Note: Descriptions are shown in the official language in which they were submitted.
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99I22231
NOVEL PLANT ACYLTRANSFERASES
INTRODUCTION
This application claims the benefit of U.S. Provisional Application Serial No.
b0/101,939 filed September 2S, 199$.
Technical Field
The present invention is directed to nucleic acid and amino acid sequences and
constructs, and methods related thereto.
B ackground
Through the development of plant genetic engineering techniques, it is now
possible to
produce transgenic varieties of plant species to provide plants which have
novel and desirable
characteristics. For example, it is now possible to genetically engineer
plants for tolerance to
environmental stresses, such as resistance to pathogens and tolerance to
herbicides and to
2 0 improve the quality characteristics of the plant, far example improved
fatty acid compositions.
However, the number of useful nucleotide sequences fox the engineering of such
characteristics is thus far limited and the speed with which new useful
nucleotide sequences
for engineering new characteristics is slow.
The characterization of various acyltransferase proteins is useful for the
further study
2 5 of plant fatty acid synthesis systems and for the development of novel
andlor alternative oils
sources. Studies of plant mechanisms may provide means to further enhance,
control,
modify, or otherwise alter the total fatty acyl composition of triglycerides
and oils:
Furthermore, the elucidation of the factors) critical to the natural
production of fatty acids in
plants is desired, including the purification of such factors and the
characterization of
3 0 element{s) and/or cofactors which enhance the efficiency of the system. Of
particular interest
are the nucleic acid sequences of genes encoding proteins which may be useful
for
applications in genetic engineering.
CA 02343969 2001-03-20
WO 00/18889 . PCTIUS99/22231
z
SUMMARY OF THE INVENTION
The present invention provides nucleic acid encoding for amino acid
sequences for a class of proteins which are related to acyltransferase
proteins. Such proteins
are referred to herein as acyltransferase related or acyltransferase like
proteins.
By this invention, nucleic acid sequences encoding these acyltransferase
related
proteins may now be characterized with respect to enzyme activity. In
particular,
identification and isolation of nucleic acid sequences encoding for
acyltransferase related
proteins from Arabidopsis, yeast, corn, and soybean are provided.
Thus, this invention encompasses acyltransferase related nucleic acid
sequences and
the corresponding amino acid sequences, and the use of these nucleic acid
sequences in the
preparation of oligonucleotides containing such acyltransferase related
encoding sequences
for analysis and recovery of plant acyltransferase related gene sequences. The
acyltransferase
related encoding sequence may encode a complete or partial sequence depending
upon the
intended use. All or a portion of the genomic sequence, or cDNA sequence, is
intended.
Of special interest are recombinant DNA constructs which provide for
transcription or
transcription and translation {expression) of the acyltransferase related
sequences in host
2 0 cells. In particular, constructs which are capable of transcription or
transcription and
translation in plant host cells are preferred. For some applications a
reduction in sequences
encoding acyltransferase related sequences may be desired. Thus, recombinant
constructs
may be designed having the acyltransferase related sequences in a reverse
orientation for
expression of an anti-sense sequence or use of co-suppression, also known as
"transwitch",
2 5 constructs rnay be useful. Such constructs rnay contain a variety of
regulatory regions
including transcriptional initiation regions obtained from genes
preferentially expressed in
plant seed tissue. For some uses, it rnay be desired to use the
transcriptional and translational
initiation regions of the acyitransferase related gene either with the
acyltransferase related
encoding sequence or to direct the transcription and translation of a
heterologous sequence.
3 0 Also considered in this invention are the plants and seeds containing the
constructs
and polynucleotides of this invention.
CA 02343969 2001-03-20
WO 00/18889 PCTIUS99/2223I
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 provides the 204 amino acid conserved sequence profile identified
from
comparisons of glycerol-3-phosphate acyltransferase and various
lysophosphatidic acid
acyltransferase using PSI-BLAST.
Figure 2 provides an amino acid sequence alignment for the acyltransferase
sequences. The alignment shown is of the regions of the protein extending from
about 30
amino acids prior to the conserved H in the conserved sequence HXXXXD to 100
amino
acids after, or downstream, of the P in the conserved PEG sequence motif of
the
acyitransferase-like sequences.
Figure 3 provides schematics showing the relationship of the identified
acyitransferases. The relationships described are derived from an alignment of
the regions of
the protein extending from about 30 amino acids prior to the conserved H in
the conserved
sequence HXXXXD to 100 amino acids after, or downstream, of the P in the
conserved PEG
sequence motif of the acyltransferase-like sequences. Figure 3A provide
aphylogenetic tree
showing the relationship of several acyltransferases. Figure 3B provides a
table showing the
percent similarities and percent divergence of the novel acyitransferases and
known
acyltransferases using the Clustal method with PAM250 residue weight table.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the subject invention, nucleotide sequences are provided
which are
2 5 capable of coding sequences of amino acids, such as, a protein,
polypeptide or peptide, which
are related to nucleic acid sequences encoding acyltransferase proteins,
referred to herein as
acyltransferase-like or acyltransferase related. The novel nucleic acid
sequences find use in
the preparation of constructs to direct their expression in a host cell.
Furthermore, the novel
nucleic acid sequences may find use in the preparation of plant expression
constructs to
3 0 modify the fatty acid composition of a plant cell.
In one embodiment of the present invention, nucleic acid sequences, also
referred to
herein as polynucleotides, are identified from databases which are related, to
acyltransferases.
CA 02343969 2001-03-20
WO 00/18889 , PCTNS99I22231
Isolated proteins, Polypeptides and Polynucleotides
A first aspect of the present invention relates to isolated acyltransferase
polynucleatides. The polynucleotide sequences of the present invention include
isolated
poiynucleotides that encode the polypeptides of the invention having a deduced
amino acid
sequence selected from the group of sequences set forth in the Sequence
Listing and to other
polynucleotide sequences closely related to such sequences and variants
thereof.
The invention provides a polynucleotide sequence identical over its entire
length to
each coding sequence as set forth in the Sequence Listing. The invention also
provides the
coding sequence for the mature polypeptide or a fragment thereof, as well as
the coding
sequence for the mature polypeptide or a fragment thereof in a reading frame
with other
coding sequences, such as those encoding a leader or secretary sequence, a pre-
, pro-, or
prepro- protein sequence. The polynucleotide can also include non-coding
sequences,
including far example, but not limited to, non-coding 5' and 3' sequences,
such as the
transcribed; untranslated sequences, termination signals, ribosome binding
sites, sequences
that stabilize mRNA, introns, polyadenylation signals, and additional coding
sequence that
encodes additional amino acids. For example, a marker sequence can be included
to facilitate
the purification of the fused polypeptide. Polynucleotides of the present
invention also
include polynucleotides comprising a structural gene arid the naturally
associated sequences
2 0 that control gene expression.
The invention also includes polynucleotides of the formula:
X-~ROn ~Rz)-(R.3)n Y
wherein, at the 5' end, X is hydrogen, and at the 3' end, Y is hydrogen or a
metal, R, and R3
are any nucleic acid residue, n is an integer between 1 and 3000, preferably
between I and
2 5 1000 and R2 is a nucleic acid sequence of the invention, particularly a
nucleic acid sequence
selected from the group set forth in the Sequence Listing and preferably SEQ
IDNOs: 1, 3, 5,
7, 9, 10, 12, 14, 16, 18, 20, 22, and 226-233. In the formula, R2 is oriented
so that its 5' end
residue is at the left, bound to R,, and its 3' end residue is at the right,
bound to R3. Any
stretch of nucleic acid residues denoted by either R group, where R is greater
than 1, may be
3 0 either a heteropolymer ar a homopolymer, preferably a heteropolymer.
The invention also relates to variants of the polynucleotides described herein
that
encode fox variants of the polypeptides of the invention. Variants that are
fragments of the
polynucleotides of the invention can be used to synthesize full-length
polynucleotides of the
CA 02343969 2001-03-20
WO 00/18889 PCTIUS99/22231
invention. Preferred embodiments are polynucleotides encoding polypeptide
variants wherein
5 to 10, i to 5, 1 to 3, 2, 1 or no amino acid residues of a polypeptide
sequence of the
invention are substituted, added or deleted, in any combination. Particularly
preferred are
substitutions, additions, and deletions that are silent such that they do not
alter the properties
5 or activities of the polynucleotide or polypeptide.
Nucleotide sequences encoding acyltransferases may be obtained from natural
sources
or be partially or wholly artificially synthesized. They may directly
correspond to an
acyltransferase endogenous to a natural source or contain modified amino acid
sequences,
such as sequences which have been mutated, truncated, increased or the like.
Acyltransferases
may be obtained by a variety of methods, including but not limited to, partial
or homogenous
purification of protein extracts, protein modeling, nucleic acid probes,
antibody preparations
and sequence comparisons. Typically an acyltransferase will be derived in
whole or in part
from a natural source. A natural source includes, but is not limited to,
prokaryotic and
eukaryotic sources, including, bacteria, yeasts, plants, including algae, and
the like.
Of special interest are acyltransferases which are obtainable from eukaryotic
sources,
including those which are obtained, from plants, or from acyltransferases
which are
obtainable through the use of these sequences. "Obtainable" refers to those
acyltransferases
which have sufficiently similar sequences to that of the sequences provided
herein to provide
a biologically active protein of the present invention.
2 0 Further preferred embodiments of the invention that are at least 50%, 60%,
or 70%
identical over their entire length to a polynucleotide encoding a polypeptide
of the invention,
and polynucleotides that are complementary to such polynucleotides. More
preferable are
polynucleotides that comprise a region that is at least 80% identical over its
entire length to a
polynucleotide encoding a polypeptide of the invention and polynucleotides
that are
2 5 complementary thereto. In this regard, polynucleotides at least 90%
identical over their entire
length are particularly preferred, those at least 95% identical are especially
preferred. Further,
those with at least 97% identity are highly preferred and those with at least
98% and 99%
identity are particularly highly preferred, with those at least 99%a being the
most highly
preferred.
3 0 Preferred embodiments are polynucleotides that encode polypeptides that
retain
substantially the same biological function or activity as the mature
polypeptides encoded by
the polynucleotides set forth in the Sequence Listing.
CA 02343969 2001-03-20
WO 00!18889 PCT/US99122231
The invention further relates to polynucleotides that hybridize to the above-
described
sequences. In particular, the invention relates to polynucleotides that
hybridize under
stringent conditions to the above-described polynucleotides. As used herein,
the terms
"stringent conditions" and "stringent hybridization conditions" mean that
hybridization will
generally occur if there is at least 95% and preferably at least 97% identity
between the
sequences. An example of stringent hybridization conditions is overnight
incubation at 42°C
in a solution comprising SO% formamide, Sx SSC (150 mM NaCI, 15 mM trisodium
citrate),
50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution, 10% dextran sulfate,
and 20
micrograms/milliliter denatured, sheared salmon sperm DNA, followed by washing
the
hybridization support in O.lx SSC at approximately 6S°C. Other
hybridization and wash
conditions are well known and are exemplified in Sambrook, et al., Molecular
Cloning: A
Laboratory Manual, Second Edition, cold Spring Harbor, NY ( 1989),
particularly Chapter 11.
The invention also provides a polynucleotide consisting essentially of a
polynucleotide sequence obtainable by screening an appropriate library
containing the
complete gene for a polynucleotide sequence set for in the Sequence Listing
under stringent
hybridization conditions with a probe having the sequence of said
polynucleotide sequence or
a fragment thereof; and isolating said polynucleotide sequence. Fragments
useful for
obtaining such a polynucleotide include, for example, probes and primers as
described herein.
As discussed herein regarding polynucleotide assays of the invention, for
example,
2 0 polynucleotides of the invention can be used as a hybridization probe for
RNA, cDNA, or
genomic DNA to isolate full length cDNAs or genomic clones encoding a
polypeptide and to
isolate cDNA or genomic clones of other genes that have a high sequence
similarity to a
polynucleotide set forth in the Sequence Listing. Such probes will generally
comprise at least
15 bases. Preferably such probes will have at least 30 bases and can have at
least 50 bases.
Particularly preferred probes will have between 30 bases and 50 bases,
inclusive.
The coding region of each gene that comprises or is comprised by a
polynucleotide
sequence set forth in the Sequence Listing may be isolated by screening using
a DNA
sequence provided in the Sequence Listing to synthesize an oligonucleotide
probe. A labeled
oligonucleotide having a sequence complementary to that of a gene of the
invention is then
3 0 used to screen a library of cDNA, genomic DNA or mRNA to identify members
of the library
which hybridize to the probe. For example, synthetic oligonucleotides are
prepared which
correspond to the N-terminal sequence of the polypeptide. The partial
sequences so prepared
can then be used as probes to obtain acyltransferase clones from a gene
library prepared from
CA 02343969 2001-03-20
WO 00!18889 . PCTIUS99I22231
7
a cell source of interest. Alternatively, where oligonucleotides of low
degeneracy can be
prepared from particular peptides, such probes may be used directly to screen
gene libraries
for gene sequences. In particular, screening of cDNA libraries in phage
vectors is useful in
such methods due to lower levels of background hybridization.
Typically, a sequence obtainable from the use of nucleic acid probes will show
60-
70% sequence identity between the target acyltransferase sequence and the
encoding sequence
used as a probe. However, lengthy sequences with as little as 50-60% sequence
identity may
also be obtained. The nucleic acid probes may be a lengthy fragment of the
nucleic acid
sequence, or may also be a shorter, oligonucleotide probe. When longer nucleic
acid
fragments are employed as probes (greater than about 100 bp), one may screen
at lower
stringencies in order to obtain sequences from the target sample which have 20-
50%
deviation (i.e., 50-80% sequence homology) from the sequences used as probe.
Oligonucleotide probes can be considerably shorter than the entire nucleic
acid sequence
encoding an acyltransferase enzyme, but should be at least about 10,
preferably at least about
15, and more preferably at least about 20 nucleotides. A higher degree of
sequence identity is
desired when shorter regions are used as opposed to longer regions. It may
thus be desirable
to identify regions of highly conserved amino acid sequence to design
oligonucleotide probes
for detecting arid recovering other related genes. Shorter probes are often
particularly useful
for polymerase chain reactions (PCR), especially when highly conserved
sequences can be
2 0 identified. (See, Gould, et al., PNAS USA ( 1989) 86:1934-1938).
The skilled artisan will appreciate that, in many cases, an isolated cDNA
sequence
will be incomplete, in that the region coding for the polypeptide is truncated
with respect to
the 5' terminus of the cDNA. This is a consequence of the reverse
transcriptase, an enzyme
with low 'processivity' (a measure of the ability of the enzyme to remain
attached to the
2 5 template during the polymerization reaction) employed during the first
strand cDNA
synthesis.
There are several methods available and are well know to the skilled artisan
to obtain
full-length cDNAs, or extend short cDNAs, for example those based on the
method of Rapid
Amplification of cDNA Ends (RACE) (see, for example, Frohrnan et al. (1988)
Proc. Natl.
3 0 Acad. Sci. USA 85:8998-9002). Recent modifications of the technique,
exemplified by the
Marathonr"' technology (Cionetech Laboratories, Inc.) for example, have
significantly
simplified obtaining foil-length cDNA sequences.
CA 02343969 2001-03-20
WO 00118889
8
PCTIUS99122231
Another aspect of the present invention relates to isolated acyltransferase
polypeptides. Such polypeptides include isolated polypeptides set forth in the
Sequence
Listing, as well as polypeptides and fragments thereof, particularly those
polypeptides which
exhibit acyltransferase activity and also those polypeptides which have at
least 50%, 60% or
70% identity, preferably at least 80% identity, more preferably at least 90%
identity, and most
preferably at least 95% identity to a polypeptide sequence selected from the
group of
sequences set forth in the Sequence Listing, and also include portions of such
polypeptides,
wherein such portion of the polypeptide preferably includes at least 30 amino
acids and more
preferably includes at least 50 amino acids.
"Identity", as is well understood in the art, is a relationship between two or
more
polypeptide sequences or two or more polynucleotide sequences, as determined
by comparing
the sequences. In the art, "identity" also means the degree of sequence
relatedness between
polypeptide or polynucleotide sequences, as determined by the match between
strings of such
sequences. "Identity" can be readily calculated by known methods including,
but not limited
to, those described in Computational Molecular Biology, Lesk, A.M., ed.,
Oxford University
Press, New York (1988); Biocomputing: Informatics and Genome Projects, Smith,
D.W., ed.,
Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part l,
Griffin,
A.M. and Griffin, H.G., eds., Humana Press, New Jersey ( 1994); Sequence
Analysis in
Molecular Biology, von Heinje, G., Academic Press (1987); Sequence Analysis
Primer,
Gribskov, M. and Devereux, J., eds., Stockton Press, New York (1991); and
Carillo, H., and
Lipman, D., SIAM J.Applied Math, 48:1073 (1988). Methods to determine identity
are
designed to give the largest match between the sequences tested. Moreover,
methods to
determine identity are codified in publicly available programs. Computer
programs which
can be used to determine identity between two sequences include, but are not
limited to, GCG
(Devereux, J., et al., Nucleic Acids Research 12(1):387 (19$4); suite of five
BLAST
programs, three designed for nucleotide sequences queries (BLASTN, BLASTX, and
TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN)
(Coulson, Trends in Biotechnology, 12: 76-80 (1994); Birren, et ad., Genome
Analysis, 1:
543-559 (1997)). The BLAST X program is publicly available from NCBI and other
sources
3 0 (BLAST Manual, Altschul, S., et ad., NCBI NLM NIH, Bethesda, MD 20894;
Altschul, S., et
al.; J. Mol. Biol., 215:403-410 (1990)). The well known Smith Waterman
algorithm can also
be used to determine identity.
CA 02343969 2001-03-20
WO 00/18889 PCT/US99I22231
9
Parameters for polypeptide sequence comparison typically include the
following:
Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 { 1970)
Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, P~oc. Natt. Acad.
Sci USA 89:10915-10919 ( 1992)
Gap Penalty: 12
Gap Length Penalty: 4
A program which can be used with these parameters is publicly available as the
"gap"
program from Genetics Computer Group, Madison Wisconsin. The above parameters
along
with no penalty for end gap are the default parameters for peptide
comparisons.
Parameters for polynucleotide sequence comparison include the following:
Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970)
Comparison matrix: matches = +10; mismatches = 0
Gap Penalty: SO
Gap Length Penalty: 3
A program which can be used with these parameters is publicly available as the
"gap"
program from Genetics Computer Group, Madison Wisconsin. The above parameters
are the
default parameters for nucleic acid comparisons.
The invention also includes polypeptides of the formula:
X-(RE)n (Rz)-{Rs)n Y
2 0 wherein, at the amino terminus, X is hydrogen, and at the carboxyl
terminus, Y is hydrogen or
a metal, Rt and R3 are any amino acid residue, n is an integer between 1 and
1000, and Rz is
an amino acid sequence of the invention, particularly an amino acid sequence
selected from
the group set forth in the Sequence Listing and preferably SEQ IDNOs: 2, 4, 6,
8, 11, 13, 15,
17, 19, 21, 23, and 218-225. In the formula, Rz is oriented so that its amino
terminal residue
is at the left, bound to Ri, and its carboxy terminal residue is at the right,
bound to R3. Any
stretch of amino acid residues denoted by either R group, where R is greater
than 1, may be
either a heteropvlymer or a homopolymer, preferably a heteropolymer.
Polypeptides of the present invention include isolated polypeptides encoded by
a
polynucleotide comprising a sequence selected from the group of a sequence
contained in
3 0 SEQ ID NOs: 1, 3, 5, 7, 9, 10, 12, 14, 16, 18, 20, 22, and 226-233.
The polypeptides of the present invention can be mature protein or can be part
of a
fusion protein.
CA 02343969 2001-03-20
WO 00118889 PCT/US99/22231
Fragments and variants of the polypeptides are also considered to be a part of
the
invention. A fragment is a variant polypeptide which has an amino acid
sequence that is
entirely the same as part but not all of the amino acid sequence of the
previously described
polypeptides. The fragments can be "free-standing" or comprised within a
larger polypeptide
5 of which the fragment forms a part or a region, most preferably as a single
continuous region.
Preferred fragments are biologically active fragments which are those
fragments that mediate
activities of the polypeptides of the invention, including those with similar
activity or
improved activity or with a decreased activity. Also included are those
fragments that
antigenic or immunogenic in an animal, particularly a human.
10 Variants of the polypeptide also include polypeptides that vary from the
sequences set
forth in the Sequence Listing by conservative amino acid substitutions,
substitution of a
residue by another with like characteristics. In general, such substitutions
are among Ala,
Val, Leu and Ile; between Ser and Thr; between Asp and Glu; between Asn and
Gln; between
Lys and Arg; or between Phe and Tyr. Particularly preferred are variants in
which 5 to 10; 1
to 5; 1 to 3 or one amino acids) are substituted, deleted, or added, in any
combination.
Variants that are fragments of the polypeptides of the invention can be used
to
produce the corresponding full length polypeptide by peptide synthesis.
Therefore; these
variants can be used as intermediates for producing the full-length
polypeptides of the
invention.
2 0 The polynucleotides and polypeptides of the invention can be used, for
example, in
the transformation of various host cells, as further discussed herein.
The invention also provides polynucleotides that encode a polypeptide that is
a mature
protein plus additional amino or carboxyl-terminal amino acids, or amino acids
within the
mature polypeptide (for example, when the mature form of the protein has more
than one
2 5 polypeptide chain). Such sequences can, for example, play a role in the
processing of a
protein from a precursor to a mature form, allow protein transport, shorten or
lengthen protein
half life, or facilitate manipulation of the protein in assays or production.
It is contemplated
that cellular enzymes can be used to remove any additional amino acids from
the mature
protein.
3 0 A precursor protein, having the mature form of the polypeptide fused to
one or more
prosequences may be an inactive form of the polypeptide. The inactive
precursors generally
are activated when the prosequences are removed. Some or all of the
prosequences may be
removed prior to activation. Such precursor protein are generally called
proproteins.
CA 02343969 2001-03-20
PCT/t3S99/22231
WO 00118889
11
The polynucleotide and polypeptide sequences can also be used to identify
additional
sequences which are homologous to the sequences of the present invention. The
most
preferable and convenient method is to store the sequence in a computer
readable medium,
for example, floppy disk, CD ROM, hard disk drives, external disk drives and
DVD, and then
to use the stored sequence to search a sequence database with well known
searching tools.
Examples of public databases include the DNA Database of Japan
(DDBJ)(http:llwww.ddbj.nig.ac.jpn; Genebank
(htt //www ncbi nlm nih ~ov/web/GenbanklIndex.html~ and the European Molecular
Biology Laboratory Nucleic Acid Sequence Database {EMBL)
(http~//www ebi ac uklebi docs/embl db.html). A number of different search
algorithms are
available to the skilled artisan, one example of which are the suite of
programs referred to as
BLAST programs. There are five implementations of BLAST, three designed for
nucleotide
sequences queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein
sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology, 12:
76-80
(1994); Birren, et al., Genome Analysis, 1: 543-S59 (1997)). Additional
programs are
available in the art for the analysis of identified sequences, such as
sequence alignment
programs, programs for the identification of more distantly related sequences,
and the like,
and are well known to the skilled artisan.
2 0 Plant Constructs and Methods of Use
Of interest in the present invention, is the use of the nucleotide sequences,
or
polynucleotides, in recombinant DNA constructs to direct the transcription or
transcription
and translation (expression) of the acyltransferase sequences of the present
invention in a host
2 5 cell.
Of particular interest is the use of the nucleotide sequences, or
polynucleotides, in
recombinant DNA constructs to direct the transcription or transcription and
translation
(expression} of the acyltransferase sequences of the present invention in a
host cell. The
expression constructs generally comprise a promoter functional in a host cell
operably linked
3 0 to a nucleic acid sequence encoding an acyltransferase of the present
invention and a
transcriptional termination region functional in a host cell.
By "host cell" is meant a cell which contains a vector and supports the
replication,
and/or transcription or transcription and translation (expression) of the
expression construct.
CA 02343969 2001-03-20
WO 00/18889 PCT/US99I22231
12
Host cells for use in the present invention can be prokaryotic cells, such as
E. coli, or
eukaryotic cells such as yeast, plant, insect, amphibian, or mammalian cells.
Preferably, host
cells are monocotyledenous or dicotyledenous plant cells.
Of particular interest in the present invention is the use of the
polynucleotides of the
present invention for the preparation of constructs to direct the
transcription or transcription
and translation of the nucleotide sequences encoding an acyltransferase in a
host plant cell.
Plant expression constructs generally comprise a promoter functional in a
plant host cell
operably linked to a nucleic acid sequence of the present and a
transcriptional termination
region functional in a host plant cell.
Those skilled in the art will recognize that there are a number of promoters
which are
functional in plant cells, and have been described in the literature.
Chloroplast and plastid
specific promoters, chloroplast or plastid functional promoters, and
chloroplast or plastid
operable promoters are also envisioned.
One set of promoters are constitutive promoters such as the CaMV35S or FMV35S
promoters that yield high levels of expression in most plant organs. Enhanced
or duplicated
versions of the CaMV35S and FMV35S promoters are useful in the practice of
this invention
(Odell, et ad. (1985) Nature 313:810-812; Rogers, U.S. Patent Number 5,378;
619). In
addition, it may also be preferred to bring about expression of the protein of
interest in
specific tissues of the plant, such as leaf, stem, root, tuber, seed, fruit,
etc., and the promoter
2 0 chosen should have the desired tissue and developmental specificity.
Of particular interest is the expression of the nucleic acid sequences of the
present
invention from transcription initiation regions which are preferentially
expressed in a plant
seed tissue. Examples of such seed preferential transcription initiation
sequences include
those sequences derived from sequences encoding plant storage protein genes or
from genes
2 5 involved in fatty acid biosynthesis in oilseeds. Examples of such
promoters include the 5'
regulatory regions from such genes as napin {Kridl et al., Seed Sci. Res.
1:209:219 (1991)),
phaseolin, zero, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase,
soybean a' subunit
of ji-coingiycinin (soy 7s, (Chen et al., Proc. Natl. Acad. Sci., 83:8560-8564
(1986))) and
oleosin.
3 0 It may be advantageous to direct the localization of proteins conferring
acyltransferase
to a particular subcellular compartment, for example, to the mitochondrion,
endoplasmic
reticulum, vacuoles, chloroplast or other plastidic compartment. For example,
where the
genes of interest of the present invention will be targeted to plastids, such
as chloroplasts, fox
CA 02343969 2001-03-20
WO 00!18889 PCTNS99122231
13
expression, the constructs will also employ the use of sequences to direct the
gene to the
plastid. Such sequences are referred to herein as chloroplast transit peptides
(CTP) or plastid
transit peptides (PTP). In this manner, where the gene of interest is not
directly inserted into
the plastid, the expression construct will additionally contain a gene
encoding a transit
peptide to direct the gene of interest to the plastid. The chioroplast transit
peptides may be
derived from the gene of interest, or may be derived from a heterologous
sequence having a
CTP. Such transit peptides are known in the art. See, for example, Von Heijne
et al. (1991)
PlantlVlol. Biol. Rep. 9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-
17550; della-
Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al. ( 1993) Biochem.
Biophys. Res
Commun. 196:1414-1421; and, Shah et al. (1986) Science 233:478-481. Additional
transit
peptides for the translocation of the protein to the endoplasmic reticulum
(ER), or vacuole
may also find use in the constructs of the present invention.
Depending upon the intended use, the constructs may contain the nucleic acid
sequence which encodes the entire acyltransferase protein, or a portion
thereof. For example,
where antisense inhibition of a given acyltransferase protein is desired, the
entire sequence is
not required. Furthermore, where acyltransferase sequences used in constructs
are intended
for use as probes, it may be advantageous to prepare constructs containing
only a particular
portion of a acyltransferase encoding sequence, for example a sequence which
is discovered
to encode a highly conserved acyltransferase region.
2 0 The skilled artisan will recognize that there are various methods for the
inhibition of
expression of endogenous sequences in a host cell. Such methods include, but
are not limited
to antisense suppression (Smith, et al. { 1988) Nature 334:724-726) , co-
suppression (Napoli,
et al. (1989) Plant Cell 2:279-289), ribozymes (PCT Publication WO 97/10328),
and
combinations of sense and antisense, such as those described by Waterhouse, et
al. {1998)
Proc. Natl. Acad. Sci. USA 95:13959-13964. Methods for the suppression of
endogenous
sequences in a host cell typically employ the transcription or transcription
and translation of
at least a portion of the sequence to be suppressed. Such sequences may be
homologous to
coding as well as non-coding regions of the endogenous sequence.
Regulatory transcript termination regions may be provided in plant expression
3 0 constructs of this invention as well. Transcript termination regions may
be provided by the
DNA sequence encoding the acyltransferase or a convenient transcription
termination region
derived from a different gene source, far example, the transcript termination
region which is
naturally associated with the transcript initiation region. The skilled
artisan will recognize
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
14
that any convenient transcript termination region which is capable of
terminating transcription
in a plant cell may be employed in the constructs of the present invention.
Alternatively, constructs may be prepared to direct the expression of the
acyltransferase sequences directly from the host plant cell plastid. Such
constructs and
methods are known in the art and are generally described, for example, in
Svab, et al. (1990)
Proc. Natl. Acad. Sci. USA 87:8526-8530 and Svab and Maliga ( 1993) Proc.
Natl. Acad. Sci.
USA 90:913-917 and in U.S. Patent Number 5,693,507.
A plant cell, tissue, organ, or plant into which the recombinant DNA
constructs
containing the expression constructs have been introduced is considered
transformed,
transfected, or transgenic. A transgenic or transformed cell or plant also
includes progeny of
the cell or plant and progeny produced from a breeding program employing such
a transgenic
plant as a parent in a cross and exhibiting an altered genotype resulting from
the presence of
an introduced acyltransferase nucleic acid sequence.
The term "introduced" in the context of inserting a nucleic acid sequence into
a cell,
means "transfection", or "transformation" or "transduction" and includes
reference to the
incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell
where the
nucleic acid sequence may be incorporated into the genome of the cell (for
example,
chromosome, plasmid, plastid; or mitochondria) DNA), converted into an
autonomous
replicon; or transiently expressed (for example, transfected mRNA).
2 0 Plant expression or transcription constructs having an acyltransferase as
the DNA
sequence of interest for increased or decreased expression thereof may be
employed with a
wide variety of plant life, particularly, plant life involved in the
production of vegetable oils
for edible and industrial uses. Plants of interesC in the present invention
include
monocotyledenous and dicotyledenous plants. Most especially preferred are
temperate
2 5 oilseed crops. Plants of interest include, but are not limited to,
rapeseed (Canola and High
Erucic Acid varieties), sunflower, safflower, cotton, soybean, peanut, coconut
and oil palms,
and corn. Depending on the method for introducing the recombinant constructs
into the host
cell, other DNA sequences may be required: Importantly, this invention is
applicable to
dicotyledyons and monocotyledons species alike and will be readily applicable
to new andlor
3 0 improved transformation and regulation techniques.
As used herein; the term "plant" includes reference to whole plants, plant
organs (for
example, leaves, stems, roots, etc.), seeds, and plant cells and progeny of
same. Plant cell, as
used herein includes, without limitation, seeds suspension cultures, embryos,
meristematic
CA 02343969 2001-03-20
WO OOII8889 PCT/US99/22231
regions, callus tissue, leaves roots shoots, gametophytes, sporophytes,
pollen, and
microspores. The class of plants which can be used in the methods of the
present invention is
generally as broad as the class of higher plants amenable to transformation
techniques,
including both monocotyledenous and dicotyledenous plants. Particularly
preferred plants of
5 interest include, but are not limited to, rapeseed (Canola and High Erucic
Acid varieties),
sunflower, safflower, cotton, soybean, peanut, coconut and oil palms, and
corn. Most
especially preferred plants include Brassica, soybean, and corn.
As used herein, "transgenic plant" includes reference to a plant which
comprises
within its genome a heterologous polynucleotide. Generally, the heteroiogous
polynucleotide
10 is stably integrated within the genome such that the polynucleotide is
passed on to successive
generations. The heterologous polynucleotide may be integrated into the genome
alone or as
part of a recombinant expression cassette. "Transgenic" is used herein to
include any cell,
cell line, callus, tissue, plant part or plant, the genotype of which has been
altered by the
presence of heterologous nucleic acid including those transgenics initially so
altered as well
15 as those created by sexual crosses or asexual propagation from the initial
transgenic.
Thus a plant having within its cells a heterologous polynucleotide is referred
to herein
as a transgenic plant. The heterologous polynucleotide can be either stably
integrated into the
genorne, or can be extra-chromosomal. Preferably, the polynucleotide of the
present
invention is stably integrated into the genome such that the polynucleotide is
passed on to
2 0 successive generations. The polynucleotide is integrated into the genorne
alone or as part of a
recombinant expression cassette. "Transgenic" is used herein to include any
cell, cell line,
callus, tissue, plant part or plant, the genotype of which has been altered by
the presence of
heterologous nucleic acids including those transgenics initially so altered as
well as those
created by sexual crosses or asexual reproduction of the initial transgenics.
2 5 As used herein, "heterologous" in reference to a nucleic acid is a nucleic
acid that
originates from a foreign species, or, if from the same species, is
substantially modified from
its native form in composition and/or genomic locus by deliberate human
intervention. For
example, a promoter operably linked to a heterologous structural gene is from
a species
different from that from which the structural gene was derived, or, if from
the same species,
3 0 one or bath are substantially modified from their original form. A
heterologous protein may
originate from a foreign species, or, if from the same species, is
substantially modified from
its original form by deliberate human intervention.
CA 02343969 2001-03-20
WO 00/18889 PCTIUS99/22231
16
As used herein, a "recombinant expression cassette" is a nucleic acid
construct,
generated recombinantly or synthetically, with a series of specified nucleic
acid elements
which permit transcription of a particular nucleic acid in a target cell. The
recombinant
expression cassette can be incorporated into a plasmid, chromosome,
mitochondria) DNA,
plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant
expression cassette
portion of an expression vector includes, among other sequences, a nucleic
acid sequence to
be transcribed and a promoter.
It is contemplated that the gene sequences may be synthesized, either
completely or in
part, especially where it is desirable to provide plant-preferred sequences.
Thus, all or a
portion of the desired structural gene (that portion of the gene which encodes
the
acyltransferase protein) may be synthesized using codons preferred by a
selected host. Host-
preferred codons may be determined, for example, from the codons used most
frequently in
the proteins expressed in a desired host species.
One skilled in the art will readily recognize that antibody preparations,
nucleic acid
probes (DNA and RNA) and the like rnay be prepared and used to screen and
recover
"homologous" or "related" acyltransferase from a variety of plant sources.
Homologous
sequences are found when there is an identity of sequence, which may be
determined upon
comparison of sequence information, nucleic acid or amino acid, or through
hybridization
reactions between a known acyltransferase and a candidate source. Conservative
changes,
such as Glu/Asp, Valllle, SerIThr, Arg/Lys and Gln/Asn may also be considered
in
determining sequence homology. Amino acid sequences are considered homologous
by as
little as 25% sequence identity between the two complete mature proteins. (See
generally,
Dooiittle, R.F., OF URFS and ORFS (University Science Books, CA, 1986.)
Thus, other acyltransferase sequences can be obtained from the specific
exemplified
2 5 sequences provided herein. Furthermore, it will be apparent that one can
obtain natural and
synthetic sequences, including modified amino acid sequences and starting
materials for
synthetic-protein modeling from the exemplified sequences and from
acyltransferases which
are obtained through the use of such exemplified sequences. Modified amino
acid sequences
include sequences which have been mutated, truncated, increased and the like,
whether such
3 0 sequences were partially or wholly synthesized. Sequences which are
actually purified from
plant preparations or are identical or encode identical proteins thereto,
regardless of the
method used to obtain the protein or sequence, are equally considered
naturally derived.
CA 02343969 2001-03-20
WO 00/18889 l ~ PCTIUS99/22231
For immunological screening, antibodies to the acyltransferase protein can be
prepared by injecting rabbits or mice with the purified protein or portion
thereof, such
methods of preparing antibodies being well known to those in the art. Either
monoclonal or
polyclonal antibodies can be produced, although typically polyclonal
antibodies are more
useful for gene isolation. Western analysis may be conducted to determine that
a related
piotein is present in a crude extract of the desired plant species, as
determined by cross-
reaction with the antibodies to the acyitransferase protein. When cross-
reactivity is observed,
genes encoding the related proteins are isolated by screening expression
libraries representing
the desired plant species. Expression libraries can be constructed in a
variety of connmercially
available vectors, including lambda gtl l, as described in Sambrook, et al.
(Molecular
Cloning: A Laboratory Manual, Second Edition ( 1989) Cold Spring Harbor
Laboratory, Cold
Spring Harbor, New York).
The nucleic acid sequences associated with acyltransferase proteins will find
many
uses. For example, recombinant constructs can be prepared which can be used as
probes, or
which will provide for expression of the acyltransferase protein in host cells
to produce a
ready source of the enzyme and/or to modify the composition of triglycerides
found therein.
Other useful applications may be found when the host cell is a plant host
cell, either in vitro
or in viva.
The modification of fatty acid compositions may also affect the fluidity of
plant
2 0 membranes. Different lipid concentrations have been observed in cold-
hardened plants, for
example. By this invention, one may be capable of introducing traits which
will lend to chill
tolerance. Constitutive or temperature inducible transcription initiation
regulatory control
regions may have special applications for such uses.
As discussed above, nucleic acid sequence encoding an acyltransferase of this
2 5 invention may include genornic, cDNA or mRNA sequence. By "encoding" is
meant that the
sequence corresponds to a particular amino acid sequence either in a sense or
anti-sense
orientation. By "extrachromosomal" is meant that the sequence is outside of
the plant
genome of which it is naturally associated. By "recombinant" is meant that the
sequence
contains a genetically engineered modification through manipulation via
mutagenesis,
3 0 restriction enzymes, and the like.
Once the desired acyltransferase nucleic acid sequence is obtained, it rnay be
manipulated in a variety of ways. Where the sequence involves non-coding
flanking regions,
the flanking regions may be subjected to resection, mutagenesis, etc. Thus,
transitions,
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99/22231
18
transversions, deletions, and insertions may be performed on the naturally
occurring
sequence. In addition, all or part of the sequence may be synthesized. In the
structural gene,
one or more codons may be modified to provide for a modified amino acid
sequence, or one
or more codon mutations may be introduced to provide for a convenient
restriction site or
other purpose involved with construction or expression. The structural gene
may be further
modified by employing synthetic adapters, linkers to introduce one or more
convenient
restriction sites, or the like.
The nucleic acid or amino acid sequences encoding an acyltransferase of this
invention may be combined with other non-native, or "heterologous", sequences
in a variety
of ways. By "heterologous" sequences is meant any sequence which is not
naturally found
joined to the acyltransferase, including, fox example, combinations of nucleic
acid sequences
from the same plant which are not naturally found joined together.
The DNA sequence encoding an acyltransferase of this invention may be employed
in
conjunction with all or part of the gene sequences normally associated with
the
acyltransferase. In its component parts, a DNA sequence encoding
acyltransferase is
combined in a DNA construct having, in the 5' to 3' direction of
transcription, a transcription
initiation control region capable of promoting transcription and translation
in a host cell, the
DNA sequence encoding plant acyltransferase and a transcription and
translation termination
region.
Potential host cells include both prokaryotic cells, such as E.coli and
eukaryotic cells
such as yeast, insect, amphibian, or mammalian cells. A host cell may be
unicellular or found
in a multicellular differentiated or undifferentiated organism depending upon
the intended
use. Preferably, host cells of the present invention include plant cells, both
monocotyledenous and dicotyledenous. Cells of this invention may be
distinguished by
2 5 having a sequence foreign to the wild-type cell present therein, for
example, by having a
recombinant nucleic acid construct encoding an acyltransferase therein.
The methods used for the transformation of the host plant cell are not
critical to the
present invention. The transformation of the plant is preferably permanent,
i.e. by integration
of the introduced expression constructs into the host plant genome, so that
the introduced
3 0 constructs are passed onto successive plant generations. The skilled
artisan will recognize
that a wide variety of transformation techniques exist in the art, and new
techniques are
continually becoming available. Any technique that is suitable for the target
host plant can be
employed within the scope of the present invention. For example, the
constructs can be
CA 02343969 2001-03-20
WO 00118889 PCT/ITS99l22231
19
introduced in a variety of forms including, but not limited to as a strand of
DNA, in a
plasmid, or in an artificial chromosome. The introduction of the constructs
into the target
plant cells can be accomplished by a variety of techniques, including, but not
limited to
calcium-phosphate-DNA co-precipitation, electroporation, microinjection,
Agrobacterium
infection, liposomes or microprojectile transformation. The skilled artisan
can refer to the
literature for details and select suitable techniques for use in the methods
of the present
invention.
Normally, included with the DNA construct will be a structural gene having the
necessary regulatory regions far expression in a host and providing for
selection of
transformant cells. The gene may provide for resistance to a cytotoxic agent,
e.g. antibiotic,
heavy metal, toxin, etc., complementation providing prototrophy to an
auxotrophic host, viral
immunity or the like. Depending upon the number of different host species the
expression
construct or components thereof are introduced, one or more markers may be
employed,
where different conditions for selection are used for the different hosts.
Where Agrobacterium is used for plant cell transformation, a vector may be
used
which may be introduced into the Agrobacterium host for homologous
recombination with T-
DNA or the Ti- or Ri-plasmid present in the Agrobacterium host. The Ti- or Ri-
plasmid
containing the T-DNA for recombination may be armed (capable of causing gall
formation)
or disarmed (incapable of causing gall formation), the latter being
permissible, so long as the
2 0 vir genes are present in the transformed Agrobacterium host. The armed
plasmid can give a
mixture of normal plant cells and gall.
In some instances where Agrobacterium is used as the vehicle for transforming
host
plant cells, the expression or transcription construct bordered by the T-DNA
border regions)
will be inserted into a broad host range vector capable of replication in E.
coli and
2 5 Agrobacterium; there being broad host range vectors described in the
literature. Commonly
used is pRK2 or derivatives thereof. See, for example, Ditta, et al., (Proc.
Nat. Acad. Sci.,
U.S.A. (1980) 77:7347-7351) and EPA 0 120 515, which are incorporated herein
by reference.
Alternatively, one may insert the sequences to be expressed in plant cells
into a vector
containing separate replication sequences, one of which stabilizes the vector
in E. coli, and
3 0 the other in Agrobacterium. See, for example, McBride and Summerfelt
(Plant Mol. Biol.
( 1990) 14:269-276}, wherein the pRiHRI (Jouanin, et al., Mol. Gen. Genet. (
1985) 201:370-
374) origin of replication is utilized and provides for added stability of the
plant expression
vectors in host Agrobacterium cells.
CA 02343969 2001-03-20
WU 00/18$$9 PCTIUS99/22231
Included with the expression construct and the T-DNA will be one or more
markers,
which allow for selection of transformed Agrobacterium and transformed plant
cells. A
number of markers have been developed for use with plant cells, such as
resistance to
chloramphenicol, kanamycin, the aminoglycoside 6418, hygromycin, or the Like.
The
5 particular marker employed is not essential to this invention, one or
another marker being
preferred depending on the particular host and the manner of construction.
For transformation of plant cells using Agrobacterium, explants may be
combined and
incubated with the transformed Agrobacterium for sufficient time for
transformation, the
bacteria killed, and the plant cells cultured in an appropriate selective
medium. Once callus
10 forms, shoot formation can be encouraged by employing the appropriate plant
hormones in
accordance with known methods and the shoots transferred to rooting medium for
regeneration of plants. The plants may then be grown to seed and the seed used
to establish
repetitive generations and for isolation of vegetable oils.
There are several possible ways to obtain the plant cells of this invention
which
15 contain multiple expression constructs. Any means for producing a plant
comprising a
construct having a nucleic acid sequence of the present invention, and at
least one other
construct having another DNA sequence encoding an enzyme are encompassed by
the present
invention. For example, the expression construct can be used to transform a
plant at the same
time as the second construct either by inclusion of both expression constructs
in a single
2 0 transformation vector or by using separate vectors, each of which express
desired genes. The
second construct can be introduced into a plant which has already been
transformed with the
first expression construct, or alternatively, transformed plants, one having
the first construct
and one having the second construct, can be crossed to bring the constructs
together in the
same plant.
2 5 In general, acyltransferase proteins are active in the transfer of acyl
groups from a
donor to a variety of different substrates. For example, diacylglycerol
acyltransferases add
acyl groups to diacylglycerol to form triacylglycerol (TAG),
oracyl:CoA:cholesterol
acyltransferase uses an acyl-CoA as a donor to transfer an acyl group to a
sterol to form a
sterol ester. Typically, the substrates include, but are not limited to
glycerides, including
3 0 mono and diglycerides, sterols, stanols, phosphatides, and the like.
Donors include, but are
not limited to acyl-CoA and acyl-ACP molecules.
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
21
The invention now being generally described, it will be more readily
understood by
reference to the following examples which are included for purposes of
illustration only and
are not intended to limit the present invention.
EXAMPLES
Example 1: RNA Isolations
Total RNA from the inflorescence and developing seeds of Arabidopsis thaliana
is
isolated for use in construction of complementary (cDNA) libraries. The
procedure is an
adaptation of the DNA isolation protocol of Webb and Knapp (D.M. Webb and S.J.
Knapp,
(1990) Plant Molec. Reparter, 8, 180-185). The following description assumes
the use of lg
fresh weight of tissue. Frozen seed tissue is powdered by grinding under
liquid nitrogen. The
powder is added to lOml REC buffer {50rnM Tris-HCI, pH 9, 0.8M NaCI, IOmM
EDTA,
0.5% w/v CTAB (cetyltrimethyl-ammonium bromide)) along with 0.2g insoluble
polyvinylpolypyrrolidone, and ground at room temperature. The homogenate is
centrifuged
for 5 minutes at 12,000 xg to pellet insoluble material. The resulting
supernatant fraction is
extracted with chloroform, and the top phase is recovered.
2 0 The RNA is then precipitated by addition of 1 volume RecP (50mM Tris-HCL
pH9,
IOmM EDTA and 0.5% (w/v) CTAB) and collected by brief centrifugation as
before. The
RNA pellet is redissolved in 0.4 ml of 1M NaCI. The RNA pellet is redissolved
in water and
extracted with phenol/chloraform. Sufficient 3M potassium acetate (pH 5) is
added to make
the mixture 0.3M in acetate, followed by addition of two volumes of ethanol to
precipitate the
2 5 RNA. After washing with ethanol, this final RNA precipitate is dissolved
in water and stored
frozen.
Alternatively, total RNA may be obtained using TRIzol reagent (BRL-
Lifetechnologies, Gaithersburg, MD) following the manufacturers protocol. The
RNA
precipitate is dissolved in water and stored frozen.
Example 2: Identification of Acyltransferase Homology Sequences
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
22
Searches are performed on a Silicon Graphics Unix computer using additional
Bioaccellerator hardware and GenWeb software supplied by Compugen Ltd. This
software
and hardware enables the use of the Smith-Waterman algorithm in searching DNA
and
protein databases using profiles as queries. The program used to query protein
databases is
profilesearch. This is a search where the query is not a single sequence but a
profile based on
a multiple alignment of amino acid or nucleic acid sequences. The profile is
used to query a
sequence data set, i.e., a sequence database. The profile contains all the
pertinent information
for scoring each position in a sequence, in effect replacing the "scoring
matrix" used for the
standard query searches. The program used to query nucleotide databases with a
protein
profile is tprofilesearch. Tprofilesearch searches nucleic acid databases
using an amino acid
profile query. As the search is running, sequences in the database are
translated to amino acid
sequences in six reading frames. The output file for tprofilesearch is
identical to the output
file for profilesearch except for an additional column that indicates the
frame in which the
best alignment occurred.
The Smith-Waterman algorithm, (Smith and Waterman (1981) supra), is used to
search for similarities between one sequence from the query and a group of
sequences
contained in the database. E score values as well as other sequence
information, such as
conserved peptide sequences of HXXXXD and PEG are used to identify related
sequences.
2 0 By using the conserved peptide sequence information, E score values of
greater than E-12 and
E-8 are considered. For example, the EST sequence originally used to identify
ATAT2 had
an E score of 0.0094, while the EST sequence originally used to identify
ATLPAAT1 had an
E score of 0.0868.
A protein sequence of glycerol-3-phosphate from E. toll (Swiss Prot Accession
2 5 P00482) is used to search the NCBI non-redundant protein database using
BLAST. In the
first round of searches, other membrane forms of G3PAAT are identified. In
subsequent PSI-
BLAST searches (Altschul, et al. ( 1997) Nucleic Acids Res 25:3389-3402),
LPAATs and
other acyltransferases are identified. Using sequence alignment software
programs, G3PAAT
and different LPAAT amino acid sequences are aligned, and a profile is
generated using a
3 0 homologous sequence region, between amino acids 256 and 459 of the E. toll
sequence.
The identified 204 amino acid is used to query the protein database using PSI-
BLAST.
After 5 iterations of PSI-BLAST, the profile generated from this new query
(Figure 1)
CA 02343969 2001-03-20
WO 00/18889 PCT/US99122231
23
identified soluble forms of G3PAAT. Prior to this identification, no sequence
homology had
been identified between the membrane and soluble forms of G3PAAT.
Example 3: Excision of PSI-BLAST Profile
The profile generated from the queries using PSI-BLAST is excised from the
hyper
text markup language (html) file. The worldwide web (www)/html interface to
psiblast at
ncbi stores the current generated profile matrix in a hidden field in the html
file that is
returned after each iteration of psiblast. However, this matrix has been
encoded into string62
(s62) format for ease of transport through html. String62 format is a simple
conversion of the
values of the matrix into html legal ascii characters.
The encoded matrix width (x axis) is 26 characters, and comprise the consensus
characters, the probabilities of each amino acid in the order
A,B,C,D,E,F,G,H,I,K,L,M,N,
P,Q,R,S,T,V,W,X,Y,Z (where B represents D and N, and Z represents Q and E, and
X
represents any amino acid), gap creation value, and gap extension value.
The length (y axis) of the matrix corresponds to the length of the sequences
identified
by PSI-BLAST. The order of the amino acids corresponds to the conserved amino
acid
sequence of the sequences identified using PSI-BLAST, with the N-terminal end
at the top of
2 0 the matrix. The probabilities of other amino acids at that position are
represented for each
amino acid along the x axis, below the respective single letter amino acid
abbreviation.
Thus, each row of the profile consists of the highest scoring (consensus)
amino acid,
followed by the scores for each possible amino acid at that position in
sequence matrix, the
score for opening a gap that that position, and the score for continuing a gap
at that position.
2 5 The string62 file is converted back into a profile for use in subsequent
searches. The
gap open field is set to 11 and the gap extension field is set to 1 along the
x axis. The gap
creation and gap extension values are known, based on the settings given to
the PSI-BLAST
algorithm. The matrix is exported to the standard GCG profile form. This
format can be read
by GenWeb.
3 0 The algorithm used to convert the string62 formatted file to the matrix is
outlined in
Table 1.
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
24
Table 1
1. if encoded character z then the value is blast score min
2. if encoded character Z then the value is blast score max
3. else if the encoded character is uppercase then its value is (64-(ascii #
of char))
4. else if the encoded character is a digit the value is {{ascii # of char)-
48)
5. else if the encoded character is not uppercase then the value is {(ascii #
of char) - 87)
6. ALL B positions are set to min of D and N amino acids at that row in
sequence matrix
7. ALL Z positions are set to min of Q amd E amino acids at that row in
sequence matrix
8. ALL X positions are set to min of all amino acids at that row in sequence
matrix
9. kBLAST_SCORE_MAX=999;
10. kBLAST SCORE MIN=-999;
11. all gap opens are set to 11
12. all gap lens are set to 1
Example 4; Identification of Novel Acyltransferase Related Amino Acid
Sequences
2 0 The profile (Figure 1 ) is used in further queries to identify a number of
previously
unidentified proteins from yeast as novel acyltransferases. A protein is
identified from an
Arabidopsis protein sequence database (ATAT 1 ) (SEQ ID N0:2). Sequences are
also
identified from nucleic acid databases (Table 2}
2 5 Table 2
Database ID Number BLAST Search Hits Log probability
Saccharomyces cerevisiae
gi 1078509 Limnanthes putative LPAAT e-10 (SEQ ID
N0:217)
3 0 gi 586485 Limnanthes putative LPAAT e-13 (SEQ ID
N0:218)
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
gi 320748 Limnanthes putative LPAAT e-I9 (SEQ ID
N0:219)
gi 2506920 SUPPRESSES CTR1 (choline transport mutant) (SEQ
ID N0:220)
gi 549b27 similar to CTRL e-118 {SEQ ID
5 N0:221)
gi 2133031 unidentified (SEQ ID
N0:222)
gi 2132939 unidentified (SEQ ID
N0:223)
10 gi 2132299 TAFAZZIN e-I4 (SEQ ID
N0:224)
In Table 2, the gi number is the database identifier, the middle column shows
the
results of BLAST searches against the NCBI NR protein database, and the log
probability
15 number shows represents the log of the probability of such a match
occurring by random
chance. These proteins, including the ATAT 1 protein sequence, are identified
using the
original PSI-BLAST search of the NCBI NR protein database. Thus, these
proteins are novel
acyltransferase related proteins with unidentified activities.
The Arabidopsis acyltransferase sequence, herein referred to as ATAT1, is also
2 0 identified using the original PSI-BLAST search of the NCBI NR protein
database, and did not
have an annotated function.
Additional Arabidopsis amino acid sequences related to acyltransferases are
identified
from the databases, referred to as ATAT2est, ATAT3est, ATAT4est, ATATSest,
ATATbest,
ATAT7est, ATATBest, ATAT9, ATAT 10, and ATAT 11 est. Furthermore, Arabidopsis
2 5 amino acid sequences are identified which demonstrate sequence similarity
to known
lysophosphatidic acid, referred to as ATLPAAT 1. The sequences of ATAT9 and
ATAT 10
are identified from the database as genomic sequences, all otherArabidopsis
sequences are
identified as ESTs.
Example S: Sequence Analysis of the Novel Acyltransferases
CA 02343969 2001-03-20
WO 00/18889 26 PCT/US99122231
To obtain the entire coding region corresponding to the Arabidopsis
acyltransferase
sequences, synthetic oligo-nucleotide primers are designed to amplify the 5'
and 3' ends of
partial cDNA clones containing acyltransferase related sequences. Primers are
designed
according to the respective Arabidopsis acyltransferase related sequences
(Table 3) and used
in Rapid Amplification of cDNA Ends (RACE) reactions (Frohman et al. ( 1988)
Proc. Natl.
Acad. Sci. USA 85:8998-9002) using the Marathon cDNA amplification kit
(Clontech
Laboratories Inc, Palo Alto, CA). Primers with an R designation are used for
5' RACE
reactions, and primers with an F designation are used for 3' RACE reactions.
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
27
Table 3
ATAT2
ATAT2R1 CCATCCGCTTCAAGGGAACGACACCCATCA (SEQ ID N0:135)
ATAT2R2 TCCCTGTCTTGCTTGATGAACTTAAAGCTTG (SEQ ID N0:136)
~ ATAT2R3 ACAGCAGGAGTGTCTGATGATGGCAGATTC (SEQ ID N0:137)
ATAT3
ATAT3R1 ACTGGAGTTCCAGCCAAAAATGCACCTGTC {SEQ ID N0:138)
ATAT3R2 GATACACCCTTGAAATCAGGCGATTTTGCT (SEQ ID N0:139}
ATAT4
ATAT4R 1 TTGCAAATTCAATTCCTGTTTCACCGGGCC (SEQ ID N0:140)
ATAT4R2 GTTTTCTGCTATTCCAGAAGGCGTCAACAA (SEQ ID NO:141 )
ATATS
ATATSR1 CATTGAAGATCCGTCCGTGAAGTTNCCTTACC (SEQ ID N0:142)
ATATSR2 TCGAGCTGTGATCGATGATTGGCTGTGAAG (SEQ ID N0:143}
ATATSF1 GTCTCTTCAAAAACACACACACACGTCTCT (SEQ ID N0:144)
~ ATATSF2 GTCTCTTCAAAAACACACACACACGTCTCT (SEQ iD N0:145)
ATAT6
H76348-F1GTAGAGAGCCTTACTTGCTTCGGTTTAGTC (SEQ ID N0:146)
H76348-F2ACGTCATCGTACCTGTTGCTATTGACTCAC (SEQ ID N0:147)
H76348-R1ACTTTTCCATTGTCAGGGACTCCTCGACAC (SEQ ID N0:148)
2 H76348-R2ACGGTGTAGGAAGGGAAAGGATTCAAAAGG (SEQ ID N0:149)
5
ATAT7
ATTS0193-F1GCGAT~AACTACAGAGTCGGATTCTTCCTC (SEQ ID N0:150)
ATTS0193-F2CCGGTTTACGAGATTACGTTCTTGAACCAG (SEQ ID NO:151)
ATTS0193-R1CAATGGAGACAAGGCTCGAAAGTGCTAACC (SEQ ID N0:152)
~ ATTS0193-R2 ATTCTCTGAACATAGTTCGCCACGGTCATG {SEQ ID N0:153)
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99/22231
28
ATAT8
AA042618-F1 GAAATCCAACGCCTTCCCAATATCACTCTG (SEQ ID N0:154)
AA042618-F2 CTTCAACTTTCCATCAGGATCTTGGCACGT (SEQ ID N0:155)
AA042618-R 1 ACCACTTGTTAGAGACCTTACCTGCTTAGG (SEQ ID N0:156)
~ AA042618-R2 TCCTACCTACACCATCCAATTTCTCGACCC (SEQ ID N0:157)
ATAT 11
ATAT11R1 CTGCGTCAAGTGAGCAACTCAGTTCTTGCA {SEQ ID N0:158)
ATAT11R2 TGGGAAGCAGCACGTTGTTCAGTATCGGAA {SEQ ID N0:159)
~ ATAT 11 R3 TAGCCTCTGTGTAATCTGTGCCCTCGGGGA {SEQ ID NO: l b0)
From the nucleic acid sequences obtained from the RACE reactions, protein
sequence
is predicted for each nucleic acid sequence using Macvector software. Nucleic
acid sequences
are provided for ATAT1 (SEQ ID NO:1), ATAT2 (SEQ ID N0:3), ATAT3 (SEQ ID
NO:S),
ATAT4 (SEQ ID N0:7), ATATS {SEQ ID NO:9), ATAT6 (SEQ ID NO:10), ATAT7 (SEQ
ID N0:12), ATAT8 (SEQ ID N0:14), ATAT9 (SEQ ID N0:16), ATAT10 (SEQ ID NO:18),
ATAT 11 (SEQ ID N0:20) and ATLPAAT 1 (SEQ ID N0:22), respectively.
The protein sequence derived from the ATAT 1 {SEQ ID N0:2) nucleic acid
sequence
2 0 from Arabidopsis has- a predicted molecular mass of 32.5 kDa, and a PI of
9.74. Alignment
of the Arabidopsis acyltransferase with several LPAAT and G3PAAT shows that
some of the
domains that are conserved between LPAAT and G3PAAT are conserved in the new
acyltransferase protein.
The ATAT2 nucleic acid sequence is predicted to encode a 312 amino acid
protein
2 5 (SEQ ID N0:4), with a molecular weight of 34.6 kD, and a pI of 9.99. The
ATAT2 protein
may also contain 2 to 3 transmernbrane domains. However, the protein encoded
by the
ATAT2 nucleic acid sequence may be longer than predicted because of the
absence of an
inframe stop codon upstream of the ATG start codon used.
The ATAT3 nucleic acid sequence is predicted to encode a 398 amino acid
protein
3 0 (SEQ ID N0:6), with a molecular weight of 44.7 kD, and a pI of 5.62. The
ATAT3 protein
may contain 1 to 4 transmernbrane domains. The ATAT4 nucleic acid sequence is
predicted
to encode a 317 amino acid protein (SEQ ID N0:8), with a molecular weight of
36.5 kD, and
a pI of 9.67. The ATAT4 protein is predicted to have 2 to S transmembrane
domains.
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99/22231
29
The ATLPAAT 1 nucleic acid sequence is predicted to encode a 389 amino acid
protein {SEQ ID N0:23), with a molecular weight of 43.7 kD, and a pI of 9.52.
The
ATLPAAT 1 protein is predicted to have up to 3 transmembrane domains. The
protein
predicted from the ATLPAAT1 nucleic acid sequence is similar to LPAATs
reported for
Brassaca, maize, and meadowfoam (described in PCT Publication WO 94/13814).
The
ATAT11 nucleic acid sequence is predicted to encode a 375 amino acid protein
(SEQ ID
N0:21 ), with a molecular weight of 43.5 kD, and a pI of 9.45. The deduced
amino acid
sequences of ATAT6 (SEQ ID NO:I 1), ATAT7 (SEQ ID N0:13), ATAT8 (SEQ ID
N0:15},
ATAT9 (SEQ ID N0:17), and ATAT10 (SEQ iD N0:19) are also provided
A sequence region approximately 30 amino acids upstream through approximately
100 amino acids downstream of the conserved amino acid sequences HXXXXD (Heath
and
Rock, (1998) J. Bacteriol. 180(6):1425-1430) and PEG (Neuwald (1997) Curr
Biol7:R465-
R466) of the predicted amino acid sequences derived from the nucleic acid
sequences of
ATATI, ATAT2, ATAT3, ATAT4, ATAT6, ATAT7, ATATB, ATAT9, ATAT10,
ATLPAAT1, and ATAT11 are compared to the amino acid sequences of
lysophosphatidic
acid acyltransferase (Jojoba AT (SEQ ID N0:162, the nucleic acid sequence is
provided in
SEQ ID NO:I61), maize AT (PCT Publication WO 94/13814), PLSC coco{GenBank
accession 1098605), PLSC Lim(GenBank accession 1209507), PLSC, Ecoli (GenBank
accession 1209507), and PLSC Yeast(GenBank accession 464422}) and glycerol-3-
phosphate
2 0 acyltransferase (PLSB Ecoli(GenBank accession 130326) and PLSB
Mouse(GenBank
accession 2498786)) (Figure 2), and similarities are identified (Figure 2 and
Figure 3).
Sequence comparisons reveal several classes of acyltransferases exist based on
conserved amino acid sequences identified in the comparisons in Figure 2. For
example,
ATAT1, ATAT6, ATAT7, ATATB, and ATAT9, contain the conserved amino acid
sequences of VTYSXS(SEQ ID NO: 128), VXLTRXR(SEQ ID NO: 129), LXXGDLV(SEQ
ID NO: 132} between the HXXXXD and PEG sequences. In addition, ATAT1, ATAT6,
ATAT7, ATATB, and ATAT9 also contain the conserved sequences CPEGT(SEQ ID NO:
130) which comprises the PEG sequence, as well as IVPVA(SEQ ID NO: 131) and
VANXXQ {SEQ ID NO: 134)(Figure 2) downstream of the PEG sequence. The
sequences
3 0 corresponding to ATAT 1, ATAT7, and ATAT9 are the most closely related in
this class, with
similarities between ATATi and ATAT9 of 67.0%, between ATAT1 and ATAT7 of
58.2%
and between ATAT9 and ATAT7 of 63.9% (Figure 3B).
CA 02343969 2001-03-20
WO 00/18889 PCTIUS99/22231
~a
Sequence comparisons also demonstrate that the sequence of ATLPAAT1 is most
closely related to the jojoba LPAAT (82.3% similar), and maize (78.0%
similar).
Furthermore, sequence analysis demonstrates that ATAT4 is the most divergent
sequence with the highest similarity to ATAT10 (18.5%). The highest similarity
{i5.3%) to a
known sequence is with a meadowfoam (Limnanthes douglassi) LPAAT. However, the
sequences of ATAT4 and ATATiO share several conserved peptide sequences with
the amino
acid sequences of ATAT2 and ATAT3 (Figure 2), VXNHXS (SEQ ID NO: 127) where
the H
comprises the conserved H of the HXXXXD sequence and FXXGAF (SEQ ID NO: 133)
downstream of the PEG sequence.
Example 6: Identification of Additional Acyltransferase Sequences
The novel Arabidopsis sequences identified above are used to search
proprietary
databases containing soybean and corn EST sequences. The results of this
search identifies
EST sequences from soybean (SEQ ID N0:24 through SEQ ID NO: 85) as well as
from corn
(SEQ ID NO: 86 through SEQ ID N0:126) as encoding acyltransferase related
proteins.
Sequence comparisons between the various EST sequences and the complete
Arabidopsis sequences reveals that the identified EST sequences demonstrate
higher
2 0 similarity to the various Arabidopsis sequences as determined by BLAST
scores.
Expressed Sequence Tag (EST) sequences from soybean and corn databases are
identified which are most closely related by BLAST score to ATAT 1 (SEQ ID
NOS:24-29
and SEQ ID NOS:86-88, respectively), ATAT2 (SEQ ID NO: 30 and SEQ ID N0:89,
respectively), ATAT3 (SEQ ID NOS:31-35 and SEQ ID NOS:90-94, respectively),
ATAT4
(SEQ ID NOS:36-44 and SEQ ID NOS:95-100, respectively), ATAT6 (SEQ ID NOS:45-
49
and SEQ ID NO:101, respectively), ATAT7 (SEQ ID NOS:50-54 and SEQ ID NOS:102-
103,
respectively), ATAT8 (SEQ ID NOS:55-56 and SEQ ID N0:104, respectively), ATAT9
{SEQ ID NOS:57-79 and SEQ ID NOS:105-111, respectively), ATAT10 (SEQ ID NOS:80-
81 and SEQ ID N0:112, respectively), ATAT11, {SEQ ID NOS:82-85 and SEQ ID
3 0 NOS:123-126, respectively), and ATLPAAT1 (SEQ ID NOS: 113-122
respectively).
CA 02343969 2001-03-20
WO 00/18889 31 PCT/US99l22231
Example 7: Expression Construct Preparation
A series of synthetic oligo nucleotide primers were prepared for use in
Polymerase
Chain Reactions (PGR) to amplify the entire DNA sequences encoding the various
acyltransferase sequences identified above. The sequences are listed in Table
3.
Table 3
Primer Sequence ( listed 5 ~ _~ . ~ S~Q =n
NO:
ATAT1F AAGCTTGCATGCGTCGACACAATGGTTCATGCGACCAAGT 163
CAG
ATAT1R GGTACCGTCGACTCACTTCTTGGTGTTGTTGATAG 164
ATAT2F GGATCCGCGGCCGCACAATGACGAGCTTTACTACTTCCCT 165
TCAT
ATAT2R GGATCCCCTGCAGGTTAGAGATCCATTGATTCTGCAAT 166
ATAT3F GGATCCGCGGCCGCATAATGGAATCAGAGCTCAAAGAT 167
ATAT3R GGATCCCCTGCAGGTCATTCTTCTTTCTGATGGA.A.ATC 168
ATAT4F GGATCCGCGGCCGCACAATGACTCGTTCACAAGATGTTTC 169
A
ATAT4R GGATCCCCTGCAGGTCACTTCTCTTCCAATCTAGCCAG 170
ATAT6F GGATCCGCGGCCGCACAATGTCCGGTAATAAGATCTCGAC 171
TCTTCA
ATAT6R GGATCCCCTGCAGGTTATTTTTTCTTGACAACTCCGTTAT 172
TACCGG
ATAT7F ATATCCGCGGCCGCACAATGGTTATGGAGCAAGCTGGAA 173
ATAT7R GGATCCCCTGCAGGTCAATGGAGACAAGGCTCGAAAGT 174
ATATBF GGATCCGCGGCCGCACAATGTCCGCCAAGATTTCAATATT 175
CC
ATATBR GGATCCCCTGCAGGTTAATTTTTCTTAACTACTCCATT 176 I
ATAT9F GGATCCGCGGCCGCACAATGGGAGCTCAGGAGAAACGGCG 177
CC
ATAT9R GGATCCCCTGCAGGTCACGTCTTCTCCTTCTTCACCGG 178
ATAT10F GGATCCGCGGCCGCACAATGGCGGATCCTGATCTGTCTTC 179
TCCT
ATAT10R GGATCCCCTGCAGGTTATGTTGGGGCCAAGTCAGGTGCAA 180
AGAT
ATAT11F GGATCCGCGGCCGCAAAATGG~~i~AAAAAGAGTGTACCAAA 181
~u~sYm~ s~~~r ~u~~ ~s~
CA 02343969 2001-03-20
WO 00/18889 32 PCT/US99/22231
TTCT
ATAT11R GGATCCCCTGCAGGTTATTTGTTTACTAATTTGAGGGAAT 182
TTTTTG
ATLPAAT TCGACCTGCAGGAAGCTTAAGGATGGTGATTGCTGC 183
1F
ATLPAAT GGATCCGCGGCCGCTTACTTCTCCTTCTCCG 184
1R
YSCAT1F GGATCCGCGGCCGCACAATGTCTTTTAGGGATGTCCTAG 185
YSCAT1R GGATCCCCTGCAGGTCAATCATCCTTACCCTTTGGTTTAC 186
',YSCAT ATGTCTTTTAGGGATGTCCTAGAAAGAGGAGATGAATTTT 187
1
iK0 F CTGTGCGGTATTTCACACCG
I
YSCAT TCAATCATCCTTACCCTTTGGTTTACCCTCTGGAGGCAGA 188
1
KO R AGATTGTACTGAGAGTGCAC
YSCAT2F GGATCCGCGGCCGCACAATGAAGCATTCCCAAAAATACCG 189
TAGG
YSCAT2R GGATCCCCTGCAGGTCAATGATTTTTTTTCATCACAAATA 190
C
YSCAT 2 ATGAAGCATTCCCAAAAATACCGTAGGTATGGAATTTATG 191
KO CTGTGCGGTATTTCACACCG
F
YSCAT 2 TCAATGATTTTTTTTCATCACAA.ATACAAGAATAAGAAA.A 192
KO AGATTGTACTGAGAGTGCAC
R
'YSCAT GGATCCGCGGCCGCACAATGGGTTTTGTTGATTTCTTCGA 193
', AAC
3
F
IYSCAT GGATCCCCTGCAGGTTATTTGGTCTCAATTTTAATATTTT 194
3R TTTGC
YSCAT 3 ATGGGTTTTGTTGATTTCTTCGAAACATATATGGTCGGTT 195
KO CTGTGCGGTATTTCACACCG
F
YSCAT 3 TTATTTGGTCTCAATTTTAATATTTTTTTGCAAGGACTCG 196
KO AGATTGTACTGAGAGTGCAC
R
YSCAT GGATCCGCGGCCGCACAATGGAAAAGTACACCAATTGGAG 197
4F AGAC
YSCAT GGATCCCCTGCAGGCTACTTCCTCTTTTTACGTTGATCGC 198
4R TG
YSCAT 4 ATGGAAAAGTACACCAATTGGAGAGACAATGGTACGGGAA 199
IKO F CTGTGCGGTATTTCACACCG
YSCAT 4 CTACTTCCTCTTTTTACGTTGATCGCTGATATATTCCTTC 200
KO R AGATTGTACTGAGAGTGCAC
Stlt3STITUTE SHEET' tRllLE 26)
CA 02343969 2001-03-20
WO 00118889 PCT/US99/22231
3~
YSCAT GGATCCGCGGCCGCACAATGCCTGCACCAAAACTCACGGA 202
5F G
YSCAT GGATCCCCTGCAGGCTACGCATCTCCTTCTTTCCCTTC 202
5R
YSCAT 5 ATGCCTGCACCAAAACTCACGGAGAAATCTGCCTCTTCCA 203
KO F CTGTGCGGTATTTCACACCG
YSCAT 5 CTACGCATCTCCTTCTTTCCCTTCTTCTTCTTCTTCCTCT 204
KO R AGATTGTACTGAGAGTGCAC
YSCAT GGATCCGCGGCCGCACAATGTCTGCTCCCGCTGCCGATCA 205
6F TAACGC
YSCAT GGATCCCCTGCAGGTCATTCTTTCTTTTCGTGTTCTCTTT 206
6R TCTG
YSCAT 6 ATGTCTGCTCCCGCTGCCGATCATAACGCTGCCAAACCTA 207
KO F CTGTGCGGTATTTCACACCG
YSCAT 6 TCATTCTTTCTTTTCGTGTTCTCTTTTCTGTCTTACCAGC 208
KO R AGATTGTACTGAGAGTGCAC
YSCAT GGATCCGCGGCCGCACAATGCTGCATCAAAAAATAGCTCA 209
7F TAAAGTTCG
YSCAT GGATCCGCTGCAGGTCF~'-~AAAA.TAAAACAATAAAGTTTAT210
7R AAACTAACC
YSCAT 7 ATGCTGCATCP~AAAAATAGCTCATAAAGTTCGAA.AAGTCG 211
KO CTGTGCGGTATTTCACACCG
F
IYSCAT7 TCAAAAAATAAAACAATAAAGTTTATAAACTAACCAAATT 212
KO AGATTGTACTGAGAGTGCAC
R
YSCAT GGATCCGCGGCCGCACAATGAGTGTGATAGGTAGGTTCTT 213
8F G
YSCAT GGATCCCCTGCAGGTTAATGCATCTTTTTTACAGATGAAC 214
8R C
YSCAT $ ATGAGTGTGATAGGTAGGTTCTTGTATTACTTGAGGTCCG 215
KO CTGTGCGGTATTTCACACCG
F
YSCAT 8 TTAATGCATCTTTTTTACAGATGAA.CCTTCGTTATGGGTA 216
KO AGATTGTACTGAGAGTGCAC
R
The entire coding regions for each of the acyltransfezase sequences were
amplified
using the respective prixriers listed in the Table 3 above, cloned into the
vector pCR2.lTopo
(Invitrogen) or pZero (Invitrogen), and labeled as pCGN8558 (ATAT 1 ),
pCGN8564
y ~l~S'1"f~t~ SM~~' RULE 26)
CA 02343969 2001-03-20
WO 00/18889 PCT/US99122231
33-1
(ATAT2), pCGF3856S (ATAT3), pGGN8566 (ATAT4), pCC'~N8918 (ATAT6),
pCGN8913 (ATAT7), pCGN8904 (ATAT8), pCGN9)70 (ATAT~3), pCGN9940
(ATAT10), pCGN8567 (ATAT11), pCGN8632 (ATLPAAT1), pCGN9901 (YSCAT1
also referred to a5 gi2132299), pCGN9902 (YSCAT2, also referred to as gi
1078509),
pCGN9903 ('S;''SCAT3, also referred to as gi2132939), pCGN9904 (YSCAT4, alsa
referred to gi2133031 ), pCGN9905 ('YSCATS, also referred to as gi320748),
pCGN9906
{YSCAT6, also xe:ferred to as gi549C27), pCGN9907 (YSCAT7, also refezred to
a..e
giS86485), and pCGN9908 (YSCATB, also referred to as gi464422). The nucleic
acid
sequencc;s far the respective yeast acyltransferase are provided YSCAT1 (SEQ m
N0:225), YSCAT2 (SEQ ID N0:226), YSCAT3 (SEQ II? 1~I0:227), YSCAT4 (SEQ 1D
N0:228), YSCAT5 (SEQ ID N0:229), YSCAT6 (SEQ ID N0:230), YSCAT7 (SEQ ID
N0:231 ), and YSCAT8 (SEQ rD N0:232}.
~U6ST~UT~ SHEET (6~ULE 26)
CA 02343969 2001-03-20
WO 00lI8889 34 PCTIUS99I22231
7A. Baculovirus Expression Constructs
Constructs are prepared to direct the expression of the Arabidopsis ATAT
sequences
in cultured insect cells. The entire coding regions of ATAT1, 2, 3, 4, 6, 7,
8, 9, 10, and 11 are
cloned into the vector pFastBacl {Gibco-BRL, Gaithersburg, MD) digested
withNotI and
PstI. The respective coding sequences were cloned as NotiISse8387I fragments.
Double
stranded DNA sequence was obtained to verify that no errors were introduced by
PCR
amplification. The resulting plasmid were designated pCGN9723 (ATAT1),
pCGN9724
(ATAT2), pCGN9725 (ATAT3), pCGN9726 (ATAT4), pCGN9727 (ATATS), pCGN9728
(ATAT7), pCGN9729 (ATATB), pCGN9991 (ATAT9) pCGN9730 {ATAT10), pCGN9731
(ATAT11).
7B. Plant Expression Construct Preparation
A plasmid containing the napin cassette derived from pCGN3223 (described in
USPN
5,639,790, the entirety of which is incorporated herein by reference) was
modified to make it
more useful for cloning large DNA fragments containing multiple restriction
sites, and to
allow the cloning of multiple napin fusion genes into plant binary
transformation vectors. An
adapter comprised of the self annealed oligonucleotide of sequence
CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAA
(SEQ ID NU:233) AT was ligated into the cloning vector pBC SK+ (Stratagene)
after
2 0 digestion with the restriction endonuclease BssHII to construct vector
pCGN7765. Plamids
pCGN3223 and pCGN776S were digested with NotI and ligated together. The
resultant
vector, pCGN7770, contains the pCGN7765 backbone with the napin seed specific
expression cassette from pCGN3223.
The cloning cassette, pCGN7787, essentially the same regulatory elements as
2 5 pCGN7770, with the exception of the napin regulatory regions of pCGN7770
have been
replaced with the double CAMV 35S promoter and the tml polyadenylation and
transcriptional termination region.
A binary vector for plant transformation, pCGNS 139, was constructed from
pCGNl558 (McBride and Summerfelt, (1990) Plant Molecular Biology, 14:269-276).
The
30 polylinker of pCGN1558 was replaced as a HindIIIlAsp718 fragment with
apolylinker
containing unique restriction endonuclease sites, Ascl, Paci, XbaI, Swal,
BamHI,and NotI.
The Asp718 and HindIII restriction endonuclease sites are retained in
pCGN5139.
CA 02343969 2001-03-20
WO 00/18889 35 . PCT/US99/2223~
A series of turbo binary vectors are constructed to allow for the rapid
cloning of DNA
sequences into binary vectors containing transcriptionai initiation regions
(promoters) and
transcriptianal termination regions.
The plasmid pCGN8618 was constructed by Iigating oligonucleotides 5'-
TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' ) (SEQ ID N0:234) and 5'-
TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' ) (SEQ ID N0:235) into SaII/Xhol-
digested pCGN7770. A fragment containing the napin promoter, polylinker and
napin 3'
region was excised from pCGN8618 by digestion with Asp718I; the fragment was
blunt-
ended by filling in the 5' overhangs with Klenow fragment then ligated into
pCGN5139 that
had been digested with Asp7I8I and HindIII and blunt-ended by filling in the
5' overhangs
with Klenow fragment. A plasmid containing the insert oriented so that the
napin promoter
was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was
closest to the
blunted HindIII site was subjected to sequence analysis to confirm both the
insert orientation
and the integrity of cloning junctions: The resulting plasmid was designated
pCGN8622.
The plasmid pCGN8619 was constructed by ligating oligonucleotides 5'-
TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC -3' } (SEQ ID N0:236) and 5'-
TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' } (SEQ ID N0:237} into SaII/XhoI-
digested pCGN7770. A fragment containing the napin promoter, polylinker and
napin 3'
region was removed from pCGN8619 by digestion with Asp718I; the fragment was
blunt-
2 0 ended by filling in the 5' overhangs with HIenaw fragment then ligated
into pCGN5139 that
had been digested with Asp718I and HindIII and blunt-ended by filling in the
5' overhangs
with HIenaw fragment. A plasmid containing the insert oriented so that the
napin promoter
was closest to the blunted Asp718I site of pCGN5139 and the napin 3' was
closest to the
blunted HindIII site was subjected to sequence analysis to confirm both the
insert orientation
2 5 and the integrity of cloning junctions. The resulting plasmid was
designated pCGN8623.
The plasmid pCGN8620 was constructed by ligating oligonucleotides 5'-
TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT -3' ) (SEQ ID N0:238) and 5'-
CCTGCAGGAAGCTTGCGGCCGCGGATCC-3' ) (SEQ ID N0:239} into SaIT/SacI-
digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml
3' region
3 0 was removed from pCGN8620 by complete digestion with Asp718I and partial
digestion with
NotI. The fragment was blunt-ended by filling in the 5' overhangs with Klenow
fragment
then ligated into pCGN5139 that had been digested with Asp718I and HindIII and
blunt-
ended by filling in the 5' overhangs with HIenow fragment. A plasmid
containing the insert
CA 02343969 2001-03-20
WO 00/18889 36 PCT/US99/22231
oriented so that the d35S promoter was closest to the blunted Asp718I site of
pCGN5139 and
the tm13' was closest to the blunted HindIII site was subjected to sequence
analysis to
confirm both the insert orientation and the integrity of cloning junctions.
The resulting
plasmid was designated pCGN8624.
The plasmid pCGN8621 was constructed by ligating oligonucleotides 5'-
TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT -3' } (SEQ ID N0:240) and 5'-
GGATCCGCGGCCGCAAGCTTCCTGCAGG-3' ) (SEQ ID N0:241) into SaII/SacI-
digested pCGN7787. A fragment containing the d35S promoter, polylinker and tml
3' region
was removed from pCGN8621 by complete digestion with Asp718I and partial
digestion with
NotI. The fragment was blunt-ended by filling in the 5' overhangs with Klenow
fragment
then ligated into pCGN5139 that had been digested with Asp718I and HindIII and
blunt-
ended by filling in the 5' overhangs with Klenow fragment. A plasmid
containing the insert
oriented so that the d35S promoter was closest to the blunted Asp7I8I site of
pCGN5139 and
the tmI 3' was closest to the blunted HindIII site was subjected to sequence
analysis to
confirm both the insert orientation and the integrity of cloning junctions.
The resulting -
plasmid was designated pCGN8625.
The coding regions of the various acyltransferase sequences were cloned as
NotIISse8387I fragments into pCGN8622, pCGN8623, pCGN8624, and pCGN8625, for
expression in sense or antisense orientations from a tissue preferential
promoter, napin, or the
2 0 35S promoter. Fragments which were cloned into the pCGN8622 vector created
the
constructs pCGN8901 (ATAT1), pCGN8571 (ATAT2), pCGN8909 (ATAT3), pCGN8596
(ATAT4), pCGN8919 (ATAT6), pCGN8914 {ATAT7), pCGN8905 (ATATB), pCGN9973
(ATAT9), pCGN9942 (ATAT10), pCGN8575 (ATAT11), and pCGN8633 (ATLPAATl) for
the sense expression of the respective coding sequences from the napin
promoter. Fragments
2 5 which were cloned into the pCGN8623 vector created the constructs pCGN8900
(ATAT 1 );
pCGN8572 (ATAT2}, pCGN8910 (ATAT3), pCGN8597 (ATAT4), pCGN8920 (ATAT6),
pCGN8915 (ATAT7), pCGN8906 (ATATB), pCGN9972 (ATAT9), pCGN9943 (ATATiO},
pCGN85?6 (ATAT 11 ), and pCGN8634 (ATLPAAT 1 } for the antisense expression of
the
respective coding sequences from the napin promoter. Fragments which were
cloned into the
3 0 pCGN8624 vector created the constructs pCGN8903 (ATAT1), pCGN8573 (ATAT2),
pCGN891I (ATAT3), pCGN8598 (ATAT4), pCGN8921 (ATAT6), pCGN8916 {ATAT7),
pCGN8907 (ATATB), pCGN9971 (ATAT9), pCGN9944 (ATAT 10), pCGN8577 (ATAT 11 ),
and pCGN8635 (ATLPAAT1) for the sense expression of the respective coding
sequences
CA 02343969 2001-03-20
WO 00/18889 37 PCT/US99/22231
from the 35S promoter. Fragments which were cloned into the pCGN8625 vector
created the
constructs pCGN8902 (ATAT 1 ) and pCGN9974 (ATAT9) for the antisense
expression of
the respective coding sequences from the 355 promoter.
In addition, the yeast acyltransferase coding sequences were cloned into the
vector
pCGN8624 creating the constructs pCGN9926 (YSCATI), pCGN9927 (YSCAT2),
pCGN9928 (YSCAT3}, pCGN9929 (YSCAT4), pCGN9930 (YSCATS), pCGN9931
(YSCAT6}, pCGN9932 (YSCAT7}, and pCGN9933 (YSCATB). These constructs allow for
the sense expression of the respective acyltransferase coding sequences from
the 35S
promoter in plant cells.
Example 8: Plant Transformation
A variety of methods have been developed to insert a-DNA sequence of interest
into the
genome of a plant host to obtain the transcription or transcription and
translation of the sequence
to effect phenotypic changes.
Transgenic Brassica plants are obtained by Agrobacterium-mediated
transformation
as described by Radke et al. (Theor. Appl. Genet. ( 1988) 75:685-694; Plant
Cell Reports
( 1992) 11:499-505). Transgenic Arabidopsis thaliana plants may be obtained by
2 0 Agrobacterium-mediated transformation as described by Valverkens et al.,
(Proc. Nat. Acad.
Sci. (1988) 85:5536-5540); or as described by Bent et al. ((1994}, Science
265:1856-1860), or
Bechtold et al. ((1993), C.R.Acad.Sci, Life Sciences 316:1194-1199) or Clough,
et al. (1998)
Plant J., 16:735-43. Other plant species may be similarly transformed using
related
techniques.
2 5 Alternatively, microprojectile bombardment methods, such as described by
Klein et
al. (Bio~l'echnology 10:286-291 ) may also be used to obtain nuclear
transformed plants.
The above results demonstrate that the nucleic acid sequences identified
encode
proteins which are related to protein sequences encoding acyltransferase
proteins. Such
3 0 acyitransferase sequences find use in preparing expression constructs for
plant
transformations.
All publications and patent applications mentioned in this specification are
indicative
of the level of skill of those skilled in the art to which this invention
pertains. All
CA 02343969 2001-03-20
WO 00/18889 38 PCT/US99I22231
publications and patent applications are herein incorporated by reference to
the same extent as
if each individual publication or patent application was specifically and
individually indicated
to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
obvious that
certain changes and modifications may be practiced within the scope of the
appended claim.
CA 02343969 2001-03-20
WO 00118889 PCTlUS99/2223I
j
SEQUENCE LISTING
<110> Lassner, Michael W
Emig, Robin A
Ruezinsky, Diane
Van Eenennaam, Alison
<120> Novel Plant Acyltransferases
<130> 17029/00/WO
<140>
<141>
<150> 60/101,939
<151> 1998-09-25
<160> 241
<170> PatentTn Ver. 2.0
<210> 1
<211> 869
<212> DNA
<213> Arabidopsis sp.
<400> 1
atggttcatg cgaccaagtc agccacaacg attccaaaag aacgcttaaa gaaccgcata 60
gtcttccatg atgggcgttt agcgcaacgt ccaactccgt taaacgccat tatcacatac 120
ctatggcttc cttttggttt catctctcca tcattcgcgt ctacttcaac ctccctttac 180
ctgaaagatt tgtccgttac acttacgaga tgctcgggat ccacttaacc attcgtggtc 240
atcgtcctcc acctccttcc cctggaactc ttggcaacct ctatgtcctt aaccaccgta 300
ccgcgcttga tcccatcatc gtcgctattg ctcttggacg taagatctgt tgcgtcactt 360
acagtgtctc tcgtctctcc cttatgcttt ctcctattcc tgctgttgcc ctcacccgtg 420
accgtgccac cgatgctgcc aacatgagaa aacttctcga gaaaggcgac ttggtgatat 480
gtccggaagg cacgacgtgt agagaagagt atctactgag atttagcgct ctattcgcag 540
agctaagcga ccggattgtg ccagtagcga tgaactgtaa acaaggaatg ttcaacggga 600
ccacagttag gggtgtgaag ttttgggacc cttacttctt cttcatgaac ccaagaccaa 660
gctatgaagc cactttcttg gatcgtttgc ctgaagaaat gactgtcaac ggtggtggca 720
agactcctat agaggtggct aattacgtcc agaaagttat cggcgcggtt ttgggcttcg 780
aatgcaccga acttactcgc aaggataaat atcttttgct tggaggtaat gacggcaagg 840
tggagtctat caacaacacc aagaagtga 869
<210> 2
<211> 289
<212> PRT
<213> Arabidopsis sp.
<400> 2
Met Val His Ala Thr Lys Ser Ala Thr Thr Ile Pro Lys Glu Arg Leu
1 5 10 15
Lys Asn Arg Ile Val Phe His Asp Gly Arg Leu Ala Gln Arg Pro Thr
20 25 30
Pro Leu Asn Ala Ile Ile Thr Tyr Leu Trp Leu Pro Phe Gly Phe Ile
35 40 45
LeuSerTle IleArgVal TyrPheAsn LeuProLeu G1u ArgPhe
Pro
50 55 60
ValArgTyr ThrTyrGlu MetLeuGly IleHisLeu I1e ArgGly
Thr
65 70 75 80
HisArgPro ProProPro SerProGly ThrLeuGly Leu TyrVal
Asn
85 90 95
LeuAsnHis ArgThrAla LeuAspPro IleIleVal Ile AlaLeu
Ala
100 105 110
CA 02343969 2001-03-20
WO 00118889 PCTIUS99/22231
2
SEQUENCE LISTING
<110> Lassner, Michael W
Emig, Robin A
Ruezinsky, Diane
Van Eenennaam, Alison
<220> Novel Plant Acyltransferases
<130> 17029/00/WO
<140>
<141>
<150> 60/101,939
<151> 1998-09-25
<160> 241
<170> Patentln Ver. 2.0
<210> 1
<211> 869
<212> DNA
<213> Arabidopsis sp.
<400> 1
atggttcatg cgaccaagtc agccacaacg attccaaaag aacgcttaaa gaaccgcata 60
gtcttccatg atgggcgttt agcgcaacgt ccaactccgt taaacgccat tatcacatac 120
ctatggcttc cttttggttt catctctcca tcattcgcgt ctacttcaac ctccctttac 180
ctgaaagatt tgtccgttac acttacgaga tgctcgggat ccacttaacc attcgtggtc 240
atcgtcctcc acctccttcc cctggaactc ttggcaacct ctatgtcctt aaccaccgta 300
ccgcgcttga tcccatcatc gtcgctattg ctcttggacg taagatctgt tgcgtcactt 360
acagtgtctc tcgtctctcc cttatgcttt ctcctattcc tgctgttgcc ctcacccgtg 420
accgtgccac cgatgctgcc aacatgagaa aacttctcga gaaaggcgac ttggtgatat 480
gtccggaagg cacgacgtgt agagaagagt atctactgag atttagcgct ctattcgcag 540
agctaagcga ccggattgtg ccagtagcga tgaactgtaa acaaggaatg ttcaacggga 600
ccacagttag gggtgtgaag ttttgggacc cttacttctt cttcatgaac ccaagaccaa 660
gctatgaagc cactttcttg gatcgtttgc ctgaagaaat gactgtcaac ggtggtggca 720
agactcctat agaggtggct aattacgtcc agaaagttat cggcgcggtt ttgggcttcg 780
aatgcaccga acttactcgc aaggataaat atcttttgct tggaggtaat gacggcaagg 840
tggagtctat caacaacacc aagaagtga 869
<210> 2
<211> 289
<212> PRT
<213> Arabidopsis sp.
<400> 2
Met Val His Ala Thr Lys Ser Ala Thr Thr Ile Pro Lys Glu Arg Leu
1 5 10 15
Lys Asn Arg Ile Val Phe His Asp Gly Arg Leu Ala Gln Arg Pro Thr
20 25 30
Pro Leu Asn Ala Ile Ile Thr Tyr Leu Trp Leu Pro Phe Gly Phe Ile
35 40 45
Leu Sex Ile Ile Arg Val Tyr Phe Asn Leu Pro Leu Pro Glu Arg Phe
50 55 60
Val Arg Tyr Thr Tyr G1u Met Leu Gly Ile His Leu Thr Ile Arg Gly
65 70 75 80
His Arg Pro Pro Pro Pro Ser Pro Gly Thr Leu Gly Asn Leu Tyr Val
85 90 95
Leu Asn His Arg Thr A1a Leu Asp Pro Ile Tle Val Ala Ile Ala Leu
100 105 110
CA 02343969 2001-03-20
WO 00/18889 ~ . PCT/US99J22231
Gly Arg Lys Ile Cys Cys Val Thr Tyr Ser Val Sex Arg Leu Ser Leu
115 120 125
Met Leu Ser Pro I1e Pro Ala Val Ala Leu Thr Arg Asp Arg Ala Thr
130 135 140
Asp Ala Ala Asn Met Arg Lys Leu Leu Glu Lys Gly Asp Leu Val Ile
145 150 155 160
Cys Pro Glu G1y Thr Thr Cys Arg Glu Glu Tyr Leu Leu Arg Phe Ser
165 170 175
Ala Leu Phe Ala Glu Leu Ser Asp Arg Ile Val Pro Val Ala Met Asn
180 185 190
Cys Lys Gln Gly Met Phe Asn Gly Thr Thr Val Arg Gly Val Lys Phe
195 200 205
Trp Asp Pro Tyr Phe Phe Phe Met Asn Pro Arg Pro Ser Tyr Glu Ala
210 215 220
Thr Phe Leu Asp Arg Leu Pro Glu Glu Met Thr Val Asn Gly Gly Gly
225 230 235 240
Lys Thr Pro Ile Glu Val Ala Asn Tyr Val Gln Lys Val Ile Gly Ala
245 250 255
Val Leu Gly Phe Glu Cys Thr Glu Leu Thr Arg Lys Asp Lys Tyr Leu
260 265 270
Leu Leu Gly Gly Asn Asp Gly Lys Val Glu Ser Ile Asn Asn Thr Lys
275 280 285
Lys
<210> 3
<211> 939
<212> DNA
<213> Arabidopsis sp.
<400> 3
atgacgagct ttactacttc ccttcatgct gtcccgagtg aaaaatttat gggcgaaaca 60
agacgtactg gcattcaatg gtctaaccgc tctttaagac atgatcctta cagatttctt 120
gataagaaat cacctagatc aagtcaattg gcaagagata tcactgtgag agcagatctt 180
tcaggagctg caacccctga ctcttctttt cctgaaccag agattaagtt gagctcaaga 240
ctcagaggga tattcttttg tgttgttgct ggcatttcgg ctacttttct cattgtcctg 300
atgattattg ggcatccgtt cgtccttctc ttcgatccct ataggagaaa attccaccac 360
ttcattgcta aactttgggc ttccataagc atttatccgt tttacaaaat caacatcgag 420
ggtttggaga atctgccatc atcagacact cctgctgtat atgtttcaaa ccaccaaagt 480
tttctggata tctacacact tcttagtctt ggaaaaagct ttaagttcat cagcaagaca 540
gggatattcg taattcccat catcggttgg gccatgtcca tgatgggtgt cgttcccttg 600
aagcggatgg acccaagaag ccaagtggat tgcttaaaac gctgcatgga acttttaaag 660
aagggagcat ctgtgttttt cttcccagaa ggaacacgga gtaaggatgg tcggttaggt 720
tctttcaaga aaggcgcatt.tacagtggct gcgaagaccg gagttgcagt agttccaata 780
acgctaatgg gaacaggcaa aatcatgcca acgggtagtg aaggtatact gaaccatggg 840
aatgtgagag ttatcatcca taaaccaata catggaagca aagcggatgt tctttgcaac 900
gaggccagaa gcaagattgc agaatcaatg gatctctaa 939
<210> 4
<z11> 312
<212> PRT
<213> Arabidopsis sp.
<400> 4
Met Thr Ser Phe Thr Thr Ser Leu His Ala Val Pro Ser G1u Lys Phe
1 5 10 15
Met Gly Glu Thr Arg Arg Thr Gly Ile Gln Trp Ser Asn Arg Ser Leu
CA 02343969 2001-03-20
WO 00/18889 ~ PCT/US99/2223I
20 25 30
Arg His Asp Pro Tyr Arg Phe Leu Asp Lys Lys Ser Pro Arg Ser Ser
35 40 45
Gln Leu Ala Arg Asp I1e Thr Val Arg Ala Asp Leu Ser Gly A1a Ala
50 55 60
Thr Pro Asp Ser Ser Phe Pro Glu Pro Glu Ile Lys Leu Ser Ser Arg
65 70 75 80
Leu Arg Gly Ile Phe Phe Cys Val Val Ala Gly Ile Ser Ala Thr Phe
85 90 95
Leu Ile Val Leu Met Ile Ile Gly His Pro Phe Val Leu Leu Phe Asp
100 105 110
Pro Tyr Arg Arg Lys Phe His His Phe Ile Ala Lys Leu Trp Ala Ser
215 120 125
Ile Ser Ile Tyr Pro Phe Tyr Lys Ile Asn Ile Glu Gly Leu Glu Asn
130 I35 140
Leu Pro Ser Ser Asp Thr Pro Ala Val Tyr Val Ser Asn His Gln Ser
145 250 155 160
Phe Leu Asp Ile Tyr Thr Leu Leu Ser Leu Gly Lys Ser Phe Lys Phe
165 170 175
Ile Ser Lys Thr Gly Ile Phe Va1 Ile Pro Ile I1e Gly Trp Ala Met
180 185 190
Ser Met Met GIy Val Val Pro Leu Lys Arg Met Asp Pro Arg Ser Gln
195 200 205
Val Asp Cys Leu Lys Arg Cys Met Glu Leu Leu Lys Lys Gly Ala Ser
210 215 220
Val Phe Phe Phe Pro Glu Gly Thr Arg Ser Lys Asp Gly Arg Leu Gly
225 230 235 240
Ser Phe Lys Lys Gly Ala Phe Thr Val Ala Ala Lys Thr Gly Val Ala
245 250 255
Val Val Pro Ile Thr Leu Met Gly Thr G1y Lys Ile Met Pro Thr Gly
260 265 270
Ser Glu Gly Ile Leu Asn His Gly Asn Val Arg Val Ile Ile His Lys
275 280 285
Pro Ile His G1y Ser Lys Ala Asp Val Leu Cys Asn Glu Ala Arg Sex
290 295 300
Lys Ile Ala G1u Ser Met Asp Leu
305 310
<210> 5
<211> 1197
<222> DNA
<213> Arabidopsis sp.
<400> 5
atggaatcag agctcaaaga tttgaattcg aattcgaatc ctccgtcgag caaagaggac 60
cggccgttac tgaaatcaga atccgatttg gcggctgcca ttgaagagtt agacaaaaag 220
ttcgcacctt acgcgaggac cgatttgtat gggacgatgg gtttgggtcc tttcccgatg 180
acggagaata ttaaattggc ggttgcattg gtgactcttg ttccattgcg gtttcttctc 240
tcgatgagca tcttgcttct ctattacttg atttgtaggg tatttacgct gttttctgct 300
ccttatcgtg ggccagagga agaggaagat gaaggtggag ttgtttttca ggaagattat 360
gctcacatgg aaggttggaa acggactgtt atcgtccggt ctgggaggtt tctctctagg 420
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/2223~
5
gttttgcttt tcgtttttgg gttttattggattcacgagagctgtccaga tcgagattca480
gacatggatt ctaatcctaa aactacttctacagagattaaccagaaagg ggaagccgcc540
acggaggaac ctgaaagacc tggagccattgtgtccaatcatgtttcgta cttggacatt600
ttgtatcata tgtctgcttc ttttccaagttttgttgccaagagatcagt gggcaaactt660
cctcttgttg gcctcattag caaatgccttggttgtgtctatgttcaaag agaagcaaaa720
tcgcctgatt tcaagggtgt atctggcacagtaaatgaaagagttcgaga agctcatagc780
aataaatctg ctccaactat tatgctttttccagaaggaacaactacaaa tggagactac840
ttacttacat tcaagacagg tgcatttttggctggaactccagttcttcc ggtaatatta900
aaatatccgt atgagcgctt cagtgtggcatgggataccatatccggggc acgccacatt960
ttattccttc tctgtcaagt cgtaaatcacttggaagtcatacggttacc tgtatactac
1020
ccatcccaag aagagaaaga cgatcccaaactttatgctagcaatgttcg gaaattaatg
1080
gccaccgagg gtaacttgat tctatcggagttgggacttagcgacaaaag gatatatcac
1140
gcaactctca atggtaatct tagtcaaacccgtgatttccatcagaaaga agaatga
1197
<210> 6
<211> 398
<212> PRT
<213> Arabiclopsis sp.
<400> 6
Met Glu Ser Glu Leu Lys Ser Asn Pro Pro
Asp Leu Asn Ser Asn Ser
1 5 10 15
Ser Lys Glu Asp Arg Pro Lys Ser Ser Asp Leu Ala
Leu Leu Glu Ala
20 25 30
Ala Ile Glu Glu Leu Asp Phe Ala Tyr Ala Arg Thr
Lys Lys Pro Asp
35 40 45
Leu Tyr Gly Thr Met Gly Pro Phe Met Thr Glu Asn
Leu G1y Pro Ile
50 55 60
Lys Leu Ala Val Ala Leu Leu Val Leu Arg Phe Leu
Val Thr Pro Leu
65 70 75 80
Ser Met Ser Ile Leu Leu Tyr Leu Cys Arg Val Phe
Leu Tyr Ile Thr
85 90 95
Leu Phe Ser Ala Pro Tyr Pro Glu Glu G1u Asp G1u
Arg Gly Glu Gly
100 105 120
Gly Val Val Phe Gln Glu Ala His Glu Gly Trp Lys
Asp Tyr Met Arg
115 120 125
Thr Val Ile Val Arg Ser Phe Leu Arg Val Leu Leu
Gly Arg Ser Phe
130 135 140
Val Phe Gly Phe Tyr Trp Glu Ser Pro Asp Arg Asp
Ile His Cys Sex
145 150 155 160
Asp Met Asp Ser Asn Pro fihr Ser Glu Ile Asn Gln
Lys Thr Thr Lys
165 170 175
Gly Glu A1a Ala Thr Glu Glu Arg Gly Ala Ile Val
Glu Pro Pro Ser
180 185 190
Asn His Val Ser Tyr Leu Leu Tyr Met Ser Ala Ser
Asp Ile His Phe
195 200 205
Pro Ser Phe Val Ala Lys Val Gly Leu Pro Leu Val
Arg Ser Lys Gly
210 215 220
Leu Ile Ser Lys Cys Leu Val Tyr Gln Arg G1u Ala
Gly Cys Val Lys
225 230 235 240
Ser Pro Asp Phe Lys Gly Gly Thr Asn Glu Arg Val
Val Ser Val Arg
CA 02343969 2001-03-20
WO 00/18889 6 . PCT/US99122231
245 250 255
Glu Ala His Ser Asn Lys Ser Ala Pro Thr Ile Met Leu Phe Pro Glu
260 265 270
Gly Thr Thr Thr Asn Gly Asp Tyr Leu Leu Thr Phe Lys Thr Gly Ala
275 280 285
Phe Leu Ala Gly Thr Pro Val Leu Pro Val Ile Leu Lys Tyr Pro Tyr
290 295 300
Glu Arg Phe Ser Val Ala Trp Asp Thr Ile Ser Gly Ala Arg His Ile
305 310 315 320
Leu Phe Leu Leu Cys Gln Val Va1 Asn His Leu Glu Val Ile Arg Leu
325 330 335
Pro Val Tyr Tyr Pro Ser Gln Glu Glu Lys Asp Asp Pro Lys Leu Tyr
340 345 350
Ala Ser Asn Va1 Arg Lys Leu Met Ala Thr Glu Gly Asn Leu Ile Leu
355 360 365
Ser Glu Leu G1y Leu Ser Asp Lys Arg Ile Tyr His Ala Thr Leu Asn
370 375 380
Gly Asn Leu Ser Gln Thr Arg Asp Phe His Gln Lys Glu G1u
385 390 395
<210> 7
<211> 1131
<212> DNA
<213> Arabidopsis sp.
<400> 7
atgagcagta cggcagggag gctcgtgact tcaaaatccg agcttgacct cgatcaccct 60
aacatcgaag attaccttcc ttctggttct tccatcaatg aacctcgcgg caagctcagc 120
ctgcgtgatt tgctagacat ctctccaacg ctcactgaag ctgctggtgc cattgttgat 180
gactcgttca caagatgttt caaatcaaat cctccagaac cttggaactg gaatatttac 240
ttattcccac tatactgctt tggggttgtt gttagatact gtatcctctt tcccttgagg 300
tgcttcactt tagcttttgg gtggattatt ttcctttcat tgtttatccc tgtaaatgcg 360
ttgctgaaag gtcaagatag gttgaggaaa aagatagaga gggtcttggt ggaaatgatt 420
tgcagctttt ttgtcgcctc atggaccgga gttgtcaaat atcacgggcc acgtcctagc 480
atccgtccta agcaggtcta tgttgccaac catacttcaa tgattgattt catcgtattg 540
gagcagatga ccgcatttgc tgttataatg cagaagcatc ctggttgggt tggtcttctg 600
caaagcacaa tattagagag tgtgggatgt atctggttca atcgttcaga ggcaaaggat 660
cgtgaaattg tagcaaaaaa gttaagggac catgtccaag gagctgacag taatcctctt 720
ctcatatttc ccgaagggac atgtgtaaat aataattaca cagtgatgtt taagaagggt 780
gcttttgaat tggactgcac tgtttgtcca attgcaatta aatacaacaa gatttttgtt 840
gacgccttct ggaatagcag aaaacaatca tttactatgc acttgctgca actcatgaca 900
tcatgggctg ttgtatgtga agtgtggtac ttggaaccac aaaccataag gcccggtgaa 960
acaggaattg aatttgcaga gagggtcaga gacatgatat ctcttcgggc gggtctcaaa
1020
aaggtccctt gggatggata cttgaagtat tcgagaccaa gccccaagca tagtgaacgc
1080
aagcaacaga gtttcgcaga gtcgatcctg gctagattgg aagagaagtg a
3.131
<210> 8
<211> 376
<212> PRT
<213> Arabidopsis sp.
<400> 8
Met Ser Ser Thr Ala Gly Arg Leu Val Thr Ser Lys Ser G1u Leu Asp
1 5 1.0 15
Leu Asp His Pro Asn Ile Glu Asp Tyr Leu Pro Ser G1y Ser Ser Ile
20 25 30
CA 02343969 2001-03-20
WO 00/18889 ,~ PCT/US99/Z2231
Asn Glu Pro Arg Gly Lys Leu Ser Leu Arg Asp Leu Leu Asp Ile Ser
35 40 45
Pro Thr Leu Thr Glu Ala A1a Gly Ala Ile Val Asp Asp Ser Phe Thr
50 55 60
Arg Cys Phe Lys Ser Asn Pro Pro Glu Pro Trp Asn Trp Asn Ile Tyr
65 70 75 80
Leu Phe Pro Leu Tyr Cys Phe Gly Val Val Val Arg Tyr Cys Ile Leu
85 90 95
Phe Pro Leu Arg Cys Phe Thr Leu Ala Phe Gly Trp Ile Ile Phe Leu
100 105 110
Ser Leu Phe Ile Pro Val Asn Ala Leu Leu Lys Gly Gln Asp Arg Leu
115 120 125
Arg Lys Lys Ile Glu Arg Val Leu Val Glu.Met Ile Cys Ser Phe Phe
130 135 140
Val Ala Ser Trp Thr Gly Val Val Lys Tyr His Gly Pro Arg Pro Ser
145 150 155 260
Ile Arg Pro Lys Gln Val Tyr Val Ala Asn His Thr Ser Met Ile Asp
165 170 175
Phe Ile Val Leu Glu Gln Met Thr Ala Phe Ala Val Ile Met Gln Lys
180 185 190
His Pro Gly Trp Val Gly Leu Leu GIn Ser Thr Ile Leu Glu Ser Val
195 200 205
Gly Cys Ile Trp Phe Asn Arg Ser Glu Ala Lys Asp Arg Glu Ile Val
210 215 220
Ala Lys Lys Leu Arg Asp His Val Gln Gly Ala Asp Ser Asn Pro Leu
225 230 235 240
Leu Ile Phe Pro Glu Gly Thr Cys Val Asn Asn Asn Tyr Thr Val Met
245 250 255
Phe Lys Lys Gly Ala Phe Glu Leu Asp Cys Thr Val Cys Pro Ile Ala
260 265 270
Ile Lys Tyr Asn Lys Ile Phe Val Asp Ala Phe Trp Asn Ser Arg Lys
275 280 285
Gln Ser Phe Thr Met His Leu Leu Gln Leu Met Thr Ser Trp Ala Val
290 295 300
Val Cys Glu Val Trp Tyr Leu Glu Pro Gln Thr Ile Arg Pro Gly Glu
305 310 315 320
Thr Gly Ile Glu Phe Ala Glu Arg Val Arg Asp Met Ile Ser Leu Arg
325 330 335
Ala Gly Leu Lys Lys Val Pro Trp Asp Gly Tyr Leu Lys Tyr Ser Arg
340 345 350
Pro Ser Pro Lys His Ser Glu Arg Lys Gln Gln Ser Phe Ala Glu Sex
355 360 365
Ile Leu Ala Arg Leu Glu Glu Lys
370 375
<210> 9
<211> 965
CA 02343969 2001-03-20
WO 00/18889 ~ PCT/US99122231
<212> DNA
<213> Arabidopsis sp.
<400> 9
gttgttaagt tacaagtctc ttcaaaaaca cacacacacg tctctcttca cagccaatca 60
tcgatcacag ctcgattttc ctttattgtt ccgttggttt tcttgagnat ttttctttct 120
tgggatcatc aaactngtcg gtaaggwaac ttcacggacg gatcttcaat gttgagctgt 180
tctaatggta ccgtcgtgat cgcaaccgcc atggtttgct caagcaccgc tctgtttctc 240
gccatggctc gtcaattcca tggaaatcat caaaatccta aggttcttga tcagactcta 300
cgacccattc tccgttcttg tctatcttca gaggaaacga agaaacaggg gaagaagata 360
aagaaagtgc ggttcgcgga taatgtgaaa gatacgaaag gtaacgggga agagtaccgg 420
aggagggaat tgaaccggaa aagcgtaccg aagccagtga ctaaaccggg aaagaccggt 480
tctatgtgta gaatctctac catgccagcg aaccggatgg ctctgtacaa tgggattctt 540
agagaccgag atcacagagt tcaatattct tattgacttt ttcttcttga ttagtcaata 600
gatttaggtt ttgtaaatct ttcttttgtt tttcggtaat attagatttt ttcttggaaa 660
tttcagatat tgtagacttt gtagttgggt ggtcttcttt ttctcccttt ttgtgtctca 720
tagtagtagg tggttttctt atgctccact tatctactta cttgttttaa atcaagtgat 780
gatgtaaata attgacatgt aagtagtcat tagaaatttg aaaaggcaaa tgaaagaata 840
taaatttgta aaaacatagt gtgcctattg tacatataaa ctctcttttg ttggggatat 900
ctatggaatt tatattgatt gtgttgaaaa aacaaaaaaa aaaaaaaaaa aaaaaaaaaa 960
aaaaa 965
<210> 10
<211> 1593
<212> DNA
<213> Arabidopsis sp.
<400> 10
atgtccggta ataagatctc gactcttcaa gctcttgtct tcttcttgta ccggtttttc 60
attctccgtc gttggtgtca tcgtagccct aaacaaaaat accaaaaatg cccttctcac 120
ggcctccacc aatatcaaga cctatcgaat cacactttga tattcaacgt cgaaggagct 180
ctactcaaat caaactcttt attcccttac ttcatggttg tggcattcga agccggaggg 240
gtgataaggt cacttttcct cttagttctt tatccattta taagcttgat gagctacgaa 300
atgggcttga agacgatggt gatgctgagc ttctttggag ttaaaaagga aagcttccga 360
gtggggaaat cagttttgcc taagtatttt ctagaagatg ttgggctcga gatgttccag 420
gttttgaaaa gaggaggcaa gagagttgct gtgagtgatt taccacaagt tatgattgat 480
gtattcttgc gagattactt,ggagatagaa gttgtggtcg gaagagacat gaaaatggtc 540
ggtggttact acctaggcat cgtggaggat aagaagaacc ttgaaattgc ttttgataaa 600
gtggttcaag aagaaagact tggtagtggt cgtcgtctta ttggcatcac ttcctttaac 660
tcgccaagtc acagatctct cttctctcaa ttttgccagg aaatttactt cgtcagaaat 720
tcagacaaga aaagttggca aaccctacca caagatcaat accctaaacc attgattttc 780
cacgatggtc gtttagccgt taagccaaca cctttaaaca cactcgtatt attcatgtgg 840
gccccattcg ccgccgtctt agccgctgca agactcgtct tcggcctaaa cttaccttac 900
tccctagcca atcccttcct cgccttttcc ggtatccacc ttactctcac cgtcaacaac 960
cacaacgacc taatatccgc cgacagaaaa agaggttgtc tctttgtgtg taaccataga
1020
acgttattgg acccacttta catttcatac gctctaagaa agaaaaacat gaaagccgtg
1080
acgtatagtc taagcagatt atctgagctt ctggctccga tcaagaccgt tagattgact
1140
cgtgatcgag tcaaagatgg tcaagccatg gagaaattgc tgagccaggg agatctcgtg
1200
gtttgtccgg aagggactac gtgtagagag ccttacttgc ttcggtttag tccacttttc
1260
tctgaggttt gtgacgtcat cgtacctgtt gctattgact cacacgtgac tttcttctat
1320
ggcacgacgg ctagtggtct taaggcattt gatcccattt tcttcctttt gaatcctttc
1380
ccttcctaca ccgtcaaatt gcttgaccct gtctctggaa gtagctcgtc cacgtgtcga
1440
ggagtccctg acaatggaaa agttaacttc gaggtggcta atcacgtgca gcatgagatc
1500
gggaatgcct tggggtttga gtgcaccaac ctcacgagaa gagataagta cttgatcttg
1560
gccggtaata acggagttgt caagaaaaaa taa
1593
<210> 11
<211> 530
<212> PRT
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99/22231
9
<213> Arabidopsis sp.
<400> 11
Met Ser Gly Asn Lys Ile Ser Thr Leu Gln Ala Leu Val Phe Phe Leu
1 5 10 15
Tyr Arg Phe Phe Ile Leu Arg Arg Trp Cys His Arg Ser Pro Lys Gln
20 25 30
Lys Tyr Gln Lys Cys Pro Ser His Gly Leu His Gln Tyr Gln Asp Leu
35 40 45
Ser Asn His Thr Leu Ile Phe Asn Val Glu Gly Ala Leu Leu Lys Ser
50 55 60
Asn Ser Leu Phe Pro Tyr Phe Met Val Val Ala Phe Glu Ala Gly Gly
65 70 75 80
Val Ile Arg Ser Leu Phe Leu Leu Val Leu Tyr Pro Phe Ile Ser Leu
85 90 95
Met Ser Tyr Glu Met Gly Leu Lys Thr Met Val Met Leu Ser Phe Phe
100 105 110
Gly Val Lys Lys Glu Ser Phe Arg Val Gly Lys Ser Val Leu Pro Lys
115 120 125
Tyr Phe Leu Glu Asp Val Gly Leu Glu Met Phe Gln Val Leu Lys Arg
130 135 140
Gly Gly Lys Arg Val Aia Val Ser Asp Leu Pro Gln Val Met Ile Asp
14S 150 155 160
Val Phe Leu Arg Asp Tyr Leu Glu Ile Glu Val Val Val Gly Arg Asp
165 170 175
Met Lys Met Val Gly Gly Tyr Tyr Leu Gly Tle Val Glu Asp Lys Lys
180 18-5 190
Asn Leu Glu Ile Ala Phe Asp Lys Val Val Gln Glu Glu Arg Leu Gly
195 200 205
Ser Gly Arg Arg Leu Ile Gly Ile Thr Ser Phe Asn Sex Pro Ser His
220 215 220
Arg Ser Leu Phe Ser Gln Phe Cys Gln Glu Ile Tyr Phe Va1 Arg Asn
225 230 235 240
Ser Asp Lys Lys Ser Trp Gln Thr Leu Pro Gln Asp Gln Tyr Pro Lys
245 250 255
Pro Leu Ile Phe His Asp Gly Arg Leu Ala Va1 Lys Pro Thr Pro Leu
260 265 270
Asn Thr Leu Val Leu Phe Met Trp Ala Pro Phe Ala Ala Val Leu Ala
275 280 285
Ala Ala Arg Leu Val Phe Gly Leu Asn Leu Pro Tyr Ser Leu Ala Asn
290 295 300
Pro Phe Leu Ala Phe Ser Gly Ile His Leu Thr Leu Thr Val Asn Asn
305 310 315 320
His Asn Asp Leu Ile Ser Ala Asp Arg Lys Arg Gly Cys Leu Phe Val
325 330 335
Cys Asn His Arg Thr Leu Leu Asp Pro Leu Tyr Ile Ser Tyr Ala Leu
340 345 350
Arg Lys Lys Asn Met Lys Ala Val Thr Tyr Ser Leu Ser Arg Leu Sex
CA 02343969 2001-03-20
WO 00/18889 . PCTIUS99/22231
10
355 360 365
Glu Leu Leu Ala Pro I1e Lys Thr Val Arg Leu Thr Arg Asp Arg Val
370 375 380
Lys Asp Gly Gln Ala Met Glu Lys Leu Leu Ser Gln Gly Asp Leu Val
385 390 395 400
Val Cys Pro Glu Gly Thr Thr Cys Arg Glu Pro Tyr Leu Leu Arg Phe
405 410 415
Ser Pro Leu Phe Ser Glu Val Cys Asp Va1 Ile Val Pro Val Ala Ile
420 425 430
Asp Ser His Val Thr Phe Phe Tyr Gly Thr Thr Ala Ser Gly Leu Lys
435 940 445
Ala Phe Asp Pro Ile Phe Phe Leu Leu Asn Pro Phe Pro Ser Tyr Thr
450 455 460
Val Lys Leu Leu Asp Pro Val Ser Gly Ser Ser Ser Ser Thr Cys Arg
46S 470 475 480
Gly Val Pro Asp Asn Gly Lys Val Asn Phe Glu Val Ala Asn His Val
485 490 495
Gln His Glu Ile Gly Asn Ala Leu Gly Phe Glu Cys Thr Asn Leu Thr
500 505 510
Arg Arg Asp Lys Tyr Leu Ile Leu Ala Gly Asn Asn Gly Val Val Lys
515 520 525
Lys Lys
S30
<210> 12
<211> 1509
<212> DNA
<213> Arabidopsis sp.
<400> 12
atggttatgg agcaagctgg aacgacatcg tattcggtcg tgtcagagtt tgaaggaaca 60
atactgaaga acgcagattc attctcttac ttcatgctcg tagccttcga agcagctggt 120
ctaattcgtt tcgctatctt gttgtttcta tggcccgtaa tcacactcct tgacgttttc 180
agctacaaaa acgcagctct caagctcaag atttttgtag ccactgttgg tctacgtgaa 240
ccggagatcg aatcagtggc tagagccgtt ctgccaaaat tctacatgga cgacgtaagc 300
atggacacgt ggagggtttt cagctcgtgt aagaagaggg tcgtggtcac gagaatgcct 360
cgagttatgg tggagaggtt tgctaaggag catcttagag cagatgaggt catcggtacg 420
gaactgattg taaaccggtt cggttttgtc accggtttga ttcgcgaaac ggatgttgat 480
cagtctgctt tgaaccgtgt cgctaatttg tttgttggtc ggaggcctca actaggtctt 540
ggaaaaccgg ctttgaccgc ctctacaaat ttcttatcgt tatgtgagga gcatattcat 600
gcaccaatcc cggagaacta caaccacggt gaccaacaac ttcagctacg tccacttccg 660
gtgatatttc acgacggaag actagtgaag cggccaacgc cggccaccgc tctcatcatc 720
ctcctttgga tcccatttgg aatcattctc gccgtgatcc ggatctttct tggagccgtc 780
ctcccattgt gggccacacc ttacgtctct cagatattcg gtggccatat catcgtcaaa 840
ggaaagcctc ctcagccacc ggcggctgga aaatccggcg tgctctttgt gtgtactcac 900
agaaccctaa tggaccctgt ggtattatct tatgtcctcg gacgtagcat cccagccgtt 960
acttactcaa tctcgcgctt atcagagatc ttatctccca ttccaaccgt ccgattgaca
2020
agaatccgag atgtggatgc ggctaagatc aaacaacaac tgtcaaaagg agatctagtg
1080
gtttgtcctg agggaaccac ttgtcgtgaa ccgtttttgt taagattcag cgcgcttttc
1140
gctgagttaa cggataggat tgttccggtt gcgatgaact acagagtcgg attcttccac
1200
gcgactacag cgagaggctg gaagggtttg gacccaattt tcttcttcat gaacccaaga
1260
ccggtttacg agattacgtt cttgaaccag cttcctatgg aggcaacatg ttcgtccggg
1320
CA 02343969 2001-03-20
WO 00/18889 11 PCT/US99/22231
aagagcccgc atgacgtggc gaactatgtt cagagaatct tggcggctac gttagggttt
1380
gagtgcacca acttcacaag aaaagataag tatagggttc tcgctggaaa cgatggaaca
1440
gtgtcgtact tgtcgttgct agaccaattg aagaaggtgg ttagcacttt cgagccttgt
1500
ctccattga
1509
<220> 13
<211> 502
<212> PRT
<213> Arabidopsis sp.
<400> 23
Met Val Met Glu Gln A1a Gly Thr Thr Ser Tyr Ser Val Val Ser Glu
1 5 10 15
Phe Glu Gly Thr Ile Leu Lys Asn Ala Asp Ser Phe Ser Tyr Phe Met
20 25 30
Leu Val Ala Phe Glu Ala Ala Gly Leu Ile Arg Phe Ala Ile Leu Leu
35 40 45
Phe Leu Trp Pro Val Ile Thr Leu Leu Asp Val Phe Ser Tyr Lys Asn
50 55 60
Ala Ala Leu Lys Leu Lys Ile Phe Val Ala Thr Val Gly Leu Arg Glu
65 70 75 80
Pro Glu Ile Glu Ser Val A1a Arg Al.a Val Leu Pro Lys Phe Tyr Met
85 90 95
Asp Asp Val Ser Met Asp Thr Trp Arg Val Phe Ser Ser Cys Lys Lys
100 105 110
Arg Val Val Val Thr Arg Met Pro Arg Val Met Val Glu Arg Phe Ala
115 120 125
Lys Glu His Leu Arg Ala Asp Glu Val Ile Gly Thr Glu Leu Ile Val
130 135 140
Asn Arg Phe Gly Phe Val Thr Gly Leu Ile Arg Glu Thr Asp Val Asp
245 150 155 160
Gln Ser Ala Leu Asn Arg Val Ala Asn Leu Phe Val Gly Arg Arg Pro
165 170 175
Gln Leu Giy Leu Gly Lys Pro Ala Leu Thr Ala Ser Thr Asn Phe Leu
180 185 190
Ser Leu Cys Glu Glu His Ile His Ala Pro Ile Pro Glu Asn Tyr Asn
295 200 205
His Gly Asp Gln Gln Leu Gln Leu Arg Pro Leu Pro Val Ile Phe His
210 215 220
Asp Gly Arg Leu Val Lys Arg Pro Thr Pro Ala Thr Ala Leu Ile Ile
225 230 235 240
Leu Leu Txp Ile Pro Phe Gly Ile Ile Leu Ala Val Ile Arg Ile Phe
245 250 255
Leu Gly Ala Val Leu Pro Leu Trp Ala Thr Pro Tyr Val Ser Gln Ile
260 265 270
Phe Gly Gly His Ile Ile Val Lys Gly Lys Pro Pro Gln Pro Pro Ala
275 280 285
Ala Gly Lys Ser Gly Val Leu Phe Val Cys Thr His Arg Thr Leu Met
CA 02343969 2001-03-20
WO 00/18889 12 PCT/US99/22231
290 295 300
Asp Pro Val Val Leu Ser Tyr Va7: Leu Gly Arg Ser Ile Pro Ala Val
305 310 315 320
Thr Tyr Ser Ile Ser Arg Leu Ser Glu I1e Leu Ser Pro Ile Pro Thr
325 330 335
Va1 Arg Leu Thr Arg Ile Arg Asp Val Asp Ala Ala Lys Ile Lys Gln
340 345 350
Gln Leu Ser Lys Gly Asp Leu Val Val Cys Pro Glu Gly Thr Thr Cys
355 360 365
Arg Glu Pro Phe Leu Leu Arg Phe Ser Ala Leu Phe Ala Glu Leu Thr
370 375 380
Asp Arg Ile Val Pro Val Ala Met Asn Tyr Arg Val Gly Phe Phe His
385 390 395 400
Ala Thr Thr Ala Arg Gly Trp Lys Gly Leu Asp Pro Ile Phe Phe Phe
405 410 415
Met Asn Pro Arg Pro Val Tyr Glu Tle Thr Phe Leu Asn Gln Leu Pro
420 425 430
Met Glu Ala Thr Cys Ser Ser Gly Lys Ser Pro His Asp Val Ala Asn
435 440 445
Tyr Val Gln Arg Ile Leu Ala Ala Thr Leu Gly Phe Glu Cys Thr Asn
450 455 460
Phe Thr Arg Lys Asp Lys Tyr Arg Val Leu Ala Gly Asn Asp Gly Thr
465 470 475 480
Val Ser Tyr Leu Ser Leu Leu Asp Gln Leu Lys Lys Val Val Ser Thr
485 490 495
Phe Glu Pro Cys Leu His
500
<210> 14
<211> 1563
<212> DNA
<213> Arabidopsis sp.
<400> 14
atgtccgcca agatttcaat attccaagct cttgtctttc tattctaccg gtttatcctc 60
cggcgatatc ggaactctaa accaaaatac caaaatggcc cttcttctct cctccaatcc 120
gacctatcac gccacacatt gatcttcaac gtagaaggag ctcttctcaa atccgactct 180
ctcttccctt acttcatgtt agtagcattt gaggcgggag gcgtaataag gtcatttctc 240
ctcttcattc tctatccatt gataagcttg atgagccatg agatgggtgt caaagtgatg 300
gtaatggtga gcttcttcgg gatcaaaaaa gaaggttttc gagcggggag agcggttttg 360
cctaaatact ttctagaaga tgtcggactc gagatcttcg aagtgttgaa gagaggaggg 420
aagaaaatcg gagtgagtga tgatcttcct caagttatga tcgaagggtt cttgagagat 480
tacttggaga ttgacgttgt ggtcgggaga gaaatgaaag tcgttggagg ttattatcta 540
ggtatcatgg aggataaaac caaacatgat cttgtctttg atgagttagt tcgtaaagag 600
agactaaaca ccggtcgtgt tattggcatc acttccttca atacatctct tcaccgatat 660
ctattctctc agttttgcca ggaaatttat ttcgtgaaga aatcagacaa gcgaagctgg 720
caaaccctac cacgaagcca gtaccctaaa ccattgattt tccatgatgg ccgtctcgcg 780
atcaaaccaa ccctaatgaa cactttggtc ttgttcatgt ggggtccttt cgcagccgca 840
gccgcagcag ccagactctt cgtctctctt tgcatccctt actctttatc aatcccgatc 900
ctcgcctttt ccggttgcag actaaccgtc actaacgact acgtttcatc tcaaaaacaa 960
aaaccaagtc aacgcaaagg ttgtctcttt gtatgtaacc ataggacttt attggaccct
1020
ctctatgttg cattcgcttt gagaaagaaa aacatcaaaa ctgtaacgta tagtttgagt
1080
agggtatctg agattttggc tccgatcaag acggtgagac tgacccgtga tcgggtgagc
1140
CA 02343969 2001-03-20
WO 00/18889 13 PCT/US99/22231
gacggtcaag ccatggagaa attgttaacc gaaggagatc tcgttgtttg tcctgaagga
1200
accacttgta gagaacctta cctgcttagg tttagccctt tgttcaccga ggttagtgat
1260
gtcatcgttc ccgtggctgt gacggtacac gtgaccttct tctacggtac aacggcgagt
1320
ggtcttaagg cacttgaccc gcttttcttc ctcttggatc cttatcctac ctacaccatc
1380
caatttctcg accctgtctc cggtgccacg tgccaagatc ctgatggaaa gttgaagttt
1440
gaggtggcca acaatgttca gagtgatatt gggaaggcgc tggatttcga gtgcacaagt
1500
ctcactagaa aagacaagta tttgatcttg gccggtaata atggagtagt taagaaaaat
1560
taa
1563
<210> 15
<211> 520
<212> PRT
<213> Arabidopsis sp.
<400> 15
Met Ser Ala Lys Ile Ser Ile Phe Gln Ala Leu Val Phe Leu Phe Tyr
1 5 10 15
Arg Phe I1e Leu Arg Arg Tyr Arg Asn Ser Lys Pro Lys Tyr Gln Asn
20 25 30
Gly Pro Ser Ser Leu Leu Gln Ser Asp Leu Ser Arg His Thr Leu Ile
35 40 45
Phe Asn Val Glu Gly Ala Leu Leu Lys Ser Asp Ser Leu Phe Pro Tyr
50 55 60
Phe Met Leu Va1 Ala Phe Glu Ala Gly Gly Val Ile Arg Ser Phe Leu
65 70 75 80
Leu Phe Ile Leu Tyr Pro Leu Ile Ser Leu Met Ser His Glu Met Gly
85 90 95
Val Lys Val Met Val Met Val Ser Phe Phe Gly Ile Lys Lys Glu Gly
100 105 110
Phe Arg Ala Gly Arg Ala Val Leu Pro Lys Tyr Phe Leu Glu Asp Val
115 120 125
Gly Leu Glu Ile Phe Glu Val Leu Lys Arg Gly Gly Lys Lys Ile Gly
130 135 140
Val Ser Asp Asp Leu Pro Gln Va1 Met Ile Glu Gly Phe Leu Arg Asp
145 150 155 160
Tyr Leu Glu Ile Asp Val Val Val Gly Arg Glu Met Lys Val Val Giy
165 170 175
Gly Tyr Tyr Leu Gly Ile Met Glu Asp Lys Thr Lys His Asp Leu Val
180 185 190
Phe Asp Glu Leu Val Arg Lys Glu Arg Leu Asn Thr Gly Arg Val Ile
195 200 205
Gly Ile Thr Ser Phe Asn Thr Ser Leu His Arg Tyr Leu Phe Ser Gln
210 215 220
Phe Cys Gln Glu Ile Tyr Phe Val Lys Lys Ser Asp Lys Arg Ser Trp
225 230 235 240
Gln Thr Leu Pro Arg Ser Gln Tyr Pro Lys Pro Leu Ile Phe His Asp
245 ''S0 255
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99/22231
14
Gly Arg Leu Ala Tle Lys Pro Thr Leu Met Asn Thr Leu Val Leu Phe
260 265 270
Met Trp Gly Pro Phe Ala Ala Ala Ala Ala Ala Ala Arg Leu Phe Val
275 280 285
Ser Leu Cys Ile Pro Tyr Ser Leu Ser Ile Pro Ile Leu Ala Phe Ser
290 295 300
Gly Cys Arg Leu Thr Val Thr Asn Asp Tyr Val Ser Sex Gln Lys Gln
305 310 315 320
Lys Pro Ser Gln Arg Lys Gly Cys Leu Phe Val Cys Asn His Arg Thr
325 330 335
Leu Leu Asp Pro Leu Tyr Val Aia Phe A1a Leu Arg Lys Lys Asn Ile
340 345 350
Lys Thr Val Thr Tyr Ser Leu Ser Arg Val Ser Glu Ile Leu Ala Pro
355 360 365
Ile Lys Thr Val Arg Leu Thr Arg Asp Arg Val Ser Asp Gly Gln Ala
370 375 380
Met Glu Lys Leu Leu Thr Glu Gly Asp Leu Val Val Cys Pro Glu Gly
385 390 395 400
Thr Thr Cys Arg Glu Pro Tyr Leu Leu Arg Phe Ser Pro Leu Phe Thr
405 410 415
Glu Val Ser Asp Val Ile Val Pro Val Ala Val Thr Val His Val Thr
420 425 4'30
Phe Phe-Tyr Gly Thr Thr Ala Ser Gly Leu Lys Ala Leu Asp Pro Leu
435 440 445
Phe Phe Leu Leu Asp Pro Tyr Pro Thr Tyr Thr Ile Gln Phe Leu Asp
450 455 460
Pro Val Ser Gly Ala Thr Cys G1n Asp Pro Asp Gly Lys Leu Lys Phe
465 470 475 480
Glu Val Ala Asn Asn Val Gln Ser Asp Ile Gly Lys Ala Leu Asp Phe
485 490 495
Glu Cys Thr Ser Leu Thr Arg Lys Asp Lys Tyr Leu Tle Leu Ala Gly
500 505 510
Asn Asn Gly Val Val Lys Lys Asn
515 520
<210> 16
<211> 1506
<212> DNA
<213> Arabidopsis sp.
<400> 16
atgggagctc aggagaaacg gcgccgtttc gagcagatat caaagtgcga tgttaaggac 60
cggtccaacc ataccgtggc cgctgatcta gacggaacac tactaatctc tcgtagcgcc 120
ttcccttact atttcctcgt agccctcgag gcagggagct tgctccgagc gttgatccta 180
cttgtgtccg taccattcgt ttatcttacg tacttgacca tctccgagac tttagccatc 240
aacgtatttg tcttcatcac gttcgcgggt ctcaagatcc gagacgttga gctagtggtc 300
cgttccgtcc tcccgaggtt ctatgcggag gacgtgaggc ccgatacctg gcgtatcttc 360
aacacgttcg ggaaacggta cataataact gcgagccctc gaattatggt cgagccattc 420
gtgaaaacat tcctaggagt tgataaagtt cttggaacag agctagaggt ctccaaatcg 480
ggtcgggcaa ccgggttcac cagaaaacca ggtattctcg tcggtcagta caaacgtgac 540
gtcgttttga gagagtttgg tggcctagcg tctgatttac ctgatttggg gctcggcgat 600
agcaagacgg accacgactt catgtccatc tgcaaggaag gttacatggt gccacgtacg 660
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
15
aaatgcgaaccattaccaagaaacaaactcttaagccccataatattccacgagggcaga720
ttagtccaacgcccaacgccgttagttgctctgttaactttcctctggcttcccgtcggt780
ttcgtcctctctatcatccgcgtctacacgaatattccgttaccggaacgtatcgcccgt840
tacaactacaagcttactggcatcaagctagtcgtcaacggccaccctcctccgccgcca900
aaacctggccagccaggccatcttttggtctgcaaccaccgcaccgttctcgatcctgtg96p
gtcacagctgtcgcactcggccggaaaatcagctgcgtcacttacagcatcagcaagttc
1020
tctgagctaatctcaccaatcaaagccgttgcgttgactcgtcaacgtgagaaagacgca
1080
gcgaacatcaagcgtcttttggaggaaggcgatctcgtgatatgtcccgagggaaccacg
1140
tgccgtgagcctttccttctccggtttagtgctcttttcgctgagctcacggaccggatc
1200
gttcccgtggcgatcaacacaaagcagagcatgttcaatggtaccaccacacgtggatac
1260
aagcttcttgatccttactttgcgttcatgaacccgaggccgacgtatgagatcacgttc
1320
ctcaaacagattccagctgagctgacgtgtaaaggaggcaaatctccgatagaggttgcg
1380
aattacatacagagggttttgggaggaaccttaggttttgagtgcaccaatttcacaaga
1440
aaggataagtacgcaatgcttgctggtactgacggtagggttccggtgaagaaggagaag
1500
acgtga
1506
<210> 17
<211> 500
<212> PRT
<213> Arabidopsis sp.
<400> 17
Met Gly Ala Gln Glu Lys Arg Arg Arg Phe Glu G1n Ile Ser Lys Cys
1 5 10 15
Asp Val Lys Asp Arg Ser Asn His Thr Val Ala Ala Asp Leu Asp G1y
20 25 30
Thr Leu Leu Ile Ser Arg Ser Ala Phe Pro Tyr Tyr Phe Leu Val Ala
35 40 45
Leu Glu Ala Gly Ser Leu Leu Arg Ala Leu Ile Leu Leu Val Ser Val
SO 55 60
Pro Phe Val Tyr Leu Thr Tyr Leu Thr Ile Ser Glu Thr Leu Ala Ile
65 70 75 80
Asn Val Phe Val Phe Ile Thr Phe Ala G1y Leu Lys Ile Arg Asp Val
85 90 95
Glu Leu Val Val Arg Ser Val Leu Pro Arg Phe Tyr A1a Glu Asp Val
100 105 110
Arg Pro Asp Thr Trp Arg Ile Phe Asn Thr Phe Gly Lys Arg Tyr Ile
115 120 125
Ile Thr Ala Ser Pro Arg Ile Met Val Glu Pro Phe Val Lys Thr Phe
130 135 140
Leu Gly Val Asp Lys Val Leu GIy Thr Glu Leu Glu Val Ser Lys Ser
145 150 155 160
Gly Arg Aia Thr Gly Phe Thr Arg Lys Pro Gly Ile Leu Val Gly Gln
165 170 175
Tyr Lys Arg Asp Val Val Leu Arg Glu Phe Gly Gly Leu Ala Ser Asp
180 185 190
Leu Pro Asp Leu Gly Leu Gly Asp Ser Lys Thr Asp His Asp Phe Met
195 200 205
CA 02343969 2001-03-20
WO 00/18889 PCT/US99I22231
16
Ser Ile Cys Lys Glu Gly Tyr Met Val Pro Arg Thr Lys Cys Gl.u Pro
210 215 220
Leu Pro Arg Asn Lys Leu Leu Ser Pro 21e Ile Phe His Glu Gly Arg
225 230 235 240
Leu Val Gln Arg Pro Thr Pro Leu Val Ala Leu Leu Thr Phe Leu Trp
245 250 2S5
Leu Pro Val Gly Phe Val Leu Ser Ile Ile Arg Val Tyr Thr Asn Ile
260 265 270
Pro Leu Pro Glu Arg Ile Ala Arg Tyr Asn Tyr Lys Leu Thr Gly Ile
275 280 285
Lys Leu Val Val Asn Gly His Pro Pro Pro Pro Pro Lys Pro Gly Gln
290 295 300
Pro Gly His Leu Leu Val Cys Asn His Arg Thr Val Leu Asp Pro Val
305 310 315 320
Val Thr Ala Val Ala Leu Gly Arg Lys Ile Ser Cys Val Thr Tyr Ser
325 330 335
Ile Ser Lys Phe Ser Glu Leu Ile Ser Pro Ile Lys Ala Val Ala Leu
340 345 350
Thr Arg Gln Arg Glu Lys Asp Ala Ala Asn Ile Lys Arg Leu Leu Glu
355 360 365
Glu Gly Asp Leu Val Ile Cys Pro Glu G1y Thr Thr Cys Arg Glu Pro
370 375 380
Phe Leu Leu Arg Phe Ser Ala Leu Phe Ala Glu Leu Thr Asp Arg Ile
385 390 395 400
Val Pro Val Ala Ile Asn Thr Lys Gln Ser Met Phe Asn Gly Thr Thr
405 410 415
Thr Arg Gly Tyr Lys Leu Leu Asp Pro Tyr Phe Ala Phe Met Asn Pro
420 425 430
Arg Pro Thr Tyr Glu Ile Thr Phe Leu Lys G1n Ile Pro Ala Glu Leu
435 440 445
Thr Cys Lys Gly Gly Lys Ser Pro Ile Glu Val Ala Asn Tyr Ile Gln
450 455 460
Arg Val Leu Gly Gly Thr Leu Gly,Phe Glu Cys Thr Asn Phe Thr Arg
465 470' 475 480
Lys Asp Lys Tyr Ala Met Leu Ala Gly Thr Asp Gly Arg Val Pro Val
48S 490 495
Lys Lys Glu Lys
500
<210> 18
<211> 1620
<212> DNA
<213> Arabidopsis sp.
<400> 18
atggcggatc ctgatctgtc ttctcctttg atccaccatc aatcctccga tcaacctgaa 60
gttgttatct ctatcgccga cgacgacgac gacgagtcag gactcaatct tcttccagcc 120
gttgttgacc ctcgtgtttc acgaggtttt gagtttgacc atcttaatcc ttatggcttt 180
ctcagcgagt cagagcctcc ggttctcggt ccgacgacgg tggatccatt ccggaacaat 240
acacctggag ttagcggatt gtacgaagcg attaagctcg tgatttgtct tccgattgct 300
CA 02343969 2001-03-20
WO 00/18889 . PCT/US99/22231
17
ctgattagacttgttctctttgctgctagcttagctgttggttacttggctacaaaattg360
gcacttgctggctggaaagataaagagaaccctatgcctctttggagatgcagaatcatg420
tggattactcggatctgtaccagatgtatcctcttctcttttggctatcagtggataaga480
aggaaagggaaacctgctcggagagagattgctccgattgttgtatcaaatcatgtttct540
tatattgaaccaatcttctacttctatgaattatcaccgaccattgttgcatcggagtca600
catgattcacttccatttgttggaactattatcagggcaatgcaggtgatatatgtgaat660
agattctcacagacatcaaggaagaatgctgtgcatgaaataaagagaaaagcttcctgc720
gatagatttcctcgtctgctgttattccccgaaggaaccacgactaatgggaaagttctt780
atttccttccaactcggtgctttcatccctggttaccctattcaacctgtagtagtccgg840
tatccccatgtacattttgatcaatcctggggaaatatctctttgttgacgctcatgttt900
agaatgttcactcagtttcacaatttcatggaggttgaatatcttcctgtaatctatccc960
agtgaaaagcaaaagcagaatgctgtgcgtctctcacagaagactagtcatgcaattgca
1020
acatctttgaatgtcgtccaaacatcccattcttttgcggacttgatgctactcaacaaa
1080
gcaactgagttaaagctggagaacccctcaaattacatggttgaaatggcaagagttgag
1140
tcgctattccatgtaagcagcttagaggcaacgcgatttttggatacatttgtttccatg
1200
attccggactcgagtggacgtgttaggctacatgactttcttcggggtcttaaactgaaa
1260
ccttgccctctttctaaaaggatatttgagttcatcgatgtggagaaggtcggatcaatc
1320
actttcaaacagttcttgtttgcctcgggccacgtgttgacacagccgctttttaagcaa
1380
acatgcgagctagccttttcccattgcgatgcagatggagatggctatattacaattcaa
1440
gaactcggagaagctctcaaaaacacaatcccaaacttgaacaaggacgagattcgagga
1500
atgtaccatttgctagacgacgaccaagatcaaagaatcagccaaaatgacttgttgtcc
1560
tgcttaagaagaaaccctcttctcatagccatctttgcacctgacttggccccaacataa
1620
<210> 19
<211> 539
<212> PRT
<213> Arabidopsis sp.
<400> 19
Met Ala Asp Pro Asp Leu Ser Ser Pro Leu Ile His His Gln Ser Ser
1 5 10 15
Asp Gln Pro Glu Val Val Ile Ser Ile Ala Asp Asp Asp Asp Asp Glu
20 25 30
Ser Gly Leu Asn Leu Leu Pro Ala Val Val Asp Pro Arg Val Ser Arg
35 40 45
Gly Phe Glu Phe Asp His Leu Asn Pro Tyr Gly Phe Leu Ser Glu Ser
50 55 60
Glu Pro Pro Va1 Leu Gly Pro Thr Thr Val Asp Pro Phe Arg Asn Asn
55 70 75 80
Thr Pro Gly Val Ser Gly Leu Tyr G1u Ala Ile Lys Leu Val Ile Cys
85 90 95
Leu Pro Ile Ala Leu Ile Arg Leu Val Leu Phe Ala Ala Ser Leu Ala
100 105 110
Val Gly Tyr Leu Ala Thr Lys Leu Ala Leu Ala Gly Trp Lys Asp Lys
115 120 125
Glu Asn Pro Met Pro Leu Trp Arg Cys Arg Ile Met Trp Ile Thr Arg
130 135 140
Ile Cys Thr Arg Cys Ile Leu Phe Ser Phe Gly Tyr Gln Trp IIe Arg
145 150 155 160
CA 02343969 2001-03-20
WO UO/I8889 1 g PCT/US9912223I
Arg Lys Gly Lys Pro Ala Arg Arg Glu I1e Ala Pro Ile Val Val Ser
165 170 17S
Asn His Val Ser Tyr Ile Glu Pro Ile Phe Tyr Phe Tyr Glu Leu Ser
180 185 190
Pro Thr Iie Val Ala Ser Glu Ser His Asp Ser Leu Pro Phe Val Gly
195 200 205
Thr Ile Ile Arg Ala Met Gln Val Ile Tyr Val Asn Arg Phe Sex Gln
210 215 220
Thr Ser Arg Lys Asn Ala Val His Glu Ile Lys Arg Lys Ala Ser Cys
225 230 235 240
Asp Arg Phe Pro Arg Leu Leu Leu Phe Pro Glu G1y Thr Thr Thr Asn
245 250 255
Gly Lys Val Leu Ile Ser Phe Gln Leu Gly Ala Phe Ile Pro Gly Tyr
260 265 270
Pro Ile Gln Pro Val Val Val Arg Tyr Pro His Val His Phe Asp Gln
275 280 285
Ser firp Gly Asn Ile Ser Leu Leu Thr Leu Met Phe Arg Met Phe Thr
290 295 300
Gln Phe His Asn Phe Met Glu Val G1u Tyr Leu Pro Val Ile Tyr Pro
305 310 315 320
Ser Glu Lys Gln Lys Gln Asn Ala Val Arg Leu Ser Gln Lys Thr Ser
325 330 335
His Ala Ile Ala Thr Ser Leu Asn VaI Val Gln Thr Ser His Ser Phe
340 345 350
Ala Asp Leu Met Leu Leu Asn Lys Ala Thr Glu Leu Lys Leu Glu Asn
355 360 365
Pro Ser Asn Tyr Met Val Glu Met Ala Arg Val Glu Ser Leu Phe His
370 375 380
Val Ser Ser Leu Glu Ala Thr Arg Phe Leu Asp Thr Phe Val Ser Met
385 390 395 400
Ile Pro Asp Ser Ser Gly Arg Val Arg Leu His Asp Phe Leu Arg Gly
405 410 415
Leu Lys Leu Lys Pro Cys Pro Leu Ser Lys Arg Ile Phe Glu Phe Ile
420 425 430
Asp Val Glu Lys Val Gly Ser Ile Thr Phe Lys Gln Phe Leu Phe Ala
435 440 445
Ser Gly His Val Leu Thr Gln Pro Leu Phe Lys Gln Thr Cys Glu Leu
450 455 460
Ala Phe Ser His Cys Asp Ala Asp Gly Asp Gly Tyr Ile Thr Ile Gln
465 470 475 480
Glu Leu Gly Glu Ala Leu Lys Asn Thr Ile Pro Asn Leu Asn Lys Asp
485 490 495
Glu Ile Arg Gly Met Tyr His Leu Leu Asp Asp Asp Gln Asp Gln Arg
500 505 510
Ile Ser Gln Asn Asp Leu Leu Ser Cys Leu Arg Arg Asn Pro Leu Leu
515 520 525
Ile Ala Ile Phe Ala Pro Asp Leu A1a Pro Thr
CA 02343969 2001-03-20
WO 00/18889 19 PCT/US99/22231
530 535
<210> 20
<211> 1128
<212> DNA
<213> Arabidopsis sp.
<400> 20
atggaaaaaa agagtgtacc aaattctgat aagttgtctc tgattagagt gttaagaggt 60
ataatatgtc tgatggtgtt agtttcaaca gcttttatga tgttgatatt ctgggggttc 120
ttatcagctg tagtgttgag gcttttcagc attcgctata gccgtaaatg tgtttccttc 180
ttctttggct cgtggctcgc cttgtggcct ttcctctttg agaagattaa caaaaccaaa 240
gttatcttct ctggtgataa ggttccttgc gaggatcgag tattgctcat tgcaaaccac 300
cgaacagaag ttgattggat gtacttctgg gatcttgcac tgcgtaaagg ccagattggg 360
aatatcaaat atgtgcttaa gagtagtttg atgaaattac ctctctttgg ttgggcgttt 420
cacctctttg agtttattcc tgttgagagg agatgggaag tcgatgaagc aaacttgaga 480
cagatagttt cgagttttaa ggatccccga gacgctttat ggcttgctct tttccccgag 540
ggcacagatt acacagaggc taaatgccaa aggagtaaga aatttgctgc tgaaaatggc 600
cttccgatac tgaacaacgt gctgcttccc aggacaaaag gtttcgtctc ctgcttgcaa 660
gaactgagtt gctcacttga cgcagtttat gatgtgacca tcggttataa aacccgctgc 720
ccatctttct tagacaacgt ttatggaatt gagccatcag aagttcacat ccacatccgt 780
cgtatcaacc tgacccaaat cccaaatcaa gaaaaggaca tcaatgcttg gttaatgaac 840
acattccagc tcaaagacca gctgctcaat gacttttact ccaatggtca tttccctaac 900
gaaggaacag agaaagagtt caacacaaag aagtacctca taaactgttt ggcagtgatt 960
gccttcacca ccatctgtac acatctcacc ttcttctcat caatgatttg gttcaggatt
1020
tatgtctctt tggcctgtgt ctacttgacc tctgctacgc atttcaatct tcgttctgtt
1080
ccacttgttg agactgcaaa aaattccctc aaattagtaa acaaataa
1128
<210> 21
<211> 375
<212> PRT
<213> Arabidopsis sp.
<400> 22
Met Glu Lys Lys Ser Val Pro Asn Ser Asp Lys Leu Ser Leu Ile Arg
1 5 10 15
Val Leu Arg Gly Ile Ile Cys Leu Met Val Leu Val Ser Thr Ala Phe
20 25 30
Met Met Leu Ile Phe Trp Gly Phe Leu Ser Ala Val Val Leu Arg Leu
35 40 45
Phe Ser Ile Arg Tyr Ser Arg Lys Cys Val Ser Phe Phe Phe Gly Ser
50 55 60
Trp Leu Ala Leu Trp Pro Phe Leu Phe Glu Lys Ile Asn Lys Thr Lys
65 70 75 80
Val Ile Phe Ser Gly Asp Lys Val Pro Cys Glu Asp Arg Val Leu Leu
85 90 95
Ile Ala Asn His Arg Thr Glu Val Asp Trp Met Tyr Phe Trp Asp Leu
100 105 110
Ala Leu Arg Lys Gly Gln I1e G1y Asn Ile Lys Tyr Val Leu Lys Ser
115 120 125
Ser Leu Met Lys Leu Pro Leu Phe Gly Trp Ala Phe His Leu Phe Glu
130 135 140
Phe I1e Pro Val Glu Arg Arg Trp Glu Val Asp Glu Ala Asn Leu Arg
145 150 155 160
Gln Ile Val Ser Ser Phe Lys Asp Pro Arg Asp Ala Leu Trp Leu Ala
165 170 175
CA 02343969 2001-03-20
WO 00!18889 Za . PCTIUS99/22231
Leu Phe Pro Glu G1y Thr Asp Tyr Thr Glu Ala Lys Cys Gln Arg Sex
180 185 190
Lys Lys Phe AIa A1a Glu Asn Gly Leu Pro Ile Leu Asn Asn Val Leu
195 200 205
Leu Pro Arg Thr Lys Gly Phe Val Ser Cys Leu G1n Glu Leu Ser Cys
210 215 220
Ser Leu Asp Ala Val Tyr Asp Val Thr Ile Gly Tyr Lys Thr Arg Cys
225 230 235 240
Pro Ser Phe Leu Asp Asn Val Tyr Gly Ile GIu Pro Ser Glu Val His
245 250 255
Ile His I1e Arg Arg Ile Asn Leu Thr Gln Ile Pro Asn Gln Glu Lys
260 265 270
Asp Ile Asn Ala Trp Leu Met Asn Thr Phe.Gln Leu Lys Asp Gln Leu
275 280 285
Leu Asn Asp Phe Tyr Ser Asn Gly His Phe Pro Asn Glu Gly Thr Glu
290 295 300
Lys Glu Phe Asn Thr Lys Lys Tyr Leu Ile Asn Cys Leu A1a Val Ile
305 310 315 320
Ala Phe Thr Thr Ile Cys Thr His Leu Thr Phe Phe Ser Ser Met Ile
325 330 335
Trp Phe Arg Ile Tyr Val Ser Leu Ala Cys Va1 Tyr Leu Thr Ser Ala
340 345 350
Thr His Phe Asn Leu Arg Ser Val Pro Leu Val Glu Thr Ala Lys Asn
355 360 365
Ser Leu Lys Leu Val Asn Lys
370 375
<210> 22
<211> 1170
<212> DNA
<213> Arabidopsis sp.
<400> 22
atggtgattg ctgcagctgt catcgtgcct ttgggccttc tcttcttcat atctggtctc 60
gctgtcaatc tctttcaggc agtttgctat gtactcattc gaccactgtc taagaacaca 120
tacagaaaaa ttaaccgggt ggttgcagaa accttgtggt tggagcttgt atggatagtt 180
gactggtggg ctggagttaa gatccaagtg tttgctgata atgagacctt caatcgaatg 240
ggcaaagaac atgctcttgt cgtttgtaat caccgaagtg atattgattg gcttgtggga 300
tggattctgg ctcagcggtc aggttgcctg ggaagcgcat tagctgtaat gaagaagtct 360
tccaaattcc ttccagtcat aggctggtca atgtggttct cggagtatct ctttctggaa 420
agaaattggg ccaaggatga aagcactcta aagtcaggtc ttcagcgctt gagcgacttc 480
cctcgacctt tctggttagc cctttttgtg gagggaactc gctttacaga agccaaactt 540
aaagccgcac aagagtatgc agcctcctct gaattgccta tccctcgaaa tgtgttgatt 600
cctcgcacca aaggtttcgt gtcagctgtt agtaatatgc gttcatttgt cccagcaatt 660
tatgatatga cagtgactat tccaaaaacc tctccaccac ccacgatgct aagactattc 720
aaaggacaac cttcagtggt gcatgttcac atcaagtgtc actcgatgaa agacttacct 780
gaatcagatg acgcaattgc acagtggtgc agagatcagt ttgtggctaa ggatgctctg 840
ttagacaaac acatagctgc agacactttc cccggtcaac aagaacagaa cattggccgt 900
cccataaagt cccttgcggt ggttctatca tgggcatgcg tactaactct tggagcaata 960
aagttcctac actgggcaca actcttttct tcatggaaag gtatcacgat atcggcgctt
1020
ggtctaggta tcatcactct ctgtatgcag atcctgatac gctcgtctca gtcagagcgt
1080
tcgaccccag ccaaagtcgt cccagccaag ccaaaagaca atcaccaccc agaatcatcc
1140
CA 02343969 2001-03-20
WO 00/18889 21 PCT/US99I22231
tcccaaacag aaacggagaa ggagaagtaa
1170
<210> 23
<211> 389
<212> PRT
<213> Arabidopsis sp.
<400> 23
Met Val Ile Ala Ala Ala Val Ile Val Pro Leu Gly Leu Leu Phe Phe
1 5 10 15
Ile Ser Gly Leu Ala Val Asn Leu Phe Gln Ala Val Cys Tyr Va1 Leu
20 25 30
Ile Arg Pro Leu Ser Lys Asn Thr Tyr Arg Lys Ile Asn Arg Va1 Val
35 40 45
Ala Glu Thr Leu Trp Leu Glu Leu Val Trp Ile Val Asp Trp Trp Ala
50 55 60
Gly Val Lys Ile Gln Val Phe Ala Asp Asn Glu Thr Phe Asn Arg Met
65 70 75 80
Gly Lys Glu His Ala Leu Val Val Cys Asn His Arg Ser Asp Ile Asp
85 90 95
Trp Leu Val Gly Trp Ile Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser
100 105 110
Aia Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly
115 120 125
Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Asn Trp Ala
130 135 140
Lys Asp Glu Ser Thr Leu Lys Ser Gly Leu Gln Arg Leu Ser Asp Phe
145 150 155 160
Pro Arg Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr
165 170 175
Glu Ala Lys Leu Lys Ala Ala Gln Glu Tyr Ala Ala Ser Ser Glu Leu
180 185 190
Pro Ile Pro Arg Asn Val Leu Ile Pro Arg Thr Lys G1y Phe Val Ser
195 200 205
Ala Val Ser Asn Met Arg Ser Phe Val Pro Ala I1e Tyr Asp Met Thr
210 225 220
Val Thr Ile Pro Lys Thr Ser Pro Pro Pro Thr Met Leu Arg Leu Phe
225 230 235 240
Lys Gly Gln Pro Ser Val Val His Val His Ile Lys Cys His Ser Met
245 250 255
Lys Asp Leu Pro Glu Ser Asp Asp Ala Ile Ala Gln Trp Cys Arg Asp
260 265 270
Gln Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Tle Ala Ala Asp
275 280 285
Thr Phe Pro Gly Gln Gln Glu Gln Asn Ile G1y Arg Pro Ile Lys Ser
290 295 300
Leu Ala Val Val Leu Ser Trp Ala Cys Val Leu Thr Leu G1y Ala Ile
305 310 315 320
Lys Phe Leu His Trp Ala Gln Leu Phe Ser Ser Trp Lys Gly I1e Thr
CA 02343969 2001-03-20
WO 00118889 22 PCT/US99l22231
325 330 335
Ile Ser Ala Leu Gly Leu G1y Ile Ile Thr Leu Cys Met Gln Ile Leu
340 345 350
Ile Arg Ser Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Val .Pro
355 360 365
Ala Lys Pro Lys Asp Asn His His Pro Glu Ser Ser Ser G1n Thr Glu
370 375 380
Thr Glu Lys Glu Lys
385
<210> 24
<211> 269
<212> DNA
<213> Glycine max
<400> 24
gac.ccactga acgctctcat caccttcacg tggctcccct tcggcttcat cctctccatc 60
ataagggtct acttcaacct ccctctccca gaacncattg tccgctacac ctacgagatg 120
ctcggcatca acctcgtcat ccgcggccac cgccctcctc cgccttcccc cggcaccccc 180
ggcaacctct acgtctgcaa ccaccgcacc gctctcgacc ccatcgtcat cgccattgcc 240
ctcggccgca aggtctcctg cgtcaccta 269
<210> 25
<211> 242
<2i2> DNA
<213> Glycine max
<400> 25
tgatcttcca cgacggccgt ttcgtgcaga ggccagaccc actgaacgct ctcatcacct 60
tcacgtggct ccccttcggc ttcatcctct ccatcataag ggtctacttc aaccttcctc 120
tcccagaacg cattgtccgc tacacctacg agatgctcgg catcaacctc gtcatccgcg 180
gCCaCCgCCC tcctccgcct tcccccggca cccccggcaa cctctacgtc tgcaaccacc 240
gc 242
<210> 26
<211> 272
<212> DNA
<213> Glycine max
<400> 26
gtttgttcaa aggccaactc ctctagcagc cctcttgacc ttcctatggt tgccaattgg 60
catcatactc tccatnctta agggtctacc ttaacatccc tttgcctgaa agaattgctt 120
ggtataacta taagctatta ggaatcagag ttattgtgaa gggtacccct ccaccacccc 180
caaagaaggg tcaaagtggt gtcctatttg tttgtaacca ccgcacagtt ttagaccctg 240
tggttactgc agttgcactt ggaagaaaaa tt 272
<210> 27
<211> 218
<212> DNA
<213> Glycine max
<400> 27
atagcacagg agggttacat ggtgcctccg agcaaatcag caaaggcagt cccacaggag 60
cgtctgaaga gcagaatgat cttccacgac gggcgtttcg tgcagaggcc agacccaatg 120
aatgccctca tcaccttcac atggctccct ttgggtttcg tcctctccat cataagggtc 180
tacttcaacc tccctctccc agaacgcatc gtccgcta 218
<210> 28
<211> 270
<212> DNA
<213> Glycine max
<400> 28
gtgcctgttg ctgtgaactg caagcagaac atgttctttg gaaccaccgt tcgtggcgtc 60
aagttctggg acccttaact tacttcttac atgaacccta ggcctgtgta cgaggttacc 120
CA 02343969 2001-03-20
WO 00/18889 23 PCT/US99/22231
ttaccttgat acctttgccg aggagatgtc ggttaaggct ggggggaagt cgtccattga 180
ggtggccaac cacgtggcag aaggtgctgg gggatgtgtt agggtttgag tgcaccgggt 240
tgactaggaa ggataagtat atgttgttgg 270
<210> 29
<211> 252
<212> DNA
<213> Glycine max
<400> 29
catgagggta ggtttgctca aaggccaact cctctagctg ccctcttgac cttcctatgg 60
ctgccaattg gcatcatact ctccatctta agggtctacc ttaacatccc tttgcctgaa 120
agaattgttg gtacaactac aagctcttag gaatcagagt tattgtgaag ggtacccctc 180
caccgccccc aaagaagggt caaagtggtg tctatttgtt tgtaaccacc gcacagtatt 240
agaccctgtt gt 252
<210> 30
<211> 272
<212> DNA
<213> Glycine max
<400> 30
ctgggactgc cttaaacgat gcatggatct tatcaagaaa ggagcctctg tttttttctt 60
tccagaggga acacgcagta aagatggaag actaggcaca ttcaagaagg gtgctttcag 120
tgttgctgca aagacaaatg caccagtagt accaattacc cttattggaa ctggtcaaat 180
catgcctgca ggaaaggagg gaatagtgaa cataggttct gtgaaagtgg ttatacataa 240
acctattgtt ggaaaggatc ctgacatgtt at 272
<210> 31
<211> 239
<212> DNA
<213> Glycine max
<400> 31
cgggaatcaa ggtcatcaga cttcaagggt gtttcagctg ttgtcactga cagaattcga 60
gaagctcatc agaatgagtc tgctccatta atgatgttat ttccagaagg tacaaccaca 120
aatggagagt tcctccttcc attcaagact ggtggttttt tggcaaaggc accggtactt 180
cctgtgatat tacgatatca ttaccagaga tttagccctg cctgggattc catatctgg 239
<210> 32
<211> 242
<212> DNA
<213> Glycine max
<400> 32
gaacggcaac ggcaacagcg ttcgcgatga ccgtcctctg ctgaagccgg agcctccggt 60
cttccgccga cagcatcgcc gatatggaga agaagttcgc cgcttacgtc cgccgctacg 120
tgtacggcac catgggacgc ggcgagttgc ctcccaagga gaagctcttg ctcggtttcg 180
cgttggtcac tcttctcccc attcgagtcg ttctcgccgt caccatattg ctcttttatt 240
ac 242
<210> 33
<211> 248
<212> DNA
<213> Giycine max
<400> 33
ttcttcttct ctcactctct aaaaccctaa ctctatacat ggaagggaaa nctcaaatct 60
natgactaat taattaatcc atcgatcaag catggagtcc gaactcaaag acctcaattc 120
gaagccgccg aacggcaacg gcaacagcgt tcgcgatgac cgtcctctgc tgaagccgga 180
gcctccggtc tccgccgaca gcatcgccga tatggagaag.aagttcgccg cttacgtccg 240
ccgcgacg 248
<210> 34
<211> 217
<212> DNA
<213> Glycine max
<400> 34
aaaaccctaa ttctatacat ggaagggaaa tctcaaatct aatgactaat taattaatcc 60
CA 02343969 2001-03-20
WO 00/18889 24 PCT/US99/22231
atcgatcaag catggagtcc gaactcaaag acctcaattc gaagccgccg aacggcaacg 120
gcaacagcgt tcgcgatgac cgtcctctgc tgaagccgga gcctccggtc tccgccgaca 180
gcatcgccga tatggagaag aagttcgccg cttacgt 217
<210> 35
<211> 257
<222> DNA
<213> Glycine max
<400> 35
atctctgtct ctgcatttcc ctccctaaaa ccctaattct acatttggaa aggaaatctc 60
aaatctaatg actaattaat caatcaatcg tattaataat ccatcgatca agtatggagt 220
ccgaactcaa agacctcaat tcgaagccac ccaactgcaa cggcaacgcc aacagcgttt 180
gcgacgaccg tcctctgctg aagccggagc ctccggcctc ctccgacagc atcgccgaga 240
tggagaagaa gttcgcc 257
<210> 36
<211> 284
<212> DNA
<213> Glycine max
<400> 36
cccgaccaaa acaggttttt gtggccaatc atacttccat gattgatttc attatcttag 60
aacagatgac tgcatttgct gttattatgc agaagcatcc tggatgggtt ggattattgc 120
agagcaccat tntggagagt gtagggtgta tctggttcaa ccgtacagag gcaaaggatc 180
gagaagttgt ggcaaggaaa ttgagggatc atgtcctggg agctaacaac.aaccctcttc 240
ttatatttcc tgaaggaact tgtgtaaata atcactactc gtca 284
<210> 37
<211> 246
<212> DNA
<213> Glycine max
<400> 37
ggagatccgc ataagcaaat caatcatcct gttccttcct tatctctgtc tctgcatttc 60
cctccctaaa accctaattc tacatttgga aaggaantct caaatctaat gataattaat 120
caatcaatcg tattaataat ccatcgatca agtatggagt ccgaactcaa agacctcaat 180
tcgaagccac ccaactgcaa cggcaacgcc aacagcgttt gcgacgaccg tcctctgctg 240
aagccg 246
<210> 38
<211> 278
<212> DNA
<213> Glycine max
<400> 38
gttttctatt gccacgttgt ggaagcgtaa cgaagatgaa tggcattggg aaactcaaat 60
cgtcgagttc tgaattggac cttcacattg aagattacct accttctgga tccagtgttc 120
aacaagaacg gcatggcaag ctccgactgt gtgatttgct agacatttct cctagtctat 180
ctgaggcagc acgtgccatt gtagatgata cattcacaag gtgcttcaag caaatcctcc 240
agaaccttgg aactggaatg tttatttgtt tcctttgt 278
<210> 39
<211> 322
<212> DNA
<213> Glycine max
<400> 39
ttaactttgg cacattctcc ttttgttcat caatgtgtgt tgtaaattgt ncatttcctt 60
cagaggtctt tggtaganat gatgtgcagt ttctgtggtg catcttggac tgnggntgtt 120
aagnatcatg gacccaggcc tagcaggaga ccaaagcagg tttttgtagc caaccatact 180
tcatgattga tntcattatn tnagaacaga tgactgcttt tgcngttatn atgcagaagc 240
atcctggatg ggttggtaag cntacagnat gtcaacngtg tatnaaatat gntacacnnn 300
acttgcgtct tc 312
<210> 40
<211> 255
<212> DNA
<213> Glycine max
CA 02343969 2001-03-20
WO 00/18889 25 PCT/US99/22231
<400> 40
ggattattgn ngcanatgca gtcatctgtt ctaagataat ganatcnatc atggaagtat 60
gattggncac anaaacctgt yttttggttg gatactaggt cttggcccat ggtacttgac 120
naccccagtc catgatgcaa canaganact gnacatcatc tccaccaaac ccctctgana 180
ganacgagaa ttgagcaatt tagagtacct tggtttgatg caagtcagta tattcaagtt 240
tctattcatc aaagg 255
<210> 41
<211> 291
<212> DNA
<213> Glycine max
<400> 41
caacctccca tgcaatcgct caccctctcc gtcacctgaa tctgttttct attccctccg 60
tcgcgtaaca aggatgaatg gcattgggaa actcaaatcg tcgagttctg aattggacct 120
tcacattgaa gattacctgc cttctggatc cagtgttcaa caagaacggc atggcaagct 180
ccgcctgtgt gatttgctag acatttctcc tagtctatct gaggcagcac gtgccattgt 240
agatgataca ttcacaaggt gcttcaagtc aaatcctcca gaaccttgga a 291
<210> 42
<211> 284
<212> DNA
<213> Glycine max
<400> 42
ctgcaaccta ccatgcaatt cctcacctga atccgttttc tattgccacg.ttgtggaagc 60
gtaacgaaga tgaatggcat tgggaaactc aaatcgtcga gttctgaatt ggaccttcac 120
attgaagatt acctaccttc tggatccagt gttcaacaag aacggcatgg caagctccga 180
ctgtgtgatt tgctagacat ttctcctagt ctatctgagg cagcacgtgc catgtagatg 240
atacatcaca aggtgctcaa gtcaaatctc cagaaccttg gaat 284
<210> 43
<211> 268
<212> DNA
<213> Glycine max
<400> 43
ctgaagtatt ctcgtcctag cccaaagcat agagaaaggn agcaacagaa ctttgctgag 60
tcagtgctgc ggcgatggga ggaaaagtga tgtgtacctt tatgtggtgt tgttcttaat 120
tattcttagt aatgccattg cttcgacccc tttttttgct tttgttttgt cattgctaac 180
tatttatttt taacactttt attaaagata tggcatatat ncacttcagt anacaaagtt 240
gtnccagtaa tttnttttcc aaaaaaaa 268
<210> 44
<211> 241
<212> DNA
<213> Glycine max
<400> 44
gancaaaatt gccctccatc actttccttg ttagagttgg tttctgcnac ctaccatgca 60
attccctcac ctgaatccgt tttctattgc cacgttgtgg aagcgtaacg aagatgaatg 120
gcattgggaa actcaaatcg tcgagttctg aattggacct tcacattgaa gattacctac 180
cttctggatc cagtgttcaa caagaacggc atggcaagct ccgactgtgt gatttgctag 240
a 241
<210> 45
<211> 247
<212> DNA
<213> Glycine max
<400> 45
gtaggatgtc tgagatcctt gccccaatca aaacggtgcg gttaactaga aaccgcgacg 60
aggatgcgaa aatgatgaaa aatttgctgg ggcaagggga cctggtggtt tgtcctgaag 120
ggaccacatg tagagaacct tatttattga ggttcagccc tctgttctca gagatgtgcg 180
atgagattgt ccccgttggc agttgattcc cagttatatg ttccacggaa ccactgctgg 240
247
tgganta
<210> 46
<211> 271
<212> DNA
CA 02343969 2001-03-20
WO 00/18889 26 . PCT/US99I22231
<213> Glycine max
<400> 46
tgcagggggg cttgttagag ccatagtttt ggttcttcta tacccttttg tttgtgtcgt 60
aggaaaagag atggggttga agataatggt catggcatgc ttcttcggga tcaaagcatc 120
gagcttcaga gttggaaggt ccgttttgcc cnaattcttc tnggaggacg ttngtgcaga 180
aatgtttgag gcactcaaaa aaggagggaa gacagtggga gttaccaatt taccccacgt 240
gatggtggaa agcttcttga gagagtattt g 271
<210> 47
<211> 242
<212> DNA
<213> Glycine max
<400> 47
ttcacagctg tcacgccgtn aacggaaaat ggcaacggcg agacgcagtt tcccgcctat 60
caccgaatgc aacggaacga cnccgtgcga ntctgtngnc gccgacctcg agggtacgct 120
cctcatctcc cgtngctcgt tcccgtactt catgctcgtc gccgtcgaag ccggcagcnt 180
cctccgcggc ctcatgctnc tcctctccct tccgttcgtc atnatcgcct acctcttcat 240
ct 242
<210> 48
<211> 244
<212> DNA
<213> Glycine max
<400> 48
acatattctt cagttagctc ccccaaccta tacacttcac caccacacca caaccctacc 60
ctctctctct gtcatggtca ttggaggagc cttccctcgt ttcgacccaa tcaccaaatg 120
tagacccaag accgctccaa ccagaccatc gcctcggacc tcgatggcac cctccttgtc 180
tcccggagtg ccttccccta ctacttcctc gtcgccctcg aagccggcag cgtcttccga 240
gcct 244
<210> 49
<211> 230
<212> DNA
<213> Glycine max
<400> 49
caacattcca cctagctccc caatcacatc ttcaccacac cataaacctt cttaatttct 60
ctcttcattt tctcctctat tgtcataatc atggggacct tccctcgctt cgacccaatc 120
accacccaag accggtccaa ccagaccgtg gcctccgacc ttgacggcac cctcctcgtc 180
tcccggagcg ccttccccta ctacctcctc gttgccctcg aagccggcag 230
<210> 50
<211> 265
<212> DNA
<213> Glycine max
<400> 50
ctggtgaata atcctaagtt atggagtctg tggtgtgtga gctagaaggc acgcttgtga 60
aggacaagga tgcgttctca tacttcatgt tggttgcgtt tgaagcttca ggtttggttc 120
gtttcgcctt gttgctaaca ctattgcccg tgattcggtt ccttgacatg gttggcatga 180
acgatgcatc tctcaagcta ntnatcttcg tggctgtggc tggtgttcca aagtccgaga 240
ttgaatcagt ggctagggca gtttt 265
<210> 51
<211> 252
<212> DNA
<213> Glycine max
<400> 51
ctggtgaata atcctaagtt atggagtctg tggtgtgtga gctagaaggc acgcttgtga 60
aggacaagga tgcgttctca tacttcatgt tggttgcgtt tgaagcttca ggtttggttc 120
gtttcgcctt gttgctaaca ctattgcccg tgattcggtt ccttgacatg gttggcatga 180
acgatgcatc tctcaagcta atgatcttcg tggctgtggc tgggttccaa agtccgagat 240
tgaatcagtg gc 252
<210> 52
<211> 218
CA 02343969 2001-03-20
WO 00118889 2~ PCTIUS99l22231
<212> DNA
<213> Glycine max
<400> 52
aactgcaact acaacaacat tcattcattc acagctgtca cgccgtgaac ggaaaatggc 60
aacggcgaga cgcagtttac ccgcctatac accgaatgca acggaacgac accgtgcgag 120
tctgtggccg ccgacctcga cggtacgctc ctcatntccc gtagctcgtt cccgtacttc 180
atgctcgtcg ccgtcgaagc cggcagcctc ctccgcgg 218
<2I0> 53
<211> 262
<212> DNA
<213> Glycine max
<400> 53
ggttaaggac attgagatgg tcgnntcctc ggtgctgccc aagttctaca ccgaggacgt 60
gcnccccgag agctggagag tcttcaatcc ttcgggaagc gttacattgt cactgctagt 120
ctagggtgat ggtggagcan tttgttaaga cgtttcttgg ggctgataag gtgcttggga 180
ctgagcttga ggccacgaaa tcggggaggt tcatgggttt gttaaggagc ctggtgtgct 240
tgttggggag cacaagaaag tg 262
<210> 54
<211> 212
<212> DNA
<223> Glycine max
<400> 54
gcaactacaa caacattcat tcattcacag ctgtcacgcc gtgaacggaa aatggcaacg 60
gcgagacgca gtttcccgcc tatcaccgaa tgcaacggaa cgacgccgtg cgagtctgtg 120
gccgccgacc tcgacggtac gctcctcatc tcccgtagnc cgttcccgta cttcatgctc 180
gtngccgtcg aagccggcag cctcctccgc gg 212
<210> 55
<211> 273
<212> DNA
<213> Glycine max
<400> 55
catggttttc ttgagcttct ttggcctcag aaaggacaca ttcagaacag gatcagctgt 60
tctggcaaag ttcttcttag aagatgttgg attggaaggc tttgaggccg taatatgttg 120
tgagagaaaa gtggcatcta gtaagttgcc aagggtcatg gttgaaaatt tcctcaagga 180
ctatttaggg gttgatgctg ttatagcaag agaattgaag tcctttagtg gcttcttttt 240
gggagttttt gagagtaaga agccaattaa aat 273
<210> 56
<211> 257
<212> DNA
<213> Glycine max
<400> 56
ctctcaaaaa aggagggaag acagtgggag tcaccaatct accccatgtg atggtggaaa 60
gcttcttgag agagtatttg gacattgatt tcgttgtggg cagggagctg aaagttttct 120
gtggatacta cgtaggattg atggatgaca caaaaactat gcatgccttg gagctggtta 180
aagaaggaaa aggatgctcc gacatgatcg gaatcacaag gtttcgcaac atacgcgacc 240
atgatgattt tttctcc 257
<210> 57
<211> 240
<212> DNA
<213> Glycine max
<400> 57
gaactaagtg tgaaccacta ccaagaaaca agcttttaag tccaattatt tttcatgagg 60
gtaggtttgc tcaaaggcca actcctctag ctgnnctctt gaccttccta tggctgccaa 120
ttggcatcat actctccatc ttaagggtct accttaacat ccctttgcct gaaagaattg 180
cttggtacaa ctacaagctc ttaggaatca gagttattgt gaagggtacc cctccaccgc 240
<210> 58
<211> 254
<212> DNA
CA 02343969 2001-03-20
WO 00118889 2g PCT/US99/22231
<213> Glycine max
<400> 58
cttggaataa gggtcattag gaagggtatc cctccacccc cagcnaagaa gggccaaagt 60
ggagtcctat ttgtatgcaa ccacaggaca gttttagacc ctgtggttac agctgttgca 120
ttaggaagga aaattagctg tgtcacatat agcataagca aattcactga aataatttca 180
ccaatcaaag ctgtggcact ctctagggag agggacaaag atgctgccaa catcaagang 240
ttgcttgagg aagg 254
<210> 59
<211> 267
<212> DNA
<223> Glycine max
<400> 59
gccaganaga cttgcttggt acaactacaa gcttcttgga ataagggtca ttaggaaggg 60
tatccctcca cccccagcaa agaagggcca aagtggagtc ctatttgtat gcaaccacag 120
gacagtttta gaccctgtgg ttacagctgt tgcattagga aggaaaatta gctgtgtcac 180
atatagcata agcaaattca ctgaaataat tcaccaatca aagctgtggc actctctagg 240
gagagggacc nagatgctgc cnacatc 267
<210> 60
<211> 261
<212> DNA
<213> Glycine max
<400> 60
gtaaccacag ggtctaaaac tgtgcggtgg ttactgcagt tgcacttgnc nagaaaaatt 60
tgcttatgct atatgtgaca cagctaattc actgnaataa tttcaccaat taaagctgtg 120
gcactctcaa ggganngaga gaaagatgct gccaatatcc ngagactact tgaggaaggg 180
gacttggtga tttgccctga aggcacaact tgtagagagc cttcctcttg aggttcagtg 240
cactatttgc tgaactcact g 262
<210> 61
<211> 258
<212> DNA
<213> Glycine max
<400> 61
caaggagctc acatgcagtg gagggaaatc agctattgaa gttgcaaact acattcaaag 60
ggttcttgca gggactttgg gatttgagtg cacaaatttg actaggaaga gcaaatatgc 120
catgcttgca ggcacagatg ggacagttcc atctaaggag aaggcttgan aagggagaga 180
aattaagttc tcccttttga ttattctgta ttggtgccca atgtgtttcc aaaacactta 240
gaattatgat agaaataa 258
<210> 62
<211> 258
<212> DNA
<213> Glycine max
<400> 62
attggcataa tcctctccat cctaagggtc tatctcaaca tccctctgcc agaaagactt 60
gcttgntaca actacaagct tcttggaata agggtcatta ggaagggtat ccctccaccc 120
ccagcaaaga agggccaaag tggagcctat ttgtatgcaa ccacaggaca gttttagacc 180
ctgtggttac agctgttgca ttaggaagga aaattagctg tgtcacatat agcataagca 240
aattcactga aataattt 258
<210> 63
<211> 239
<212> DNA
<213> Glycine max
<400> 63
cacttcacca ccacaccaca accctaccct ctctctctgt catggtcatt ggaggagcct 60
tccctcgttt cgacccaatc accaaatgta gcacccaaga ccgctccaac cagaccatcg 120
cctcggacct cgatggcacc ctccttgtct cccggagtgc cttcccctac tacttcctcg 180
tcgccctcga agccggcagc gtcttccgag ccctccttct cttaaccttc gtccccttc 239
<210> 64
<211> 531
CA 02343969 2001-03-20
WO UQ/1$$$9 . PCT/US99/22231
29
<212> DNA
<213> Glycine max
<400> 64
ccgagaaccg gtctaaccaa accgtggcct cggacttgga cggcaccctc ctggtgtccc 60
ccagcgcatt tccttactac atgctggtcg ccatcgaagc cggcagcttc ctccgtggcc 120
ttgtcctcct tgcctccgtc cctttcgtgt attcacgtac atattcctct ccgagaccgc 180
ggccatcaag tccctgatct tcatcgcctt cgcgggcctg aaggtcaggg acgttgagat 240
ggtcgcgtgc tcggtgctgc ccaagttcta cgccgacata ttcttcagtt agctccccca 300
acctatacac ttcaccacca caccacaacc ctaccctctc tctctgtcat ggtcattgga 360
ggagccttcc ctcgtttcga cccaatcacc aaatgtagca cccaagaccg ctccaaccag 420
accatcgcct cggacctcga tggcaccctc cttgtctccc ggagtgcctt cccctactac 480
ttcctcgtcg ccctcgaagc cggcagcgtc ttccgagccc tccttctctt a 531
<210> 65
<211> 256
<212> DNA
<213> Glycine max
<400> 65
acatattctt cagttagctc ccccaaccta tacacttcac caccacacca caaccctacc 60
ctctctctct gtcatggtca ttggaggagc cttccctcgt ttcgacccaa tcaccaaatg 120
tagcacccaa gaccgctcca accagaccat cgcctcggac ctcgatggca ccctccttgt 180
ctcccggagt gccttcccct actacttcct cgtcgccctc gaagccggca gcgtcttccg 240
agccctcctt ctctta 256
<210> 66
<211> 260
<212> DNA
<213> Glycine max
<400> 66
ccatccaaca tattcttcag ttagctcccc caacctatac acttcaccac cacaccacaa 60
ccctaccctc tctctctgtc atggtcattg gaggagcctt ccctcgtttc gacccaatca 120
ccaaatgtag cacccaagac cgctccaacc agactatcgc ctcggacctc gatggcaccc 180
tccttgtctc ccggagtgcc ttcccctact acttcctcgt cgccctcgaa gccggcagcg 240
tcttccgagc cctccttctc 260
<210> 67
<211> 248
<212> DNA
<213> Glycine max
<400> 67
caccaaccaa acctcactct ccctttctcc cctgaccctc tccctgccat ggtcatggga 60
gcctttggcc acttcgaacc ggtctccaaa tgcagcaccg agaaccggtc taaccaaacc 120
gtggcctcgg acttggacgg caccctcctg gtgtccccca gcgcatttcc ttactacatg 180
ctgggcgcca tcgaagccgg cagcttcctc cgtggccttg tcctccttgc ctccgtccct 240
ttcgtgta 248
<210> 68
<211> 283
<212> DNA
<213> Glycine max
<400> 68
ttcttcccca ccatcacacc aancaaacct cactctncct ggccatggtc atgnnngcct 60
ttccgccact tcgaaccggt ttccaaatgc agcaccgaaa accggtttaa ccaaaccgtg 120
gcctcggact tggacggcac cctcctggtg tcccctagcg CCtttCCtta CtaCatgCtC 180
gtcgccatcg aagccggcag cttcctccgt ggccttgtcc tccttggatc cgtccctttc 240
gtgtacttca cgtacatatt cttctccgag accgcggcca tca 283
<210> 69
<211> 258
<212> DNA
<213> Glycine max
<400> 69
ctcttcttcc ccaccatcnn accaaccaaa cctcactctc cctgaccatg gtcatgggag 60
cctttcgcca cttcgaaccg gtttccaaat gcagcaccga aaaccggttt aaccaaaccg 120
CA 02343969 2001-03-20
WO 00/18889 3~ PCTIUS99/22231
tggcctcgga cttggacggc accctcctgg tgtcccctag cgcctttcct tactacatgc 180
tcgtcgccat cgaagccggc agcttcctcc gtggccttgt cctccttgga tccgtccctt 240
tcgtgtactt cacgtaca 258
<210> 70
<211> 256
<212> DNA
<213> Glycine max
<400> 70
tgcaactaca acaacattca ttcattcaca gctgtcacgc cgtgaacgga aaatggcaac 60
ggcgagacgc agtttcccgc ctatcaccga atgcaacgga acgacaccgt gcgagtctgt 120
ggccgccgac ctcgacggta cgctcctcat ctcccgtagc tcgttcccgt acttcatgct 180
cgtcgccgtc gaagccggca gcntcctccg cggcctcatc ctcctcctng ccantccgtt 240
cgtcatcanc gcctac 256
<210> 71
<211> 259
<212> DNA
<213> Glycine max
<400> 71
cttccccacc atcacaccan ggcnaacctc antctccctt tctccacnga ccctctccct 60
gccatngtca tgggancctt tggccacttc gaaccggtct ccaaatgcag caccgagaac 120
cggnctaacc aaaccgtggc ctcggacttg gacggcaccc tcctggtgtc ccncagcgca 180
tttccttact acatgctggc ngccatcgaa gccggcagct tcctccgtgg ccttgtcctc 240
cttgcctccg tccctttcg 259
<210> 72
<211> 249
<212> DNA
<213> Glycine max
<400> 72
ccaacatatt cttcagttag ctcccccaac ctatacactt caccaccaca ccacaaccct 60
accctctctc tctgtcatgg tcattggagg agccttccct cgtttcgacc caatcaccaa 120
atgtagcacc caagaccgct ccaaccagac catcgcctcg gacctcgatg gcaccctnct 180
tgtctcccgg agtgccttcc cctactactt cctcgtcgcc ctcgaagccg gcagcgtctt 240
ncgagccct 249
<210> 73
<211> 257
<212> DNA
<213> Glycine max
<400> 73
caaccctctt cttccccacc atcacaccaa ncaaacctca ctctcccttt ctcccctgac 60
cctctccctg ccatggtcat gggagccttt ggccacttcg aaccggtctc caaatgcagc 120
accgagaacc ggtctaacca aaccgtggcc tcggacttgg acggcaccct cctggtgtcc 180
cccagcgcat ntccttacta catgctggtc gccatcgaag ccggcagctt cctccgtggc 240
cttgtcctcc ttgcctg 257
<210> 74
<211> 255
<212> ANA
<213> Glycine max
<400> 74
gccgaagacg tgcacccgga gagttggaga gtgttcaact ctttcgggaa gcgttacatt 60
gtcacggcta gtcctagggt gatggtggag ccgtttgtta aggcgtttct cggggctgac 120
aaggtgcttg ggactgaact tgaggccacc aaatcgggga cgttcactgg gtttgttaag 180
aagcctggtg tgcttgttgg ggagcataag aaagtggctc tggtgaagga gtttcagggt 240
aattacctga cttgg 255
<210> 75
<211> 244
<212> DNA
<213> Glycine max
<400> 75
CA 02343969 2001-03-20
WO 00/1$$$9 31 PCT1US99/22231
caacaacatt cattcattca cagctgtcac gccgtgaacg gaaaatggca acggcgagac 60
gcagtttccc gcctatcacc gaatgcaacg gaacgacacc gtgcgagtct gtggccgccg 120
acctcgacgg tacgctcctc atcncccgta gctcgttccc gtacttcatg ctcgtcgccg 180
tcgaagccgg cagcctcctc cgcggcctca tgcnttcctg ggtttanttt gagnacccct 240
gagg 244
<210> 76
<211> 240
<212> DNA
<213> Glycine max
<400> 76
gctggctacc ctcttcttcc ccaccatcac accaatcaaa cctcactcta ccctggccat 60
ggtcatggga gcctttncgc cacttcgaac cggtttccaa atgcagcacc gaanaccggt 120
ttnaccanac cgtggcctcg gncttggacg gcaccctcct ggtgtcccct agcgcctttc 180
cttactacat gctcgtcgcc atcgaagccg gcagcttcct ccgtggcttg tcctccttgg 240
<210> 77
<211> 263
<212> DNA
<213> Glycine max
<400> 77
gtttctcggg gctgacaagg tgcttgggac tgaacttgag gccaccaaat cggggacgtt 60
cactgggttt gttaagaagc ctggtgtgct tgttggggag cataagaaag tggctctggt 120
gaaggagttt cagggtaatt tacctgactt gggtctaggt gatagtaaaa gtgattatga 180
cttcatgtca atttgcaagg aagggtacat ggtgccaaga actaagtgtg aaccactacc 240
aagaaacaag cttttaagtc caa 263
<210> 78
<211> 258
<212> DNA
<213> Glycine max
<400> 78
ggccacgaaa tcggggaggt tcactgggtt tgttaaggag cctggtgtgc ttgttgggga 60
gcacaagaaa gtggctgttg tgaaggagtt tcagggtaat ttacctgact tgggactagg 120
agatagtaaa agtgattatg acttcatgtc aatttgcaag gaagggtaca tggtgccaag 180
gactaagtgt gaaccactac caagaaacaa acttttaagt ccaattattt ntcatgaggg 240
taggtttgtt caaaggcc 258
<210> 79
<211> 260
<222> DNA
<213> Glycine max
<400> 79
ctcttcttcc ccaccatcac accaancaaa cctcactctc cctttctccc ctgaccctct 60
ccctgccatg gtcatgggag cctttggcca cttcgaaccg gtctccaaat gcagcaccga 120
gaaccggtct aaccaaaccg tggcctcgga cttggacggc accctcctgg tgtcccccag 180
cgcatttcct tactacatgc tggtcgccat cgaagccggc agcttcctcc gtgggccttg 240
tcctccttgc ctccgtccct 260
<210> 80
<211> 257
<212> DNA
<213> Glycine max
<400> 80
gggaacaaca acaaatggca ngaaccttat ctccttccaa cttggtgcat ttatccctgg 60
atacccaatc cagcctgtaa ttgtacgcta tcctcatgtg cactttgacc aatcctgggg 120
tcatgtntct ttgggaaagc ttatgttcag aatgttcact caatttcaca acttttttga 180
ggtagaatat cttcctgtca tttatcccct ggatgataag gaaactgctg tancttntcg 240
ggagaggact agccggg 257
<210> 81
<211> 272
<212> DNA
<213> Glycine max
CA 02343969 2001-03-20
WO 00/1$889 32 PCT/US99122231
<400> 81
catacctttt gttggcacca ttattagagc aatgcaggtc.atatatgtta acagattctt 60
accatcatca aggaagcagg ctgttaggga aataaaggaa ctgaataaca gagaagggcc 120
tcttgtgata aatttcctcg agtactatta tttcccgagg gaacaacaac taatggcagg 180
aaccttatct ccttccaact tggtgcattt atccctggat acccaatcca gcctgtaatt 240
atacgctatc ctcatgtaca ctttgaccaa tc 272
<210> 82
<211> 245
<212> DNA
<213> Glycine max
<400> 82
gggcatttca catactagag ttcatcccag tgaaaagaaa gtgggaggct gatgaatcaa 60
tcatgcgcca tatgctttct acattcaagg atccacaaga tcctctctgg cttgcgcttt 120
tcccagaagg cactgatttc actgagcaaa agtgccttcg gagtcaaaaa tatgctgctg 180
aacataagtt accggttctg aaaaatgttt tacttccaag gacaaagggg cttctgtgcc 240
245
gcttg
<210> 83
<211> 268
<212> DNA
<213> Glycine max
<400> 83
cagtgtcctt cctttctgga caatgttttt ggtgttgacc cttcagaagt gcacctgcat 60
gtgcggcgta ttccggtgga ggagattcca gcttctgaaa ccaaagctgc ttcttggtta 120
atcgacacat tccagatcaa ggaccaattg ctttcggatt tcaagattca aggccatttc 180
cctaaccaac taaatgaaaa tgaaatttct agatttaaga gcctactctc ttttatggtg 240
atagtttctt ttactgccat gtttattt 268
<210> 84
<211> 265
<212> DNA
<213> Glycine max
<400> 84
gaaagagact gggcaaaaga tgaaacatca ctgaagtcag gttttaggca tctagagcac 60
atgccattcc ctttctggtt ggcccttttt gttgaaggaa ctcgtttcac gcagacaaag 120
cttttacaag ctcaagagtt tgctgcttca aaagggctgc ctatacctag aaatgttttg 180
attcctcgta ctaagggttt tgtcacagca gnacaaagcc ttcggccatt tcgttccagc 240
catttatgat tgcacatatg cagtt 265
<210> 85
<211> 265
<212> DNA
<213> Glycine max
<400> 85
gaaagagact gggcaaaaga tgaaacatca ctgaagtcag gttttaggca tctagagcac 60
atgccattcc ctttctggtt ggcccttttt gttgaaggaa ctcgtttcac gcagacaaag 120
cttttacaag ctcaagagtt tgctgcttca aaagggctgc ctatacctag aaatgttttg 180
attcctcgta ctaagggttt tgtcacagca gnacaaagcc ttcggccatt tcgttccagc 240
catttatgat tgcacatatg cagtt 265
<210> 86
<211> 301
<212> DNA
<213> Zea mays
<400> 86
ctcgtcgtca agggcacccc gccgccgccg cccaagaagg gccacccggg cgtcctcttc 60
gtctgcaacc accgcaccgt gctcgacccc gtcgaggtgg ccgtggcgct gcgccgcaag 120
gtcagctgcg tcacctacag catctccaag ttctccgagc tcatctcgcc catcaaggcc 180
gtcgcgctgt cgcgggaggc gacaaggacg ccgagaacat ccgccgcctg ctggaggagg 240
gcgacctggt catctgcccc gagggnaaca actgccgcga gcccttcctg ctgcgttcag 300
g 301
<210> 87
<211> 309
CA 02343969 2001-03-20
WO 00/18889 33 PCTIUS99/22231
<212> DNA
<213> Zea mays
<400> 87
cgctcatgcg gtgtacatca acctgccgct gcccgagcgc atcgtctact acacctacaa 60
gctcatgggc atcaggctcg tcgtcaaggg caccccgccg ccgccgccca agaagggcca 120
cccgggcgtc ctcttcgtct gcaaccaccg caccgtgctc gaccccgtcg aggtggccgt 180
ggcgctgcgc cgcaaggtca gctgcgtcac ctacagcatc tccaagttct ccgagctcat 240
ctcgcccatc aaggccgtcg cgctgtcggg gaggcgacaa ggacgccgag aacatccgcc 300
gcctgctgg 309
<210> 88
<211> 304
<212> DNA
<213> Zea mays
<400> 88
tggctgtgca ggaggcctac ctggtgacgt caaggaagta cagcccggtg cccaggaacc 60
agctgctgag cccgctgatt cgtgcacgac ggccgcctcg tgcagcgccc gacgccgctc 120
gtcgcgctcg tcaccttcct ctggatgccg ttcggcttcg cgctggcgct catgcgcgtg 180
tacatcaacc tgccgctgcc cgagcgcatc gtctactaca cctacaagct catgggcatc 240
aggctcgtcg tcaagggcac cccgccgccg ccgcccaaga agggccaccc gggcgtcctc 300
304
ttcg
<210> 89
<211> 312
<212> DNA
<213> Zea mays
<400> 89
ggttcatcca cttgtgttgc tattngaccg gtaccgtagg agagcacagc actancatcg 60
caaagatttn gggctacggt gacaatctcc atgttctaca atcttnaggt cgaaggaatg 120
gagaatctgc ctccaaatag ctgtcctggt gtctatgttg ctaaccatca gagcttcttg 180
gatatttata cccttctaac tctagggagg tgcttcaaat ttataagcaa gaccagcatc 240
tttatgttcc ctattatagg gtgggcaatg tatctcttgg gtgtgattcc tctgcggcgt 300
312
atggacagca gg
<210> 90
<211> 264
<212> DNA
<213> Zea mat's
<400> 90
ggtgctgtat ctgaaagaat ccatcgtgct catcaacaga aaaatgcacc aatgatgcta 60
ctcttcccct gagggcacaa ctacaaatgg ggattatctc cttccattca aaacaggtgc 120
ttttcttgca aaggcaccag ttcaaccagt cattttgaga tatccttaca aaagatttaa 280
tgcagcatgg gattccatgt caggggcacg tcatgtattt ctgctgctct gtcaatttgt 240
aaattaccta gaggtggtcc gctt 264
<210> 91
<221> 212
<212> DNA
<213> Zea mat's
<400> 91
aaatgtcttg gatgcatttt tgttcagcgg gagtcgaaaa caccagattt caaaggtgtt 60
tcaggtgctg tatttgaaag aatccatcgt gctcatcaac agaaaaatgc accaatgatg 120
ctactcttcc ctgagggcac aactacaaat ggggattatc tccttccatt caaaacaggt 180
gcttttcttg caaaggcacc agttcaacca gt 212
<210> 92
<211> 267
<212> DNA
<213> Zea mat's
<400> 92
gtctaaagaa atngaaaggc gtggggnaat tgtgtctaat catgtntctt atgtggatat 60
tctttatcan atgtcagcct cttttcctag ttttgttgct aagagatcag tggntagatt 120
gcctctagtt ggtctcataa gcaaatgtct tggatgcatt tttgttcagc gggagtnnaa 180
aatncanatt tcaaaggtgt ttaaggtgtg gnatctgaaa gaatccatcg tgctcatcaa 240
CA 02343969 2001-03-20
WO 00/18889 34 . PCTlUS99/22231
cagaaaaatg caccaatgat gctactc 267
<210> 93
<211> 152
<212> DNA
<213> Zea mat's
<400> 93
ctacaaatgg ggattacctt cttccattta agactggagc ctttnttgca ggtgcaccag 60
tgcagccagt cattttgaaa tacccttaca ggagatttag tccagcatgg gattcaatgg 120
atggagcacg tcatgtgtta ttgctgctct gt 152
<210> 94
<211> 274
<212> DNA
<213> Zea mat's
<400> 94
aaaatataaa ttaatatggt cttaatccca ccatataaat aacgttctct ttctgcaggg 60
caatttagtt ctttctaata ttgggctggc agagaagcgc gtgtaccatg cagcactgac 120
tggtagtagt ctacctggcg ctagacatga gaaagatgat tgaaagacgt tgcgtcgctt 180
tttctgtaac agacagccga ggaacactta aaaatgtaac tgtgtgcgtg tttttatacc 240
tgtaatgtgg cagtttattt gtttgaggag gctg 274
<210> 95
<211> 295
<212> DNA
<213> Zea mat's
<400> 95
aatagctatc aagtacaata aaatatttgt tgatgccttt tggaacagta agaagcaatc 60
ttttacaatg cacttggtcc ggctgatgac atcatgggct gttgtgtgtg atgtttggta 120
cttacctcct caatatctga gggagggaga gacggcaatt gcatttgctg agagagtaag 180
ggacatgata gctgctagag ctggactaaa gaaggttcct tgggatggct atctgaaaca 240
caaccgtcct agtcccaaac acactgaaga gaacaacgca tattgccgat ctgtc 295
<210> 96
<211> 273
<212> DNA
<213> Zea mat's
<400> 96
gngccatctc accggcggcn ggcctgcggc cggcaaccgg aggcgatggc gagctngtct 60
gtggtggcgg acatggagca ntaccgcccc aacctggagg actacctccc gcccgactcg 120
ctcccgcagg aggcgcceag gaatctccat ctgcgcgatc tgcttgacat ctcgccggtg 180
ctaaccgagg cagcgggtgc catagtcgat gattcattca cccgttgctt taagtcgaat 240
tctccagaac catggaatgg aacatatatt tgt 273
<210> 97
<211> 127
<212> DNA
<213> Zea mat's
<400> 97
ctcaatatct ganggaggga gagactgcaa ttgcgtttgc tgagagagta agggacatga 60
tagcagctag agctggtctt aagaaggtcc cgtgggatgg ctatctgaag cacaaccgcc 120
ctagtcc 127
<210> 98
<211> 286
<212> DNA
<213> Zea mat's
<400> 98
gaaccgtacg cgcctcatta cgcccatcca cgtgctcgcc tctccccatc gcataatttt 60
nctcggcggc gtcgccatct ccancggcng cnggcctgcn gccggcaacc ggaggcgatg 120
gcgagctcgt ctgtggcggc ggacatggag ctggaccgcc ccaacctgga ggactacntc 180
ccgcccgant cgctcccgca ggaggcgacc aggaatctcc atctgngcga tctgcttgan 240
atctcgccgg tgctaaccga ggcagcgggt gccatagtcg atgatt 286
CA 02343969 2001-03-20
WO 00/18889 35 PCT/US99/22231
<210> 99
<211> 308
<212> DNA
<213> Zea mat's
<400> 99
cgccatctca tcggcggcgg gcgtgcggcc ggcggcngag gcgaggngcg attggcgagc 60
tcgtctgtgg cgccggacat ggagctggac cgcccanacc tggaggacta nctcccgccc 120
gactcgnncc cgcagaggcg ccccggaatc tccanctgcg cgatctgctg gacatcncgc 180
cggtgctcac cgaggcagcg ggtgccattg tcgatgactc cttcacacgg ngctttaagt 240
caaattctcc agagccatgg aattggaaca tatatctgtt ccccttatgt gctttggtgt 300
ataataag 308
<210> 200
<211> 282
<212> DNA
<213> Zea mat's
<400> 100
cagaaactag angttagtca cagcatggca ttaaattgtc atagtaaaca acancncact 60
gagcaactat gcaatttaat gccatgctgt gactaacttc tagtttctgg cattaaatta 120
ctgtttggct actaggaaga ccgaggtaga gaagcaaata taagaatacc ctccaacgca 180
canccaaatg acagagtaaa tgaaggtagg gttcaccttc ttgaacatga ccgtatactg 240
gttgttaaca caagttcctc tgggaaaatc agagagggtt tt 282
<210> 101
<211> 282
<212> DNA
<213> Zea mat's
<400> 101
ggcgcggctg gccgtggcgc tggtCCtgCC gtacagtact cgacgccgat cctggcngcg 60
acnggcatgt cgtggcggct caaagggtng cgcccngngc ttgcnnngcc gtgctccggc 120
gggcgctgnc agctgttcgt gtgcaacnac cggacgctga tcgacccngt gtacgtgtcc 180
gtagcgtgga ccgggaaatg cgcgncgtgt nctacagnct gangcggntn tcggagctca 240
tctcccccat ngncggaang tgcacctgan accgggaacg gg 282
<210> 102
<211> 290
<212> DNA
<213> Zea mat's
<400> 102
ggacgcggca ccatgcgcgc cgagctggcc agtggcgacg tggccgtgtg ccccgagggc 60
accacgtgcc gggagccctt cctgctccgc ttctccaagc tcttcgcgga gctcagcgac 120
aggatcgtgc ccgtggcgat gaactaccgc gtggggctct tccacccgac gacggcgcgc 180
gggtggaaag ccatggaccc catcttcttc ttcatgaacn gcggcccgtg tacgaggtga 240
cgttcctgaa ccantccccg caaagcgacg tgcgcggcgg ggaagagccc 290
<210> 103
<211> 279
<212> DNA
<213> Zea mat's
<400> 103
acgaggtgac gttcctgaac cagctccccg cagaggcgac gtgcgcggcg gggaagagcc 60
ccgttgatgt agccaactac gttcagcgga tactcgctgc cacgctcggg ttcgagtgca 120
ccaccctcac aaggaaggac aaatacacgg tgctcgccgg caacgacggc gtcctgaacg 180
ccaagccggc ggcggcccgg aagccggctt ggcagagccg cgtgaaggaa gtcctcgggt 240
tctgctccac taacaattac accttgccca gatctggac 279
<210> 104
<211> 315
<212> DNA
<213> Zea mat's
<400> 104
gcccgagcgc atcgtctact acacctacaa gctcatgggc atcaggctcg tcgtcaaggg 60
caccccgccg ccgccgccca agaagggcca cccgggcgtc ctcttcgtct gcaaccaccg 120
caccgtgctc gaccccgtcg aggtggccgt ggcgctgcgc cgcaangtca gctgcgtcac 180
CA 02343969 2001-03-20
WO 00118889 3~ PCT/US99/22231
tacagcatct ccaagttctc cgagctcatc tcgcccatca aggccgtagc agnaaagcag 240
gtcgcaaatg gagcagnagc gagtcgatgg aagngaattg gcgactggtc atctgcncga 300
aggnacactg cggag 315
<210> 105
<211> 314
<212> DNA
<213> Zea mat's
<400> 105
cgagacaccg agcacgtact accagcaaga tggtggcgtc tcccagattc aagcccatcg 60
aggagtgctg ctcggagggg cggtcggagc agacggtggc cgccgacctg gacggcacgc 120
tgctcatctc caggagcgcg ttcccctact acctcctcgt ggctctcgag gccggcagcg 180
tcctccgcgc cgcgctgctg ctcctgtccg tgccgttcgt ctacgtcacc tacgccttct 240
tctccgagtc gctggccatc agcacgctgg tgtacatctc cgtggcgggg ctcaaggtgc 300
gcanatcgag atgg 314
<210> 106
<211> 291
<212> DNA
<213> Zea mat's
<400> 106
ctctgggtct ggggccgaga caccgagcac gtactaccag caagatggtg gcgtctccca 60
gattcaagcc catcgaggag tgctgctcgg aggggcggtc ggagcagacg gtggccgccg 120
acctggacgg cacgctgctc atntccagga gcgcgttccc ctactacctc ctcgtggctc 180
tcgaggccgg cagcgtcctc cgcgccgcgc tgctgctcct gtccgtgccg ttcgtctacg 240
tcacctacgc cttcttctcc gagtcgctgg ccatcagcac gctggtgtac a 291
<210> 107
<211> 300
<212> DNA
<213> Zea mat's
<400> 107
gcacgcagca gtacgacgtc tctcctctgg gtctggggcc gagacaccga gcacgtacta 60
ccagcaagat ggtggcgtct cccagattca agcccatcga ggagtgctgc tcggaggggc 120
ggtcggagca gacggtggcc gccgacctgg acggcacgct gctcatctcc aggagcgcgt 180
tcccctacta cctcctcgtg gctctcgagg ccggcagcgt cctccgcgcc gcgctgctgc 240
tcctgtccgt gccgttcgtc tacgtcacct acgccttctt ctccgagtcg ctggccatca 300
<210> 108
<211> 284
<212> DNA
<213> Zea mat's
<400> 108
gnggccgaga caccgagcac gtactaccag cangatggtg gcgtctccca gattcangcc 60
antcgaggag tgctgctcgg aggggcggtc ggagcagacg gtggccgccg acctggacgg 120
cacgctgctc atctccagga gcgcgttccc ctacnacctc ctcgtggctc tcgaggccgg 180
cagcgtcctc cgcgccgcgc tgctgctcct gtccgtgccg ttcgtctacg tcactacgcc 240
ttcttctccg agtcgctggc catcaanacg ctggtgtaca tctc 284
<210> 109
<211> 280
<212> DNA
<213> Zea mat's
<400> 109
ctcctctggg tctggggccg agacaccgag cacgtactac cagcaagatg gtggcgtctc 60
ccagattcaa gcccatcgag gagtgctgct cggaggggcg gtcggagcag acggtggccg 120
ccgacctgga cggcacgctg ctcatctcca ggagcgcgtt ccnctactac ctcctcgtgg 180
ctctcgaggc cggcagcgtc ctccgcgccg cgctgctgct cctgtccgtn ccgttcgtct 240
acgtcaccta cgcnttnttc tccgagtcgc tggccatcag . 280
<210> 110
<211> 287
<212> DNA
<213> Zea mat's
CA 02343969 2001-03-20
WO 00/18889 3~ . PCTIUS99/22231
<400> 110
cgtctctcct ctgggtctgg ggccgagaca ccgagcacgt actaccagca agatggtggc 60
gtctcccaga ttcaagccca tcgaggagtg ctgctcggag gggcggtcgg agcagacggt 120
ggccgccgac ctggacggca gctgctcatc tccaggagcg cgttccccta ctacctcctc 180
gtggctctcg aggccggcag cgtcctccgc gccgcgctgc tgctcctgtc cgtgccgttc 240
gtctacgtca ctacggcttc ttctccgagt cgctggccat cagcacg 287
<210> 111
<211> 286
<212> DNA
<213> Zea mays
<400> 111
cgcacagtta cgacgtctct cctctgggtc tggggccgag acaccgagca cgtactacca 60
gcaagatggt ggcgtctccc agattcaagc ccatcgagga gtgctgctcg gaggggcggt 120
cggagcagac ggtggccgcc gacctggacg gcacgctgct catctccagg agcgcgttcc 180
cctactactc ctcgtgctct cgaggccggc aggtcctccg cgccgcgctg tgctcctgtc 240
gtgcgttcgt ctagtcacta cgcttttctc gancgtggca ataana 286
<210> 112
<211> 323
<212> DNA
<213> Zea mat's
<400> 112
gt~attccct gaaggtacca caacaaatgg gagattcctg atttcgttcc aacatggtgc 60
attcatacct ggctaccctg ttcaacctgt tgttgtccgt tatccacatg tgcactttga 120
tcaatcatgg gggnatatat cgttattaaa gctcatgttt aagatgttca cccaatttca 180
taatttcatg gaggtagagt accttcctgt tgtctaccct cctgagatca agcaagagaa 240
tgcccttcat tttgcggagg ataccagcta tgctatggca cgtgccctca atgtcttgcc 300
aacttcctat tcatatggtg att 323
<210> 113
<211> 312
<212> DNA
<213> Zea mat's
<400> 113
cgataaggcc cttttcgaag agcttctacc gtcggatcaa cagattcttg gccgagctgc 60
tgtggcttca gcttgtctgg gtggtggact ggtgggcagg tgttaaggta caactgcatg 120
cagatgagga aacttacaga tcaatgggta aagagcatgc actcatcata tcaaatcatc 180
ggagtgatat tgattggctc attggatgga tattggccca gcgttcaggg tgccttggaa 240
gtacacttgc tgtcatgaag aagtcatcca agttccttcc agttattggc tggtcaatgt 300
ggtttgcaga gt 312
<210> 114
<211> 279
<212> DNA
<213> Zea mat's
<400> 114
agtggggtct ccaaaggttg aaagacttcc ctagaccatt ttggctagct ctttttgttg 60
agggtactcg ctttactcca gcaaagcttc tcgcagctca ggagtatgcg gcttcccagg 120
gcttaccagc tcctagaaat gtacttattc cacgtaccaa gggatttgta tctgccgtaa 180
gtattatgcg agattttgtt ccagccattt acgatacaac tgtaatagtt cctaaagatt 240
cccctcaacc aacaatgctg cggattttga aagggcaat 279
<210> 115
<211> 304
<212> DNA
<213> Zea mat's
<400> 115
cgtcaacgcc atccaggccg tcctatttgt gacgataagg cccttttcga agagcttcta 60
ccgtcggatc aacagattct tggccgagct gctgtggctt cagcttgtct gggtggtgga 120
ctggtgggca ggtgttaagg tacaactgca tgcagatgag gaaacttaca gatcaatggg 180
taaagagcat gcactcatca tatcaaatca tcggagtgat attgattggc tcatggatgg 240
atattggccc agcgttcagg gtgccttgga agtacattgc tgtcatgaag aagtcatcca 300
agtt 304
CA 02343969 2001-03-20
WO 00118889 . PCTIUS99I22231
38
<210> 216
<211> 259
<212> DNA
<213> Zea mat's
<400> 116
cttcctcctg tccggcctca tcgtcaacgc catccaggcc gtcctatttg tgacgataag 60
gcccntttcg aagagcttct aacgtcggat caacagattc ntggccgagc tgctgtggct 120
tcagcttgtc tgggtggtgg acnggtgggc aggtgttaag gtacaactgc atgcngatga 180
ggaaacttac agatcnatgg gtanagagca tgcactcatc atatcaaatc atcggagtga 240
tattgattgg cncattgga 259
<210> 117
<211> 235
<212> DNA
<213> Zea mat's
<400> 117
attccacgta ccaagggatt tgtatctgct gtaagtatta tgcgagattt tgttccagcc 60
atttatgata caactgtaat agttcctaaa gattcccctc aaccaacaat gctgcggatt 120
ttgaaagggc aatcatcagt gatacatgtc cgcatgaaac gtcatgcaat gagtgagatg 180
ccaaaatcag atgaggatgt ttcaaaatgg tgtaaagaca tttttgtggc aaagg 235
<210> 118
<211> 282
<212> DNA
<213> Zea mat's
<400> 118
tgagatgcca aaatcagatg atgacgtttc aaaatggtgt aaagacattt ttgtgacaaa 60
ggatgcctta ctggacaaac atttggcaac aggcactttc gatgaggaga ttagacctat 120
cggccgccca gtgaaatcat tgctggtgac cctgttttgg tcgtgcctgc tgttgtttgg 180
tgccatcgag ttcttcaagt ggacgcagct cctatcgaca tggagaggag tggcattcac 240
tgccgcagga tggcgctcgt gacaggggtc atgcacgtct tc 282
<210> 119
<211> 166
<212> DNA
<213> Zea mat's
<400> 129
ctggtgggca ggcgttaagg tacaactaca tgcggatgag gacacttacc gatcaatggg 60
taaagagcat gcactcgtca tatcaaatca tcgaagtgat attgattggc ttattggatg 120
gatattggcc cagcgctcag ggtgccttgg aagtacgctc gctgtc 166
<210> 120
<211> 234
<212> DNA
<213> Zea mat's
<400> 120
agtcanccaa gntccttcca gtcattggct ggtcaatgtg gtttgcagag tacctctttt 60
nggagaggag ctgggccaag gatgaaaaga cactaaagtg gggtctccaa aggttgaaag 120
acttccctag accatttngg ctagctcttn tttgtngagg gnantcgctt tactccagca 180
angnttntng aggnnncagn agnnncgggn ttcccanggg ttaacagncc cana 234
<210> 121
<211> 210
<212> DNA
<213> Zea mat's
<400> 121
gtgagatgcn aaaatcagat gatgacgttt caaaatggtg taaagacatt tttgtggaca 60
aaggatgcct tactggacaa acatttggca acaggcactt tcgatgagga gattagacct 120
atcggccgcc cagtgaaatc atngctggtg accctgtnnt ggtcgtgcct gctgttgttt 180
ggtgccatcg agntcttcaa gtggacgcag 210
<210> 122
<211> 274
<212> DNA
CA 02343969 2001-03-20
WO 00/18889 39 PCT/US99/22231
<213> Zea mays
<400> 122
acncccgaat ccgccgcgcg cgcnccgtcc tcgtcgccgg cggaggcgcc cgcnaccgcc 60
cacagcagcc tatcgccgga gaaggaacgc cgcggggagc ttttccacng ccatctcccg 120
tctgacccct ccgagatcgn aagcggcggc catggcgatc ccgctcgtgc tcgtcgtgct 180
cccgctcggc ctcctcttcc tcctg~ccgg cctcatcgtc aacaccatcc aggccatcct 240
atttgtgaca ataaggccct tttccaagag cttg 274
<210> 123
<211> 305
<212> DNA
<213> Zea mays
<400> 123
ttgcactgag gaaaggccat tagggatata tcaagtacat acataagagc agcttgatga 60
agttgcctat ttttagctgg gcatttcaca tttttgagtt tatcccggta gaacggaaat 220
gggagattga tgaagcaatt attcagaaca agctatcaaa-atttaagaac ccgagagatc 180
ctatctggtt ggcggttttt cctgaaggca cggattatac tgagaagaaa tgcatcatga 240
gtcaagagta tgcttcagaa catggcttgc ctatgctaga acatgtcctc cttccaaaga 300
305
caagg
<210> 124
<211> 279
<212> DNA
<213> Zea mays
<400> 124
ccagattttc tggacaatgt gtatggcgtt gatccttctg aagtccacat ccacgtcaga 60
atggttcagc tccatcacat ccccacaaca gaagacaaga taacagaatg gatggncgag 120
aggtttaggc agaaggacca gctcctggca gatttcttca tgaaggggca tttcctgatg 180
aaaggaactg aaaggagatc tgtcgacgcc gagtgcctgg caaactttct taaccagtag 240
tatgcttgac ggccnatctg gtttgtacct aaactcttt 279
<210> 125
<211> 219
<212> DNA
<213> Zea mays
<400> 125
agattttntg gacaatgtgt atggngttga tccttntgaa gtncacatcc acgtnagaat 60
ggttcagctc catcacatcc ccacaacagn agacaagata acagaangga tggtagagag 120
gtttaggcag aaggaccagc tcctggcaga tttcttcatg aaggggcact ttcctgatga 180
aggaactgaa ggagatctgt cgacgccgaa gtgcctggc 219
<210> 126
<211> 293
<212> DNA
<213> Zea mays
<400> 126
taccatagat gctgtgtacg acatcacgat cgcntacaaa caccggcngc ngacatttct 60
ngacaacgtc tacngcgtgg ntccttcgga agtccacatc cacatcanca gcatccaggt 120
ctccgacata ncggcgtccg aaaaacgggg tggctggcng gntnngtgga gcggttcaag 180
gcntnganna acgagctngc tgttcggggc tttctaccgc ggctggggcc aatttcnccc 240
cgaacgaaag ggaaaaaggg gaaccgaagg ggggaacctg ttngaacggg ncc 293
<210> 127
<211> 6
<212> PRT
<213> conserved sequence
<400> 127
Val Xaa Asn His Xaa Ser
1 5
<210> 128
<211> 6
<212> PRT
CA 02343969 2001-03-20
WO 00/18889 4~ . PCT/US99122231
<213> conserved sequence
<400> 128
Val Thr Tyr Sex Xaa Ser
1 5
<210> 129
<211> 7
<212> PRT
<213> conserved sequence
<400> 129
Val Xaa Leu Thr Arg Xaa Arg
1 5
<210> 130
<211> 5
<212> PRT
<213> conserved sequence
<400> 130
Cys Pro Glu Gly Thr
1 5
<210> 131
<211> 5
<212> PRT
<213> conserved sequence
<400> 131
Ile VaI Pro Val Ala
1 5
<210> 132
<211> 7
<212> PRT
<213> conserved sequence
<400> 132
Leu Xaa Xaa Gly Asp Leu Val
1 5
<210> 133
<211> 6
<212> PRT
<213> conserved sequence
<400> 133
Phe Xaa Xaa Gly Ala Phe
1 5
<210> 13~
<211> 6
<212> PRT
<213> Synthetic Oligonucleotide
<400> 134
Val Ala Asn Xaa Xaa Gln
1 5
<210> 135
<211> 30
<212> DNA
CA 02343969 2001-03-20
WO 00/18889 41 PCT/US99/22231
<213> Synthetic Oligonucleotide
<400> 135
ccatccgctt caagggaacg acacccatca 30
<210> 136
<211> 31
<212> DNA
<213> Synthetic Oligonucleoti:de
<400> 136
tccctgtctt gcttgatgaa cttaaagctt g 31
<210> 137
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 137
acagcaggag tgtctgatga tggcagattc 30
<210> 138
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 138
actggagttc cagccaaaaa tgcacctgtc 30
<210> 139
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 139
gatacaccct tgaaatcagg cgattttgct 30
<210> 140
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 140
ttgcaaattc aattcctgtt tcaccgggcc 30
<210> 141
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 141
gttttctgct attccagaag gcgtcaacaa 30
<210> 3.42
<211> 32
<212> ANA
<213> Synthetic Oligonucleotide
<400> 142
cattgaagat ccgtccgtga agttncctta cc 32
<210> 143
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 143
tcgagctgtg atcgatgatt ggctgtgaag 30
<210> 144
CA 02343969 2001-03-20
WO 00/18889 PCT/US99/22231
42
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 144
gtctcttcaa aaacacacac acacgtctct 30
<210> 145
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 145
gtctcttcaa aaacacacac acacgtctct 30
<210> 146
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 146
gtagagagcc ttacttgctt cggtttagtc 30
<210> 147
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 147
acgtcatcgt acctgttgct attgactcac 30
<210> 148
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 148
acttttccat tgtcagggac tcctcgacac 30
<210> 149
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 149
acggtgtagg aagggaaagg attcaaaagg 30
<210> 150
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 150
gcgatgaact acagagtcgg attcttcctc 30
<210> 151
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 151
ccggtttacg agattacgtt cttgaaccag 30
<210> 152
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 152
caatggagac aaggctcgaa agtgctaacc 30
CA 02343969 2001-03-20
WO 00/18889 43 PCT/US99/22231
<210> 153
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 153
attctctgaa catagttcgc cacggtcatg 30
<210> 154
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 154
gaaatccaac gccttcccaa tatcactctg 30
<210> 155
<211> 30
<2I2> DNA
<213> Synthetic Oligonucleotide
<400> 155
cttcaacttt ccatcaggat cttggcacgt 30
<210> 156
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 156
accacttgtt agagacctta cctgcttagg 30
<210> 157
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 157
tcctacctac accatccaat ttctcgaccc 30
<210> 158
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 158
ctgcgtcaag tgagcaactc agttcttgca 30
<210> 159
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 159
tgggaagcag cacgttgttc agtatcggaa 30
<210> 160
<211> 30
<212> DNA
<213> Synthetic Oligonucleotide
<400> 160
tagcctctgt gtaatctgtg ccctcgggga 30
<210> 161
<211> 1702
<212> DNA
<213> Simmondsia chinensis
CA 02343969 2001-03-20
WO 00/18889 44 PCTNS99I22231
<400> 161
gaattctagc ctctctcctc ctgcaattct acttgctttc tacgatcttt ccctctctct 60
ctctaaaacc ttaaaattgg aatggaatcg tttaaaaata tgatcttttt gtaattgaat 120
tagtataatt atatctgggt aatcttgaat ttgttggtga ggccatgggg atcccagctg 180
cggctgtgat tgtaccgctt ggcttgctct tcttcttctc tggtctcttc atcaacttca 240
ttcaggcaat ttgttttgtg ctcgtgcggc cactgtcaaa gnntacatac agaaggatta 300
acagggtgct ggtggaattg ttgtggcttg agctgatatg gctcgtagat tggtgggcaa 360
gtgttaagat caagttgttc acagatcctg atacctttcg gctaatgggt aaagagcatg 420
cacttgtgat atcaaaccac agaagtgata ttgattggct tgttggatgg gtgttggccc 480
agagatcagg ctgcctggga agcacactgg ctgtcatgaa gaaatcatca aagtttctcc 540
cggtcatagg ttggtctatg tggttttctg agtacctttt tcttgagaga agctgggcca 600
aggatgaaag cacattgaag ttaggtcttc aacgcctcaa ggactaccct ctgcctttct 660
ggttggctct tttcgtagaa ggaacacgat ttacccaagc taaactttta gcagctcaag 720
aatatgctac ttcaatggga ttgccagttc ctagaaatac tttgatccct cgtactaagg 780
gatttgtttc agccgtgagc catatgcgtt cgtttgtccc ggccatatat gatgtaacgg 840
tggccatccc taaatcttct tcgcagccta caatgctcag acttttcaaa ggccagccat 900
ccacggttca tgtacacatc aagcgccgct cgatgaaaga tctccctgaa gcagcagatg 960
atgttgcaca atggtgtcga gacacattcg tcgcaaagga tgcactcctg gacaagcata
1020
atgtagatga cactttcgga gatgagtatc tgcaggacac tggccggcct ttgaaatctc
1080
tctttgtagc agtctcttgg gcattgattc tcatcctggg aggtttgaaa ttcctacgat
1140
ggtcgtccct tctatcatca tggaaggggg tcgccttctc agccgcatgc cttgtgctcg
1200
tcaccattct tatgcagatc ttaatccaat tttctcaatc cgagcgctcg actcctgcta
1260
aggtagcccc aggaaagccc aagaacatgg tatcagaacc cacggaaacg caacgacata
1320
agcagcacta aaagtatata tggaccccaa ctaagaagat tcagacgcaa gccacagttg
1380
attcaactgt tcagaatgtc aaatatagtt tgagaaacaa aagatcaaga ttagctgatg
1440
aagagcctaa tgaacctaca tacttggatc tgtcgtcgcc accgtctgct gctagctcgt
1500
tatcagaatt cgtgattccg ggaccgatcc cggatcttag ccttctatgc atggattatg
1560
atagtatctt aaatttcttt aatgatgtac cggaattata atgttagtta attaggggga
1620
tgagcattgt ttgggtttat atcgtggtaa atccttgtat tgtttataag atttgaagaa
1680
aattcgattc gagtgctctg as
1702
<210> 162
<211> 387
<212> PRT
<2I3> Simmondsia chinensis
<400> 162
Met Gly Ile Pro Ala Ala Ala Val Ile Val Pro Leu Gly Leu Leu Phe
1 5 10 15
Phe Phe Ser Gly Leu Phe Ile Asn Phe Ile Gln Ala Ile Cys Phe Val
20 25 30
Leu Val Arg Pro Leu Ser Lys Thr Tyr Arg Arg Ile Asn Arg Val Leu
35 40 45
Val Glu Leu Leu Trp Leu Glu Leu Ile Trp Leu Val Asp Trp Trp Ala
50 55 60
Ser Val Lys Ile Lys Leu Phe Thr Asp Pro Asp Thr Phe Arg Leu Met
65 70 75 80
Gly Lys Glu His Ala Leu Val Ile Ser Asn His Arg Ser Asp Ile Asp
85 90 95
Trp Leu Val Gly Trp Val Leu Ala Gln Arg Ser Gly Cys Leu Gly Ser
100 105 110
CA 02343969 2001-03-20
WO 00/18889 45 PCT/US99122231
Thr Leu Ala Val Met Lys Lys Ser Ser Lys Phe Leu Pro Val Ile Gly
115 120 125
Trp Ser Met Trp Phe Ser Glu Tyr Leu Phe Leu Glu Arg Ser Trp Ala
130 135 140
Lys Asp Glu Ser Thr Leu Lys Leu Gly Leu Gln Arg Leu Lys Asp Tyr
145 150 155 160
Pro Leu Pro Phe Trp Leu Ala Leu Phe Val Glu Gly Thr Arg Phe Thr
165 170 175
Gln Ala Lys Leu Leu Ala Ala Gln Glu Tyr Ala Thr Ser Met Gly Leu
180 185 190
Pro Val Pro Arg Asn Thr Leu Ile Pro Arg Thr Lys Gly Phe Val Ser
195 200 205
Ala Val Ser His Met Arg Ser Phe Val Pro Ala Ile Tyr Asp Val Thr
210 215 220
Val Ala Ile Pro Lys Ser Ser Ser Gln Pro Thr Met Leu Arg Leu Phe
225 230 235 240
Lys Gly Gln Pro Ser Thr Val His Va1 His Ile Lys Arg Arg Ser Met
245 250 255
Lys Asp Leu Pro Glu Ala Ala Asp Asp Val Ala Gln Trp Cys Arg Asp
260 265 270
Thr Phe Val Ala Lys Asp Ala Leu Leu Asp Lys His Asn Val Asp Asp
275 280 285
Thr Phe Gly Asp Glu Tyr Leu Gln Asp Thr Gly Arg Pro Leu Lys Ser
290 295 300
Leu Phe Val Ala Val Ser Trp Ala Leu Ile Leu Ile Leu Gly Gly Leu
305 31,0 315 320
Lys Phe Leu Arg Trp Ser Ser Leu Leu Ser Ser Trp Lys Gly Val Ala
325 330 335
Phe Ser Ala Ala Cys Leu Val Leu Val Thr Ile Leu Met Gln Ile Leu
340 345 350
Ile Gln Phe Ser Gln Ser Glu Arg Ser Thr Pro Ala Lys Val Ala Pro
355 360 365
Gly Lys Pro Lys Asn Met Val Ser Glu Pro Thr Glu Thr Gln Arg His
370 375 380
Lys Gln His
385
<210> 163
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 163
aagcttgcat gcgtcgacac aatggttcat gcgaccaagt cag 43
<210> 164
<212> 35
CA 02343969 2001-03-20
WO PCTlUS99122231
00118889
46
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>164
ggtaccgtcg 35
actcacttct
tggtgttgtt
gatag
<210>165
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>165
ggatccgcgg 44
ccgcacaatg
acgagcttta
ctacttccct
tcat
<210>166
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>166
ggatcccctg 38
caggttagag
atccattgat
tctgcaat
<210>167
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>167
ggatccgcgg 38
ccgcataatg
gaatcagagc
tcaaagat
<210>168
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>168
ggatcccctg 38
caggtcattc
ttctttctga
tggaaatc
<210>169
<211>41
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>169
ggatccgcgg ccgcacaatg actcgttcac aagatgtttc 41
a
CA 02343969 2001-03-20
WO PCT/US99/22231
X0/18889
~~
<210>170
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>170
ggatcccctg ctagccag 38
caggtcactt
ctcttccaat
<210>171
<211>46
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>171
ggatccgcgg agatctcgac tcttca 46
ccgcacaatg
tccggtaata
<210>172
<211>46
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>172
ggatcccctg actccgttat taccgg 46
caggttattt
tttcttgaca
<210>173
<211>39
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence; Synthetic
Oligonucleotide
<400>173
atatccgcgg aagctggaa 39
ccgcacaatg
gttatggagc
<210>174
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>174
ggatcccctg tcgaaagt 38
caggtcaatg
gagacaaggc
<210>175
<211>42
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400> 275
CA 02343969 2001-03-20
WO PCT/US99/22231
00/18889
4$
ggatccgcgg 42
ccgcacaatg
tccgccaaga
tttcaatatt
cc
<210>176
<221>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>176
ggatcccctg 38
caggttaatt
tttcttaact
actccatt
<210>177
<211>42
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>177
ggatccgcgg 42
ccgcacaatg
ggagctcagg
agaaacggcg
cc
<210>178
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>178
ggatcccctg 38
caggtcacgt
cttctccttc
ttcaccgg
<210>179
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<4O0>179
ggatccgcgg 44
ccgcacaatg
gcggatcctg
atctgtcttc
tcct
<210>180
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<4oa>1so
ggatcccctg caggttatgt tggggccaag tcaggtgcaa 44
agat
<210>181
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
CA 02343969 2001-03-20
WO 00/18889 49 . PCT/US99/22231
<400>181
ggatccgcgg gtgtaccaaa ttct 44
ccgcaaaatg
gaaaaaaaga
<210>182
<211>46
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>182
ggatcccctg ttgagggaat tttttg 46
caggttattt
gtttactaat
<210>183
<211>36
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>183
tcgacctgca tgctgc 36
ggaagcttaa
ggatggtgat
<210>184
<211>31
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>184
ggatccgcgg g 31
ccgcttactt
ctccttctcc
<210>185
<211>39
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>185
ggatccgcgg atgtcctag 39
ccgcacaatg
tcttttaggg
<210>186
<211>41
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>186
ggatcccctg caggtcaatc atccttaccc 41
tttggtttac c
<210>187
<212>60
<212>DNA
<213>Artificial Sequence
<220>
CA 02343969 2001-03-20
WO PCT/US99/22231
00/18889
5~
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>187
atgtctttta tttcacaccg
gggatgtcct 60
agaaagagga
gatgaatttt
ctgtgcggta
<210>188
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<40d>188
tcaatcatcc gagagtgcac
ttaccctttg 60
gtttaccctc
tggaggcaga
agattgtact
<210>189
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>189
ggatccgcgg 44
ccgcacaatg
aagcattccc
aaaaataccg
tagg
<210>190
<211>41
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>190
ggatcccctg 41
caggtcaatg
attttttttc
atcacaaata
c
<210>192
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence:5ynthetic
Oligonucleotide
<400>191
atgaagcatt tttcacaccg
cccaaaaata 60
ccgtaggtat
ggaatttatg
ctgtgcggta
<210>192
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence: Synthetic
Oligonucleotide
<400>192
tcaatgattt gagagtgcac
tttttcatca 60
caaatacaag
aataagaaaa
agattgtact
<210>193
<211>43
<212>DNA
<213>Artificial Sequence
CA 02343969 2001-03-20
WO 00/18889 51 PCT/US99122231
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>193
ggatccgcgg atttcttcga aac 43
ccgcacaatg
ggttttgttg
<210>194
<211>45
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
0ligonucleotide
<400>194
ggatcccctg ttaatatttt tttgc 45
caggttattt
ggtctcaatt
<210>195
<211>50
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>195
atgggttttg atggtcggtt ctgtgcggtatttcacaccg
ttgatttctt 60
cgaaacatat
<210>196
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>196
ttatttggtc caaggactcg agattgtactgagagtgcac
tcaattttaa 60
tatttttttg
<210>197
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>197
ggatccgcgg ccaattggag agac 44
ccgcacaatg
gaaaagtaca
<210>198
<211>42
<212>DNA
<213>Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 198
ggatcccctg caggctactt cctcttttta cgttgatcgc tg 42
<210> 199
<211> 60
CA 02343969 2001-03-20
WO OO/I8889 52 . PCT/US99/22231
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 199
atggaaaagt acaccaattg gagagacaat ggtacgggaa ctgtgcggta tttcacaccg 60
<210> 200
<211> 60
<212> DNA
<213> Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>200
ctacttcctc atattccttc agattgtactgagagtgcac
tttttacgtt 60
gatcgctgat
<210>201
<211>41
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>202
ggatccgcgg aactcacgga g 41
ccgcacaatg
cctgcaccaa
<210>202
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>202
ggatcecctg ttcccttc 3$
caggctacgc
atctccttct
<210>203
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>203
atgcctgcac gcctcttcca ctgtgcggtatttcacaccg
caaaactcac 60
ggagaaatct
<210>204
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>204
ctacgcatct ttcttcctct agattgtactgagagtgcac
ccttctttcc 60
cttcttcttc
CA 02343969 2001-03-20
W0 PCT/US99/22231
00/18889
53
<zlo>205
<211>46
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence:.Synthetic
Oligonucleotide
<400>205
ggatccgcgg ctgccgatca taacgc 46
ccgcacaatg
tctgctcccg
<210>206
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>206
ggatcccctg tgttctcttt tctg 44
caggtcattc
tttcttttcg
<210>207
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>207
atgtctgctc gccaaaccta ctgtgcggtatttcacaccg
ccgctgccga 60
tcataacgct
<210>208
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleoti.de
<400>208
tcattctttc tcttaccagc agattgtactgagagtgcac
ttttcgtgtt 60
ctcttttctg
<210>209
<211>49
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>209
ggatccgcgg aaatagctca taaagttcg49
ccgcacaatg
ctgcatcaaa
<210>210
<211>49
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400> 210
CA 02343969 2001-03-20
WO . PCT/US99/22231
OO/I8889
54
ggatcccctg taaagtttat aaactaacc49
caggtcaaaa
aataaaacaa
<220>211
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>211
atgctgcatc cgaaaagtcg ctgtgcggtatttcacaccg
aaaaaatagc 60
tcataaagtt
<210>212
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>222
tcaaaaaata taaccaaatt agattgtactgagagtgcac
aaacaataaa 60
gtttataaac
<210>223
<211>41
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>213
ggatccgcgg gtaggttctt g 42
ccgcacaatg
agtgtgatag
<210>214
<211>41
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>214
ggatcccctg acagatgaac c 41
caggttaatg
catctttttt
<210>215
<211>60
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence: Synthetic
Oligonucleotide
<400>215
atgagtgtga ttgaggtccg ctgtgcggtatttcacaccg
taggtaggtt 60
cttgtattac
<210>216
<211>60
<212>ANA
<213>Artificial Sequence
<220>
<223>Description of ArtificialSequence:Synthetic '
Oligonucleotide
CA 02343969 2001-03-20
WO 00118889 55 PCT/US99/22231
<400> 216
ttaatgcatc ttttttacag atgaaccttc gttatgggta agattgtact gagagtgcac 60
<210> 217
<211> 381
<212> PRT
<213> Saccharomyces sp.
<220>
<400> 217
Met Ser Phe Arg Asp Val Leu Glu Arg Giy Asp Glu Phe Leu Glu Ala
1 5 10 15
Tyr Pro Arg Arg Ser Pro Leu Trp Arg Phe Leu Ser Tyr Ser Thr Ser
20 25 30
Leu Leu Thr Phe Gly Val Ser Lys Leu Leu Leu Phe Thr Cys Tyr Asn
35 40 45
Vai Lys Leu Asn Gly Phe Glu Lys Leu G1u Thr Ala Leu Glu Arg Ser
5o s5 60
Lys Arg Glu Asn Arg Gly Leu Met Thr Val Met Asn His Met Ser Met
65 70 75 80
Val Asp Asp Pro Leu Val Trp Ala Thr Leu Pro Tyr Lys Leu Phe Thr
85 90 95
Ser Leu Asp Asn Ile Arg Trp Ser Leu G1y Ala His Asn Ile Cys Phe
100 105 1.10
Gln Asri Lys Phe Leu A1a Asn Phe Phe Ser Leu Gly Gln Val Leu Ser
115 120 125
Thr Glu Arg Phe Gly Val Gly Pro Phe G1n Gly Ser I1e Asp Ala Ser
130 135 140
T1e Arg Leu Leu Ser Pro Asp Asp Thr Leu Asp Leu Glu Trp Thr Pro
145 150 155 160
His Ser Glu Val Ser Ser Ser Leu Lys Lys Ala Tyr Ser Pro Pro I1e
165 170 175
Ile Arg Ser Lys Pro Ser Trp Val His Val Tyr Pro Glu Gly Phe Val
180 185 190
Leu Gln Leu Tyr Pro Pro Phe Glu Asn Ser Met Arg Tyr Phe Lys Trp
195 200 205
Gly Ile Thr Arg Met Ile Leu Giu Ala Thr Lys Pro Pro Ile Val Val
210 215 220
Pro Ile Phe Ala Thr Gly Phe Glu Lys Ile Aia Ser Glu Ala Val Thr
225 230 235 240
Asp Ser Met Phe Arg Gln Ile Leu Pro Arg Asn Phe Gly Ser Glu Ile
245 250 255
Asn Val Thr Ile Gly Asp Pro Leu Asn Asp Asp Leu.Ile Asp Arg Tyr
260 265 270
Arg Lys Glu Trp Thr His Leu Val Glu Lys Tyr Tyr Asp Pro Lys Asn
275 280 285
Pro Asn Asp Leu Ser Asp Glu Leu Lys Tyr Gly Lys Giu Ala Gln Asp
290 295 300
Leu Arg Ser Arg Leu Ala Ala Glu Leu Arg Ala His Val Ala Glu Ile
CA 02343969 2001-03-20
WO OQ118889 56 PCT/US99122231
305 310 315 320
Arg Asn Glu Val Arg Lys Leu Pro Arg G1u Asp Pro Arg Phe Lys Ser
325 330 335
Pro Ser Trp Trp Lys Arg Phe Asn Thr Thr Glu Gly Lys Ser Asp Pro
340 345 350
Asp Val Lys Val Ile Gly Glu Asn Trp Ala Tle Arg Arg Met Gln Lys
355 360 3-65
Phe Leu Pro Pro Glu G1y Lys Pro Lys G1y Lys Asp Asp '
370 375 380
<210> 218
<211> 396
<212> PRT
<213> Saccharomyces sp.
<220>
<400> 228
Met Lys His Ser Gln Lys Tyr Arg Arg Tyr Gly Ile Tyr Glu Lys Thr
1 5 10 15
Gly Asn Pro Phe Ile Lys Gly Leu Gln Arg Leu Leu Ile Ala Cys Leu
20 25 30
Phe Ile Ser Gly Ser Leu Ser Ile Val Val Phe Gln Ile Cys Leu Gln
35 40 45
Val Leu Leu Pro Trp Ser Lys Ile Arg Phe Gln Asn Gly Ile Asn Gln
50 55 60
Ser Lys Lys Ala Phe Ile Val Leu Leu Cys Met Tle Leu Asn Met Val
65 70 75 80
Ala Pro Ser Ser Leu Asn Val Thr Phe Glu Thr Ser Arg Pro Leu Lys
85 90 95
Asn Ser Ser Asn Ala Lys Pro Cys Phe Arg Phe Lys Asp Arg Ala Ile
100 105 110
Ile Ile Ala Asn His Gln Met Tyr Ala Asp Trp Ile Tyr Leu Trp Trp
115 120 125
Leu Ser Phe Val Ser Asn Leu Gly Gly Asn Val Tyr Ile Ile Leu Lys
130 135 140
Lys Ala Leu Gln Tyr Ile Pro Leu Leu Gly Phe Gly Met Arg Asn Phe
145 150 155 160
Lys Phe Ile Phe Leu Ser Arg Asn Trp G1n Lys Asp Glu Lys Ala Leu
165 170 175
Thr Asn Ser Leu Val Ser Met Asp Leu Asn Ala Arg Cys Lys Gly Pro
180 185 190
Leu Thr Asn Tyr Lys Ser Cys Tyr Ser Lys Thr Asn Glu Sex Ile Ala
195 200 205
Ala Tyr Asn Leu Ile Met Phe Pro G1u Gly Thr Asn Leu Ser Leu Lys
210 215 220
Thr Arg Glu Lys Ser Glu Ala Phe Cys Gln Arg Ala His Leu Asp His
225 230 235 240
Val Gln Leu Arg His Leu Leu Leu Pro His Ser Lys Gly Leu Lys Phe
245 250 255
CA 02343969 2001-03-20
WD 001i$$$9 5~ PCT/US99/22233
A1a Val Glu Lys Leu Ala Pro Ser Leu Asp Ala Ile Tyr Asp Val Thr
260 265 270
Ile Gly Tyr Ser Pro Ala Leu Arg Thr Glu Tyr Val Gly Thr Lys Phe
275 280 285
Thr Leu Lys Lys Ile Phe Leu Met Gly Val Tyr Pro Glu Lys Val Asp
290 295 300
Phe Tyr Ile Arg Glu Phe Arg Val Asn Glu Ile Pro Leu Gln Asp Asp
305 310 315 320
Glu Val Phe Phe Asn Trp Leu Leu Gly Val Trp Lys Glu Lys Asp Gln
325 330 335
Leu Leu Glu Asp Tyr Tyr Asn Thr Gly Gln Phe Lys Ser Asn Ala Lys
340 345 350
Asn Asp Asn Gln Ser Ile Val Val Thr Thr Gln. Thr Thr Gly Phe Gln
355 360 365
His Glu Thr Leu Thr Pro Arg Ile Leu Ser Tyr Tyr Gly Phe Phe Ala
370 375 380
Phe Leu Ile Leu Val Phe Val Met Lys Lys Asn His
385 390 395
<210> 219
<211> 479
<212> PRT
<213> Saccharomyces sp.
<220>
<400> 219
Met Gly Phe Val Asp Phe Phe Giu Thr Tyr Met Val Gly 5er Arg Val
1 5 10 15
Gln Phe Lys Gln Leu Asp Ile Ser Asp Trp Leu Ser Leu Thr Pro Arg
20 25 30
Leu Leu Ile Leu Phe Gly Tyr Phe Tyr Leu His Ser Phe Phe Thr Ala
35 40 45
Ile Asn Gln Phe Leu Gln Phe Ile Asn Thr Asn Ser Phe Cys Leu Arg
50 55 60
Leu His Leu Leu Tyr Asp Arg Phe Trp Ser His Val Pro Ile Ile Gly
65 70 75 80
Glu Tyr Lys Ile Arg Leu Leu Ser Arg Ala Leu Thr Tyr Ser Lys Leu
85 90 95
Lys Ile Ile Pro Thr Leu Asp Lys Val Leu Glu Ala Ile Glu Ile Trp
100 105 110
Phe Gln Leu His Leu Val Glu Met Thr Phe Glu Lys Lys Lys Asn Val
115 120 125
G1n Ile Phe Ile Thr G1u Gly Ser Asp Asp Leu Asn Phe Phe Lys Asp
130 135 140
Ser Lys Phe Gln Thr Thr Leu Met Ile Cys Asn His Arg Ser Val Asn
145 150 155 160
Asp Tyr Thr Leu Ile Asn Tyr Leu Phe Leu Lys Ser Cys Pro Thr Lys
165 170 175
CA 02343969 2001-03-20
WO 00/18889 5g PCT/US99122231
Phe Tyr Thr Lys Trp Glu Phe Leu Gln Lys Leu Arg Lys Gly G1u Asp
180 185 190
Leu Ala Glu Trp Pro Gln Leu Lys Phe Leu Giy Trp Gly Lys Met Phe
195 200 205
Asn Phe Pro Arg Leu Asp Leu Leu Lys Asn Ile Phe Phe Lys Asp Glu
210 215 220
Thr Leu Ala Leu Ser Ser Asn Glu Leu Arg Asp Ile Leu Glu Arg Gln
225 230 235 240
Asn Asn Gln Ala Ile Thr Ile Phe Pro Glu Val Asn Ile Met Ser Leu
245 250 255
Glu Leu Ser Ile Ile Gln Arg Lys Leu His Gln Asp Phe Pro Phe Val
260 265 270
Ile Asn Phe Tyr Asn Leu Leu Tyr Pro Arg Phe Lys Asn Phe Thr Thr
275 280 285
Leu Met Ala Ala Phe Ser Ser Ile Lys Asn Ile Lys Arg Lys Lys Asn
290 295 300
Arg Asn Asn Ile Ile Lys Glu Ala Arg Tyr Leu Phe His Arg Glu Leu
305 310 315 320
Asp Lys Leu Val His Lys Ser Met Lys Met Glu Ser Ser Lys Val Ser
325 330 335
Asp Lys Thr Thr Pro Pro Met Ile Val Asp Asn Ser Tyr Leu Leu Thr
340 345 350
Lys Lys Glu Glu Ile Ser Ser Gly Lys Pro Lys Val Val Arg Ile Asn
355 360 365
Pro Tyr Ile Tyr Asp Va1 Thr Ile Ile Tyr Tyr Arg Val Lys Tyr Thr
370 375 380
Asp Ser Gly His Asp His Thr Asn Gly Asp Leu Arg Leu His Lys Gly
385 390 395 400
Tyr Gln Leu Glu Gln Ile Ser Pro Thr Ile Phe Glu Met Ile Gln Pro
405 410 415
Glu Met Glu Ser Glu Asn Asn Ile Lys Asp Lys Asp Pro Ile Val Val
420 425 430
Met Val Asn Val Lys Lys His Gln Ile Gln Pro Leu Leu Ala Tyr Asn
435 440 445
Asp Glu Ser Leu Glu Lys Trp Leu Glu Asn Arg Trp Ile Glu Lys Asp
450 455 460
Arg Leu Ile Glu Ser Leu Gln Lys Asn Ile Lys Ile Glu Thr Lys
465 470 475
<210> 220
<211> 300
<212> PRT
<213> Saccharomyces sp.
<400> 220
Met Glu Lys Tyr Thr Asn Trp Arg Asp Asn Gly Thr Gly Ile Ala Pro
1 5 10 15
Phe Leu Pro Asn Thr Ile Arg Lys Pro Ser Lys Val Met Thr Ala Cys
20 25 30
CA 02343969 2001-03-20
WO 00/18889 59 PCT/US99/2223!
Leu Leu Gly Ile Leu Gly Val Lys Thr Ile Ile Met~Leu Pro Leu Ile
35 40 45
Met Leu Tyr Leu Leu Thr Gly Gln Asn Asn Leu Leu Gly Leu Ile Leu
50 55 60
Lys Phe Thr Phe Ser Trp Lys Glu Glu Ile Thr Val Gln Gly Ile Lys
65 70 75 80
Lys Arg Asp Val Arg Lys Ser Lys His Tyr Pro Gln Lys Gly Lys Leu
85 90 95
Tyr Ile Cys Asn Cys Thr Ser Pro Leu Asp Ala Phe Ser Val Val Leu
100 205 110
Leu Ala Gln Gly Pro Val Thr Leu Leu Val Pro Ser Asn Asp Ile Val
115 120 125
Tyr Lys Val Ser Ile Arg Glu Phe Ile Asn Phe Ile Leu Ala Gly Gly
130 135 140
Leu Asp Ile Lys Leu Tyr Gly His Glu Val A1a Glu Leu Ser Gln Leu
145 150 155 160
Gly Asn Thr Val Asn Phe Met Phe Ala Glu Gly Thr Ser Cys Asn G1y
165 170 175
Lys Ser Val Leu Pro Phe Ser Ile Thr Gly Lys Lys Leu Lys Glu Phe
180 185 1:90
Ile Asp Pro Ser Ile Thr Thr Met Asn Pro Ala Met Ala Lys Thr Lys
195 200 205
Lys Phe Glu Leu Gln Thr Ile Gln Ile Lys Thr Asn Lys Thr Ala Ile
210 215 220
Thr Thr Leu Pro Ile Ser Asn Met Glu Tyr Leu Ser Arg Phe Leu Asn
225 230 235 240
Lys Gly Ile Asn Val Lys Cys Lys Ile Asn Glu Pro Gln Val Leu Ser
245 250 255
Asp Asn Leu Glu Glu Leu Arg Val Ala Leu Asn Gly Gly Asp Lys Tyr
260 265 270
Lys Leu Val Ser Arg Lys Leu Asp Val Glu Ser Lys Arg Asn Phe Val
275 280 285
Lys Glu Tyr Ile Ser Asp Gln Arg Lys Lys Arg Lys
290 295 300
<210> 221
<211> 759
<212> PRT
<213> Saccharomyces sp.
<400> 221
Met Pro Pro Leu ThrGluLys PheAlaSer SerLysSer Thr
Ala Lys
1 5 10 15
G1n Lys Thr Tyr SerSerIle GluAlaLys SerValLys Thr
Thr Asn
20 25 30
Ser Ala Gln Tyr IleTyrGln GluProSer AlaThrLys Lys
Asp Ala
35 40 45
Ile Leu Ser Ala ThrTrpLeu LeuTyrAsn IlePheHis Cys
Tyr Ile
50 55 60
CA 02343969 2001-03-20
WO 00/18889 6~ PCT/US99/22231
Phe Phe Arg Glu Ile Arg Gly Arg Gly Ser Phe Lys Val Pro Gln Gln
65 70 75 ~ 80
Gly Pro Val Ile Phe Val Ala Ala Pro His Ala Asn Gln Phe Val Asp
85 90 95
Pro Val Ile Leu Met Gly Glu Val Lys Lys Ser Val Asn Arg Arg Val
100 105 110
Ser Phe Leu Ile Ala Glu Ser Ser Leu Lys Gln Pro Pro Ile Gly Phe
215 120 125
Leu Ala Ser Phe Phe Met Ala Ile Gly Va1 Val Arg Pro Gln Asp Asn
130 135 140
Leu Lys Pro Ala Glu Gly Thr Ile Arg Val Asp Pro Thr Asp Tyr Lys
145 150 155 260
Arg Va1 Ile Gly His Asp Thr His Phe Leu Thr Asp Cys Met Pro Lys
165 270 275
Gly Leu Ile Gly Leu Pro Lys Ser Met Gly Phe Gly Glu Ile Gln Ser
180 185 190
Tle Glu Ser Asp Thr Ser Leu Thr Leu Arg Lys Glu Phe Lys Met Ala
195 200 205
Lys Pro Glu Ile Lys Thr Ala Leu Leu Thr Gly Thr Thr Tyr Lys Tyr
220 215 220
Ala AIa Lys Val Asp Gln Ser Cys Val Tyr His Arg Val Phe Glu His
225 230 235 240
Leu Ala His Asn Asn Cys Ile Gly Ile Phe Pro Glu Gly Gly Ser His
245 250 255
Asp Arg Thr Asn Leu Leu Pro Leu Lys Ala Gly Val Ala I1e Met Ala
260 265 270
Leu Gly Cys Met Asp Lys His Pro Asp Val Asn Val Lys Ile Val Pro
275 280 285
Cys Giy Met Asn Tyr Phe His Pro His Lys Phe Arg Ser Arg Ala Val
290 295 300
Val Glu Phe Gly Asp Pro Ile Glu Ile Pro Lys Glu Leu Val Ala Lys
305 310 315 320
Tyr His Asn Pro Glu Thr Asn Arg Asp Ala Val Lys Glu Leu Leu Asp
325 330 335
Thr Ile Ser Lys Gly Leu Gln Ser Val Thr Val Thr Cys Ser Asp Tyr
340 345 350
Glu Thr Leu Met Val Val Gln Thr 21e Arg Arg Leu Tyr Met Thr Gln
355 360 365
Phe Ser Thr Lys Leu Pro Leu Pro Leu Ile Val Glu Met Asn Arg Arg
370 375 380
Met Val Lys Gly Tyr Glu Phe Tyr Arg Asn Asp Pro Lys Ile Ala Asp
385 390 395 400
Leu Thr Lys Asp Ile Met Ala Tyr Asn Ala Ala Leu Arg His Tyr Asn
405 420 415
Leu Pro Asp His Leu Val Glu Glu Ala Lys Val Asn Phe Ala Lys Asn
420 425 430
CA 02343969 2001-03-20
WO 00/18889 61 PC'1'IUS99/22231
Leu Gly Leu Val Phe Phe Arg Ser Ile Gly Leu Cys Ile Leu Phe Ser
435 440 445
Leu Ala Met Pro Gly Ile Ile Met Phe Ser Pro Val Phe Ile Leu A1a
450 455 460
Lys Arg Ile Ser Gln Glu Lys Ala Arg Thr Ala Leu Ser Lys Ser Thr
465 470 475 480
Val Lys Ile Lys Ala Asn Asp Val Ile Ala Thr Trp Lys Ile Leu Ile
485 490 495
Gly Met Gly Phe Ala Pro Leu Leu Tyr Ile Phe Trp Ser VaI Leu Ile
500 505 510
Thr Tyr Tyr Leu Arg His Lys Pro Trp Asn Lys Ile Tyr Val Phe Ser
515 520 525
Gly Ser Tyr Ile Ser Cys Val Ile Val Thr Tyr Ser Ala Leu Ile Val
530 535 540
Gly Asp Ile Gly Met Asp Gly Phe Lys Ser Leu Arg Pro Leu Val Leu
545 550 555 560
Ser Leu Thr Ser Pro Lys Gly Leu Gln Lys Leu Gln Lys Asp Arg Arg
565 570 575
Asn Leu Ala Glu Arg Tle Ile Glu Val Val Asn Asn Phe Gly Ser Glu
580 585 590
Leu Phe Pro Asp Phe Asp Ser Ala Ala Leu Arg Glu Glu Phe Asp Val.
595 600 605
Ile Asp Glu Glu Glu Glu Asp Arg Lys Thr Ser Glu Leu Asn Arg Arg
610 615 620
Lys Met Leu Arg Lys Gln Lys Tle Lys Arg Gln Glu Lys Asp Ser Ser
625 630 635 640
Ser Pro Ile Tle Ser Gln Arg Asp Asn His Asp Ala Tyr Glu His His
645 650 655
Asn Gln Asp Ser Asp Gly Val Ser Leu Val Asn Ser Asp Asn Ser Leu
660 665 670
Ser Asn Ile Pro Leu Phe Ser Ser Thr Phe His Arg Lys Ser Glu Ser
675 680 685
Ser Leu Ala Ser Thr Ser Val Ala Pro Ser Ser Ser Ser Glu Phe Glu
690 695 700
Val Glu Asn Glu Ile Leu Glu Glu Lys Asn Gly Leu Ala Ser Lys Ile
705 710 715 720
Ala Gln Ala Val Leu Asn Lys Arg Ile Gly Glu Asn Thr Ala Arg Glu
725 730 735
Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu
740 745 750
Glu Gly Lys Glu Gly Asp Ala
755
<210> 222
<211> 743
<212> PRT
<213> Saccharomyces sp.
<400> 222
CA 02343969 2001-03-20
WO 00/18889 (~ PCT/US99/22231
Met Ser Ala Pro Ala Ala Asp His Asn Ala Ala Lys Pro Ile Pro His
1 5 10 15
Val Pro Gln A1a Ser Arg Arg Tyr Lys Asn Ser Tyr Asn Gly Phe Val
20 25 30
Tyr Asn Ile His Thr Trp Leu Tyr Asp Val Ser Val Phe Leu Phe Asn
35 40 45
Ile Leu Phe Thr Ile Phe Phe Arg Glu Ile Lys Val Arg Gly Ala Tyr
50 55 60
Asn Val Pro Glu Val Gly Val Pro Thr Ile Leu Val Cys Ala Pro His
65 70 75 80
Ala Asn Gln Phe Ile Asp Pro Ala Leu Val Met Ser Gln Thr Arg Leu
85 90 95
Leu Lys Thr Ser Ala Gly Lys Ser Arg Ser Arg Met Pro Cys Phe Val
100 105 110
Thr Ala Glu Ser Ser Phe Lys Lys Arg Phe Ile Sex Phe Phe Gly His
115 120 125
Ala Met Gly Gly Ile Pro Val Pro Arg Ile Gln Asp Asn Leu Lys Pro
130 135 140
Val Asp Glu Asn Leu Glu Ile Tyr Ala Pro Asp Leu Lys Asn His Pro
145 150 155 160
G1u Ile Ile Lys Gly Arg Ser Lys Asn Pro Gln Thr Thr Pro Val Asn
165 170 175
Phe Thr Lys Arg Phe Ser Ala Lys Ser Leu Leu Gly Leu Pro Asp Tyr
180 185 190
Leu Ser Asn Ala Gln Ile Lys Glu Ile Pro Asp Asp Glu Thr Ile Ile
195 200 205
Leu Ser Ser Pro Phe Arg Thr Ser Lys Ser Lys Val Val Glu Leu Leu
210 215 220
Thr Asn Gly Thr Asn Phe Lys Tyr Ala Glu Lys Ile Asp Asn Thr Glu
225 230 235 240
Thr Phe Gln Ser Val Phe Asp His Leu His Thr Lys Gly Cys Val Gly
245 250 255
Ile Phe Pro G1u Gly Gly Ser His Asp Arg Pro Ser Leu Leu Pro Ile
260 265 270
Lys Ala G1y Val Ala IIe Met Ala Leu Gly Ala Val Ala Ala Asp Pro
275 280 285
Thr Met Lys Val A1a Val Val Pro Cys Gly Leu His Tyr Phe His Arg
290 295 300
Asn Lys Phe Arg Ser Arg Ala Val Leu Glu Tyr Gly Glu Pro I1e Val
305 310 315 320
Va1 Asp Gly Lys Tyr Gly Glu Met Tyr Lys Asp Ser Pro Arg Glu Thr
325 330 335 '
Vai Ser Lys Leu Leu Lys Lys Ile Thr Asn Ser Leu Phe Ser Val Thr
340 345 350
Glu Asn Ala Pro Asp Tyr Asp Thr Leu Met Val Ile Gln Ala Ala Arg
355 360 365
Arg Leu Tyr Gln Pro Val Lys Val Arg Leu Pro Leu Pro Ala Ile Val
CA 02343969 2001-03-20
WO 00/18889 63 PCT/US99122231
370 375 380
Glu Ile Asn Arg Arg Leu Leu Phe Gly Tyr Ser Lys Phe Lys Asp Asp
385 390 395 400
Pro Arg I1e Ile His Leu Lys Lys Leu Val Tyr Asp Tyr Asn Arg Lys
405 410 415
Leu Asp Ser Val Gly Leu Lys Asp His Gln Val Met Gln Leu Lys Thr
420 425 430
Thr Lys Leu Glu Ala Leu Arg Cys Phe VaI Thr Leu Ile Val Arg Leu
435 440 445
Ile Lys Phe Ser Val Phe Ala Ile Leu Ser Leu Pro Gly Ser Ile Leu
4S0 455 460
Phe Thr Pro Ile Phe Ile Ile Cys Arg Val Tyr Ser Glu Lys Lys Ala
465 470 475 480
Lys G1u Gly Leu Lys Lys Ser Leu Val Lys Ile Lys G1y Thr Asp Leu
485 490 495
Leu Ala Thr Trp Lys Leu Ile Val Ala Leu Ile Leu Ala Pro Ile Leu
500 505 510
Tyr Val Thr Tyr Ser Ile Leu Leu Ile Ile Leu Ala Arg Lys Gln His
515 520 525
Tyr Cys Arg Ile Trp Val Pro Ser Asn Asn Ala Phe Ile Gln Phe Val
530 535 540
Tyr Phe Tyr Ala Leu Leu Val Phe Thr Thr Tyr Ser Ser Leu Lys Thr
545 550 555 560
Gly Glu Ile Gly Val Asp Leu Phe Lys Ser Leu Arg Pro Leu Phe Val
565 570 575
Ser Ile Val Tyr Pro Gly Lys Lys Iie Glu Glu Ile Gln Thr Thr Arg
580 585 590
Lys Asn Leu Ser Leu Glu Leu Thr Ala Val Cys Asn Asp Leu Gly Pro
595 600 605
Leu Val Phe Pro Asp Tyr Asp Lys Leu Ala Thr Glu Ile Phe Ser Lys
610 615 620
Arg Asp Gly Tyr Asp Va1 Ser Ser Asp Ala Glu Ser Ser Ile Ser Arg
625 630 635 640
Met Ser Va1 Gln Ser Arg Sex Arg Ser Ser Ser Ile His Ser Ile Gly
645 650 655
Ser Leu Ala Ser Asn Ala Leu Ser Arg Val Asn Ser Arg Gly Ser Leu
660 665 670
Thr Asp Ile Pro Ile Phe Ser Asp Ala Lys Gln G1y G1n Trp Lys Ser
675 680 685
Glu Gly G1u Thr Ser Glu Asp Glu Asp Glu Phe Asp Glu Lys Asn Pro
690 695 700
Ala I1e Val Gln Thr Ala Arg Ser Ser Asp Leu Asn Lys Glu Asn Ser
705 720 715 720
Arg Asn Thr Asn I1e Ser Ser Lys Ile Ala Ser Leu Val Arg Gln Lys
725 730 735
Arg Glu His Giu Lys Lys G1u
740
CA 02343969 2001-03-20
WO 00/18889 ~4 PCT/US99/22231
<210> 223
<211> 397
<212> PRT
<213> Saccharomyces sp.
<400> 223
Met Leu His Gln Lys Ile Ala His Lys Val Arg Lys Val Val Val Pro
1 5 10 15
Gly Ile Ser Leu Leu Ile Phe Phe Gln Gly Cys Leu Ile Leu Leu Phe
20 25 30
Leu Gln Leu Thr Tyr Lys Thr Leu Tyr Cys Arg Asn Asp Ile Arg Lys
35 40 45
Gln Ile Gly Leu Asn Lys Thr Lys Arg Leu Phe Ile Val Leu Val Ser
50 55 60
Ser Ile Leu His Val Val Ala Pro Sex Ala Va1 Arg Ile Thr Thr Glu
65 70 75 80
Asn Ser Sex Val Pro Lys Gly Thr Phe Phe Leu Asp Leu Lys Lys Lys
85 90 95
Arg Ile Leu Ser His Leu Lys Ser Asn Ser Val Ala Ile Cys Asn His
100 105 110
Gln Ile Tyr Thr Asp Trp Ile Phe Leu Trp Trp Leu Ala Tyr Thr Ser
115 120 125
Asn Leu Gly Ala Asn Val Phe Ile Ile Leu Lys Lys Ser Leu Ala Ser
130 135 140
Ile Pro Ile Leu Gly Phe G1y Met Arg Asn Tyr Asn Phe Ile Phe Met
145 150 155 160
Ser Arg Lys Trp Ala Gln Asp Lys Ile Thr Leu Ser Asn Ser Leu Ala
165 170 175
Gly Leu Asp Ser Asn Ala Arg Gly Ala Gly Ser Leu Ala Gly Lys Ser
180 185 190
Pro Glu Arg Ile Thr Glu G1u Gly Glu Ser Ile Trp Asn Pro Glu Val
195 200 205
Tle Asp Pro Lys Gln I1e His Trp Pro Tyr Asn Leu Ile Leu Phe Pro
210 215 220
Glu G1y Thr Asn Leu Ser Ala Asp Thr Arg Gln Lys Ser Ala Lys Tyr
225 230 235 240
Ala Ala Lys Ile Gly Lys Lys Pro Phe Lys Asn Val Leu Leu Pro His
245 250 255
Ser Thr Gly Leu Arg Tyr Ser Leu Gln Lys Leu Lys Pro Ser Ile Glu
260 265 270
Ser Leu Tyr Asp Ile Thr Ile Gly Tyr Ser Gly Val Lys Gln Glu Glu
275 280 285
Tyr Gly Glu Leu Ile Tyr Gly Leu Lys Ser Ile Phe Leu Glu G1y Lys
290 295 300
Tyr Pro Lys Leu Val Asp T1e His Ile Arg Ala Phe Asp Val Lys Asp
305 310 315 320
Ile Pro Leu Glu Asp Glu Asn Glu Phe Ser Glu Trp Leu Tyr Lys Ile
325 330 335
CA 02343969 2001-03-20
WO 00/18889 65 PCT/US99/22231
Trp Ser Glu Lys Asp Ala Leu Met Glu Arg Tyr Tyr Ser Thr Gly Ser
340 345 350
Phe Val Ser Asp Pro Glu Thr Asn His Ser Val Thr Asp Ser Phe Lys
355 360 365
Tle Asn Arg Ile Glu Leu Thr Glu Val Leu Ile Leu Pro Thr Leu Thr
370 375 380
Ile Ile Trp Leu Val Tyr Lys Leu Tyr Cys Phe Ile Phe
385 390 395
<210> 224
<211> 303
<212> PRT
<213> Saccharomyces sp.
<400> 224
Met Ser Val Ile Gly Arg Phe Leu Tyr Tyr Leu Arg Ser Val Leu Val
1 5 10 15
Val Leu Ala Leu Ala Gly Cys Gly Phe Tyr Gly Val Ile Ala Ser Ile
20 25 30
Leu Cys Thr Leu Ile Gly Lys Gln His Leu Ala Gln Trp Ile Thr Ala
35 40 45
Arg Cys Phe Tyr His Val Met Lys Leu Met Leu Gly Leu Asp Val Lys
50 55 60
Val Val Gly Glu Glu Asn Leu Ala Lys Lys Pro Tyr Ile Met Ile Ala
65 70 75 80
Asn His Gln Ser Thr Leu Asp Ile Phe Met Leu G1y Arg I1e Phe Pro
85 90 95
Pro Gly Cys Thr Val Thr Ala Lys Lys Ser Leu Lys Tyr Val Pro Phe
100 105 120
Leu Gly Trp Phe Met Ala Leu Ser Gly Thr Tyr Phe Leu Asp Arg Ser
115 120 125
Lys Arg Gln Glu Ala I1e Asp Thr Leu Asn Lys Gly Leu Glu Asn Val
130 135 140
Lys Lys Asn Lys Arg Ala Leu Trp Val Phe Pro Glu Gly Thr Arg Ser
145 150 155 160
Tyr Thr Ser Glu Leu Thr Met Leu Pro Phe Lys Lys Gly Ala Phe His
1-65 170 175
Leu Ala Gln Gln Gly Lys Ile Pro I1e Val Pro Val Val Val Ser Asn
180 185 190
Thr Ser Thr Leu Val Ser Pro Lys Tyr Gly Val Phe Asn Arg Gly Cys
195 200 205
Met Tle Val Arg Ile Leu Lys Pro Ile Ser Thr Glu Asn Leu Thr Lys
210 215 220
Asp Lys Ile Gly Glu Phe Ala Glu Lys Val Arg Asp Gln Met Val Asp
225 230 235 240
Thr Leu Lys Glu Ile Gly Tyr Ser Pro Ala Ile Asn Asp Thr Thr Leu
245 250 255
Pro Pra Gln Ala Ile Glu Tyr Ala Ala Leu Gln His Asp Lys Lys Val
260 265 270
CA 02343969 2001-03-20
WO 00/18889 (6 . PCT/US99/22231
Asn Lys Lys Ile Lys Asn Glu Pro Val Pro Ser Val Ser Ile Ser Asn
275 280 285
Asp Val Asn Thr His Asn Glu Gly Ser Ser Val Lys Lys Met His
290 295 300
<210> 225
<221> 1146
<212> DNA
<213> Saccharomyces sp.
<400> 225
atgtctttta gggatgtcct agaaagagga gatgaatttt tagaagccta tcccagaaga 60
agcccccttt ggagatttct ttcatacagt acatcattac tgaccttcgg tgtatcaaaa 120
ctgcttcttt tcacatgcta taatgtcaaa ttgaatggtt ttgaaaaatt agaaactgcc 180
ttggaacgtt ccaaaaggga aaatagaggc cttatgacgg tcatgaacca tatgagtatg 240
gtcgatgatc cgttagtttg ggcaacacta ccatataagt tatttacgtc tttggacaac 300
ataagatggt ctttgggtgc acataatatt tgctttcaaa ataaatttct ggccaacttt 360
ttctcacttg gccaagtcct ttcaacagaa agatttgggg tgggcccatt tcaaggttct 420
atagatgctt caataagatt gttaagccct gacgacactt tagacttgga atggacccct 480
cactctgagg tctcttcttc gctaaaaaaa gcctactccc cgcccataat aaggtcgaag 540
ccatcttggg tccatgttta tccagaagga tttgtactac aattatatcc gccttttgaa 600
aattcgatga ggtattttaa atggggtatt accagaatga tcctagaagc aacaaagccg 660
cccattgtag taccaatatt tgctacaggg tttgaaaaaa tagcatccga agcagtcaca 720
gattcaatgt ttagacaaat tctaccaaga aactttggct ctgaaataaa tgttaccata 780
ggggatcctt taaatgatga tttaatcgac aggtatagaa aagaatggac acatttggtt 840
gaaaaatact atgatcccaa aaatcctaac gacctctctg acgaattgaa atatggtaaa 900
gaggcgcaag atttaagaag cagattagcc gctgaactga gagcccatgt tgctgaaatt 960
agaaatgaag ttcgcaaatt accacgcgaa gaccctaggt tcaaatcccc ctcatggtgg
1020
aagcggttca acaccacgga aggtaaatcg gacccagatg ttaaagtcat tggcgaaaat
1080
tgggcaataa ggaggatgca aaagtttctg cctccagagg gtaaaccaaa gggtaaggat
1140
gattga
1146
<210> 226
<211> 1191
<212> DNA
<213> Saccharomyces sp.
<400> 226
atgaagcatt cccaaaaata ccgtaggtat ggaatttatg aaaagactgg taatcccttt 60
ataaaagggt tgcaaaggct gcttatcgct tgcttgttca tttcaggctc gctgagtatt 120
gtcgtttttc agatctgtct acaggtgctt ctcccttgga gcaagattag atttcaaaat 180
ggtataaatc aaagtaagaa ggcttttatc gttttattat gcatgatctt gaacatggtg 240
gctccctctt ctttgaatgt cacttttgaa acatcgcggc cattgaagaa ctcttctaac 300
gccaagccat gctttagatt taaagacagg gctataataa ttgcaaatca tcaaatgtat 360
gcagactgga tttatctctg gtggctttcc tttgtttcaa atttgggtgg taacgtttat 420
atcatcctga agaaagctct gcagtacata ccattactgg gatttggcat gcgaaatttt 480
aagtttatat ttttaagtag gaactggcaa aaggatgaga aagctttaac aaatagtttg 540
gtttctatgg acttaaacgc gaggtgcaag gggcccctta caaattataa gagttgttat 600
tccaagacaa atgaatccat tgccgcttat aatttaatca tgttccctga gggtacaaat 660
ctaagcctca agacaagaga aaaaagcgag gcattctgtc aaagagcaca tttggaccat 720
gtccaattaa gacatttgtt attaccgcac tctaaaggct tgaagtttgc agtagaaaaa 780
ctagctccta gtttagatgc tatctacgat gtcactattg gatattctcc cgccttgaga 840
acggaatacg tcggcaccaa attcaccttg aagaaaatat tcttaatggg tgtctatccg 900
gagaaagtag atttttatat tagggaattt agagttaatg agatcccttt gcaagatgac 960
gaagtttttt tcaattggtt actgggcgtg tggaaagaaa aagatcaact gctagaagac
1020
tactacaaca caggccaatt taaaagtaat gctaaaaatg acaaccaatc catcgttgtt
1080
acgacacaaa cgactggatt tcagcacgaa acattgacac cccgtatcct ttcatattac
1140
gggttcttcg cttttcttat tcttgtattt gtgatgaaaa aaaatcattg a
1191
CA 02343969 2001-03-20
WO 00/18889 ('7 PCT/US99/22231
<210> 227
<211> 1440
<212> DNA
<213> Saccharomyces sp.
<400> 227
atgggttttg ttgatttctt cgaaacatat atggtcggtt ctagggtcca gttcaaacag 60
ttagatattt ctgattggtt gagtctgacc ccaaggttgc ttattctttt tggctatttt 120
taccttcatt ctttttttac tgcaatcaat caattcctac agttcattaa cacgaattcc 180
ttctgtctta gactgcattt actatatgac agattttggt cgcatgtgcc cataataggt 240
gagtacaaaa ttcggctgct ctcgagggca ctgacatata gtaaactgaa aataatacca 300
actttagaca aggtgctgga ggcgattgaa atttggtttc agctacattt agttgaaatg 360
accttcgaaa aaaaaaaaaa cgtccaaatt ttcataaccg agggaagtga tgacctaaac 420
ttttttaaag atagcaaatt ccaaaccaca ttaatgatat gtaatcatcg atcagtgaat 480
gactacacat tgattaatta cctttttctc aaaagttgtc ccaccaagtt ttatactaaa 540
tgggaatttc tacaaaagct gaggaagggg gaagatctag ctgaatggcc tcagttaaaa 600
tttcttggtt ggggaaaaat gtttaacttt cctcgattgg atctactaaa gaacatattc 660
ttcaaagatg aaacactcgc actctcatcg aatgagttaa gagatatttt agaaagacaa 720
aacaatcaag ctattactat ttttcccgaa gtcaatatca tgagtttgga actatcaatt 780
attcaaagaa aattacacca agattttccc tttgttataa acttctataa tttattatac 840
ccaagattta aaaactttac cactttgatg gctgcttttt catcaattaa aaacatcaaa 900
agaaagaaaa accgtaacaa tataatcaaa gaggcccgat acctgtttca cagagaactt 960
gacaaattag ttcacaagag catgaaaatg gagtcttcca aggtatccga taagacgacg
1020
ccgcccatga tcgtagataa ttcatactta cttacaaaaa aggaagaaat cagcagcggc
1080
aagcccaagg tggtacgaat caatccatac atatatgatg tcaccataat ttattaccga
1140
gtcaaatata ctgatagtgg gcatgatcat accaacggag atttgagact tcataaaggt
1200
tatcaattag agcaaatatc tccgacaatc tttgagatga ttcaaccaga aatggagtct
1260
gaaaacaaca taaaggataa ggaccccatt gttgtgatgg taaatgtaaa aaagcatcaa
2320
attcaaccat tactcgcata caatga~gag agtttagaaa agtggcttga aaataggtgg
138a
atagaaaaag atagattaat cgagtccttg caaaaaaata ttaaaattga gaccaaataa
1440
<210> 228
<211> 903
<212> DNA
<213> Saccharomyces sp.
<400> 228
atggaaaagt acaccaattg gagagacaat ggtacgggaa tagctccatt tctaccaaac 60
acaatcagga aacctagtaa ggtgatgaca gcgtgtttgt tgggtatcct aggggtgaaa 120
accattataa tgctaccatt gattatgctg taccttctaa ctggccagaa caacttactg 180
ggtttgatat tgaagtttac attcagttgg aaagaggaaa ttaccgtgca aggaatcaag 240
aaacgtgacg taaggaaatc caagcattat ccacagaagg gcaagcttta tatttgcaat 300
tgtacctcac ctttagatgc tttttcagtg gtgttattag ctcaagggcc tgttacgttg 360
ttggtcccat ccaatgacat tgtatacaaa gtttccataa gagaattcat caacttcatc 420
ctcgccggtg ggttagatat aaaactctat ggccacgagg tagcagagct atctcaattg 480
ggcaataccg tgaattttat gtttgctgag ggtacctcat gtaatggtaa aagcgtctta 540
ccgtttagta taaccgggaa aaaacttaaa gaattcatag acccttcaat aaccacaatg 600
aaccccgcaa tggccaaaac taaaaaattt gaattgcaga ccatccaaat caaaactaat 660
aaaactgcca tcaccacatt gcccatctcc aatatggagt atttatctag atttctgaac 720
aagggcatta atgttaaatg caagatcaac gagccacaag tactctcgga taatttagag 780
gaattacgcg ttgcattaaa cggtggcgac aaatataaac tagtctcacg gaagttagat 840
gttgaatcta agaggaattt tgtgaaggaa tatatcagcg atcaacgtaa aaagaggaag 900
tag 903
<210> 229
<211> 2280
<212> DNA
<213> Saccharomyces sp.
<400> 229
atgcctgcac caaaactcac ggagaaattt gcctcttcca agagcacaca gaaaactacg 60
aattacagtt ccatcgaggc caaaagcgtc aagacgtcgg ctgatcaggc atacatctac 120
CA 02343969 2001-03-20
WO 00118889 (g PCTIUS99/22231
caagagcctagcgctaccaagaagatactttactccatcgccacatggctgttgtacaac180
atcttccactgcttctttagagaaatcagaggccggggcagtttcaaggtaccgcaacag240
ggaccggtgatctttgttgcggctccgcatgctaaccagttcgtcgaccctgtaatcctt300
atgggcgaggtgaagaaatctgtcaacagacgtgtgtccttcttgattgcggagagctca360
ttaaagcaaccccccatagggtttttggctagtttcttcatggccataggcgtggtaagg420
ccgcaggataatttgaaaccggcagaaggtactatccgcgtagatccaacagactacaag480
agagttatcggccacgacacgcatttcttgactgattgtatgccaaagggtctcatcggg540
ttacccaaatcaatgggatttggagaaatccagtccatagaaagtgacacgagtttgacc600
ctaagaaaagagttcaaaatggccaaaccagagattaaaactgctttactcaccggcact660
acttataaatatgccgctaaagtcgaccaatcttgcgtttaccatagagtttttgagcat720
ttggcccataacaactgcattgggatctttcctgaaggtgggtcccacgacagaacaaac780
ttgttgcccctgaaagcaggtgtggcgattatggctcttggttgcatggataagcatcct840
gacgtcaatgttaagattgttccctgcggtatgaattatttccatccacataagttcagg900
tcgagagcggttgttgaattcggtgaccccattgaaataccgaaggaactagtcgccaag960
taccacaacccggaaacgaacagagatgcagtgaaagaattattagataccatatcgaag
1020
ggtttacaatccgttaccgttacatgttctgattatgaaactttgatggtggttcaaacg
1080
ataagaagactatatatgacacaatttagcaccaagttaccgttgcccttgattgtggaa
1140
atgaacagaagaatggtcaaaggttacgaattctatagaaacgatcctaaaatagcggac
1200
ttgaccaaagatataatggcatataatgccgccttgagacactataatcttcctgatcac
1260
cttgtggaggaggcaaaggtaaatttcgcaaaaaacctcggacttgttttttttagatcc
1320
atcgggctctgcatcctcttttcgttagccatgccaggtatcattatgttctcacctgtc
1380
ttcatattagccaagagaatttctcaagaaaaggcccgtaccgctttgtccaagtctaca
1440
gttaaaataaaggctaacgatgtcattgccacgtggaaaatcttgattgggatgggattt
1500
gcgcccttgctttacatcttttggtccgttttaatcacttattacctcagacataaacca
1560
tggaataaaatatatgttttttccgggtcttacatctcgtgtgttatagtcacgtattcc
1620
gccttaatcgtgggtgatattggtatggatggtttcaaatctttgagaccactggtttta
1680
tctcttacatctccaaagggcttgcaaaagctacaaaaggatcgtagaaatctggcagaa
1740
agaataatcgaagttgtaaataactttggaagcgaattattccccgatttcgatagtgcc
1800
gccctacgtgaagaattcgacgtcatcgatgaagaggaagaagatcgaaaaacctcagaa
1860
ttgaatcgcaggaaaatgctaagaaaacagaaaataaaaagacaagaaaaagattcgtca
1920
tcacctatcatcagccaacgtgacaaccacgatgcctatgaacaccataaccaagattcc
1980
gatggcgtctcattggtcaatagtgacaattccctctctaacattccattattctcttct
2040
acttttcatcgtaagtcagagtcttccttagcttcgacatccgttgcaccttcttcttcc
2100
tccgaatttgaggtagaaaacgaaatcttggaggaaaaaaatggattagcaagtaaaatc
2160
gcacaggccgtcttaaacaagagaattggtgaaaatactgccagggaagaggaagaggaa
2220
gaagaagaggaagaagaagaagaggaagaagaagaagaagggaaagaaggagatgcgtag
2280
<210> 230
<211> 2232
<212> DNA
<213> Saccharomyces sp.
<400> 230
atgtctgctc ccgctgccga tcataacgct gccaaaccta ttcctcatgt acctcaagcg 60
tcccgacggt acaaaaattc atacaatgga ttcgtataca atatacatac atggctgtat 120
gatgtgtctg tatttctgtt taatattttg ttcactattt tcttcagaga aattaaggta 180
cgtggtgcat ataacgttcc cgaagttggg gtgccaacca tccttgtgtg tgcccctcat 240
gcaaatcagt tcatcgaccc ggctttggta atgtcgcaaa cccgtttgct gaagacatca 300
CA 02343969 2001-03-20
WO 00/18$89 g9 . PCT/US99122231
gcgggaaagtcccgatccagaatgccttgttttgttactgctgagtcgagttttaagaaa360
agatttatctctttctttggtcacgcaatgggcggtattcccgtgcctagaattcaggac420
aacttgaagccagtggatgagaatcttgagatttacgctccggacttgaagaaccacccg480
gaaatcatcaagggccgctccaagaacccacagactacaccagtgaactttacgaaaagg540
ttttctgccaagtccttgcttggattgcccgactacttaagtaatgctcaaatcaaggaa600
atcccggatgatgaaacgataatcttgtcctctccattcagaacatcgaaatcaaaagtg660
gtggagctcttgactaatggtactaattttaaatatgcagagaaaatcgacaatacggaa720
actttccagagtgtttttgatcacttgcatacgaagggctgtgtaggtattttccccgag780
ggtggttctcatgaccgtccttcgttactacccatcaaggcaggtgttgccattatggct.840
ctgggcgcagtagccgctgatcctaccatgaaagttgctgttgtaccctgtggtttgcat900
tatttccacagaaataaattcagatctagagctgttttagaatacggcgaacctatagtg960
gtggatgggaaatatggcgaaatgtataaggactccccacgtgagaccgtttccaaacta
1020
ctaaaaaagatcaccaattctttgttttctgttaccgaaaatgctccagattacgatact
1080
ttgatggtcattcaggctgccagaagactatatcaaccggtaaaagtcaggctacctttg
1140
cctgccattgtagaaatcaacagaaggttacttttcggttattccaagtttaaagatgat
1200
ccaagaattattcacttaaaaaaactggtatatgactacaacaggaaattagattcagtg
1260
ggtttaaaagaccatcaggtgatgcaattaaaaactaccaaattagaagcattgaggtgc
1320
tttgtaactttgatcgttcgattgattaaattttctgtctttgctatactatcgttaccg
1380
ggttctattctcttcactccaattttcattatttgtcgcgtatactcagaaaagaaggcc
1440
aaagagggtttaaagaaatcattggttaaaattaagggtaccgatttgttggccacatgg
1500
aaacttatcgtggcgttaatattggcaccaattttatacgttacttactcgatcttgttg
1560
attattttggcaagaaaacaacactattgtcgcatctgggttccttccaataacgcattc
1620
atacaatttgtctatttttatgcgttattggttttcaccacgtattcctctttaaagacc
1680
ggtgaaatcggtgttgaccttttcaaatctttaagaccactttttgtttctattgtttac
1740
cccggtaagaagatcgaagaaatccaaacaacaagaaagaatttaagtctagagttgact
1800
gctgtttgtaacgatttaggacctttggttttccctgattacgataaattagcgactgag
1860
atattctctaagagagacggttatgatgtctcttctgatgcagagtcttctataagtcgt
1920
atgagtgtacaatctagaagccgctcttcttctatacattctattggctcgctagcttct
1980
aacgccctatcaagagtgaattcaagaggctcgttgaccgatattccaattttttctgat
2040
gcaaagcaaggtcaatggaaaagtgaaggtgaaactagtgaggatgaggatgaatttgat
2100
gagaaaaatcctgccatagtacaaaccgcacgaagttctgatctaaataaggaaaacagt
2160
cgcaacacaaatatatcttcgaagattgcttcgctggtaagacagaaaagagaacacgaa
2220
aagaaagaatga
2232
<210> 231
<211> 1194
<212> DNA
<213> Saccharomyces sp.
<400> 231
atgctgcatc aaaaaatagc tcataaagtt cgaaaagtcg tcgtcccagg tatttcctta 60
ttgattttct tccagggatg ccttattctt ttgtttctcc aactcaccta taagactctt 120
tactgtagaa atgatataag gaaacaaatt ggtctcaata aaaccaaaag attatttatt 180
gtcttggtat catccatttt gcatgttgtc gcaccatctg cagtgagaat taccactgaa 240
aattccagtg ttcctaaagg tacttttttt ttagacttga agaagaaaag gattctttct 300
catctaaagt ccaattcggt ggccatttgc aatcaccaaa tatacacgga ttggatattt 360
ttatggtggt tggcttacac atcgaactta ggggctaatg tcttcattat tttaaaaaaa 420
tcgttggctt ccattcctat cctcggtttc ggtatgagaa actataattt catttttatg 480
CA 02343969 2001-03-20
WO 00/18889 ~p PCTIUS99I22231
agtagaaagt gggcacaaga caaaataacc ctaagcaaca gccttgctgg ccttgattcg 540
aatgcaaggg gcgccggctc acttgctgga aagtcacctg agcgcataac tgaggaagga 600
gagagcatat ggaatccgga ggttattgat ccaaaacaaa tccattggcc atacaatctt 660
atcctattcc ctgaaggtac aaatctcagt gctgatacta ggcaaaaaag tgctaaatat 720
gctgccaaaa taggcaaaaa gccattcaag aatgtgctac tgcctcattc tacaggccta 780
agatactcgt tacaaaagtt gaagccaagt attgaaagtc tttatgatat tacgatcggc 840
tactccggtg taaaacagga ggaatatggt gagcttatat atgggctgaa gagcatattt 900
ttagaaggaa aatacccgaa gttagtcgat attcacatca gagcatttga tgttaaagat 960
attccattag aggacgagaa tgaattttca gaatggctgt ataaaatttg gagtgagaag
1020
gatgctctaa tggaaaggta ctattccact ggatcattcg taagtgatcc tgaaacaaac
1080
cattcagtta ccgatagttt caagatcaat cgtattgagt taactgaagt gctaatatta
1140
ccaactctaa caataatttg gttagtttat aaactttatt gttttatttt ttga
1194
<210> 232
<211> 912
<212> DNA
<213> Saccharomyces sp.
<400> 232
atgagtgtga taggtaggtt cttgtattac ttgaggtccg tgttggtcgt actggcgctt 60
gcaggctgtg gcttttacgg tgtaatcgcc tctatccttt gcacgttaat cggtaagcaa 220
catttggctc agtggattac tgcgcgttgt ttttaccatg tcatgaaatt gatgcttggc 180
cttgacgtca aggtcgttgg~ cgaggagaat ttggccaaga agccatatat tatgattgcc 240
aatcaccaat ccaccttgga tatcttcatg ttaggtagga ttttcccccc tggttgcaca 300
gttactgcca agaagtcttt gaaatacgtc ccctttctgg gttggttcat ggctttgagt 360
ggtacatatt tcttagacag atctaaaagg caagaagcca ttgacacctt gaataaaggt 420
ttagaaaatg ttaagaaaaa caagcgtgct ctatgggttt ttcctgaggg taccaggtct 480
tacacgagtg agctgacaat gttgcctttc aagaagggtg ctttccattt ggcacaacag 540
ggtaagatcc ccattgttcc agtggttgtt tccaatacca gtactttagt aagtcctaaa 600
tatggggtct tcaacagagg ctgtatgatt gttagaattt taaaacctat ttcaaccgag 660
aacttaacaa aggacaaaat tggtgaattt gctgaaaaag ttagagatca aatggttgac 720
actttgaagg agattggcta ctctcccgcc atcaacgata caaccctccc accacaagct 780
attgagtatg ccgctcttca acatgacaag aaagtgaaca agaaaatcaa gaatgagcct 840
gtgccttctg tcagcattag caacgatgtc aatacccata acgaaggttc atctgtaaaa 900
aagatgcatt as 912
<210> 233
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 233
cgcgatttaa atggcgcgcc ctgcaggcgg ccgcctgcag ggcgcgccat ttaa 54
<210> 234
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 234
tcgaggatcc gcggccgcaa gcttcctgca gg 32
<210> 235
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
CA 02343969 2001-03-20
WO 00/18889 71 PCT/US99/22231
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 235
tcgacctgca ggaagcttgc ggccgcggat cc 32
<210> 236
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 236
tcgacctgca ggaagcttgc ggccgcggat cc 32
<210> 237
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 237
tcgaggatcc gcggccgcaa gcttcctgca gg 32
<210> 238
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 238
tcgaggatcc gcggccgcaa gcttcctgca ggagct 36
<210> 239
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 239
cctgcaggaa gcttgcggcc gcggatcc 28
<210> 240
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 240
tcgacctgca ggaagcttgc ggccgcggat ccagct 36
<210> 241
<211> 28
<212> DNA
<213> Artificial Sequence
CA 02343969 2001-03-20
WO 00/18889 72 PCT/US99/22231
<220>
<223> Description of Artificial Sequence: Synthetic
Oligonucleotide
<400> 241
ggatccgcgg ccgcaagctt cctgcagg 2$
