Note: Descriptions are shown in the official language in which they were submitted.
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
Pharmaceutical Composition For The Pre-Treatment Of
Patient In Need Of A Drug Or Pro-Drug
The present invention concerns the preparation of a pharmaceutical composition
io for the pre-treatment of a patient in need of a drug or a pro-drug wherein
said drug
or pro-drug is over or under metabolized in said patient, and uses of such
pharmaceutical composition.
Over the past 20 years, genetic heterogeneity has been increasingly recognized
as
is a significant source of variation in drug response. Many scientific
communications
(Meyer, Ann. Rev. Pharmacol. Toxicol. 37 (1997), 269-296 and West, J. Clin.
Pharmacol. 37 (1997), 635-648) have clearly shown that some drugs work better
or
may even be highly toxic in some patients than in others and that these
variations
in patient's responses to drugs can be related to molecular basis. This
20 "pharmacogenomic" concept spots correlations between responses to drugs and
genetic profiles of patient's (Marshall, Nature Biotechnology, 15 (1997), 954-
957;
Marshall, Nature Biotechnology, 15 (1997), 1249-1252}.
Drugs or pro-drugs after their in vivo administration are metabolized in order
to be
2s eliminated either by excretion or by metabolism to one or more active or
inactive
metabolites (Meyer, J. Pharmacokinet. Biopharm. 24 (1996), 449-459). The
systems which are involved in these metabolisms are enzymatic pathways
(involving for example, cytochrome P450, dehydrogenases, oxidases, esterases,
reductases and a number of conjugating enzymatic systems including methyl
3o transferase, glutathione-s-transferase, arylhydrocarbon hydroxylase,
sulfotransferase, glucuronyl transferase or N-acetyl transferase) localized in
specific organs (mainly in the liver) (Ferrero, Adv. Pharmacol. 43 (1997), 131-
169}.
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/069~3
2
For example, the cytochrome p450 enzyme, which is responsible for the
metabolism of the majority of drugs given to human, bears the brunt of the
load
metabolizing drugs into products that are more readily excreted into the urine
and
feces. It is furthermore well known that the level of these enzymes can affect
the
s rate of metabolism of drugslpro-drugs and that these levels can be induced
by
certain drugs or be correlated to genetic polymorphisms between individuals
(e.g.
amplification of the genes encoding said enzymes). Similarly, inter-individual
variability can result of genetic alterations (e.g. deletions) that lead to
low
expression of the enzymes or expression of deficient isoforms of the enzymes.
1o When the level of metabolizing enzymes is too high or when the produced
enzymes are ultrarapid metabolizes isoforms (showing an increased metabolism
activity compared with the wild type isoform of the enzyme), the metabolism
rate is
also high and therefore a) the drug is rapidly cleared leading to an
inefficient
concentration of the drug in blood or tissue and to a resistance to the
implemented
15 therapy or b) the pro-drug is excessively converted into its active form
which can
reach toxic levels in the patient. Conversely, when the level of said enzymes
is too
low or when the produced enzymes are non metabolizes or slow metabolizes
isoforms (showing a decreased metabolism activity compared with the wild type
isoform of the enzyme), the metabolism rate is also low leading to c) an
inefficient
2o drug clearance, toxic drug concentration in the blood and tissue or d) an
inefficient
pro-drug conversion, low rate of active drug and therefore inefficient
treatment
{see, for review, Ozama, J. Toxicol. Sci. 21 (1996), 323-329).
P450 enzymes are involved in the metabolism of numerous physiological
25 substrates such as steroids, fatty acids, prostaglandins, cytokines, bile
acids
(Nebert and Nelson, 1991, Methods in Enzymology, 206, 3-11 ). P450 enzyme is a
super-family of various enzymes, many of which metabolize a wide range of
foreign
chemicals including drugs. Genetic polymorphisms have been identified, for
example among six of the P450 enzymes named CYP1A1, CYP2C9, CYP2C19,
3o CYP2E1, CYP3A4 and CYP2D6 which can alter enzymatic response to drugs and
define slow or ultrarapid metabolizes isoforms (Guengerich, Chem. Biol.
Interact.
106 (1997), 161-182; Wrighton, J. Pharmacokinet. Biopharm. 24 (1996), 461-
473).
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99106973
3
Similarly, N-acetyltransferase isoforms can divide patients into slow
acetylators,
ultrarapid acetylators and moderate acetylators (wild type).
The level of expression of the CYP enzymes can also enhancelinhibit the rate
of
metabolism of specific drugs and lowerlimprove plasma levels of targeted
drugs,
such as warfarin or quinidin. This enzyme expression can furthermore be
inducedlinhibited to an extent which varies from patient to patient by other
drugs,
such as phenobarbitol or rifampin. Moreover, some administered drugs (e.g.
coumarin) have a narrow therapeutic window which, if metabolism is too slow,
can
1o result in excessive anticoagulation effect. Similarly, many of the adverse
drug
interactions can occur due to mutual interaction with the same enzymes.
CYP3A is a major route of metabolism for cyclosporine, quinidine, lovastatin,
warfarin, nifedipine, lidocaine, terfenadine, astemizole, cisapride,
~5 methylprednisolone, carbamazepine, midazolam, triazolam or erythromycin,
for
example. Inhibition of CYP3A by gene alteration (slow isoform) or inhibition
of
CYP3A gene expression with another drug, such as ketoconazole, itraconazole,
fluconazole, diltiazem, nicardipine or verapamil, can result in increased side
effects
which can induce organ damages.
CYP2D6 is the main metabolizing enzyme for antiarrhythmic agents (e.g.
propaferone, flecainide), beta-adrenoreceptor blockers (e.g. timolol,
metoprolol or
alprenolol}, tricyclic antidepressants (e.g. nortriptyline, desipramine,
imipramine or
clomipramine), neuroleptic drugs (e.g. perphenazine, thioridazine or
haloperidol),
2s selective serotonin reuptake inhibitors (e.g. fluoxetine or paroxetine) and
opiates
(e.g. codeine or dextromethorphan). For example, poor ability to metabolize
codeine translates into impaired production of the active metabolite morphine
resulting in a lower analgesic effect. Poor ability to metabolize can also
result in
systemic side effects for many of drugs. For example, ophtalmic administration
of
3o timilol in a patient with slow metabolizer CYP2D6 isoform can result in
systemic
beta-adrenoreceptor blockade. 20% of Caucasians are slow metabolizers of drugs
due to impaired CYP2D6 activity.
CA 02343321 2001-03-19
19-10-2000 EP 009906973
4
CYP2C19 metabolizes drugs such as mephenytoin, omeprazole, proguanil,
diazepam or citalopram. Patients with the slow metabolizer isoform of. CYP2C19
are 100 to 200 fold less efficient than normal patients at metabolizing said
drugs. A
regular dose of mephenytoin to slow metabolizers will result in higher drug
levels,
s exaggerated pharmacologic responses and toxicity. 5% of Caucasians and 20%
of
Orientals are slow metabolizers due to impaired CYP2C19 activity.
The cytochrome P450 (CYP) genes have been previously used in the frame of anti-
tumoral gene therapy. US 5,688,773 and WO 97/35994 disclose a suicide gene
io therapy strategy wherein the tumor cells, which ordinarily do not have the
capacity
to convert inactive cancer chemotherapeutic pro-drugs into active drugs having
therapeutic effects, have been genetically modified by introducing a selected
CYP
gene. The tumor modified by gene transfer becomes thus able to express the CYP
enzyme and thereby becomes specifically sensitive to antitumoral drugs (for
is example oxazaphosphorines). These studies have shown that drug-activating
CYP
genes may be useful for the development of novel combined chemotherapy/gene
therapy strategies for the targeted treatment of cancer utilizing established
cancer
chemotherapeutic agents.
2o Isoniazid, hydralazine, procainamide as well as other drugs are metabolized
in the
Diver by N-acetyltransferase. If a drug is , converted into its active form or
is
eliminated by acetylation, the pharmacologic response and toxicity wilt be
exaggerated -in the slow and ultrarapid acetylator patients subsets,
respectively.
28% of Caucasians and 7% of Orientals are slow acetylators while 5% of
2s Caucasians and 15% of Orientals are ultrarapid acetylators due to different
isoforms of N-acetyltransferase (NAT-1, NAT-2).
In this context of population variability with regard to drug therapy,
pharmacogenomics has been proposed as a tool useful in the identification and
3o selection of patients which can respond to a particular drug without side
effects.
This identification/selection can be based upon molecular diagnosis of genetic
polymorphisms by genotyping DNA from leukocytes in the blood of patient, for
example, and characterization of disease (Benz, Clin. Pharmacokinet. 32
(1997),
AMENDED SHEET
CA 02343321 2001-03-19
19-10-2000 EP 009906973
4a
210-256; Engel, J. Chromatogra. B. Biomed. Appf. 678 (1996), 93-103). For the
founders of health care, such as health maintenance organizations in the US
and
government pubiic health services in many European countries, this
pharmacogenomics approach can represent a way of both improving health care
and reducing overheads ~~because there is a large cost to unnecessary drugs,
ineffective drugs and drugs with side effects (for example, 106 000 die in US
and 2
millions are hospitalized by year due to drug interaction).
AMENDED SHEET
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
Nevertheless, this pharmacogenomic selection of patients which are possible
candidates to drug therapy is not fully satisfactory because it only results
in
druglpro-drug or patients selection that are treatable. Therefore
- a promising druglpro-drug could be cleared from the market because it is not
s universal or economically not satisfactory because targeted to a restricted
patient population and segmented market;
- a drug/pro-drug can be approvable but its use should provide improved
dosing recommendations in product labeling by allowing the prescriber to
anticipate, without any guarantee related to the security, necessary to dose
1o adjustments depending on the considered patient group, with a real risk of
causing harm or death by prescribing the wrong drug to the wrong patients
at the wrong dose;
- no solution are proposed for patients with slow or ultrarapid metabolism ;
- many drugs in cancer care, for example, are quite toxic, but they are
1s approvable because cancer is a fatal illness with no known cure and in this
particular case, pharmacogenomic selection presents no utility.
The present invention proposes a way to recapture missed patients for a
particular
drug/pro-drug therapy, to decrease side effects related to altered metabolism
of
drug/pro-drug and to inhibit drug interaction.
Thus, the present invention first concerns the use of a first polynucleotide
which
encodes or is complementary to the sequence which encodes a functional first
enzyme isoform, said first enzyme being involved in in vivo metabolism of a
first
drug or pro-drug, for the preparation of a pharmaceutical composition for the
pre-
2s treatment by gene therapy of a patient in need of said first drug or pro-
drug wherein
said first drug or pro-drug is over or under metabolized by said first enzyme
in said
patient.
According to the present invention, "in vivo metabolism of a drug or pro-drug"
3o means that the drug or pro-drug are enzymatically transformed into soluble
and
excretable metabolites in order to clear it from the body or processed from an
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
6
inactive pro-drug form into an active one, respectively (Meyer, J.
Pharmacokinet
Biopharm. 24 (1996), 449-459, is herein included as part of the description).
"Over metabolized" means that the drug/pro-drug is very actively and rapidly
cleared from the body (eg. in feces or urine) leading to an inefficient
concentration
of the drug in blood or tissue and to a resistance to the implemented therapy;
or
that the pro-drug is excessively converted into its active form which can
reach toxic
levels in the patient. This over metabolization can be associated with an over
expression of the metabolizing enzyme (and therefore over concentration of
this
enzyme in blood or tissue); or with the expression of an ultrarapid enzyme
isoform.
"Under metabolized" means that the druglpro-drug is insufficiently cleared
from the
body leading to toxic drug level; or that the pro-drug is insufficiently
converted into
its active form leading to a low rate of active drug in blood or tissue and
therefore
inefficient treatment. This under metabolization can be associated with an
under
~s expression of the metabolizing enzyme or with synthesis of altered enzyme
isoform
(slow isoform).
"Gene therapy" is understood as a method for the introduction of a
polynucleotide
into cells. In particular, it concerns the case where the gene product (enzyme
for
example) is expressed in a target tissue as well as the case where the gene
2o product is excreted, especially into the blood stream.
Methods for delivering a nucleic acid to the interior of a cell of a
vertebrate in vivo
has been widely described in literature related to gene therapy. Gene therapy
methods are well within the skill of those in the art. Most delivery
mechanisms used
to date involve viral vectors, especially adeno- and retroviral vectors.
Viruses have
25 developed diverse and highly sophisticated mechanisms to achieve this goal
including crossing of the cellular membrane, escape from endosomes and
lysosomal degradation, and finally delivery of their genome to the nucleus
followed
by expression of the viral genome. In consequence, viruses have been used in
many gene delivery applications in vaccination or gene therapy applied to
humans.
3o In 1990, Wolff, {Science, 247, 1465-1468) have shown that injection of
naked RNA
or DNA, without any special delivery system, directly into mouse skeletal
muscle
results in expression of reporter genes within the muscle cells. Therefore,
these
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
7
results indicate that nucleic acid by itself is capable of end-up in certain
cells in
vivo.
Various methods have also been proposed in the literature based on the use of
non-viral synthetic vectors to improve intracellular uptake of nucleic acids
which
present potential advantages with respect to large-scale production, safety,
targeting of transfectable cells, low immunogenicity, and the capacity to
deliver
large fragments of DNA. Thus, in 1989, Felgner, (Nature, 337, 387-388)
proposed
the use of cationic lipids in order to facilitate the introduction of large
anionic
molecules such as nucleic acids into cells. These cationic lipids are capable
of
forming complexes with anionic molecules, thus tending to neutralize the
negative
charges of these molecules allowing to compact the complex, and favoring its
introduction into the cell. Example of lipid-mediated transfection compounds
are
DOTMA (Felgner, PNAS 84 (1987), 7413-7417), DOGS or TransfectamT"' (Behr,
PNAS 86 (1989), 6982-6986), DMRIE or DORIE (Felgner, Methods 5 (1993), 67-
is 75), DC-CHOL (Gao, BBRC 179 (1991 ), 280-285), DOTAPT"" (McLachlan, Gene
Therapy 2 (1995), 614-622) or LipofectamineT"".
Other non-viral delivery systems have been developed which are based on
polymer-mediated transfection. There have been many reports on the use for
cellular delivery of anionic polymers such as, for example, polyamidoamine
20 (Haensler, Bioconjugate Chem. 4 (1993), 372-379), dendritic polymer (WO
95/24221 ), polyethylene imine or polypropylene imine {WO 96/02655),
polylysine
(US-A-5,595,897 or FR-A-2 719 31fi).
The successful in vivo delivery of antisenselribozyme compounds, has been
shown
in many clinical trials using antisense oligonucleotides (for example, Guinot
and
25 Temsamani, Pathol. Biol. 46 (1998), 347-354; Normanno and Agrawal, Mol.
Med.
Today 4 (1998), 514-516; Agrawal and Zhao, Curr. Opin. Chem. Biol. 2 (1998),
519-528), US 5,578,716; US 5, 773,601 ).
"Polynucleotide" may be a DNA andlor RNA fragment, single or double-stranded,
linear or circular, natural or synthetic, modified or not (see US 5,525,711;
US
30 4,711,955 or EP 302 175 for modification examples) defining a fragment or a
portion of a nucleic acid, without size limitation. It may be, infer alia, a
genomic
DNA, a cDNA, a mRNA, an antisense RNA, a ribozyme, or DNA encoding such
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
8
RNAs. "Polynucleotides" and "nucleic acids" are synonyms with regard to the
present invention. The polynucleotide may also be in the form of a plasmid or
linear
polynucleotide which contains at feast one coding sequence of polynucleotide
that
can be transcribed and translated to generate enzyme involved in in vivo
metabolism of drug or pro-drug. The polynucleotide can also be an
oligonucleotide
which is to be delivered to the cell, e.g., for antisense or ribozyme
functions.
According to the invention, said polynucleotide can also be formulated with
viral
proteins, or cationic lipids, or cationic polymers as vectors facilitating
polynucleotide
uptake into cells.
to In a preferred embodiment, both DNA and RNA can be delivered to cells to
form
therein all or part of enzyme, this product being able to metabolize in vivo
drug or
pro-drug. This product may further stay within the cell or be secreted from
the cell.
In a more preferred embodiment, plasmid DNA is preferred. If the nucleic acids
contain the proper genetic information, they will direct the synthesis of
relatively
is large amounts of the encoded enzyme. The genetic information necessary for
expression by a target cell comprise all the elements required for
transcription of
said DNA into mRNA and for translation of mRNA into polypeptide.
Transcriptional
promoters suitable for use in various vertebrate systems are well known. For
example, suitable promoters include viral promoters RSV, MPSV, SV40, CMV or
20 7.5k, vaccinia promoter, inducible promoters, etc. Nucleic acids can also
include
intron sequences, targeting sequences, transport sequences, sequences involved
in replication or integration. Said sequences have been reported in the
literature
and can be readily obtained by those skilled in the art. Nucleic acids can
also be
stabilized with specific components such as spermine. According to the
invention,
25 the polynucleotide can be homologous or heterologous to the target
expressing
cells.
"A functional enzyme isoform" (also called "moderate" or "wild type isoform")
designates all or part of a polypeptide showing enzymatic properties
comparable to
those of the functional enzyme (wild type) naturally involved in drug
metabolism
3o pathway.
"Slow metabolizers isoforms of an enzyme" designates enzyme isoforms which
have low or no ability to metabolize drugs compared to the functional isoform.
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
9
"Pre-treatment of patient" means that the pharmaceutical preparation of the
present
invention is intended to be administered to patients in conjunction with or
separately, simultaneously or preferably prior, to a druglpro-drug
administration to
patients in need of said druglpro-drug treatment.
s "Slow metabolizes patient" means that in said patient druglpro-drug is under
metabolized by the related metabolizing enzyme. Conversely, "ultrarapid
metabolizes patient" means that in said patient drug/pro-drug is over
metabolized
by the related metabolizing enzyme.
According to a first embodiment, the patient is an ultrarapid metabolizes
patient
to which means that in this patient, before pre-treatment with the
pharmaceutical
composition of the invention, said first drug or pro-drug is over metabolized
by said
first enzyme. The ultrarapid metabolizes phenotype can be correlated to an
enhanced expression of the gene encoding said first enzyme into the patient
cells
or to an enhancement of the activity of said first enzyme (ultrarapid first
enzyme
is isoform). According to a preferred embodiment, said first polynucleotide is
an
antisense RNA complementary to all or part of the sequence which encodes said
first enzyme. In this specific case, the observed over metabolism in the
patient is
associated to high level expression of said enzyme. Antisense gene therapy has
been widely disclosed in literature (for a review see for example Gura,
Science 270
20 (1995), 575-577). By computerized analysis, antisense sequences can easily
be
determined which can bind in vivo to the gene or the RNA encoding said first
enzyme in order to block its synthesis and reduce its level into the patient.
According to a preferred embodiment, said first drug or pro-drug is under
25 metabolized by said first enzyme in said patient. This patient is a slow
metabolizes
patient which means that in this patient, before pre-treatment with the
pharmaceutical composition of the invention, said first drug or pro-drug is
under
metabolized by said first enzyme. This case occurs more specifically when the
first
enzyme is under expressed or has a lower activity compared to the functional
3o isoform (slow metabolizers enzyme isoforms). In this specific embodiment of
the
invention, the polynucleotide encodes a functional isoform of said first
enzyme.
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
This first enzyme can also be selected in the group including enzymes
responsible
for acetylation, methylation, glucuronidation, sulfation or de-esterification.
In a
preferred embodiment, said first enzyme is an enzyme produced by the liver,
and
more specifically is selected in the group consisting in cytochrome p450, UDP-
5 glucuronosyl transferase, methyl transferase and N-acetyl transferase and
their
isoforms.
According to a first embodiment of the invention, said first enzyme is
selected in the
group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9,
to CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
When said first enzyme is the cytochrome p450 enzyme named CYP2D6, said first
drug or pro-drug is selected from the group consisting in propafenone,
flecainide,
trimolol, metropolol, alprenolol, nortriptyiine, desipramine, imipramine,
clomipramine, perphenazine, thioridazine, haloperidol, fluoxetine, paroxetine,
codeine and dextromethorphan.
When said first enzyme is the cytochrome p450 enzyme named CYP3A, said first
drug or pro-drug is selected from the group consisting in cyclosporine,
2o erythromycin, methylprednisolone, carbazepine, midazolam, triazolam,
quinidine,
lovastin, warfarin, nifedipine, lidocaine, terfenadine, asternizolam and
cisapride.
When said first enzyme is the cytochrome p450 enzyme named CYP2C19, said
first drug or pro-drug is selected from the group consisting in mephenytoin,
omoprazole, proguanil, diazepam and citalopram.
When said first enzyme is the N-acetyl transferase, said first drug or pro-
drug is
selected from the group consisting in isoniazid, hydralazine and procainamide.
3o Much emphasis in metabolic research and development has focused on the
liver
because this organ has always been regarded as the principal site of drug
metabolism. However, for particular drugs, other tissues may predominate
(e.g., the
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
11
kidney or gastrointestinal mucosa). Polynucleotides encoding functional
isoform of
enzymes involved in organ directed metabolism pathways have been reported in
the literature and can be readily obtained by those skilled in the art (see,
for
example, nucleic acid sequences disclosed in GenBank data basis,
s http:liwww.ncbl.nlm.nih.gov/genbank), i.e., CYP1A1 coding sequence available
on
GenBank, Accession number NM 000499, CYPC19 coding sequence (GenBank
Accession number NM 000769), CYP2E1 coding sequence (GenBank Accession
number AF 084225), CYP3A4 coding sequence (GenBank Accession number NM
000106) or ADH3 coding sequence (GenBank Accession number NM 000669).
Moreover, many enzymatic metabolic routes of eliminationlconversion of a
druglpro-drug, can be inhibited or induced by concomitant treatment with
another
drug or pro-drug. As a result, abrupt changes can occur with co-administered
agent
in a single patient. Such interaction can lead to a substantial decrease or
increase
1s in the blood and tissue concentrations of a drug/pro-drug or cause the
accumulation of a toxic substance.
The invention is therefore further directed to the use of a first
polynucleotide which
encodes or is complementary to the sequence which encodes a functional first
2o enzyme isoform, said first enzyme being involved in in vivo metabolism of a
first
drug or pro-drug, said first drug or pro-drug being involved in activation or
inhibition
of the expression of a second polynucleotide which encodes a second enzyme
involved in a second drug or pro-drug in vivo metabolism, for the preparation
of a
pharmaceutical composition for the pre-treatment of patient in need of said
first and
2s second drug or pro-drug wherein said second drug or pro-drug is over or
under-
metabolized by said second enzyme and said first drug or pro-drug is under-
metabolized in said patient.
The activation/inhibition of the second druglpro-drug metabolism can result of
3o activation/inhibition by a first druglpro-drug a) of the expression level
of the
polynucleotide encoding said second enzyme or b) of the enzymatic activity of
said
second enzyme.
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
12
The second enzyme is defined as previously described for the first one.
According
to a first embodiment, the first and second enzymes are selected in the group
consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, CYP2C19,
s CYP2E1, CYP3A4 and CYP2D6. However, according to a preferred embodiment,
said first and second enzymes are different and are involved in metabolism of
different first and second drug/pro-drug, respectively.
According to a particular embodiment, the first drug or pro-drug is involved
in
to activation of said second enzyme. For example, said first drug or pro-drug
is
phenobarbitol or rifampicin and said second enzyme is a cytochrome P450
isoform.
According to another particular embodiment, the first drug or pro-drug is
involved in
inhibition of said second enzyme. For example, said first drug or pro-drug is
quinine, said second enzyme is a CYP2D6 isoform and said first enzyme is
is CYP3A4. In another example, said first drug or pro-drug is selected in the
group
consisting in cyclosporine, erythromycine, ketoconazole, itraconazole,
fluconazole,
diltiazen, nicardipine and verapamil involved in inhibition of said second
enzyme
which is a CYP isoform and said second drug is selected in the group
consisting in
cyclosporine, quinidine, lovastine, warfarin, nifectipine, loidocaine,
terfenadine,
2o astemizole, cisapride, erythromycin, methylprednisolone, carbamazepine,
midazolam and triazolam.
According to the invention, the targeted patient is in need of at least a
first
druglpro-drug but is also a slow or ultrarapid metabolizer for said first
druglpro-
2s drug. Therefore, administration of said druglpro-drug to said patient can
be
correlated to inefficient or toxic level of active drug in blood or tissue and
consequently to possible organ damages or toxicity. The invention further
relates to
uses as previously disclosed to prevent or to treat organ damage or toxicity
in
patient, and more particularly hepatic or renal damages or toxicity. According
to a
so particular embodiment, said hepatic damage is alcoholism. Alcoholism could
be a
side effect of drug/pro-drug delivery and inefficient metabolism. It can also
result
from the deleterious effects of alcohol which are caused by its metabolism.
For
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
13
example, Brown, (Pharmacogenetics 8 (1998), 335-342) have focused their
attention upon gene encoding ethanol metabolizing enzymes. They have
identified
related polymorphisms in gene loci-cytochrome p4502E1 (CYP2E1) and alcohol
dehydrogenase 3 (ADH3). In this special case, ethanol could be considered as a
drug equivalent even when this drug is not administered with therapeutic
prospect.
According to a specific embodiment, the targeted patient can be an opiate or
cocaine user. Ibogaine, for example, is a psychoactive alkaloid that possesses
potential as an agent to treat opiate or cocaine addiction. The primary
metabolite
to arises via O-demethylation at the 12-position to yield 12-hydroxyibogamine.
Obach,
(Drug ~etab. Dispos. 26 (1998), 764-768) have presented evidence that the O-
demethylation of ibogaine observed in the liver is catalyzed primarily by the
polymorphically expressed cytochrome p4502D6 (CYP2D6). Therefore, over- or
under-metabolism of ibogaine, or related druglpro-drug involved in treatment
of
is drug addiction, could have effect in said treatment.
The invention is also related to uses to improve or enable efficacy of first
and or
second drug/pro-drug.
2o The present invention concerns preparation of therapeutic composition for
administration into vertebrate target tissues, and more specifically into the
liver.
Said administration can be performed by different delivery routes (systemic
delivery
and targeted delivery). According to the present invention, the prepared
therapeutic
composition is preferably administered into organ involved in druglpro-drug
25 metabolism, however prepared therapeutic composition administration can
also
occur in other tissues of the vertebrate body including those of muscle, skin,
brain,
lung, liver, spleen, bone marrow, thymus, heart, lymph, bone, cartilage,
pancreas,
kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum,
nervous
system, eye, gland, connective tissue, blood, tumor, etc. The polynucleotide
3o encoded enzyme can thus be excreted in body fluids (e.g., blood) allowing
its
delivery in metabolizing organs or said polynucleotide can be associated with
targeting molecules which are capable to point its uptake into targeted cells.
Gene
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
14
therapy literature provides many mechanisms for efficient and targeted
delivery and
expression of genetic information within the cells of a living organism (see
for
example 'European patent application EP-0 401 108.0). Said administration may
be
made by intradermal, subdermal, intravenous, intramuscular, intranasal,
s intracerebral, intratracheal, intraarterial, intraperitoneal, intravesical,
intrapleural,
intracoronary or intratumoral injection, with a syringe or other devices.
Transdermal
administration is also contemplated, as are inhalation or aerosol routes.
The invention also pertains to a pharmaceutical composition for the pre-
treatment
of patient in need of a drug or pro-drug wherein said drug or pro-drug is over
or
under metabolized by a natural enzyme in said patient, said composition
comprising a polynucleotide which encodes or is complementary to the sequence
which encodes a functional enzyme isoform, said enzyme being involved in in
vivo
metabolism of a drug or pro-drug .
~5
The pharmaceutical composition in accordance with the present invention
comprises a polynucleotide which encodes or is complementary to the sequence
which encodes a functional isoform of an enzyme produced by the liver, and
more
specifically which is selected in the group consisting in cytochrome p450, UDP
2o glucuronosyl transferase, methyl transferase, N-acetyl transferase and
alcohol
dehydrogenase 3 (ADH3).
According to a preferred embodiment of the invention, said enzyme is selected
in
the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9,
25 CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
According to a specific embodiment, the pharmaceutical composition comprises
an
antisense RNA complementary to all or part the sequence which encodes said
first
enzyme.
In another preferred embodiment, the polynucleotide which is contained in the
pharmaceutical composition is a DNA. Other particular embodiments of the
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99106973
invention are pharmaceutical compositions wherein said polynucleotide is
naked,
associated with viral polypeptides or complexed with cationic components, more
preferably with cationic lipids. In general, the concentration of
polynucleotide in the
pharmaceutical compositions is from about 0.1 pglml to about 20 mglml.
s
In a further preferred embodiment, the pharmaceutical composition further
comprises a pharmaceutically acceptable injectable carrier. The carrier is
preferably isotonic, hypotonic or weakly hypertonic and has a relatively low
ionic
strength, such as provided by a sucrose solution. It includes any relevant
solvent,
to aqueous or partly aqueous liquid carrier comprising sterile, pyrogen-free
water,
dispersion media, coatings, and equivalents. The pH of the pharmaceutics!
preparation is suitably adjusted and buffered.
In another embodiment, the pharmaceutical composition of the present invention
15 comprises an instruction for use of said pharmaceutical composition (e.g.,
a leaflet)
describing that said pharmaceutical composition is used according to the
present
invention, i.e. for the pre-treatment of a patient in need of above said first
drug or
pro-drug, wherein said first drug or pro-drug is over or under metabolized by
above
said first enzyme in said patient. In another embodiment said instruction for
use
2o describes that the pharmaceutical composition of the present invention is
used for
the pre-treatment of a patient in need of above said first and second drug or
pro-
drug, wherein said second drug or pro-drug is over or under metabolized by
said
second enzyme and said first drug or pro-drug is under metabolized in said
patient.
2s The invention has been described in an illustrative manner, and it is to be
understood that the terminology which has been used is intended to be in the
nature of words of description rather than of limitation. Obviously, many
modifications and variations of the present invention are possible in light of
the
above teachings. It is therefore to be understood that within the scope of the
3o claims, the invention may be practiced otherwise than as specifically
described.
CA 02343321 2001-03-19
WO 00/17366 PCT/EP99/06973
16
The present invention is further illustrated by reference to the following non-
limiting
example:
Example: Construction of an adenoviral vector expressing cytochrome p450
s CYP1 A1 (Ad CYP1 A1 ).
The constructs below described have been made according to the molecular
cloning methods described in Maniatis et al., (1989, Laboratory Manual, Cold
Spring Harbor, Laboratory Press, Cold Spring Harbor, NY). The homologous
1o recombinant steps are preferably realized in E. toll BJ 5183 strain
(Hanahan, J.
Mol. Biol. 166 (1983), 557-580). The adenovirai fragments used are defined
with
reference to their position in the Adenovirus 5 genome sequence as disclosed
in
GenBank, Accession number M73260. Cells are transfected and cultured
according to technique widely used in the art.
The coding region of CYP1A1 has been amplified by PCR using a human cDNA
library and primer oligonucleotides, defined with reference to CYP1A1 sequence
available on GenBank, Accession number NM 000499, and comprising EcoRl and
Xbal restriction sites:
from 5' end 5' GGCAGCCAGAATTCCTGAAGGTGAC 3'
from 3' end 5'GGCTGTCAGTGGGATCTAGACTAAGAGCGCAGC 3'
EcoRl and Xbal restriction sites have been respectively introduced in 5' and
3' end
2s of the CYP1A1 coding sequence. The PCR fragment is then digested with EcoRl
and Xbal, and inserted into pCl-neo plasmid (Promega Corp) leading to pCl-
neoCYP1A1. The fragment Xhol Xbal of pCl-neoCYP1A1 including the CYP1A1
coding sequence is isolated and subcloned into the vector pTG6600 (Lathe et
al,
1987, Gene 57, 193-201 ) linearized wit the same enzymes. The resulting
transfert
3o vector is named pTG6600 CYP1A1. The adenoviral vector Ad CYP1A1 is produced
by homologous recombination in E. toll BJ 5183 strain between the Pacl-8stEll
fragment of pTG6600 CYP1 A1 and vector pTG6624 finearized with Clal. The final
CA 02343321 2001-03-19
WO 00/17366 PCT1EP99/06973
17
construct Ad CYP1A1 comprises the E1 (nucleotides 459 to 3328) and E3
(nucleotides 28249 to 30758) deleted AdS, comprising in the E1 region an
expression cassette containing CYP1A1 coding sequence under the control of
CMV promoter. Adenoviral particles are produced after transfection of 293 cell
line
(ATCC CRL1573). Said recombinant adenoviral vector might be used for preparing
the composition of the present invention by combining it with a sucrose
solution
which is known as a pharmaceutically acceptable injectable carrier.
Using teachings readily available on GenBank and the methodology above-
to described or equivalent one, skilled man can prepare recombinant vectors
comprising CYP2C19 coding sequence (GenBank Accession nurnber NM 000769),
CYP2E1 (GenBank Accession number D11131 ), CYP2D6 coding sequence
(GenBank Accession number NM 000106) or ADH3 coding sequence {GenBank
Accession number NM 000Ei69}.
CYP1A1 coding sequence available on GenBank, Accession number NM 000499,
CYP2C19 coding sequence (GenBank Accession number NM 000769), CYP2E1
coding sequence (GenBank Accession number AF 084225), CYP3A4 coding
sequence (GenBank Accession number D11131 ), CYP2D6 coding sequence
(GenBank Accession number NM 000106) or ADH3 coding sequence (GenBank
Accession number NM 000669).
