Note: Descriptions are shown in the official language in which they were submitted.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
VANADATE RESISTANCE GLYCOSYLATION 4 GENE
Field of the Invention
The present invention relates to a yeast Vanadate Resistance Glycosylation 4
(VRG 4) gene and homologs thereof and protein encoded therein useful in
methods
of identifying inhibitors of a GDP-mannose transporter for use as anti-fungal
compounds.
Background of the Invention
The Golgi complex is the site at which the terminal glycosylation of both
proteins and lipids occurs. Unlike mammalian cells, in the yeast S.
cerevisiae,
glycoproteins and sphingolipids are exclusively modified by the addition of
mannose residues in the Golgi. Glycoproteins can undergo two types of
modifications in which oligosaccharides are linked to either asparagine
residues (N
linked) or serine/threonine residues (O-linked) (for review see (1,2). Both of
these
glycosylation pathways initiate in the endoplasmic reticulum (ER) and
terminate in
the Golgi. After transport of the protein to the Golgi, most N linked
oligosaccharides are elongated by a series of different mannosyltransferases
to form
glycoproteins that contain outer chains of 50 or more mannose residues. The
a1,6-
linked outer chain is highly branched with a1,2- and a1,3-linked mannoses. As
in
higher eukaryotes, it appears that the various mannosyltransferases that
catalyse
these sequential reactions are compartmentalized from one another within the
individual Golgi cisternae. In the case of O-linked sugars, up to five
mannoses are
added after the addition of the first mannose in the ER (3,4). The
phosphoinositol-
containing sphingolipids in yeast also undergo mannosylation in the Golgi. In
S.
cerevisiae, there are three major classes of sphingolipids. These include the
inositol-phosphorylceramides (IPCs) and the
mannosylinositolphosphorylceramides
(MIPC and M(IP)ZC) (for review, see (5). MIPC and M(IP)ZC contain a single
mannose attached to the inositol (6), though little is known about the
mannosyltransferase(s) that catalyses this reaction.
CA 02339338 2001-02-06
WO 00/09550 PCTNS99/18402
_2_
The mannosyl donor for all of these Golgi-localized reactions is the
nucleotide sugar GDP-mannose, whose site of synthesis is the cytoplasm. Before
it
can be utilized by the different lumenal mannosyltransferases, GDP-mannose
must
be transported into the Golgi by a specific nucleotide sugar transporter (7).
Once
the sugar is donated to lumenal mannosyltransferase acceptors, the nucleoside
diphosphate GDP is converted to a monophosphate by a nucleoside diphosphatase
(7). As in the mammalian Golgi, the transport of the nucleotide sugar into the
lumen is coupled to the outward exit of the monophosphate in yeast. The yeast
GDPase-encoding gene, GDAI, has been isolated (8). As predicted, a deletion of
GDAI results in the under glycosylation of proteins and lipids, though the
null allele
has no effect on growth.
Many nucleotide sugar transport activities have been reported, which differ
from one another in their substrate specificity and subcelluar localization
(9). Since
the cytoplasm is the sole site at which nucleotide sugars are synthesized,
they must
be transported into the various organelles in which glycosylation occurs.
Mammalian cells require the transport of many different nucleotide sugars due
to
the diversity of carbohydrate processing in the ER and Golgi. Carbohydrate
chains
may contain galactose, sialic acid, fucose, xylose, N-acetylglucosamine, and N-
acetylgalactosamine. In contrast, in S. cerevisiae, glycosylation in the Golgi
is
largely restricted to mannosylation which in principle requires only a single
transporter.
The VRG4 gene is an essential gene that is required for a number of different
Golgi-specific functions, includingN linked glycosylation (10-12), secretion,
protein sorting and the maintenance of a normal endomembrane system (12).
The present invention discloses that the transport of GDP-mannose into the
Golgi is the principal function of the VRG;I gene product in yeast. The
present
invention discloses that pathogenic yeast also contain a VRG 4 gene homolog.
The
yRG 4 gene is essential for viability. A simple system to assay GDP-mannose
transport is disclosed, using permeabilized yeast spheroplasts. Methods for
identifying putative inhibitors of b'RG ;I gene and gene product are
disclosed.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-3-
Summary of the Invention
The invention provides a method of measuring an activity of a nucleotide-
sugar transporter derived from yeast comprising providing a nucleotide sugar
to a
source, said source comprising a nucleotide-sugar transporter associated with
a
phospholipid membrane, and determining the amount of nucleotide-sugar bound to
or transported through said membrane.
The invention further provides a method of measuring an activity of a
nucleotide-sugar transporter derived from yeast comprising providing a
nucleotide
sugar to a source, said source comprising a nucleotide-sugar transporter
associated
with a phospholipid vesicle, and determining the amount of nucleotide-sugar
transported into or accumulated within the vesicle.
One object of the invention is to provide a method of measuring an activity
of a Golgi nucleotide-sugar transporter from yeast comprising providing a
nucleotide-sugar to a source derived from permeabilized yeast spheroplasts,
the
source comprising a nucleotide-sugar transporter and yeast golgi, and
determining
the amount of golgi-associated nucleotide-sugar as an indicator of nucleotide-
sugar
transporter activity.
Another object of the invention is to provide a method of identifying
inhibitors of golgi nucleotide-sugar transporter activity in yeasts comprising
providing a putative inhibitor to a source derived from permeabilized yeast
spheroplasts, the source comprising a nucleotide-sugar transporter and yeast
golgi,
with a nucleotide-sugar, and determining the amount of golgi-associated
nucleotide-
sugar in the presence of the inhibitor compared to the amount of golgi-
associated
nucleotide sugar in the absence of candidate inhibitor.
One aspect of the invention is permeabilized yeast cells useful in methods of
assessing nucleotide-sugar transport.
The present invention encompasses permeabilized yeast cells useful in
methods of assessing GDP-mannose transport and useful in methods of
identifying
inhibitors of GDP-mannose transport. The present invention provides
permeabilized yeast cells containing a dpm 1 mutation useful in methods of
measuring transporter activity.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-4-
An aspect of the invention is a kit comprising permeabilized yeast cells and
optionally a nucleotide sugar useful in methods of measuring golgi nucleotide-
sugar
transporter activity.
One aspect of the invention are anti-fungal compounds that inhibit GDP-
mannose transporter activity in yeast.
Another aspect of the invention is an isolated VRG4 gene and portions
thereof encoding a golgi GDP-mannose transporter in a pathogenic yeast.
Yet another aspect of the invention is an isolated VRG4 protein or portion
thereof encoded by a VRG4 gene from a pathogenic yeast.
Another object of the invention is to provide a recombinant method of
making RNA or protein encoded by the VRG4 gene encoding a golgi GDP-mannose
transporter derived from a pathogenic yeast.
Another aspect of the invention is antibody specifically reactive to a VRG4
protein or immunogenic portion thereof.
A further aspect of the invention is a pharmaceutical composition
comprising an antibody specifically reactive to a VRG4 protein or immunogenic
portion thereof useful in inhibiting nucleotide-sugar transporter function.
It is another object of the invention to provide nucleic acid probes for the
detection of a wild-type VRG~ gene or alterations or mutations in the VRG4
gene.
In accordance with the invention, such nucleic acid probes are complementary
to the
wild-type VRG~ gene coding sequences and can form mismatches with mutant or
altered VRG4 genes, thus allowing their detection by enzymatic cleavage,
chemical
cleavage, or by shifts in electrophoretic mobilities.
It is still another object of the invention to provide a method for diagnosing
yeast infections human cells and tissues. In accordance with the invention the
method comprises isolating cells and/or infected tissue from a human and
detecting
the normal or wild-type VRG;t genes, mRNA or their expression products from
the
cells and/or infected tissue, wherein the detection of the gene, mRNA or
expression
products in the cell and/or infected tissue is indicative of a yeast
infection.
Another aspect of the invention is to provide a method of determining
efficacy of treatment of a yeast infection in humans comprising isolating
cells
and/or infected tissue from a human and detecting alterations, reduction or
absence
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-5-
° of the normal or wild-type VRG~I gene, mRNA or expression product is
indicative of
efficacy of treatment by an antifungal compound.
It is a further object of the invention to provide a kit for the
identification
and determination of the genomic nucleotide sequence of the VRG4 genes by
using
oligonucleotide probes.
It is another object of the invention to provide diagnostic probes for
detection of pathogenic yeast in humans.
Yet another object of the invention is to provide a method of supplying
normal or wild-type VRG4 gene function to a cell which has lost such normal
gene
function by virtue of a mutation or alteration in the endogenous wild-type
VRG4
gene, which comprises introducing a exogenous wild-type VRG4 gene or
functional
portion thereof into a cell which has lost said gene function, or which
contains an
aberrant gene, such that the wild-type gene is expressed in the cell.
Another object of the invention is to provide a method of supplying VRG4
gene function to a cell which lacks such a gene, which comprises introducing a
portion or part of a wild-type VRG~t gene into a cell which lacks said gene
function,
such that the gene portion or part is expressed in the cell.
Brief Description of Drawings
Figure 1. Immunoblot analysis of chitinase in vrg4 mutant and wild
type extracts. Proteins were extracted from the culture supernatants of RSY255
(VRG.I, lane 1), NDYS (vrg4-2, lane 2), or HTYiO (mnnl0-2, lane 3) by acetone
precipitation, fractionated by 8% SDS-PAGE and subjected to immunoblot
analysis
using anti-chitinase antisera as described in Materials and Methods. The arrow
denotes the mobility of wild type chitinase.
Figure 2. Analysis of sphingolipids in vrg4-2 and wild type cells.
Sphingolipids in RSY255 (VRG4) or NDYS (vrg~-2) were pulse labeled with [3H]
myoinositol and chased for 20 or 40 minutes with unlabeled inositol, extracted
and
separated by thin layer chromatography as described in Materials and Methods.
The
assignment of PI, IPCs, MIPC and M(IP)ZC, denoted by arrows, is based upon a
comparison of their mobility on TLC with those reported in the literature and
upon
heir relative abundance (41 ).
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-6-
° Figure 3A and 3B. GDP-mannose transport in permeabilized yeast cells
as a function of time and protein concentration. PYCs (prepared from strain
JPY25 6c) were incubated in reaction buffer containing 3~M GDP-mannose and 50
nCi GDP-[3H]-mannose ( 15 Ci/mmole) in a final volume of 25 pl, as described
in
Materials and Methods. Figure 3A shows the transport of GDP-[3H]mannose as a
function of time, in which reactions were carried out in a final protein
concentration
of 0.5 ~.g/pl. Figure 3B shows the protein dependence of the reactions,
carried out
for six min at 30°C under conditions described above. 20 pmoles of GDP
mannose
transport corresponds to a lumenal uptake of 27% of the GDP-mannose in the
reaction. Typical values for the absolute cpms transported into vesicles
prepared
from a 25 pl reaction range from 6000-12,000 cpm in over 10 separate
experiments
Figure 4. GDP-mannose transport activity in vrg4-2 and wild type cells.
PYCs were prepared in parallel from JPY26 3d (vrg4-2) , JPY26 3d harboring
p~L which bears the wild type YRG4 gene or the isogenic wild type strain,
JPY25
6c as described in Materials and Methods. PYCs were used in standard GDP-
mannose transport assays and the time of incubation was varied. The % of GDP-
mannose transported was determined as described in Materials and Methods.
Figure SA-5C. Western immunoblot and cytological analysis of the
Vrg4 protein. Figure 5A. Whole cell protein extracts were prepared from yeast
cells (SEY6210) harboring plasmids expressing Vrg4-HA3p on a CEN plasmid
(pRHL-HA3), a 2p plasmid (pYRHL-HA3) or the vector alone (pYEp352) or
untransformed and fractionated by 10 % SDS-PAGE and subjected to western blot
analysis using anti-HA antibodies, as described in Materials and Methods.
Figure
5B and SC. Indirect immunofluorescence of SEY6210 cells or SEY6210
expressing Vrg4-HA3p (Figure SB) or Ochl-HA3p (Figure SC). Fixed cells were
treated with anti-HA antibodies, followed by FITC-conjugated anti-mouse IgG
and
viewed by confocal microscopy.
Figure 6. The Nucleotide (SEQ. ID No: 1) and Predicted Amino Acid
Sequence (SEQ. ID No: 2) of VRG4 gene from Saccharomyces cerevisiae. The
five potential glycosylation sites, at amino acid positions 81, 119, 242, 246,
and
249, are denoted by asterisks. Four potential membrane-spanning domains,
comprised of at least 20 uncharged residues and flanked by charged residues
are
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
_7_
° underlined. This sequence was found to be the same as that of the
VAN2 gene
(GenBankTM accession no. U 15599 ( 11 ).
S
Figure 7A-7B . The Full Length Nucleotide (SEQ. ID No: 3) and
Predicted Amino Acid Sequence (SEQ. ID No: 4) of VRG4 gene from Candida
albicans.
Figure 8. An Alignment of the S. cerevisiae and C. albicans VRG4
proteins. Shown here is a portion of the C. albicans YRG4 homolog (SEQ. ID No:
S) and the region of its conservation to the S cerevisiae VRG4 protein (SEQ.
ID No:
6). The alignment was performed using the Gapped BLAST algorithim (Altschul,
S. et al 1997, Gapped BLAST and PSI-BLAST: A New Generation of Protein
Database Search Programs, Nucleic Acids Research 25:3389-3401). The two
proteins display 65% identity and 78% similarity along their entire length.
Figure 9. The physical map of the pSK~Ca VRG4 plasmid containing a
portion of the VRG4 gene from Candida albicans.
Figure l0A and IOB. Co-immunoprecipitation of stable Vrg4p
multimers in detergent extracts. Epitope tagged Vrg4p-containing complexes
were extracted from yeast cells by treatment with 1 % digitonin (PANEL 1 OA)
or
1% Triton X-100 (PANEL lOB) and immunoprecipitated with anti-HA antibodies.
After loading equivalent amounts of protein in each lane and fractionating by
SDS-
PAGE, precipitates were immunoblotted with anti-myc antibodies and detected by
chemiluminescence. Extracts were prepared from a yeast strain (SEY6210)
expressing VRG4-myc alone (YEplac8l-Vrg4myc3) (lane 1), co-expressing both
VRG4-myc (YEplacl8l-Vrg4myc3) and VRG4-HA (YEp352-Vrg4-HA3) (lane 2), or
expressing either VRG4-myc (YEplac181-Vrg4myc3) or VRG4-HA (YEp352-Vrg4-
HA3) and mixed after extraction but prior to immunoprecipitation (Lane 3).
Extracts
were prepared from SEY6210 co-expresing VRG4-myc (YEplac181-Vrg4myc3) and
GDAI-HA (pY023-GDAI-HA3) (PANEL 10A, lane 4) or from strains expressing
either of these genes and extracts were mixed prior to immunoprecitation
(PANEL
10B, lane 4).
Figure 11A and 11B. Expression of the cloned vrg4-2 (A286D) mutant
allele. The vrg4-2 mutant allele was cloned and epitope-tagged as described in
Materials and Methods. PANEL 11 A. Isogenic wild type (RSY255) or vrg4-2
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
_g-
mutatnt cells (NDYS) transformed with plasmids containing either VRG4-HA (YEp-
RHL-HA3) or vrg4-A286D-HA (YEpVrg4-A286D-HA3) were streaked onto YPAD
media plus or minus 50 ~g/ml hygromycin B. PANEL 11 B. Western blot of the
mutant Vrg4-A286D-HA and wild type Vrg4-HA proteins. Whole cell lysates from
wild type yeast (SEY6210) expressing either VRG=~-HA on a CEN plasmid (pRHL-
HA3) (lane 2) or a 2p plasmid (YEpRHL-HA3) (lane 5) or vrg4-A286D-HA on a
CEN plasmid (pRS316-Vrg4-A286D-HA3) (lane 3) or 2~ plasmid (YEp352-Vrg4-
A286D-HA3) (lane 4). After loading equivalent amounts of protein per well,
proteins were fractionated by SDS-PAGE and subjected to western blot analysis
with anti-HA antibodies and detected by chemiluminescence.
Figure 12. The Vrg4-A286D mutant protein stably interacts with itself
and with the wild type Vrg4 protein.
Extracts were prepared from a yeast strain (SEY6210) expressing VRG4-myc
alone (YEplacl81-Vrg4-myc3) (lane 1 ), co-expressing both VRG4-HA
(YEpRHLHA3) and vrg4-A286D-myc (YEplacl8l-Vrg4-A286D-myc3) (lane 2},
both vrg=1A286D-HA and vrg4-A286D-myc (YEp352-Vrg4-A2826-HA3 and
YEplac181 Vrg4-A286D-myc3) (lane 3), or both VRG4-HA and VRG4-myc
(YEpRHL-HA3 and YEplacl8l-Vrg4-myc3) (lane 4). Vrg4p-containing complexes
were extracted from yeast cells by treatment with 1 % Digitonin and
immunoprecipitated with anti-HA antibodies. After loading equivalent amounts
of
protein in each lane and fractionating by SDS-PAGE, precipitates were .
immunoblotted with anti-myc antibodies and detected by chemiluminescence.
Figure 13A-13D. The Vrg4-A286D mutant protein localizes to the Golgi.
Indirect immunofluorescence of SEY6210 expressing Vrg4-HAp (pRHL-
I-IA3) (13C), the mutant Vrg4-A286D-HAp (pRS316-Vrg4-A286D-HA3) (13D),
Ochl-HAp (a Golgi marker) (13B) and Ost4-HAp (an ER marker) (13A). Fixed
cells were treated with anti-HA antibodies, followed by FITC-conjugated anti-
mouse IgG.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-9-
° Figure 14A and 14B. The vrg4-2 allele contains a single mutation
(A286D) in a
region of the protein that is highly conserved among other NSTs.
PANEL 14A. A hydropathy profile of the Vrg4 protein, with the location of
the A286D mutation indicated with a circle. PANEL 14B. An alignment of the
region surrounding the A286D mutation (depicted with an asterisk) in other
nucleotide sugar transporters. Group I proteins are closely related to the GDP-
mannose transporters defined by the Leishmania donovani Lpg2 protein and_ the
S.
cerevisiae Vrg4 protein. Group II proteins are most highly related to those
that
transport UDP-sugars. The accession numbers for related but uncharacterized
ORFs
are indicated. The identification of these proteins was obtained using BLAST
version 2.Os [Altschul, 1997 #242]. Alignments were performed using the
DNASTAR MegAlign program, using the Clustal algorithm. The consensus was
stringently defined as a majority of five out of six identical residues for
Group I
proteins (shaded in black) and five out of eight identical residues for Group
II
(shaded in gray). Residues in group II that are identical to group I are
shaded in
black.
Detailed Description of the Invention
The present invention discloses that the Vanadate Resistance Glycosylation
4 (VRG~) gene isolated from Saccharomyces cerevisiae encodes a protein that
transports GDP-mannose from the cytoplasm into the lumen of the golgi complex.
GDP-mannose is the mannosyl donor for all of the glycosylation events that
occur
in the yeast golgi. As such, the VRG4 protein may be said to be the master
regulator of glycosylation in yeast. The VRG4 protein of the present invention
as
essential for viability of the yeast Golgi. Mammalian cells do not have a GDP-
mannose transporter. Since the VRG4 protein is a yeast-specific gene product,
it
represents a specific anti-fungal drug target. Thus anti-fungal compounds
specifically targeted against the VRG~ gene or gene product have little or no
side
effects on mammalian cells.
The present invention encompassed the VRG=t gene isolated from yeast. Of
particular interest are VRG~ genes isolated from pathogenic yeast. The
pathogenic
yeast including hut not limited to Candida albicans, Candida tropicalis,
Torulopsis
~labrata, Cryptococcus neojormans, Aspergillus, Microsporium, Trichophyton,
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-10-
° Epidermophyton, Pityrosporum, Histoplasma, Blastomyces and the like.
Preferably
the VRG=I gene is derived from Candida albicans. Homologs and functional
portions of the VRG=I gene are included in the ambit of the invention.
Functional
portion as used herein, is any portion which has nucleotide-sugar transporter
activity, preferably GDP-mannose transporter activity. The nucleotide sequence
of
the VRG;~ gene is depicted in Figures 6 and 7. However, the nucleotide
sequence of
the VRG=I gene of the present invention is in no way limited to the sequences
depicted in Figures 6 and 7, but may include the complementary sequence as
well as
variations in the nucleotide sequence as are known in the art as a result of
code
degeneracy that results in a functionally equivalent sequence. Further,
naturally
occurring allelic variations in a given species are also encompassed by the
present
invention.
The present invention also encompasses a mutant VRG 4 gene.
Encompassed in mutant VRG4 genes are mutations which renders the gene totally
nonfunctional or renders selected portions of the gene nonfunctional. In one
embodiment, the mutant VRG4 gene has one or more mutations in a GDP-mannose
binding domain. The mutation includes one or more substitutions or deletions,
and
the like, which render the GDP-mannose binding domain incapable of binding
GDP-mannose. In one embodiment, the mutant VRG4 gene comprises a single base
pair change in the region coding for the GDP-mannose binding domain. In a
particular embodiment, the mutant VRG4 gene comprises a single C to A base
pair
change at nucleotide position 857 of the wild-type VRG4 gene.
A VRG4 gene from a yeast may be cloned by methods known in the art such
as those used to clone the VRG4 gene of Saccharomyces cerevisiae ( 12). Of
particular interest is the cloning of the full length VRG4 gene from
pathogenic yeast
such as from Candida albicans. The full length VRG4 gene of Candida albicans
may be isolated fram a genomic Candida albicans library using standard methods
known in the art. In one embodiment, a Candida genomic library transformed
into
E. coli is used to isolate the full length gene. The full length clone is
obtained by
screening E coli colonies using the partial Candida gene as a probe by the
conventional method of colony hybridization.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
° The isolated VRG4 gene may be incorporated into vectors including but
not
limited to yeast vectors, yeast shuttle vectors, plasmid vectors for
expression in
mammalian cells and the like. The vectors contain the appropriate promoters
and
selectable markers as are known in the art for expression in the host cell. In
one
embodiment, the vector is the plasmid SK-Ca VRG;t containing a partial VRG4
gene
of C. albicans deposited August 11, 1998 with the American Type Culture
Collection, 10801 University Boulevard, Manassas, VA under Accession No.
ATCC 203137 under the terms of the Budapest Treaty.
The present invention includes host cells transformed or transfected with the
VRG.~ gene or portion thereof. Host cells include both eukaryotic and
prokaryotic
host cells provided they contain the correct elements for host-specific
expression.
Such host cells include but are not limited to bacterial cells, yeast cells,
mutant
yeast, mammalian cells such as BHK-21, COS-7, CV-l, Hela and the like. In one
embodiment, Saccharomyces cerevisiae is a host cell in which the endogenous
VRG4 gene is replaced by the homolog VRG4 gene isolated from Candida albicans.
The present invention encompasses the VRG4 gene product from yeast. In
one embodiment the VRG4 gene product is a protein of about 36.9 kDa and
peptides
thereof. The VRG4 gene product of the present invention is associated with
Golgi
GDP-mannose transport in yeast. The amino acid sequence of the VRG4 gene
product from Saccharomyces cerevisiae is depicted in Figure 6. Functional
portions
of the VRG~t protein are within the ambit of the present invention. Such
isolated
portions are those which facilitate transport of GDP-mannose across the Golgi.
A full length nucleic acid sequence of the VRG4 gene and predicted amino
acid sequence of the VRG4 protein from Candida albicans is depicted in Figure
7A
and 7B. The alignment of the amino acid sequence from C. albicans with S.
cerevisiae is provided in Figure 8. The two proteins display 65% identity and
78%
similarity along their entire length.
In one embodiment, a functional portion of the VRG~ protein encompass the
GDP-mannose binding domain.
In another embodiment, the GDP-mannose binding domain comprises the
consensussequence:
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-12-
° W Xaa Xaa Xaa Xaa T Xaa Xaa T T Y S
1 5 10
Xaa V G Xaa L N K Xaa P Xaa Xaa
15 20
Xaa Xaa G Xaa Xaa Xaa F Xaa
S
25 30
in which Xaa at position 16 is Ala or Ser;
Xaa at position 20 is Leu or Ile;
Xaa at position 22 is Leu or Ile; and
Xaa at positions 2-5, 7-8, 14, 22-25, 27-29 and 31 is one of any naturally
occurring
wino acid (SEQ. ID No: 23).
In another example, the GDP-mannose binding domain comprises SEQ. ID
No: 7, SEQ. ID No: 9, or SEQ. ID No: 11.
Another aspect of the invention is a mutant GDP-mannose binding domain.
The mutant may be the result of one or more substitutions, deletions and the
like
which affects the function of the domain. In one embodiment the mutant GDP-
mannose binding domain comprises SEQ. ID No. 8, which contains a single amino
acid substitution in the consensus sequence.
The full length VRG4 protein from Candida albicans may be easily obtained
by recombinant techniques or the protein may be isolated from yeast cells by
chromatographic techniques known in the art such as immunoaffinity
chromatography and the like.
In one embodiment, a recombinant VRG4 protein or portion thereof is made
by a method comprising incorporating an isolated VRG4 gene or functional
nucleic
acid sequence thereof into a vector, transforming or transfecting a host cell
with the
vector and culturing the host cell under conditions that allows expression of
the
recombinant VRG;t protein or portion thereof.
The YRG~ protein or functional portion thereof may be used in assays for
measuring VRG:~ transporter activity and in assays for identifying inhibitors
of
GDP-mannose transport activity. Such inhibitors may be used as anti-fungal
compounds in the treatment of yeast infections. The VRG4 protein or
immunogenic
portions thereof are also useful in eliciting anti-VRG4 antibody. Such
antibody is
useful in diagnostic assay and as a therapeutic to inhibit transporter
activity.
CA 02339338 2001-02-06
WO 00109550 PC1'NS99/18402
-13-
The present invention encompasses a method of measuring a nucleotide-
sugar transporter activity. The nucleotide-sugar transporter, under natural
conditions, is unique to yeast cells and is not present under natural
conditions in
mammalian cells or bacterial cells. Of particular interest is a nucleotide-
sugar
transporter from pathogenic yeasts such as Candida albicans, Cryptococcus,
Aspergillus and the like.
In the method of measuring nucleotide-sugar transporter activity, the
transport of an amount of exogenously added nucleotide-sugar is measured which
is
associated with the Golgi. The nucleotide-sugar transporter of the present
invention
is capable of causing the transport of a nucleotide-sugar into the Golgi. The
amount
of nucleotide-sugar accumulating within the Golgi, in particular the lumen of
the
Golgi is indicative of activity by the transporter.
The method of the present invention may be used to determine the activity of
~Y nucleotide-sugar transporter which is associated with golgi.
In one embodiment, the activity of a GDP-mannose transporter is
determined. The method of assaying GDP-mannose transporter activity comprises
adding an amount of GDP-mannose to a source of GDP-mannose transporter and a
membrane source. The GDP-mannose transporter is associated with the membrane
source in a manner such that the binding and transport of the GDP-mannose may
be
determined from the membrane source.
In one embodiment, the GDP-mannose is detectably labeled in such a
manner to allow it to be easily detected and quantitated when associated with
the
GDP-transporter. Such labels include but are not limited to enzymes,
radioisotopes,
chemiluminescent compounds, bioluminescent compounds, and the like provided
the labels do not interfere with transport. Alternatively, a second reagent
may be
added to detect the GDP-mannose. The second reagent, such as an antibody, may
be labeled.
The source of the GDP-mannose transporter is from natural sources or
recombinant sources. The GDP-mannose transporter may be expressed from an
endogenous GDP-mannose transporter gene or an exogenous GDP-mannose
transport gene or a functional portion thereof. In a preferred embodiment, the
GDP-
m~nose transporter is associated in a membrane such as the Golgi membrane, or
CA 02339338 2001-02-06
WO 00/09550 PCTNS99/I8402
-14-
synthetic membrane such as a liposome membrane. Liposome membranes useful in
the present invention may be made by methods known in the art such as those
described in U.S. Patent Nos. 4,663,161 and 5,766,626.
The membrane source for use in the method of measuring transport activity
and inhibitors of transport activity include but are not limited to
permeabilized yeast
cells, mammalian cells, liposomes having associated therewith a GDP-mannose
transporter, and the like.
In one embodiment the membrane source is a mammalian cell transformed
or transfected with a yeast nucleotide-sugar transporter.
In a preferred embodiment permeabilized yeast cells are used in the method
of determining nucleotide-sugar transporter activity. The yeast cells for use
in the
method of measuring transport activity are yeast spheroplasts, devoid of cell
walls.
The yeast spheroplasts are permeabilized spheroplasts which comprise a leaky
Plasma membrane within which is contained an intact Golgi, an endomembrane
system and a Golgi associated nucleotide-sugar transporter.
The penmeabilization of the yeast spheroplasts provides a leaky plasma
membrane to allow access of the nucleotide-sugar into the cell. The yeast
cells may
be permeabilized by means which slightly disrupts the integrity of the plasma
membrane and at the same time has little or no effect on the nucleotide-sugar
transporter system. In a prefer ed embodiment, the yeast spheroplasts are
permeabilized using liquid nitrogen.
The permeabilized yeast spheroplasts for use in a method of measuring
Golgi nucleotide-sugar transporter activity are devoid of any other system
which
may utilize GDP-mannose or compete with the GDP-mannose transport.
In a preferred embodiment, the permeabilized spheroplasts lack/or have been
genetically altered to inactivate a dolichol phosphate-mannose synthase. In
one
preferred embodiment, the permeabilized spheroplasts have a dolichol phosphate-
mannose synthase mutation which renders the synthase inactive.
The permeabilized spheroplasts for use in the method of measuring Golgi
nucleotide-sugar transporter activity, preferably Golgi GDP-mannose
transporter
activity, contain a functionally active endogenous Golgi GDP-mannose
transporter
or an exogenous source of a functionally active Golgi GDP-mannose transporter.
In
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-15-
an embodiment in which the permeabilized spheroplasts utilizes an exogenous
source of active Golgi GDP-rnannose transporter provided by an exogenous gene
encoding a Golgi GDP-mannose transporter, an endogenous gene encoding a Golgi
GDP-mannose transporter, if present, is mutated so as to prevent expression of
the
endogenous Golgi GDP-mannose transporter.
In one embodiment, the permeabilized spheroplasts have a functional VRG4
gene derived from a pathogenic yeast, preferably derived from Candida
albicans.
In a preferred embodiment the permeabilized spheroplasts are from a
Saccharomyces strain which has a dpm 1 gene mutation (dpm 1-) and a mutation
in
the endogenous VRG4 gene (VRG4'), each mutation rendering the respective gene
inactive. In one preferred embodiment the yeast strain is JPY263D of
Saccharomyces cerevisiae having the genotype dpml'/VRG4' deposited August 11,
1998 with The American Type Culture Collection under Accession No. ATCC
X4461 under the terms of the Budapest Treaty. A functionally active exogenous
VRG4 gene may be incorporated into JPY263D yeast strain by techniques known in
the art and transporter activity determined using the methods of the present
invention.
The method of the present invention is an improvement over methods
described in the past because of its simplicity and efficiency. Past methods
relied
on the use of enriched, partially purified Golgi membranes that are of a low
specific
activity. The prior art method involved growing up liters ( I 0) of cell
cultures,
resulting in the recovery of only small amounts of active membranes.
Typically, the
prior art method starting with 1 liter of cells only provided enough material
for
about 4-5 reactions. The present method allows one to start with much smaller
cell
culture volumes, yet provides enough material to perform many assays of the
present invention as the Golgi membranes enclosed in permeabilized
spheroplasts
retain higher levels of activity. In one embodiment of the present invention,
1 liter
provided enough material for about 100-200 assays. For the application of
testing
Golgi nucleotide-sugar transporter inhibitors, a quick, reliable and
quantitative assay
is essential as it allows large number of candidate inhibitors to be screened
at a time.
Vectors suitable for use in the invention comprise at least one expression
control element operationally linked to the nucleic acid sequence or part
thereof.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-16-
° Expression control elements are inserted in the vector to control and
regulate the
expression of the nucleic acid sequence. Non-limiting examples of expression
control elements include, but are not limited to, the lac system, operator and
promoter regions of phage lambda, yeast promoters, and promoters derived from
vaccinia virus, adenovirus, retroviruses, or SV40. Other operational elements
include, but are not limited to, appropriate leader sequences, termination
codons,
polyadenylation signals, and other sequences required for the appropriate
transcription and subsequent translation of the nucleic acid sequence in a
given host
system. Of course, the correct combinations of expression control elements
will
depend on the host system used. In addition, it is understood that the
expression
vector contains any additional elements necessary for the transfer and
subsequent
replication of the nucleic acid-containing expression vector in the host
system.
Examples of such elements include, but are not limited to, origins of
replication and
selectable markers. Such expression vectors are commercially available or are
readily constructed using methods known to those in the art (e.g., F. Ausubel
et al.,
1987, in "Current Protocols in Molecular Biology", John Wiley and Sons, New
York, New York).
The recombinant expression vector containing all or part of the VRG4
nucleic acid sequence are transformed, transfected or otherwise inserted into
a host
organism or cell. The host cells transformed with the VRG4 nucleic acid
sequence
of the invention include eukaryotic and mammalian cells, such as animal,
plant,
insect and yeast cells, and prokaryotic cells, such as E. coli, or algal cells
as known
in the art. The means by which the vector carrying the gene may be introduced
into
a cell includes, but is not limited to, microinjection, electroporation,
transduction, or
transfection using DEAE-dextran, lipofection, calcium phosphate, or other
procedures known to those skilled in the art (Sambrook et al. (1989) in
"Molecular
Cloning. A Laboratory Manual", Cold Spring Harbor Press, Plainview, New York).
In one embodiment, eukaryotic expression vectors that function in eukaryotic
cells,
and preferably mammalian cells, are used. In one embodiment, mammalian
expression vectors that function in a mammalian host cells are used. In a
preferred
embodiment, yeast expression vectors that function in yeast host cells are
used.
Non-limiting examples of vectors include vaccinia virus vectors, adenovirus
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-17-
vectors, herpes virus vectors, and baculovirus transfer vectors. Preferred
eukaryotic
cell lines include, but are not limited to, COS cells, CHO cells, HeLa cells,
and
NIH/3T3 cells. Particularly preferred host cells are yeast cells.
The expressed recombinant VRG4 protein or portions thereof may be
detected by methods known in the art, some of which include Coomassie blue
staining, silver staining, and Western blot analysis using antibodies specific
for the
VRG4 protein as discussed further below. In addition, the recombinant protein
expressed by the transformed host cells can be obtained as a crude lysate or
can be
purified by standard protein purification procedures known in the art,
including
differential precipitation, molecular sieve chromatography, ion-exchange
chromatography, isoelectric focusing, gel electrophoresis, affinity and
immunoaffinity chromatography and the like. (Ausubel et. al., 1987, In
"Current
Protocols in Molecular Biology" John Wiley and Sons, New York, New York). In
the case of immunoaffinity chromatography, the recombinant protein may be
purified by passage through a column containing a resin which has bound
thereto
antibodies specific for the VRG4 protein (Ausubel et. al., 1987, In "Current
Protocols in Molecular Biology" John Wiley and Sons, New York, New York).
In one embodiment, an active YRG4 protein was purified by using an HA-
epitope tagged gene which was constructed and tested for activity by
complementation of the VRG4 mutant phenotype. This HA-tagged protein was then
over-expressed and purified by affinity-chromoatography using 12CA5 bound
resin.
According to the diagnostic method of the present invention, the wild type
VRG4 gene or alterations of the wild type VRG4 gene is detected. Alteration of
a
wild-type gene according to the present invention encompasses alI forms of
mutations, including deletions. The alteration may also be due to
rearrangements,
such as insertions, inversions, and deletions, or to point mutations.
Deletions may
be of the entire gene or only a portion of the gene. The method of the present
invention may be used to determine efficacy of antifungal treatment in a
mammal in
which an alteration, reduction or elimination of the wild type VRG4 gene, mRNA
or
gene product is indicative of efficacy in reducing or eliminating a yeast
infection.
Mutations induced by antifungal therapy leads to non-functional or absent gene
products which in turn also lead to inhibition and loss of viability of yeast.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-18-
o The detection of point mutations may be accomplished by molecular cloning
of the allele (or alleles) present in the yeast and sequencing that alleles)
using
techniques well known in the art. Alternatively, polymerise chain reaction
(PCR)
can be used to amplify gene sequences directly from a genomic DNA preparation
from yeast. The DNA sequence of the amplified sequences can then be determined
by conventional methods. The polymerise chain reaction itself is well known in
the
art (see, e.g., Saiki et al., 1988, Science, 239:487; il.S. Patent No.
4,683,203; and
U.S. Patent No. 4,683,195). Specific primers which can be used in order to
amplify
the gene. It will be appreciated by those skilled in the art that the primers
provided
herein, in particular primers from the C. albicans VRG4 gene may be used to
amplify the specified VRG4 gene and to screen population samples for
mutations.
The ligase chain reaction, which is known in the art, can also be used to
amplify
VRG4 sequences (See, e.g., Wu et al., 1989, Genomics, 4:560-569). In addition,
a
technique known as allele-specific PCR can be used (see, e.g., Ruano and Kidd,
1989, Nucl. Acids Res., 17:8392) According to this technique, primers are used
which hybridize at their 3' ends to a particular VRG4 mutation. If the
particular
VRG4 mutation is not present, an amplification product is not observed.
Also, combinations of oligonucleotide pairs based on the VRG4 nucleotide
sequence may be used as PCR primers to detect VRG4 mRNA in a biological
sample using the reverse transcriptase polymerise chain reaction (RT-PCR)
process
for amplifying selected RNA nucleic acid sequences as detailed in Ausubel et
al.,
1987, In "Current Protocols in Molecular Biology" Chapter 15, John Wiley and
Sons, New York, New York. The oligonucleotides can be synthesized by
automated instruments sold by a variety of manufacturers or can be
commercially
prepared based upon the nucleic acid sequence of the invention. Biological
samples
for testing may include cells, tissues, organs, blood, serum, stool, sputum,
amniotic
fluid, mucous secretions and urine.
In one preferred embodiment, insertions and deletions of VRG4 gene are
detected by using a non-complementation assay of a mutant as is known in the
art
(Current Protocols in Molecular Biolo y, Vol. 2. Chapter 13, Eds. Ausubel,
F.M. et
al, John Wiley & Sons, Inc. 1998)
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-19-
The invention also relates to antibody specifically immunoreactive with the
GDP-mannose transporter, preferably immunoreactive with VRG-4 protein or
epitope thereof. This invention comprises an antibody preparation or
antibodies
which are immunoreactive with the VRG4 protein having the amino acid sequence
depicted in Figure 6, 7 or 8, or a unique portion or peptide thereof. In this
embodiment of the invention, the antibodies are either monoclonal or
polyclonal in
origin. The antibodies may be raised against native VRG4 protein or peptides,
VRG4 fusion proteins or peptides, or mutant VRG4 proteins or peptides. The
VRG4 proteins or peptides used to generate the antibodies may be from natural
or
recombinant sources or produced by chemical synthesis using synthesis
techniques
known in the art. Natural VRG4 proteins can be isolated from yeast cultures,
isolated golgi, from mammalian biological samples containing or suspected to
contain yeast and the like. Recombinant VRG4 proteins or peptides may be
produced and purified by conventional methods. Synthetic VRG4 peptides may be
custom ordered or commercially made based upon the predicted amino acid
sequence of the present invention (Figure 6, 7 or 8) or synthesized by methods
known to one skilled in the art (Merrifield, R.B., 1963, J. Amer. Soc.
85:2149). If
the peptide is of insufficient size to be antigenic, it may be conjugated,
complexed,
or otherwise covalently linked to a carrier molecule to enhance the
antigenicity of
the peptide. Examples of Garner molecules, include, but are not limited to,
albumins
(e.g., human, bovine, fish, ovine), and keyhole limpet hemocyanin ("Basic and
Clinical Immunology", 1991, Eds. D.P. Stites, and A.I. Terr, Appleton and
Lange,
Norwalk Connecticut, San Mateo, California).
The antibodies should be specific and immunoreactive with VRG4 epitopes,
preferably epitopes not present on other yeast protein or human protein, to
avoid
crossreactivity. However, antibodies can be generated against particular
epitopes
which are found to be common to other proteins, if desired or necessary to
detect
related structures or molecules. In a preferred embodiment of the invention,
the
antibodies will immunoprecipitate VRG4 proteins from solution as well as react
with VRG4 proteins on Western or immunoblots of polyacrylamide gels on
membrane supports or substrates. In another preferred embodiment, the
antibodies
will detect VRG4 proteins in paraffin or frozen tissue sections, or in cells
which
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-20-
° have been fixed or unfixed and prepared on slides, coverslips, or the
like, for use in
immunocytochemical, immunohistochemicaI, and immunofluorescence techniques.
Exemplary antibody molecules for use in the detection methods or as a
therapeutic of the present invention are intact immunoglobulin molecules,
substantially intact immunoglobulin molecules, or those portions of
immunoglobulin molecules that contain the antigen binding site, known in the
art as
F(ab), Flab) ~ 2, and F(v) immunoglobulin fragments. Polyclonal or monoclonal
antibodies may be produced by methods conventionally known in the art (e.g.,
Kohler and Milstein, 1975, Nature, 256:495-497; Campbell "Monoclonal Antibody
Technology, the Production and Characterization of Rodent and Human
Hybridomas", 1985, In: "Laboratory Techniques in Biochemistry and Molecular
Biology," Eds. Burdon et al., Volume 13, Elsevier Science Publishers,
Amsterdam).
Monoclonal antibodies may be human monoclonal antibodies, chimeric monoclonal
16 antibodies, or humanized monoclonal antibodies made by techniques that are
well
known in the art. (Takeda 1985 Nature 314:452; U.S. Patent No. 5,585,089, U.S.
Patent No. 5,530,101.) The antibodies or antigen binding fragments may also be
produced by genetic engineering. The technology for expression of both heavy
and
light chain genes in E. coli is the subject of PCT patent applications,
publication
number WO 901443, WO 901443 and WO 9014424 and in Huse et al., 1989,
Science, 246:1275-1281. Antibody molecules of the present invention may be
intact immunoglobulin molecules, or portions thereof that contain the antigen
binding site. Single chain antibody may be constructed by methods known in the
art
(U.S. Patent No. 4,946,778; Davis, G.T. et al. 1991 Biotechnolo~y 9:165-169;
Pluckthun, A. 1990 Nature 347:497-498). The antibody molecules may be of any
class including IgG, IgM and IgA.
The antibody of the present invention may be used as a diagnostic reagent to
detect and quantitate the Golgi GDP-mannose transporter, and to determine
Golgi
GDP-mannose transporter activity. Standard immunoassay may be used with the
anti-GDP-mannose transporter antibody for detection and quantitation of the
Golgi
GDP-mannose transporter in biological samples.
In another embodiment, VRG4 protein-specific antibodies are used in
immunoassays to detect the novel VRG4 protein in biological samples. In this
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-21-
method, the antibodies of the present invention are contacted with a
biological
sample and the formation of a complex between the VRG4 protein and the
antibody
is detected. As described, suitable immunoassays include radioimmunoassay,
Western blot assay, immunofluorescent assay, enzyme linked immunoassay
(ELISA), chemiluminescent assay, immunohistochemical assay,
immunocytochemical assay, and the like (see, e.g., "Principles and Practice of
Immunoassay", 1991, Eds. Christopher P. Price and David J. Neoman, Stockton
Press, New York, New York; "Current Protocols in Molecular Biology", 1987,
Eds.
Ausubel et al., John Wiley and Sons, New York, New York). Standard techniques
know in the art for ELISA are described in Methods in Immunodia nosis, 2nd
Ed.,
Eds. Rose and Bigazzi, John Wiley and Sons, New York 1980; and Campbell et
al.,
1984, Methods in Immunolo~y, W.A. Benjamin, Inc.). Such assays may be direct,
indirect, competitive, or noncompetitive as described in the art (see, e.g.,
"Principles
and Practice of Immunoassay", 1991, Eds. Christopher P. Price and David J.
Neoman, Stockton Pres, NY, NY; and Oellirich, M., 1984, J. Clin. Chem. Clin.
Biochem., 22:895-904). Proteins may be isolated from test specimens and
biological samples by conventional methods, as described in "Current Protocols
in
Molecular Biology", 1987, Eds. Ausubel et al., John Wiley and Sons, New York,
New York.
The antibody of the present invention may be provided in the form of a kit
and may also include GDP-mannose and/or other assay reagents.
The antibody of the present invention may be used as a therapeutic to
specifically inhibit the function of the Golgi GDP-mannose transporter.
Binding of
the antibody to the transporter prevents glycosylation in yeast and results in
the loss
of viability of the yeast cells. The antibody may be provided
intraperitoneally,
intravenously, intramuscularly, subcutaneously, mucosally or topically
administered. The antibody is administered to a patient with a yeast infection
for a
period of time sufficient to reduce or eliminate the infection. For use as a
therapeutic, the antibody may be modified so as to enhance the transport of
the
antibody across the cell wall of the yeast so as to aid accessibility of the
antibody to
the transporter in the golgi. For topical administration, or as an oral
mouthwash, the
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-22-
° antibody may be administered in combination with a detergent to allow
entry of the
antibody through the cell wall.
In another aspect of the invention, primer pairs of the invention are
useful for the determination of the nucleotide sequence of the YRG4 gene using
the
polymerase chain reaction. The pairs of single stranded DNA primers can be
annealed to sequences within or surrounding the VRG4 gene, or a discrete
segment
of the gene in order to prime amplifying DNA synthesis of the YRG4 gene
itself. In
general, PCR primers may be on the order of about 15-40 bp, more preferably,
on
the order of about 18-30 by to PCR an approximately 100-600 bp, more
preferably,
a 100-200 by stretch of DNA. A complete set of primers allows synthesis of all
of
the nucleotides of the VRG4 gene coding sequences. Allele specific primers can
also be used. Such primers anneal only to particular VRG4 mutant alleles, and
thus
will only amplify a product in the presence of the mutant allele as a
template. Non-
limiting examples of VRG4 sequence primers for use in the invention may be the
nucleic acid sequence or portion thereof as shown in Figures 6, 7A and 7B.
In order to facilitate the subsequent cloning of amplified sequences,
primers may have enzyme restriction site sequences appended to their 5' ends.
Thus, all nucleotides of the primers are derived from VRG4 sequences or
sequences
adjacent to VRG4, except for the few nucleotides necessary to form a
restriction
enzyme site. Such enzymes and enzyme restriction sites are well known in the
art.
The primers themselves (for each strand of DNA) can be synthesized using
techniques which are well known in the art. Generally, the primers can be made
using synthesizing machines which are commercially available. Given the
sequence
of the VRG4 open reading frame shown in Figure 6 and in Figure 7A and 7B, the
design of particular primers is well within the skill of the art, as there are
no exons
in the VRG=l gene.
Nucleic acid probes provided by the present invention are useful for
a number of purposes. They can be used in Southern hybridization analyses to
probe genomic DNA, and in the RNase protection method for detecting point
mutations. The probes can be used to detect PCR amplification products, and
can
also be used to detect mismatches with the YRG4 gene or mRNA using other
techniques. Examples of nucleic acid sequences that can be used as probes
include,
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-23-
° but are not limited to, native DNA, recombinant DNA, and synthetic
oligonucleotides. Methods known in the art can be used prepare and label
nucleic
acid probes. As examples, DNA sequences can be labeled with 32P using Klenow
enzyme, polynucleotide kinase or polymerases, such as TAQ used in the PCR
reactions. There are also non-radioactive labeling techniques for signal
amplification, including methods for attaching chemical moieties to pyrimidine
and
purine rings (Dale, R.N.K. et al., 1973, Proc. Natl. Acad. Sci. USA, 70:2238-
2242;
and Heck, R.F., 1986, S. Am. Chem. Soc., I 14:8736-8740); methods allowing
detection by chemiluminescence (Barton et al., 192, J. Am. Chem. Soc.,
114:8736-
8740); and methods utilizing biotinylated nucleic acid probes (Johnson, T.K.
et al.,
1983, Anal. Biochem., 133:125-131; Erickson, P.F. et al., 1982, J. Immunol.
Meths.,
51:241-249; and Matthaei, F.S. et al., 1986, Anal. Biochem., 157:123-128); as
well
as methods allowing detection by fluorescence using commercially available
kits.
An entire battery of nucleic acid probes is used to formulate a kit for
detecting wild type VRG4 genes and alternations thereof. The kit allows for
hybridization to the entire VRG4 gene, or to particular regions thereof. The
probes
may overlap with each other or may be contiguous. Kits may contain other
reagents
useful for carrying out the assay, such as buffers, enzymes, control samples,
and the
like.
Nucleic acid probes may also be complementary to the VRG4 gene or
to mutant alleles of the VRG4 gene. Such probes are useful to detect similar
homologs or mutations on the basis of hybridization. As also described, the
VRG4
probes can be used in Southern hybridizations to genomic DNA to detect gross
chromosomal changes, such as deletions and insertions. In addition, the probes
can
be used to detect VRG4 mRNA from yeasts in tissues to determine if expression
is
diminished as a result of alteration of wild type VRG4 genes as a result of
antifungal
therapy.
Antisense oligonucleotides may be derived from the VRG4 gene as
depicted in Figures 6, 7A and 7B or derived from the nucleic acid sequence
encoding the GDP-mannose binding domain depicted in Figures 14A and 14B.
Antisense oligonucleotides are useful in specifically inhibiting the formation
of the
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-24-
VRG=! gene product. Antisense oligonucleotides may be made by methods known
in the art.
According to the present invention, a method is also provided to
supply wild type VRG4 function to a cell which is devoid of a VRG4 gene or to
a
cell that carries a mutant VRG4 alleles. The wild type VRG~t gene or a part of
the
gene may be introduced into the cell in a vector. Vectors for the introduction
of
genes both for recombination and for extrachromosomal maintenance are known in
the art, and any suitable vector or vector construct may be used in the
invention.
Methods for introducing DNA into cells such as electroporation, calcium
phosphate
co-precipitation and viral transduction as mentioned hereinabove are known in
the
art; therefore, the choice of method may lie with the competence and
preference of
the skilled practitioner. Cells transformed with the wild type VRG4 gene are
used as
model systems to study nucleotide-sugar transport to screen for antifungal
drugs for
treatments against yeast infections.
The protein or peptides of VRG4 may function as competitive
inhibitors of the native VRG4 protein and as such may be used as an antifungal
compound to treat infections caused by yeast. Protein and peptides can be
produced
by expression of the isolated DNA sequence, in particular genomic DNA, in
yeast,
for example, using known expression vectors. Alternatively, VRG:I can be
extracted
from VRG=~-producing cells, such as yeast cells. The protein may be cleaved
using
enzymes or reducing agents may be used to form peptides. Inhibitor peptides
may
be selected using the methods described herein . In addition, the techniques
of
synthetic chemistry can be employed to synthesize VRG4 protein or peptides.
Active inhibitory VRG4 molecules can he introduced into cells by
microinjection or by the use of liposomes, for example. Alternatively, some of
the
active molecules may be taken up by cells, actively or passively by diffusion.
Extracellular application of VRG4 gene product may be sufficient to affect
yeast
growth. Agents may be added to facilitate the entry of the VRG4 protein or
peptide
across the cell wall of the yeast and to facilitate the association of the
exogenously
supplied VRG4 protein or peptide with the golgi. Such agents include but are
not
limited to liposomes antibody and the like.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-25-
The isolated VRG4 protein or portion thereof may be used in the
form of a pharmaceutical composition, along with standard excipients as are
known
in the art, for inhibition of the endogenous VRG4 gene product of a yeast. The
inhibitors of the present invention are useful in preventing and treating
yeast and
fungal infections in mammals, including humans. Yeast and fungal diseases that
may be treated using the inhibitors of the present invention include but are
not
limited to candidiasis, aspergillosis, phycomycoses, nocardiosis,
cryptococcosis,
histoplasmosis, blastomycosis, coccidioidomycosis, paracoccidioidomycosis,
onychomycosis dermatophyte infections and the like.
The inhibitors of the present invention may be administered in the
form of a pharmaceutical composition, alone, or as a mixture, and may be
administered in combination with one or more other fungicidal and fungistatic
compounds. The fungicidal and fungistatis compounds include but are not
limited
to ketoconazole, flucytosine, fluconazole, itraconazole, amphotericin B and
the like.
Means of administering the VRG4 protein or parts thereof include,
but are not limited to, oral, sublingual, intravenous, intraperitoneal,
percutaneous,
intranasal, intrathecal, subcutaneous, intracutaneous, mucosal or enteral.
Local
administration to the afflicted site may be accomplished through means known
in
the art, including, but not limited to, topical application, injection, and
implantation.
In a method of treatment of a yeast or fungal infection in a mammal, the
inhibitor is
provided in a dose sufficient to inhibit nucleotide-sugar transport into the
Golgi of
the yeast or fungi, preferably a dose effective in inhibiting a Golgi GDP-
mannose
transporter present in the yeast or fungi. Such inhibition in transport
results in
inhibition of growth and loss of viability of the yeast or fungi causing the
infection.
Other inhibitors of a Golgi nucleotide-sugar transporter include but
are not limited to a nucleotide-sugar analog, stilbeine or derivatives thereof
provided
the inhibitor specifically inhibits a Golgi nucleotide-sugar transporter in
fungi or
yeast and is nontoxic or has minimal effect on mammalian cells. The inhibitors
of
the present invention may be competitive or noncompetitive inhibitors.
The inhibitors of the present invention are useful in inhibiting VRG4
transport activity in fungi and yeast. Such inhibition of VRG=! transport
activity in
the Golgi result in inhibition of growth and ultimate lack of inability of
fungi and
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-26-
yeast. The fungi and yeast amenable to inhibition by the inhibitors of VRG4
transport activity include but are not limited to Candida, Torulopsis,
Cryptococcus,
Aspergillus, Nocardia, Histoplasmosis, Trycophyton, and the like.
All publications, patents and articles referred to herein are expressly
incorporated herein in toto by reference thereto. The following examples are
presented to illustrate the present invention but are in no way to be
construed as
limitations on the scope of the invention. It will be recognized by those
skilled in
the art that numerous changes and substitutions may be made without departing
from the spirit and purview of the invention.
Example 1
Cloning of VRG4 Gene of Saccharomyces cerevisiae
Cloning and Sequencing the Wild Type VRG4 Gene - Strain NDYS
(ura3-52 leu2-211 vrg4-2) was transformed with a yeast genomic CEN-based
library, carrying the LEU2 selectable marker. Prototrophic transformants were
selected on medium lacking leucine and replica-plated onto media containing 50
~g/ml hygromycin B. Plasmid DNA from hygromycin B-resistant colonies was
isolated, amplified in Escherichia toll, and retransformed into the VRG4
mutant to
confirm complementing activity.
A 2.1-kb EcoRI/HindIII fragment capable of complementing the
hygromycin B sensitivity of VRG4 was sequenced by the dideoxy method (43}
generating a nested deletion series using the ExoIII/ExoVII method (44). Both
DNA strands were sequenced. DNA and predicted protein sequence comparisons
against data bases were made using the BLAST algorithm (41 ) and analyzed
using
the GCG programs.
Plasmid Constructions - All DNA manipulations were carried out
according to standard protocols (45). The 2.1-kb EcoRI/HindIII fragment
containing the entire VRG4 gene and regulatory sequences was subcloned into
the
vector pRS316 (46) to generate the CEN based plasmid, pRHL, containing the
selectable marker, URA3. This plasmid was labeled with [32P]dCTP (Amersham
Corp.) using the random priming method and used to probe a nitrocellulose
filter,
which contained separated yeast chromosomes (47).
CA 02339338 2001-02-06
WO 00/09550 PCTNS99/18402
-27-
The disruption plasmid pGS::LEU was constructed by inserting a
Smal/SaII fragment (blunt-ended with Klenow) containing the LEU2 gene into the
unique HpaI site that lies within the VRG4 gene.
The integrative plasmid pGSi was constructed by cloning the
HindllllEcoRl fragment containing the entire VRG4 gene into the URA3-
containing
pRS306. The plasmid was linearized at a unique Hpal site in the VRG4 gene and
transformed into strain NDYS.
Cloning and Analysis of the VRG4 Gene - Vanadate-resistant
mutants fail to grow on media containing hygromycin B at concentrations where
wild type cells grow normally ( 10). This drug sensitivity was exploited as a
means
to clone the wild type VRG4 gene. Mutants were transformed with a CEN-based
yeast genomic library, containing the Leu2 gene as a selectable marker.
Leucine
prototrophs were selected and replica plated onto media supplemented with 50
wg/ml hygromycin B. Six hygromycin-resistant colonies were isolated. Plasmids
isolated from each of these colonies were distinct, but contained overlapping
restriction fragments. All six plasmids conferred hygromycin B resistance when
retransformed into the VRG4 mutant. Further subcloning isolated the
complementing activity to a 2.1-kb EcoR/HindIII fragment. Hybridization of the
32p_labeled EcoRI/HindIII fragment to separated yeast chromosomes mapped this
gene on chromosome XV (data not shown). Expression of the cloned fragment
containing the putative VRG4 gene in the VRG4 mutant restores the ability of
these
cells to retain ER proteins and rescues the invertase glycosylation defect. A
slight
amount of invertase that was underglycosylated could still be detected in VRG4
mutant cells that harbored the cloned gene. Cell growth during invertase
induction
was not carried out under conditions that favor plasmid selection. Therefore,
this
apparent leakiness may have been due to plasmid loss in some of the cells
assayed.
To confirm that the cloned fragment contained the VRG4 locus, the
EcoRI/HindIII fragment was cloned in an integrative plasmid (pRS306) that
contains the selectable marker, URA3. The plasmid was linearized at a unique
site
within the VRG4 portion to allow homologous recombination at the VRG4 locus
and
used to transform VRG=l ura3 cells. Ura+transformants were then crossed to a
VRG;t ura3 strain. The resulting diploid was sporulated and tetrads dissected.
This
CA 02339338 2001-02-06
WO 00109550 PCT/US99/18402
-28-
analysis demonstrated a 2:2 segregation pattern for Ura+/Ura and a 4:0 pattern
for
hygromycin resistance/hygromycin sensitivity, indicating that the cloned
fragment
is tightly linked to VRG4 and most likely does contain VRG4 locus (data not
shown).
DNA sequence analysis of the 2.1-kb fragment revealed the presence
of two open reading frames. Further analyses mapped the complementing activity
to the larger open reading frame, within a 1.6-kb HindIIllEcoRV fragment. The
nucleotide and predicted amino acid sequence of this region is shown in Figure
6.
The VRG4 DNA sequence encodes a predicted protein of about 36.9
kDa. There are five potential recognition sites for N-linked glycosylation
(indicated
by asterisks in Figure 6). Hydrophobicity analysis (33) suggests that the
protein is
hydrophobic, containing multiple membrane-spanning domains.
Example 2
Cloning of VRG4 Gene of Candida Albicans
A plasmid designated SK-Ca VRG4 comprising a partial VRG4 gene
of Candida albicans was deposited with the American Type Culture Collection,
P.O. Box 3605, Manassas, Virginia 20108 U.S.A. (ATCC), on August 1 l, 1998
under Accession No. ATCC 203137 under the terms of the Budapest treaty. The
physical map of the Sk-Ca VRG4 plasmid is shown in Figure 9. Yeast strain
JPY263D of Saccharomyces cerevisiae which lacks dpm 1 and has a mutant
endogenous VRG4 gene was used as a host cell for incorporation of the VRG4
gene
of Candida albicans. The yeast strain was deposited with ATCC on August 11,
1998 under Accession No. ATCC 74461 under the terms of the Budapest Treaty.
The partial VRG4 gene was used to isolate a full length genomic
YRG4 gene from a genomic Candida albicans library and a clone comprising a
full
length genomic VRG4 gene was isolated.
Example 3
GDP-Mannose Transport Function of VRG4
Materials and Methods
Yeast strains, media and general genetic methods -
Yeast strains used in this study are listed in Table 1. Media
preparation and standard yeast genetic methods used for sporulation, tetrad
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-29-
° dissection and strain constructions have been described (13). YPAD
liquid medium
was supplemented with 0.5 M KCl for the growth of the vrg4 mutant strains
( 10,12). Hygromycin B (Boehringer Mannheim) was added to YPAD agar after
autoclaving to a final concentration of 30 ~g/ml. Yeast strains were
transformed
using the lithium acetate procedure (14).
15
25
35
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-30-
Table L Strains used in this study.
Strain Genotvne Source
5 RSY255 MATa ura3-S2 leu2-21II R. Scheckman
XD2-7C MATaura3-S2 his4 dpml P. Orlean
NDYS MATa ura3-S2 leu2-211 vrg4-2 Poster
et al
(12)
SEY6210 MATaura3-52 his3-4200 trill-d901 lys2-801 S. Emr
suc2-d9 leu2-3, 112
SEY6211 MATa ura3-S2 his3-4200 trill-d901 ade2 S. Emr
-101 suc2-d9 leu2-3, 112
10 JPY23 MATalMATaura3-S2/ura3-S2 his3-d200/his3-d200This study
trill-d901/trpl-
9 DI ade2 -IOllADE2 leu2-3.112/leu2-3,112
lys2-801/LYS2 suc2-
d9/ suc2-d9hvgl d: : LEU2/HYGI
JPY23 6c MATa ura3-52 his3-d200 trill -4901 leu2-3,This study
I l2 hvgl d:: LEU2
JPY23 6d MATa ura3-S2 his3-4200 trill-d901 ade2 This study
-101 suc2-d9 leu2-3 l l2
15 hvgl d:: LEU2 This study
JPY24 la MATaura3-S2 his3-d200 trill-d901 ade2 -101This study
suc2-d9 leu2-3 112
vrg4-2 hvgl d: : LEU2
JPY25 6b MATa ura3-S2 his3-d200 trill-d901 ade2-101
JPY25 6c MATa ura3-S2 his3-d200 trill-d901 ade2-!01This study
dpml'
20 JPY26 MATcrura3-52 leu2-3 112 ade2-101 vrg4-2 This study
3d dpml-
JPY32 MATaiMATa ura.~-32/ura3-S2 his3-d200/his3-d200This study
trill-d901/trpl-
4901 lys2-801/LYS2 suc 2 - d9/suc 2 - d91eu2-3,4d':
112/leu 2-3, 112 vrg
LEU2/YRG4 ade2-I01/ADE2
JPY3Z IA MATaura3-52 his 3-d 200 trp 1-d 901 lys 9
2-801 leu 2-3, 1l2 suc 2-d
25 vrg4d::LEU2 pVRG4 :: URA3 This study
Plasmids
An epitope -tagged allele of YRG4 was created in several steps. First, PCR was
used to amplify the VRG4 gene while replacing the stop codon with an NsiI
site. A
30 1.5 kb HindIIIlNsiI fragment containing the VRG4 gene was then ligated into
the
HindIIIlPstI site of SK'P/X HA3 (15) to produce pSKRHL HA3. This results in
the
in-frame fusion of YRG4 with sequences encoding three tandem copies of the HA
epitope at the 3' terminus, followed by a stop codon. A 0.5 kb HpaIlXbaI
fragment
from pSK-RHL HA3, containing the HA-tagged 3' terminus of VRG4 was
35 exchanged with the 3' end of VRG4 in pRHL (12) which contains the VRG4 gene
SUBSTITUTE SHEST (RULE 26)
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-3 I -
° as well as 5' and 3' flanking regulatory sequences. This places the
HA-tagged allele
of VRG4 under its own promoter in a URA3/ CEN yeast expression plasmid.
pYRHL-HA3 contains the HA3-tagged VRG~t, under its own
promoter in a 2~., URA3 plasmid. It was constructed by ligating the
HindIIIlXbaI
fragment from pRHL-HA3 into the HindIIIlXbaI sites of YEp352.
A DNA fragment containing the entire HVGI gene and flanking
sequences was cloned by PCR amplification of genomic yeast DNA. This 1.3 kb
fragment, flanked by BamH 1 /HindIII sites was cloned into pRS316 to generate
the
plasmid, pHVGl . Similarly, PCR amplification of yeast genomic DNA was used to
generate a 1,026 by fragment containing only the HVGI ORF. This fragment,
flanked by a BamHllHindIII site was cloned into YIp56X to place it under the
control of the TPI promoter ( 16). A deletion of the HVGI gene was carried out
by
replacing the entire HVGI open reading frame with the S. pombe HISS gene,
which
is functionally analogous to the S. cerevisiae HISS gene (17). PCR
amplification of
a fragment containing the S. pombe HISS gene (kindly provided by Sean Munro,
MRC, LMB), with HVGI primer ends, was used to generate a linear fragment
containing the HISS gene flanked by SO by of sequence homologous to HVGl. This
linear fragment was used to transform strain SEY6210. His+ transformants were
isolated and the deletion was confirmed by PCR (data not shown).
Western Immunoblotting
Whole cell protein extracts were prepared, separated by SDS-PAGE and
immunoblotted as described (12). For the detection of secreted chitinase,
proteins in
the culture supernatants were precipitated by the addition of 10 volumes of
ice cold
acetone and centrifuged at 10,000 X g. Anti-chitinase antibodies (from W.
Tanner)
were used at a I :1000 dilution. Culture supernatants, containing the
monoclonal
anti-HA antibody, 12CA5, were used at a 1:10 dilution. Secondary anti-rabbit
or
anti-mouse antibodies (Amersham), conjugated to horseradish peroxidase, were
used at a I :3000 dilution and were detected by chemiluminescence (ECL,
Amersham) followed by autoradiography.
Indirect Immunofluorescence
10 ml of logarithmic cultures ( I -3 X 10' cells/ml) of SEY6210 or SEY6210
containing pYRHL-HA3 or TiOCH-HA ( 1 S) were fixed by the addition of
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-32-
° formaldehyde to 3.7 % for 30 min at room temperature. Cells were
harvested,
resuspended in 10 ml of (3.7 % formaldehyde; 0.1 M KP04, pH 6.8) and fixed for
an additional I-2 hours at room temperature. Fixed cells were washed with (1.0
M
sorbitol; 100 mM HEPES, pH 6.8; 5 mM NaN3) and spheroplasted by the addition
of 30 pg/ml Zymolase 100T. Spheroplasts were treated with 0.1 % Triton X-100
for
min at room temperature. After attaching to glass slides, cells were plunged
into -
20°C methanol for 6 minutes, followed by -20°C acetone for 30
sec. Slides were
incubated overnight in primary antibody (12CA5 culture supernatant, diluted
1:10),
washed 12 times with PBS and then incubated in anti-mouse IgG:FITC or anti-
rabbit: IgG:FITC (Jackson ImmunoResearch, PA), diluted 1:200, for I-2 hours.
After washing, cells were overlayed with mounting media containing 25 ng/ml
DAPI.
Radiolabelirrg of cells and lipid analysis
IS Cultures were grown to an OD6oo of 1 in Wickerham's minimal medium (18),
containing 2% glucose and lacking myo-inositol (WH-I). Labeling was initiated
by
the addition of 5 ~Ci/ml of [3H]-myoinositol (American Radiolabeled Chemicals,
St
Louis, MO). Cells were metabolically labeled for 10 min at 30 °C and
chased by
the addition of 4 volumes of WH containing 40 p.g/ml unlabeled myoinositol.
Reactions were stopped by the addition of ice cold NaN3. Cells were washed
once
in NaN3, suspended in 100 pl NaN3 and broken by vortexing with glass beads.
The lysate was removed from the glass beads and lipids were
extracted by adding 600 ~1 chlorofonn/methanol (l :l} to 90 pl of the cell
extract to
achieve a final concentration of (10:10:3) chlorofotm/methanol/aqueous
solution.
After centrifugation, the pellet was re-extracted for 45 min with
chloroform/methanol/H20 (10:10:3). The pooled lipid fractions were dried under
NZ
gas and desalted by phase separation in n-butanol and water (19). Lipids were
resuspended in 40 ~1 of chloroform/methanol/aqueous solution (10:10:3) for
thin
layer chromatography.
HPTLC Silica-60 gel plates ( 0.2 mm) (Merck, Darmstedt, Germany)
were dried ( 110°C) for two hours and then cooled to room temperature
prior to
using. Samples were applied (150,000 cpm per lane) and ascending
chromatography was performed using a chloroform/methanol/0.22 % KC1 in HZO
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-33-
° (55:45:10) solvent system (in tanks equilibrated with solvent for 1-2
hours). After
chromatography, plates were air dried, sprayed with EN3HANCE (New England
Nuclear) and fluorographed overnight.
Preparation ofpermeabilized yeast cells
Permeabilized yeast cells (PYC), suitable for use in determining Golgi
nucleotide-
s
sugar transport, were prepared as described (20) with modifications. 100-200
ml of
cells were grown in YPAD medium containing 0.5 M KCI at 30°C to an
OD6oo of 1-
2. After harvesting, cells were suspended at 50 OD unit/ml in ( 100 mM Tris-
HCI,
pH 9.4; 10 mM DTT) and kept at room temperature for 5 min. The cells were
centrifuged and resuspended at 50 OD unit/ml in (0.75 X YPA, 0.5% glucose, 0.7
M
sorbitol, 10 mM Tris-HCI, pH 7.5) and 10 U lyticase/OD unit of cells was added
to
form spheroplasts. After 20 minutes incubation at 30°C, over 80% of the
yeast cells
were converted to spheroplasts. Spheroplasts were centrifuged at 1,500 X g for
3
min and resuspended in 0.75 X YPA containing 0.7 M sorbitol and 1 % glucose.
After incubating at 30°C for 20 minutes to allow metabolic recovery,
cells were
washed with the buffer (400mM sorbitol; 20 mM HEPES, pH 6.8; 150 mM
potassium acetate; 2 mM magnesium acetate) and resuspended in buffer at 300 OD
unit/ml. For permeabilization, aliquots of PYCs were slowly frozen over liquid
nitrogen for 1 hour and immediately transfered to -70°C.
GDP-mannose Transport Assay Using Permeabilized Yeast Cells
GDP-mannose transport was measured in permeabilized spheroplasts. Reactions
contained 20 mM HEPES (pH6.8); 150 mM potassium acetate, 250 mM sorbitol, 5
mM magnesium acetate; 3 ~M GDP mannose and 50 nCi GDP-[3H)-mannose (15
Ci/mmole) in a final volume of 25 ~l. Permeabilized cells were thawed quickly
and
washed three times with 1 ml of ice cold reaction buffer (buffer H) (20 mM
HEPES,
pH6.8; 150 mM potassium acetate, 250 mM sorbitol, S mM magnesium acetate) to
remove cytosol and endogenous GDP-mannose. Membranes were concentrated to
one half the original volume in buffer H. Reactions were initiated by mixing S
~1 of
membranes (containing 10-20 ~g of protein) with 20 ~1 reaction buffer,
bringing the
final protein concentration to 0.4-0.8 mg/ml. Protein concentrations were
determined using the BCA reagent (Pierce Chemical Co, Rockford, IL)
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-34-
° After incubating at 30°C for 6 min, the reaction was stopped
by
adding 0.5 ml of ice-cold buffer H and samples were placed on ice. Membranes
were pelleted by centrifugation at either 14,000 X g or 100,000 X g in an
ultracentrifuge (Beckman Optima TL). Free radioactive solutes were removed by
washing the membrane pellet three times with 1.0 rnl of ice-cold buffer H.
Pellets
were resuspended in 100 pl 0.1 % Triton X-100 and 50 p.l sample was removed,
added to 1 ml of scintillation mix and radioactivity quantitated in a
scintillation
counter. The amount of GDP-[3H] mannose that non-specifically bound to the
outside of membrane was determined by measuring radioactivity of membranes at
zero time of incubation and subtracting from the value of solutes associated
with the
membranes. The percent activity was calculated by dividing this value by the
total
cpm in the reaction [% transport activity = (CPM in pelletb min- CPM in
pelleto
min)~CPMtotai]. Each value was normalized by dividing the percent transport
activity
by the total amount of protein in each reaction, when comparing PYC
preparations
of different strains.
Guanosine Diphosphatase assay
GDPase was assayed as described (7) in solubilized P100 fractions prepared
from
PYCs from strains JPY25 6c (YRG4) or JPY26 3d (vrg~t-2). Inorganic phosphate
was determined by the method of Ames (21 ). One unit of GDPase is defined as
the
activity that releases 1 nmole of inorganic phosphate per minute. Background
values, determined by assaying reactions that lacked substrate or protein were
subtracted to give the values described.
Example 4
The vrg4 mutant is defective in both N- and O-linked sugar modifications
VRG4 is required for N linked glycosylation (10-12). To assay for
effects on O-linked glycosylation, we examined the glycosylation state of
chitinase.
Chitinase is a secreted protein that contains carbohydrates that are
exclusively O-
linked. Therefore, any effect on O-linked glycosylation can be detected by an
electrophoretic mobility shift (22). Whole cell extracts were prepared from
isogenic
wild type and vrg~ cells and assayed by immunoblotting, using anti-chitinase
antiserum. As a control, chitinase mobility was also examined in cells
containing
ap mnn~0-2 mutation, which are defective only in N-linked glycosylation (23).
A
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-35-
mobility shift was detected in chitinase from vrg~-2 when compared to wild
type
cells, but not in mnnl0-2 cells (Figure 1 ). This result demonstrates that the
vrg4
mutation affects O-linked glycosylation and therefore is required for the
glycosylation of both classes of proteins.
Example 5
The vrg4 mutant is defective in sphingolipid mannosylation
vrg4 cells display an aberrant morphology of intracellular
membranes when viewed by electron microscopy ( 12). In vrg4 mutants,
membranes accumulate but stain poorly with potassium permanganate. This
observation suggested that the VRG~ gene product may be required for
maintaining
the normal protein/lipid ratio of these Golgi membranes whose staining
properties
are altered by the vrg4 mutation. The synthesis of sphingolipids in yeast
requires
vesicular transport to the Golgi, and suggests that their synthesis occurs in
this
compartment (24). Therefore, it was of interest to determine whether the vrg4
mutation affected sphingolipid biosynthesis. In S. cerevisiae, there are three
major
classes of sphingolipids. These include the inositolphosphorylceremides (IPCs)
and
the mannosylinositolphosphorylceramides (MIPC, and M(IP)2C) (see reference 5
for review). To test the idea that VRG4 is required for sphingolipid
biosynthesis, we
compared [3H)-inositol-labeled lipids in isogenic vrg4-2 mutant and wild type
strains. Cells were labeled for I 0 minutes with [3H]-inositol and chased for
20 or
40 minutes. Lipids were extracted and analysed by thin layer chromatography.
The
most significant difference between wild type and vrg4-2 cells was the failure
of the
vrg~-2 strain to accumulate MIPC and M(IP)ZC (Figure 2). These results
demonstrate that VRG4 is required for the biosynthesis of sphingolipids and
suggest
that the defect specifically affects the mannosylated forms.
Example 6
Development of an in vitro GDP-mannose transport based on permeabilized
yeast cells.
The effect of the vrg4 mutation on glycoprotein and sphingolipid
biosynthesis suggested that VRG=~ is generally required for mannosylation in
the
Golgi. A simple model that could explain the pleiotropic phenotype of the vrg4
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-3 6-
mutant is that VRG4 is required for the accumulation or transport of GDP-
mannose
into the lumen of the Golgi.
To test this model, GDP-mannose transport activity was compared in
isogenic wild type and vrg=~-2 mutant strains. Lumenal GDP-mannose transport
in
vitro in yeast has been characterized using crude Golgi-enriched vesicles (7).
Using
this system, we routinely observed a decrease in the activity of mutant
membranes
compared to wild type (data not shown). However, this method involves large
scale
cell preparations, where reactions typically require the addition of milligram
quantities of protein. To allow the processing of more samples simultaneously
for
comparative purposes we sought to develop another system to measure GDP-
[3H]mannose transport at an analytical scale. For this purpose, permeabilized
yeast
cells (PYCs) were used. PYCs are highly competent for glycosylation in vitro
when
supplemented with GDP-mannose (20) and therefore must be capable of efficient
1 S lumenal GDP-mannose transport.
GDP-mannose transport was characterized in permeabilized yeast
cells containing a dpml mutation that results in a 90%-95% decrease of
dolichol-
phosphate-mannose synthase (Dpm 1 ) activity in vitro (25 ). This mutant
background was required to eliminate a competing reaction catalyzed by Dpm 1
p, in
which GDP-mannose donates mannose to form dolichol-phosphate-mannose (Dol-
P-Man) that in turn acts as the mannose donor for glycosylation in the ER.
This ER
reaction, which is quite efficient in vitro, would otherwise obscure the Golgi
transport of GDP-mannose (7). A comparison of the [3H]-mannose uptake into
sealed membranes of isogenic strains that were wild type (JPY25 6b) or that
contained the dpml mutation (JPY25 6c) demonstrated that mannose incorporation
into Dol-P-Man accounted for greater than 60% of the observed [3H] uptake
(data
not shown). Therefore, all of the experiments described below were conducted
with
isogenic strains harboring the dpml mutation, which did not otherwise effect
the
growth properties of these strains (data not shown).
To assay GDP-mannose uptake, after incubating PYCs in the
presence of GDP-[3H]mannose, the amount of [3H]-mannose associated with
washed vesicles was compared to that which remained in the supernatant (S100).
Vesicles were prepared by centrifugation at 100,000 X g (P100) with extensive
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-3 7-
washes to remove bound radiosolutes. A time course of [3H) uptake suggested
that
transport of GDP-mannose was quite efficient. Typically 20-30 % of the [3HJ in
the
reaction was recovered in the P 100 fraction after 6-8 min, corresponding to
an
uptake of about 25 pmoles of GDP mannose (Figure 3A). The rate of transport
was
linear with time up to 6 min (Figure 3A) and with protein concentration in a
range
S
from 0.4 to 1.2 mg/ml (Figure 3B). Transport was temperature dependent;
optimal
transport occurred at 30° C, was slightly reduced at 25 and 42°C
and inhibited at
temperatures above 60°C (data not shown).
GDP-mannose uptake was completely inhibited by the addition of
detergent (0.1 % Triton X-100) with transport reduced to less than 2%,
demonstrating that the accumulation of GDP-mannose requires intact vesicles.
Similarly, inclusion of 4 mM 4,4-diisothiocyanostilbene-2,2-disulfonic acid
(DIDS),
a stilbene derivative that is known to inhibit transport of nucleotide sugars
in both
mammalian (26) and yeast (7) systems completely inhibited activity. As
demonstrated previously, (7), transport was not dependent on energy nor on
divalent
cations as the addition of ATP, Mg++ or EDTA did not affect the efficiency of
transport (data not shown). However, we infer that removal of Mg++ or
inclusion of
EDTA did affect the activity of endogenous acceptor glycosyltransferases that
utilized the labeled mannose, since the transport was stimulated about two
fold in
the presence of Mg++ (data not shown).
The physical properties of lumenal radioactive material was
examined by analyzing the transport reaction products after phase
partitioning. This
separates lipid-linked oligosaccharides, which partition into the organic
phase from
protein-linked oligosaccharide, which are insoluble in chloroform/methanol.
After
allowing the transport reaction to occur for six minutes, PYCs were extracted
to
separate lipid, protein and water soluble products as described by Waechter et
al
(27). By this assay, most of the radioactive products (87%) that associated
with the
membranes were water soluble (GDP-mannose) or chloroform/methanol insoluble
(protein). We conclude that GDP-mannose transport in PYCs appears to have all
of
the hallmarks previously described for this activity in crude Golgi membranes
(7).
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-38-
Example 7
The VR'G4 gene product is required for lumenal Golgi GDP-mannose
translocation.
To test the model that VRG~ is required for GDP-mannose transport,
PYCs were prepared in parallel from wild type and vrg;t mutant cells and their
transport activity was compared. Transport activity in VRG4 (JPY25 6c and vrg4-
2
(JPY26 3d) strains was examined as a function of time. In contrast to wild
type
cells, where greater than 25 % of the exogenous GDP-[3H]-mannose was
transported, vrg4-2 membranes displayed a severe defect in GDP mannose uptake
(< 2 % transport) (Figure 4). This defect was partially complemented in the
vrg4-2
mutant strain by a plasmid bearing the VRG4 gene (Figure 4). This is
consistent
with the observation that this plasmid does not fully complement the vrg4-2
mutant
glycosylation phenotype in vivo (data not shown).
To determine whether the effect of the vrg4-2 mutation was specific
for GDP-mannose uptake, the activity of another Golgi protein was assayed in
solubilized P100 fractions prepared from wild type and vrg4-2 PYCs. As shown
in
Table II, the level of GDPase activity in wild type or vrg4-2-derived P100
fractions
was essentially indistinguishable. Vrg4p is therefore specifically required
for GDP-
mannose uptake.
Table IL Guanosine Diphosphatase activity in vrg4-2 and VRG4 extracts
Extract U*/~.g_protein
vrg4-2 9.6
VRG4 20.6
Membranes were prepared from the isogenic strains JPY25 6c (VRG4) or JPY26 3d
(vrg9-2) and assayed for hydrolysis of GDP, as described (7, 21).
* One unit is defined as the activity that releases 1 nmole of inorganic
phosphate per
minute. Background values, determined by assaying reactions that lacked
substrate
(GDP) or protein were subtracted to give the values listed above.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-39-
Example 8
VRG4 is a resident Goigi protein
The VRG~ gene product is required for a number of different Golgi
functions ( 12). If these effects are due to its role in nucleotide sugar
uptake, Vrg4p
would be predicted to reside in the Golgi complex. To determine the
intracellular
localization of Vrg4p, the VRG4 gene was tagged at the carboxy terminus with
three
tandem copies of the HA epitope (see Materials and Methods). Even when tagged
with three copies of the HA epitope, when expressed as a single copy,Vrg4-HA3p
in
whole cell extracts was barely detectable by immunoblot analyses (Figure SA).
Although the HA-tagged form of VRG4 did not complement the slow growth
phenotype of the vrg4-2 mutant to the same extent as the wild type VRG4 gene,
it
was able to complement the sensitivity to hygromycin B as well as the
lethality of a
VRG~t deletion (data not shown). This suggests that the C-terminal addition of
the
HA-epitope does not significantly alter the normal function of the Vrg4
protein.
The intracellular location of Vrg4-HA3p was examined by indirect
immunofluorescence, using antibody directed at the HA epitope. A punctate
pattern
of fluorescence, characteristic of the Golgi complex, was observed in cells
expressing Vrg4-HA3p (Figure SB). This staining pattern was similar to another
Golgi-localized protein, Och 1 p, an initiating a 1,6 mannosyltransferase
{Figure SB).
One difference in the staining pattern of these two proteins was that
generally more
punctate spots were observed in the Vrg4-HA3p expressing cells. In most of the
Vrg4-HA3p-expressing cells observed, the average number of HA-staining spots
per
cell observed by shifting the plane of focus was 20-25. This was confirmed by
performing a Z-series in which the analysis of optical sections of 1 p
thickness
through individual cells indicated an average number of 25 spots per cell
{data not
shown). Cells expressing Ochl-HA3p contained between 7-10 spots/cell and no
qualitative differences were observed in cells overexpressing Och 1 p. From
these
results, we conclude that Vrg4p resides in the Golgi complex. Taken together
with
immunoelectronmicroscopy studies which suggest that the yeast GoTgi is
comprised
of about 30 spot-like structures (28), it appears that unlike the more
spatially
restricted Ochlp, the Vrg4 protein is broadly distributed throughout the Golgi
complex.
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-40-
Example 9
Homology to VRG4 predicts the existence of other putative S. cerevisiae
nucleotide sugar transporters.
VRG4 encodes a highly conserved protein. Thirteen different members have
been identified including the Leishmania LPG2 and the Kluyveromyces lactis
MNN2
gene products (12, 29, 30). In the case of Lpg2p and Mnn2p, both proteins have
been implicated as nucleotide sugar transporters (29-31 ). A search of the S.
cerevisiae genome data base identified several other yeast ORFs with sequence
similarity to Vrg4, suggesting that these putative proteins may function in
nucleotide sugar transport. These putative yeast proteins are listed by ORF
name in
Table III. One of these ORFs (Yer039p), which we have designated HYGI (for
Homologous to VRG4) encodes a predicted protein that is highly similar to
Vrg4p
(80% identical). Although the other proteins listed in Table III are more
distantly
related to Vrg4 and Hvglp (about 25% identical and 45% similar along their
length), each of these proteins are of a similar size (35-45 kD) and have a
similar
predicted structure, as inferred by the near overlap of their respective
hydrophobicity profiles (data not shown).
Table III. Putative Vr~4n yeast homologues
ORF % identity % similarity
Yer039p 81 92
(HVGI )
Ye1004p 36 55
Ymd8 26 42
Yor306c 26 42
Ym1018c 25 41
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99118402
-41-
The Vrg4 protein sequence was used to search the S. cerevisiae genome data
base
using the BLAST algorithm (42) and the identified proteins were aligned using
DNASTAR MegAlign program with the Clustal algorithm. The accession numbers
for each are as follows: (hvgl=Yem9/yer039p accession # P40027); Yea4/ye1004p
accession # P40004; YMD8 accession # Q03697; Yor306c, accession #Q04835;
Ym1018C accession # Z46659x21.
Because of the high degree of identity to Vrg4p, it was of interest to
examine the Hvg 1 protein and the phenotype of the null mutant. The predicted
ORF
and flanking sequences were cloned by PCR amplification of yeast genomic DNA
(see Materials and Methods). To determine whether the HVGI gene could
complement the vrg4 mutation, the HVGI gene was introduced into the vrg4-2
mutant strain (NDYS) in either a single and high copy expression plasmid.
Though
the encoded gene products are remarkably similar, the HVGI gene does not
complement the glycosylation and slow growth phenotype of the vrg~-2 mutant or
the inviability of the null vrg4 allele. Unlike VRG4, which is required for
viability,
a deletion of HVGl has no discernible effect on the growth properties of
vegetatively growing cells. Similarly, the vrg4-2 hvgl double mutant did not
display any synthetic phenotype and PYCs prepared from the hvg mutant had wild
type levels of GDP-mannose transport activity (data not shown). These results
demonstrate that the Hvg 1 p and Vrg4 proteins do not perform overlapping
functions. They also suggest that either Hvglp performs a function that is
redundant to another, as yet unidentified proteins) or that its function is
completely
dispensable for vegetative growth of yeast.
Example 10
We have undertaken a functional analysis of Vrg4p as a model for
understanding nucleotide sugar transport in the Golgi. We analyzed epitope
tagged
alleles of VRG4 which were fused with either the myc or HA epitope. Results
from
co-immunoprecipitation experiments demonstrate that the Vrg4 protein
multimerizes with specificity and high affinity, both in vivo and in vitro.
The
molecular weight of the Vrg4p-containing complex calculated by gel filtration
is
twice that of the monomer, suggesting that the active enzyme is a dimer of
identical
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-42-
subunits. In addition to the wild type protein, we have also characterized a
protein
encoded by a mutant allele of VRG4. Although the mutant protein is
catalytically
inactive for nucleotide sugar - transport, it maintains the ability to
multimerize, is
localized normally to the Golgi, and is as stable as its wild type
counterpart.
Sequence analysis of the vrg4-2 allele reveals a single base pair alteration
that
changes an alanine to an aspartate residue. This alanine is embedded in a
region that
is highly conserved in other GDP-mannose transporters but has diverged in
transporters of other nucleotide sugars. These results are consistent with a
model in
which this amino acid identifies a site that is involved in binding to or
transport of
GDP-mannose.
MATERIAL AND METHODS
Yeast Strains and Media
Standard yeast media and genetic techniques were used (48). Hygromycin B
sensitivity was tested on yeast extract/peptone/ adenine sulfate/dextrose
plates
(YPAD) supplemented with SOp,g/ml hygromycin B {Boehringer Mannheim) as
described (49). The wild type strain used was SEY6210 (MATa ura3-52 leu2-3,112
his3-0200 trill-X901 lys2-801 suc2~9) NDYS (MATa ura3-52 leu2-211 vrg4-2)
(12) was used as the source of genomic DNA for the cloning of the vrg4-2
allele.
The isogenic parental strain is RSY255 (MATa ura3-52 leu2-211 ).
Cloning and DNA sequence analysis of the vrg=l-2 allele
A 1.35-kB fragment containing the vrg4-2 open reading frame and 237 base
pairs of 5' and 72 base pairs of 3' flanking sequences was amplified by PCR
using
LA Taq thermophilic DNA polymerase (TaKaRa Shuzo, Japan) from genomic DNA
isolated from the vrg4-2 strain, NDYS (12), using the following primers:
5'CGTAATGAATCGCAATATACG3' (SEQ. ID No: 25) and
5'TTGCATTAGATGCCTCTATAA3' (SEQ. ID No: 26). LA Taq polymerase has
the same high fidelity as Pfu, but like Taq polymerase, lacks the 3' to 5'
proofreading exonuclease activity. This results in PCR products containing TA
overhangs that were directly cloned into the pCRII-TA cloning vector (In
Vitrogen)
to generate pCRIIvrg4-2. Plasmids from three independent clones were isolated
and
the sequence from each of these was compared to the VRG4 gene isolated by PCR
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-43-
0
from the isogenic parental strain and cloned in the same way to exclude PCR-
derived mutations. DNA sequencing was performed by the dideoxy chain
termination method (43) as described (50) using the Thermo Sequenase cycle
sequencing kit (Amersham Pharmacia Biotech). DNA sequence analysis was
performed using an automated LI-COR 4000L DNA sequencer.
Construction of plasmids
Standard molecular biology techniques were used for all plasmid
constructions (45). DNA sequence analysis identified-a single C to A base pair
change at nucleotide 857 in the vrg4-2 allele. To construct a series of
equivalent
expression plasmids containing either the VRG4 or vrg4-2 allele that differ
only in
this mutation, a 251 base pair HpaIlMfeI fragment from pCRIIvrg4-2, containing
this point mutation, was used to replace the same region in the wild type YRG4
gene. The plasmid, pRS316Vrg4-A286D, was made by replacing this fragment in
pRHL (12) which contains the VRG4 gene under its own promoter on an
EcoRIlHindIII fragment in pRS316, a CEN6/URA3 vector (46).
pRS316Vrg4-A286D-HA3 encodes the Vrg4-A286D mutant protein tagged
with three copies of the HA epitope at the C-terminus in pRS316. It was
constructed
bY replacing a HpaIlMfeI fragment of pRHL-HA3 (51 ), with the HpaIlMfeI
fragment from pCRIIvrg4-2. To construct YEp352-Vrg4-A286D-HA3, which
contains the HA-tagged vrg4-2 allele on a 2E.t/URA3 plasmid, a HindIIIlXbaI
fragment from pRS316 Vrg4-A286D-HA3, containing the entire Vrg4-A286D-HA3,
was subcloned into YEp352 (52).
To construct pRHL-myc3, the YRG4 gene was cloned in-frame to three
copies of the myc epitope. A fragment containing the VRG4 ORF, lacking the
stop
codon and flanked by a 5' HindIII and a 3' NsiI site was isolated by PCR. This
fragment was cloned into HindIII-PstI digested pSK-P/X myc3, a Bluescript SK'
derivative (Stratagene). pSK-P/X myc3 carries a 172 by fragment containing
sequences that encode three tandem copies of the myc epitope (EQKLISEEDL)
(SEQ. ID No: 27) cloned between the PstI and XbaI sites. Thus, the SK-VRG4-
myc3
construct contains an in-frame fusion of the three copies of the myc epitope
to the
c~'boxy terminus of Vrg4p. SK VRG4-myc3 was used to generate pRHL-myc3
which contains VRG4-myc3 on an EcoRIlHindIII fragment in pRS316.
CA 02339338 2001-02-06
0
WO 00!09550 PCT/US99/18402
-44-
A myc-tagged vrg4-A286D allele was constructed in several steps. First, a
fragment containing the 3' end of vrg4-A286D-HA3 including the triple HA tag
but
lacking the point mutation, on an MfeI IlSac I fragment, was replaced by the
corresponding MfeIlSacI fragment from VRG4-myc3. The resulting plasmid,
pRS316-Vrg4-A286D-myc3 contains the myc-tagged vrg4-2 allele in pRS316. A 1.3
kB HindIIIlXbaI fragment containing the entire vrg4-A286D-myc3 ORF and
promoter sequences was subcloned into YEplac181, a LEU2/2p, vector to generate
YEpLacl81-Vrg4-A286D-myc3.
An HA-tagged GDA 1 plasmid was created by introducing a Sall lEco RI site
5' and 3' to the GDA 1 ORF by PCR. After digestion with SaII and EcoRI, this
fragment was ligated into the SaIIlEcoRI site of pSK-P/X HA3 plasmid (15) to
produce pSK'GDA 1-HA3. This results in the in-frame fusion of GDA 1 with
sequences encoding 3 copies of the HA epitope at the 3' terminus, followed by
a
stop codon. The sequence of pSK~GDA 1-HA3 was confirmed by DNA sequencing
as described above. Finally, the SaIIlNotI fragment containing GDA 1-HA3 from
pSK-GDA1-HA3 was subcloned into a HIS3/2p expression vector, pY0323 (53) to
generate pY0323 GDA 1-HA3.
Preparation of cell free lysates
Exponentially growing yeast cells (A600: 1-3) were harvested and converted
to spheroplasts with lyticase (SIGMA), as described (59). Spheroplasts were
resuspended in 400 p.l of ice cold lysis buffer ( 1 SO mM NaCI, 10 mM HEPES-
KOH
(pH7.5), 5 mM MgCl2, 1 mM PMSF) containing either 1 % digitonin or 1 % Triton
X-100 to solubilize membrane proteins, and centrifuged for 5 min at 4°C
at 14 kG to
remove debris. These detergent extracts were used for both FPLC analysis and
the
co-immunopreciptation assays described below. Whole cell protein extracts were
prepared by TCA precipitation, as described (59).
For preparation of a membrane fraction, 50 A6oo units of cells were
spheroplasted using lyticase (59). The spheroplasts were resuspended in 1 ml
cold
lysis buffer (0.1 M Sorbitol, 50 mM Potassium Acetate, 2 mM EDTA, 20 mM--
HEPES (pH7.4), 1 mM DTT) containing a protease inhibitor cocktail (1 mM
phenylmethylsulfonyl fluoride (PMSF), 1 p.g/ml pepstatin, 50 pg/ml N - Tosyl-L
lysine chloromethyl ketone, (TLCK) 100pg/ml N-Tosyl-L-phenylalanine
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-45-
chloromethyl ketone (TPCK) and 100 p,g/ml Trypsin inhibitor). Lysis was
carried
out by dounce homogenization (25 strokes) on ice and unbroken cells were
removed
from the lysate by centrifugation for 5 min in a microfuge. Membranes were
isolated by centrifugation at 100 kG for 30 min in a Beckman optima TL
ultracentrifuge. The membrane pellet was resuspended in 1 SOp,I lysis buffer
and
used for protease protection assays (see below).
Co-immunoprecipitation, western immunoblotting and immuno~luorescence
The HA-tagged proteins were immunoprecipitated by incubating 400u1 of
the detergent extract (described above) with 200 p,l of a hybridoma cell
cultpre
supernatants containing the 12CA5 monoclonal anti-HA antibody and 25 pl of
protein A-Sepharose (Pharmacia) at room temperature for 2 hours. The protein A-
Sepharose beads and associated proteins were centrifuged and washed three
times
with the same lysis buffer ( 1% digitonin or 1% Triton X-100; 150 mM NaCI, SO
mM HEPES-KOH (pH7.5), 5 mM MgCl2, 1 mM PMSF). After resuspending in
Laemmli's sample buffer and solubilizing at 45°C for 3 min,
immunoprecipitates
were fractionated by 10% SDS-PAGE, transferred to Immobilon-PVDF membranes
(Millipore) and immunoblotted with anti-myc A-14 polyclonal antibodies (Santa
Cruz Biotechnology). Secondary anti-rabbit antibodies conjugated to
horseradish
peroxidase (Amersham) were used at a 1:3000 dilution and detected by
chemiluminescence (ECL, Amersham) followed by autoradiography.
Indirect immunofluorescence of yeast cells expressing Vrg4-HAp or Vrg4
A286D-HA was performed as described (51 ). Samples were observed with a Zeiss
Axioscop and photographed with a Sony DXC-9000 cooled CCD camera. Images
were captured using NIH Image software and all processing was done with Canvas
version 5 (Deneba).
~SULTS
The Vrg;l protein multimerizes in vivo and in vitro
To examine whether the Vrg4 protein functions as a monomer or in a higher
order structure, a co-immunoprecipitation assay was first used to determine
whether
the Vrg4 protein can interact with itself. A yeast strain was constructed that
co-
expressed both an HA- and myc-tagged allele of VRG4 on high copy plasmids.
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-46-
Both of these tagged alleles can complement the hygromycin B sensitivity of a
vrg4
mutant, although not as well as the untagged alleles, indicating that these
epitopes
do not significantly alter the normal function of Vrg4p. Membrane proteins
from
this strain were solubilized with 1 % digitonin and immunoprecipitated with
the
12CA5 anti-HA monoclonal antibody. To measure the relative amount of Vrg4-myc
protein that associated with the HA-tagged Vrg4p, the precipitates were
fractionated
by SDS-PAGE and immunoblotted with a rabbit antiserum against the myc epitope
(Figure 1 OA). Vrg4-mycp efficiently co-precipitated with Vrg4-HA, since it
could
only be detected in the presence of extracts containing Vrg4-HA (Figure 10A,
compare lanes 1 and 2). Similar results were obtained if the anti-myc antibody
was
used for the immunoprecipitation and the anti-HA antibody was used for western
blotting (not shown), indicating that co-precipitation is not dependent on the
antibody. Though strains coexpressing high levels of Vrg4-HAp and Vrg4-mycp
were used for the experiment shown in Figure I OA, Vrg4p multimerized as
efficiently when the epitope-tagged proteins were expressed from low copy CEN
containing vectors ar when the proteins were expressed from epitope-tagged
chromosomal alleles (not shown). These results suggest that Vrg4p multimerizes
efficiently.
Vrg4p is very hydrophobic, containing six to eight predicted membrane
spanning domains. As a control for non-specific aggregation due to its
hydrophobicity, we examined whether we could detect an interaction of Vrg4p
with
other membrane proteins. Neither Gdal-HAp (Figure l OB, lane 4), Yndl-HAp (not
shown) which are Golgi localized GDPases with single transmembrane domains,
nor Pmalp (not shown), a plasma membrane protein that contains I O predicted
transmembrane domains, co-precipitated with Vrg4-mycp, suggesting that Vrg4p
oligomerization is not due to nonspecific hydrophobic interactions.
To determine if the observed Vrg4p-containing complex had assembled in
vivo, we performed a mixing experiment in which digitonin extracts were
prepared
from strains that expressed either Vrg4-mycp or Vrg4-HAp. These extracts were
combined together prior to immunoprecipitation with anti-HA antibody.
Following
fractionation by SDS-PAGE, no Vrg4-mycp could be detected in the precipitate
CA 02339338 2001-02-06
0
WO 00/09550 PCTNS99/18402
-47-
(Figure 10A, lane 3), demonstrating that the complex had stably formed in vivo
and
did not disassemble in the presence of digitonin in vitro.
In the course of determining optimal conditions for extracting Vrg4p-
containing complexes, we noticed that the Vrg4p-containing complex behaved
differently in Triton X-100 than in digitonin. As was observed with digitonin,
stable
Vrg4p oligomers could be extracted from yeast solubilized with 1% Triton X-100
since Vrg4-mycp efficiently co-precipitated with Vrg4HA and could only be
detected in the presence of extracts containing Vrg4HAp (Figure 10B, lanes 1
and
2)~ However, when Triton extracts from strains expressing Vrg4-mycp or Vrg4-
HAp were mixed together prior to immunoprecipitation with anti-HA antibodies,
a
substantial amount of Vrg4mycp precipitated with Vrg4-HAp (Figure IOB, lane
3).
The strains used for these experiments contain the endogenous, untagged Vrg4p
in
addition to the epitope-tagged version. Presumably the tagged and untagged
forms
of Vrg4p form a complex with one another in vivo. Therefore, any association
between Vrg4-mycp and Vrg4-HAp that we observed in vitro required the
disassembly of complexes that had assembled in vivo. The amount of Vrg4mycp
that co-precipitated with Vrg4-HAp after mixing was three fold reduced from
that
which co-precipitated from extracts that were prepared from cells co-
expressing
these two proteins (Figure lOB, lanes 2 and 3), suggesting that the Vrg4p-
containing
complex is less stable in Triton X-100 than in digitonin. Vrg4 multimerization
in
Triton is specific since its association with other membrane proteins, such as
Gdal-
mycp (Figure IOB, lane 4) or Yndl-mycp (not shown) was not observed. This was
the case in extracts from strains coexpressing these control proteins and Vrg4-
HA
(not shown), or in extracts containing each of these proteins individually
that were
mixed prior to immunoprecipitation (Figure 1 OB, lane 4). Taken together,
these
results demonstrate that Vrg4p has the capacity to multimerize with high
specificity
and efficiency both in vivo and in vitro.
The mutant protein encoded by tl:e vrg4-2 allele is stable and retains the
ability to
form protein interactions.
Although a deletion of the VRG4 gene is lethal, we previously isolated a
viable allele of vrg4 that has a severe glycosylation phenotype both in vivo
and in
vi/ro. vrg4-2 strains display a level of nucleotide sugar transport activity
in vitro that
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-48-
is about twenty five fold reduced from those of wild type strains. To analyze
the
mutant protein in yeast extracts, the vrg4-2 allele was cloned by PCR
amplification
of genomic DNA from a vrg4-2 mutant strain and tagged with either the HA-or
myc
epitope appended to the C-terminus (see Materials and Methods). The isolation
of
the mutant allele was confirmed by sequence analysis (see below), by testing
its
inability to complement the hygromycin B grovvth sensitivity of the vrg4-2
mutant
strain (Figure 11A), and by western blot analysis (Figure 11B).
Sequence analysis demonstrated that the vrg4-2 allele contains a single point
mutation that changes an alanine at position 286 to an aspartate (see below).
Therefore, this mutant protein will be referred to as Vrg4-A286Dp. To
determine if
the A286D mutation altered protein stability, the steady state level of the HA-
tagged
mutant protein was compared to the normal Vrg4-HA protein by western blot
analysis with the anti-HA antibody (Figure 11 B). By this assay, we found that
the
steady state levels of the mutant and wild type Vrg4 proteins were virtually
indistinguishable, when expressed from either a low copy, CEN vector (Figure
11 B,
compare lanes 2 and 3) or a high copy, 2p, vector (Figure 11B, compare lanes 4
and
5). These results demonstrate that the Vrg4 A286D-HA protein is as stable as
its
wild type counterpart.
Multimerization of the mutant Vrg4 A286D-HA was examined using a co-
immunoprecipitation assay. Yeast strains were constructed that co-express in
either
the mutant and wild type Vrg4 proteins that were HA- and myc-tagged,
respectively, or that co-express the HA- and myc- tagged mutant Vrg4-A286D
protein. The relative aff pity of the mutant protein for itself and for the
wild type
Vrg4 protein was compared by quantitating the amount of Vrg4 A286Dmycp that
precipitated with anti-HA antibody in detergent extracts. The Vrg4A286D mutant
protein could multimerize as well as the wild type Vrg4 protein since equal
amounts
of Vrg4 A286D-mycp precipitated with both Vrg4-HAp and Vrg4-A286D-HAp
(Figure 12, lanes 2 and 3 ). This was similar, but not identical to the amount
of wild
type Vrg4 protein that precipitated with itself which was typically observed
to be in
the range of 1.5 to 3 fold greater (Figure 12, compare 3 and 4).
Tl~e Vrg4-A286D protein is correctly localized to the Golgi
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-49-
The vrg4-2 mutation causes a severe underglycosylation of both proteins and
lipids. In addition, this mutant displays levels of GDP-mannose transport
activity in
vitro that are at background levels. Since the Vrg4-A286D mutant protein is
stable
and also retains the ability to homo-dimerize, this raised the question of
what is the
biochemical basis for the loss of nucleotide transport activity. GDP-mannose
transport activity is associated with Golgi membranes and the Vrg4-HA protein
is
localized to the yeast Golgi. One possible explanation for its inactivity is
that Vrg4
A286Dp fails to exit the ER. To test whether the mutant Vrg4-A286D protein is
mislocalized, we compared its intracellular location to that of the normal
Vrg4
protein. Cells expressing VRG4-HA or vrg4-A286D-HA were fixed with
formaldehyde and the HA-tagged proteins were detected by indirect
immunofluorescence using antibodies directed against the HA-epitope. By this
assay, the mutant protein displayed the same punctate pattern characteristic
of the
yeast Golgi that is observed for the wild type Vrg4 protein that is distinct
from the
perinuclear, ER staining (Figure 13A-13D) suggesting that the mutant protein
is
correctly localized to the Golgi. Therefore, the inactivity of the mutant Vrg4
A286D protein is not due to its mislocalization.
Sequence analysis of the mutant vrg4-2 allele
The results described above indicated that the vrg4-2 allele contains a
mutation that affects nucleotide sugar transport, but that does not affect
homo-
oligomerization, Golgi localization or protein stability. To identify the
molecular
basis for this mutant phenotype, the sequence of the vrg4-2 mutant allele was
determined. The mutant gene was cloned using a PCR approach (see Materials and
Methods). A comparison of the DNA sequence from three independent clones
containing the mutant allele to the wild type VRG4 gene revealed a single C to
A
base pair change at nucleotide position 857. This point mutation results in
the
replacement of an alanine with an aspartate at position 286 whose location in
the
protein is shown graphically in the hydropathy plot in Figure 14A. This amino
acid
is located in a region of Vrg4p that is particularly conserved-among Vrg4-
related
proteins (Figure 14B).
Example 11
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
-50-
0
Figure 15A and 15 B show complementation of the S cerevisiae vrg-4
mutant by the Candida VRG4 gene. This figure demonstrates that the isolated
gene
is not just a structural homologue but also a functional homologue, i.e., that
the
isolated C. albicans VRG4 gene is a bona,fide GDP-mannose transporter. The
g second important point of this datum is that the Candida gene functions in S
cerevisiae, which means that method aimed at inhibition of the Candida protein
can
be performed in this nonpathogenic strain, rather than in Candida.
15
25
35
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-51-
References
1. Herscovics, A., and Orlean, P. (1993) FASEBJ. 7, 540-S50
2. Ballou, C. E. (1990) Methods Enzymol. 185, 440-470
3. Gentzsch, M., and Tanner, W. ( 1996) EMBO J 15, 5752-5759
S 4. Gentzsch, M., and Tanner, W. (1997) Glycobiology 7, 481-486
5. Lester, R. L., and Dickson, R. C. (1993) Adv. in Lipid Res. 26, 253-274
6. Smith, S. W., and Lester, R. L. (1974) J. Biol. Chem 249, 3395-3405
7. Abeijon, C., Orlean, P., Robbins, P. W., and Hirschberg, C. B. (1989) Proc.
Natl. Acad. Sci U.S.A. 86, 6935-6939
8. Abeijon, C., Yanagisawa, K., Mandon, E. C., Hausler, A., Moremen, K.,
Hirschberg, C. B., and Robbins, P. W. (1993) J. Cell Biol. 122(2), 307-323
9. Hirschberg, C. B., and Snider, M. D. ( 1987) Annu. Rev. Biochem. 56, 63-87
10. Ballou, L., Hitzeman, R. A., Lewis, M. S., and Ballou, C. E. (1991) Proc.
Natl.
Acad. Sci. 88, 3209-3212
1 I. Kanik-Enulat, C., Montalvo, E., and Neff, N. (1995) Genetics 140(3), 933-
943
12. Poster, J. B., and Dean, N. (1996) J. Biol. Chem. 271, 3837-3845
13. Sherman, F., Fink, G. R., and Hicks, J. B. (1983) Methods in Yeast
Genetics.
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor
14. Ito, H. Y., Fukuda, Y., Murata, K., and Kimura, J. (1983)J. Bacteriol.
153,
163-168
15. Neiman, A. M., Mhaiskar, V., Manus, V., Galibert, F., and Dean, N. (1997)
Genetics 145, 637-645
16. Alber, T., and Kawasaki, G. ( 1982) J Mol Appl Genet 1, 419-434
17. Cottarel, G. (1995) Curr. Genet. 28, 380-383
18. Wickerham, L. J. (1946) J. Bacteriol. 52, 293-301
19. Krakow, J. L., Hereld, D., Bangs, J. D., Hart, G. W., and Englund, P. T.
(1986)
J. Biol. Chem. 261, 12147-12153
20. Baker, D., Hicke, L., Rexach, M., Schleyer, M., and Schekman, R. ( 1988)
Cell
54, 335-344
21. Ames, B. N. (1966) Methods Enrymol. 8, 115-118
22~ Kuranda, M. J., and Robbins, P. W. ( 1991 ) J. Biol Chem. 266, 19758-19767
23. Dean, N., and Poster, J. ( I 996) Glycobiology 6, 73-81
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-52-
24. Puoti, A., Desponds, C., and Conzelmann, A. ( 1991 ) J. Cell Biol. 113, 5
I 5-525
25. Orlean, P., Albright, C., and Robbins, P. W. ( 1988) J. Biol. Chem. 263,
17499-
17507
26. Perez, M., and Hirschberg, C. B. ( I 987) Methods Enrymol. 138, 709-715
27. Waechter, C. J., Lucas, J. J., and Lennarz, W. J. (1973) J. Biol. Chem.
248,
7570-7579
28. Preuss, D., Mulholland, J., Franzusoff, A., Segev, N., and Botstein, D.
(1992)
Mol. Biol. Cell. 3, 782-803
29. Ma, D., Russell, D. G., Beverley, S. M., and Turco, S. J. (1997) J. Biol.
Chem.
272, 3799-3805
30. Abeijon, C., Robbins, P. W., and Hirschberg, C. B. (1996) Proc. Natl.
Acad.
Sci. U.S.A. 93, 5963-5968
31. Abeijon, C., Mandon, E. C., Rohbins, P. W., and Hirschberg, C. B. (1996)
J.
Biol. Chem. 271, 8851-8854
32. Patton, and Lester. ( 1992) Arch. Biochem. Biophys. 292, 70-76
33. Wu, W. L, Lin, Y. P., Wang, E., Mernll, A. H., Jr., and Carman, G. M.
(1993)
J. Biol. Chem. 268, 13830-13837
34. Conzelmann, A., Puoti, A., Lester, R. L., and Desponds, C. ( 1992) EMBO J.
11, 457-466
35. Hechtberger, P., Zinser, E., Saf, R., Hummel, K., Paltauf, F., and Daum,
G.
( 1994) Eur. J. Biochem. 225, 641-649
36. to Heesen, S., Janetsky, B., Lehle, L., and Aebi, M. (1992) EMBOJ.11, 2071-
2075
37. Silberstein, S., and Gilmore, R. (1996) FASEB J. 10, 849-858
38. Nakanishi-Shindo, Y., Nakayama, K., Tanaka, A., Toda, Y., and Jigami, Y.
(1993) J. Biol. Chem. 268(15), 26338-26345
39. Nakayama, K., Nagasu, T., Shimma, Y., Kuromitsu, J., and Jigami, Y. (1992)
EMBOJ. (7), 2511-2519
40. Lussier, M., Sdicu, A. M., Bussereau, F., Jacquet, M., and Bussey, H. (
1997) J.
Biol. Chem. 272, 15527-15531
41. Smith, S. W., and Lester, R. L. (1974) J. Biol. Chem. 249, 3395-3405
42. Altschul, S., F.Gish, W., Miller, W., Myers, E. W. and Lipman, D. J.
(1990)
CA 02339338 2001-02-06
0
WO 00/09550 PCT/US99/18402
-53-
J. Mol. Biol. 215, 403-410
43. Sanger, F., et al 1977 Proc. Natl. Acad. Sci U.S A 74:5463-5467
44. Yannish-Perron, C. et al 1985. Gene (Amst). 33, 103-119.
45. Sambrook, J. et al 1989. Molecular Cloning A Laboratory Manual, Cold
Spring
Harbor Laboratory, Cold Spring Harbor, NY
46. Sikorski, R. et al 1989 Genetics 122, 19-27
47. Carle, G.F. et al 1985 Proc. Natl. Acad. Sci tJ.S A 82, 3756-3760.
48. Guthrie, C., and Fink, G. R. ( 1991 ) Methods Enzymol 194, 3-20
49. Dean, N. (1995) Proc. Natl. Acad. Sci. U.S A 92, 1287-1291
50. Machida, M., Chang, Y. C., Manabe, M., Yasukawa, M., Kunihiro, S., and
Jigami, Y. (1996) Curr. Genet. 30, 423-431
51. Dean, N., Zhang, Y. B., and Poster, J. B. (1997) J. Biol. Chem. 272, 31908-
31914
52. Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1993) Yeast
2, 163-
167
53. Homma, K., Terui, S., Minemura, M., Qadota, H., Anraku, Y., Kanaho, Y.,
and
ohya, Y. (1998) J. Biol. Chem. 273, 15779-15786
54. Baudin, A., ozier-Kalogeropoulos, o., Denouel, A., Lacroute, F., and
Cullin, C.
(1993) Nucleic Acids Res 21(14), 3329-30
55. Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994) Yeast
10(13),
1793-808
56. Wach, A., Brachat, A., Alberti-Segui, C., Rebischung, C., and Philippsen,
P.
(1997) Yeast 13(11), 1065-75
57. Mondigler, M., and Ehrmann, M. (1996) J Bacteriol 178(10), 2986-8
58. Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach,
A.,
Brachat, A., Philippsen, P., and Pringle, J. R. ( 1998) Yeast 14, 953-61
59. Chi, J. H., Roos, J., and Dean, N. (1996) J. Biol. Chem. 271, 3132-3140
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
SEQUENCE LISTING
<110> THE RESEARCH FOUNDATION OF STATE UNIVERSITY OE NEW
<120> VANADATE RESISTANCE GLYCOSYLATION 9 GENE (VRG4),
PROTEIN AND USES IN METHODS OF SCREENING FOR
ANTI-FUNGAL COMPOUNDS
<130> 0887-4136PC
<140>
<191>
<150> US 60/096,609
<151> 1998-08-19
<150> US 60/118,370
<151> 1999-02-03
<160> 27
<170> PatentIn Ver. 2.1
<210> 1
<211> 1108
<212> DNA
<213> Saccharomyces cerevisiae
<400> 1
ttaattacca aaagagccta agaaaacaaa cacactaacc acacagtacc tttcgcccga 60
atgtctgaat tgaaaacagg tcatgcaggc cataaccctt gggcttcagt tgccaattcc 120
ggtccgatct ctattttatc ctactgtggt tcctctattt taatgacggt gactaacaag 180
ttcgtcgtca atttgaagga tttcaacatg aactttgtca tgcttttcgt gcaatctttg 240
gtttgtacta taaccttgat tatcctacgt atactgggct atgcgaagtt ccgttcatta 300
aacaaaacag acgccaagaa ctggttccct atttcctttt tactggtctt gatgatctac 360
acctcttcga aggctttaca atacttggct gttccaattt acaccatttt caagaatttg 420
actattatct tgattgctta tggtgaggtt ctcttttttg gtggctctgt cacctccatg 980
gaattgtcat catttttgtt gatggtcctt tcttctgtcg ttgcaacttg gggtgaccag 540
caagctgtgg ctgccaaggc tgcttcattg gctgaaggag cagccggtgc tgttgcctcc 600
tttaacccag gttatttctg gatgttcacc aactgtatca cttctgcatt attcgttctt 660
ataatgagaa agagaattaa gttaactaac ttcaaggatt tcgacactat gttttacaac 720
aatgttttgg ctctacctat tctattgctg ttttctttct gtgtggaaga ttggtcttca 780
gttaatttga ccaataactt ttctaacgat tcgctaactg ctatgatcat cagtggtgtt 840
gcatccgtcg gtatttctta ctgttccggt tggtgtgttc gtgttacttc gtctactaca 900
tattcgatgg taggggcttt gaacaagctg ccaattgcct tgtctggttt gattttcttt 960
gatgctccaa gaaacttctt atctattctc tccattttta ttggtttcct atcaggtatt 1020
atttatgctg ttgccaaaca aaagaagcaa caagcccaac ctttacgtaa atgagaactt 1080
acggggggtg caatttattt tttttttt 1108
1
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
<210> 2
<211> 336
<212> PRT
<213> Saccharomyces cerevisiae
<900> 2
Met Ser Glu Leu Lys Thr Gly His Ala Gly His Asn Pro Trp Ala Ser
1 5 10 15
Val Ala Asn Ser Gly Pro Ile Ser Ile Leu Ser Tyr Cys Gly Ser Ser
20 25 30
Ile Leu Met Thr Val Thr Asn Lys Phe Val Val Asn Leu Lys Asp Phe
35 40 45
Asn Met Asn Phe Val Met Leu Phe Val Ser Leu Val Cys Thr Ile Thr
50 55 60
Leu Ile Ile Leu Arg Ile Leu Gly Tyr Ala Lys Phe Arg Ser Leu Asn
65 70 75 80
Lys Thr Asp Ala Lys Asn Trp Phe Pro Ile Ser Phe Leu Leu Val Leu
85 90 95
Met Ile Tyr Thr Ser Ser Lys Ala Leu Gln Tyr Leu Ala Val Pro Ile
100 105 110
Tyr Thr Ile Phe Lys Asn Leu Thr Ile Ile Leu Ile Ala Tyr Gly Glu
115 120 125
Val Leu Phe Phe Gly Gly Ser Val Thr Ser Met Glu Leu Ser Ser Phe
130 135 140
Leu Leu Met Val Leu Ser Ser Val Val Ala Thr Trp Gly Asp Gln Gln
145 150 155
160
Ala Val Ala Ala Lys Ala Ala Ser Leu Ala Glu Gly Ala Ala Gly Ala
165 170 175
Val Ala Ser Phe Asn Pro Gly Tyr Phe Trp Met Phe Thr Asn Cys Ile
180 185 190
Thr Ser Ala Leu Phe Val Leu Ile Met Arg Lys Arg Ile Lys Leu Thr
195 200 205
Asn Phe Lys Asp Phe Asp Thr Met Phe Tyr Asn Asn Val Leu Ala Leu
2
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
210 215 220
Pro Ile Leu Leu Leu Phe Ser Phe Cys Val Glu Asp Trp Ser Ser Val
225 230 235
240
Asn Leu Thr Asn Asn Phe Ser Asn Asp Ser Leu Thr Ala Met Ile Ile
295 250 255
Ser Gly Val Ala Ser Val Gly Ile Ser Tyr Cys Ser Gly Trp Cys Val
260 265 270
Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala Leu Asn Lys
275 280 285
Leu Pro Ile Ala Leu Ser Gly Leu Ile Phe Phe Asp Ala Pro Arg Asn
290 295 300
Phe Leu Ser Ile Leu Ser Ile Phe Ile Gly Phe Leu Ser Gly Ile Ile
305 310 315
320
Tyr Ala Val Ala Lys Gln Lys Lys Gln Gln Ala Gln Pro Leu Arg Lys
325 330 335
<210> 3
<211> 1116
<212> DNA
<213> Candida albicans
<400> 3
atgggagtta tactgtttta tttaatagga caattattat atttaatcag aaagaaatac 60
actactactt atagacaaca acaacaatac caatacaata tggattcaaa acattctact 120
tcttcttctt cttctggctc attagctact agaatttcca attcaggtcc tatttctata 180
gcagcctatt gtctttcatc tattttaatg acagtcacca ataaatatgt tttatcgggt 240
tttagtttta atttgaattt tttcttatta gcagtccaat caattgtttg tattgttact 300
attggttcat taaaatcatt aaatatcatt acttatagac aattcaataa agatgaagct 360
aagaaatggt caccaattgc atttttatta gttgctatga tttatacttc ttccaaagct 420
ttacaatatt taagtatccc cgtttatact attttcaaaa atttaaccat tattttaatt 480
gcttatggtg aagtcatttg gtttggtggt aaagttacta ctatggcttt gagttcattt 540
ttattaatgg ttttatcctc ggtcattgct tattatggtg ataatgctgc tgttaaatct 600
catgatgatg cctttgcatt atatttagga tatttttgga tgttgaccaa ttgttttgct 660
tcagctgctt ttgttttaat tatgagaaaa agaattaaat tgactaattt taaagatttt 720
gatactatgt attataataa tttattatca attcctattt tgttgatttg ttcatttatt 780
tttgaagatt ggtctagtgc taatgtttca ttgaatttcc ctgctgataa tagagtcact 840
3
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
accattacgg.caatgatttt aagtggtgct tcatccgttg gtatttctta ttgttctgct 900
tggtgtgtta gagtcacttc ttctactact tattctatgg ttggagcatt gaataaatta 960
ccaattgcct tatcaggatt aatatttttt gaagctgctg tcaatttttg gtcggtttct 1020
tctattttcg ttggttttgg tgcaggatta gtttatgctg ttgctaaaca aaaacaacaa 1080
aaagaacaat ctcaacaatt accaaccact aaatag 1116
<210> 9
<211> 371
<212> PRT
<213> Candida albicans
<400> 4
Met Gly Val Ile Leu Phe Tyr Leu Ile Gly Gln Leu Leu Tyr Leu Ile
1 5 10 15
Arg Lys Lys Tyr Thr Thr Thr Tyr Arg Gln Gln Gln Gln Tyr Gln Tyr
20 25 30
Asn Met Asp Ser Lys His Ser Thr Ser Ser Ser Ser Ser Gly Ser Leu
35 40 95
Ala Thr Arg Ile Ser Asn Ser Gly Pro Ile Ser Ile Ala Ala Tyr Cys
50 55 60
Leu Ser Ser Ile Leu Met Thr Val Thr Asn Lys Tyr Val Leu Ser Gly
65 70 75 80
Phe Ser Phe Asn Leu Asn Phe Phe Leu Leu Ala Val Gln Ser Ile Val
85 90 95
Cys Ile Val Thr Ile Gly Ser Leu Lys Ser Leu Asn Ile Ile Thr Tyr
100 105 110
Arg Gln Phe Asn Lys Asp Glu Ala Lys Lys Trp Ser Pro Ile Ala Phe
115 120 125
Leu Leu Val Ala Met Ile Tyr Thr Ser Ser Lys Ala Leu Gln Tyr Leu
130 135 140
Ser Ile Pro Val Tyr Thr Ile Phe Lys Asn Leu Thr Ile Ile Leu Ile
145 150 155 160
Ala Tyr Gly Glu Val Ile Trp Phe Gly Gly Lys Val Thr Thr Met Ala
165 170 175
Leu Ser Ser Phe Leu Leu Met Val Leu Ser Ser Val Ile Ala Tyr Tyr
180 185 190
9
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
Gly Asp Asn Ala Ala Val Lys Ser His Asp Asp Ala Phe Ala Leu Tyr
195 200 205
Leu Gly Tyr Phe Trp Met Leu Thr Asn Cys Phe Ala Ser Ala Ala Phe
210 215 220
Val Leu Ile Met Arg Lys Arg Ile Lys Leu Thr Asn Phe Lys Asp Phe
225 230 235 240
Asp Thr Met Tyr Tyr Asn Asn Leu Leu Ser Ile Pro Ile Leu Leu Ile
295 250 255
Cys Ser Phe Ile Phe Glu Asp Trp Ser Ser Ala Asn Val Ser Leu Asn
260 265 270
Phe Pro Ala Asp Asn Arg Val Thr Thr Ile Thr Ala Met Ile Leu Ser
275 280 285
Gly Ala Ser Ser Val Gly Ile Ser Tyr Cys Ser Ala Trp Cys Val Arg
290 295 300
Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala Leu Asn Lys Leu
305 310 315 320
Pro Ile Ala Leu Ser Gly Leu Ile Phe Phe Glu Ala Ala Val Asn Phe
325 330 335
Trp Ser Val Ser Ser Ile Phe Val Gly Phe Gly Ala Gly Leu Val Tyr
340 345 350
Ala Val Ala Lys Gln Lys Gln Gln Lys Glu Gln Ser Gln Gln Leu Pro
355 360 365
Thr Thr Lys
370
<210> 5
<211> 312
<2I2> PRT
<213> Candida albicans
<400> 5
Ile Ser Asn Ser Gly Pro Ile Ser Ile Ala Ala Tyr Cys Leu Ser Ser
1 5 10 15
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
Ile Leu Met Thr Val Thr Asn Lys Tyr Val Leu Ser Gly Phe Ser Phe
20 25 30
Asn Leu Asn Phe Phe Leu Leu Ala Val Gln Ser Ile Val Cys Ile Val
35 40 95
Thr Ile Gly Ser Leu Lys Leu Asn Ile Ile Thr Tyr Arg Gln Phe Asn
50 55 60
Lys Asp Glu Ala Lys Lys Trp Ser Pro Ile Ala Phe Leu Leu Val Ala
65 70 75 80
Met Ile Thr Tyr Thr Ser Ser Lys Ala Leu Gln Tyr Leu Ser Ile Pro
85 90 95
Val Tyr Thr Ile Phe Lys Asn Leu Thr Ile Ile Leu Ile Ala Tyr Gly
100 105 110
Glu Val Ile Trp Phe Gly Gly Lys Val Thr Thr Met Ala Leu Ser Ser
115 120 125
Phe Leu Leu Met Val Leu Ser Ser Val Ile Ala Tyr Tyr Gly Asp Asn
130 135 140
Ala Ala Val Lys Ser His Asp Asp Ala Phe Ala Leu Tyr Leu Gly Tyr
145 150 155 160
Phe Trp Met Leu Thr Asn Cys Phe Ala Ser Ala Ala Phe Val Leu Ile
165 170 175
Met Arg Lys Arg Ile Lys Leu Thr Asn Phe Lys Asp Phe Asp Thr Met
180 185 190
Tyr Tyr Asn Asn Leu Leu Ser Ile Pro Ile Leu Leu Ile Cys Ser Phe
195 200 205
Ile Phe Glu Asp Trp Ser Ser Ala Asn Val Ser Leu Asn Phe Pro Ala
210 215 220
Asp Asn Arg Val Thr Thr Ile Thr Ala Met Ile Leu Ser Gly Ala Ser
225 230 235 240
Ser Val Gly Ile Ser Tyr Cys Ser Ala Trp Cys Val Arg Val Thr Ser
245 250 255
Ser Thr Thr Tyr Ser Met Val Gly Ala Leu Asn Lys Leu Pro Ile Ala
260 265 270
6
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
Leu Ser Gly Leu Ile Phe Phe Glu Ala Ala Val Asn Phe Trp Ser Val
275 280 285
Ser Ser Ile Phe Val Gly Phe Gly Ala Gly Leu Val Tyr Ala Val Ala
290 295 300
Lys Gln Lys Gln Gln Lys Glu Gln
305 310
<210> 6
<211> 317
<212> PRT
<213> Saccharomyces cerevisiae
<400> 6
Val Ala Asn Ser Gly Pro Ile Ser Ile Leu Ser Tyr Cys Gly Ser Ser
1 5 10 15
Ile Leu Met Thr Val Thr Asn Lys Phe Val Val Asn Leu Lys Asp Phe
20 25 30
Asn Met Asn Phe Val Met Leu Phe Val Gln Ser Leu Val Cys Thr Ile
35 40 45
Thr Leu Ile Ile Leu Arg Ile Leu Gly Tyr Ala Lys Phe Arg Ser Leu
50 55 60
Asn Lys Thr Asp Ala Lys Asn Trp Phe Pro Ile Ser Phe Leu Leu Val
65 70 75 80
Leu Met Ile Tyr Thr Ser Ser Lys Ala Leu Gln Tyr Leu Ala Val Pro
85 90 95
Ile Tyr Thr Ile Phe Lys Asn Leu Thr.Ile Ile Leu Ile Ala Tyr Gly
100 105 110
Glu Val Leu Phe Phe Gly Gly Ser Val Thr Ser Met Glu Leu Ser Ser
115 120 125
Phe Leu Leu Met Val Leu Ser Ser Val Val Ala Thr Trp Gly Asp Gln
130 135 140
Gln Ala Val Ala Ala Lys Ala Ala Ser Leu Ala Glu Gly Ala Ala Gly
145 150 155
160
Ala Val Ala Ser Phe Asn Pro Gly Tyr Phe Trp Met Phe Thr Asn Cys
7
CA 02339338 2001-02-06
WO 00!09550 PCT/US99/18402
165 170 175
Ile Thr Ser Ala Leu Phe Val Leu Ile Met Arg Lys Arg Ile Lys Leu
180 185 190
Thr Asn Phe Lys Asp Phe Asp Thr Met Phe Tyr Asn Asn Val Leu Ala
195 200 205
Leu Pro Ile Leu Leu Leu Phe Ser Phe Cys Val Glu Asp Trp Ser Ser
210 215 220
Val Asn Leu Thr Asn Asn Phe Ser Asn Asp Ser Leu Thr Ala Met Ile
225 230 235
240
Ile Ser Gly Val Ala Ser Val Gly Ile Ser Tyr Cys Ser Gly Trp Gys
295 250 255
Val Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala Leu Asn
260 265 270
Lys Leu Pro Ile Ala Leu Ser Gly Leu Ile Phe Phe Asp Ala Pro Arg
275 280 285
Asn Phe Leu Ser Ile Leu Ser Ile Phe Ile Gly Phe Leu Ser Gly Ile
290 295 300
Ile Tyr Ala Val Ala Lys Gln Lys Lys Gln Gln Ala Gln
305 310 315
<210> 7
<211> 22
<212> PRT
<213> Candida albicans
<400> 7
Trp Cys Val Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala
1 5 10 15
Leu Asn Lys Leu Pro Ile
<2I0> 8
<211> 22
<212> PRT
8
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
<213> Candida albicans
<400> 8
Trp Cys Val Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Asp
1 5 10 15
Leu Asn Lys Leu Pro Ile
<210> 9
<211> 31
<212> PRT
<213> Saccharomyces cerevisiae
<400> 9
Trp Cys Val Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala
1 5 10 15
Leu Asn Lys Leu Pro Ile Ala Leu Ser Gly Leu Ile Phe Phe Asp
20 25 30
<210> 10
<211> 31
<212> PRT
<213> Leishmania donovani
<400> 10
Trp Cys Met Ser Ile Thr Ser Pro Thr Thr Met Ser Val Val Gly Ser
1 5 10 15
Leu Asn Lys Ile Pro Leu Thr Phe Leu Gly Met Leu Val Phe His
20 25 30
<210> 11
<211> 31
<212> PRT
<213> Candida albicans
<400> 11
Trp Cys Val Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala
1 5 10 15
9
CA 02339338 2001-02-06
WO 00!09550 PCT/US99/18402
Leu Asn Lys Leu Pro Ile Ala Leu Ser Gly Leu Ile Phe Phe Glu
20 25 30
<210> 12
<211> 31
<212> PRT
<213> Arabidopsis thaliana
<400> 12
Trp Phe Leu His Gln Thr Gly Ala Thr Thr Tyr Ser Leu Val Gly Ser
1 5 10 15
Leu Asn Lys Ile Pro Leu Ser Ile Ala Gly Ile Val Leu Phe Asn
20 25 30
<210> 13
<211> 31
<212> PRT
<213> Zea mays
<400> 13
Trp Phe Leu His Gln Ser Arg Ala Thr Thr Tyr Ser Leu Leu Gly Ser
1 5 10 15
Leu Asn Lys Ile Pro Leu Ser Ile Ala Gly Ile Leu Leu Phe Lys
20 25 30
<210> 14
<211> 31
<212> PRT
<213> Saccharomyces cerevisiae
<400> 14
Trp Cys Val Arg Val Thr Ser Ser Thr Thr Tyr Ser Met Val Gly Ala
1 5 10 15
Leu Asn Lys Leu Pro Ile Ala Leu Ala Gly Leu Val Phe Phe Asp
20 25 30
<210> 15
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
<211> 31
<212> PRT
<213> Schizosaccharomyces pombe
<400> 15
Ala Leu Gly Ala Glu Thr Ser Ala Leu Thr Val Ser Val Val Leu Asn
1 5 10 15
Val Arg Lys Phe Val Ser Leu Cys Leu Ser Leu Tle Leu Phe Glu
20 25 30
<210> 16
<211> 31
<212> PRT
<213> Schizosaccharomyces pombe
<400> 16
Phe Thr Leu Glu Lys Phe Gly Ser Ile Thr Leu Val Thr Ile Thr Leu
1 5 10 15
Thr Arg Lys Ile Phe Thr Met Leu Leu Ser Val Phe His Phe His
20 25 30
<210> 17
<211> 31
<212> PRT
<213> Kluyveromyces marxianus
<400> 17
Met Leu Ala Ser Asn Thr Asp Ala Leu Thr Leu Ser Val Val Leu Leu
1 5 10 15
Val Arg Lys Phe Val Ser Leu Leu Leu Ser Val Tyr Ile Tyr Lys
20 25 30
<210> 18
<211> 31
<212> PRT
<213> Saccharomyces cerevisiae
<400> 18
Ile Leu Ala Ser Lys Thr Asn Ala Leu Thr Leu Ser Ile Thr Leu Leu
11
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
1 5 10 15
Val Arg Lys Phe Ile Ser Leu Leu Leu Ser Val Arg Leu Phe Asp
20 25 30
<210> 19
<211> 31
<212> PRT
<213> Caenorhabditis elegans
<400> 19
Met Leu Ser Ala Val Thr Thr Ser Leu Asn Val Thr Met Val Leu Thr
1 5 10 15
Leu Arg Lys Phe Phe Ser Leu Leu Ile Ser Phe Ile Val Phe Glu
20 25 30
<210> 20
<211> 31
<212> PRT
<213> Homo sapiens
<400> 20
Met Thr Val Val Tyr Phe Gly Pro Leu Thr Cys Ser Ile Ile Thr Thr
1 5 10 15
Thr Arg Lys Phe Phe Thr Ile Leu Ala Ser Val Ile Leu Phe Ala
20 25 30
<210> 21
<211> 31
<212> PRT
<213> Saccharomyces cerevisiae
<900> 21
Tyr Thr Leu Glu Gln Phe Gly Ser Leu Val Leu Ile Met Ile Thr Val
1 5 10 15
Thr Arg Lys Met Val Ser Met Ile Leu Ser Ile Ile Val Phe Gly
20 25 30
12
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
<210> 22 -
<211> 31
<212> PRT
<213> Arabidopsis thaliana
<400> 22
Ser Leu Ile Ala Leu Phe Gly Ala Ala Thr Thr Ala Leu Ile Thr Thr
1 5 10 15
Ala Arg Lys Gly Val Thr Leu Leu Leu Ser Tyr Leu Ile Phe Thr
20 25 30
<210> 23
<211> 30
<212> PRT
<213> ARTIFICIAL SEQUENCE
<220>
<223> Xaa at position 16 is Ala or Ser; Xaa at position
20 and 21 is Leu or Ile; Xaa at position 2-5, 7-8,
14, 22-25, 27-29 and 31 is one of any naturally
occurring amino acid
<400> 23
Trp Xaa Xaa Xaa Xaa Thr Xaa Thr Thr Tyr Ser Xaa Val Gly Xaa Leu
1 5 10 15
Asn Lys Xaa Pro Xaa Xaa Xaa Xaa Gly Xaa Xaa Xaa Phe Xaa
20 25 30
<210> 24
<211> 31
<212> PRT
<213> ARTIFICIAL SEQUENCE
<220>
<223> Xaa is one of any naturally occurring amino acid
<400> 24
Xaa Leu Xaa Xaa Xaa Thr Xaa Xaa Leu Thr Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
Xaa Arg Lys Phe Xaa Ser Leu Leu Leu.Ser Xaa Xaa Xaa Phe Xaa
13
CA 02339338 2001-02-06
WO 00/09550 PCT/US99/18402
20 25 30
<210> 25
<211> 21
<212> DNA
<213> Candida albicans
<900> 25
cgtaatgaat cgcaatatac g 21
<210> 26
<211> 21
<212> DNA
<213> Candida albicans
<400> 26
ttgcattaga tgcctctata a 21
<210> 27
<211> 10
<212> PRT
<213> Candida albicans
<400> 27
Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu
1 5 10
19
