Note: Descriptions are shown in the official language in which they were submitted.
CA 02342957 2001-03-14
REGULATORY PROTEIN FROM HUMAN KERATINOCYTES
Description
The invention relates to an isolated polypeptide that is
identical or similar (i.e., the same in function and
effect) to a protein that occurs naturally in human
keratinocytes and is increasingly expressed when the
keratinocytes are in an activated state. It also relates to
an isolated nucleic acid, which codE:s a polypeptide or
protein typical for human keratinocyte;s, and to the use of
this polypeptide and this nucleic acid for detection, in
particular diagnostic, and/or therapeutic purposes, and the
use of reagents, in particular recombinant vector molecules
and antibodies against such molecules.
Based on prior art as currently exists, essentially
pharmaceuticals with a broad range of action are used in
skin treatment to influence epidermal disturbances, e.g.,
autoimmune dermatoses "Pemphigus vulgaris" and "Bullous
Pemphigoid", including locally or systemically applied
glucocorticoids, vitamin A aucid derivatives,
antimetabolites and cytostatics, or more or less non-
specific measures are used in treatment, such as "dye
therapy" or "light therapy". However, the disadvantage to
all known agents or measures is that they are not very
specific, and hence of course bring about numerous side
effects.
The preparation of more specific agents has thus far been
unsuccessful due to a basic problem that has persisted in
dermatology for a long time, namely that the number of
cellular target molecules (target structures, targets)
which might serve as a point of attack for exerting a
(specific) influence on cellular metabolism, in particular
from a medical or even cosmetic standpoint, is narrowly
restricted in epidermal keratinocytes.
CA 02342957 2001-03-14
1 s z, ,
- 2 -
Therefore, the object of this invention is to provide new
target structures in epidermal keratino cytes that can serve
as a point of attack for diagnostic, therapeutic and
cosmetic agents, or generally for :influencing cellular
metabolism.
One solution to this object involves preparing a protein of
the kind mentioned at the outset, which is upwardly
adjusted given activated keratinocytes, i.e., increasingly
expressed or produced, and kept at a higher concentration
level, and which has the amino acid sequence indicated in
either the SEQ ID N0:2 sequence protocc>1 or the SEQ ID N0:3
sequence protocol, or an allel or derivative obtained
through amino acid substitution, deletion, insertion or
inversion from one of these two amino acid sequences. In
the following, the polypeptide with the SEQ ID N0:2 or SEQ
ID N0:3 amino acid sequence shall also be referred to as
protein pKe#122.
Another solution to this object involves preparing an
isolated nucleic acid that codes a protein, which is
identical or similar to a protein that occurs naturally in
human keratinocytes and is increasingly expressed when the
keratinocytes are in an activated state, and which has the
nucleotide sequence indicated in either the SEQ ID N0:1
sequence protocol or the SEQ ID N0:4 sequence protocol, or
a nucleotide sequence complementary to one of these two, or
a partial sequence of one of these two indicated or
complementary nucleotide sequences, or a nucleotide
sequence that hybridizes wholly or in part with one of
these aforementioned nucleotide sequences, wherein "U" can
take the place of "T" in these two sequence protocols. This
group of nucleic acids or nucleotide sequences according to
the invention also includes in particular splice variants
and sense or antisense oligonucleotides, which hybridize
with the nucleotide sequence indicated in the SEQ ID N0:1
sequence protocol or the SEQ ID N0:4 sequence protocol,
CA 02342957 2001-03-14
T
- 3 -
preferably identical or complementary to at least one of
these two.
As a result, the invention also encompasses proteins or
polypeptides of the kind mentioned at the outset, which
have an amino acid sequence that results from such a splice
variant, in particular the splice variant of an mRNA, which
is identical or complementary to the nucleotide sequence
indicated in the SEQ ID NO:1 sequence protocol or the SEQ
ID N0:4 sequence protocol.
The sense or antisense oligonucleotides according to the
invention encompass at least 6, preferably 8 to 25
nucleotides.
The term "hybridized" relates to the hybridization
procedures known in the art under conventional, in
particular also under highly stringent hybridization
conditions. The expert selects the specific hybridization
parameters based on the used nucleotide sequence and his or
her general technical knowledge (compare: Current Protocols
in Molecular Biology, Vol. 1, 1997, John Wiley & Sons Inc.,
Suppl. 37, Chapter 4.9.14).
The nucleic acids) according to th~~ invention can be
obtained from both a natural source or synthetically or
semi-synthetically. Its presentation a:> cDNA has proven to
be particularly effective in practice.
The polypeptide that has the amino acid sequence according
to SEQ ID N0:2 or SEQ ID N0:3 and is coded by the nucleic
acid indicated in the SEQ ID N0:1 sequf~nce protocol or the
SEQ ID N0:4 sequence protocol, and that is referred to as
protein pKe#122 below, is upwardly adjusted in human
epidermal keratinocytes, namely increasingly expressed
(produced) and kept at a significantly :higher concentration
level in comparison to the initial state if these cells are
CA 02342957 2001-03-14
r
,.
- 4
in the "activated" state, i.e., in a si~ate of proliferation
and/or migration, among others, e.g., after an accidental
skin injury or given an autoimmunologically induced bullous
dermatoses "Pemphigus vulgaris" (triggered by
autoantibodies against desmosomes) and "Bullous Pemphigoid"
(triggered by autoantibodies against hemidesmosomes). The
activated state of the human epidermal keratinocytes is
also manifested in an elevated expression of known
activation markers uPA (urokinase-type plasminogen
activator) and uPA-R (receptor for urokinase-type
plasminogen activator) relative to the resting state
(initial state), and can be qualitatively and
quantitatively detected based on these markers. (compare:
Schafer B.M., Reinartz J., Bechtel M.~J., Inndorf S., Lang
E., and Kramer M. D., 1996: Disease mediated basal
detachment of cultured keratinocytes induces urokinase-type
plasminogen activator (uPA) and its receptor (uPA-R, CD87) ,
Exp. Cell Res. 228, pp. 246-253).
Protein pKe#122 has a serine/threonine-kinase motif,
several (four) tyrosine kinase phosphorylation motifs and a
kinase domain with an ATP binding site. It is obviously
involved in signal transduction processes, very probably
has a serine/threonine-kinase function, and plays a
presumed role in the formation of cell-cell and/or cell-
matrix connections, and/or of desmosomes and/or
hemidesmosomes.
It is known in prior art that serine/threonine-kinases
influence the function of cell-cell and cell-matrix
contacts in keratinocytes. S. Bl.um and coauthors
demonstrated that the localization of specific cell contact
molecules of the Zonula adhaerens can be influenced by
activating or inactivating the "protein kinase C (PKC)"-
type serine/threonine-kinase (compare Blum S., Ness W.,
Petrow W., Achenbach F., 1994: Loca~:ization of protein
kinase C in primary cultures of human keratinocytes in
CA 02342957 2001-03-14
- 5 -
relation to cell contact proteins. Cell Sig.6:157-165). In
addition, M. Serres and coauthors showed that treating
keratinocytes in a cell culture (HaCaT cells) with the
serine/threonine-phosphatase inhibitors okadaic acid,
calyculin and PefablocTM results in a loss of cell-cell
connections on the one hand, and in an increased
serine/threonine phosphorylation of the linker protein I3-
catenine involved in cellular adhesion (compare Serres M.,
Grangeasse C., Haftek M., Durocher Y.,, Duclos B., Schmitt
D., 1997: Hyperphosphorylation of l3-Catenin on serine-
threonine residues and loss of cell-cell-contacts induced
by calyculin A and okadaic acid in human epidermal cells.
Exp. Cell. Res. 231: 163-172). These in-vitro findings were
confirmed on epidermal keratinocytes of explanted human
skin: a clear disruption of epidermal c:ell/cell connections
with acantholysis occurred after the a~>plication of okadaic
acid (2 ~,M, 24 hours). Neither PKC: activators (e. g.,
bryostatin-1 or TPA=PMA=phorbol myristate acetate) and PKC
inhibitors (sphingosine, staurosporine, chelerythreine,
H7=1-(5-isoquinolinylsulfonyl)-2-methylpiperazine) nor
inhibitors or activators of protein kinase A (PKA), nor
tyrosine-kinase and phosphatase inhibitors or less specific
phosphatase inhibitors had such an effect on the cells.
Serine/threonine kinases also play an important role in the
formation of hemidesmosomes (compare M<~iniero F., Pepe A.,
Wary K.K., Spinardi L., Mohammadi M., Schlessinger J.
Giancotti F.G., 1995: Signal transduction by the
alpha6beta4 integrin: distinct beta4 subunit sites mediate
recruitment of Shc/Grb2 and association raith the
cytoskeleton of hemidesmosomes. EMBO J. 14:4470-4481).
The isolated preparation of protein pKe#122, namely the
description of nucleotide sequences that code this protein,
and the indication of (one of) its amino acid sequences)
make it possible to exert a targeted influence on the
metabolism of physiologically active or activated
CA 02342957 2001-03-14
3 y
a, 1
- 6 -
keratinocytes, and of course of other cells that express
protein pKe#122, in particular for purposes of medical and
cosmetic therapy.
The invention also relates to recombinant DNS vector
molecules, which encompass a nucleic acid according to the
invention, and which have the ability to express a protein
that occurs in human keratinocytes and is increasingly
expressed when the keratinocytes are in an activated state,
in particular protein pKe#122, in a prokaryotic or
eukaryotic cell. The DNS vector molecules preferably
involve the plasmid pUEX-1 and/or i~he plasmid pGEX-2T
and/or the plasmid pBK-CMV and/or the plasmid pHR 2 (a
derivative of Bluescript KS [Strategene, Heidelberg],
contains the human keratin-14 promotor), since these
vectors have proven to be highly suitable in practice.
While the eukaryotic cell includes in particular cells from
cell cultures, e.g., COS cells, the respective cell can
also be a constituent of a living organism, e.g., a
transgenic mouse.
Therefore, the invention also encompasses transformed host
cells that contain a nucleic acid according to the
invention that is linked with an acaivatable promotor;
which is contained in these cells naturally or as the
result of recombination, and that (consequently) have the
ability to express a protein that occurs naturally in human
keratinocytes and is increasingly expressed when the
keratinocytes are in an activated state, in particular
protein pKe#122.
The invention also relates to the use: of a nucleic acid
according to the invention or a vector molecule according
to the invention to manufacture transgenic mammals, in
particular mice or rats.
CA 02342957 2001-03-14
s ,
The transfectants according to the invention open up an
opportunity for research and development work aimed at
further clarifying the protein pKe#122-induced changes in
cell morphology and cellular base functions such as
proliferation, adhesion, migration,and. differentiation, in
particular with an eye toward answering the question as to
whether protein pKe#122 itself possesses a "pathogenic"
activity.
The object of this invention also relates to a reagent for
the indirect detection of a protein that is encountered in
human keratinocytes and increasingly expressed when the
keratinocytes are in an activated state, in particular
protein pKe#122, wherein this reagent is characterized by
the fact that it encompasses at least one nucleic acid
according to the invention. In this context, "for the
indirect detection" implies that the protein-coding mRNA is
actually directly detected, and hence the protein is only
indirectly detected (by means of this m.RNA).
Protein pKe#122 and the polypeptides related thereto, i.e.,
to the amino acid sequence indicated in the SEQ ID N0:2
sequence protocol or SEQ ID N0:3 sequence protocol,
specifically the polypeptides that can. be derived through
substitution, deletion, insertion and/or inversion from one
of these amino acid sequences according to SEQ ID N0:2 or
SEQ ID N0:3, or that have an amino acid sequence resulting
from a splice variant of an mRNA, which is identical or
complementary to the nucleotide sequence indicated in the
SEQ ID N0:1 sequence protocol or the ~~EQ ID N0:4 sequence
protocol, or to a partial sequence of these nucleotide
sequences, or at least hybridized, offer numerous
applications in the area of dermatological research and
development. In particular, antibodies can be developed
against these polypeptides or proteins,, which then can be
correspondingly modified for use either as diagnostic or
CA 02342957 2001-03-14
r
_ 8 _
therapeutic agents, or as cosmetic agents
("cosmeceuticals").
Consequently, the invention also encompasses the use of
such a protein or polypeptide for manufacturing a
(monoclonal, polyclonal or recombinant) antibody against
this polypeptide, the aforementioned antibody itself, and
also its use for the diagnostic and/or therapeutic
treatment of dermatological diseases, for the cosmetic
treatment of the epidermis, and for the diagnostic,
therapeutic and/or cosmetic treatment of other tissues or
organs that express protein pKe#122.
According to more recent scientific knc>wledge, sense and/or
antisense oligonucleotides are also possible as active
agents for pharmacotherapy (compare G. Hartmann et al.
1998: Antisense 0ligonucleotides, Deutsches Arzteblatt 95,
Issue 24, C1115-C1119), and also as active agents with a
fundamentally new operating principle in pharmacotherapy.
Therefore, the present invention also relates to the use of
sense or antisense oligonucleotides according to the
invention for diagnostic and/or therapeutic treatment, in
particular of dermatological diseases, or for the cosmetic
treatment in particular of the epidermis.
One technically and economically _Lmportant potential
application for a polypeptide according to the invention or
a nucleic acid according to the invention also involves not
least the fact that such a molecule can be used in a
screening procedure to isolate materials from a very high
number of provided materials that specifically bind to the
respective nucleic acid or respective polypeptide. These
substances can then serve as the parent material (lead
structure) for the development of substances for use in
pharmacology, and hence offer the pre conditions for the
development of alternative pharmaceuticals for diagnosis
CA 02342957 2001-03-14
- 9 -
and therapy, in particular with respect to the
dermatological diseases mentioned at the outset.
In this regard, the invention also relates to the
application of a polypeptide according to the invention or
a nucleic acid according to the invention for identifying
substances that can be used in pharmacology, which bind to
the polypeptide or nucleic acid, thereby influencing
its/their function and/or expression, in particular
exerting an inhibiting or activating effect.
The invention will be explained in greater detail below
based on manufacturing and application examples.
Example l: Manufacture of Protein pKe#122
A) Extraction or Manufacture of a Polynucleotide that Codes
Protein pKe#122
The polynucleotide source consisted of human epidermal
keratinocytes of a cell culture or cell culture model
described extensively in the publication of Schafer B.M.,
Reinartz J. , Bechtel M. J. , Inndorf S. , Lang E. , and Kramer
M. D., 1996: Disease mediated basal detachment of cultured
keratinocytes induces urokinase-type p.lasminogen activator
(uPA) and its receptor (uPA-R, CD87) , Exp. Cell Res. 228,
pp. 246-253. Reference is hereby made expressly to the
content of this publication. This cell culture or cell
culture model is characterized by the fact that it makes it
possible to convert keratinocytes from the resting [uPA
/uPA-R ] to the activated [uPA+/uPA-R+] state through
enzymatic disruption of the cell/matrix contacts, i.e.,
disease-induced detachment of the ker~atinocytes from the
culture matrix. The induction of the activated state is
reversible: the (renewed) formation of a confluent (=grown
to maximal density), multilayered cell <~ggregate consisting
of differentiated keratinocytes results in the downward
CA 02342957 2001-03-14
- 10 -
adjustment of uPA and uPA-R, i.e., the slowing of
production and setting to a lower concentration level (see
the publication of Schafer B.M., Stark: H.J., Fusenig N.E.,
Rodd R.F., Kramer M.D., 1996 Differential expression of
urokinase-type plasminogen activator (uPA) , its receptor
(uPA-R) , and inhibitor type-2 (PAI-2) during
differentiation of keratinocytes in an organotypic
coculture system, Exp. Cell Res. 220:415-423).
Cells in this cell culture or cell culture model shall also
be referred to as NHEK below (="normal human epidermal
keratinocytes").
The following measures were implemented for preparing the
cell culture or cell culture model: Human epidermal
keratinocytes obtained from a skin biopsy were trypsinated
overnight at 4°C and then cultivated in Petri dishes or 175
cm2 culture flasks according to the "feeder-layer"
technique of J.G. Rheinwald and H. Green (1975, Cell 6,
331-334) for a duration of 8 days in Dulbecco's modified
Eagle's Medium (DMEM) with a content of 100 (vol./vol.)
fetal calf serum (FCS) and added adenine hemisulfate,
insulin, transferrin, triiodothyronine, hydrocortisone,
Forskolin, epidermal growth factor (EGF) and antibiotics
(penicillin, streptomycin and gentamycin) under
differentiation conditions, namely elevated calcium levels
(37 °C, 7o C02). Therefore, cultivation took place under
conventional conditions common in prior art. Under these
conditions, keratinocytes form confluent two to three-layer
"epidermis equivalents", or keratinocyte "sheets".
These epidermis equivalents or keratinocyte sheets were
detached from the culture matrix in a 30-minute treatment
with disease II (2.4 mg/ml in DMEM without FCS), washed
twice in DMEM and then incubated in complete, conditioned
DMEM for a duration of 4 or 8 hours. Incubation in
conditioned DMEM took place to preclude the influence of
CA 02342957 2001-03-14
i
r r
- 11 -
fresh FCS. During incubation, the expression of known
activation markers uPA and uPA-R was upwardly adjusted in
these floating keratinocyte sheets, as was protein pKe#122
described for the first time herein. The uPA/uPA-R upward
adjustment could be detected by means of known techniques,
such as enzyme linked immunosorbent a~~say (ELISA), in-situ
hybridization and immune fluorescence. The entire RNA was
extracted from the incubated cells ("'RNA-Clean" kit, AGS
company in Heidelberg) using the guanidinium-thiocyanate-
phenol-chloroform extraction method known in the art
(compare Chromczynski P. and Sacchi N., 1986: Single-step
method of RNA isolation by acid guanidinium thiocyanate-
phenol-chloroform extraction. Anal. Biochem. 162:156-159).
The mRNA was isolated from the entire RNA through binding
on poly-T coated beads. This mRNA was used as the starting
material for the ensuing step of subtraction cloning.
mRNA was isolated from adherent keratir~ocyte sheets for use
in control tests or for comparison preparations,
specifically according to the same procedural pattern
described above, except that a disease inhibitor, e.g.,
phosporamidone (100 ~.g/ml), was additionally applied to the
disease for the duration of disease treatment.
The principle of subtraction cloning w<~s used to establish
a gene bank, which preferably contained cDNA of the
dyshesion-induced gene, i.e., of those genes that were
increasingly expressed after detachment of the keratinocyte
sheets in the latter (or their cells). To this end, the
mRNA obtained from the cells of the adherent keratinocyte
sheets was again bound to poly-T coated beads, rewritten
into single-strand cDNA on the latter, and then hybridized
against the mRNA of detached, i.e., non-adherent
keratinocyte sheets. Those mRNA molecules that were
expressed only in the non-adherent state, i.e., after
dyshesion, and hence found no hybridization partner,
CA 02342957 2001-03-14
c
- 12 -
remained behind as a supernatant . They were rewritten into
cDNA and cloned in cloning vector pUEX--1.
For purposes of verification, the resultant gene bank was
then also subjected to a southernblot procedure with [32P]-
marked cDNA of adherent and non-adherent keratinocyte
sheets. Those cDNA, or rather the host cell clones
containing them, here the E. coli strain MC1061, which
exhibited a distinct upward adjustment after dyshesion,
were subsequently cultivated or multiplied overnight at 30°
C under conventional culture conditions. The plasmid DNA
(pUEXl-cDNA) were prepared from these E. coli clones. The
cDNA fragments were cut out of the pLJEXl vector and were
[3zp]-marked by means of random priming. The marked cDNA
was used as a probe in northernblots with RNA from adherent
and non-adherent keratinocyte sheets. The clones containing
cDNA, which revealed no or only a slight signal with the
RNA of adherent keratinocytes when used as a probe in the
northernblot procedure, but exhibited. a distinct signal
with RNA of non-adherent keratinocytes;, were selected for
the ensuing step of sequencing.
While sequencing the respective clone; by means of "non-
radioactive cycle sequencing", which is a modification of
the sequencing method according to Sanger and has in the
meantime become a common method in prior art, the gene with
the nucleotide sequence according to SEQ ID N0:1 and DEQ ID
N0:4 was found. This gene and the accompanying protein were
designated pKe#122. More detailed analyses of the mRNA that
belongs to gene pKe#122, i.e., is pKe#122-specific (from
dissolved, i.e., non-adherent ker.atinocyte sheets),
provided information as to the fact that this mRNA has a
size of roughly 4.8 kb, and exhibits an upward regulation
after disease-induced detachment. Fig. 1 shows the results
of a northernblot, which was performed with mRNA from
keratinocyte sheets (a) immediately after or (b) four hours
after disease-induced detachment and with [32P]-marked
CA 02342957 2001-03-14
- 13 -
pKe#122 cDNA. This result indicates that little pKe#122
mRNA was present, or at least detectab_Le, immediately after
detachment, while large quantities were present four hours
later (a broad, color-intensive band), namely in the
molecular weight zone of about 4.8 kb.
The nucleotide sequence of the pKe#1.22 gene has a stop
codon at the 3' end at position 2373-2375 according to SEQ
ID N0:1, and hence at position 2472-2474 according to SEQ
ID N0:4, which stipulates the probable location of the
transcription end, and which is followed by a sequence very
similar to the "polyadenylation site" (AATAAA), namely
AATAA, exactly 28 nucleic acids before the poly-A site.
As a result with respect to the overall structure of the
pKe#122 gene, or in general of a polynucleotide that codes
for protein pKe#122, we find that this gene or
polynucleotide has the nucleotide sequence indicated in the
SEQ IN N0:1 sequence protocol or the SEQ IN N0:4 sequence
protocol, or a partial sequence of one of these two
nucleotide sequences, or encompasses a nucleotide sequence
or consists of one that is complementary to one of these
indicated nucleotide sequences or one of their partial
sequences, or that this gene or polynucleotide is wholly or
partially hybridized with the nucleotide sequence indicated
in the SEQ ID NO:l sequence protocol or the SEQ ID N0:4
sequence protocol or with a partial sequence of one of
these two nucleotide sequences, or with a sequence
complementary to these indicated nucleotide sequences or
their partial sequences, wherein "U" can take the place of
"T" in the SEQ ID NO:1 and SEQ ID N0:4 sequence protocols,
and that an mRNA corresponding or homologous to a cDNA of
approx. 4.8 kb is read from this gene o:r polynucleotide.
CA 02342957 2001-03-14
a
- 14 -
B) Derivation of the Amino Acid Sequence and
Characterization of the pKe#122 Protein based on the
polynucleotide coded for this urpose (pKe#122 gene)
Based on the genetic code and using a computer-assisted
procedure (program: HUSAR - Heidelberg Unix Sequence
Analysis Resources, Version 4.0, 'German Cancer Research
Center, Heidelberg, 1997), an amino acid sequence indicated
in the SEQ ID N0:2 and/or SEQ ID N0:3 :sequence protocol was
derived from the nucleotide sequence according to the SEQ
ID N0:1 and SEQ ID N0:4 sequence protocol. A structural
analysis of these amino acid sequences according to the SEQ
ID N0:2 and SEQ ID N0:3 sequence protocol with this very
program yielded the following informat:ion, which is valid
for both amino acid sequences:
- the amino acid sequence from position 40 to 63
(LGKGNFAVVKLARHRVTK TQVAIK) according to SEQ ID N0:2, and
consequently from position 73 to 96 according to SEQ ID
N0:3 corresponds to known protein kinase motifs with ATP
binding site,
- the amino acid sequence from poaition 152, to 164
(IVHRDLKTENLLL) according to SEQ ID N0:2, and
consequently from position 185 to 197 according to SEQ ID
N0:3 corresponds to known serine/threonine protein kinase
motifs,
- the amino acid sequences from position 238 to 240 (TLR),
from position 475 to 477 (TGR), from position 485 to 487
(STR) and from position 600 to 603 (TTR) according to
SEQ ID N0:2 and from position 271 to 273 (TLR), from
position 508 to 510 (TGR), from position 518 to 520 (STR)
and from position 633 to 635 (TTR) according to SEQ ID
N0:3 correspond to known phosphor°ylation sites for
protein kinase C,
- the amino acid sequence from po~~ition 138 to 156
(WQILSAVEYCHDHHIVHRD) according to SEQ ID N0:2 and
consequently from position 171 to 189 according to SEQ ID
N0:3 represents the pKe#122-1 peptide, against which the
CA 02342957 2001-03-14
- 15 -
anti-peptide antibody "anti-pKe#122-1" was produced in a
rabbit (compare Example 2),
- the amino acid sequence from position 481 to 499
(LAEVSTRLSPLTAPCIVVS) according to SEQ ID N0:2 and
consequently from position 514 to 532 according to SEQ ID
N0:3 represents the pKe#122-2 peptide, against which the
anti-peptide antibody "anti-pKe#122-2" was produced in a
rabbit (compare Example 2).
- the amino acid sequence from position 339 to 352
(NHFAAIYYLLLERL) according to SEQ ID N0:2 and
consequently from position 372 to 38-'i according to SEQ ID
N0:3 represents the pKe#122-3 peptide, against which the
anti-peptide antibody "anti-pKe#122-3" was produced in a
rabbit (compare Example 2).
- the amino acid sequence from position 614 to 625
(GLARQVCQVPAS) according to SEQ ID N0:2 and consequently
from position 647 to 658 according to SEQ ID N0:3
represents the pKe#122-4 peptide, against which the anti-
peptide antibody "anti-pKe#122-4" was produced in a
rabbit (compare Example 2).
In Fig. 2 (for SEQ ID N0:2 ) and Fig. 14 (for SEQ ID N0:3),
these structural data for protein pKe#122 are shown
diagrammatically. Fig. 2A and Fig. 14A show the protein
kinase motif with ATP binding sites, the serine/threonine
protein kinase motif and the four phosphorylation sites for
protein kinase C, while Fig. 2B and Fig. 14B show the
sequence segments against which anti-peptide antibodies
were produced in rabbits.
Example 2: Use of the Amino Acid SequE=nce of the pKe#122
Protein for the Manufacture of Polyclonal Anti-
Peptide Antibodies
A computer-assisted antigenicity analysis was performed
using the computer program mentioned in Example 1 to select
areas from the amino acid sequence according to SEQ ID N0:2
CA 02342957 2001-03-14
- 16 -
that appeared suitable for the production of polyclonal
anti-peptide antibodies. These areas were synthesized
according to the known "multip:le-antigenic-peptide"
procedure (compare: Posnett D.N., Tam J.P., 1989: Multiple
antigenic peptide method for producing antipeptide site-
specific antibodies. Methods-Enzymol. 1998; 178: 739-746)
in the form of separate peptides (pKe#122-1 to -4, compare
Fig. 2) with a molecular weight of approx. 10-15 kD. These
peptides were used without the addition of a carrier
substance for the adjuvant-assisted immunization of
rabbits. The details of this peptide manufacturing
procedure and this immunization procedure are generally
known in prior art. The pre- and post-immunosera were
tested for reactivity with the respective peptides and
comparison peptides used for the immunization by means of
the generally known enzyme-linked immunosorbent assay
(ELISA). A clear immunization against ~>eptides pKe#122-l, -
122-2 and -122-4 could be detected. To purify the
polyclonal antibodies, the post-immunosera were initially
subjected to ammonium sulfate precipitation, which enriched
the IgG fraction. Immune-affinity chromatography was then
carried out with this enriched IgG fraction. To this end,
the four peptides pKe#122-1 to -4 used for immunization
were immobilized on sepharose 4B, and this peptide-
sepharose 4B conjugate was used in immune-affinity
chromatography. This resulted in three largely pure anti-
peptide IgG fractions, namely anti-peptide pKe#122-1, anti-
peptide pKe#122-2 and anti-peptide pKe:#122-4. These three
affinity-purified antibody fractions showed a clear immune
reaction with the respectively corresponding antigen
peptide. Table 1 shows these results.
The immune serum against peptide pKe#122-1, the polyclonal
antibody anti-pKe#122-l, was also used to test cell
lysates of the keratinocyte line HaCaT and keratinocyte
sheets 8 hours after detachment with disease (=non-
adherent keratinocyte sheets) in the we~sternblot procedure
CA 02342957 2001-03-14
- 17 -
for the expression of the pKe#122 protein. A band with a
molecular weight of approx. 70-85 kD was detected in both
the HaCaT cells and the cells of the detached (non-
adherent) keratinocyte sheets. The westernblot used in the
experiment is described in detail in Example 3B(2) and
depicted on Fig. 3. It exhibits a protein measuring
approx. 70-85 kD in both HaCaT cells and in the non-
adherent keratinocyte sheets.
The polyclonal anti-peptide antibody pKe#122-1 was
additionally tested in the immunoblot procedure with the
recombinant approx. 100 kD GST-pKe#k122 fusion protein
(fraction 85 in Fig. 10B) described here in Example 5. The
polyclonal anti-peptide antibody pKe#122-1 reacted with the
fusion protein. This positive reaction was confirmed by a
comparison with control tests, in which an anti-GST
antibody or normal rabbit IgG was used instead of the anti-
peptide antibody pKe#122-1. The results are presented in
Table 1 and on Fig. 4. Trace "a" o:n Fig. 4 shows the
control batch with normal goat IgG, while trace "d" on Fig.
4 shows the batch with rabbit anti-pKe#122-1.
Example 3: Use of the pKe#122 protein either against the
protein or against the mRNA of the pKe#122-oriented
reagents for detecting the activated state of human
epidermal keratinocytes
A) Used Keratinocytes
The test cells or target cells (=target. object cells) were
HaCaT cells and human epidermal keratinocytes of the cell
culture or the cell culture model (NHEK) that was
extensively described in the publication by B.M. Schafer
and coauthors'(loco citato) and is briefly summarized here
in Example 1 (A). Express reference will be made to the
content of this publication at this juncture too. In
CA 02342957 2001-03-14
- 18 -
addition, skin biopsies were analyzed :for the expression of
the pKe#122 protein.
B) Detection procedures based on thE: use of antibodies
oriented against the pKe#122 protein.
1. Immunohistology
A cryotom was used to manufacture 5 ~m thick frozen
sections of tissues from skin biopsies of clinically
unpathological, normal skin and clinically pathological,
lesional skin owing to the diseases Pemphigus vulgaris,
Bullous Pemphigoid and Psoriasis vulgaris. These are dried
at room temperature and fixed in 1000 acetone (1000
methanol, 1000 ethanol or 4% paraformaldehyde can be used
instead of acetone). The sections are then treated
according to the "blocking procedure" known in prior art to
block non-specific binding sites for t:he antibody. In this
example, two blocking steps are performed: (1) blocking
with avidin/biotin and (2) blocking with normal serum. In
the first blocking step, the avidin/biotin blocking was
performed using the avidin-biotin blocking kit from Vector
Laboratories according to the manufacturer's instructions,
i.e., incubation was performed at room temperature
initially for 15 minutes with the avidin finished solution,
and then 15 minutes with the biotin finished solution.
Subsequently, the sections were incubated with 10 vol.o
normal serum in PBS (normal serum of species from which the
second antibody originates, here goat normal serum; PBS -
phosphate buffered saline, pH 7.2-7.4) for l5.minutes at
room temperature.
After blocking, the sections in PBS are incubated for 1
hour at room temperature with a content of 5 ~g/ml anti-
peptide pKe#122-1. To remove the unf>ound antibody, the
sections are then washed in PBS with a content of 0.20
(weight/volume) bovine serum albumin. 'this is followed by
CA 02342957 2001-03-14
- 19 -
incubation, for example with a biotin-labelled antibody
from the goat against rabbit IgG (1:50() diluted in PBS/0.2o
BSA; 30 minutes at room temperature), another washing step
and the application of a streptavidin labelled with the
fluorescent dye Cy3 (1:1,000 in PBS/0.2o BSA diluted). A
fluorescent dye other than Cy3 can also be used to.mark the
streptavidin, e.g., FITC. After the last washing step, the
sections are covered with a covering agent, e.g., elvanol
or histogel, and then analyzed and evaluated under a
fluorescence microscope. Fig. 5 shows the results obtained
from an immune fluorescence detection performed in this
manner: The anti-pKe#122-1 IgG antibody Staines
keratinocytes on normal skin sections in the area of the
epidermal basal membrane zone (Fig. 5A). When dying
biopsies of lesional skin caused by the diseases Pemphigus
vulgaris (Fig. 5B), Bullous Pemphigoid (Fig. 5C) or
Psoriasis vulgaris (Fig. 5D), a distinctively strong
coloration is observed in epidermal keratinocytes, in
particular in the area of epidermal lesions. Hence, an
increased expression and evident upward adjustment of the
pKe#122 protein took place there.
2. Immunoblot ("Westernblot") and Dotblot
Fig. 3 shows the detection of the pKe#122 protein via the
westernblot procedure using anti-pKe#122-1. To this end,
cell lysates of the keratinocyte line HaCaT ("HaCaT"
samples) and keratinocyte sheets were electrophoretically
fractionated 8 hours after dispase treatment ("NHEK 8h"
samples ) in an SDS polycrylic amide gel_ . The proteins were
blotted on a nitrocellulose membrane according to a
standard procedure. To block non-specific binding sites,
incubation was performed with a 5 %w/w powdered milk/TBS
buffer. Incubation at 4°C for approx. 1.8 hours (overnight)
then was performed on the (protein) strips labeled "anti-
122-1" in a 3o powdered milk/TBS buffer with the addition
of anti-pKe#122-1 antibodies (1 ~g!ml), and on the
CA 02342957 2001-03-14
- 20 -
(protein)strips labeled "rbIgG" in a 3o powdered milk/TBS
buffer with the addition of rabbit normal IgG (1 ~g/ml).
The nitrocellulose membrane was then washed with TBS/tween
and TBS.buffer, and incubated with an enzyme-marked anti-
rabbit IgG antibody in a 3% powdered m_Llk/TBS buffer. After
renewed washing with TBS/tween anal TBS, the bound
antibodies were made visible with a peroxidase-specific
luminescence substrate (e. g., the ECL system of Amersham-
Buchler) and autoradiographically depicted. An alternative
marking with chromogenic substrates is also easily
possible.
The cellysates can also be directly blotted onto a
nitrocellulose membrane without preceding electrophoretic
fractionation and further treated as described above.
3. Enzyme-linked-immunosorbent-assay (ELISA)
Microtiter plates are coated with recombinant pKe#122/GST
fusion protein in various concentrations (10-0 ng/ml). Non-
specific binding sites are blocked via treatment with 0.1
%w/w gelatine in PBS (PBS/gelatine) . The coated wells were
then incubated with anti-pKe#122-1 IgG (1 ~g/ml) for 1 hour
at room temperature (see Fig. 6 A, closed circles). The
control batch takes place with rabbit normal IgG in the
same concentrations (see Fig. 6 A, open circles). After a
washing step with 0.05 %v/v Tween-20 in PBS (PBS/Tween) is
followed by incubation with peroxidas;e-marked goat-anti-
rabbit IgG (1:10,000 in PBS/tween). After another washing
step to remove unbound enzyme-marked antibodies, the
colorless peroxidase substrate orthophenylene diamine is
added, which is converted into a colored product by the
peroxidase. Other peroxidase substrates with sharp color
change can be used in place of orthophE:nylene diamine . The
color formation, and hence the bound antibody, is
quantified by means of an absorption measurement in a
microtiter plate photometer at 490 against 405 nm
CA 02342957 2001-03-14
- 21 -
(ordinate). Fig. 6A shows the result of such a test. It
shows that the color concentration is proportional to the
amount of pKe#122 fusion protein bound to the plate. As a
result, an unknown amount of antigen can be quantified by
comparison when using samples with known antigen
concentrations, so-called standards.
To quantify the pKe#122 protein in complex solutions, the
execution of a sandwich EZISA (Fig. kiB) is preferred. To
this end, a microtiter plate is coated with an antibody
oriented against pKe#122 (e. g., rabbit anti-pKe#122/GST
fusion protein, 1 ~g/well). The still remaining non-
specific binding sites of the microtiter plate are then
blocked with PBS/gelatins. The mi.crotiter plate is
subsequently mixed in with various concentrations of the
pKe#122/GST protein (10-0 ng/ml). After a washing step with
PBS/tween, the plate is incubated with a second peroxi.dase-
marked anti-pKe#122 antibody (e. g., peroxidase-marked
rabbit anti-pKe#122-1 (peptide) antibody) (e.g., for one
hour while shaking at room temperature). "Peroxidase" here
stands for practically any marking of the antibody, e.g.,
with enzymes, fluorescence molecules or luminescence
molecules. After an additional washing step to remove
unbound, enzyme-marked antibodies, the colorless peroxidase
substrate orthophenylene diamine is added, which is
converted into a colored product by the peroxidase
activity. The color formation is quantified by means of an
absorption measurement in a microtiter plate photometer at
490 against 405 nm (ordinate). Fig. 6B shows the result of
such a test. It shows that the color concentration is
proportional to the amount of pKe#122 bound to the plate.
As a result, the unknown quantity of :pKe#122 in a sample
can be quantified by means of this test: procedure. In this
case, the substance orthophenylene diamine stands for any
desired peroxidase substrate that detf=ctably changes its
color due to the peroxidase activity.
CA 02342957 2001-03-14
- 22 -
Instead of the polyclonal antibody ".anti-pKe#122-1" used
here as an example, use can just as well be made of
monoclonal antibodies, which are t<~rgeted against the
protein pKe#122, namely both in the simple ELISA (=enzyme
linked immunosorbent assay) and in the sandwich ELISA.
Example 4: Detection of pKe#122-specific mRNA in cells via
reverse polymerase chain reaction
The polymerase chain reaction (PCR) was used to detect
pKe#122-specific RNA in cells of kerati.nocyte sheets (NHEK)
after disease treatment and in HaCaT cells. To this end,
RNA was isolated from cells of kerati:r~ocyte sheets (NHEK)
after disease treatment and incubation times of varying
length, and from HaCaT cells using standard methods
(guanidinium-thiocyanate-phenol-chloroform extraction
method, see also Example lA) and rewritten to cDNA~
according to standard methods. This cDNA was subjected to a
PCR, during which a partial fragment of X350 kb was
amplified from the pKe#122-specific cDNA. A combination of
the primers "pKe#122-forward 3" (tgagcaggcgctgggtatcatgcag)
and "pKe#122-reverse 2" (tcaccgggaac<~agaagggccacct) was
used as the primer pair. 10 ng of cDNA were mixed with 10
M of primer along with a mixture of heat-stable DNA
polymerase, ATP, TTP, GTP, CTP and poly:.merase buffer (e. g.,
compare: Current protocols in Moleculz3r Biology, Vol. 1,
1997, John Wiley & Sons. Inc, Suppl. 37, Chapter 15), in
this example in the form of the commercially available,
ready-to-use "PCR master mix" from Clontech. Tn addition,
the following control tests were performed: 1. The batch
described above with the plasmid pUEX-1./pKe#122 instead of
the cDNA; 2. The kit-internal positive control; 3. The
reaction batch described above without added cDNA (negative
control 1); 4. The batch described above with cDNA from
cells of keratinocyte sheets (NHEK) 2 hours after disease
treatment, without adding primers (negat:ive control 2). The
reaction product s of the PCR reaction were
CA 02342957 2001-03-14
- 23 -
electrophoretically fractionated in agarose gel. Fig. 7
shows the results of this fractionation. The following
applies: Trace 1 - molecular weight marker; Trace 2 - NHEK
T0; Trace 3 - NHEK T2; Trace 4 - NHEK T4; Trace 5 - NHEK
T8; Trace 6 - HaCaT; Trace 7 - free; Trace 8 - positive
control (pUEX-l; with pKe#122 as the insert); Trace 9 -
negative control (batch with cDNA without primer); Trace
= kit-specific positive control for functional check of
PCR ; Trace 11 = negative control (batch with primer without
cDNA); Trace 12 = molecular weight marker. A PCR product of
the expected size of ~ 350 kb was detected in traces 3, 4,
5, 6 and 8, meaning that pKe#122-specific mRNA was detected
in cells of keratinocyte sheets at time 2 (T2), 4 (T4) and
8 (T8) hours after disease-induced detachment, and also in
HaCaT cells.
This technique makes it possible to detect the pKe#122
expression even in cases where the pKe#122 protein cannot
be detected owing to excessively low expression levels by
means of immune histological methods, the ELISA, dotblot or
westernblot procedures.
Example 5: Manufacture of vector molecules with the ability
to express the protein pKe#122 in prokaryotic or
eukaryotic cells
Two approaches were taken to manufact=ure or express the
recombinant pKe#122 protein. In the first, two pKe#122
glutathion-S-transferase (GST) fusion proteins,
pKe#122/GST-I and pKe#122/GST-II (vector pGEX; see Fig. 8)
were manufactured in bacteria (E. coli DHSa) for purposes
of expression. In the second, a pKe#122 FLAG fusion protein
(vector pBK-CMV; see Fig. 9) was manufactured in eukaryotic
cells (Cells-cells) for purposes of expression.
The pKe#122-gluthathion-S-transferase (GST) fusion proteins
were expressed in E. coli (DHSa) through IPTG induction.
CA 02342957 2001-03-14
- 24 -
After induction, the bacterial lysate was analyzed in a
westernblot with anti-GST antibodies, specifically in
comparison to pKe#122-gluthathion-~S-tansferase (GST)
vector-carrying, non-induced bacteria lysate, and to lysate
of bacteria that expressed only GST. The product of this
westernblot is shown on Fig. 10A: Trace (a) shows the
control transfectant (GST without insert) before IPTG
induction, trace (b) shows the control transfectant (GST
without insert) after IPTG induction, trace (c) shows
pKe#122/GST-I before IPTG induction, trace (d) shows
pKe#122/GST-I after IPTG induction, trace (e) shows
pKe#122/GST-II before IPTG induction, and trace (f) shows
pKe#122/GST-II after IPTG induction.
As evident from the figure, a mixture of GST-positive bands
varying in size could be detected, namely exclusively after
IPTG induction. The highest molecular :band had a molecular
weight of approx. 100 kD (fraction 85), the lowest
molecular band of approx. 26 kD, which corresponds to the
molecular weight of the pure GST protein. The cited data
indicate that the recombinant pKe#122-GST fusion protein
breaks down in E. coli. The express>ed fusion proteins
(trace d) were present as insoluble protein aggregates in
the so-called "inclusion bodies", so that a prep-cell
purification was performed. The fractions of this prep-cell
purification were then electrophoretically fractionated
using standard procedures, and analyzed by means of the
immunoblot procedure already described above using anti-GST
antibodies. The product of this purification procedure is
shown on Fig. 10B. Purification resulted in a mixture of
varying large GST fusion proteins. The -thickest band, i.e.,
the majority of GST fusion proteins, had an apparent
molecular weight marker of 65 kD. This allows us to
conclude that the 65 kD pKe#122 GST fusion protein consists
of the GST protein and an approx. 40 kD large fragment of
the protein pKe#122. The 65 kD pKe#122/GST fusion protein
was drawn upon to manufacture a polyclonal antiserum in
CA 02342957 2001-03-14
- 25 -
rabbits. The manufacture and characterization of the
antibodies took place as described i:n Example 2 for the
anti-peptide antibodies.
The highest molecular band had an apparent molecular weight
of approx. 100 kD (compare Fig. 10 B,, fraction 85). This
allows us to conclude that the 100 k:D pKe#122-GST fusion
protein consists of the GST protein and an approx. 70-75 kD
large fragment of the pKe#122 protein (compare also Fig. 4
and accompanying description in Example 2).
In the eukaryotic system, the pBK-CMV-pKe#122 vector (Fig.
9) was transformed into so-called Cos cells, i.e., into
cells of the Cos-cell line generally known in prior art.
The Cos cells were made to absorb the plasmid-DNA in a
standard procedure through treatment with DEAE-
dextran/chloroquine. The transformed cells were then
incubated for two days under standard conditions (37°C and
7o C02). The Cos cells were subjected to lysis and analyzed
in the immunoblot procedure using an antibody against the
FLAG epitope or the anti-peptide ant_Lbody anti-pKe#122-1
IgG. Fig. 11 shows the product of the immunoblot: Trace a
shows the non-transfected Cos cells, Trace b shows a FLAG
control protein, and Trace c shows Cos cells transfected
with pKe#122-FLAG vector construct. Trace c exhibits a band
with an approximate molecular weight of 80 kD, which was
stained by the anti-FLAG antibody. Trace b shows a FLAG-
marked control protein that demonstrates the functionality
of the anti-FLAG antibody.
Example 6: Influencing of keratinocyt:es with pKe#122-
specific antisense oligonucleotides
Antisense nucleotides are absorbed by cells, also
keratinocytes (compare G. Hartmann et al. 1998: Antisense-
0ligonukleotide, Deutsches Arzteblatt 95, Issue 24, C1115-
C1119); and bind to the mRNA present in the cell,
CA 02342957 2001-03-14
r
- 26 -
inhibiting its translation, and hence expression (compare
Y.-S. Lee, et al. 1997: Definition b.y specific antisense
oligonucleotides of a role for proteinkinase Ca in
expression of differentiation markers in normal and
neoplastic mouse epidermal kerat_inocytes, Molecular
Carcinogenesis 18, pp. 44-53). Suitable antisense
oligonucleotides were manufactured using the pKe#122-
specific nucleotide sequence (SEQ ID N0:1 or SEQ ID N0:4).
They were set to a concentration of 100 ~M with a suitable
buffer medium (so-called "oligobuffer"). HaCaT cells were
cultivated at 37°C and 7o C02 up to a confluence of 70-80%.
The cells were trypsinated off (10 minutes, 0.2 o EDTA, 5-
minutes, 0.1 o trypsin) and set to a concentration of
25,000 cells/ml. 100 ~l cell suspension (corresponds to
2,500 cells) was pipetted in per well of a 96-well plate.
The cells were incubated for 1 hour, followed by the
addition of the antisense oligonucleotide (2 ~l of a 100 ~M
solution) and further incubation foz: 24-48 hours. The
negative control consisted of cell batches to which was
added an oligonucleotide with the same base distribution,
but a randomly selected sequence.
The cells treated in this manner were analyzed under a
microscope for phenotypic changes in the cells. The result
of the microscopic analysis is shown on Fig. 12 and Fig.
13: Fig 12 a shows sub-confluent HaCaT cultures that were
treated with pKe#122-specific antisense oligonucleotides,
Fig. 12 b shows sub-confluent HaCaT cultures treated with
control oligonucleotides, Fig. 13 a shows confluent HaCaT
cultures treated with pKe#122-specific antisense
oligonucleotides, Fig. 13 b shows confluent HaCaT cultures
treated with control oligonucleotides, and Fig. 13 c shows
a detail section from Fig. 13 a.
The results of microscopic analysis dE:monstrate that, in
comparison to control oligonucleotides, the number of cells
in the cultures treated with the specific antisense-
CA 02342957 2001-03-14
' r
- 27 -
oligonucleotide is distinctly reduced. This allows us to
conclude that the cellular proliferation was diminished by
the antisense-oligonucleotide. After confluence had been
reached, the HaCaT cultures treated with antisense-
oligonucleotides exhibited greatly enlarged cells, which
were not discovered in the cultures vtreated with control
oligonucleotides. These large cells correspond to
differentiated keratinocytes in terms of their morphology.
The findings allow us to conclude that cells treated with
pKe#122-specific antisense-oligonucleotides show an
increased tendency toward differentiation.
In sum, treatment with pKe#122-specific oligonucleotides
has a distinct influence on proliferation and
differentiation.
