p.l
eppendorf tube and a master mix containing buffer, dNTPs and oligonucleotides
was
CA 02335651 2001-O1-17
WO 00/09704 - 23 - PCT1GB99/02653
added. The Taq polymerase (Gibco-BRL~) was added afrer samples were denatured
for 3 minutes.
Chemical treatments
OHHL was dissolved in methanol (Sigma) and the stock maintained at -
20°C.
The compound was diluted in growth media used to germinate seedlings.
Uninduced
seedlings were treated with equivalent amount of methanol. Seeds were
germinated
in MS media supplemented with 0.8% (w/v) agar. Seedlings were collected 2 days
post-germination (two cotyledon stage).
GUS Assay
In seedling induction experiments 10 two day old seedlings were collected and
flash frozen in liquid nitrogen. The seedlings were homogenised in 300 p,l of
GUS
extraction buffer and centrifuged for 5 minutes at 13000rpm. The supernatant
was
used for both GUS and Bio-Rad~'~"' protein assays.
Example 5 Stable constitutive expression of yenl gene in tobacco plants
Binary vector construction.
pBDHELI (Figure 21) was constructed by fusing the alfalfa mosaic virus
(AMV) translation enhancer sequence from pBi526 (Dada et al., Plant Science
94,
139-140 (1993)) to the yenl coding sequence from Yersinia enterocolitica. AMV-
Luxl
gene fusion was directional cloned into pDHS 1 (Pietrzak et al.,1986) vector
to
produce pDHELI. A l.8kb fragment of pDHELI was cloned into pBinl9 {Bevan,
1994) to give pBDHELI (Figure 21). The plasmid was introduced into
Agrobacterium
as described above. A tobacco plant population of was produce and screened as
detailed above. A high expressor of yenl gene was selected by their ability to
synthesised OHHL. The assay consists of placing a leaf of the transgenic plant
on an
agar plate overnight. The leaf was then removed and the cvil mutant of
C>zromobacterium violaceum spread over the plate. Violacein (a purple pigment)
production by the bacterium can be seen when OHHL had diffused out of the leaf
and
into the agar (Figure 24).
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
-24-
Example 6. LuxR is activated by compounds produced by yenl plants.
The root of a transgenic tobacco plant containing the yenl expression
cassette,
that was grown in tissue culture under aseptic conditions, was placed on an LB
agar
plate and overlain with top agar containing E. coli with the plasmid pSB401
(Figure
22). This strain expresses the lux operon (i.e. IuxR, lux ABCDE) and will
bioluminesce in response to OHHL and HHL. Figure 24 shows that acyl-homoserine
lactones produced by yenl introduction into tobacco plants are capable of
activating
LuxR harboured in E.coli and activate reporter gene expression. These data
suggest
that introduction of LuxR expression and reporter cassettes into plants
harbouring the
yenl gene will result in activation of reporter gene expression.
Example 7. Cross of LuxR tobacco high expressor plant with yenl tobacco plant.
Plants are produced by crossing the yenl expressing plant with the AHL switch
plants. The seed of the progeny was collected and assayed for GUS activity as
described above. GUS activity was assayed for in all tissues and different
ages as the
expectation was that GUS protein would be present in all tissues expressing
the yenl
gene. yenl is under control of the 35S CaMV promoter as is the LuxR protein in
the
AHL switch. Initially, progeny seedlings were grown in 1/2MS and were
collected 2
days post-germination or when cotyledons were fully extended.
Other modifications of the present invention will be apparent to those skilled
in the art without departing from the scope of the invention.
CA 02335651 2001-O1-17
WO 00/09704 - 25 - PCT/GB99/02653
References
Aarts et al., Nature, 363:715-717
Albani D., Robert L.S., Donaldson P.A., Altosaar L, Arnison P.G., Fabijanski
S.F.
(1990) Plant Mol. Biol. 15:605-622
Bassler, B.L., Wright, M. and Silverman, M.R. ( 1994) Molecular Microbiology
12,
403-412.
Bevan, M (1984).Nucl. Acids Res. 12, 8711-8721.
Bradford, M.M. (1976). 72, 248-254.
Beck von Bodman, S and Farrand, S.K. (1995) Journal of Bacteriology 177, 5000-
5008.
Budelier, K.A., Smith, A.G., and Gasser, C.S. (1990). Mol. Gen. Genet 224, 183-
I92.
Christou, P. Plant Mol Biol 35: 197-203 (1997)
De Block, M., Debrouwer, T., Moens, T. (1997). Theor Appl Genet. 95, 125-131.
Devine , J.H., Countryman, C and Baldwin, T.O. (1988) Biochemistry 27, 837-
842.
Ficker, M., Wemmer, T., and Thompson, R.D (1997). Plant Mol Biol 35, 425-431
Fuqua, W.C. and Winans , S.C. (1994) Journal of Bacteriology I76, 2796-2806.
Fuqua, W.C., Winans , S.C. and Greenberg, E.P. (1994) Journal of Bacteriology
176,
269-275.
Gilson, L., Kuo, A and Dunlap, P.V. (1995) Journal of Bacteriology 177, 6946-
6951.
Goldman, M.H., Goldberg, R.B., Mariane, C. (1994). EMBO J 13: 2976-2984.
Gray, K.M. et al., (1996) Journal of Bacteriology 178, 372-376.
Hamilton, D.A., Bashe, D.M., Stinson, J.R., Mascarenhas, J.P. (1989). Sex
Plant
R, e~~rod 2, 208-212.
Hanson, D.H., Hamilton, D.A., Travis, J.L., Bashe, D.M., Mascarenhas, J.P.
(12989).
The Plant Cell 1, 173-179
Hasselhof. J and Gerlach W.L, 1988) Nature Vol 334: 585-591.
Hird, D.L., Worrall, D., Hodge, R., Smartt, S., Paul, W and Scott, R (1993).
The Plant
Journal 4(6), 1023-1033.
Hwang, L, Cook, D.M. and Farrad, S.K. (1995) J.Biotechnology 177, 449-458.
Izawa T, Ohnishi T, Toshitsugu N, Ishida N, Hiroyuki E, Hashimoto H, Itoh K,
Terada R, Wu C, Miyazaki C, Endo T, Iida S and Shimaamoto K (1997 Plant Mol
Biol 35: 219-229
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
-26-
Jefferson, R.A., Kavanagh, T.A. and Bevan, M. W. (1987) EMBO J. 6, 3901-3907.
Jepson, I, Lay, V., Holt, D.C., Bright, W.J., and Greenland, A.J.,(1994)..
Plant
Molecular Biology 26: 1855-1866.
Kamalay, J.C., and Goldberg, R.B. (1980). Cell 19, 935-946
Kang H.G., Noh Y.S., Chung Y.Y., Costa M.A., An K., An G. (199 Plant Mol.
Biol.
29:1-10
Kempin , S.A., Liljigren, S.J., Block, L.M., Rounsley, S.D., and Yanofsky,
M.F.
(1997).. Nature Vol 389
Kilian A, Chen J, Han F, Steffenson B and Kleinhofs A (1997 Plant Mol Biol 35:
187-195.
Koes R.E:, Spelt C.E., van Den Elzen P.J.M., Mol J.N.M.. (1989. Gene 81:245-
257
Latifi, A, et al (1995) Molecular Microbiology 17, 333-343.
Lotan,T., Ori, N., and Fluhr, R. (1989). Plant Cell 1, 881-887
Mariani, C., Gossele, V., De Beuckeleer, M., De Block, M., Goldberg, R.B., De
Greef, W. and Leemans, J. (1992). Nature Vol 357, 384-387.
McGowan, S et al (1995) Microbiology 141, 541-550.
Meighen, E.A. (1994) Annual Reviews of Genetics 28, 117-139.
Milton, D.L., Hardman, A., Camara, M., Cdhabra, S-R., Bycroft, B.W., Steward,
G.S.A.B. and William, P (1997) Journal of Bacteriology 179, 3004-3012.
Moore G, Devos K.M, Wang Z, and Gale M.D. (1995) Current Biol 5: 737-739
Nadeau, J .A., Zhang, X.S., Li, J and O'Neill, S.D. (1996 The Plant Cell 8,
213-239
Nasrallah, J.B., and Nasrallah, M.E. (1993)Plant Cell 5., 1325-1335.
Negrutiu, L, Shillito, R., Potrykus, L, Biasini, G., Sala, F. (1987) Plant
Molecular
Biology, 8, 363-373.
Nelson, O.E., and Clary, G.B. (1952) J Hered. 43, 205-210
Ochsner, U.A. and Reiser, J. (1995) Proc. Natl. Acad. Sci. USA 92, 6424-6428.
Ori, N., Sessa, G., Lotan, T., Himmelhoch, S., and Fluhr, R. (1990). EMBO J 9,
3429-
3436.
Pesci, E.C., Pearson, J.P., Seed, P.C. and Iglewski, B.H. (1997) Journal of
Bacteriology 179, 3127-3132.
Pieterzak, M. et al., (1986) Nucl. Acids Res. 14, 5857-5868
Robinson-Beers, KK., Pruitt, R. E., and Gasser, C. S. (1992). Plant Cell 4,
1237-1249
CA 02335651 2001-O1-17
WO 00/09704 - 27 - PC'T/GB99/02653
Seurinck J., Truettner J., Goldberg R.B. (1990). Nucleic Acids Res. 18:3403-
3403
Sitnokov, D.M., Schineller, J.B. and Baldwin, T.O. (1995) Molecular
Microbiology
17, 801-812.
Spena, A., Estruch, J.J., Prensen, E., Nacken, W., Van Onckelen, H., Sommer,
H.
(1992). Theor Appl Genet 84, 520-527
Swift, S. et al (1993) Molecular Microbiology 10- 511-520.
Swift, S., Karlyshev, A.V., Fish, L., Durant, E.L., Winson, M.K., Chhadra, S-
R.,
Williams, P, Macintyre, S. and Steward, G.S.A.B. (1997) Journal of
Bacteriology 179,
5271-5281.
Theissen G., Strater T., Fischer A., Saedler H. (1995). Gene 156:155-166
Throup J.P et al., (1995) Molecular Microbiology 17, 345-356.
Tsuchiya T., Toriyama K., Ejiri S., Hinata K. (1994). Plant Mol. Biol. 26:1737-
1746
Tsuchiya, T., Toriyama, K., Yoshikawa, M., Ejiri, S., Hinata, K., (1995).
Plant Cell
P~36, 487-494.
Twell, D., Wing, R.A., Yamaguchi, J., McCormick, S. (1989) MoI Gen Genet 217,
240-245.
Twell, D., Yamaguchi, J., McCormick, S. (1990) Development 109, 705-713.
Weeks JT et al. (1993) 102:1077-1084
Williams, P. in Pseudomonas - Molecular Biology and Biotechnology (Nakazawa,
T.,
Furukawa, K., Haas, D. and Silver, S, eds), ASM press.
Winson, M.K., et al (1994) in Proceedings of the 94'" annual meeting of the
American
Society for Microbiology (May, 1994, Las Vegas, USU) Abstract H-71 p 212.
Winson, M.K., et al (1995) Proc. Natl. Acad. Sci. USA 92, 9427-9431.
Wood, D.W. and Pierson, L.S. (1996) Gene 168, 49-53.
Wright,S.Y., Suner,M-M., BelI,P,J., Vaudin,M., and Greenland,A.J (1993) The
Plant
Journal 3, 41-49.
Xu, H., Davis, S.P., Kwan, B.Y.H., 0'Bries, A.P., Singh, M., Knox, R.P. (1993)
Mol Gen Genet 239, 58-65.
Yokoi, S., Tsuchiya, T., Toriyama, K., Hinata, K (1997). Plant Cell Reports
16, 363-
367.
Zhu, Jun and Winans, S.C. (1999) PNAS 96, p4832-4837
CA 02335651 2001-O1-17
WO 00/09704 - 2g - PCT/GB99/02653
Zou. J.T., Zhan.X.Y., WU, H.M., Wang, H., Cheung, A.Y. (1994) Am J Bot 81, 552-
561.
CA 02335651 2001-O1-17
- WO 00/09704 PCT/GB99/02653
1
SEQUENCE LISTING
<110> ZENECA LIMITED
<120> GENE SWITCH
<130> PPD 50369 GENE SWITCH
<190>
<141>
<150> GB9817704.1
<151> 1998-08-13
<160> 24
<170> PatentIn Ver. 2.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Lux Box
Promoter Region
<400> 1
gatcacctgt acgatcgtac aggt 24
<210> 2
<211> 245
<212> DNA
<213> Photobacterium fischeri
<400> 2
ggatccagaa ttcgtgattc cactgcagtg atcatctctt tatccttacc tattgtttgt 60
cgcaattttg cgtgttatat atcattaaaa cggtaatgga ttgacatttg attctaataa 120
attggatttt tgtcacacta ttgtatcgct gggaatacaa ttacttaaca taagcacctg 180
taggatcgta caggtttagc gaagaaaatg gtttgttata gtcgaataaa cgcaagggag 290
gatcc 245
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:LuxrbamHI
Fragment
<400> 3
cccggatcct aacaatgggt atgaaagaca taaatg 36
<210> 4
<211> 90
<212> DNA
<213> Artificial Sequence
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
2
<220>
<223> Description of Artificial Sequence:LuxRBamH2
Fragment
<400> 9
cgaactcgag tcatgatttt aaagtatggg caatcaattg 90
<210> 5
<211> 781
<212> DNA
<213> Photobacterium fischeri
<220>
<221> CDS
<222> (12)..(770)
<400> 5
ggatcctaac a atg ggt atg aaa gac ata aat gcc gac gac act tac aga 50
Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg
1 5 10
ata att aat aaa att aaa get tgt aga agc aat aat gat att aat caa 98
Ile Ile Asn Lys ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln
15 20 25
tgc tta tct gat atg act aaa atg gta cat tgt gaa tat tat tta ctc 146
Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu
30 35 40 45
gcg atc att tat cct cat tcc atg gtt aaa tct gat att tca att cta 199
Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu
50 55 60
gat aat tac cct aaa aaa tgg agg caa tat tat gat gac get aat tta 242
Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu
65 70 75
ata aaa tat gat cct ata gta gat tat tct aac tcc aat cat tca cca 290
Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro
80 85 90
att aat tgg aat ata ttt gaa aac aat get gta aat aaa aaa tct cca 338
Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro
95 100 105
aat gta att aaa gaa gcg aaa tca tca ggt ctt atc act ggg ttt agt 386
Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser
110 115 120 125
ttc cct att cat act get aat aat ggc ttc gga atg ctt agt ttt gca 434
Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala
130 135 140
cat tca gag aaa gac aac tat ata gat agt tta ttt tta cat gca tgt 482
His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys
145 150 155
atg aac ata cca tta att gtt cct tct cta gtt gat aat tat cga aaa 530
Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys
160 165 170
ata aat ata gca aat aat aaa tca aac aac gat tta acc aaa aga gaa 578
Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu
175 180 185
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
3
aaagaatgtttagcg tgggcatgcgaa ggaaagagctcttgg gatatt 626
LysGluCysLeuAla TrpAlaCysGlu GlyLysSerSerTrp.AspIle
190 195 200 205
tcaaaaatattaggc tgcagtaagcgt acggtcactttccat ttaacc 679
SerLysIleLeuGly CysSerLysArg ThrValThrPheHis LeuThr
210 215 220
aatgcgcaaatgaaa ctcaatacaaca aaccgctgccaaagt atttct 722
AsnAlaGlnMetLys LeuAsnThrThr AsnArgCysGlnSer IleSer
225 230 235
aaagcaattttaaca ggagcaattgat tgcccatactttaaa tcatga 770
LysAlaIleLeuThr GlyAlaIleAsp CysProTyrPheLys Ser
240 245 250
ctcgactgca g 781
<210> 6
<211> 252
<212> PRT
<213> Photobacterium fischeri
<400> 6
Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn
1 5 10 15
Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser
20 25 30
Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile
35 40 95
Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr
50 55 60
Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr
65 70 75 80
Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp
85 90 95
Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile
100 105 110
Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile
115 120 125
His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu
130 135 140
Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile
145 150 155 160
Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile
165 170 175
Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys
180 185 190
Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile
195 200 205
Leu Gly Cys Ser Lys Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln
210 215 220
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
4
Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile
225 230 235 240
Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Ser
245 250
<210> 7
<211> 1190
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:NVLuxR Fusion
<220>
<221> CDS
<222> (16)..(999)
<400> 7
ggtacccagc ttatg ccc aag aag aag cgg aag gtc tcg agc ggc gcc aat 51
Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn
1 5 10
ttt aat caa agt ggg aat att get gat agc tca ttg tcc ttc act ttc 99
Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe
15 20 25
act aac agt agc aac ggt ccg aac ctc ata aca act caa aca aat tct 147
Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser
30 35 40
caa gcg ctt tca caa cca att gcc tcc tct aac gtt cat gat aac ttc 195
Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe
45 50 55 60
atg aat aat gaa atc acg get agt aaa att gat gat ggt aat aat tca 243
Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser
65 70 75
aaa cca ctg tca cct ggt tgg acg gac caa act gcg tat aac gcg ttt 291
Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe
80 85 90
gga atc act aca ggg atg ttt aat acc act aca atg gat gat gta tat 339
Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr
95 100 105
aac tat cta ttc gat gat gaa gat acc cca cca aac cca aaa aaa gag 387
Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu
110 115 120
ggt ggg tcg acc ccg gga att cag atc cta aca atg ggt atg aaa gac 935
Gly Gly Ser Thr Pro Gly Ile Gln Ile Leu Thr Met Gly Met Lys Asp
125 130 135 140
ata aat gcc gac gac act tac aga ata att aat aaa att aaa get tgt 483
Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys
145 150 155
aga agc aat aat gat att aat caa tgc tta tct gat atg act aaa atg 531
Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met
160 165 170
gta cat tgt gaa tat tat tta ctc gcg atc att tat cct cat tcc atg 579
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met
175 180 185
gtt aaa tct gat att tca att cta gat aat tac cct aaa aaa tgg agg 627
Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg
190 195 200
caa tat tat gat gac get aat tta ata aaa tat gat cct ata gta gat 675
Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp
205 210 215 220
tat tct aac tcc aat cat tca cca att aat tgg aat ata ttt gaa aac 723
Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn
225 230 235
aat get gta aat aaa aaa tct cca aat. gta att aaa gaa gcg aaa tca 771
Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Ser
290 295 250
tca ggt ctt atc act ggg ttt agt ttc cct att cat act get aat aat 819
Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn
255 260 265
ggc ttc gga atg ctt agt ttt gca cat tca gag aaa gac aac tat ata 867
Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile
270 275 280
gat agt tta ttt tta cat gca tgt atg aac ata cca tta att gtt cct 915
Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile Pro Leu Ile Val Pro
285 290 295 300
tct cta gtt gat aat tat cga aaa ata aat ata gca aat aat aaa tca 963
Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser
305 310 315
aac aac gat tta acc aaa aga gaa aaa gaa tgt tta gcgtgggcat 1009
Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu
320 325
gcgaaggaaa gagctcttgg gatatttcaa aaatattagg ctgcagtaag cgtacggtca 1069
ctttccattt aaccaatgcg caaatgaaac tcaatacaac aaaccgctgc caaagtattt 1129
ctaaagcaat tttaacagga gcaattgatt gcccatactt taaatcatga ctcgactgca 1189
g 1190
<210> 8
<211> 328
<212> PRT
<213> Artificial Sequence
<400> 8
Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn Phe Asn Gln Ser
1 5 10 15
Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe Thr Asn Ser Ser
20 25 30
Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser Gln Ala Leu Ser
35 40 95
Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe Met Asn Asn Glu
50 55 60
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
6
Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser Lys Pro Leu Ser
65 70 75 80
Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe Gly Ile Thr Thr
85 90 95
Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr Asn Tyr Leu Phe
100 105 110
Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu Gly Gly Ser Thr
115 120 125
Pro Gly Ile Gln Ile Leu Thr Met Gly Met Lys Asp Ile Asn Ala Asp
130 135 140
Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn
145 150 155 160
Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu
165 170 175
Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp
180 185 190
Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp
195 200 205
Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser
210 215 220
Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn
225 230 235 290
Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile
245 250 255
Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met
260 265 270
Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe
275 280 285
Leu His Ala Cys Met Asn ile Pro Leu Ile Val Pro Ser Leu Val Asp
290 295 300
Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu
305 310 315 320
Thr Lys Arg Glu Lys Glu Cys Leu
325
<210> 9
<211> 1206
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:LuxRNV Sequence
<220>
<221> CDS
<222> (12)..(1187)
<400> 9
ggatcctaac a atg ggt atg aaa gac ata aat gcc gac gac act tac aga 50
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
7
Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg
1 5 10
ata att aat aaa att aaa get tgt aga agc aat aat gat att aat caa 98
Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln
15 20 25
tgc tta tct gat atg act aaa atg gta cat tgt gaa tat tat tta ctc 146
Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu
30 35 90 95
gcg atc att tat cct cat tcc atg gtt aaa tct gat att tca att cta 194
Ala Ile Ile Tyr Pro His Ser. Met Val Lys Ser Asp Ile Ser Ile Leu
50 55 60
gat aat tac cct aaa aaa tgg agg caa, tat tat gat gac get aat tta 242
Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu
65 70 75
ata aaa tat gat cct ata gta gat tat tct aac tcc aat cat tca cca 290
Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro
80 85 90
att aat tgg aat ata ttt gaa aac aat get gta aat aaa aaa tct cca 338
Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro
95 100 105
aat gta att aaa gaa gcg aaa tca tca ggt ctt atc act ggg ttt agt 386
Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser
110 115 120 125
ttc cct att cat act get aat aat ggc ttc gga atg ctt agt ttt gca 434
Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala
130 135 190
cat tca gag aaa gac aac tat ata gat agt tta ttt tta cat gca tgt 482
His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys
195 150 155
atg aac ata cca tta att gtt cct tct cta gtt gat aat tat cga aaa 530
Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys
160 165 170
ata aat ata gca aat aat aaa tca aac aac gat tta acc aaa aga gaa 578
Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu
175 180 185
aaa gaa tgt tta gcg tgg gca tgc gaa gga aag agc tct tgg gat att 626
Lys Glu Cys Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile
190 195 200 205
tca aaa ata tta ggc tgc agt aag cgt acg gtc act ttc cat tta acc 679
Ser Lys Ile Leu Gly Cys Ser Lys Arg Thr Val Thr Phe His Leu Thr
210 215 220
aat gcg caa atg aaa ctc aat aca aca aac cgc tgc caa agt att tct 722
Asn Ala Gln Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser
225 230 235
aaa gca att tta aca gga gca att gat tgc cca tac ttt aaa agt atc 770
Lys Ala Iie Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Ser Ile
240 245 250
gat aag ctt atg ccc aag aag aag cgg aag gtc tcg agc ggc gcc aat 818
Asp Lys Leu Met Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn
255 260 265
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
8
ttt aat caa agt ggg aat att get gat agc tca ttg tcc ttc act ttc 866
Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe
270 275 280 285
act aac agt agc aac ggt ccg aac ctc ata aca act caa aca aat tct 914
Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser
290 295 300
caa gcg ctt tca caa cca att gcc tcc tct aac gtt cat gat aac ttc 962
Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe
305 310 315
atg aat aat gaa atc acg get agt aaa att gat gat ggt aat aat tca 1010
Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser
320 325 330
aaa cca ctg tca cct ggt tgg acg gac caa act gcg tat aac gcg ttt 1058
Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe
335 390 345
gga atc act aca ggg atg ttt aat acc act aca atg gat gat gta tat 1106
Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr
350 355 360 365
aac tat cta ttc gat gat gaa gat acc cca cca aac cca aaa aaa gag 1154
Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu
370 375 380
ggt ggg tcg acc ccg gga att cag atc tac tag tgcggccgct cgactgcag 1206
Gly Gly Ser Thr Pro Gly Ile Gln Ile Tyr
385 390
<210> 10 '
<211> 391
<212> PRT
<213> Artificial Sequence
<400> 10
Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn
1 5 10 15
Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser
20 25 30
Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile
35 90 45
Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr
50 55 60
Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr
65 70 75 80
Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp
85 90 95
Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile
100 105 110
Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile
115 120 125
His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu
130 135 140
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
9
Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile
195 150 155 160
Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile
165 170 175
Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys
180 185 190
Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile
195 200 205
Leu Gly Cys Ser Lys Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln
210 215 220
Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile
225 230 235 290
Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Ser Ile Asp Lys Leu
245 250 255
Met Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn Phe Asn Gln
260 265 270
Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe Thr Asn Ser
275 280 285
Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser Gln Ala Leu
290 295 300
Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe Met Asn Asn
305 310 315 320
Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser Lys Pro Leu
325 330 335
Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe Gly Ile Thr
390 395 350
Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr Asn Tyr Leu
355 360 365
Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu Gly Gly Ser
370 375 380
Thr Pro Gly Ile Gln Ile Tyr
385 390
<210> 11
<211> 91
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:TraRl Fragment
<400> 11
aattggtacc caccatgcag cactggctgg acaagttgac c 41
<210> 12
<211> 38
<212> DNA
<213> Artificial Sequence
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
<220>
<223> Description of Artificial Sequence:TraR2 Fragment
<400> 12
aattggatcc cagatcagct ttcttctgct tggcgagg 38
<210> 13
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:LasBoxl
Fragment
<400> 13
tcgacacctg cgagttctcc gaggtg 26
<210> 19
<211> 26
<212> RNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:LasBox2
Fragment
<900> 14
tcgacacctc ggagaactcg caggtg 26
<210> 15
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:TraBoxl
Fragment
<900> 15
tcgactacac gtctagacgt gtagg 25
<210> 16
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:TraBox2
Fragment
<900> 16
tcgacctaca cgtctagacg tgtag 25 .
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
CA 02335651 2001-O1-17
WO 00/09704 PCT/G899/02653
11
<223> Description of Artificial Sequence:TraBox3
Fragment
<400> 17
tcgactacac gtctagacgt gtaag 25
<210> 18
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:TraBox9
Fragment
<900> 18
tcgacttaca cgtctagacg tgtag 25
<210> 19
<211> 250
<212> PRT
<213> Photobacterium fischeri
<400> 19
Met Lys Asn Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile
1 5 10 15
Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met
20 25 30
Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro
35 40 45
His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys
50 55 60
Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro
65 70 75 80
Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile
85 90 95
Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu
100 105 110
Ala Lys Thr Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr
115 120 125
Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp
130 135 140
Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile Pro Leu
145 150 155 160
Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn
165 170 175
Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu Ala
180 185 190
Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile Leu Gly
195 200 205
Cys Ser Glu Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln Met Lys
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
12
210 215 220
Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile Leu Thr
225 230 235 240
Gly Ala Ile Asp Cys Pro Tyr Phe Lys Asn
245 250
<210> 20
<211> 239
<212> PRT
<213> Pseudomonas aeruginosa
<400> 20
Met Ala Leu Val Asp Gly Phe Leu Glu Leu Glu Arg Ser Ser Gly Lys
1 5 10 15
Leu Glu Trp Ser Ala Ile Leu Gln Lys Met Ala Ser Asp Leu Gly Phe
20 25 30
Ser Lys Ile Leu Phe Gly Leu Leu Pro Lys Asp Ser Gln Asp Tyr Glu
35 40 45
Asn Ala Phe Ile Val Gly Asn Tyr Pro Ala Ala Trp Arg Glu His Tyr
50 55 60
Asp Arg Ala Gly Tyr Ala Arg Val Asp Pro Thr Val Ser His Cys Thr
65 70 75 BO
Gln Ser Val Leu Pro Ile Phe Trp Glu Pro Ser Ile Tyr Gln Thr Arg
85 90 95
Lys Gln His Glu Phe Phe Glu Glu Ala Ser Ala Ala Gly Leu Val Tyr
100 105 110
Gly Leu Thr Met Pro Leu His Gly Ala Arg Gly Glu Leu Gly Ala Leu
115 120 125
Ser Leu Ser Val Glu Ala Glu Asn Arg Ala Glu Ala Asn Arg Phe Met
130 135 140
Glu Ser Val Leu Pro Thr Leu Trp Met Leu Lys Asp Tyr Ala Leu Gln
145 150 155 160
Ser Gly Ala Gly Leu Ala Phe Glu His Pro Val Ser Lys Pro Val Val
165 170 175
Leu Thr Ser Arg Glu Lys Glu Val Leu Gln Trp Cys Ala Ile Gly Lys
180 185 190
Thr Ser Trp Glu Ile Ser Val Ile Cys Asn Cys Ser Glu Ala Asn Val
195 200 205
Asn Phe His Met Gly Asn Ile Arg Arg Lys Phe Gly Val Thr Ser Arg
210 215 220
Arg Val Ala Ala Ile Met Ala Val Asn Leu Gly Leu Ile Thr Leu
225 230 235
<210> 21
<211> 234
<212> PRT
<213> Agrobacterium tumefaciens
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
13
<400> 21
Met Gln His Trp Leu Asp Lys Leu Thr Asp Leu Ala Ala Ile Gln Gly
1 5 10 15
Asp Glu Cys Ile Leu Lys Asp Gly Leu Ala Asp Leu Ala Glu His Phe
20 25 30
Gly Phe Thr Gly Tyr Ala Tyr Leu His Ile Gln His Lys His Thr Ile
35 40 45
Ala Val Thr Asn Tyr His Arg Asp Trp Arg Ser Ala Tyr Phe Glu Asn
50 55 60
Asn Phe Asp Lys Leu Asp Pro Val Val Lys Arg Ala Lys Ser Arg Lys
65 70 75 80
His Val Phe Ala Trp Ser Gly Glu Gln Glu Arg Ser Arg Leu Ser Lys
85 90 95
Glu Glu Arg Ala Phe Tyr Ala His Ala Ala Asp Phe Gly Ile Arg Ser
100 105 110
Gly Ile Thr Ile Pro Ile Lys Thr Ala Asn Gly Ser Met Ser Met Phe
115 120 125
Thr Leu Ala Ser Glu Arg Pro Ala Ile Asp Leu Asp Arg Glu Ile Asp
130 135 140
Ala Ala Ala Ala Ala Gly Ala Val Gly Gln Leu His Ala Arg Ile Ser
145 150 155 160
Phe Leu Gln Thr Thr Pro Thr Val Glu Asp Ala Ala Trp Leu Asp Pro
165 170 175
Lys Glu Ala Thr Tyr Leu Arg Trp Ile Ala Val Gly Met Thr Met Glu
180 185 190
Glu Val Ala Asp Val Glu Gly Val Lys Tyr Asn Ser Val Arg Val Lys
195 200 205
Leu Arg Glu Ala Met Lys Arg Phe Asp Val Arg Ser Lys Ala His Leu
210 215 220
Thr Ala Leu Ala Ile Arg Arg Lys Leu Ile
225 230
<210> 22
<211> 720
<212> DNA
<213> Pseudomonas aeruginosa
<400> 22
atggccttgg ttgacggttt tcttgagctg gaacgctcaa gtggaaaatt ggagtggagc 60
gccatcctgc agaagatggc gagcgacctt ggattctcga agatcctgtt cggcctgttg 120
cctaaggaca gccaggacta cgagaacgcc ttcatcgtcg gcaactaccc ggccgcctgg 180
cgcgagcatt acgaccgggc tggctacgcg cgggtcgacc cgacggtcag tcactgtacc 240
cagagcgtac tgccgatttt ctgggaaccg tccatctacc agacgcgaaa gcagcacgag 300
ttcttcgagg aagcctcggc cgccggcctg gtgtatgggc tgaccatgcc gctgcatggt 360
gctcgcggcg aactcggcgc gctgagcctc agcgtggaag cggaaaaccg ggccgaggcc 420
CA 02335651 2001-O1-17
WO 00/09704 PCT/GB99/02653
14
aaccgtttca tggagtcggt~cctgccgacc ctgtggatgc tcaaggacta cgcactgcag 480
agcggtgccg gactggcctt cgaacatccg gtcagcaaac cggtggttct gaccagccgg 540
gagaaggaag tgttgcagtg gtgcgccatc ggcaagacca gttgggagat atcggttatc 600
tgcaactgct cggaagccaa tgtgaacttc catatgggaa atattcggcg gaagttcggt 660
gtgacctccc gccgcgtagc ggccattatg gccgttaatt tgggtcttat tactctctga 720
<210> 23
<211> 705
<212> DNA
<213> Agrobacterium tumefaciens
<900> 23
atgcagcact ggctggacaa gttgaccgat cttgccgcaa ttcagggcga cgagtgcatc 60
ctgaaggatg gccttgccga ccttgccgaa catttcggct tcaccggcta tgcctatctc 120
catatccagc acaaacacac catcgcggtc accaattatc atcgtgactg gcgatcggct 180
tacttcgaga acaacttcga caagctcgat ccggtcgtca agcgcgcgaa atccaggaag 240
cacgtctttg cctggtccgg cgaacaggaa cgatcgcggc tatcgaagga agagcgtgcc 300
ttctacgcgc atgcggccga tttcggcatc cgctccggca tcaccattcc gatcaagacc 360
gccaacggat caatgtcgat gttcacgctg gcgtcggaaa ggccggcgat cgacctcgac 920
cgtgagatcg acgcggccgc agccgcgggc gccgtcgggc agctccatgc ccgcatctct 480
ttccttcaga ccactccgac agtggaagat gccgcctggc tcgatccgaa agaggcgacc 540
tatctcagat ggatcgccgt cggcatgaca atggaggaag tcgcagacgt ggagggcgtc 600
aagtacaaca gcgtccgtgt caagctccgc gaggccatga agcgcttcga cgttcgcagc 660
aaggcccatc tcaccgccct cgcaatcaga agaaagctga tctga 705
<210> 24
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:LuxI Box
Promoter Region
<400> 24
cacctgtagg atcgtacagg t 21
